Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

PubMed

Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

2006-12-01

Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

Comparison of ribosomal RNA removal methods for transcriptome sequencing workflows in teleost fish

USDA-ARS?s Scientific Manuscript database

RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. rRNAs are commonly removed from total RNA via either mRNA selection or rRNA depletion. These methods have...

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information

PubMed Central

Chen, Tsute; Yu, Wen-Han; Izard, Jacques; Baranova, Oxana V.; Lakshmanan, Abirami; Dewhirst, Floyd E.

2010-01-01

The human oral microbiome is the most studied human microflora, but 53% of the species have not yet been validly named and 35% remain uncultivated. The uncultivated taxa are known primarily from 16S rRNA sequence information. Sequence information tied solely to obscure isolate or clone numbers, and usually lacking accurate phylogenetic placement, is a major impediment to working with human oral microbiome data. The goal of creating the Human Oral Microbiome Database (HOMD) is to provide the scientific community with a body site-specific comprehensive database for the more than 600 prokaryote species that are present in the human oral cavity based on a curated 16S rRNA gene-based provisional naming scheme. Currently, two primary types of information are provided in HOMD—taxonomic and genomic. Named oral species and taxa identified from 16S rRNA gene sequence analysis of oral isolates and cloning studies were placed into defined 16S rRNA phylotypes and each given unique Human Oral Taxon (HOT) number. The HOT interlinks phenotypic, phylogenetic, genomic, clinical and bibliographic information for each taxon. A BLAST search tool is provided to match user 16S rRNA gene sequences to a curated, full length, 16S rRNA gene reference data set. For genomic analysis, HOMD provides comprehensive set of analysis tools and maintains frequently updated annotations for all the human oral microbial genomes that have been sequenced and publicly released. Oral bacterial genome sequences, determined as part of the Human Microbiome Project, are being added to the HOMD as they become available. We provide HOMD as a conceptual model for the presentation of microbiome data for other human body sites. Database URL: http://www.homd.org PMID:20624719

Bacterial community comparisons by taxonomy-supervised analysis independent of sequence alignment and clustering

PubMed Central

Sul, Woo Jun; Cole, James R.; Jesus, Ederson da C.; Wang, Qiong; Farris, Ryan J.; Fish, Jordan A.; Tiedje, James M.

2011-01-01

High-throughput sequencing of 16S rRNA genes has increased our understanding of microbial community structure, but now even higher-throughput methods to the Illumina scale allow the creation of much larger datasets with more samples and orders-of-magnitude more sequences that swamp current analytic methods. We developed a method capable of handling these larger datasets on the basis of assignment of sequences into an existing taxonomy using a supervised learning approach (taxonomy-supervised analysis). We compared this method with a commonly used clustering approach based on sequence similarity (taxonomy-unsupervised analysis). We sampled 211 different bacterial communities from various habitats and obtained ∼1.3 million 16S rRNA sequences spanning the V4 hypervariable region by pyrosequencing. Both methodologies gave similar ecological conclusions in that β-diversity measures calculated by using these two types of matrices were significantly correlated to each other, as were the ordination configurations and hierarchical clustering dendrograms. In addition, our taxonomy-supervised analyses were also highly correlated with phylogenetic methods, such as UniFrac. The taxonomy-supervised analysis has the advantages that it is not limited by the exhaustive computation required for the alignment and clustering necessary for the taxonomy-unsupervised analysis, is more tolerant of sequencing errors, and allows comparisons when sequences are from different regions of the 16S rRNA gene. With the tremendous expansion in 16S rRNA data acquisition underway, the taxonomy-supervised approach offers the potential to provide more rapid and extensive community comparisons across habitats and samples. PMID:21873204

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.

PubMed

Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier

2014-01-01

Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.

Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

ScienceCinema

Tremblay, Julien

2018-01-22

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien

2012-06-01

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

PubMed Central

Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

2010-01-01

Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

[Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

PubMed

Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

2013-07-04

Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

Diversity and community composition of methanogenic archaea in the rumen of Scottish upland sheep assessed by different methods.

PubMed

Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John

2014-01-01

Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

PubMed

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-12-31

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

PubMed Central

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

PubMed

Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

2016-07-01

Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...

Bacterial flora analysis of coliforms in sewage, river water, and ground water using MALDI-TOF mass spectrometry.

PubMed

Suzuki, Yoshihiro; Niina, Kouki; Matsuwaki, Tomonori; Nukazawa, Kei; Iguchi, Atsushi

2018-01-28

The aim of this study was to rapidly and effectively analyze coliforms, which are the most fundamental indicators of water quality for fecal pollution, using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). Coliform bacteria were isolated from municipal sewage, river water, and groundwater. For each sample, 100 isolates were determined by MALDI-TOF MS. In addition, these same 100 isolates were also identified via 16S rRNA gene sequence analysis. Obtained MALDI-TOF MS data were compared with the 16S rRNA sequencing analysis, and the validity of MALDI-TOF MS for classification of coliform bacteria was examined. The concordance rate of bacterial identification for the 100 isolates obtained by MALDI-TOF MS analysis and 16S rRNA gene sequence analysis for sewage, river water, and ground water were 96%, 74%, and 62% at the genus level, respectively. Among the sewage, river water, and ground water samples, the coliform bacterial flora were distinct. The dominant genus of coliforms in sewage, river water, and groundwater were Klebsiella spp., Enterobacter spp., and Serratia spp., respectively. We determined that MALDI-TOF MS is a rapid and accurate tool that can be used to identify coliforms. Therefore, without using conventional 16S rRNA sequencing, it is possible to rapidly and effectively classify coliforms in water using MALDI-TOF MS.

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekov, Andrei D.

2007-10-30

The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

PubMed Central

2011-01-01

Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

PubMed Central

Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.

2014-01-01

In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

PubMed

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

PubMed

Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

2013-08-01

Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

Phylogeny of the Defined Murine Microbiota: Altered Schaedler Flora

PubMed Central

Dewhirst, Floyd E.; Chien, Chih-Ching; Paster, Bruce J.; Ericson, Rebecca L.; Orcutt, Roger P.; Schauer, David B.; Fox, James G.

1999-01-01

The “altered Schaedler flora” (ASF) was developed for colonizing germfree rodents with a standardized microbiota. The purpose of this study was to identify each of the eight ASF strains by 16S rRNA sequence analysis. Three strains were previously identified as Lactobacillus acidophilus (strain ASF 360), Lactobacillus salivarius (strain ASF 361), and Bacteroides distasonis (strain ASF 519) based on phenotypic criteria. 16S rRNA analysis indicated that each of the strains differed from its presumptive identity. The 16S rRNA sequence of strain ASF 361 is essentially identical to the 16S rRNA sequences of the type strains of Lactobacillus murinis and Lactobacillus animalis (both isolated from mice), and all of these strains probably belong to a single species. Strain ASF 360 is a novel lactobacillus that clusters with L. acidophilus and Lactobacillus lactis. Strain ASF 519 falls into an unnamed genus containing [Bacteroides] distasonis, [Bacteroides] merdae, [Bacteroides] forsythus, and CDC group DF-3. This unnamed genus is in the Cytophaga-Flavobacterium-Bacteroides phylum and is most closely related to the genus Porphyromonas. The spiral-shaped strain, strain ASF 457, is in the Flexistipes phylum and exhibits sequence identity with rodent isolates of Robertson. The remaining four ASF strains, which are extremely oxygen-sensitive fusiform bacteria, group phylogenetically with the low-G+C-content gram-positive bacteria (Firmicutes, Bacillus-Clostridium group). ASF 356, ASF 492, and ASF 502 fall into Clostridium cluster XIV of Collins et al. Morphologically, ASF 492 resembles members of this cluster, Roseburia cecicola, and Eubacterium plexicaudatum. The 16S rRNA sequence of ASF 492 is identical to that of E. plexicaudatum. Since the type strain and other viable original isolates of E. plexicaudatum have been lost, strain ASF 492 is a candidate for a neotype strain. Strain ASF 500 branches deeply in the low-G+C-content gram-positive phylogenetic tree but is not closely related to any organisms whose 16S rRNA sequences are currently in the GenBank database. The 16S rRNA sequence information determined in the present study should allow rapid identification of ASF strains and should permit detailed analysis of the interactions of ASF organisms during development of intestinal disease in mice that are coinfected with a variety of pathogenic microorganisms. PMID:10427008

A new version of the RDP (Ribosomal Database Project)

NASA Technical Reports Server (NTRS)

Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;

Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

PubMed Central

Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.

2016-01-01

Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

PubMed

Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

1990-01-01

16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.

PubMed

Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A

2016-05-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Skin microbiome surveys are strongly influenced by experimental design

PubMed Central

Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.

2016-01-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039

Pneumocystis jirovecii multilocus genotyping profiles in patients from Portugal and Spain.

PubMed

Esteves, F; Montes-Cano, M A; de la Horra, C; Costa, M C; Calderón, E J; Antunes, F; Matos, O

2008-04-01

Pneumonia caused by the opportunistic organism Pneumocystis jirovecii is a clinically important infection affecting AIDS and other immunocompromised patients. The present study aimed to compare and characterise the frequency pattern of DNA sequences from the P. jirovecii mitochondrial large-subunit rRNA (mtLSU rRNA) gene, the dihydropteroate synthase (DHPS) gene and the internal transcribed spacer (ITS) regions of the nuclear rRNA operon in specimens from Lisbon (Portugal) and Seville (Spain). Total DNA was extracted and used for specific molecular sequence analysis of the three loci. In both populations, mtLSU rRNA gene analysis revealed an overall prevalence of genotype 1. In the Portuguese population, genotype 2 was the second most common, followed by genotype 3. Inversely, in the Spanish population, genotype 3 was the second most common, followed by genotype 2. The DHPS wild-type sequence was the genotype observed most frequently in both populations, and the DHPS genotype frequency pattern was identical to distribution patterns revealed in other European studies. ITS types showed a significant diversity in both populations because of the high sequence variability in these genomic regions. The most prevalent ITS type in the Portuguese population was Eg, followed by Cg. In contrast to other European studies, Bi was the most common ITS type in the Spanish samples, followed by Eg. A statistically significant association between mtLSU rRNA genotype 1 and ITS type Eg was revealed.

Enterobacter xiangfangensis sp. nov., isolated from Chinese traditional sourdough, and reclassification of Enterobacter sacchari Zhu et al. 2013 as Kosakonia sacchari comb. nov.

PubMed

Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng

2014-08-01

A Gram-stain-negative bacterial strain, 10-17(T), was isolated from traditional sourdough in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, RNA polymerase β subunit (rpoB) gene sequence analysis, DNA gyrase (gyrB) gene sequence analysis, initiation translation factor 2 (infB) gene sequence analysis, ATP synthase β subunit (atpD) gene sequence analysis, fatty acid methyl ester analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain 10-17(T) was phylogenetically related to Enterobacter hormaechei CIP 103441(T), Enterobacter cancerogenus LMG 2693(T), Enterobacter asburiae JCM 6051(T), Enterobacter mori LMG 25706(T), Enterobacter ludwigii EN-119(T) and Leclercia adecarboxylata LMG 2803(T), having 99.5%, 99.3%, 98.7%, 98.5%, 98.4% and 98.4% 16S rRNA gene sequence similarity, respectively. On the basis of polyphasic characterization data obtained in the present study, a novel species, Enterobacter xiangfangensis sp. nov., is proposed and the type strain is 10-17(T) ( = LMG 27195(T) = NCIMB 14836(T) = CCUG 62994(T)). Enterobacter sacchari Zhu et al. 2013 was reclassified as Kosakonia sacchari comb. nov. on the basis of 16S rRNA, rpoB, gyrB, infB and atpD gene sequence analysis and the type strain is strain SP1(T)( = CGMCC 1.12102(T) = LMG 26783(T)). © 2014 IUMS.

Cloning and restriction enzyme mapping of ribosomal DNA of Giardia duodenalis, Giardia ardeae and Giardia muris.

PubMed

van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L

1991-06-01

In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.

Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

PubMed

Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

2016-02-25

Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. Copyright © 2016 Mehetre et al.

Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments

EPA Science Inventory

The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

Identification by 16S rRNA gene sequencing of an Actinomyces hongkongensis isolate recovered from a patient with pelvic actinomycosis.

PubMed

Flynn, A N; Lyndon, C A; Church, D L

2013-08-01

A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.

The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).

PubMed

Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai

2016-01-01

In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.

In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

PubMed Central

Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

2007-01-01

This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

PubMed

Jiang, Xuexia; Jiao, Nianzhi

2016-09-01

Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

PubMed Central

Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.

2009-01-01

The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

PubMed Central

O’Farrell, Katrina A.; Janssen, Peter H.

1999-01-01

Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

Microbial community profiling of fresh basil and pitfalls in taxonomic assignment of enterobacterial pathogenic species based upon 16S rRNA amplicon sequencing.

PubMed

Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke

2017-09-18

Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B.V. All rights reserved.

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

PubMed

Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr.

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

PubMed Central

Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr. PMID:26954507

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

A meta-analysis of bacterial diversity in the feces of cattle

USDA-ARS?s Scientific Manuscript database

In this study, we conducted a meta-analysis on 16S rRNA gene sequences of bovine fecal origin that are publicly available in the RDP database. A total of 13663 sequences including 603 isolate sequences were identified in the RDP database (Release 11, Update 1), where 13447 sequences were assigned t...

Evaluation of the Bacterial Diversity in the Human Tongue Coating Based on Genus-Specific Primers for 16S rRNA Sequencing.

PubMed

Sun, Beili; Zhou, Dongrui; Tu, Jing; Lu, Zuhong

2017-01-01

The characteristics of tongue coating are very important symbols for disease diagnosis in traditional Chinese medicine (TCM) theory. As a habitat of oral microbiota, bacteria on the tongue dorsum have been proved to be the cause of many oral diseases. The high-throughput next-generation sequencing (NGS) platforms have been widely applied in the analysis of bacterial 16S rRNA gene. We developed a methodology based on genus-specific multiprimer amplification and ligation-based sequencing for microbiota analysis. In order to validate the efficiency of the approach, we thoroughly analyzed six tongue coating samples from lung cancer patients with different TCM types, and more than 600 genera of bacteria were detected by this platform. The results showed that ligation-based parallel sequencing combined with enzyme digestion and multiamplification could expand the effective length of sequencing reads and could be applied in the microbiota analysis.

Identification by 16S rRNA Gene Sequencing of an Actinomyces hongkongensis Isolate Recovered from a Patient with Pelvic Actinomycosis

PubMed Central

Flynn, A. N.; Lyndon, C. A.

2013-01-01

A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532

Comparison between rpoB and 16S rRNA Gene Sequencing for Molecular Identification of 168 Clinical Isolates of Corynebacterium

PubMed Central

Khamis, Atieh; Raoult, Didier; La Scola, Bernard

2005-01-01

Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

Molecular phylogeny of grey mullets (Teleostei: Mugilidae) in Greece: evidence from sequence analysis of mtDNA segments.

PubMed

Papasotiropoulos, Vasilis; Klossa-Kilia, Elena; Alahiotis, Stamatis N; Kilias, George

2007-08-01

Mitochondrial DNA sequence analysis has been used to explore genetic differentiation and phylogenetic relationships among five species of the Mugilidae family, Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens. DNA was isolated from samples originating from the Messolongi Lagoon in Greece. Three mtDNA segments (12s rRNA, 16s rRNA, and CO I) were PCR amplified and sequenced. Sequencing analysis revealed that the greatest genetic differentiation was observed between M. cephalus and all the other species studied, while C. labrosus and L. aurata were the closest taxa. Dendrograms obtained by the neighbor-joining method and Bayesian inference analysis exhibited the same topology. According to this topology, M. cephalus is the most distinct species and the remaining taxa are clustered together, with C. labrosus and L. aurata forming a single group. The latter result brings into question the monophyletic origin of the genus Liza.

Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

PubMed

Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

2015-04-01

Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite scaffolds occurring more likely in taxonomically distant producers but suggest that the antibiotic selection of gene pools is also influenced by site conditions.

16S rRNA Gene Sequencing, Multilocus Sequence Analysis, and Mass Spectrometry Identification of the Proposed New Species “Clostridium neonatale”

PubMed Central

Bouvet, Philippe; Ferraris, Laurent; Dauphin, Brunhilde; Popoff, Michel-Robert; Butel, Marie Jose

2014-01-01

In 2002, an outbreak of necrotizing enterocolitis in a Canadian neonatal intensive care unit was associated with a proposed novel species of Clostridium, “Clostridium neonatale.” To date, there are no data about the isolation, identification, or clinical significance of this species. Additionally, C. neonatale has not been formally classified as a new species, rendering its identification challenging. Indeed, the C. neonatale 16S rRNA gene sequence shows high similarity to another Clostridium species involved in neonatal necrotizing enterocolitis, Clostridium butyricum. By performing a polyphasic study combining phylogenetic analysis (16S rRNA gene sequencing and multilocus sequence analysis) and phenotypic characterization with mass spectrometry, we demonstrated that C. neonatale is a new species within the Clostridium genus sensu stricto, for which we propose the name Clostridium neonatale sp. nov. Now that the status of C. neonatale has been clarified, matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) can be used for better differential identification of C. neonatale and C. butyricum clinical isolates. This is necessary to precisely define the role and clinical significance of C. neonatale, a species that may have been misidentified and underrepresented during previous neonatal necrotizing enterocolitis studies. PMID:25232167

16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

EPA Science Inventory

The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

EPA Science Inventory

We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development - Poster

EPA Science Inventory

We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

PubMed

Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

2016-09-23

The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

Microbial Characterization of Qatari Barchan Sand Dunes

PubMed Central

Chatziefthimiou, Aspassia D.; Nguyen, Hanh; Richer, Renee; Louge, Michel; Sultan, Ali A.; Schloss, Patrick; Hay, Anthony G.

2016-01-01

This study represents the first characterization of sand microbiota in migrating barchan sand dunes. Bacterial communities were studied through direct counts and cultivation, as well as 16S rRNA gene and metagenomic sequence analysis to gain an understanding of microbial abundance, diversity, and potential metabolic capabilities. Direct on-grain cell counts gave an average of 5.3 ± 0.4 x 105 cells g-1 of sand. Cultured isolates (N = 64) selected for 16S rRNA gene sequencing belonged to the phyla Actinobacteria (58%), Firmicutes (27%) and Proteobacteria (15%). Deep-sequencing of 16S rRNA gene amplicons from 18 dunes demonstrated a high relative abundance of Proteobacteria, particularly enteric bacteria, and a dune-specific-pattern of bacterial community composition that correlated with dune size. Shotgun metagenome sequences of two representative dunes were analyzed and found to have similar relative bacterial abundance, though the relative abundances of eukaryotic, viral and enterobacterial sequences were greater in sand from the dune closer to a camel-pen. Functional analysis revealed patterns similar to those observed in desert soils; however, the increased relative abundance of genes encoding sporulation and dormancy are consistent with the dune microbiome being well-adapted to the exceptionally hyper-arid Qatari desert. PMID:27655399

16S-23S rRNA gene internal transcribed spacer sequences for analysis of the phylogenetic relationships among species of the genus Porphyromonas.

PubMed

Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C

2005-03-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.

Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

PubMed

Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

2017-10-06

Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

Weissella ghanensis sp. nov., isolated from a Ghanaian cocoa fermentation.

PubMed

De Bruyne, Katrien; Camu, Nicholas; Lefebvre, Karen; De Vuyst, Luc; Vandamme, Peter

2008-12-01

During a study on lactic acid bacteria (and their species diversity) in spontaneous heap fermentations of Ghanaian cocoa beans, two strains, designated 215(T) and 194B, were isolated. A phylogenetic analysis based on 16S rRNA gene sequences demonstrated that these strains represented a distinct lineage close to the genus Weissella and showing only 92.1 % 16S rRNA gene sequence similarity with respect to their closest neighbour, Weissella soli LMG 20113(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and physiological and biochemical tests confirmed the unique taxonomic position of the two novel isolates. On the basis of the results of the morphological and biochemical tests and 16S rRNA gene sequence analysis, strains 215(T) and 194B represent the most peripheral lineage of the genus Weissella, for which we propose the name Weissella ghanensis sp. nov. The type strain is 215(T) (=LMG 24286(T)=DSM 19935(T)).

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria.

PubMed

Salzman, Nita H; de Jong, Hendrik; Paterson, Yvonne; Harmsen, Hermie J M; Welling, Gjalt W; Bos, Nicolaas A

2002-11-01

Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of these sequences, 25% (10/40) corresponded to described intestinal organisms of the mouse, including Lactobacillus spp., Helicobacter spp., segmented filamentous bacteria and members of the altered Schaedler flora (ASF360, ASF361, ASF502 and ASF519); 75% (30/40) represented novel sequences. A large number (11/40) of the novel sequences revealed a new operational taxonomic unit (OTU) belonging to the Cytophaga-Flavobacter-Bacteroides phylum, which the authors named 'mouse intestinal bacteria'. 16S rRNA probes were developed for this new OTU. Upon analysis of the novel sequences, eight were found to cluster within the Eubacterium rectale-Clostridium coccoides group and three clustered within the Bacteroides group. One of the novel sequences was distantly related to Verrucomicrobium spinosum and one was distantly related to Bacillus mycoides. Oligonucleotide probes specific for the 16S rRNA of these novel clones were generated. Using a combination of four previously described and four newly designed probes, approximately 80% of bacteria recovered from the murine large intestine and 71% of bacteria recovered from the murine caecum could be identified by fluorescence in situ hybridization (FISH).

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

PubMed

Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

PubMed Central

Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

PubMed

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

PubMed

Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

2012-04-01

Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

PubMed Central

Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

2012-01-01

Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

New Erwinia-Like Organism Causing Cervical Lymphadenitis▿

PubMed Central

Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo

2008-01-01

The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665

Lactobacillus heilongjiangensis sp. nov., isolated from Chinese pickle.

PubMed

Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng

2013-11-01

A Gram-stain-positive bacterial strain, S4-3(T), was isolated from traditional pickle in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, pheS gene sequence analysis, rpoA gene sequence analysis, dnaK gene sequence analysis, fatty acid methyl ester (FAME) analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain S4-3(T) showed 97.9-98.7 % 16S rRNA gene sequence similarities, 84.4-94.1 % pheS gene sequence similarities and 94.4-96.9 % rpoA gene sequence similarities to the type strains of Lactobacillus nantensis, Lactobacillus mindensis, Lactobacillus crustorum, Lactobacillus futsaii, Lactobacillus farciminis and Lactobacillus kimchiensis. dnaK gene sequence similarities between S4-3(T) and Lactobacillus nantensis LMG 23510(T), Lactobacillus mindensis LMG 21932(T), Lactobacillus crustorum LMG 23699(T), Lactobacillus futsaii JCM 17355(T) and Lactobacillus farciminis LMG 9200(T) were 95.4, 91.5, 90.4, 91.7 and 93.1 %, respectively. Based upon the data obtained in the present study, a novel species, Lactobacillus heilongjiangensis sp. nov., is proposed and the type strain is S4-3(T) ( = LMG 26166(T) = NCIMB 14701(T)).

Identification of a forensic case using microscopy and forensically informative nucleotide sequencing (FINS): a case study of small Indian civet (Viverricula indica).

PubMed

Sahajpal, Vivek; Goyal, S P

2010-06-01

The exhibits obtained in wildlife offence cases quite often present a challenging situation for the forensic expert. The selection of proper approach for analysis is vital for a successful analysis. A generalised forensic analysis approach should proceed from the use of non-destructive techniques (morphological and microscopic examination) to partially destructive and finally destructive techniques (DNA analysis). The findings of non-destructive techniques may sometime be inconclusive but they definitely help in steering further forensic analysis in a proper direction. We describe a recent case where a very small dried skin piece (<0.05 mg) with just one small trimmed guard hair (0.4 cm) on it was received for species identification. The single guard hair was examined microscopically to get an indication of the type of species. We also describe the extraction procedure with a lower amount of sample, using an automated extraction method (Qiagen Biorobot EZ1) and PCR amplification of three mitochondrial genes (16s rRNA, 12s rRNA and cytochrome b) for species identification. Microscopic examination of the single hair indicated a viverrid species but the initial DNA analysis with 16s rRNA (through NCBI BLAST) showed the highest homology (93%) with a hyaenid species (Hyaena hyaena). However, further DNA analysis based on 12s rRNA and cytochrome b gene proved that the species was indeed a viverrid i.e. Viverricula indica (small Indian civet). The highest homology shown with a Hyaenid species by the 16s rRNA sequence from the case sample was due to lack of a 16s rRNA sequence for Viverricula indica in the NCBI data base. The case highlights the importance of morphological and microscopic examinations in wildlife offence cases. With respect to DNA extraction technology we found that automatic extraction method of Biorobot EZ1 (Qiagen) is quite useful with less amount of sample (much below recommended amount). Copyright 2009 Forensic Science Society. Published by Elsevier Ireland Ltd. All rights reserved.

Evolution of blue-flowered species of genus Linum based on high-throughput sequencing of ribosomal RNA genes.

PubMed

Bolsheva, Nadezhda L; Melnikova, Nataliya V; Kirov, Ilya V; Speranskaya, Anna S; Krinitsina, Anastasia A; Dmitriev, Alexey A; Belenikin, Maxim S; Krasnov, George S; Lakunina, Valentina A; Snezhkina, Anastasiya V; Rozhmina, Tatiana A; Samatadze, Tatiana E; Yurkevich, Olga Yu; Zoshchuk, Svyatoslav A; Amosova, Аlexandra V; Kudryavtseva, Anna V; Muravenko, Olga V

2017-12-28

The species relationships within the genus Linum have already been studied several times by means of different molecular and phylogenetic approaches. Nevertheless, a number of ambiguities in phylogeny of Linum still remain unresolved. In particular, the species relationships within the sections Stellerolinum and Dasylinum need further clarification. Also, the question of independence of the species of the section Adenolinum still remains unanswered. Moreover, the relationships of L. narbonense and other species of the section Linum require further clarification. Additionally, the origin of tetraploid species of the section Linum (2n = 30) including the cultivated species L. usitatissimum has not been explored. The present study examines the phylogeny of blue-flowered species of Linum by comparisons of 5S rRNA gene sequences as well as ITS1 and ITS2 sequences of 35S rRNA genes. High-throughput sequencing has been used for analysis of multicopy rRNA gene families. In addition to the molecular phylogenetic analysis, the number and chromosomal localization of 5S and 35S rDNA sites has been determined by FISH. Our findings confirm that L. stelleroides forms a basal branch from the clade of blue-flowered flaxes which is independent of the branch formed by species of the sect. Dasylinum. The current molecular phylogenetic approaches, the cytogenetic analysis as well as different genomic DNA fingerprinting methods applied previously did not discriminate certain species within the sect. Adenolinum. The allotetraploid cultivated species L. usitatissimum and its wild ancestor L. angustifolium (2n = 30) could originate either as the result of hybridization of two diploid species (2n = 16) related to the modern L. gandiflorum and L. decumbens, or hybridization of a diploid species (2n = 16) and a diploid ancestor of modern L. narbonense (2n = 14). High-throughput sequencing of multicopy rRNA gene families allowed us to make several adjustments to the phylogeny of blue-flowered flax species and also reveal intra- and interspecific divergence of the rRNA gene sequences.

Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

NASA Technical Reports Server (NTRS)

Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

1991-01-01

Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

PubMed Central

Dalmay, Tamas

2018-01-01

RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

PubMed

Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

2005-10-01

Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

PubMed Central

Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro

2017-01-01

Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

PubMed Central

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

PubMed

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation.

PubMed

De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

2010-09-01

Two lactic acid bacteria, strains 257(T) and 252, were isolated from traditional heap fermentations of Ghanaian cocoa beans. 16S rRNA gene sequence analysis of these strains allocated them to the genus Weissella, showing 99.5 % 16S rRNA gene sequence similarity towards Weissella ghanensis LMG 24286(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and biochemical tests confirmed their unique taxonomic position. DNA-DNA hybridization experiments towards their nearest phylogenetic neighbour demonstrated that the two strains represent a novel species, for which we propose the name Weissella fabaria sp. nov., with strain 257(T) (=LMG 24289(T) =DSM 21416(T)) as the type strain. Additional sequence analysis using pheS gene sequences proved useful for identification of all Weissella-Leuconostoc-Oenococcus species and for the recognition of the novel species.

Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

NASA Technical Reports Server (NTRS)

Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

1992-01-01

Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

PubMed Central

Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

2002-01-01

Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992

Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

PubMed

Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

2011-01-01

To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

PubMed Central

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

PubMed

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

MetaDP: a comprehensive web server for disease prediction of 16S rRNA metagenomic datasets.

PubMed

Xu, Xilin; Wu, Aiping; Zhang, Xinlei; Su, Mingming; Jiang, Taijiao; Yuan, Zhe-Ming

2016-01-01

High-throughput sequencing-based metagenomics has garnered considerable interest in recent years. Numerous methods and tools have been developed for the analysis of metagenomic data. However, it is still a daunting task to install a large number of tools and complete a complicated analysis, especially for researchers with minimal bioinformatics backgrounds. To address this problem, we constructed an automated software named MetaDP for 16S rRNA sequencing data analysis, including data quality control, operational taxonomic unit clustering, diversity analysis, and disease risk prediction modeling. Furthermore, a support vector machine-based prediction model for intestinal bowel syndrome (IBS) was built by applying MetaDP to microbial 16S sequencing data from 108 children. The success of the IBS prediction model suggests that the platform may also be applied to other diseases related to gut microbes, such as obesity, metabolic syndrome, or intestinal cancer, among others (http://metadp.cn:7001/).

Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

Complete Deletion of the Fucose Operon in Haemophilus influenzae Is Associated with a Cluster in Multilocus Sequence Analysis-Based Phylogenetic Group II Related to Haemophilus haemolyticus: Implications for Identification and Typing

PubMed Central

de Gier, Camilla; Kirkham, Lea-Ann S.

2015-01-01

Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the “fuzzy species” strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. PMID:26378279

Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

PubMed

Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

2007-04-10

To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

First molecular detection and phylogenetic analysis of Anaplasma phagocytophilum in shelter dogs in Seoul, Korea.

PubMed

Lee, Sukyee; Lee, Seung-Hun; VanBik, Dorene; Kim, Neung-Hee; Kim, Kyoo-Tae; Goo, Youn-Kyoung; Rhee, Man Hee; Kwon, Oh-Deog; Kwak, Dongmi

2016-07-01

In this study, the status of Anaplasma phagocytophilum infection was assessed in shelter dogs in Seoul, Korea, with PCR and phylogenetic analyses. Nested PCR on 1058 collected blood samples revealed only one A. phagocytophilum positive sample (female, age <1year, mixed breed, collected from the north of the Han River). The genetic variability of A. phagocytophilum was evaluated by genotyping, using the 16S rRNA, groEL, and msp2 gene sequences of the positive sample. BLASTn analysis revealed that the 16S rRNA, groEL, and msp2 genes had 99.6%, 99.9%, and 100% identity with the following sequences deposited in GenBank: a cat 16S rRNA sequence from Korea (KR021166), a rat groEL sequence from Korea (KT220194), and a water deer msp2 sequence from Korea (HM752099), respectively. Phylogenetic analyses classified the groEL gene into two distinct groups (serine and alanine), whereas the msp2 gene showed a general classification into two groups (USA and Europe) that were further subgrouped according to region. To the best of our knowledge, this study is the first to describe the molecular diagnosis of A. phagocytophilum in dogs reared in Korea. In addition, the high genetic identity of the 16S rRNA and groEL sequences between humans and dogs from the same region suggests a possible epidemiological relation. Given the conditions of climate change, tick ecology, and recent incidence of human granulocytic anaplasmosis in Korea, the findings of this study underscore the need to establish appropriate control programs for tick-borne diseases in Korea. Copyright © 2016 Elsevier GmbH. All rights reserved.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

[Isolation and phylogenetic analysis of one actinomycete strain YIM 90022 exhibiting anticancer activity].

PubMed

Chen, Yi-Guang; Li, Wen-Jun; Cui, Xiao-Long; Jiang, Cheng-Lin; Xu, Li-Hua

2006-10-01

One facultative alkaliphilic actinomycete strain YIM 90022 was isolated from hypersaline alkaline soil in Qinghai province, China. An almost-complete 16S rRNA gene sequence (1500 bp) for strain YIM 90022 was obtained. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain YIM 90022 was closely related to four members of the genus Nocardiopsis with 16S rRNA gene sequence similarity values of 98.8% (N. exhalans DSM 44407T), 98.5% (N. prasina DSM 43845T), 98.4% (N. metallicus DSM 44598T) and 97.8% (N. listeri DSM 40297T), but represented a distinct phylogenetic lineage. Repetitive element sequence-based PCR (rep-PCR) genomic fingerprinting was evaluated on strain YIM 90022 and its closest relatives to investigate their genetic relatedness. The analysis of the rep-PCR genomic fingerprints showed that strain YIM 90022 was distinguishable from its closest relatives. The polyphasic taxonomic data presented in this study, including its morphology, physiological and biochemical characteristics, chemotaxonomy, 16S rRNA gene sequence-based phylogenetic analysis and rep-PCR genomic fingerprinting, supported the view that strain YIM 90022 represented a potential new species of the genus Nocardiopsis. The fermentation broth of strain YIM 90022 strongly inhibited growth of cell series of gastric cancer, lung cancer, mammary cancer, melanoma cancer, renal cancer and uterus cancer. Strain YIM 90022 grew well on most tested media, producing exuberant vegetative hyphae and aerial hyphae. The vegetative hyphae are long and fragmented. Light yellow to deep brown diffusible pigments were produced on ISP 2, ISP 3 and ISP 6. Growth of the strain occurred in the pH range 6.0-12.0, with optimal pH8.5. The NaCl tolerate range was 0-15% (W/V). Cell walls contain meso-diaminopimelic acid and have no diagnostic sugars. Polar lipids are phosphatidylcholine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylmethylethanolamine. Major menaquinones are MK-10 (H4, H6). The DNA G + C content is 71.5 mol %.

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genetic differences in internal transcribed spacer 1 between Dermanyssus gallinae from wild birds and domestic chickens.

PubMed

Brännström, S; Morrison, D A; Mattsson, J G; Chirico, J

2008-06-01

We investigated the presence of the poultry red mite or the chicken mite, Dermanyssus gallinae De Geer, Acari: Dermanyssidae, in wild bird populations in four different geographical regions of Sweden. The mites identified as D. gallinae were compared genetically with D. gallinae from egg-producing poultry farms in the same regions. The small subunit (SSU) gene, the 5.8S ribosomal RNA (rRNA) gene and the two internal transcribed spacers (ITS) of the rRNA genes were used in the genetic analysis. All D. gallinae mites had identical SSU rRNA, 5.8S rRNA and ITS2 sequences independent of their origin. By contrast, we identified significant differences in the ITS1 sequences. Based on the differences in the ITS1 sequences, the mites could be divided into two genotypes, of wild and domesticated origin, with no variation within the groups. These results imply that wild bird populations are of low importance, if any, as natural reservoirs of D. gallinae in these four geographical regions of Sweden.

Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos) Shown with 16S rRNA Gene-Based Microbial Community Analysis

PubMed Central

Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei

2013-01-01

Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms. PMID:24058905

Population abundance of potentially pathogenic organisms in intestinal microbiome of jungle crow (Corvus macrorhynchos) shown with 16S rRNA gene-based microbial community analysis.

PubMed

Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei

2013-01-01

Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

Molecular detection and phylogenetic analysis of Hepatozoon spp. in questing Ixodes ricinus ticks and rodents from Slovakia and Czech Republic.

PubMed

Hamšíková, Zuzana; Silaghi, Cornelia; Rudolf, Ivo; Venclíková, Kristýna; Mahríková, Lenka; Slovák, Mirko; Mendel, Jan; Blažejová, Hana; Berthová, Lenka; Kocianová, Elena; Hubálek, Zdeněk; Schnittger, Leonhard; Kazimírová, Mária

2016-10-01

By amplification and sequencing of 18S rRNA gene fragments, Hepatozoon spp. DNA was detected in 0.08 % (4/5057) and 0.04 % (1/2473) of questing Ixodes ricinus ticks from Slovakia and Czech Republic, respectively. Hepatozoon spp. DNA was also detected in spleen and/or lungs of 4.45 % (27/606) of rodents from Slovakia. Prevalence of infection was significantly higher in Myodes glareolus (11.45 %) than in Apodemus spp. (0.28 %) (P < 0.001). Sequencing of 18S rRNA Hepatozoon spp. gene amplicons from I. ricinus showed 100 % identity with Hepatozoon canis isolates from red foxes or dogs in Europe. Phylogenetic analysis showed that at least two H. canis 18S rRNA genotypes exist in Slovakia of which one was identified also in the Czech Republic. The finding of H. canis in questing I. ricinus suggests the geographical spread of the parasite and a potential role of other ticks as its vectors in areas where Rhipicephalus sanguineus is not endemic. Sequencing of 18S rRNA gene amplicons from M. glareolus revealed the presence of two closely related genetic variants, Hepatozoon sp. SK1 and Hepatozoon sp. SK2, showing 99-100 % identity with isolates from M. glareolus from other European countries. Phylogenetic analysis demonstrates that 18S rRNA variants SK1 and SK2 correspond to previously described genotypes UR1 and UR2 of H. erhardovae, respectively. The isolate from Apodemus flavicollis (Hepatozoon sp. SK3b) was 99 % identical with isolates from reptiles in Africa and Asia. Further studies are necessary to identify the taxonomic status of Hepatozoon spp. parasitizing rodents in Europe and the host-parasite interactions in natural foci.

The complete mitochondrial genome sequence of the Tibetan red fox (Vulpes vulpes montana).

PubMed

Zhang, Jin; Zhang, Honghai; Zhao, Chao; Chen, Lei; Sha, Weilai; Liu, Guangshuai

2015-01-01

In this study, the complete mitochondrial genome of the Tibetan red fox (Vulpes Vulpes montana) was sequenced for the first time using blood samples obtained from a wild female red fox captured from Lhasa in Tibet, China. Qinghai--Tibet Plateau is the highest plateau in the world with an average elevation above 3500 m. Sequence analysis showed it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region (CR). The variable tandem repeats in CR is the main reason of the length variability of mitochondrial genome among canide animals.

Fast, accurate and easy-to-pipeline methods for amplicon sequence processing

NASA Astrophysics Data System (ADS)

Antonielli, Livio; Sessitsch, Angela

2016-04-01

Next generation sequencing (NGS) technologies established since years as an essential resource in microbiology. While on the one hand metagenomic studies can benefit from the continuously increasing throughput of the Illumina (Solexa) technology, on the other hand the spreading of third generation sequencing technologies (PacBio, Oxford Nanopore) are getting whole genome sequencing beyond the assembly of fragmented draft genomes, making it now possible to finish bacterial genomes even without short read correction. Besides (meta)genomic analysis next-gen amplicon sequencing is still fundamental for microbial studies. Amplicon sequencing of the 16S rRNA gene and ITS (Internal Transcribed Spacer) remains a well-established widespread method for a multitude of different purposes concerning the identification and comparison of archaeal/bacterial (16S rRNA gene) and fungal (ITS) communities occurring in diverse environments. Numerous different pipelines have been developed in order to process NGS-derived amplicon sequences, among which Mothur, QIIME and USEARCH are the most well-known and cited ones. The entire process from initial raw sequence data through read error correction, paired-end read assembly, primer stripping, quality filtering, clustering, OTU taxonomic classification and BIOM table rarefaction as well as alternative "normalization" methods will be addressed. An effective and accurate strategy will be presented using the state-of-the-art bioinformatic tools and the example of a straightforward one-script pipeline for 16S rRNA gene or ITS MiSeq amplicon sequencing will be provided. Finally, instructions on how to automatically retrieve nucleotide sequences from NCBI and therefore apply the pipeline to targets other than 16S rRNA gene (Greengenes, SILVA) and ITS (UNITE) will be discussed.

Burkholderia cordobensis sp. nov., from agricultural soils.

PubMed

Draghi, Walter O; Peeters, Charlotte; Cnockaert, Margo; Snauwaert, Cindy; Wall, Luis G; Zorreguieta, Angeles; Vandamme, Peter

2014-06-01

Two Gram-negative, rod-shaped bacteria were isolated from agricultural soils in Córdoba province in central Argentina. Their 16S rRNA gene sequences demonstrated that they belong to the genus Burkholderia, with Burkholderia zhejiangensis as most closely related formally named species; this relationship was confirmed through comparative gyrB sequence analysis. Whole-cell fatty acid analysis supported their assignment to the genus Burkholderia. Burkholderia sp. strain YI23, for which a whole-genome sequence is available, represents the same taxon, as demonstrated by its highly similar 16S rRNA (100% similarity) and gyrB (99.1-99.7%) gene sequences. The results of DNA-DNA hybridization experiments and physiological and biochemical characterization further substantiated the genotypic and phenotypic distinctiveness of the Argentinian soil isolates, for which the name Burkholderia cordobensis sp. nov. is proposed, with strain MMP81(T) ( = LMG 27620(T) = CCUG 64368(T)) as the type strain. © 2014 IUMS.

Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

PubMed

Barb, Jennifer J; Oler, Andrew J; Kim, Hyung-Suk; Chalmers, Natalia; Wallen, Gwenyth R; Cashion, Ann; Munson, Peter J; Ames, Nancy J

2016-01-01

There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology. This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9) processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY). Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies) and their sequencing data is subjected to a novel analytical pipeline. Results are presented at family and genus level. The Kullback-Leibler divergence (DKL), a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst) average DKL while the V4 gave the lowest (best) average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria. The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points throughout a clinical protocol.

Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

PubMed

Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

2009-08-01

Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050

Phylogeny of Kinorhyncha Based on Morphology and Two Molecular Loci

PubMed Central

Sørensen, Martin V.; Dal Zotto, Matteo; Rho, Hyun Soo; Herranz, Maria; Sánchez, Nuria; Pardos, Fernando; Yamasaki, Hiroshi

2015-01-01

The phylogeny of Kinorhyncha was analyzed using morphology and the molecular loci 18S rRNA and 28S rRNA. The different datasets were analyzed separately and in combination, using maximum likelihood and Bayesian Inference. Bayesian inference of molecular sequence data in combination with morphology supported the division of Kinorhyncha into two major clades: Cyclorhagida comb. nov. and Allomalorhagida nom. nov. The latter clade represents a new kinorhynch class, and accommodates Dracoderes, Franciscideres, a yet undescribed genus which is closely related with Franciscideres, and the traditional homalorhagid genera. Homalorhagid monophyly was not supported by any analyses with molecular sequence data included. Analysis of the combined molecular and morphological data furthermore supported a cyclorhagid clade which included all traditional cyclorhagid taxa, except Dracoderes that no longer should be considered a cyclorhagid genus. Accordingly, Cyclorhagida is divided into three main lineages: Echinoderidae, Campyloderidae, and a large clade, ‘Kentrorhagata’, which except for species of Campyloderes, includes all species with a midterminal spine present in adult individuals. Maximum likelihood analysis of the combined datasets produced a rather unresolved tree that was not regarded in the following discussion. Results of the analyses with only molecular sequence data included were incongruent at different points. However, common for all analyses was the support of several major clades, i.e., Campyloderidae, Kentrorhagata, Echinoderidae, Dracoderidae, Pycnophyidae, and a clade with Paracentrophyes + New Genus and Franciscideres (in those analyses where the latter was included). All molecular analyses including 18S rRNA sequence data furthermore supported monophyly of Allomalorhagida. Cyclorhagid monophyly was only supported in analyses of combined 18S rRNA and 28S rRNA (both ML and BI), and only in a restricted dataset where taxa with incomplete information from 28S rRNA had been omitted. Analysis of the morphological data produced results that were similar with those from the combined molecular and morphological analysis. E.g., the morphological data also supported exclusion of Dracoderes from Cyclorhagida. The main differences between the morphological analysis and analyses based on the combined datasets include: 1) Homalorhagida appears as monophyletic in the morphological tree only, 2) the morphological analyses position Franciscideres and the new genus within Cyclorhagida near Zelinkaderidae and Cateriidae, whereas analyses including molecular data place the two genera inside Allomalorhagida, and 3) species of Campyloderes appear in a basal trichotomy within Kentrorhagata in the morphological tree, whereas analysis of the combined datasets places species of Campyloderes as a sister clade to Echinoderidae and Kentrorhagata. PMID:26200115

PanFunPro: Bacterial Pan-Genome Analysis Based on the Functional Profiles (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lukjancenko, Oksana

2012-06-01

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

PanFunPro: Bacterial Pan-Genome Analysis Based on the Functional Profiles (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

ScienceCinema

Lukjancenko, Oksana

2018-01-10

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

PubMed

Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

2017-02-28

High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Detection and identification of Theileria infection in sika deer ( Cervus nippon ) in China.

PubMed

He, Lan; Khan, Muhanmad Kasib; Zhang, Wen-Jie; Zhang, Qing-Li; Zhou, Yan-Qin; Hu, Min; Zhao, Junlong

2012-06-01

The sika deer ( Cervus nippon ) is a first-grade state-protected animal in China and designated a threatened species by the World Conservation Union. To detect hemoparasite infection of sika deer, blood samples were collected from 24 animals in the Hubei Province Deer Center. Genomic DNA was extracted, and the V4 hypervariable region encoding 18S rRNA was analyzed by reverse line blot hybridization assay. PCR products hybridized with Babesia / Theileria genus-specific probes but failed to hybridize with any of the Babesia or Theileria species-specific probes, suggesting the presence of a novel, or variant, species. Here 18S rRNA and internal transcribed spacer (ITS) genes were amplified, cloned, and sequenced from 7 isolates. Alignment and BlastN of the cloned sequences revealed high similarities to the homologous 18S rRNA genes and ITS genes of Theileria cervi (AY735122), Theileria sp. CNY1A (AB012194), and Theileria sp. ex Yamaguchi (AF529272). Phylogenetic analysis based on the 18S rRNA gene and ITS sequences showed that all cloned sequences were grouped within the Theileria clade. Phylogeny based on the 18S rRNA gene divided the organisms into 2 groups. Group 1 was closest to Theileria sp. ex Yamaguchi (AF529272), and group 2 was distinct from all other identified Theileria and Babesia species. These results suggest the existence of Theileria sp. infection in sika deer in China. To our knowledge, this is the first report of cervine Theileria sp. in China.

Three new anascosporic genera of the Saccharomycotina: Danielozyma gen. nov., Deakozyma gen. nov. and Middelhovenomyces gen. nov.

USDA-ARS?s Scientific Manuscript database

Three new non-ascosporic, ascomycetous yeast genera are proposed based on their isolation from currently described species and genera. Phylogenetic placement of the genera was determined from analysis of nuclear gene sequences for D1/D2 large subunit rRNA, small subunit rRNA, translation elongation...

Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

EPA Science Inventory

Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

Diversity analysis of lactic acid bacteria in takju, Korean rice wine.

PubMed

Jin, Jianbo; Kim, So-Young; Jin, Qing; Eom, Hyun-Ju; Han, Nam Soo

2008-10-01

To investigate the lactic acid bacterial population in Korean traditional rice wines, biotyping was performed using cell morphology and whole-cell protein pattern analysis by SDSPAGE, and then the isolates were identified by 16S rRNA sequencing analysis. Based on the morphological characteristics, 103 LAB isolates were detected in wine samples, characterized by whole-cell protein pattern analysis, and they were then divided into 18 patterns. By gene sequencing of 16S rRNA, the isolates were identified as Lactobacillus paracasei, Lb. arizonensis, Lb. plantarum, Lb. harbinensis, Lb. parabuchneri, Lb. brevis, and Lb. hilgardii when listed by their frequency of occurrence. It was found that the difference in bacterial diversity between rice and grape wines depends on the raw materials, especially the composition of starch and glucose.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

PubMed

Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

2015-11-13

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

PubMed Central

Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

2015-01-01

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

Microbial diversity in an Armenian geothermal spring assessed by molecular and culture-based methods.

PubMed

Panosyan, Hovik; Birkeland, Nils-Kåre

2014-11-01

The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Group 16SrXI phytoplasma strains, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D, are associated with sugar cane white leaf.

PubMed

Zhang, Rong-Yue; Li, Wen-Feng; Huang, Ying-Kun; Wang, Xiao-Yan; Shan, Hong-Li; Luo, Zhi-Ming; Yin, Jiong

2016-01-01

Sugar cane white leaf (SCWL) is a serious disease caused by phytoplasmas. In this study, we performed nested PCR with phytoplasma universal primer pairs (P1/P7 and R16F2n/R16R2) for the 16S rRNA gene to detect SCWL phytoplasmas in 31 SCWL samples collected from Baoshan and Lincang, Yunnan, China. We cloned and sequenced the nested PCR products, revealing that the 16S rRNA gene sequences from 31 SCWL samples were all 1247 bp in length and shared more than 99 % nucleotide sequence similarity with the 16S rRNA gene sequences of SCWL phytoplasmas from various countries. Based on the reported 16S rRNA gene sequence data from SCWL isolates of various countries, we conducted phylogenetic and virtual RFLP analysis. In the resulting phylogenetic tree, all SCWL isolates clustered into two branches, with the Lincang and Baoshan SCWL phytoplasma isolates belonging to different branches. The virtual RFLP patterns show that phytoplasmas of the Lincang branch belong to subgroup 16SrXI-B. However, the virtual RFLP patterns revealed by HaeIII digestion of phytoplasmas of the Baoshan branch differed from those of subgroup 16SrXI-B. According to the results of phylogenetic and virtual RFLP analysis, we propose that the phytoplasmas of the Baoshan branch represent a new subgroup, 16SrXI-D. These findings suggest that SCWL is caused by phytoplasmas from group 16SrXI, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D.

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

PHYLOGENETIC ANALYSIS OF 16S RRNA GENE SEQUENCES REVEALS THE PREVALENCE OF MYCOBACTERIA SP., ALPHA-PROTEOBACTERIA, AND UNCULTURED BACTERIA IN DRINKING WATER MICROBIAL COMMUNITIES

EPA Science Inventory

Previous studies have shown that culture-based methods tend to underestimate the densities and diversity of bacterial populations inhabiting water distribution systems (WDS). In this study, the phylogenetic diversity of drinking water bacteria was assessed using sequence analysis...

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Comparative evaluation of rRNA depletion procedures for the improved analysis of bacterial biofilm and mixed pathogen culture transcriptomes

PubMed Central

Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin

2017-01-01

Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Use of rpoB gene analysis for identification of nitrogen-fixing Paenibacillus species as an alternative to the 16S rRNA gene.

PubMed

da Mota, F F; Gomes, E A; Paiva, E; Rosado, A S; Seldin, L

2004-01-01

To avoid the limitations of 16S rRNA-based phylogenetic analysis for Paenibacillus species, the usefulness of the RNA polymerase beta-subunit encoding gene (rpoB) was investigated as an alternative to the 16S rRNA gene for taxonomic studies. Partial rpoB sequences were generated for the type strains of eight nitrogen-fixing Paenibacillus species. The presence of only one copy of rpoB in the genome of P. graminis strain RSA19(T) was demonstrated by denaturing gradient gel electrophoresis and hybridization assays. A comparative analysis of the sequences of the 16S rRNA and rpoB genes was performed and the eight species showed between 91.6-99.1% (16S rRNA) and 77.9-97.3% (rpoB) similarity, allowing a more accurate discrimination between the different species using the rpoB gene. Finally, 24 isolates from the rhizosphere of different cultivars of maize previously identified as Paenibacillus spp. were assigned correctly to one of the nitrogen-fixing species. The data obtained in this study indicate that rpoB is a powerful identification tool, which can be used for the correct discrimination of the nitrogen-fixing species of agricultural and industrial importance within the genus Paenibacillus.

Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

USDA-ARS?s Scientific Manuscript database

This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

Novel Molecular Method for Identification of Streptococcus pneumoniae Applicable to Clinical Microbiology and 16S rRNA Sequence-Based Microbiome Studies

PubMed Central

Scholz, Christian F. P.; Poulsen, Knud

2012-01-01

The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered specific for S. pneumoniae hamper the exact identification of S. pneumoniae. Based on sequence analysis of 16S rRNA genes of a collection of 634 streptococcal strains, identified by multilocus sequence analysis, we detected a cytosine at position 203 present in all 440 strains of S. pneumoniae but replaced by an adenosine residue in all strains representing other species of mitis group streptococci. The S. pneumoniae-specific sequence signature could be demonstrated by sequence analysis or indirectly by restriction endonuclease digestion of a PCR amplicon covering the site. The S. pneumoniae-specific signature offers an inexpensive means for validation of the identity of clinical isolates and should be used as an integrated marker in the annotation procedure employed in 16S rRNA-based molecular studies of complex human microbiotas. This may avoid frequent misidentifications such as those we demonstrate to have occurred in previous reports and in reference sequence databases. PMID:22442329

Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene.

PubMed

Lynch, T; Gregson, D; Church, D L

2016-03-01

Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene

PubMed Central

Gregson, D.; Church, D. L.

2016-01-01

Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization–time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. PMID:26739153

The structural analysis of the mitochondrial SSUrRNA implies a close phylogenetic relationship between mitochondria from plants and from the heterotrophic alga Prototheca wickerhamii.

PubMed

Wolff, G; Kück, U

1990-04-01

The gene for the mitochondrial small subunit rRNA (SSUrRNA) from the heterotrophic alga Prototheca wickerhamii has been isolated from a gene library of extranuclear DNA. Sequence and structural analyses allow the determination of a secondary structure model for this rRNA. In addition, several sequence motifs are present which are typically found in SSUrRNAs of various mitochondrial origins. Unexpectedly, the Prototheca RNA sequence has more features in common with mitochondrial SSUrRNAs from plants than with that from the green alga Chlamydomonas reinhardtii. The phylogenetic relationship between mitochondria from plants and algae is discussed.

Genetic diversity of Rhizobia isolates from Amazon soils using cowpea (Vigna unguiculata) as trap plant

PubMed Central

Silva, F.V.; Simões-Araújo, J.L.; Silva Júnior, J.P.; Xavier, G.R.; Rumjanek, N.G.

2012-01-01

The aim of this work was to characterize rhizobia isolated from the root nodules of cowpea (Vigna unguiculata) plants cultivated in Amazon soils samples by means of ARDRA (Amplified rDNA Restriction Analysis) and sequencing analysis, to know their phylogenetic relationships. The 16S rRNA gene of rhizobia was amplified by PCR (polymerase chain reaction) using universal primers Y1 and Y3. The amplification products were analyzed by the restriction enzymes HinfI, MspI and DdeI and also sequenced with Y1, Y3 and six intermediate primers. The clustering analysis based on ARDRA profiles separated the Amazon isolates in three subgroups, which formed a group apart from the reference isolates of Bradyrhizobium japonicum and Bradyrhizobium elkanii. The clustering analysis of 16S rRNA gene sequences showed that the fast-growing isolates had similarity with Enterobacter, Rhizobium, Klebsiella and Bradyrhizobium and all the slow-growing clustered close to Bradyrhizobium. PMID:24031880

Estimating Bacterial Diversity for Ecological Studies: Methods, Metrics, and Assumptions

PubMed Central

Birtel, Julia; Walser, Jean-Claude; Pichon, Samuel; Bürgmann, Helmut; Matthews, Blake

2015-01-01

Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5). Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques. PMID:25915756

[Genetic diversity and phylogeny of rhizobia isolated from peanut (Arachis hypogaea)].

PubMed

Yang, Jiang-Ke; Xie, Fu-Li; Zhou, Jun-Chu

2002-12-01

Forty three rhizobium strains isolated from peanut (Arachis hypogaea) and 15 reference strains from other genus and species were analyzed by the method of 16S rRNA RFLP, 16S rRNA sequencing and 16S-23S IGS PCR RFLP. The results of the 16S rRNA RFLP shown that 43 strains tested were all ascribed to the genus of Bradyrhizobium phylogenetically. Strains tested were adjacent to the B. japonicum and far from B. elkanii 16S rRNA genotype. The genotypes generated by the 4 restriction endonucleases, Mbo I, Dde I, Hae III and Msp I, were same as the representatives of B. japonicum. The dendrogram generated by 16S rRNA sequence and Neighbor-joining method shown that peanut rhizobia clustered into the subcluster represented by B. japonicum and B. liaoningense, were more close to B. liaoningense genetically, and the sequence difference between them was less than 1%. High sequence similarity was also determined between B. liaoningense and B. japonicum. JZ1, representative strain of peanut rhizobia were systematically far from the B. elkanii, and the sequence divergence about 2%. The results from IGS RFLP analysis indicated that although they were phylogenetically close to B. japonicum and B. elkanii, peanut rhizobia forming an independent group at the similarity of 71% could be further divided into four subgroups, A, B, C and D. Subgroup A consisted of strains from different region, subgroup B was composed of strains from Wuchang, Qianjiang and Jingzhou, subgroup C was mainly composed of strains from Jingzhou and starins of subgroup D mainly from Neijiang. Reference strains from B. japonicum and B. elkanii were independently clustered into the subgroup E at the similarity of 71%. The geographical factor effect on genetic diversity of rhizobia was found.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Diversity of lactic acid bacteria in suan-tsai and fu-tsai, traditional fermented mustard products of Taiwan.

PubMed

Chao, Shiou-Huei; Wu, Ruei-Jie; Watanabe, Koichi; Tsai, Ying-Chieh

2009-11-15

Fu-tsai and suan-tsai are spontaneously fermented mustard products traditionally prepared by the Hakka tribe of Taiwan. We chose 5 different processing stages of these products for analysis of the microbial community of lactic acid bacteria (LAB) by 16S rRNA gene sequencing. From 500 LAB isolates we identified 119 representative strains belonging to 5 genera and 18 species, including Enterococcus (1 species), Lactobacillus (11 species), Leuconostoc (3 species), Pediococcus (1 species), and Weissella (2 species). The LAB composition of mustard fermented for 3 days, known as the Mu sample, was the most diverse, with 11 different LAB species being isolated. We used sequence analysis of the 16S rRNA gene to identify the LAB strains and analysis of the dnaA, pheS, and rpoA genes to identify 13 LAB strains for which identification by 16S rRNA gene sequences was not possible. These 13 strains were found to belong to 5 validated known species: Lactobacillus farciminis, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Weissella cibaria, and Weissella paramesenteroides, and 5 possibly novel Lactobacillus species. These results revealed that there is a high level of diversity in LAB at the different stages of fermentation in the production of suan-tsai and fu-tsai.

Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

NASA Technical Reports Server (NTRS)

Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

1995-01-01

Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

PubMed Central

Pan, W J; Blackburn, E H

1995-01-01

The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.

PubMed

Habibi, Gh

2012-01-01

Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.

Streptomyces tritici sp. nov., a novel actinomycete isolated from rhizosphere soil of wheat (Triticum aestivum L.).

PubMed

Zhao, Junwei; Shi, Linlin; Li, Wenchao; Wang, Jiabin; Wang, Han; Tian, Yuanyuan; Xiang, Wensheng; Wang, Xiangjing

2018-02-01

Two novel actinomycete isolates, designated strains NEAU-A4 T and NEAU-A3, were isolated from rhizosphere soil of wheat (Triticumaestivum L.) and characterized using a polyphasic approach. Morphological and chemotaxonomic characteristics of the two strains coincided with those of the genus Streptomyces. The 16S rRNA gene sequence analysis showed that the two isolates exhibited 99.6 % 16S rRNA gene sequence similarity with each other and that they were most closely related to Streptomyces violaceorectus DSM 40279 T (98.8, 99.0 %). Phylogenetic analysis based on 16S rRNA gene sequences indicated that the two strains clustered together and formed a separate subclade. Furthermore, a combination of DNA-DNA hybridization results and some physiological and biochemical properties demonstrated that the two strains could be distinguished from its closest relative. Therefore, it is proposed that strains NEAU-A4 T and NEAU-A3 should be classified as representatives of a novel species of the genus Streptomyces, for which the name Streptomycestritici sp. nov. is proposed. The type strain is NEAU-A4 T (=CGMCC 4.7393 T =DSM 104540 T ).

[Phylogenetic and diversity analysis of Acidithiobacillus spp. based on 16S rRNA and RubisCO genes homologues].

PubMed

Liu, Minrui; Lin, Pengwu; Qi, Xing'e; Ni, Yongqing

2016-04-14

The purpose of the study was to reveal geographic region-related Acidithiobacillus spp. distribution and allopatric speciation. Phylogenetic and diversity analysis was done to expand our knowledge on microbial phylogeography, diversity-maintaining mechanisms and molecular biogeography. We amplified 16S rRNA gene and RubisCO genes to construct corresponding phylogenetic trees based on the sequence homology and analyzed genetic diversity of Acidithiobacillus spp.. Thirty-five strains were isolated from three different regions in China (Yunnan, Hubei, Xinjiang). The whole isolates were classified into five groups. Four strains were identified as A. ferrivorans, six as A. ferridurans, YNTR4-15 Leptspirillum ferrooxidans and HBDY3-31 as Leptospirillum ferrodiazotrophum. The remaining strains were identified as A. ferrooxidans. Analysis of cbbL and cbbM genes sequences of representative 26 strains indicated that cbbL gene of 19 were two copies (cbbL1 and cbbL2) and 7 possessed only cbbL1. cbbM gene was single copy. In nucleotide-based trees, cbbL1 gene sequences of strains were separated into three sequence types, and the cbbL2 was similar to cbbL1 with three types. Codon bias of RubisCO genes was not obvious in Acidithiobacillus spp.. Strains isolated from three different regions in China indicated a great genetic diversity in Acidithiobacillus spp. and their 16S rRNA/RubisCO genes sequence was of significant difference. Phylogenetic tree based on 16S rRNA genes and RubisCO genes was different in Acidithiobacillus spp..

Microbial community structure in the gut of the New Zealand insect Auckland tree weta (Hemideina thoracica).

PubMed

Waite, David W; Dsouza, Melissa; Biswas, Kristi; Ward, Darren F; Deines, Peter; Taylor, Michael W

2015-05-01

The endemic New Zealand weta is an enigmatic insect. Although the insect is well known by its distinctive name, considerable size, and morphology, many basic aspects of weta biology remain unknown. Here, we employed cultivation-independent enumeration techniques and rRNA gene sequencing to investigate the gut microbiota of the Auckland tree weta (Hemideina thoracica). Fluorescence in situ hybridisation performed on different sections of the gut revealed a bacterial community of fluctuating density, while rRNA gene-targeted amplicon pyrosequencing revealed the presence of a microbial community containing high bacterial diversity, but an apparent absence of archaea. Bacteria were further studied using full-length 16S rRNA gene sequences, with statistical testing of bacterial community membership against publicly available termite- and cockroach-derived sequences, revealing that the weta gut microbiota is similar to that of cockroaches. These data represent the first analysis of the weta microbiota and provide initial insights into the potential function of these microorganisms.

Census of the bacterial community of the gypsy moth larval midgut by using culturing and culture-independent methods.

PubMed

Broderick, Nichole A; Raffa, Kenneth F; Goodman, Robert M; Handelsman, Jo

2004-01-01

Little is known about bacteria associated with Lepidoptera, the large group of mostly phytophagous insects comprising the moths and butterflies. We inventoried the larval midgut bacteria of a polyphagous foliivore, the gypsy moth (Lymantria dispar L.), whose gut is highly alkaline, by using traditional culturing and culture-independent methods. We also examined the effects of diet on microbial composition. Analysis of individual third-instar larvae revealed a high degree of similarity of microbial composition among insects fed on the same diet. DNA sequence analysis indicated that most of the PCR-amplified 16S rRNA genes belong to the gamma-Proteobacteria and low G+C gram-positive divisions and that the cultured members represented more than half of the phylotypes identified. Less frequently detected taxa included members of the alpha-Proteobacterium, Actinobacterium, and Cytophaga/Flexibacter/Bacteroides divisions. The 16S rRNA gene sequences from 7 of the 15 cultured organisms and 8 of the 9 sequences identified by PCR amplification diverged from previously reported bacterial sequences. The microbial composition of midguts differed substantially among larvae feeding on a sterilized artificial diet, aspen, larch, white oak, or willow. 16S rRNA analysis of cultured isolates indicated that an Enterococcus species and culture-independent analysis indicated that an Entbacter sp. were both present in all larvae, regardless of the feeding substrate; the sequences of these two phylotypes varied less than 1% among individual insects. These results provide the first comprehensive description of the microbial diversity of a lepidopteran midgut and demonstrate that the plant species in the diet influences the composition of the gut bacterial community.

Diversity and Functional Analysis of Bacterial Communities Associated with Natural Hydrocarbon Seeps in Acidic Soils at Rainbow Springs, Yellowstone National Park

PubMed Central

Hamamura, Natsuko; Olson, Sarah H.; Ward, David M.; Inskeep, William P.

2005-01-01

In this paper we describe the bacterial communities associated with natural hydrocarbon seeps in nonthermal soils at Rainbow Springs, Yellowstone National Park. Soil chemical analysis revealed high sulfate concentrations and low pH values (pH 2.8 to 3.8), which are characteristic of acid-sulfate geothermal activity. The hydrocarbon composition of the seep soils consisted almost entirely of saturated, acyclic alkanes (e.g., n-alkanes with chain lengths of C15 to C30, as well as branched alkanes, predominately pristane and phytane). Bacterial populations present in the seep soils were phylogenetically characterized by 16S rRNA gene clone library analysis. The majority of the sequences recovered (>75%) were related to sequences of heterotrophic acidophilic bacteria, including Acidisphaera spp. and Acidiphilium spp. of the α-Proteobacteria. Clones related to the iron- and sulfur-oxidizing chemolithotroph Acidithiobacillus spp. were also recovered from one of the seep soils. Hydrocarbon-amended soil-sand mixtures were established to examine [14C]hexadecane mineralization and corresponding changes in the bacterial populations using denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene fragments. Approximately 50% of the [14C]hexadecane added was recovered as 14CO2 during an 80-day incubation, and this was accompanied by detection of heterotrophic acidophile-related sequences as dominant DGGE bands. An alkane-degrading isolate was cultivated, whose 16S rRNA gene sequence was identical to the sequence of a dominant DGGE band in the soil-sand mixture, as well as the clone sequence recovered most frequently from the original soil. This and the presence of an alkB gene homolog in this isolate confirmed the alkane degradation capability of one population indigenous to acidic hydrocarbon seep soils. PMID:16204508

Diversity and functional analysis of bacterial communities associated with natural hydrocarbon seeps in acidic soils at Rainbow Springs, Yellowstone National Park.

PubMed

Hamamura, Natsuko; Olson, Sarah H; Ward, David M; Inskeep, William P

2005-10-01

In this paper we describe the bacterial communities associated with natural hydrocarbon seeps in nonthermal soils at Rainbow Springs, Yellowstone National Park. Soil chemical analysis revealed high sulfate concentrations and low pH values (pH 2.8 to 3.8), which are characteristic of acid-sulfate geothermal activity. The hydrocarbon composition of the seep soils consisted almost entirely of saturated, acyclic alkanes (e.g., n-alkanes with chain lengths of C15 to C30, as well as branched alkanes, predominately pristane and phytane). Bacterial populations present in the seep soils were phylogenetically characterized by 16S rRNA gene clone library analysis. The majority of the sequences recovered (>75%) were related to sequences of heterotrophic acidophilic bacteria, including Acidisphaera spp. and Acidiphilium spp. of the alpha-Proteobacteria. Clones related to the iron- and sulfur-oxidizing chemolithotroph Acidithiobacillus spp. were also recovered from one of the seep soils. Hydrocarbon-amended soil-sand mixtures were established to examine [14C]hexadecane mineralization and corresponding changes in the bacterial populations using denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene fragments. Approximately 50% of the [14C]hexadecane added was recovered as 14CO2 during an 80-day incubation, and this was accompanied by detection of heterotrophic acidophile-related sequences as dominant DGGE bands. An alkane-degrading isolate was cultivated, whose 16S rRNA gene sequence was identical to the sequence of a dominant DGGE band in the soil-sand mixture, as well as the clone sequence recovered most frequently from the original soil. This and the presence of an alkB gene homolog in this isolate confirmed the alkane degradation capability of one population indigenous to acidic hydrocarbon seep soils.

Molecular Evidence of Chlamydia-Like Organisms in the Feces of Myotis daubentonii Bats.

PubMed

Hokynar, K; Vesterinen, E J; Lilley, T M; Pulliainen, A T; Korhonen, S J; Paavonen, J; Puolakkainen, M

2017-01-15

Chlamydia-like organisms (CLOs) are recently identified members of the Chlamydiales order. CLOs share intracellular lifestyles and biphasic developmental cycles, and they have been detected in environmental samples as well as in various hosts such as amoebae and arthropods. In this study, we screened bat feces for the presence of CLOs by molecular analysis. Using pan-Chlamydiales PCR targeting the 16S rRNA gene, Chlamydiales DNA was detected in 54% of the specimens. PCR amplification, sequencing, and phylogenetic analysis of the 16S rRNA and 23S rRNA genes were used to classify positive specimens and infer their phylogenetic relationships. Most sequences matched best with Rhabdochlamydia species or uncultured Chlamydia sequences identified in ticks. Another set of sequences matched best with sequences of the Chlamydia genus or uncultured Chlamydiales from snakes. To gain evidence of whether CLOs in bat feces are merely diet borne, we analyzed insects trapped from the same location where the bats foraged. Interestingly, the CLO sequences resembling Rhabdochlamydia spp. were detected in insect material as well, but the other set of CLO sequences was not, suggesting that this set might not originate from prey. Thus, bats represent another potential host for Chlamydiales and could harbor novel, previously unidentified members of this order. Several pathogenic viruses are known to colonize bats, and recent analyses indicate that bats are also reservoir hosts for bacterial genera. Chlamydia-like organisms (CLOs) have been detected in several animal species. CLOs have high 16S rRNA sequence similarity to Chlamydiaceae and exhibit similar intracellular lifestyles and biphasic developmental cycles. Our study describes the frequent occurrence of CLO DNA in bat feces, suggesting an expanding host species spectrum for the Chlamydiales As bats can acquire various infectious agents through their diet, prey insects were also studied. We identified CLO sequences in bats that matched best with sequences in prey insects but also CLO sequences not detected in prey insects. This suggests that a portion of CLO DNA present in bat feces is not prey borne. Furthermore, some sequences from bat droppings not originating from their diet might well represent novel, previously unidentified members of the Chlamydiales order. Copyright © 2016 American Society for Microbiology.

How many novel eukaryotic 'kingdoms'? Pitfalls and limitations of environmental DNA surveys

PubMed Central

Berney, Cédric; Fahrni, José; Pawlowski, Jan

2004-01-01

Background Over the past few years, the use of molecular techniques to detect cultivation-independent, eukaryotic diversity has proven to be a powerful approach. Based on small-subunit ribosomal RNA (SSU rRNA) gene analyses, these studies have revealed the existence of an unexpected variety of new phylotypes. Some of them represent novel diversity in known eukaryotic groups, mainly stramenopiles and alveolates. Others do not seem to be related to any molecularly described lineage, and have been proposed to represent novel eukaryotic kingdoms. In order to review the evolutionary importance of this novel high-level eukaryotic diversity critically, and to test the potential technical and analytical pitfalls and limitations of eukaryotic environmental DNA surveys (EES), we analysed 484 environmental SSU rRNA gene sequences, including 81 new sequences from sediments of the small river, the Seymaz (Geneva, Switzerland). Results Based on a detailed screening of an exhaustive alignment of eukaryotic SSU rRNA gene sequences and the phylogenetic re-analysis of previously published environmental sequences using Bayesian methods, our results suggest that the number of novel higher-level taxa revealed by previously published EES was overestimated. Three main sources of errors are responsible for this situation: (1) the presence of undetected chimeric sequences; (2) the misplacement of several fast-evolving sequences; and (3) the incomplete sampling of described, but yet unsequenced eukaryotes. Additionally, EES give a biased view of the diversity present in a given biotope because of the difficult amplification of SSU rRNA genes in some taxonomic groups. Conclusions Environmental DNA surveys undoubtedly contribute to reveal many novel eukaryotic lineages, but there is no clear evidence for a spectacular increase of the diversity at the kingdom level. After re-analysis of previously published data, we found only five candidate lineages of possible novel high-level eukaryotic taxa, two of which comprise several phylotypes that were found independently in different studies. To ascertain their taxonomic status, however, the organisms themselves have now to be identified. PMID:15176975

Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps

PubMed Central

Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz

2015-01-01

In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450

Taxonomic evaluation of Streptomyces hirsutus and related species using multi-locus sequence analysis

USDA-ARS?s Scientific Manuscript database

Phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species having very similar gross morphology. These species, including Streptomyces bambergiensis, Streptomyces chlorus, Streptomyces...

Enterococcus Xinjiangensis sp. nov., Isolated from Yogurt of Xinjiang, China.

PubMed

Ren, Xiaopu; Li, Mingyang; Guo, Dongqi

2016-09-01

A Gram-strain-positive bacterial strain 48(T) was isolated from traditional yogurt in Xinjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, polymerase α subunit (rpoA) gene sequence analysis, determination of DNA G+C content, DNA-DNA hybridization with the type strain of Enterococcus ratti and analysis of phenotypic features. Strain 48(T) accounted for 96.1, 95.8, 95.8, and 95.7 % with Enterococcus faecium CGMCC 1.2136(T), Enterococcus hirae ATCC 9790(T), Enterococcus durans CECT 411(T), and E. ratti ATCC 700914(T) in the 16S rRNA gene sequence similarities, respectively. The sequence of rpoA gene showed similarities of 99.0, 96.0, 96.0, and 96 % with that of E. faecium ATCC 19434(T), Enterococcus villorum LMG12287, E. hirae ATCC 9790(T), and E. durans ATCC 19432(T), respectively. Based upon of polyphasic characterization data obtained in the study, a novel species, Enterococcus xinjiangensis sp. nov., was proposed and the type strain was 48(T)(=CCTCC AB 2014041(T) = JCM 30200(T)).

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

PubMed

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

Molecular Fingerprint and Dominant Environmental Factors of Nitrite-Dependent Anaerobic Methane-Oxidizing Bacteria in Sediments from the Yellow River Estuary, China.

PubMed

Yan, Pengze; Li, Mingcong; Wei, Guangshan; Li, Han; Gao, Zheng

2015-01-01

Nitrite-dependent anaerobic methane oxidation (n-damo) is performed by "Candidatus Methylomirabilis oxyfera" (M. oxyfera), which connects the carbon and nitrogen global nutrient cycles. In the present study, M. oxyfera-like bacteria sequences were successfully recovered from Yellow River Estuary sediments using specific primers for 16S rRNA and pmoA genes. A M. oxyfera-like sequences analysis based on the 16S rRNA gene revealed greater diversity compared with the pmoA gene; the 16S rRNA gene sequences retrieved from the Yellow River Estuary sediments belong to groups A as well as B and were mainly found in freshwater habitats. Quantitative PCR showed that 16S rRNA gene abundance varied from 9.28±0.11×10(3) to 2.10±0.13×10(5) copies g(-1) (dry weight), and the pmoA gene abundance ranged from 8.63±0.50×10(3) to 1.83±0.18×10(5) copies g(-1) (dry weight). A correlation analysis showed that the total organic carbon (TOC) and ammonium (NH4(+)) as well as the ratio of total phosphorus to total nitrogen (TP/TN) influenced the M. oxyfera-like bacteria distribution in the Yellow River Estuary sediments. These findings will aid in understanding the n-damo bacterial distribution pattern as well as their correlation with surrounding environmental factors in temperate estuarine ecosystems.

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.

Molecular Characterization of “Candidatus Parilichlamydia carangidicola,” a Novel Chlamydia-Like Epitheliocystis Agent in Yellowtail Kingfish, Seriola lalandi (Valenciennes), and the Proposal of a New Family, “Candidatus Parilichlamydiaceae” fam. nov. (Order Chlamydiales)

PubMed Central

Polkinghorne, A.; Miller, T. L.; Groff, J. M.; LaPatra, S. E.; Nowak, B. F.

2013-01-01

Three cohorts of farmed yellowtail kingfish (Seriola lalandi) from South Australia were examined for Chlamydia-like organisms associated with epitheliocystis. To characterize the bacteria, 38 gill samples were processed for histopathology, electron microscopy, and 16S rRNA amplification, sequencing, and phylogenetic analysis. Microscopically, the presence of membrane-enclosed cysts was observed within the gill lamellae. Also observed was hyperplasia of the epithelial cells with cytoplasmic vacuolization and fusion of the gill lamellae. Transmission electron microscopy revealed morphological features of the reticulate and intermediate bodies typical of members of the order Chlamydiales. A novel 1,393-bp 16S chlamydial rRNA sequence was amplified from gill DNA extracted from fish in all cohorts over a 3-year period that corresponded to the 16S rRNA sequence amplified directly from laser-dissected cysts. This sequence was only 87% similar to the reported “Candidatus Piscichlamydia salmonis” (AY462244) from Atlantic salmon and Arctic charr. Phylogenetic analysis of this sequence against 35 Chlamydia and Chlamydia-like bacteria revealed that this novel bacterium belongs to an undescribed family lineage in the order Chlamydiales. Based on these observations, we propose this bacterium of yellowtail kingfish be known as “Candidatus Parilichlamydia carangidicola” and that the new family be known as “Candidatus Parilichlamydiaceae.” PMID:23275507

Correcting names of bacteria deposited in National Microbial Repositories: an analysed sequence data necessary for taxonomic re-categorization of misclassified bacteria-ONE example, genus Lysinibacillus.

PubMed

Rekadwad, Bhagwan N; Gonzalez, Juan M

2017-08-01

A report on 16S rRNA gene sequence re-analysis and digitalization is presented using Lysinibacillus species (one example) deposited in National Microbial Repositories in India. Lysinibacillus species 16S rRNA gene sequences were digitalized to provide quick response (QR) codes, Chaose Game Representation (CGR) and Frequency of Chaose Game Representation (FCGR). GC percentage, phylogenetic analysis, and principal component analysis (PCA) are tools used for the differentiation and reclassification of the strains under investigation. The seven reasons supporting the statements made by us as misclassified Lysinibacillus species deposited in National Microbial Depositories are given in this paper. Based on seven reasons, bacteria deposited in National Microbial Repositories such as Lysinibacillus and many other needs reanalyses for their exact identity. Leaves of identity with type strains of related species shows difference 2 to 8 % suggesting that reclassification is needed to correctly assign species names to the analyzed Lysinibacillus strains available in National Microbial Repositories.

A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

PubMed

Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

2017-11-06

Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria.

PubMed

Gaby, John Christian; Buckley, Daniel H

2014-01-01

We describe a nitrogenase gene sequence database that facilitates analysis of the evolution and ecology of nitrogen-fixing organisms. The database contains 32 954 aligned nitrogenase nifH sequences linked to phylogenetic trees and associated sequence metadata. The database includes 185 linked multigene entries including full-length nifH, nifD, nifK and 16S ribosomal RNA (rRNA) gene sequences. Evolutionary analyses enabled by the multigene entries support an ancient horizontal transfer of nitrogenase genes between Archaea and Bacteria and provide evidence that nifH has a different history of horizontal gene transfer from the nifDK enzyme core. Further analyses show that lineages in nitrogenase cluster I and cluster III have different rates of substitution within nifD, suggesting that nifD is under different selection pressure in these two lineages. Finally, we find that that the genetic divergence of nifH and 16S rRNA genes does not correlate well at sequence dissimilarity values used commonly to define microbial species, as stains having <3% sequence dissimilarity in their 16S rRNA genes can have up to 23% dissimilarity in nifH. The nifH database has a number of uses including phylogenetic and evolutionary analyses, the design and assessment of primers/probes and the evaluation of nitrogenase sequence diversity. Database URL: http://www.css.cornell.edu/faculty/buckley/nifh.htm.

A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria

PubMed Central

Gaby, John Christian; Buckley, Daniel H.

2014-01-01

We describe a nitrogenase gene sequence database that facilitates analysis of the evolution and ecology of nitrogen-fixing organisms. The database contains 32 954 aligned nitrogenase nifH sequences linked to phylogenetic trees and associated sequence metadata. The database includes 185 linked multigene entries including full-length nifH, nifD, nifK and 16S ribosomal RNA (rRNA) gene sequences. Evolutionary analyses enabled by the multigene entries support an ancient horizontal transfer of nitrogenase genes between Archaea and Bacteria and provide evidence that nifH has a different history of horizontal gene transfer from the nifDK enzyme core. Further analyses show that lineages in nitrogenase cluster I and cluster III have different rates of substitution within nifD, suggesting that nifD is under different selection pressure in these two lineages. Finally, we find that that the genetic divergence of nifH and 16S rRNA genes does not correlate well at sequence dissimilarity values used commonly to define microbial species, as stains having <3% sequence dissimilarity in their 16S rRNA genes can have up to 23% dissimilarity in nifH. The nifH database has a number of uses including phylogenetic and evolutionary analyses, the design and assessment of primers/probes and the evaluation of nitrogenase sequence diversity. Database URL: http://www.css.cornell.edu/faculty/buckley/nifh.htm PMID:24501396

Presence and mechanisms of acquired antimicrobial resistance in Belgian Brachyspira hyodysenteriae isolates belonging to different clonal complexes.

PubMed

Mahu, M; Pasmans, F; Vranckx, K; De Pauw, N; Vande Maele, L; Vyt, Philip; Vandersmissen, Tamara; Martel, A; Haesebrouck, F; Boyen, F

2017-08-01

Swine dysentery (SD) is an economically important disease for which antimicrobial treatment still occupies an important place to control outbreaks. However, acquired antimicrobial resistance is increasingly observed in Brachyspira hyodysenteriae. In this study, the Minimal Inhibitory Concentrations (MIC) of six antimicrobial compounds for 30 recent Belgian B. hyodysenteriae isolates were determined using a broth microdilution method. In addition, relevant regions of the 16S rRNA, 23S rRNA and the L3 protein encoding genes were sequenced to reveal mutations associated with acquired resistance. Finally, a phylogeny was reconstructed using minimal spanning tree analysis of multi locus sequence typing of the isolates. For lincomycin, doxycycline, tylosin and tylvalosin, at least 70% of the isolates did not belong to the wild-type population and were considered to have acquired resistance. For valnemulin and tiamulin, this was over 50%. In all isolates with acquired resistance to doxycycline, the G1058C mutation was present in their 16S rRNA gene. All isolates showing acquired resistance to lincomycin and both macrolides displayed the A2058T mutation in their 23S rRNA gene. Other mutations in this gene and the N148S mutation in the L3 protein were present in both wild-type isolates and isolates considered to have acquired resistance. Multi locus sequence analysis revealed a previously undescribed clonal complex, with 4 novel sequence types in which the majority of isolates showed acquired resistance to all tested antimicrobial products. In conclusion, acquired antimicrobial resistance is widespread among Belgian B. hyodysenteriae isolates. The emergence of multi-resistant clonal complexes can pose a threat to swine industry. Copyright © 2017 Elsevier B.V. All rights reserved.

'Candidatus Phytoplasma noviguineense', a novel taxon associated with Bogia coconut syndrome and banana wilt disease on the island of New Guinea.

PubMed

Miyazaki, Akio; Shigaki, Toshiro; Koinuma, Hiroaki; Iwabuchi, Nozomu; Rauka, Gou Bue; Kembu, Alfred; Saul, Josephine; Watanabe, Kiyoto; Nijo, Takamichi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2018-01-01

Bogia coconut syndrome (BCS) is one of the lethal yellowing (LY)-type diseases associated with phytoplasma presence that are seriously threatening coconut cultivation worldwide. It has recently emerged, and is rapidly spreading in northern parts of the island of New Guinea. BCS-associated phytoplasmas collected in different regions were compared in terms of 16S rRNA gene sequences, revealing high identity among them represented by strain BCS-Bo R . Comparative analysis of the 16S rRNA gene sequences revealed that BCS-Bo R shared less than a 97.5 % similarity with other species of 'Candidatus Phytoplasma', with a maximum value of 96.08 % (with strain LY; GenBank accession no. U18747). This result indicates the necessity and propriety of a novel taxon for BCS phytoplasmas according to the recommendations of the IRPCM. Phylogenetic analysis was also conducted on 16S rRNA gene sequences, resulting in a monophyletic cluster composed of BCS-Bo R and other LY-associated phytoplasmas. Other phytoplasmas on the island of New Guinea associated with banana wilt and arecanut yellow leaf diseases showed high similarities to BCS-Bo R and were closely related to BCS phytoplasmas. Based on the uniqueness of their 16S rRNA gene sequences, a novel taxon 'Ca.Phytoplasma noviguineense' is proposed for these phytoplasmas found on the island of New Guinea, with strain BCS-Bo R (GenBank accession no. LC228755) as the reference strain. The novel taxon is described in detail, including information on the symptoms of associated diseases and additional genetic features of the secY gene and rp operon.

TaxI: a software tool for DNA barcoding using distance methods

PubMed Central

Steinke, Dirk; Vences, Miguel; Salzburger, Walter; Meyer, Axel

2005-01-01

DNA barcoding is a promising approach to the diagnosis of biological diversity in which DNA sequences serve as the primary key for information retrieval. Most existing software for evolutionary analysis of DNA sequences was designed for phylogenetic analyses and, hence, those algorithms do not offer appropriate solutions for the rapid, but precise analyses needed for DNA barcoding, and are also unable to process the often large comparative datasets. We developed a flexible software tool for DNA taxonomy, named TaxI. This program calculates sequence divergences between a query sequence (taxon to be barcoded) and each sequence of a dataset of reference sequences defined by the user. Because the analysis is based on separate pairwise alignments this software is also able to work with sequences characterized by multiple insertions and deletions that are difficult to align in large sequence sets (i.e. thousands of sequences) by multiple alignment algorithms because of computational restrictions. Here, we demonstrate the utility of this approach with two datasets of fish larvae and juveniles from Lake Constance and juvenile land snails under different models of sequence evolution. Sets of ribosomal 16S rRNA sequences, characterized by multiple indels, performed as good as or better than cox1 sequence sets in assigning sequences to species, demonstrating the suitability of rRNA genes for DNA barcoding. PMID:16214755

Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

PubMed Central

Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

2003-01-01

The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

PubMed

Hoshino, Tatsuhiko; Inagaki, Fumio

2017-01-01

Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.

Low Maternal Microbiota Sharing across Gut, Breast Milk and Vagina, as Revealed by 16S rRNA Gene and Reduced Metagenomic Sequencing.

PubMed

Avershina, Ekaterina; Angell, Inga Leena; Simpson, Melanie; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut

2018-05-01

The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types ( Bifidobacterium longum and Enterococcus faecalis ). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis . We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation.

Low Maternal Microbiota Sharing across Gut, Breast Milk and Vagina, as Revealed by 16S rRNA Gene and Reduced Metagenomic Sequencing

PubMed Central

Angell, Inga Leena; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut

2018-01-01

The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types (Bifidobacterium longum and Enterococcus faecalis). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis. We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation. PMID:29724017

PANGEA: pipeline for analysis of next generation amplicons

PubMed Central

Giongo, Adriana; Crabb, David B; Davis-Richardson, Austin G; Chauliac, Diane; Mobberley, Jennifer M; Gano, Kelsey A; Mukherjee, Nabanita; Casella, George; Roesch, Luiz FW; Walts, Brandon; Riva, Alberto; King, Gary; Triplett, Eric W

2010-01-01

High-throughput DNA sequencing can identify organisms and describe population structures in many environmental and clinical samples. Current technologies generate millions of reads in a single run, requiring extensive computational strategies to organize, analyze and interpret those sequences. A series of bioinformatics tools for high-throughput sequencing analysis, including preprocessing, clustering, database matching and classification, have been compiled into a pipeline called PANGEA. The PANGEA pipeline was written in Perl and can be run on Mac OSX, Windows or Linux. With PANGEA, sequences obtained directly from the sequencer can be processed quickly to provide the files needed for sequence identification by BLAST and for comparison of microbial communities. Two different sets of bacterial 16S rRNA sequences were used to show the efficiency of this workflow. The first set of 16S rRNA sequences is derived from various soils from Hawaii Volcanoes National Park. The second set is derived from stool samples collected from diabetes-resistant and diabetes-prone rats. The workflow described here allows the investigator to quickly assess libraries of sequences on personal computers with customized databases. PANGEA is provided for users as individual scripts for each step in the process or as a single script where all processes, except the χ2 step, are joined into one program called the ‘backbone’. PMID:20182525

PANGEA: pipeline for analysis of next generation amplicons.

PubMed

Giongo, Adriana; Crabb, David B; Davis-Richardson, Austin G; Chauliac, Diane; Mobberley, Jennifer M; Gano, Kelsey A; Mukherjee, Nabanita; Casella, George; Roesch, Luiz F W; Walts, Brandon; Riva, Alberto; King, Gary; Triplett, Eric W

2010-07-01

High-throughput DNA sequencing can identify organisms and describe population structures in many environmental and clinical samples. Current technologies generate millions of reads in a single run, requiring extensive computational strategies to organize, analyze and interpret those sequences. A series of bioinformatics tools for high-throughput sequencing analysis, including pre-processing, clustering, database matching and classification, have been compiled into a pipeline called PANGEA. The PANGEA pipeline was written in Perl and can be run on Mac OSX, Windows or Linux. With PANGEA, sequences obtained directly from the sequencer can be processed quickly to provide the files needed for sequence identification by BLAST and for comparison of microbial communities. Two different sets of bacterial 16S rRNA sequences were used to show the efficiency of this workflow. The first set of 16S rRNA sequences is derived from various soils from Hawaii Volcanoes National Park. The second set is derived from stool samples collected from diabetes-resistant and diabetes-prone rats. The workflow described here allows the investigator to quickly assess libraries of sequences on personal computers with customized databases. PANGEA is provided for users as individual scripts for each step in the process or as a single script where all processes, except the chi(2) step, are joined into one program called the 'backbone'.

Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

PubMed

Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

2015-03-11

A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Oxygenation of the Root Zone and TCE Remediation: A Plant Model of Rhizosphere Dynamics

DTIC Science & Technology

2008-03-01

Behavior Test .......................................................................................... 128 IV. Results and Analysis ...Circadian Rhythms and Diurnal Cycles. Just as humans have a rhythmic response to the environment, plants also have a periodic cycle governed by light...characteristics, fatty acid carbon lengths, G + C values, and 16S rRNA sequences. 16S RNA sequence analysis has identified eight genera of methanotrophs

Hot topic: 16S rRNA gene sequencing reveals the microbiome of the virgin and pregnant bovine uterus.

PubMed

Moore, S G; Ericsson, A C; Poock, S E; Melendez, P; Lucy, M C

2017-06-01

We tested the hypothesis that the uterus of virgin heifers and pregnant cows possessed a resident microbiome by 16S rRNA gene sequencing of the virgin and pregnant bovine uterus. The endometrium of 10 virgin heifers in estrus and the amniotic fluid, placentome, intercotyledonary placenta, cervical lumen, and external cervix surface (control) of 5 pregnant cows were sampled using aseptic techniques. The DNA was extracted, the V4 hypervariable region of the 16S rRNA gene was amplified, and amplicons were sequenced using Illumina MiSeq technology (Illumina Inc., San Diego, CA). Operational taxonomic units (OTU) were generated from the sequences using Qiime v1.8 software, and taxonomy was assigned using the Greengenes database. The effect of tissue on the microbial composition within the pregnant uterus was tested using univariate (mixed model) and multivariate (permutational multivariate ANOVA) procedures. Amplicons of 16S rRNA gene were generated in all samples, supporting the contention that the uterus of virgin heifers and pregnant cows contained a microbiome. On average, 53, 199, 380, 382, 525, and 13,589 reads annotated as 16, 35, 43, 63, 48, and 176 OTU in the placentome, virgin endometrium, amniotic fluid, cervical lumen, intercotyledonary placenta, and external surface of the cervix, respectively, were generated. The 3 most abundant phyla in the uterus of the virgin heifers and pregnant cows were Firmicutes, Bacteroidetes, and Proteobacteria, and they accounted for approximately 40, 35, and 10% of the sequences, respectively. Phyla abundance was similar between the tissues of the pregnant uterus. Principal component analysis, one-way PERMANOVA analysis of the Bray-Curtis similarity index, and mixed model analysis of the Shannon diversity index and Chao1 index demonstrated that the microbiome of the control tissue (external surface of the cervix) was significantly different from that of the amniotic fluid, intercotyledonary placenta, and placentome tissues. Interestingly, many bacterial species associated with postpartum uterine disease (i.e., Trueperella spp., Acinetobacter spp., Fusobacteria spp., Proteus spp., Prevotella spp., and Peptostreptococcus spp.) were also present in the uterus of virgin heifers and of pregnant cows. The presence of 16S rRNA gene sequence reads in the samples from the current study suggests that the uterine microbiome is established by the time a female reaches reproductive maturity, and that pregnancies are established and maintained in the presence of a uterine microbiome. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment

PubMed Central

2013-01-01

Background Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. Results In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Conclusion Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA. PMID:24564200

Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.

PubMed

Nagar, Anurag; Hahsler, Michael

2013-01-01

Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.

Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

PubMed

Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

2013-10-01

According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water

PubMed Central

Staley, C.; Sadowsky, M. J.; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.

2015-01-01

In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. PMID:26231650

Streptococcus oricebi sp. nov., isolated from the oral cavity of tufted capuchin.

PubMed

Saito, M; Shinozaki-Kuwahara, N; Hirasawa, M; Takada, K

2016-02-01

A Gram-stain-positive, catalase-negative, coccus-shaped organism was isolated from the oral cavity of tufted capuchin (Cebus apella). Comparative 16S rRNA gene sequence analysis suggested classification of the organism within the genus Streptococcus. Strain M8T was related most closely to Streptococcus oralis ATCC 35037T (96.17 % similarity) followed by Streptococcus massiliensis CCUG 49690T (95.90 %) based on the 16S rRNA gene. Strain M8T was related most closely to S. massiliensis CCUG 49690T (86.58 %) based on the RNA polymerase β subunit-encoding gene (rpoB), and to Streptococcus tigurinus AZ_3aT (81.26 %) followed by S. massiliensis CCUG 49690T (80.45 %) based on the 60 kDa heat-shock protein gene (groEL). The phylogenetic trees of 16S rRNA, rpoB and groEL gene sequences showed that strain M8T was most closely related to S. massiliensis. Based on phenotypic characterization as well as 16S rRNA gene and housekeeping gene (rpoB and groEL) sequence data, a novel taxon, Streptococcus oricebi sp. nov. (type strain M8T = JCM 30719T = DSM 100101T), is proposed.

Towards the ecology of hyperthermophiles: biotopes, new isolation strategies and novel metabolic properties.

PubMed

Huber, R; Huber, H; Stetter, K O

2000-12-01

Ecological studies have shown that water-containing terrestrial, subterranean and submarine high-temperature environments harbor a great diversity of hyperthermophilic prokaryotes, growing fastest at temperatures of 80 degrees C or above. The investigations included cultivation, isolation and detailed analysis of these hyperthermophiles as well as in situ 16S rRNA gene sequence analysis and in situ hybridization studies. For a safe and fast isolation of novel hyperthermophiles from mixed cultures, a new, plating-independent isolation technique was developed, based on the use of a laser microscope ('optical tweezers'). This method, combined with 16S rRNA gene sequence analysis and whole-cell hybridization using fluorescently labelled oligonucleotide probes, even allows the recovery of pure cultures of phylogenetically predicted organisms harboring novel 16S rRNA gene sequences. In their natural habitats, hyperthermophiles form complex food webs, consisting of primary producers and consumers of organic material. Their metabolic potential includes various types of aerobic and anaerobic respiration and different modes of fermentation. In hydrothermal and geothermal environments, hyperthermophiles have important ecological functions in biogeochemical processes. Members of the Sulfolobales are able to mobilize heavy metals from sulfidic ores like pyrite or chalcopyrite. Biomineralization processes of hyperthermophiles include the formation of magnetite from iron or the precipitation of arsenate as realgar, a reaction performed by a novel hyperthermophile that was isolated from Pisciarelli Solfatara, Naples, Italy.

Differentiation of Trichophyton rubrum clinical isolates from Japanese and Chinese patients by randomly amplified polymorphic DNA and DNA sequence analysis of the non-transcribed spacer region of the rRNA gene.

PubMed

Yang, Xiumin; Sugita, Takashi; Takashima, Masako; Hiruma, Masataro; Li, Ruoyu; Sudo, Hajime; Ogawa, Hideoki; Ikeda, Shigaku

2009-04-01

Trichophyton rubrum is the most common pathogen causing dermatophytosis worldwide. Recent genetic investigations showed that the microorganism originated in Africa and then spread to Europe and North America via Asia. We investigated the intraspecific diversity of T. rubrum isolated from two closely located Asian countries, Japan and China. A total of 150 clinical isolates of T. rubrum obtained from Japanese and Chinese patients were analyzed by randomly amplified polymorphic DNA (RAPD) and DNA sequence analysis of the non-transcribed spacer (NTS) region in the rRNA gene. RAPD analysis divided the 150 strains into two major clusters, A and B. Of the Japanese isolates, 30% belonged to cluster A and 70% belonged to cluster B, whereas 91% of the Chinese isolates were in cluster A. The NTS region of the rRNA gene was divided into four major groups (I-IV) based on DNA sequencing. The majority of Japanese isolates were type IV (51%), and the majority of Chinese isolates were type III (75%). These results suggest that although Japan and China are neighboring countries, the origins of T. rubrum isolates from these countries may not be identical. These findings provide information useful for tracing the global transmission routes of T. rubrum.

The status of the species Enterobacter siamensisKhunthongpan et al. 2014. Request for an Opinion.

PubMed

Kämpfer, Peter; Doijad, Swapnil; Chakraborty, Trinad; Glaeser, Stefanie P

2016-01-01

In the course of a taxonomic study describing novel species of the genus Enterobacter it was found that the 16S rRNA gene sequence of the type strain of Enterobacter siamensis, obtained both directly from the authors of the publication on Enterobacter siamensis and from the Korean Collection for Type Cultures (C2361T and KCTC 23282T, respectively), was not congruent with the 16S rRNA gene sequence deposited in the GenBank database under the accession number HQ888848, which was applied for phylogenetic analysis in the species proposal. The remaining deposit in the Japanese type culture collection, NBRC 107138T, showed an identical 16S rRNA gene sequence to the other two cultures and overall, this sequence differed at 35 positions in comparison with the 1429 bp sequence published under the accession number HQ888848.Therefore, the type strain of this species cannot be included in any further scientific comparative study. It is proposed that the Judicial Commission of the International Committee on Systematics of Prokaryotes place the name Enterobacter siamensis on the list of rejected names, if a suitable replacement for the type strain is not found or a neotype strain is not proposed within two years following the publication of this Request for an Opinion.

Coxiella Detection in Ticks from Wildlife and Livestock in Malaysia

PubMed Central

Khoo, Jing-Jing; Lim, Fang-Shiang; Chen, Fezshin; Phoon, Wai-Hong; Khor, Chee-Sieng; Pike, Brian L.; Chang, Li-Yen

2016-01-01

Abstract Recent studies have shown that ticks harbor Coxiella-like bacteria, which are potentially tick-specific endosymbionts. We recently described the detection of Coxiella-like bacteria and possibly Coxiella burnetii in ticks found from rural areas in Malaysia. In the present study, we collected ticks, including Haemaphysalis bispinosa, Haemaphysalis hystricis, Dermacentor compactus, Dermacentor steini, and Amblyomma sp. from wildlife and domesticated goats from four different locations in Malaysia. Coxiella 16s rRNA genomic sequences were detected by PCR in 89% of ticks tested. Similarity analysis and phylogenetic analyses of the 16s rRNA and rpoB partial sequences were performed for 10 representative samples selected based on the tick species, sex, and location. The findings here suggested the presence of C. burnetii in two samples, each from D. steini and H. hystricis. The sequences of both samples clustered with published C. burnetii sequences. The remaining eight tick samples were shown to harbor 16s rRNA sequences of Coxiella-like bacteria, which clustered phylogenetically according to the respective tick host species. The findings presented here added to the growing evidence of the association between Coxiella-like bacteria and ticks across species and geographical boundaries. The importance of C. burnetii found in ticks in Malaysia warrants further investigation. PMID:27763821

Molecular characterization of sulfate-reducing bacteria in the Guaymas Basin

NASA Technical Reports Server (NTRS)

Dhillon, Ashita; Teske, Andreas; Dillon, Jesse; Stahl, David A.; Sogin, Mitchell L.

2003-01-01

The Guaymas Basin (Gulf of California) is a hydrothermal vent site where thermal alteration of deposited planktonic and terrestrial organic matter forms petroliferous material which supports diverse sulfate-reducing bacteria. We explored the phylogenetic and functional diversity of the sulfate-reducing bacteria by characterizing PCR-amplified dissimilatory sulfite reductase (dsrAB) and 16S rRNA genes from the upper 4 cm of the Guaymas sediment. The dsrAB sequences revealed that there was a major clade closely related to the acetate-oxidizing delta-proteobacterial genus Desulfobacter and a clade of novel, deeply branching dsr sequences related to environmental dsr sequences from marine sediments in Aarhus Bay and Kysing Fjord (Denmark). Other dsr clones were affiliated with gram-positive thermophilic sulfate reducers (genus Desulfotomaculum) and the delta-proteobacterial species Desulforhabdus amnigena and Thermodesulforhabdus norvegica. Phylogenetic analysis of 16S rRNAs from the same environmental samples resulted in identification of four clones affiliated with Desulfobacterium niacini, a member of the acetate-oxidizing, nutritionally versatile genus Desulfobacterium, and one clone related to Desulfobacula toluolica and Desulfotignum balticum. Other bacterial 16S rRNA bacterial phylotypes were represented by non-sulfate reducers and uncultured lineages with unknown physiology, like OP9, OP8, as well as a group with no clear affiliation. In summary, analyses of both 16S rRNA and dsrAB clone libraries resulted in identification of members of the Desulfobacteriales in the Guaymas sediments. In addition, the dsrAB sequencing approach revealed a novel group of sulfate-reducing prokaryotes that could not be identified by 16S rRNA sequencing.

Whole transcriptome analysis of the poultry red mite Dermanyssus gallinae (De Geer, 1778).

PubMed

Schicht, Sabine; Qi, Weihong; Poveda, Lucy; Strube, Christina

2014-03-01

SUMMARY Although the poultry red mite Dermanyssus gallinae (De Geer, 1778) is the major parasitic pest in poultry farming causing substantial economic losses every year, nucleotide data are rare in the public databases. Therefore, de novo sequencing covering the transcriptome of D. gallinae was carried out resulting in a dataset of 232 097 singletons and 42 130 contiguous sequences (contigs) which were subsequently clustered into 24 140 isogroups consisting of 35 788 isotigs. After removal of sequences possibly originating from bacteria or the chicken host, 267 464 sequences (231 657 singletons, 56 contigs and 35 751 isotigs) remained, of which 10·3% showed homology to proteins derived from other organisms. The most significant Blast top-hit species was the mite Metaseiulus occidentalis followed by the tick Ixodes scapularis. To gain functional knowledge of D. gallinae transcripts, sequences were mapped to Gene Ontology terms, Kyoto Encyclopedia of Gene and Genomes (KEGG) pathways and parsed to InterProScan. The transcriptome dataset provides new insights in general mite genetics and lays a foundation for future studies on stage-specific transcriptomics as well as genomic, proteomic, and metabolomic explorations and might provide new perspectives to control this parasitic mite by identifying possible drug targets or vaccine candidates. It is also worth noting that in different tested species of the class Arachnida no 28S rRNA was detectable in the rRNA profile, indicating that 28S rRNA might consists of two separate, hydrogen-bonded fragments, whose (heat-induced) disruption may led to co-migration with 18S rRNA.

Bradyrhizobium sacchari sp. nov., a legume nodulating bacterium isolated from sugarcane roots.

PubMed

de Matos, Gustavo Feitosa; Zilli, Jerri Edson; de Araújo, Jean Luiz Simões; Parma, Marcia Maria; Melo, Itamar Soares; Radl, Viviane; Baldani, José Ivo; Rouws, Luc Felicianus Marie

2017-11-01

Members of the genus Bradyrhizobium are well-known as nitrogen-fixing microsymbionts of a wide variety of leguminous species, but they have also been found in different environments, notably as endophytes in non-legumes such as sugarcane. This study presents a detailed polyphasic characterization of four Bradyrhizobium strains (type strain BR 10280 T ), previously isolated from roots of sugarcane in Brazil. 16S rRNA sequence analysis, multilocus sequence analysis (MLSA) and analysis of the 16S-23S rRNA internal transcribed spacer showed that these strains form a novel clade close to, but different from B. huanghuaihaiense strain CCBAU 23303 T . Average nucleotide identity (ANI) analyses confirmed that BR 10280 T represents a novel species. Phylogenetic analysis based on nodC gene sequences also placed the strains close to CCBAU 23303 T , but different from this latter strain, the sugarcane strains did not nodulate soybean, although they effectively nodulated Vigna unguiculata, Cajanus cajan and Macroptilium atropurpureum. Physiological traits are in agreement with the placement of the strains in the genus Bradyrhizobium as a novel species for which the name Bradyrhizobium sacchari sp. nov. is proposed.

Prevotella timonensis sp. nov., isolated from a human breast abscess.

PubMed

Glazunova, Olga O; Launay, Thierry; Raoult, Didier; Roux, Véronique

2007-04-01

Gram-negative anaerobic rods were isolated from a human breast abscess. Based on genotypic and phenotypic characteristics, the novel strain belonged to the genus Prevotella. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that it was closely related to Prevotella buccalis (94 % 16S rRNA gene sequence similarity), Prevotella salivae (90 %) and Prevotella oris (89.1 %). The major cellular fatty acid was C(14 : 0) (19.5 %). The new isolate represents a novel species in the genus Prevotella, for which the name Prevotella timonensis sp. nov. is proposed. The type strain is strain 4401737(T) (=CIP 108522(T)=CCUG 50105(T)).

[Methods, challenges and opportunities for big data analyses of microbiome].

PubMed

Sheng, Hua-Fang; Zhou, Hong-Wei

2015-07-01

Microbiome is a novel research field related with a variety of chronic inflamatory diseases. Technically, there are two major approaches to analysis of microbiome: metataxonome by sequencing the 16S rRNA variable tags, and metagenome by shot-gun sequencing of the total microbial (mainly bacterial) genome mixture. The 16S rRNA sequencing analyses pipeline includes sequence quality control, diversity analyses, taxonomy and statistics; metagenome analyses further includes gene annotation and functional analyses. With the development of the sequencing techniques, the cost of sequencing will decrease, and big data analyses will become the central task. Data standardization, accumulation, modeling and disease prediction are crucial for future exploit of these data. Meanwhile, the information property in these data, and the functional verification with culture-dependent and culture-independent experiments remain the focus in future research. Studies of human microbiome will bring a better understanding of the relations between the human body and the microbiome, especially in the context of disease diagnosis and therapy, which promise rich research opportunities.

Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons

PubMed Central

Fischer, Sandra; Kumar, Neeraj

2017-01-01

The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea. PMID:28097056

Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.

PubMed

Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas

2017-01-01

The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

[Molecular characterization of pathogenic bacteria of the respiratory tract in peruvian patients with cystic fibrosis].

PubMed

Aquino, Ruth; Gonzáles, Emely; Samaniego, Sol; Rivera, Juan; Cedeño, Virna; Urbina, Yrene; Diringer, Benoit

2017-01-01

To molecularly characterize the pathogenic bacteria of the respiratory tract isolated from patients with cystic fibrosis (CF) in Peru. Bacterial communities cultured from sputum samples of pediatric and adult patients with CF admitted to the Edgardo Rebagliati Martins National Hospital and the National Institute of Child Health were characterized. Standard microbiological techniques were used for bacterial culture, and gene sequencing of 16S rRNA and matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry and tandem MALDI-TOF mass spectrometry (MALDI TOF/TOF) were used for molecular characterization. Seventeen bacterial strains were characterized by 16S rRNA sequencing, and the identified pathogenic bacteria were Pseudomonas aeruginosa (31.5%), Staphylococcus aureus (12.6%), Pseudomonas spp. (11.8%), and Klebsiella oxytoca (3.1%). MALDI-TOF analysis generated a series of spectra representative of each isolated bacterial species, whereas MALDI TOF/TOF analysis identified the peptides and proteins of the most common strains and provided data on pathogenicity and sensitivity to antibiotics. The primary pathogenic microorganisms found in the respiratory tract of patients with CF in Peru were the same as those found in other countries. This study is the first to perform 16S rRNA sequencing as well as MALDI-TOF and MALDI-TOF/TOF analysis of the bacterial pathogens circulating in Peru. The inclusion of proteomic analysis further allowed for the identification of native microorganisms involved in CF.

The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

NASA Technical Reports Server (NTRS)

Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

1989-01-01

Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

PubMed

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

Isolation and genetic characterization of Aurantimonas and Methylobacterium strains from stems of hypernodulated soybeans.

PubMed

Anda, Mizue; Ikeda, Seishi; Eda, Shima; Okubo, Takashi; Sato, Shusei; Tabata, Satoshi; Mitsui, Hisayuki; Minamisawa, Kiwamu

2011-01-01

The aims of this study were to isolate Aurantimonas and Methylobacterium strains that responded to soybean nodulation phenotypes and nitrogen fertilization rates in a previous culture-independent analysis (Ikeda et al. ISME J. 4:315-326, 2010). Two strategies were adopted for isolation from enriched bacterial cells prepared from stems of field-grown, hypernodulated soybeans: PCR-assisted isolation for Aurantimonas and selective cultivation for Methylobacterium. Thirteen of 768 isolates cultivated on Nutrient Agar medium were identified as Aurantimonas by colony PCR specific for Aurantimonas and 16S rRNA gene sequencing. Meanwhile, among 187 isolates on methanol-containing agar media, 126 were identified by 16S rRNA gene sequences as Methylobacterium. A clustering analysis (>99% identity) of the 16S rRNA gene sequences for the combined datasets of the present and previous studies revealed 4 and 8 operational taxonomic units (OTUs) for Aurantimonas and Methylobacterium, respectively, and showed the successful isolation of target bacteria for these two groups. ERIC- and BOX-PCR showed the genomic uniformity of the target isolates. In addition, phylogenetic analyses of Aurantimonas revealed a phyllosphere-specific cluster in the genus. The isolates obtained in the present study will be useful for revealing unknown legume-microbe interactions in relation to the autoregulation of nodulation.

Phylogenetic Diversity of Bacteria Associated with the Marine Sponge Rhopaloeides odorabile†

PubMed Central

Webster, Nicole S.; Wilson, Kate J.; Blackall, Linda L.; Hill, Russell T.

2001-01-01

Molecular techniques were employed to document the microbial diversity associated with the marine sponge Rhopaloeides odorabile. The phylogenetic affiliation of sponge-associated bacteria was assessed by 16S rRNA sequencing of cloned DNA fragments. Fluorescence in situ hybridization (FISH) was used to confirm the presence of the predominant groups indicated by 16S rDNA analysis. The community structure was extremely diverse with representatives of the Actinobacteria, low-G+C gram-positive bacteria, the β- and γ-subdivisions of the Proteobacteria, Cytophaga/Flavobacterium, green sulfur bacteria, green nonsulfur bacteria, planctomycetes, and other sequence types with no known close relatives. FISH probes revealed the spatial location of these bacteria within the sponge tissue, in some cases suggesting possible symbiotic functions. The high proportion of 16S rRNA sequences derived from novel actinomycetes is good evidence for the presence of an indigenous marine actinomycete assemblage in R. odorabile. High microbial diversity was inferred from low duplication of clones in a library with 70 representatives. Determining the phylogenetic affiliation of sponge-associated microorganisms by 16S rRNA analysis facilitated the rational selection of culture media and isolation conditions to target specific groups of well-represented bacteria for laboratory culture. Novel media incorporating sponge extracts were used to isolate bacteria not previously recovered from this sponge. PMID:11133476

CloVR-ITS: Automated internal transcribed spacer amplicon sequence analysis pipeline for the characterization of fungal microbiota

PubMed Central

2013-01-01

Background Besides the development of comprehensive tools for high-throughput 16S ribosomal RNA amplicon sequence analysis, there exists a growing need for protocols emphasizing alternative phylogenetic markers such as those representing eukaryotic organisms. Results Here we introduce CloVR-ITS, an automated pipeline for comparative analysis of internal transcribed spacer (ITS) pyrosequences amplified from metagenomic DNA isolates and representing fungal species. This pipeline performs a variety of steps similar to those commonly used for 16S rRNA amplicon sequence analysis, including preprocessing for quality, chimera detection, clustering of sequences into operational taxonomic units (OTUs), taxonomic assignment (at class, order, family, genus, and species levels) and statistical analysis of sample groups of interest based on user-provided information. Using ITS amplicon pyrosequencing data from a previous human gastric fluid study, we demonstrate the utility of CloVR-ITS for fungal microbiota analysis and provide runtime and cost examples, including analysis of extremely large datasets on the cloud. We show that the largest fractions of reads from the stomach fluid samples were assigned to Dothideomycetes, Saccharomycetes, Agaricomycetes and Sordariomycetes but that all samples were dominated by sequences that could not be taxonomically classified. Representatives of the Candida genus were identified in all samples, most notably C. quercitrusa, while sequence reads assigned to the Aspergillus genus were only identified in a subset of samples. CloVR-ITS is made available as a pre-installed, automated, and portable software pipeline for cloud-friendly execution as part of the CloVR virtual machine package (http://clovr.org). Conclusion The CloVR-ITS pipeline provides fungal microbiota analysis that can be complementary to bacterial 16S rRNA and total metagenome sequence analysis allowing for more comprehensive studies of environmental and host-associated microbial communities. PMID:24451270

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana

PubMed Central

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe

2018-01-01

Abstract Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization. PMID:29518237

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

PubMed

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

PubMed

Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

2013-09-01

Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.

Morphology and molecular analysis of Paratylenchus nanjingensis n. sp. (Nematoda: Paratylenchinae) from the rhizosphere soil of Pinus massoniana in China.

PubMed

Wang, K; Xie, H; Li, Y; Wu, W J; Xu, C L

2016-03-01

Paratylenchus nanjingensis n. sp. was obtained from Nanjing, Jiangsu Province, China. This new species is characterized by having a female with a slender, vermiform body (243-279 μm), head with distinct submedian lobes, slender and long stylet (64-68 μm), anchor-shaped stylet knobs, excretory pore anterior to the level of the stylet knobs, small lateral vulval flaps and lateral field with four lines; and male with more distinct body annuli, stylet lacking and pharynx degenerate. The internal transcribed spacer sequences of ribosomal RNA (ITS rRNA) gene of the new species were amplified and sequenced in this study. The phylogenetic relationships of the new species with other Paratylenchus species using the ITS rRNA gene sequences are given.

Characterization and Screening of Native Scenedesmus sp. Isolates Suitable for Biofuel Feedstock.

PubMed

Gour, Rakesh Singh; Chawla, Aseem; Singh, Harvinder; Chauhan, Rajinder Singh; Kant, Anil

2016-01-01

In current study isolates of two native microalgae species were screened on the basis of growth kinetics and lipid accumulation potential. On the basis of data obtained on growth parameters and lipid accumulation, it is concluded that Scenedesmus dimorphus has better potential as biofuel feedstock. Two of the isolates of Scenedesmus dimorphus performed better than other isolates with respect to important growth parameters with lipid content of ~30% of dry biomass. Scenedesmus dimorphus was found to be more suitable as biodiesel feedstock candidate on the basis of cumulative occurrence of five important biodiesel fatty acids, relative occurrence of SFA (53.04%), MUFA (23.81%) and PUFA (19.69%), and more importantly that of oleic acid in its total lipids. The morphological observations using light and Scanning Electron Microscope and molecular characterization using amplified 18S rRNA gene sequences of microalgae species under study were also performed. Amplified 18S rRNA gene fragments of the microalgae species were sequenced, annotated at the NCBI website and phylogenetic analysis was done. We have published eight 18S rRNA gene sequences of microalgae species in NCBI GenBank.

Characterization of chlorinated and chloraminated drinking water microbial communities in a distribution system simulator using pyrosequencing data analysis

EPA Science Inventory

The molecular analysis of drinking water microbial communities has focused primarily on 16S rRNA gene sequence analysis. Since this approach provides limited information on function potential of microbial communities, analysis of whole-metagenome pyrosequencing data was used to...

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

PubMed Central

Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

2008-01-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing

PubMed Central

Nunoura, Takuro; Takaki, Yoshihiro; Kazama, Hiromi; Hirai, Miho; Ashi, Juichiro; Imachi, Hiroyuki; Takai, Ken

2012-01-01

Microbial community structures in methane seep sediments in the Nankai Trough were analyzed by tag-sequencing analysis for the small subunit (SSU) rRNA gene using a newly developed primer set. The dominant members of Archaea were Deep-sea Hydrothermal Vent Euryarchaeotic Group 6 (DHVEG 6), Marine Group I (MGI) and Deep Sea Archaeal Group (DSAG), and those in Bacteria were Alpha-, Gamma-, Delta- and Epsilonproteobacteria, Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. Diversity and richness were examined by 8,709 and 7,690 tag-sequences from sediments at 5 and 25 cm below the seafloor (cmbsf), respectively. The estimated diversity and richness in the methane seep sediment are as high as those in soil and deep-sea hydrothermal environments, although the tag-sequences obtained in this study were not sufficient to show whole microbial diversity in this analysis. We also compared the diversity and richness of each taxon/division between the sediments from the two depths, and found that the diversity and richness of some taxa/divisions varied significantly along with the depth. PMID:22510646

Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

PubMed

Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

2005-12-01

Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

Molecular Phylogenetic Analysis of Archaeal Intron-Containing Genes Coding for rRNA Obtained from a Deep-Subsurface Geothermal Water Pool

PubMed Central

Takai, Ken; Horikoshi, Koki

1999-01-01

Molecular phylogenetic analysis of a naturally occurring microbial community in a deep-subsurface geothermal environment indicated that the phylogenetic diversity of the microbial population in the environment was extremely limited and that only hyperthermophilic archaeal members closely related to Pyrobaculum were present. All archaeal ribosomal DNA sequences contained intron-like sequences, some of which had open reading frames with repeated homing-endonuclease motifs. The sequence similarity analysis and the phylogenetic analysis of these homing endonucleases suggested the possible phylogenetic relationship among archaeal rRNA-encoded homing endonucleases. PMID:10584021

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774

First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

PubMed Central

Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

2016-01-01

Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group

NASA Astrophysics Data System (ADS)

Lloyd, K. G.; Biddle, J.; Teske, A.

2011-12-01

Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.

Archaeal phylogeny: reexamination of the phylogenetic position of Archaeoglobus fulgidus in light of certain composition-induced artifacts

NASA Technical Reports Server (NTRS)

Woese, C. R.; Achenbach, L.; Rouviere, P.; Mandelco, L.

1991-01-01

A major and too little recognized source of artifact in phylogenetic analysis of molecular sequence data is compositional difference among sequences. The problem becomes particularly acute when alignments contain ribosomal RNAs from both mesophilic and thermophilic species. Among prokaryotes the latter are considerably higher in G + C content than the former, which often results in artificial clustering of thermophilic lineages and their being placed artificially deep in phylogenetic trees. In this communication we review archaeal phylogeny in the light of this consideration, focusing in particular on the phylogenetic position of the sulfate reducing species Archaeoglobus fulgidus, using both 16S rRNA and 23S rRNA sequences. The analysis shows clearly that the previously reported deep branching of the A. fulgidus lineage (very near the base of the euryarchaeal side of the archaeal tree) is incorrect, and that the lineage actually groups with a previously recognized unit that comprises the Methanomicrobiales and extreme halophiles.

Kondoa gutianensis f.a. sp. nov., a novel ballistoconidium-forming yeast species isolated from plant leaves.

PubMed

Liu, Xin-Zhan; Groenewald, Marizeth; Boekhout, Teun; Bai, Feng-Yan

2018-01-01

Two strains, GT-165 T and GT-261, isolated from plant leaves collected from Gutian Mountain in Zhejiang province in China were identified as a novel species of the genus Kondoa by the sequence analysis of the internal transcribed spacer (ITS) region, the D1/D2 domains of the large subunit of rRNA (LSU rRNA) and the RNA polymerase II second largest subunit (RPB2), complemented by physiological tests. Phylogenetic analysis based on the concatenated sequences of ITS, D1/D2 and RPB2 showed that the closest known relatives of the new species are three undescribed Kondoa species and Kondoa thailandica. The ITS and D1/D2 sequences of the new species differ from the closely related species by 11-22% and 2-9%, respectively. The name Kondoa gutianensis f.a. sp. nov. (MB 820648, holotype = CGMCC 2.5703 T ; isotype: CBS 14811 T = CGMCC 2.5703 T ) is proposed to accommodate the new taxon.

Detection and molecular status of Isospora sp. from the domestic pigeon (Columba livia domestica).

PubMed

Matsubara, Ryuma; Fukuda, Yasuhiro; Murakoshi, Fumi; Nomura, Osamu; Suzuki, Toru; Tada, Chika; Nakai, Yutaka

2017-10-01

The domestic pigeon, Columba livia domestica, is reared for meat production, as a pet, or for racing. Few reports have characterized the parasitic protists from the genus Isospora isolated from Columbiformes. We detected Isospora-like oocysts from C. livia reared for racing. The oocyst contained two sporocysts, and each sporocyst included four sporozoites. The sporulated oocysts (n=4) were spherical; their mean diameters were 25.6 (24.0-27.2)×24.7 (23.4-26.0) μm. Micropyles, polar granules, and oocyst residuum were absent. The mean length and width of the sporocysts (n=8) were 19.5 (18.5-20.5) and 11.2 (10.2-12.1) μm, respectively. Stieda and sub-Stieda bodies were observed. Single-oocyst PCR revealed two different 18S rRNA gene sequences and one 28S rRNA gene sequence in a single oocyst of Isospora sp. Based on a phylogenetic analysis of the 18S rRNA gene, the two sequences made a group which fell within a cluster of known avian Isospora species. A tree based on the 28S rRNA gene sequence indicated that sequences from the pigeon Isospora sp. fell within a cluster of avian Isospora species. Both trees failed to clarify the phylogenetic relationships among the avian Isospora species due to limited resolution. Because the morphological description of Isospora sp. is based on only four oocysts, Isospora sp. is not proposed as a novel species here. This is the first description of Isospora sp. isolated from the domestic pigeon C. livia. Copyright © 2017 Elsevier B.V. All rights reserved.

Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

PubMed Central

Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

2001-01-01

The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

Prevalence and genetic characterization of eimeriid coccidia from feces of black-necked cranes, Grus nigricollis.

PubMed

Liang, Yu; Zhao, ZiJiao; Hu, JunJie; Esch, Gerald W; Peng, MingChun; Liu, Qiong; Chen, JinQing

2018-03-01

Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7-99.7% identity), E. reichenowi (97.9-100% identity), or E. gruis (98.6-99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Isolation and distribution of a novel iron-oxidizing crenarchaeon from acidic geothermal springs in Yellowstone National Park.

PubMed

Kozubal, M; Macur, R E; Korf, S; Taylor, W P; Ackerman, G G; Nagy, A; Inskeep, W P

2008-02-01

Novel thermophilic crenarchaea have been observed in Fe(III) oxide microbial mats of Yellowstone National Park (YNP); however, no definitive work has identified specific microorganisms responsible for the oxidation of Fe(II). The objectives of the current study were to isolate and characterize an Fe(II)-oxidizing member of the Sulfolobales observed in previous 16S rRNA gene surveys and to determine the abundance and distribution of close relatives of this organism in acidic geothermal springs containing high concentrations of dissolved Fe(II). Here we report the isolation and characterization of the novel, Fe(II)-oxidizing, thermophilic, acidophilic organism Metallosphaera sp. strain MK1 obtained from a well-characterized acid-sulfate-chloride geothermal spring in Norris Geyser Basin, YNP. Full-length 16S rRNA gene sequence analysis revealed that strain MK1 exhibits only 94.9 to 96.1% sequence similarity to other known Metallosphaera spp. and less than 89.1% similarity to known Sulfolobus spp. Strain MK1 is a facultative chemolithoautotroph with an optimum pH range of 2.0 to 3.0 and an optimum temperature range of 65 to 75 degrees C. Strain MK1 grows optimally on pyrite or Fe(II) sorbed onto ferrihydrite, exhibiting doubling times between 10 and 11 h under aerobic conditions (65 degrees C). The distribution and relative abundance of MK1-like 16S rRNA gene sequences in 14 acidic geothermal springs containing Fe(III) oxide microbial mats were evaluated. Highly related MK1-like 16S rRNA gene sequences (>99% sequence similarity) were consistently observed in Fe(III) oxide mats at temperatures ranging from 55 to 80 degrees C. Quantitative PCR using Metallosphaera-specific primers confirmed that organisms highly similar to strain MK1 comprised up to 40% of the total archaeal community at selected sites. The broad distribution of highly related MK1-like 16S rRNA gene sequences in acidic Fe(III) oxide microbial mats is consistent with the observed characteristics and growth optima of Metallosphaera-like strain MK1 and emphasizes the importance of this newly described taxon in Fe(II) chemolithotrophy in acidic high-temperature environments of YNP.

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Influence of Molecular Resolution on Sequence-Based Discovery of Ecological Diversity among Synechococcus Populations in an Alkaline Siliceous Hot Spring Microbial Mat ▿ †

PubMed Central

Melendrez, Melanie C.; Lange, Rachel K.; Cohan, Frederick M.; Ward, David M.

2011-01-01

Previous research has shown that sequences of 16S rRNA genes and 16S-23S rRNA internal transcribed spacer regions may not have enough genetic resolution to define all ecologically distinct Synechococcus populations (ecotypes) inhabiting alkaline, siliceous hot spring microbial mats. To achieve higher molecular resolution, we studied sequence variation in three protein-encoding loci sampled by PCR from 60°C and 65°C sites in the Mushroom Spring mat (Yellowstone National Park, WY). Sequences were analyzed using the ecotype simulation (ES) and AdaptML algorithms to identify putative ecotypes. Between 4 and 14 times more putative ecotypes were predicted from variation in protein-encoding locus sequences than from variation in 16S rRNA and 16S-23S rRNA internal transcribed spacer sequences. The number of putative ecotypes predicted depended on the number of sequences sampled and the molecular resolution of the locus. Chao estimates of diversity indicated that few rare ecotypes were missed. Many ecotypes hypothesized by sequence analyses were different in their habitat specificities, suggesting different adaptations to temperature or other parameters that vary along the flow channel. PMID:21169433

Microbial composition analyses by 16S rRNA sequencing: A proof of concept approach to provenance determination of archaeological ochre.

PubMed

Lenehan, Claire E; Tobe, Shanan S; Smith, Renee J; Popelka-Filcoff, Rachel S

2017-01-01

Many archaeological science studies use the concept of "provenance", where the origins of cultural material can be determined through physical or chemical properties that relate back to the origins of the material. Recent studies using DNA profiling of bacteria have been used for the forensic determination of soils, towards determination of geographic origin. This manuscript presents a novel approach to the provenance of archaeological minerals and related materials through the use of 16S rRNA sequencing analysis of microbial DNA. Through the microbial DNA characterization from ochre and multivariate statistics, we have demonstrated the clear discrimination between four distinct Australian cultural ochre sites.

Accurate and Practical Identification of 20 Fusarium Species by Seven-Locus Sequence Analysis and Reverse Line Blot Hybridization, and an In Vitro Antifungal Susceptibility Study▿†

PubMed Central

Wang, He; Xiao, Meng; Kong, Fanrong; Chen, Sharon; Dou, Hong-Tao; Sorrell, Tania; Li, Ruo-Yu; Xu, Ying-Chun

2011-01-01

Eleven reference and 25 clinical isolates of Fusarium were subject to multilocus DNA sequence analysis to determine the species and haplotypes of the fusarial isolates from Beijing and Shandong, China. Seven loci were analyzed: the translation elongation factor 1 alpha gene (EF-1α); the nuclear rRNA internal transcribed spacer (ITS), large subunit (LSU), and intergenic spacer (IGS) regions; the second largest subunit of the RNA polymerase gene (RPB2); the calmodulin gene (CAM); and the mitochondrial small subunit (mtSSU) rRNA gene. We also evaluated an IGS-targeted PCR/reverse line blot (RLB) assay for species/haplotype identification of Fusarium. Twenty Fusarium species and seven species complexes were identified. Of 25 clinical isolates (10 species), the Gibberella (Fusarium) fujikuroi species complex was the commonest (40%) and was followed by the Fusarium solani species complex (FSSC) (36%) and the F. incarnatum-F. equiseti species complex (12%). Six FSSC isolates were identified to the species level as FSSC-3+4, and three as FSSC-5. Twenty-nine IGS, 27 EF-1α, 26 RPB2, 24 CAM, 18 ITS, 19 LSU, and 18 mtSSU haplotypes were identified; 29 were unique, and haplotypes for 24 clinical strains were novel. By parsimony informative character analysis, the IGS locus was the most phylogenetically informative, and the rRNA gene regions were the least. Results by RLB were concordant with multilocus sequence analysis for all isolates. Amphotericin B was the most active drug against all species. Voriconazole MICs were high (>8 μg/ml) for 15 (42%) isolates, including FSSC. Analysis of larger numbers of isolates is required to determine the clinical utility of the seven-locus sequence analysis and RLB assay in species classification of fusaria. PMID:21389150

A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.

PubMed

Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda

2015-02-01

The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

PubMed

Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

2017-02-01

To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

A guide to enterotypes across the human body: meta-analysis of microbial community structures in human microbiome datasets.

PubMed

Koren, Omry; Knights, Dan; Gonzalez, Antonio; Waldron, Levi; Segata, Nicola; Knight, Rob; Huttenhower, Curtis; Ley, Ruth E

2013-01-01

Recent analyses of human-associated bacterial diversity have categorized individuals into 'enterotypes' or clusters based on the abundances of key bacterial genera in the gut microbiota. There is a lack of consensus, however, on the analytical basis for enterotypes and on the interpretation of these results. We tested how the following factors influenced the detection of enterotypes: clustering methodology, distance metrics, OTU-picking approaches, sequencing depth, data type (whole genome shotgun (WGS) vs.16S rRNA gene sequence data), and 16S rRNA region. We included 16S rRNA gene sequences from the Human Microbiome Project (HMP) and from 16 additional studies and WGS sequences from the HMP and MetaHIT. In most body sites, we observed smooth abundance gradients of key genera without discrete clustering of samples. Some body habitats displayed bimodal (e.g., gut) or multimodal (e.g., vagina) distributions of sample abundances, but not all clustering methods and workflows accurately highlight such clusters. Because identifying enterotypes in datasets depends not only on the structure of the data but is also sensitive to the methods applied to identifying clustering strength, we recommend that multiple approaches be used and compared when testing for enterotypes.

A Guide to Enterotypes across the Human Body: Meta-Analysis of Microbial Community Structures in Human Microbiome Datasets

PubMed Central

Waldron, Levi; Segata, Nicola; Knight, Rob; Huttenhower, Curtis; Ley, Ruth E.

2013-01-01

Recent analyses of human-associated bacterial diversity have categorized individuals into ‘enterotypes’ or clusters based on the abundances of key bacterial genera in the gut microbiota. There is a lack of consensus, however, on the analytical basis for enterotypes and on the interpretation of these results. We tested how the following factors influenced the detection of enterotypes: clustering methodology, distance metrics, OTU-picking approaches, sequencing depth, data type (whole genome shotgun (WGS) vs.16S rRNA gene sequence data), and 16S rRNA region. We included 16S rRNA gene sequences from the Human Microbiome Project (HMP) and from 16 additional studies and WGS sequences from the HMP and MetaHIT. In most body sites, we observed smooth abundance gradients of key genera without discrete clustering of samples. Some body habitats displayed bimodal (e.g., gut) or multimodal (e.g., vagina) distributions of sample abundances, but not all clustering methods and workflows accurately highlight such clusters. Because identifying enterotypes in datasets depends not only on the structure of the data but is also sensitive to the methods applied to identifying clustering strength, we recommend that multiple approaches be used and compared when testing for enterotypes. PMID:23326225

Creation of a data base for sequences of ribosomal nucleic acids and detection of conserved restriction endonucleases sites through computerized processing.

PubMed Central

Patarca, R; Dorta, B; Ramirez, J L

1982-01-01

As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402

Novel application of the MSSCP method in biodiversity studies.

PubMed

Tomczyk-Żak, Karolina; Kaczanowski, Szymon; Górecka, Magdalena; Zielenkiewicz, Urszula

2012-02-01

Analysis of 16S rRNA sequence diversity is widely performed for characterizing the biodiversity of microbial samples. The number of determined sequences has a considerable impact on complete results. Although the cost of mass sequencing is decreasing, it is often still too high for individual projects. We applied the multi-temperature single-strand conformational polymorphism (MSSCP) method to decrease the number of analysed sequences. This was a novel application of this method. As a control, the same sample was analysed using random sequencing. In this paper, we adapted the MSSCP technique for screening of unique sequences of the 16S rRNA gene library and bacterial strains isolated from biofilms growing on the walls of an ancient gold mine in Poland and determined whether the results obtained by both methods differed and whether random sequencing could be replaced by MSSCP. Although it was biased towards the detection of rare sequences in the samples, the qualitative results of MSSCP were not different than those of random sequencing. Unambiguous discrimination of unique clones and strains creates an opportunity to effectively estimate the biodiversity of natural communities, especially in populations which are numerous but species poor. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

2014-03-17

The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

Bacterial population dynamics during the ensiling of Medicago sativa (alfalfa) and subsequent exposure to air.

PubMed

McGarvey, J A; Franco, R B; Palumbo, J D; Hnasko, R; Stanker, L; Mitloehner, F M

2013-06-01

To describe, at high resolution, the bacterial population dynamics and chemical transformations during the ensiling of alfalfa and subsequent exposure to air. Samples of alfalfa, ensiled alfalfa and silage exposed to air were collected and their bacterial population structures compared using 16S rRNA gene libraries containing approximately 1900 sequences each. Cultural and chemical analyses were also performed to complement the 16S gene sequence data. Sequence analysis revealed significant differences (P < 0·05) in the bacterial populations at each time point. The alfalfa-derived library contained mostly sequences associated with the Gammaproteobacteria (including the genera: Enterobacter, Erwinia and Pantoea); the ensiled material contained mostly sequences associated with the lactic acid bacteria (LAB) (including the genera: Lactobacillus, Pediococcus and Lactococcus). Exposure to air resulted in even greater percentages of LAB, especially among the genus Lactobacillus, and a significant drop in bacterial diversity. In-depth 16S rRNA gene sequence analysis revealed significant bacterial population structure changes during ensiling and again during exposure to air. This in-depth description of the bacterial population dynamics that occurred during ensiling and simulated feed out expands our knowledge of these processes. © 2013 The Society for Applied Microbiology No claim to US Government works.

Rapid identification of acetic acid bacteria using MALDI-TOF mass spectrometry fingerprinting.

PubMed

Andrés-Barrao, Cristina; Benagli, Cinzia; Chappuis, Malou; Ortega Pérez, Ruben; Tonolla, Mauro; Barja, François

2013-03-01

Acetic acid bacteria (AAB) are widespread microorganisms characterized by their ability to transform alcohols and sugar-alcohols into their corresponding organic acids. The suitability of matrix-assisted laser desorption-time of flight mass spectrometry (MALDI-TOF MS) for the identification of cultured AAB involved in the industrial production of vinegar was evaluated on 64 reference strains from the genera Acetobacter, Gluconacetobacter and Gluconobacter. Analysis of MS spectra obtained from single colonies of these strains confirmed their basic classification based on comparative 16S rRNA gene sequence analysis. MALDI-TOF analyses of isolates from vinegar cross-checked by comparative sequence analysis of 16S rRNA gene fragments allowed AAB to be identified, and it was possible to differentiate them from mixed cultures and non-AAB. The results showed that MALDI-TOF MS analysis was a rapid and reliable method for the clustering and identification of AAB species. Copyright © 2012 Elsevier GmbH. All rights reserved.

Phylogeny of the family Moraxellaceae by 16S rDNA sequence analysis, with special emphasis on differentiation of Moraxella species.

PubMed

Pettersson, B; Kodjo, A; Ronaghi, M; Uhlén, M; Tønjum, T

1998-01-01

Thirty-three strains previously classified into 11 species in the bacterial family Moraxellaceae were subjected to phylogenetic analysis based on 16S rRNA sequences. The family Moraxellaceae formed a distinct clade consisting of four phylogenetic groups as judged from branch lengths, bootstrap values and signature nucleotides. Group I contained the classical moraxellae and strains of the coccal moraxellae, previously known as Branhamella, with 16S rRNA similarity of > or = 95%. A further division of group I into five tentative clusters is discussed. Group II consisted of two strains representing Moraxella atlantae and Moraxella osloensis. These strains were only distantly related to each other (93.4%) and also to the other members of the Moraxellaceae (< or = 93%). Therefore, reasons for reclassification of these species into separate and new genera are discussed. Group III harboured strains of the genus Psychrobacter and strain 752/52 of [Moraxella] phenylpyruvica. This strain of [M.] phenylpyruvica formed an early branch from the group III line of descent. Interestingly, a distant relationship was found between Psychrobacter phenylpyruvicus strain ATCC 23333T (formerly classified as [M.] phenylpyruvica) and [M.] phenylpyruvica strain 752/52, exhibiting less than 96% nucleotide similarity between their 16S rRNA sequences. The establishment of a new genus for [M.] phenylpyruvica strain 752/52 is therefore suggested. Group IV contained only two strains of the genus Acinetobacter. Strategies for the development of diagnostic probes and distinctive sequences for 16S rRNA-based species-specific assays within group I are suggested. Although these findings add to the classificatory placements within the Moraxellaceae, analysis of a more comprehensive selection of strains is still needed to obtain a complete classification system within this family.

Taxonomic evaluation of species in the Streptomyces hirsutus clade using multi-locus sequence analysis and proposals to reclassify several species in this clade

USDA-ARS?s Scientific Manuscript database

Previous phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species that exhibited very similar gross morphology in producing open looped (Retinaculum-Apertum) to spiral (Spira) chains...

Characterization of Microbial Communities Associated With Deep-Sea Hydrothermal Vent Animals of the East Pacific Rise and the Galápagos Rift

NASA Astrophysics Data System (ADS)

Ward, N.; Page, S.; Heidelberg, J.; Eisen, J. A.; Fraser, C. M.

2002-12-01

The composition of microbial communities associated with deep-sea hydrothermal vent animals is of interest because of the key role of bacterial symbionts in driving the chemosynthetic food chain of the vent system, and also because bacterial biofilms attached to animal exterior surfaces may play a part in settlement of larval forms. Sequence analysis of 16S ribosomal RNA (rRNA) genes from such communities provides a snapshot of community structure, as this gene is present in all Bacteria and Archaea, and a useful phylogenetic marker for both cultivated microbial species, and uncultivated species such as many of those found in the deep-sea environment. Specimens of giant tube worms (Riftia pachyptila), mussels (Bathymodiolus thermophilus), and clams (Calyptogena magnifica) were collected during the 2002 R/V Atlantis research cruises to the East Pacific Rise (9N) and Galápagos Rift. Microbial biofilms attached to the exterior surfaces of individual animals were sampled, as were tissues known to harbor chemosynthetic bacterial endosymbionts. Genomic DNA was extracted from the samples using a commercially available kit, and 16S rRNA genes amplified from the mixed bacterial communities using the polymerase chain reaction (PCR) and oligonucleotide primers targeting conserved terminal regions of the 16S rRNA gene. The PCR products obtained were cloned into a plasmid vector and the recombinant plasmids transformed into cells of Escherichia coli. Individual cloned 16S rRNA genes were sequenced at the 5' end of the gene (the most phylogenetically informative region in most taxa) and the sequence data compared to publicly available gene sequence databases, to allow a preliminary assignment of clones to taxonomic groups within the Bacteria and Archaea, and to determine the overall composition and phylogenetic diversity of the animal-associated microbial communities. Analysis of Riftia pachyptila exterior biofilm samples revealed the presence of members of the delta and epsilon proteobacteria, low GC Gram positive bacteria (firmicutes), spirochetes, CFB (Cytophaga-Flavobacterium-Bacteroides) group, green nonsulfur bacteria, acidobacteria, verrucomicrobia, and planctomycetes. The presence of the latter three taxonomic groups is of special interest, as they represent phylogenetically distinct groups within the Bacteria for which specific ecological functions have not yet been identified, but which have been found to be widely distributed and often numerically significant in diverse terrestrial and aquatic habitats. Although further sequencing is required to demonstrate the presence of a Riftia-associated microbial population distinct from that of the surrounding seawater, results available from three Riftia individuals from the East Pacific Rise suggest this to be the case. Analysis of microbial communities associated with the gill tissue of the mussel Bathymodiolus thermophilus shows a population dominated by gamma-Proteobacterial chemoautotrophic symbionts, although lower frequency novel phylotypes have been detected. Representatives of specific taxonomic groups have been selected for sequencing of the complete 16S rRNA gene, and the sequences used to reconstruct phylogenetic trees to more accurately determine the evolutionary relationships between the novel sequences, and available sequences for both cultured and non-cultured bacteria.

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Mycobacterium shottsii sp. nov., a slowly growing species isolated from Chesapeake Bay striped bass (Morone saxatilis)

USGS Publications Warehouse

Rhodes, M.W.; Kator, H.; Kotob, S.; van Berkum, P.; Kaattari, I.; Vogelbein, W.; Quinn, F.; Floyd, M.M.; Butler, W.R.; Ottinger, C.A.

2003-01-01

Slowly growing, non-pigmented mycobacteria were isolated from striped bass (Morone saxatilis) during an epizootic of mycobacteriosis in the Chesapeake Bay. Growth characteristics, acid-fastness and results of 16S rRNA gene sequencing were consistent with those of the genus Mycobacterium. A unique profile of biochemical reactions was observed among the 21 isolates. A single cluster of eight peaks identified by analysis of mycolic acids (HPLC) resembled those of reference patterns but differed in peak elution times from profiles of reference species of the Mycobacterium tuberculosis complex. One isolate (M175T) was placed within the slowly growing mycobacteria by analysis of aligned 16S rRNA gene sequences and was proximate in phylogeny to Mycobacterium ulcerans and Mycobacterium marinum. However, distinct nucleotide differences were detected in the 16S rRNA gene sequence among M175T, M. ulcerans and M. marinum (99.2% similarity). Isolate M175T could be differentiated from other slowly growing, non-pigmented mycobacteria by its inability to grow at 37??C, production of niacin and urease, absence of nitrate reductase and resistance to isoniazid (1 ??g ml-1), thiacetazone and thiophene-2-carboxylic hydrazide. Based upon these genetic and phenotypic differences, isolate M175T (= ATCC 700981T = NCTC 13215T) is proposed as the type strain of a novel species, Mycobacterium shottsii sp. nov.

Paenibacillus phoenicis sp. nov., isolated from the Phoenix Lander assembly facility and a subsurface molybdenum mine.

PubMed

Benardini, James N; Vaishampayan, Parag A; Schwendner, Petra; Swanner, Elizabeth; Fukui, Youhei; Osman, Sharif; Satomi, Masakata; Venkateswaran, Kasthuri

2011-06-01

A novel Gram-positive, motile, endospore-forming, aerobic bacterium was isolated from the NASA Phoenix Lander assembly clean room that exhibits 100 % 16S rRNA gene sequence similarity to two strains isolated from a deep subsurface environment. All strains are rod-shaped, endospore-forming bacteria, whose endospores are resistant to UV radiation up to 500 J m(-2). A polyphasic taxonomic study including traditional phenotypic tests, fatty acid analysis, 16S rRNA gene sequencing and DNA-DNA hybridization analysis was performed to characterize these novel strains. The 16S rRNA gene sequencing convincingly grouped these novel strains within the genus Paenibacillus as a separate cluster from previously described species. The similarity of 16S rRNA gene sequences among the novel strains was identical but only 98.1 to 98.5 % with their nearest neighbours Paenibacillus barengoltzii ATCC BAA-1209(T) and Paenibacillus timonensis CIP 108005(T). The menaquinone MK-7 was dominant in these novel strains as shown in other species of the genus Paenibacillus. The DNA-DNA hybridization dissociation value was <45 % with the closest related species. The novel strains had DNA G+C contents of 51.9 to 52.8 mol%. Phenotypically, the novel strains can be readily differentiated from closely related species by the absence of urease and gelatinase and the production of acids from a variety of sugars including l-arabinose. The major fatty acid was anteiso-C(15 : 0) as seen in P. barengoltzii and P. timonensis whereas the proportion of C(16 : 0) was significantly different from the closely related species. Based on phylogenetic and phenotypic results, it was concluded that these strains represent a novel species of the genus Paenibacillus, for which the name Paenibacillus phoenicis sp. nov. is proposed. The type strain is 3PO2SA(T) ( = NRRL B-59348(T)  = NBRC 106274(T)).

Rapid Detection & Identification of Bacillus Species using MALDI-TOF/TOF and Biomarker Database

DTIC Science & Technology

2006-06-01

rRNA sequence analysis. Multilocus enzyme electrophoresis ( MEE ) and comparative DNA sequence analysis suggest that they may represent a single species...adaptation of the MEE method [63] but with greater discrimination [64]. All of these new PCR-based subtyping methods are certainly superior and more...Demirev, P.A., Lin, J.S., Pineda , F.J., and Fenselau, C. (2001). Bioinformatics and mass spectrometry for microorganism identification: proteome-wide

Community analysis of a full-scale anaerobic bioreactor treating paper mill wastewater.

PubMed

Roest, Kees; Heilig, Hans G H J; Smidt, Hauke; de Vos, Willem M; Stams, Alfons J M; Akkermans, Antoon D L

2005-03-01

To get insight into the microbial community of an Upflow Anaerobic Sludge Blanket reactor treating paper mill wastewater, conventional microbiological methods were combined with 16S rRNA gene analyses. Particular attention was paid to microorganisms able to degrade propionate or butyrate in the presence or absence of sulphate. Serial enrichment dilutions allowed estimating the number of microorganisms per ml sludge that could use butyrate with or without sulphate (10(5)), propionate without sulphate (10(6)), or propionate and sulphate (10(8)). Quantitative RNA dot-blot hybridisation indicated that Archaea were two-times more abundant in the microbial community of anaerobic sludge than Bacteria. The microbial community composition was further characterised by 16S rRNA-gene-targeted Denaturing Gradient Gel Electrophoresis (DGGE) fingerprinting, and via cloning and sequencing of dominant amplicons from the bacterial and archaeal patterns. Most of the nearly full length (approximately 1.45 kb) bacterial 16S rRNA gene sequences showed less than 97% similarity to sequences present in public databases, in contrast to the archaeal clones (approximately. 1.3 kb) that were highly similar to known sequences. While Methanosaeta was found as the most abundant genus, also Crenarchaeote-relatives were identified. The microbial community was relatively stable over a period of 3 years (samples taken in July 1999, May 2001, March 2002 and June 2002) as indicated by the high similarity index calculated from DGGE profiles (81.9+/-2.7% for Bacteria and 75.1+/-3.1% for Archaea). 16S rRNA gene sequence analysis indicated the presence of unknown and yet uncultured microorganisms, but also showed that known sulphate-reducing bacteria and syntrophic fatty acid-oxidising microorganisms dominated the enrichments.

Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

PubMed

Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

2010-04-01

Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

PanFP: Pangenome-based functional profiles for microbial communities

DOE PAGES

Jun, Se -Ran; Hauser, Loren John; Schadt, Christopher Warren; ...

2015-09-26

For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost effective way to screen samples of interestmore » for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. As a result, we present a computational method called pangenome based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU s taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome s functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8 0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed reference OTU picking strategies against specific reference sequence databases. In conclusion, we developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub.« less

PanFP: pangenome-based functional profiles for microbial communities.

PubMed

Jun, Se-Ran; Robeson, Michael S; Hauser, Loren J; Schadt, Christopher W; Gorin, Andrey A

2015-09-26

For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost-effective way to screen samples of interest for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. We present a computational method called pangenome-based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU's taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome's functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8-0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed-reference OTU picking strategies against specific reference sequence databases. We developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub ( https://github.com/srjun/PanFP ).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jun, Se -Ran; Hauser, Loren John; Schadt, Christopher Warren

For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost effective way to screen samples of interestmore » for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. As a result, we present a computational method called pangenome based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU s taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome s functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8 0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed reference OTU picking strategies against specific reference sequence databases. In conclusion, we developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water.

PubMed

Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S

2015-10-01

In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Genetic speciation of environmental Legionella isolates in Thailand.

PubMed

Paveenkittiporn, Wantana; Dejsirilert, Surang; Kalambaheti, Thareerat

2012-10-01

Legionella-like organisms were isolated during 2003-2007 from various water resources by culturing on selective media of Wadowsky-Yee-Okuda agar. The 256 isolates were identified as belonging to the Legionella genus based on detection of 108 bp PCR product of the 5S rRNA gene, while the inclusion as Legionella pneumophila were confirmed by PCR detection of a specific mip gene region of 168 bp. The 50 isolates, identified as non-pneumophila, were then subjected to DNA tree analysis, based on mip gene of ~650 bp and rnpB genes product ranged from 304 to 354 bp. Phylogenetic tree was constructed to predict their species in relative to the available database. The isolates of which their speciation, based on those two genes were inconclusive, were then investigated for the almost full-length of 16S rRNA sequences. The isolates were assigned as 16 known Legionella species, and proposed seven novel species based on their unique 16S rRNA sequence. Copyright © 2012 Elsevier B.V. All rights reserved.

Natural communities of novel archaea and bacteria growing in cold sulfurous springs with a string-of-pearls-like morphology.

PubMed

Rudolph, C; Wanner, G; Huber, R

2001-05-01

We report the identification of novel archaea living in close association with bacteria in the cold (approximately 10 degrees C) sulfurous marsh water of the Sippenauer Moor near Regensburg, Bavaria, Germany. These microorganisms form a characteristic, macroscopically visible structure, morphologically comparable to a string of pearls. Tiny, whitish globules (the pearls; diameter, about 0.5 to 3.0 mm) are connected to each other by thin, white-colored threads. Fluorescent in situ hybridization (FISH) studies have revealed that the outer part of the pearls is mainly composed of bacteria, with a filamentous bacterium predominating. Internally, archaeal cocci are the predominant microorganisms, with up to 10(7) cells estimated to be present in a single pearl. The archaea appear to be embedded in a polymer of unknown chemical composition. According to FISH and 16S rRNA gene sequence analysis, the archaea are affiliated with the euryarchaeal kingdom. The new euryarchaeal sequence represents a deep phylogenetic branch within the 16S rRNA tree and does not show extensive similarity to any cultivated archaea or to 16S rRNA gene sequences from environmental samples.

Characterization and Screening of Native Scenedesmus sp. Isolates Suitable for Biofuel Feedstock

PubMed Central

Gour, Rakesh Singh; Chawla, Aseem; Singh, Harvinder; Chauhan, Rajinder Singh; Kant, Anil

2016-01-01

In current study isolates of two native microalgae species were screened on the basis of growth kinetics and lipid accumulation potential. On the basis of data obtained on growth parameters and lipid accumulation, it is concluded that Scenedesmus dimorphus has better potential as biofuel feedstock. Two of the isolates of Scenedesmus dimorphus performed better than other isolates with respect to important growth parameters with lipid content of ~30% of dry biomass. Scenedesmus dimorphus was found to be more suitable as biodiesel feedstock candidate on the basis of cumulative occurrence of five important biodiesel fatty acids, relative occurrence of SFA (53.04%), MUFA (23.81%) and PUFA (19.69%), and more importantly that of oleic acid in its total lipids. The morphological observations using light and Scanning Electron Microscope and molecular characterization using amplified 18S rRNA gene sequences of microalgae species under study were also performed. Amplified 18S rRNA gene fragments of the microalgae species were sequenced, annotated at the NCBI website and phylogenetic analysis was done. We have published eight 18S rRNA gene sequences of microalgae species in NCBI GenBank. PMID:27195694

Seasonal and regional diversity of maple sap microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries.

PubMed

Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

2010-04-01

An arbitrary primed community PCR fingerprinting technique based on capillary electrophoresis was developed to study maple sap microbial community characteristics among 19 production sites in Québec over the tapping season. Presumptive fragment identification was made with corresponding fingerprint profiles of bacterial isolate cultures. Maple sap microbial communities were subsequently compared using a representative subset of 13 16S rRNA gene clone libraries followed by gene sequence analysis. Results from both methods indicated that all maple sap production sites and flow periods shared common microbiota members, but distinctive features also existed. Changes over the season in relative abundance of predominant populations showed evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most abundantly and frequently represented genera of the 2239 sequences analyzed. Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilithonimonas and Sphingomonas were revealed as occasional contaminants in maple sap. Maple sap microbiota showed a low level of deep diversity along with a high variation of similar 16S rRNA gene sequences within the Pseudomonas genus. Predominance of Pseudomonas is suggested as a typical feature of maple sap microbiota across geographical regions, production sites, and sap flow periods.

Reclassification of Lactobacillus kimchii and Lactobacillus bobalius as later subjective synonyms of Lactobacillus paralimentarius.

PubMed

Pang, Huili; Kitahara, Maki; Tan, Zhongfang; Wang, Yanping; Qin, Guangyong; Ohkuma, Moriya; Cai, Yimin

2012-10-01

Characterization and identification of strain CW 1 ( = JCM 17161) isolated from corn silage were performed. Strain CW 1 was a Gram-positive, catalase-negative and homofermentative rod that produced the DL-form of lactic acid. This strain exhibited more than 99.6% 16S rRNA gene sequence similarity and greater than 82% DNA-DNA reassociation with type strains of Lactobacillus kimchii, L. bobalius and L. paralimentarius. To clarify the taxonomic positions of these type strains, phenotypic characterization, 16S rRNA gene sequencing, ribotyping and DNA-DNA relatedness were examined. The three type strains displayed different L-arabinose, lactose, melibiose, melezitose, raffinose and N-acetyl-β-glucosaminidase fermentation patterns. Phylogenetic analysis showed that L. paralimentarius is a closer neighbour of L. kimchii and L. bobalius, sharing 99.5-99.9% 16S rRNA gene sequence similarity, which was confirmed by the high DNA-DNA relatedness (≥82%) between L. paralimentarius JCM 10415(T), L. bobalius JCM 16180(T) and L. kimchii JCM 10707(T). Therefore, it is proposed that L. kimchii and L. bobalius should be reclassified as later synonyms of L. paralimentarius.

Characterization of Mycobacteria from a Major Brazilian Outbreak Suggests that Revision of the Taxonomic Status of Members of the Mycobacterium chelonae-M. abscessus Group Is Needed ▿

PubMed Central

Leao, Sylvia Cardoso; Tortoli, Enrico; Viana-Niero, Cristina; Ueki, Suely Yoko Mizuka; Lima, Karla Valeria Batista; Lopes, Maria Luiza; Yubero, Jesus; Menendez, Maria Carmen; Garcia, Maria Jesus

2009-01-01

An outbreak of postsurgical infections caused by rapidly growing mycobacteria has been ongoing in Brazil since 2004. The degrees of similarity of the rpoB and hsp65 sequences from the clinical isolates and the corresponding sequences from both the Mycobacterium massiliense and the M. bolletii type strains were above the accepted limit for interspecies variability, leading to conflicting identification results. Therefore, an extensive characterization of members of the M. chelonae-M. abscessus group was carried out. The M. abscessus, M. chelonae, M. immunogenum, M. massiliense, and M. bolletii type strains and a subset of clinical isolates were analyzed by biochemical tests, high-performance liquid chromatography, drug susceptibility testing, PCR-restriction enzyme analysis of hsp65 (PRA-hsp65), rpoB, and hsp65 gene sequencing and analysis of phylogenetic trees, DNA-DNA hybridization (DDH), and restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene (RFLP-16S rRNA). The clinical isolates and the M. abscessus, M. massiliense, and M. bolletii type strains could not be separated by phenotypic tests and were grouped in the phylogenetic trees obtained. The results of DDH also confirmed the >70% relatedness of the clinical isolates and the M. abscessus, M. massiliense, and M. bolletii type strains; and indistinguishable RFLP-16S rRNA patterns were obtained. On the contrary, the separation of clinical isolates and the M. abscessus, M. massiliense, and M. bolletii type strains from M. chelonae and M. immunogenum was supported by the results of PRA-hsp65, DDH, and RFLP-16S rRNA and by the rpoB and hsp65 phylogenetic trees. Taken together, these results led to the proposition that M. abscessus, M. massiliense, and M. bolletii represent a single species, that of M. abscessus. Two subspecies are also proposed, M. abscessus subsp. abscessus and M. abscessus subsp. massiliense, and these two subspecies can be distinguished by two different PRA-hsp65 patterns, which differ by a single HaeIII band, and by differences in their rpoB (3.4%) and hsp65 (1.3%) sequences. PMID:19571015

Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens.

PubMed

Lewis, William H; Sendra, Kacper M; Embley, T Martin; Esteban, Genoveva F

2018-01-01

Many anaerobic ciliated protozoa contain organelles of mitochondrial ancestry called hydrogenosomes. These organelles generate molecular hydrogen that is consumed by methanogenic Archaea, living in endosymbiosis within many of these ciliates. Here we describe a new species of anaerobic ciliate, Trimyema finlayi n. sp., by using silver impregnation and microscopy to conduct a detailed morphometric analysis. Comparisons with previously published morphological data for this species, as well as the closely related species, Trimyema compressum , demonstrated that despite them being similar, both the mean cell size and the mean number of somatic kineties are lower for T. finlayi than for T. compressum , which suggests that they are distinct species. This was also supported by analysis of the 18S rRNA genes from these ciliates, the sequences of which are 97.5% identical (6 substitutions, 1479 compared bases), and in phylogenetic analyses these sequences grouped with other 18S rRNA genes sequenced from previous isolates of the same respective species. Together these data provide strong evidence that T. finlayi is a novel species of Trimyema , within the class Plagiopylea. Various microscopic techniques demonstrated that T. finlayi n. sp. contains polymorphic endosymbiotic methanogens, and analysis of the endosymbionts' 16S rRNA gene showed that they belong to the genus Methanocorpusculum , which was confirmed using fluorescence in situ hybridization with specific probes. Despite the degree of similarity and close relationship between these ciliates, T. compressum contains endosymbiotic methanogens from a different genus, Methanobrevibacter . In phylogenetic analyses of 16S rRNA genes, the Methanocorpusculum endosymbiont of T. finlayi n. sp. grouped with sequences from Methanomicrobia, including the endosymbiont of an earlier isolate of the same species, ' Trimyema sp.,' which was sampled approximately 22 years earlier, at a distant (∼400 km) geographical location. Identification of the same endosymbiont species in the two separate isolates of T. finlayi n. sp. provides evidence for spatial and temporal stability of the Methanocorpusculum-T. finlayi n. sp. endosymbiosis. T. finlayi n. sp. and T. compressum provide an example of two closely related anaerobic ciliates that have endosymbionts from different methanogen genera, suggesting that the endosymbionts have not co-speciated with their hosts.

[Identification of Hydrocarbon-Oxidizing Dietzia Bacteria from Petroleum Reservoirs Based on Phenotypic Properties and Analysis of the 16S rRNA and gyrB Genes].

PubMed

Nazina, T N; Shumkova, E S; Sokolova, D Sh; Babich, T L; Zhurina, M V; Xue, Yan-Fen; Osipov, G A; Poltaraus, A B; Tourova, T P

2015-01-01

The taxonomic position of hydrocarbon-oxidizing bacterial strains 263 and 32d isolated from formation water of the Daqing petroleum reservoir (PRC) was determined by polyphasic taxonomy techniques, including analysis of the 16S rRNA and the gyrB genes. The major chemotaxonomic characteristics of both strains, including the IV type cell wall, composition of cell wall fatty acids, mycolic acids, and menaquinones, agreed with those typical of Dietzia strains. The DNA G+C content of strains 263 and 32d were 67.8 and 67.6 mol%, respectively. Phylogenetic analysis of the 16S rRNA gene of strain 32d revealed 99.7% similarity to the gene of D. maris, making it possible to identify strain 32d as belonging to this species. The 16S rRNA gene sequence of strain 263 exhibited 99.7 and 99.9% similarity to those of D. natronolimnaea and D. cercidiphylli YIM65002(T), respectively. Analysis of the gyrB genes of the subterranean isolates and of a number of Dietzia type strains confirmed classiffication of strain 32d as a D. maris strain and of strain 263, as a D. natronolimnaea strain. A conclusion was made concerning higher resolving power of phylogenetic analysis of the gyrB gene compared to the 16S rRNA gene analysis in the case of determination of the species position of Dietzia isolates.

Reclassification of Actinobacillus muris as Muribacter muris gen. nov., comb. nov.

PubMed

Nicklas, Werner; Bisgaard, Magne; Aalbæk, Bent; Kuhnert, Peter; Christensen, Henrik

2015-10-01

To reinvestigate the taxonomy of [Actinobacillus] muris, 474 strains, mainly from mice and rats, were characterized by phenotype and 130 strains selected for genotypic characterization by 16S rRNA and partial rpoB gene sequencing. The type strain was further investigated by whole-genome sequencing. Phylogenetic analysis of the DNA sequences showed one monophyletic group with intragroup similarities of 96.7 and 97.2 % for the 16S rRNA and rpoB genes, respectively. The highest 16S rRNA gene sequence similarity to a taxon with a validly published name outside the group was 95.9 %, to the type strain of [Pasteurella] pneumotropica. The closest related taxon based on rpoB sequence comparison was 'Haemophilus influenzae-murium', with 88.4 % similarity. A new genus and a new combination, Muribacter muris gen. nov., comb. nov., are proposed based on a distinct phylogenetic position based on 16S rRNA and rpoB gene sequence comparisons, with major divergence from the existing genera of the family Pasteurellaceae. The new genus has the characteristics of [A.] muris with the emendation that acid formation from ( - )-d-mannitol and hydrolysis of aesculin are variable, while the α-glucosidase test is positive. There is no requirement for exogenously supplied NAD (V factor) for the majority of strains investigated; however, one strain was found to require NAD. The major fatty acids of the type strain of Muribacter muris were C14 : 0, C14 : 0 3-OH/iso-C16 : 1 I, C16 : 1ω7c and C16 : 0, which is in line with most genera of the Pasteurellaceae. The type strain of Muribacter muris is CCUG 16938T ( = NCTC 12432T = ATCC 49577T).

MetaMetaDB: a database and analytic system for investigating microbial habitability.

PubMed

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes.

A novel approach for monitoring genetically engineered microorganisms by using artificial, stable RNAs

NASA Technical Reports Server (NTRS)

Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.

1995-01-01

Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.

Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

PubMed

Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

2010-04-01

This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.

Phylogenetic analysis of the spirochete Borrelia microti, a potential agent of relapsing fever in Iran.

PubMed

Naddaf, Saied Reza; Ghazinezhad, Behnaz; Bahramali, Golnaz; Cutler, Sally Jane

2012-09-01

We report a role for Borrelia microti as a cause of relapsing fever in Iran supported by robust epidemiological evidence. The molecular identity of this spirochete and its relation with other relapsing fever borreliae have, until now, been poorly delineated. We analyzed an isolate of B. microti, obtained from Ornithodoros erraticus ticks, by sequencing four loci (16S rRNA, flaB, glpQ, intragenic spacer [IGS]) and comparing these sequences with those of other relapsing fever borreliae. Phylogenetic analysis using concatenated sequences of 16S rRNA, flaB, and glpQ grouped B. microti alongside three members of the African group, B. duttonii, B. recurrentis, and B. crocidurae, which are distinct from B. persica, the most prevalent established cause of tick-borne relapsing fever in Iran. The similarity values for 10 concatenated sequences totaling 2,437 nucleotides ranged from 92.11% to 99.84%, with the highest homologies being between B. duttonii and B. microti and between B. duttonii and B. recurrentis. Furthermore, the more discriminatory IGS sequence analysis corroborated the close similarity (97.76% to 99.56%) between B. microti and B. duttonii. These findings raise the possibility that both species may indeed be the same and further dispel the one-species, one-vector theory that has been the basis for classification of relapsing fever Borrelia for the last 100 years.

Shifts in phylogenetic diversity of archaeal communities in mangrove sediments at different sites and depths in southeastern Brazil.

PubMed

Mendes, Lucas William; Taketani, Rodrigo Gouvêa; Navarrete, Acácio Aparecido; Tsai, Siu Mui

2012-06-01

This study focused on the structure and composition of archaeal communities in sediments of tropical mangroves in order to obtain sufficient insight into two Brazilian sites from different locations (one pristine and another located in an urban area) and at different depth levels from the surface. Terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene fragments was used to scan the archaeal community structure, and 16S rRNA gene clone libraries were used to determine the community composition. Redundancy analysis of T-RFLP patterns revealed differences in archaeal community structure according to location, depth and soil attributes. Parameters such as pH, organic matter, potassium and magnesium presented significant correlation with general community structure. Furthermore, phylogenetic analysis revealed a community composition distributed differently according to depth where, in shallow samples, 74.3% of sequences were affiliated with Euryarchaeota and 25.7% were shared between Crenarchaeota and Thaumarchaeota, while for the deeper samples, 24.3% of the sequences were affiliated with Euryarchaeota and 75.7% with Crenarchaeota and Thaumarchaeota. Archaeal diversity measurements based on 16S rRNA gene clone libraries decreased with increasing depth and there was a greater difference between depths (<18% of sequences shared) than sites (>25% of sequences shared). Taken together, our findings indicate that mangrove ecosystems support a diverse archaeal community; it might possibly be involved in nutrient cycles and are affected by sediment properties, depth and distinct locations. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

PubMed

Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

2014-01-01

In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

Genomic insights into the taxonomic status of the Bacillus cereus group

PubMed Central

Liu, Yang; Lai, Qiliang; Göker, Markus; Meier-Kolthoff, Jan P.; Wang, Meng; Sun, Yamin; Wang, Lei; Shao, Zongze

2015-01-01

The identification and phylogenetic relationships of bacteria within the Bacillus cereus group are controversial. This study aimed at determining the taxonomic affiliations of these strains using the whole-genome sequence-based Genome BLAST Distance Phylogeny (GBDP) approach. The GBDP analysis clearly separated 224 strains into 30 clusters, representing eleven known, partially merged species and accordingly 19–20 putative novel species. Additionally, 16S rRNA gene analysis, a novel variant of multi-locus sequence analysis (nMLSA) and screening of virulence genes were performed. The 16S rRNA gene sequence was not sufficient to differentiate the bacteria within this group due to its high conservation. The nMLSA results were consistent with GBDP. Moreover, a fast typing method was proposed using the pycA gene, and where necessary, the ccpA gene. The pXO plasmids and cry genes were widely distributed, suggesting little correlation with the phylogenetic positions of the host bacteria. This might explain why classifications based on virulence characteristics proved unsatisfactory in the past. In summary, this is the first large-scale and systematic study of the taxonomic status of the bacteria within the B. cereus group using whole-genome sequences, and is likely to contribute to further insights into their pathogenicity, phylogeny and adaptation to diverse environments. PMID:26373441

Pantoea allii sp. nov., isolated from onion plants and seed.

PubMed

Brady, Carrie L; Goszczynska, Teresa; Venter, Stephanus N; Cleenwerck, Ilse; De Vos, Paul; Gitaitis, Ronald D; Coutinho, Teresa A

2011-04-01

Eight yellow-pigmented, Gram-negative, rod-shaped, oxidase-negative, motile, facultatively anaerobic bacteria were isolated from onion seed in South Africa and from an onion plant exhibiting centre rot symptoms in the USA. The isolates were assigned to the genus Pantoea on the basis of phenotypic and biochemical tests. 16S rRNA gene sequence analysis and multilocus sequence analysis (MLSA), based on gyrB, rpoB, infB and atpD sequences, confirmed the allocation of the isolates to the genus Pantoea. MLSA further indicated that the isolates represented a novel species, which was phylogenetically most closely related to Pantoea ananatis and Pantoea stewartii. Amplified fragment length polymorphism analysis also placed the isolates into a cluster separate from P. ananatis and P. stewartii. Compared with type strains of species of the genus Pantoea that showed >97 % 16S rRNA gene sequence similarity with strain BD 390(T), the isolates exhibited 11-55 % whole-genome DNA-DNA relatedness, which confirmed the classification of the isolates in a novel species. The most useful phenotypic characteristics for the differentiation of the isolates from their closest phylogenetic neighbours are production of acid from amygdalin and utilization of adonitol and sorbitol. A novel species, Pantoea allii sp. nov., is proposed, with type strain BD 390(T) ( = LMG 24248(T)).

Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

PubMed Central

Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

2014-01-01

In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2005-03-01

Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

The Phantom Menace for Patients with Hepatobiliary Diseases: Shewanella haliotis, Often Misidentified as Shewanella algae in Biochemical Tests and MALDI-TOF Analysis.

PubMed

Byun, Jung-Hyun; Park, Hyunwoong; Kim, Sunjoo

2017-03-24

Although Shewanella algae has been known to have weak pathogenicity, case reports on infections with this species have been steadily increasing. S. algae and S. haliotis are difficult to distinguish from each other with conventional phenotypic methods. We reviewed the microbiological and clinical features of S. algae and S. haliotis infections at our institute. Bacterial culture and identification reports from patient samples from 2010 to 2014 were reviewed to screen the cases of Shewanella infections. In addition to conventional biochemical tests, 16S rRNA gene sequence analysis and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry were performed for 19 stored bacterial isolates. Medical records were reviewed for clinical characteristics and laboratory findings. All isolates were identified as S. algae by using VITEK 2. MALDI-TOF also identified all isolates as S. algae with a 99.9 confidence value. In contrast, 16S rRNA analysis identified 10 isolates as S. algae and 9 isolates as S. haliotis. Both S. algae (60%) and S. haliotis (77%) infections were strongly associated with diseases of the hepatobiliary tract and pancreas. To distinguish between S. algae and S. haliotis, 16S rRNA gene sequence analysis seems more accurate than biochemical tests or MALDI-TOF. Patients with underlying diseases in the hepatobiliary tract and pancreas seem to be susceptible to these marine pathogens.

Molecular Characterization of a Non–Babesia divergens Organism Causing Zoonotic Babesiosis in Europe

PubMed Central

Cacciò, Simone; Gherlinzoni, Filippo; Aspöck, Horst; Slemenda, Susan B.; Piccaluga, PierPaolo; Martinelli, Giovanni; Edelhofer, Renate; Hollenstein, Ursula; Poletti, Giovanni; Pampiglione, Silvio; Löschenberger, Karin; Tura, Sante; Pieniazek, Norman J.

2003-01-01

In Europe, most reported human cases of babesiosis have been attributed, without strong molecular evidence, to infection with the bovine parasite Babesia divergens. We investigated the first known human cases of babesiosis in Italy and Austria, which occurred in two asplenic men. The complete 18S ribosomal RNA (18S rRNA) gene was amplified from specimens of their whole blood by polymerase chain reaction (PCR). With phylogenetic analysis, we compared the DNA sequences of the PCR products with those for other Babesia spp. The DNA sequences were identical for the organism from the two patients. In phylogenetic analysis, the organism clusters with B. odocoilei, a parasite of white-tailed deer; these two organisms form a sister group with B. divergens. This evidence indicates the patients were not infected with B. divergens but with an organism with previously unreported molecular characteristics for the 18S rRNA gene. PMID:12967491

Lactobacillus apodemi sp. nov., a tannase-producing species isolated from wild mouse faeces.

PubMed

Osawa, Ro; Fujisawa, Tomohiko; Pukall, Rüdiger

2006-07-01

A Gram-positive, rod-shaped, non-endospore-forming bacterium, strain ASB1(T), able to degrade tannin, was isolated from faeces of the Japanese large wood mouse, Apodemus speciosus. Comparative analysis of the 16S rRNA gene sequence revealed that the strain could be assigned as a member of the genus Lactobacillus. The nearest phylogenetic neighbours were determined as Lactobacillus animalis DSM 20602(T) (98.9 % 16S rRNA gene sequence similarity) and Lactobacillus murinus ASF 361 (98.9 %). Subsequent polyphasic analysis, including automated ribotyping and DNA-DNA hybridization experiments, confirmed that the isolate represents a novel species, for which the name Lactobacillus apodemi sp. nov. is proposed. The DNA G+C content of the novel strain is 38.5 mol%. The cell-wall peptidoglycan is of type A4alpha L-lys-D-asp. The type strain is ASB1(T) (=DSM 16634(T)=CIP 108913(T)).

Molecular analysis of microflora associated with dentoalveolar abscesses.

PubMed Central

Dymock, D; Weightman, A J; Scully, C; Wade, W G

1996-01-01

The microflora associated with three dentoalveolar abscesses was determined by cultural and molecular methods. 16S rRNA genes were randomly amplified by means of conserved eubacterial primers and cloned. Restriction fragment length polymorphism analysis of the clones and amplified genes encoding 16S rRNA from the cultured bacteria was used to detect putative unculturable bacteria. Clones representative of five predominant groups of uncultured organisms were sequenced. Two were identified as Porphyromonas gingivalis and Prevotella oris, and one was found to be closely related to Peptostreptococcus micros. The remaining two clones did not correspond to known, previously sequenced organisms. One was related to Zoogloea ramigera, a species of aerobic waterborne organisms, while the other was distantly related to the genus Prevotella. This study has demonstrated the possibility of the characterization of microflora associated with human infection by molecular methods without the inherent biases of culture. PMID:8904410

Bacillus methanolicus sp. nov., a new species of thermotolerant, methanol-utilizing, endospore-forming bacteria.

PubMed

Arfman, N; Dijkhuizen, L; Kirchhof, G; Ludwig, W; Schleifer, K H; Bulygina, E S; Chumakov, K M; Govorukhina, N I; Trotsenko, Y A; White, D

1992-07-01

The generic position of 14 strains of gram-positive bacteria able to use methanol as a growth substrate was determined. All are obligately aerobic, thermotolerant organisms that are able to grow at temperatures of 35 to 60 degrees C. Nine of the strains produce oval spores at a subterminal-to-central position in slightly swollen rod-shaped cells. DNA-DNA hybridization studies, 5S rRNA sequence analysis, and physiological characteristics revealed that all 14 strains cluster as a well-defined group and form a distinct new genospecies. Analysis of the 16S and 5S rRNA sequences indicated that this new species is distinct from Bacillus brevis but closely related to B. firmus and B. azotoformans. The name proposed for this new species is B. methanolicus. The type strain, PB1, has been deposited in the National Collection of Industrial and Marine Bacteria as NCIMB 13113.

[Community structure and phylogenetic analysis of cyanobacteria in cryoconite from surface of the Glacier No. 1 in the Tianshan Mountains].

PubMed

Ni, Xuejiao; Qi, Xing'e; Gu, Yanling; Zheng, Xiaoji; Dong, Juan; Ni, Yongqing; Cheng, Guodong

2014-11-04

The purpose of this study is to characterize the community composition and phylogenetic analysis of cyanobacteria from supraglacial cryoconite of the Glacier No. 1 in the Tianshan Mountains, China. We amplified 16S rRNA genes from the extracted cryoconite DNA by PCR with 2 pairs of cyanobacteria-specific primers. Amplificon was used to construct 16S rRNA genes clone library. The estimation of species richness, diversity indices, and rarefaction curve of the 16S rRNA genes library were determined based on representative phylotypes (OTUs). Analysis of 16S rRNA gene sequences allowed grouping of 101 clones into 12 phylotypes (OTUs) using a cut-off of 97% identity. The phylogenetic analysis revealed that most of sequences affiliated to the order Oscillatoriales and Chroococcales except that three were unclassified. The clone library was dominated by representatives of the order Oscillatoriales (81% of the total clones), and the most abundant organisms within this order were in the genus Phormidium (68 clones) including clones grouping into four phylotypes. The only clone of Chroococcales was closely related to the genus Chamaesiphon with 97% similarity. In addition, comparison of soil chemical properties between different habitats indicated that supraglacial cryoconite supported significantly higher the content of available phosphorus and potassium, nitrate nitrogen and organic matter compared with the forefield of the Glacier No. 1. The diversity index of cyanobacteria were relatively high in supraglacial cryoconite of the Glacier No. 1 in the Tianshan Mountains. The community structure was dominated by members of the genus Phormidium. This study may enrich our knowledge on biogeochemical processes and ecological distribution of cyanobacterial populations in glacial ecosystem.

Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

PubMed

Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

2011-04-28

The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

Toward an Understanding of Changes in Diversity Associated with Fecal Microbiome Transplantation Based on 16S rRNA Gene Deep Sequencing

PubMed Central

Shahinas, Dea; Silverman, Michael; Sittler, Taylor; Chiu, Charles; Kim, Peter; Allen-Vercoe, Emma; Weese, Scott; Wong, Andrew; Low, Donald E.; Pillai, Dylan R.

2012-01-01

ABSTRACT Fecal microbiome transplantation by low-volume enema is an effective, safe, and inexpensive alternative to antibiotic therapy for patients with chronic relapsing Clostridium difficile infection (CDI). We explored the microbial diversity of pre- and posttransplant stool specimens from CDI patients (n = 6) using deep sequencing of the 16S rRNA gene. While interindividual variability in microbiota change occurs with fecal transplantation and vancomycin exposure, in this pilot study we note that clinical cure of CDI is associated with an increase in diversity and richness. Genus- and species-level analysis may reveal a cocktail of microorganisms or products thereof that will ultimately be used as a probiotic to treat CDI. PMID:23093385

Phylogenetic analysis of family Neisseriaceae based on genome sequences and description of Populibacter corticis gen. nov., sp. nov., a member of the family Neisseriaceae, isolated from symptomatic bark of Populus × euramericana canker.

PubMed

Li, Yong; Xue, Han; Sang, Sheng-Qi; Lin, Cai-Li; Wang, Xi-Zhuo

2017-01-01

Two Gram-stain negative aerobic bacterial strains were isolated from the bark tissue of Populus × euramericana. The novel isolates were investigated using a polyphasic approach including 16S rRNA gene sequencing, genome sequencing, average nucleotide identity (ANI) and both phenotypic and chemotaxonomic assays. The genome core gene sequence and 16S rRNA gene phylogenies suggest that the novel isolates are different from the genera Snodgrassella and Stenoxybacter. Additionally, the ANI, G+C content, main fatty acids and phospholipid profile data supported the distinctiveness of the novel strain from genus Snodgrassella. Therefore, based on the data presented, the strains constitute a novel species of a novel genus within the family Neisseriaceae, for which the name Populibacter corticis gen. nov., sp. nov. is proposed. The type strain is 15-3-5T (= CFCC 13594T = KCTC 42251T).

The conserved mitochondrial gene distribution in relatives of Turritopsis nutricula, an immortal jellyfish.

PubMed

Devarapalli, Pratap; Kumavath, Ranjith N; Barh, Debmalya; Azevedo, Vasco

2014-01-01

Turritopsis nutricula (T. nutricula) is the one of the known reported organisms that can revert its life cycle to the polyp stage even after becoming sexually mature, defining itself as the only immortal organism in the animal kingdom. Therefore, the animal is having prime importance in basic biological, aging, and biomedical researches. However, till date, the genome of this organism has not been sequenced and even there is no molecular phylogenetic study to reveal its close relatives. Here, using phylogenetic analysis based on available 16s rRNA gene and protein sequences of Cytochrome oxidase subunit-I (COI or COX1) of T. nutricula, we have predicted the closest relatives of the organism. While we found Nemopsis bachei could be closest organism based on COX1 gene sequence; T. dohrnii may be designated as the closest taxon to T. nutricula based on rRNA. Moreover, we have figured out four species that showed similar root distance based on COX1 protein sequence.

Single cell genomics of uncultured marine alveolates shows paraphyly of basal dinoflagellates.

PubMed

Strassert, Jürgen F H; Karnkowska, Anna; Hehenberger, Elisabeth; Del Campo, Javier; Kolisko, Martin; Okamoto, Noriko; Burki, Fabien; Janouškovec, Jan; Poirier, Camille; Leonard, Guy; Hallam, Steven J; Richards, Thomas A; Worden, Alexandra Z; Santoro, Alyson E; Keeling, Patrick J

2018-01-01

Marine alveolates (MALVs) are diverse and widespread early-branching dinoflagellates, but most knowledge of the group comes from a few cultured species that are generally not abundant in natural samples, or from diversity analyses of PCR-based environmental SSU rRNA gene sequences. To more broadly examine MALV genomes, we generated single cell genome sequences from seven individually isolated cells. Genes expected of heterotrophic eukaryotes were found, with interesting exceptions like presence of proteorhodopsin and vacuolar H + -pyrophosphatase. Phylogenetic analysis of concatenated SSU and LSU rRNA gene sequences provided strong support for the paraphyly of MALV lineages. Dinoflagellate viral nucleoproteins were found only in MALV groups that branched as sister to dinokaryotes. Our findings indicate that multiple independent origins of several characteristics early in dinoflagellate evolution, such as a parasitic life style, underlie the environmental diversity of MALVs, and suggest they have more varied trophic modes than previously thought.

Neisseria arctica sp. nov. isolated from nonviable eggs of greater white-fronted geese (Anser albifrons) in Arctic Alaska

USGS Publications Warehouse

Hansen, Cristina M.; Himschoot, Elizabeth; Hare, Rebekah F.; Meixell, Brandt W.; Van Hemert, Caroline R.; Hueffer, Karsten

2017-01-01

During the summers of 2013 and 2014, isolates of a novel Gram-negative coccus in the Neisseria genus were obtained from the contents of nonviable greater white-fronted goose (Anser albifrons) eggs on the Arctic Coastal Plain of Alaska. We used a polyphasic approach to determine whether these isolates represent a novel species. 16S rRNA gene sequences, 23S rRNA gene sequences, and chaperonin 60 gene sequences suggested that these Alaskan isolates are members of a distinct species that is most closely related to Neisseria canis, N. animaloris, and N. shayeganii. Analysis of the rplF gene additionally showed that our isolates are unique and most closely related to N. weaveri. Average nucleotide identity of the whole genome sequence of our type strain was between 71.5% and 74.6% compared to close relatives, further supporting designation as a novel species. Fatty acid methyl ester analysis showed a predominance of C14:0, C16:0, and C16:1ω7c fatty acids. Finally, biochemical characteristics distinguished our isolates from other Neisseria species. The name Neisseria arctica (type strain KH1503T = ATCC TSD-57T = DSM 103136T) is proposed.

Novel Detection of Insecticide Resistance Related P450 Genes and Transcriptome Analysis of the Hemimetabolous Pest Erthesina fullo (Thunberg) (Hemiptera: Heteroptera).

PubMed

Liu, Yang; Wu, Haoyang; Xie, Qiang; Bu, Wenjun

2015-01-01

Erthesina fullo (Thunberg, 1783) is an economically important heteropteran species in China. Since only three nucleotide sequences of this species (COI, 16S rRNA, and 18S rRNA) appear in the GenBank database so far, no analysis of the molecular mechanisms underlying E. fullo's resistance to insecticide and environmental stress has been accomplished. We reported a de novo assembled and annotated transcriptome for adult E. fullo using the Illumina sequence system. A total of 53,359,458 clean reads of 4.8 billion nucleotides (nt) were assembled into 27,488 unigenes with an average length of 750 bp, of which 17,743 (64.55%) were annotated. In the present study, we identified 88 putative cytochrome P450 sequences and analyzed the evolution of cytochrome P450 superfamilies, genes of the CYP3 clan related to metabolizing xenobiotics and plant natural compounds, in E. fullo, increasing the candidate genes for the molecular mechanisms of insecticide resistance in P450. The sequenced transcriptome greatly expands the available genomic information and could allow a better understanding of the mechanisms of insecticide resistance at the systems biology level.

Identification, characterization and description of Arcobacter faecis sp. nov., isolated from a human waste septic tank.

PubMed

Whiteduck-Léveillée, Kerri; Whiteduck-Léveillée, Jenni; Cloutier, Michel; Tambong, James T; Xu, Renlin; Topp, Edward; Arts, Michael T; Chao, Jerry; Adam, Zaky; Lévesque, C André; Lapen, David R; Villemur, Richard; Khan, Izhar U H

2016-03-01

A study on the taxonomic classification of Arcobacter species was performed on the cultures isolated from various fecal sources where an Arcobacter strain AF1078(T) from human waste septic tank near Ottawa, Ontario, Canada was characterized using a polyphasic approach. Genetic investigations including 16S rRNA, atpA, cpn60, gyrA, gyrB and rpoB gene sequences of strain AF1078(T) are unique in comparison with other arcobacters. Phylogenetic analysis based on the 16S rRNA gene sequence revealed that the strain is most closely related to Arcobacter lanthieri and Arcobacter cibarius. Analyses of atpA, cpn60, gyrA, gyrB and rpoB gene sequences suggested that strain AF1078(T) formed a phylogenetic lineage independent of other species in the genus. Whole-genome sequence, DNA-DNA hybridization, fatty acid profile and phenotypic analysis further supported the conclusion that strain AF1078(T) represents a novel Arcobacter species, for which the name Arcobacter faecis sp. nov. is proposed, with type strain AF1078(T) (=LMG 28519(T); CCUG 66484(T)). Crown Copyright © 2015. Published by Elsevier GmbH. All rights reserved.

First report of Rangelia vitalii infection (canine rangeliosis) in Argentina.

PubMed

Eiras, Diego Fernando; Craviotto, María Belén; Baneth, Gad; Moré, Gastón

2014-10-01

A 12-year old mixed breed neutered bitch from Misiones, Argentina, was presented with a history of fever and epistaxis. Blood, bone marrow, and lymph node samples were collected for hematology and cytology. Mild regenerative anemia was recorded and large, round, poorly stained piroplasms (>2.5 μm) were found within erythrocytes in blood and lymph node smears. Nested PCR-RFLP on blood and bone marrow samples was positive for piroplasm DNA. The 18S rRNA gene of piroplasms was targeted. A restriction pattern of a previously unreported piroplasm was observed. The PCR product was sequenced, and the sequence obtained had 99% identity with the Rangelia vitalii sequences from Brazil when compared by BLAST analysis. Further characterization of the detected piroplasm consisted of nearly full-length sequencing (1668 bp) of the 18S rRNA gene of this organism. Those sequences were deposited in GenBank. A phylogenetic analysis indicated that they clustered together with R. vitalii from Brazil but separately from large Babesia species of dogs such as Babesia canis, and from species of Theileria of dogs as well. This is the first report of R. vitalii infection in Argentina, and the first case of canine rangeliosis diagnosed outside Brazil. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

Refined identification of Vibrio bacterial flora from Acanthasther planci based on biochemical profiling and analysis of housekeeping genes.

PubMed

Rivera-Posada, J A; Pratchett, M; Cano-Gomez, A; Arango-Gomez, J D; Owens, L

2011-09-09

We used a polyphasic approach for precise identification of bacterial flora (Vibrionaceae) isolated from crown-of-thorns starfish (COTS) from Lizard Island (Great Barrier Reef, Australia) and Guam (U.S.A., Western Pacific Ocean). Previous 16S rRNA gene phylogenetic analysis was useful to allocate and identify isolates within the Photobacterium, Splendidus and Harveyi clades but failed in the identification of Vibrio harveyi-like isolates. Species of the V harveyi group have almost indistinguishable phenotypes and genotypes, and thus, identification by standard biochemical tests and 16S rRNA gene analysis is commonly inaccurate. Biochemical profiling and sequence analysis of additional topA and mreB housekeeping genes were carried out for definitive identification of 19 bacterial isolates recovered from sick and wild COTS. For 8 isolates, biochemical profiles and topA and mreB gene sequence alignments with the closest relatives (GenBank) confirmed previous 16S rRNA-based identification: V. fortis and Photobacterium eurosenbergii species (from wild COTS), and V natriegens (from diseased COTS). Further phylogenetic analysis based on topA and mreB concatenated sequences served to identify the remaining 11 V harveyi-like isolates: V. owensii and V. rotiferianus (from wild COTS), and V. owensii, V. rotiferianus, and V. harveyi (from diseased COTS). This study further confirms the reliability of topA-mreB gene sequence analysis for identification of these close species, and it reveals a wider distribution range of the potentially pathogenic V. harveyi group.

Azospirillum canadense sp. nov., a nitrogen-fixing bacterium isolated from corn rhizosphere.

PubMed

Mehnaz, Samina; Weselowski, Brian; Lazarovits, George

2007-03-01

A free-living diazotrophic strain, DS2(T), was isolated from corn rhizosphere. Polyphasic taxonomy was performed including morphological characterization, Biolog analysis, and 16S rRNA, cpn60 and nifH gene sequence analyses. 16S rRNA gene sequence analysis indicated that strain DS2(T) was closely related to the genus Azospirillum (96 % similarity). Chemotaxonomic characteristics (DNA G+C content 67.9 mol%; Q-10 quinone system; major fatty acid 18 : 1omega7c) were also similar to those of the genus Azospirillum. In all the analyses, including phenotypic characterization using Biolog analysis and comparison of cellular fatty acids, this isolate was found to be different from the closely related species Azospirillum lipoferum, Azospirillum oryzae and Azospirillum brasilense. On the basis of these results, a novel species is proposed for this nitrogen-fixing strain. The name Azospirillum canadense sp. nov. is suggested with the type strain DS2(T) (=NCCB 100108(T)=LMG 23617(T)).

Phylogenetic analysis of dissimilatory Fe(III)-reducing bacteria

USGS Publications Warehouse

Lonergan, D.J.; Jenter, H.L.; Coates, J.D.; Phillips, E.J.P.; Schmidt, T.M.; Lovley, D.R.

1996-01-01

Evolutionary relationships among strictly anaerobic dissimilatory Fe(III)- reducing bacteria obtained from a diversity of sedimentary environments were examined by phylogenetic analysis of 16S rRNA gene sequences. Members of the genera Geobacter, Desulfuromonas, Pelobacter, and Desulfuromusa formed a monophyletic group within the delta subdivision of the class Proteobacteria. On the basis of their common ancestry and the shared ability to reduce Fe(III) and/or S0, we propose that this group be considered a single family, Geobacteraceae. Bootstrap analysis, characteristic nucleotides, and higher- order secondary structures support the division of Geobacteraceae into two subgroups, designated the Geobacter and Desulfuromonas clusters. The genus Desulfuromusa and Pelobacter acidigallici make up a distinct branch with the Desulfuromonas cluster. Several members of the family Geobacteraceae, none of which reduce sulfate, were found to contain the target sequences of probes that have been previously used to define the distribution of sulfate-reducing bacteria and sulfate-reducing bacterium-like microorganisms. The recent isolations of Fe(III)-reducing microorganisms distributed throughout the domain Bacteria suggest that development of 16S rRNA probes that would specifically target all Fe(III) reducers may not be feasible. However, all of the evidence suggests that if a 16S rRNA sequence falls within the family Geobacteraceae, then the organism has the capacity for Fe(III) reduction. The suggestion, based on geological evidence, that Fe(III) reduction was the first globally significant process for oxidizing organic matter back to carbon dioxide is consistent with the finding that acetate-oxidizing Fe(III) reducers are phylogenetically diverse.

Geodermatophilus tzadiensis sp. nov., a UV radiation-resistant bacterium isolated from sand of the Saharan desert.

PubMed

Montero-Calasanz, Maria del Carmen; Göker, Markus; Broughton, William J; Cattaneo, Arlette; Favet, Jocelyne; Pötter, Gabriele; Rohde, Manfred; Spröer, Cathrin; Schumann, Peter; Klenk, Hans-Peter; Gorbushina, Anna A

2013-05-01

Three novel Gram-positive, aerobic, actinobacterial strains, CF5/2(T), CF5/1 and CF7/1, were isolated in 2007 during environmental screening of arid desert soil in the Sahara desert, Chad. Results from riboprinting, MALDI-TOF protein spectra and 16S rRNA sequence analysis confirmed that all three strains belonged to the same species. Phylogenetic analysis of 16S rRNA sequences with the strains' closest relatives indicated that they represented a distinct species. The three novel strains also shared a number of physiological and biochemical characteristics distinct from previously named Geodermatophilus species. The novel strains' peptidoglycan contained meso-diaminopimelic acid; their main phospholipids were phosphatidylcholine, phosphatidylethanolamine, diphosphatidylglycerol, phosphatidylinositol and a small amount of phosphatidylglycerol; MK-9(H4) was the dominant menaquinone. The major cellular fatty acids were the branched-chain saturated acids iso-C16:0 and iso-C15:0. Galactose was detected as diagnostic sugar. Based on these chemotaxonomic results, 16S rRNA gene sequence analysis and DNA-DNA hybridization between strain CF5/2(T) and the type strains of Geodermatophilus saharensis, Geodermatophilus arenarius, Geodermatophilus nigrescens, Geodermatophilus telluris and Geodermatophilus siccatus, the isolates CF5/2(T), CF5/1 and CF7/1 are proposed to represent a novel species, Geodermatophilus tzadiensis, with type strain CF5/2(T)=DSM 45416=MTCC 11411 and two reference strains, CF5/1 (DSM 45415) and CF7/1 (DSM 45420). Copyright © 2013 Elsevier GmbH. All rights reserved.

Ideonella azotifigens sp. nov., an aerobic diazotroph of the Betaproteobacteria isolated from grass rhizosphere soil, and emended description of the genus Ideonella.

PubMed

Noar, Jesse D; Buckley, Daniel H

2009-08-01

Strain 1a22T, a nitrogen-fixing bacterium, was isolated from soil associated with the rhizosphere of a perennial grass growing in a fallow agricultural field in Ithaca, New York, USA. Analysis of the 16S rRNA gene sequence placed the strain in the Rubrivivax-Roseateles-Leptothrix-Azohydromonas-Aquincola-Ideonella branch of the Betaproteobacteria and the closest characterized relative was the type strain of Ideonella dechloratans (97.7% 16S rRNA sequence similarity). Cells of strain 1a22T were Gram-negative, motile, straight rods, which formed polyhydroxybutyrate-like granules and were positive for oxidase and weakly positive for catalase. Cells were chemo-organotrophic, unable to grow by reduction of chlorate or nitrate and grew exclusively through aerobic respiration. Growth with mannitol on N-free solid media caused the strain to produce copious amounts of slime. The G+C content of the genomic DNA was 67.4 mol%. The major cellular fatty acids were C16:1 cis-9 and C16:0 and cells contained significant amounts of the hydroxy fatty acids C10:0 3-OH, C12:0 2-OH and C12:0 3-OH. Based on DNA-DNA hybridization studies, 16S rRNA gene sequence analysis, fatty acid analysis, and morphological and physiological characteristics, strain 1a22T represents a novel species in the genus Ideonella, for which the name Ideonella azotifigens sp. nov. is proposed. The type strain of Ideonella azotifigens is 1a22T (=JCM 15503T=DSM 21438T).

Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov., isolated from flowers in French Guiana.

PubMed

Amoikon, Tiemele Laurent Simon; Grondin, Cécile; Djéni, Théodore N'Dédé; Jacques, Noémie; Casaregola, Serge

2018-05-21

Analysis of yeasts isolated from various biotopes in French Guiana led to the identification of two strains isolated from flowers and designated CLIB 1634 T and CLIB 1707 T . Comparison of the D1/D2 domain of the large subunit (LSU D1/D2) rRNA gene sequences of CLIB 1634 T and CLIB 1707 T to those in the GenBank database revealed that these strains belong to the Starmerella clade. Strain CLIB 1634 T was shown to diverge from the closely related Starmerella apicola type strain CBS 2868 T with a sequence divergence of 1.34 and 1.30 %, in the LSU D1/D2 rRNA gene and internal transcribed spacer (ITS) sequences respectively. Strain CLIB 1634 T and Candida apicola CBS 2868 T diverged by 3.81 and 14.96 % at the level of the protein-coding gene partial sequences EF-1α and RPB2, respectively. CLIB 1707 T was found to have sequence divergence of 3.88 and 9.16 % in the LSU D1/D2 rRNA gene and ITS, respectively, from that of the most closely related species Starmerella ratchasimensis type strain CBS 10611 T . The species Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov. are proposed to accommodate strains CLIB 1634 T (=CBS 15247 T ) and CLIB 1707 T (=CBS 15257 T ), respectively.

First molecular detection and characterization of Hepatozoon and Sarcocystis spp. in field mice and voles from Japan.

PubMed

Moustafa, Mohamed Abdallah Mohamed; Shimozuru, Michito; Mohamed, Wessam; Taylor, Kyle Rueben; Nakao, Ryo; Sashika, Mariko; Tsubota, Toshio

2017-08-01

Sarcocystis and Hepatozoon species are protozoan parasites that are frequently detected in domestic and wild animals. Rodents are considered common intermediate and paratenic hosts for several Sarcocystis and Hepatozoon species. Here, blood DNA samples from a total of six rodents, including one Myodes rutilus, one Myodes rufocanus, and four Apodemus speciosus, collected from Hokkaido, Japan, were shown by conventional PCR of the 18S ribosomal RNA (rRNA) gene to contain Sarcocystis and Hepatozoon DNA. Sequencing of the DNA detected one Sarcocystis sp. in the M. rufocanus sample and two different Hepatozoon spp. in the M. rutilus and A. speciosus samples. Phylogenetic analysis showed that the detected Sarcocystis sp. sequence grouped with GenBank Sarcocystis sequences from rodents, snakes, and raccoons from Japan and China. The 18S rRNA partial gene sequences of both detected Hepatozoon spp. clustered with GenBank Hepatozoon sequences from snakes, geckos and voles in Europe, Africa, and Asia. This study provides evidence that wild rodents have a role in the maintenance of Sarcocystis and Hepatozoon species on the island of Hokkaido.

Equally parsimonious pathways through an RNA sequence space are not equally likely

NASA Technical Reports Server (NTRS)

Lee, Y. H.; DSouza, L. M.; Fox, G. E.

1997-01-01

An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

Draft Genome of Scalindua rubra, Obtained from the Interface Above the Discovery Deep Brine in the Red Sea, Sheds Light on Potential Salt Adaptation Strategies in Anammox Bacteria.

PubMed

Speth, Daan R; Lagkouvardos, Ilias; Wang, Yong; Qian, Pei-Yuan; Dutilh, Bas E; Jetten, Mike S M

2017-07-01

Several recent studies have indicated that members of the phylum Planctomycetes are abundantly present at the brine-seawater interface (BSI) above multiple brine pools in the Red Sea. Planctomycetes include bacteria capable of anaerobic ammonium oxidation (anammox). Here, we investigated the possibility of anammox at BSI sites using metagenomic shotgun sequencing of DNA obtained from the BSI above the Discovery Deep brine pool. Analysis of sequencing reads matching the 16S rRNA and hzsA genes confirmed presence of anammox bacteria of the genus Scalindua. Phylogenetic analysis of the 16S rRNA gene indicated that this Scalindua sp. belongs to a distinct group, separate from the anammox bacteria in the seawater column, that contains mostly sequences retrieved from high-salt environments. Using coverage- and composition-based binning, we extracted and assembled the draft genome of the dominant anammox bacterium. Comparative genomic analysis indicated that this Scalindua species uses compatible solutes for osmoadaptation, in contrast to other marine anammox bacteria that likely use a salt-in strategy. We propose the name Candidatus Scalindua rubra for this novel species, alluding to its discovery in the Red Sea.

Phylogenetic analysis of nitrite, nitric oxide, and nitrous oxide respiratory enzymes reveal a complex evolutionary history for denitrification.

PubMed

Jones, Christopher M; Stres, Blaz; Rosenquist, Magnus; Hallin, Sara

2008-09-01

Denitrification is a facultative respiratory pathway in which nitrite (NO2(-)), nitric oxide (NO), and nitrous oxide (N2O) are successively reduced to nitrogen gas (N(2)), effectively closing the nitrogen cycle. The ability to denitrify is widely dispersed among prokaryotes, and this polyphyletic distribution has raised the possibility of horizontal gene transfer (HGT) having a substantial role in the evolution of denitrification. Comparisons of 16S rRNA and denitrification gene phylogenies in recent studies support this possibility; however, these results remain speculative as they are based on visual comparisons of phylogenies from partial sequences. We reanalyzed publicly available nirS, nirK, norB, and nosZ partial sequences using Bayesian and maximum likelihood phylogenetic inference. Concomitant analysis of denitrification genes with 16S rRNA sequences from the same organisms showed substantial differences between the trees, which were supported by examining the posterior probability of monophyletic constraints at different taxonomic levels. Although these differences suggest HGT of denitrification genes, the presence of structural variants for nirK, norB, and nosZ makes it difficult to determine HGT from other evolutionary events. Additional analysis using phylogenetic networks and likelihood ratio tests of phylogenies based on full-length sequences retrieved from genomes also revealed significant differences in tree topologies among denitrification and 16S rRNA gene phylogenies, with the exception of the nosZ gene phylogeny within the data set of the nirK-harboring genomes. However, inspection of codon usage and G + C content plots from complete genomes gave no evidence for recent HGT. Instead, the close proximity of denitrification gene copies in the genomes of several denitrifying bacteria suggests duplication. Although HGT cannot be ruled out as a factor in the evolution of denitrification genes, our analysis suggests that other phenomena, such gene duplication/divergence and lineage sorting, may have differently influenced the evolution of each denitrification gene.

Occurrence and molecular characterization of hemoplasmas in domestic dogs and wild mammals in a Brazilian wetland.

PubMed

de Sousa, Keyla Carstens Marques; Herrera, Heitor Miraglia; Secato, Caroline Tostes; Oliveira, André do Vale; Santos, Filipe Martins; Rocha, Fabiana Lopes; Barreto, Wanessa Teixeira Gomes; Macedo, Gabriel Carvalho; de Andrade Pinto, Pedro Cordeiro Estrela; Machado, Rosangela Zacarias; Costa, Mirela Tinucci; André, Marcos Rogério

2017-07-01

Hemotropic mycoplasmas are known to cause anemia in several mammalian species. The present work aimed to investigate the occurrence of Mycoplasma spp. in wild mammals, domestic dogs and their respective ectoparasites, in southern Pantanal region, central-western Brazil. Between August 2013 and March 2015, 31 Nasua nasua, 78 Cerdocyon thous, seven Leopardus pardalis, 42 dogs, 110 wild rodents, and 30 marsupials were trapped and ectoparasites (ticks and fleas) found parasitizing the animals were collected. Mammals and ectoparasites DNA samples were submitted to conventional PCR assays for Mycoplasma spp. targeting 16S rRNA and RnaseP genes. Twenty-four N. nasua, three C. thous, two domestic dogs, one L. pardalis and one wild rodent were positive for 16S rRNA PCR protocols. Fourteen N. nasua samples were also positive in RnaseP PCR. No marsupial or arthropod showed positivity for Mycoplasma spp. The phylogenetic analyses based on 16S rRNA gene showed that all sequences obtained from dogs, two sequences obtained from C. thous and ten sequences obtained from N. nasua showed to be closely related to Mycoplasma haemocanis/Mycoplasma haemofelis species. Genotypes closely related to 'Candidatus Mycoplasma haemominutum' and Mycoplasma haemomuris were detected in the L. pardalis and in the wild rodent, respectively. Probably a novel Mycoplasma genotype, closely related to a sequence obtained from a Brazilian capybara was detected in 14 N. nasua, based on a concatenated phylogenetic analysis of 16S rRNA and RnaseP genes. The present study revealed that wild animals in southern Pantanal region, Brazil, are exposed to different species of hemoplasmas. Copyright © 2017 Elsevier B.V. All rights reserved.

Biphasic Study to Characterize Agricultural Biogas Plants by High-Throughput 16S rRNA Gene Amplicon Sequencing and Microscopic Analysis.

PubMed

Maus, Irena; Kim, Yong Sung; Wibberg, Daniel; Stolze, Yvonne; Off, Sandra; Antonczyk, Sebastian; Pühler, Alfred; Scherer, Paul; Schlüter, Andreas

2017-02-28

Process surveillance within agricultural biogas plants (BGPs) was concurrently studied by high-throughput 16S rRNA gene amplicon sequencing and an optimized quantitative microscopic fingerprinting (QMF) technique. In contrast to 16S rRNA gene amplicons, digitalized microscopy is a rapid and cost-effective method that facilitates enumeration and morphological differentiation of the most significant groups of methanogens regarding their shape and characteristic autofluorescent factor 420. Moreover, the fluorescence signal mirrors cell vitality. In this study, four different BGPs were investigated. The results indicated stable process performance in the mesophilic BGPs and in the thermophilic reactor. Bacterial subcommunity characterization revealed significant differences between the four BGPs. Most remarkably, the genera Defluviitoga and Halocella dominated the thermophilic bacterial subcommunity, whereas members of another taxon, Syntrophaceticus , were found to be abundant in the mesophilic BGP. The domain Archaea was dominated by the genus Methanoculleus in all four BGPs, followed by Methanosaeta in BGP1 and BGP3. In contrast, Methanothermobacter members were highly abundant in the thermophilic BGP4. Furthermore, a high consistency between the sequencing approach and the QMF method was shown, especially for the thermophilic BGP. The differences elucidated that using this biphasic approach for mesophilic BGPs provided novel insights regarding disaggregated single cells of Methanosarcina and Methanosaeta species. Both dominated the archaeal subcommunity and replaced coccoid Methanoculleus members belonging to the same group of Methanomicrobiales that have been frequently observed in similar BGPs. This work demonstrates that combining QMF and 16S rRNA gene amplicon sequencing is a complementary strategy to describe archaeal community structures within biogas processes.

The chaperonin-60 universal target is a barcode for bacteria that enables de novo assembly of metagenomic sequence data.

PubMed

Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E

2012-01-01

Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.

Differentiation and classification of phytoplasmas in the pigeon pea witches'-broom group (16SrIX): an update based on multiple gene sequence analysis.

PubMed

Lee, I-M; Bottner-Parker, K D; Zhao, Y; Bertaccini, A; Davis, R E

2012-09-01

The pigeon pea witches'-broom phytoplasma group (16SrIX) comprises diverse strains that cause numerous diseases in leguminous trees and herbaceous crops, vegetables, a fruit, a nut tree and a forest tree. At least 14 strains have been reported worldwide. Comparative phylogenetic analyses of the highly conserved 16S rRNA gene and the moderately conserved rplV (rpl22)-rpsC (rps3) and secY genes indicated that the 16SrIX group consists of at least six distinct genetic lineages. Some of these lineages cannot be readily differentiated based on analysis of 16S rRNA gene sequences alone. The relative genetic distances among these closely related lineages were better assessed by including more variable genes [e.g. ribosomal protein (rp) and secY genes]. The present study demonstrated that virtual RFLP analyses using rp and secY gene sequences allowed unambiguous identification of such lineages. A coding system is proposed to designate each distinct rp and secY subgroup in the 16SrIX group.

Characterization of a novel variant of Mycobacterium chimaera.

PubMed

van Ingen, J; Hoefsloot, W; Buijtels, P C A M; Tortoli, E; Supply, P; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

2012-09-01

In this study, nonchromogenic mycobacteria were isolated from pulmonary samples of three patients in the Netherlands. All isolates had identical, unique 16S rRNA gene and 16S-23S ITS sequences, which were closely related to those of Mycobacterium chimaera and Mycobacterium marseillense. The biochemical features of the isolates differed slightly from those of M. chimaera, suggesting that the isolates may represent a possible separate species within the Mycobacterium avium complex (MAC). However, the cell-wall mycolic acid pattern, analysed by HPLC, and the partial sequences of the hsp65 and rpoB genes were identical to those of M. chimaera. We concluded that the isolates represent a novel variant of M. chimaera. The results of this analysis have led us to question the currently used methods of species definition for members of the genus Mycobacterium, which are based largely on 16S rRNA or rpoB gene sequencing. Definitions based on a single genetic target are likely to be insufficient. Genetic divergence, especially in the MAC, yields strains that cannot be confidently assigned to a specific species based on the analysis of a single genetic target.

Veillonella infantium sp. nov., an anaerobic, Gram-stain-negative coccus isolated from tongue biofilm of a Thai child.

PubMed

Mashima, Izumi; Liao, Yu-Chieh; Miyakawa, Hiroshi; Theodorea, Citra F; Thawboon, Boonyanit; Thaweboon, Sroisiri; Scannapieco, Frank A; Nakazawa, Futoshi

2018-04-01

A strain of a novel anaerobic, Gram-stain-negative coccus was isolated from the tongue biofilm of a Thai child. This strain was shown, at the phenotypic level and based on 16S rRNA gene sequencing, to be a member of the genus Veillonella. Comparative analysis of the 16S rRNA, dnaK and rpoB gene sequences indicated that phylogenetically the strain comprised a distinct novel branch within the genus Veillonella. The novel strain showed 99.8, 95.1 and 95.9 % similarity to partial 16S rRNA, dnaK and rpoB gene sequences, respectively, to the type strains of the two most closely related species, Veillonelladispar ATCC 17748 T and Veillonellatobetsuensis ATCC BAA-2400 T . The novel strain could be discriminated from previously reported species of the genus Veillonella based on partial dnaK and rpoB gene sequencing and average nucleotide identity values. The major acid end-product produced by this strain was acetic acid under anaerobic conditions in trypticase-yeast extract-haemin with 1 % (w/v) glucose or fructose medium. Lactate was fermented to acetic acid and propionic acid. Based on these observations, this strain represents a novel species, for which the name Veillonella infantium sp. nov. is proposed. The type strain is T11011-4 T (=JCM 31738 T =TSD-88 T ).

Streptococcus pharyngis sp. nov., a novel streptococcal species isolated from the respiratory tract of wild rabbits.

PubMed

Vela, Ana I; Casas-Díaz, Encarna; Lavín, Santiago; Domínguez, Lucas; Fernández-Garayzábal, Jose F

2015-09-01

Four isolates of an unknown Gram-stain-positive, catalase-negative coccus-shaped organism, isolated from the pharynx of four wild rabbits, were characterized by phenotypic and molecular genetic methods. The micro-organisms were tentatively assigned to the genus Streptococcus based on cellular morphological and biochemical criteria, although the organisms did not appear to correspond to any species with a validly published name. Comparative 16S rRNA gene sequencing confirmed their identification as members of the genus Streptococcus, being most closely related phylogenetically to Streptococcus porcorum 682-03(T) (96.9% 16S rRNA gene sequence similarity). Analysis of rpoB and sodA gene sequences showed divergence values between the novel species and S. porcorum 682-03(T) (the closest phylogenetic relative determined from 16S rRNA gene sequences) of 18.1 and 23.9%, respectively. The novel bacterial isolate could be distinguished from the type strain of S. porcorum by several biochemical characteristics, such as the production of glycyl-tryptophan arylamidase and α-chymotrypsin, and the non-acidification of different sugars. Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be assigned to a novel species of the genus Streptococcus, and named Streptococcus pharyngis sp. nov. The type strain is DICM10-00796B(T) ( = CECT 8754(T) = CCUG 66496(T)).

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1991-01-21

bisphosphate carboxylase ( RubisCO ) from symbiotic bacteria of various origins, b) To continue methods development for 16S rRNA sequencing from symbionts in...frozen and badly preserved specimens, and c) To use these new techniques to sequence 16s DNA from a variety of symbionts a) RubisCO We have cloned the...gene coding for RubisCO from the sulfur oxidixing symbiont of the gastropod Alvinochoncha hessleri. Nucleotide sequence analysis of the cloned fragment

Complete Genome Sequence of a New Ruminococcaceae Bacterium Isolated from Anaerobic Biomass Hydrolysis.

PubMed

Hahnke, Sarah; Abendroth, Christian; Langer, Thomas; Codoñer, Francisco M; Ramm, Patrice; Porcar, Manuel; Luschnig, Olaf; Klocke, Michael

2018-04-05

A new Ruminococcaceae bacterium, strain HV4-5-B5C, participating in the anaerobic digestion of grass, was isolated from a mesophilic two-stage laboratory-scale leach bed biogas system. The draft annotated genome sequence presented in this study and 16S rRNA gene sequence analysis indicated the affiliation of HV4-5-B5C with the family Ruminococcaceae outside recently described genera. Copyright © 2018 Hahnke et al.

Assessing the diversity of AM fungi in arid gypsophilous plant communities.

PubMed

Alguacil, M M; Roldán, A; Torres, M P

2009-10-01

In the present study, we used PCR-Single-Stranded Conformation Polymorphism (SSCP) techniques to analyse arbuscular mycorrhizal fungi (AMF) communities in four sites within a 10 km(2) gypsum area in Southern Spain. Four common plant species from these ecosystems were selected. The AM fungal small-subunit (SSU) rRNA genes were subjected to PCR, cloning, SSCP analysis, sequencing and phylogenetic analyses. A total of 1443 SSU rRNA sequences were analysed, for 21 AM fungal types: 19 belonged to the genus Glomus, 1 to the genus Diversispora and 1 to the Scutellospora. Four sequence groups were identified, which showed high similarity to sequences of known glomalean species or isolates: Glo G18 to Glomus constrictum, Glo G1 to Glomus intraradices, Glo G16 to Glomus clarum, Scut to Scutellospora dipurpurescens and Div to one new genus in the family Diversisporaceae identified recently as Otospora bareai. There were three sequence groups that received strong support in the phylogenetic analysis, and did not seem to be related to any sequences of AM fungi in culture or previously found in the database; thus, they could be novel taxa within the genus Glomus: Glo G4, Glo G2 and Glo G14. We have detected the presence of both generalist and potential specialist AMF in gypsum ecosystems. The AMF communities were different in the plant studied suggesting some degree of preference in the interactions between these symbionts.

Novel species including Mycobacterium fukienense sp. is found from tuberculosis patients in Fujian Province, China, using phylogenetic analysis of Mycobacterium chelonae/abscessus complex.

PubMed

Zhang, Yuan Yuan; Li, Yan Bing; Huang, Ming Xiang; Zhao, Xiu Qin; Zhang, Li Shui; Liu, Wen En; Wan, Kang Lin

2013-11-01

To identify the novel species 'Mycobacterium fukienense' sp. nov of Mycobacterium chelonae/abscessus complex from tuberculosis patients in Fujian Province, China. Five of 27 clinical Mycobacterium isolates (Cls) were previously identified as M. chelonae/abscessus complex by sequencing the hsp65, rpoB, 16S-23S rRNA internal transcribed spacer region (its), recA and sodA house-keeping genes commonly used to describe the molecular characteristics of Mycobacterium. Clinical Mycobacterium isolates were classified according to the gene sequence using a clustering analysis program. Sequence similarity within clusters and diversity between clusters were analyzed. The 5 isolates were identified with distinct sequences exhibiting 99.8% homology in the hsp65 gene. However, a complete lack of homology was observed among the sequences of the rpoB, 16S-23S rRNA internal transcribed spacer region (its), sodA, and recA genes as compared with the M. abscessus. Furthermore, no match for rpoB, sodA, and recA genes was identified among the published sequences. The novel species, Mycobacterium fukienense, is identified from tuberculosis patients in Fujian Province, China, which does not belong to any existing subspecies of M. chelonea/abscessus complex. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Morphometric and molecular data on two mitochondrial genes of a newly discovered chimaeran fish ( Hydrolagus melanophasma, Chondrichthyes)

NASA Astrophysics Data System (ADS)

De La Cruz-Agüero, José; García-Rodríguez, Francisco Javier; Cota-Gómez, Víctor Manuel; Melo-Barrera, Felipe Neri; González-Armas, Rogelio

2012-06-01

Fresh and preserved (type material) specimens of the black ghost chimaera Hydrolagus melanophasma were compared for morphometric characteristics. A molecular comparison was also performed on two mitochondrial gene sequences (12S rRNA and 16S rRNA gene sequences). While significant differences in measurements were found, the differences were not attributable to sexual dimorphism or the quality of the specimens, but to the sample size and the type of statistical tests. The result of the genetic characterization showed that 12S rRNA and 16S rRNA genes represented robust molecular markers that characterized the species.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

Optimization of Multilocus Sequence Analysis for Identification of Species in the Genus Vibrio

PubMed Central

Gabriel, Michael W.; Matsui, George Y.; Friedman, Robert

2014-01-01

Multilocus sequence analysis (MLSA) is an important method for identification of taxa that are not well differentiated by 16S rRNA gene sequences alone. In this procedure, concatenated sequences of selected genes are constructed and then analyzed. The effects that the number and the order of genes used in MLSA have on reconstruction of phylogenetic relationships were examined. The recA, rpoA, gapA, 16S rRNA gene, gyrB, and ftsZ sequences from 56 species of the genus Vibrio were used to construct molecular phylogenies, and these were evaluated individually and using various gene combinations. Phylogenies from two-gene sequences employing recA and rpoA in both possible gene orders were different. The addition of the gapA gene sequence, producing all six possible concatenated sequences, reduced the differences in phylogenies to degrees of statistical (bootstrap) support for some nodes. The overall statistical support for the phylogenetic tree, assayed on the basis of a reliability score (calculated from the number of nodes having bootstrap values of ≥80 divided by the total number of nodes) increased with increasing numbers of genes used, up to a maximum of four. No further improvement was observed from addition of the fifth gene sequence (ftsZ), and addition of the sixth gene (gyrB) resulted in lower proportions of strongly supported nodes. Reductions in the numbers of strongly supported nodes were also observed when maximum parsimony was employed for tree construction. Use of a small number of gene sequences in MLSA resulted in accurate identification of Vibrio species. PMID:24951781

Isolation and Distribution of a Novel Iron-Oxidizing Crenarchaeon from Acidic Geothermal Springs in Yellowstone National Park▿ †

PubMed Central

Kozubal, M.; Macur, R. E.; Korf, S.; Taylor, W. P.; Ackerman, G. G.; Nagy, A.; Inskeep, W. P.

2008-01-01

Novel thermophilic crenarchaea have been observed in Fe(III) oxide microbial mats of Yellowstone National Park (YNP); however, no definitive work has identified specific microorganisms responsible for the oxidation of Fe(II). The objectives of the current study were to isolate and characterize an Fe(II)-oxidizing member of the Sulfolobales observed in previous 16S rRNA gene surveys and to determine the abundance and distribution of close relatives of this organism in acidic geothermal springs containing high concentrations of dissolved Fe(II). Here we report the isolation and characterization of the novel, Fe(II)-oxidizing, thermophilic, acidophilic organism Metallosphaera sp. strain MK1 obtained from a well-characterized acid-sulfate-chloride geothermal spring in Norris Geyser Basin, YNP. Full-length 16S rRNA gene sequence analysis revealed that strain MK1 exhibits only 94.9 to 96.1% sequence similarity to other known Metallosphaera spp. and less than 89.1% similarity to known Sulfolobus spp. Strain MK1 is a facultative chemolithoautotroph with an optimum pH range of 2.0 to 3.0 and an optimum temperature range of 65 to 75°C. Strain MK1 grows optimally on pyrite or Fe(II) sorbed onto ferrihydrite, exhibiting doubling times between 10 and 11 h under aerobic conditions (65°C). The distribution and relative abundance of MK1-like 16S rRNA gene sequences in 14 acidic geothermal springs containing Fe(III) oxide microbial mats were evaluated. Highly related MK1-like 16S rRNA gene sequences (>99% sequence similarity) were consistently observed in Fe(III) oxide mats at temperatures ranging from 55 to 80°C. Quantitative PCR using Metallosphaera-specific primers confirmed that organisms highly similar to strain MK1 comprised up to 40% of the total archaeal community at selected sites. The broad distribution of highly related MK1-like 16S rRNA gene sequences in acidic Fe(III) oxide microbial mats is consistent with the observed characteristics and growth optima of Metallosphaera-like strain MK1 and emphasizes the importance of this newly described taxon in Fe(II) chemolithotrophy in acidic high-temperature environments of YNP. PMID:18083851

Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

PubMed Central

Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

2006-01-01

Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

Comparison of Microbiomes between Red Poultry Mite Populations (Dermanyssus gallinae): Predominance of Bartonella-like Bacteria.

PubMed

Hubert, Jan; Erban, Tomas; Kopecky, Jan; Sopko, Bruno; Nesvorna, Marta; Lichovnikova, Martina; Schicht, Sabine; Strube, Christina; Sparagano, Olivier

2017-11-01

Blood feeding red poultry mites (RPM) serve as vectors of pathogenic bacteria and viruses among vertebrate hosts including wild birds, poultry hens, mammals, and humans. The microbiome of RPM has not yet been studied by high-throughput sequencing. RPM eggs, larvae, and engorged adult/nymph samples obtained in four poultry houses in Czechia were used for microbiome analyses by Illumina amplicon sequencing of the 16S ribosomal RNA (rRNA) gene V4 region. A laboratory RPM population was used as positive control for transcriptome analysis by pyrosequencing with identification of sequences originating from bacteria. The samples of engorged adult/nymph stages had 100-fold more copies of 16S rRNA gene copies than the samples of eggs and larvae. The microbiome composition showed differences among the four poultry houses and among observed developmental stadia. In the adults' microbiome 10 OTUs comprised 90 to 99% of all sequences. Bartonella-like bacteria covered between 30 and 70% of sequences in RPM microbiome and 25% bacterial sequences in transcriptome. The phylogenetic analyses of 16S rRNA gene sequences revealed two distinct groups of Bartonella-like bacteria forming sister groups: (i) symbionts of ants; (ii) Bartonella genus. Cardinium, Wolbachia, and Rickettsiella sp. were found in the microbiomes of all tested stadia, while Spiroplasma eriocheiris and Wolbachia were identified in the laboratory RPM transcriptome. The microbiomes from eggs, larvae, and engorged adults/nymphs differed. Bartonella-like symbionts were found in all stadia and sampling sites. Bartonella-like bacteria was the most diversified group within the RPM microbiome. The presence of identified putative pathogenic bacteria is relevant with respect to human and animal health issues while the identification of symbiontic bacteria can lead to new control methods targeting them to destabilize the arthropod host.

A taxonomic framework for cable bacteria and proposal of the candidate genera Electrothrix and Electronema.

PubMed

Trojan, Daniela; Schreiber, Lars; Bjerg, Jesper T; Bøggild, Andreas; Yang, Tingting; Kjeldsen, Kasper U; Schramm, Andreas

2016-07-01

Cable bacteria are long, multicellular filaments that can conduct electric currents over centimeter-scale distances. All cable bacteria identified to date belong to the deltaproteobacterial family Desulfobulbaceae and have not been isolated in pure culture yet. Their taxonomic delineation and exact phylogeny is uncertain, as most studies so far have reported only short partial 16S rRNA sequences or have relied on identification by a combination of filament morphology and 16S rRNA-targeted fluorescence in situ hybridization with a Desulfobulbaceae-specific probe. In this study, nearly full-length 16S rRNA gene sequences of 16 individual cable bacteria filaments from freshwater, salt marsh, and marine sites of four geographic locations are presented. These sequences formed a distinct, monophyletic sister clade to the genus Desulfobulbus and could be divided into six coherent, species-level clusters, arranged as two genus-level groups. The same grouping was retrieved by phylogenetic analysis of full or partial dsrAB genes encoding the dissimilatory sulfite reductase. Based on these results, it is proposed to accommodate cable bacteria within two novel candidate genera: the mostly marine "Candidatus Electrothrix", with four candidate species, and the mostly freshwater "Candidatus Electronema", with two candidate species. This taxonomic framework can be used to assign environmental sequences confidently to the cable bacteria clade, even without morphological information. Database searches revealed 185 16S rRNA gene sequences that affiliated within the clade formed by the proposed cable bacteria genera, of which 120 sequences could be assigned to one of the six candidate species, while the remaining 65 sequences indicated the existence of up to five additional species. Copyright © 2016 The Author(s). Published by Elsevier GmbH.. All rights reserved.

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

MetaMetaDB: A Database and Analytic System for Investigating Microbial Habitability

PubMed Central

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes. PMID:24475242

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

Community structure of the metabolically active rumen bacterial and archaeal communities of dairy cows over the transition period

PubMed Central

Zhu, Zhigang; Noel, Samantha Joan; Difford, Gareth Frank; Al-Soud, Waleed Abu; Brejnrod, Asker; Sørensen, Søren Johannes; Lassen, Jan; Løvendahl, Peter; Højberg, Ole

2017-01-01

Dairy cows experience dramatic changes in host physiology from gestation to lactation period and dietary switch from high-forage prepartum diet to high-concentrate postpartum diet over the transition period (parturition +/- three weeks). Understanding the community structure and activity of the rumen microbiota and its associative patterns over the transition period may provide insight for e.g. improving animal health and production. In the present study, rumen samples from ten primiparous Holstein dairy cows were collected over seven weeks spanning the transition period. Total RNA was extracted from the rumen samples and cDNA thereof was subsequently used for characterizing the metabolically active bacterial (16S rRNA transcript amplicon sequencing) and archaeal (qPCR, T-RFLP and mcrA and 16S rRNA transcript amplicon sequencing) communities. The metabolically active bacterial community was dominated by three phyla, showing significant changes in relative abundance range over the transition period: Firmicutes (from prepartum 57% to postpartum 35%), Bacteroidetes (from prepartum 22% to postpartum 18%) and Proteobacteria (from prepartum 7% to postpartum 32%). For the archaea, qPCR analysis of 16S rRNA transcript number, revealed a significant prepartum to postpartum increase in Methanobacteriales, in accordance with an observed increase (from prepartum 80% to postpartum 89%) in relative abundance of 16S rRNA transcript amplicons allocated to this order. On the other hand, a significant prepartum to postpartum decrease (from 15% to 2%) was observed in relative abundance of Methanomassiliicoccales 16S rRNA transcripts. In contrast to qPCR analysis of the 16S rRNA transcripts, quantification of mcrA transcripts revealed no change in total abundance of metabolically active methanogens over the transition period. According to T-RFLP analysis of the mcrA transcripts, two Methanobacteriales genera, Methanobrevibacter and Methanosphaera (represented by the T-RFs 39 and 267 bp), represented more than 70% of the metabolically active methanogens, showing no significant changes over the transition period; minor T-RFs, likely to represent members of the order Methanomassiliicoccales and with a relative abundance below 5% in total, decreased significantly over the transition period. In accordance with the T-RFLP analysis, the mcrA transcript amplicon sequencing revealed Methanobacteriales to cover 99% of the total reads, dominated by the genera Methanobrevibacter (75%) and Methanosphaera (24%), whereas the Methanomassiliicoccales order covered only 0.2% of the total reads. In conclusion, the present study showed that the structure of the metabolically active bacterial and archaeal rumen communities changed over the transition period, likely in response to the dramatic changes in physiology and nutritional factors like dry matter intake and feed composition. It should be noted however that for the methanogens, the observed community changes were influenced by the analyzed gene (mcrA or 16S rRNA). PMID:29117259

16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

PubMed

Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

2009-04-01

For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

Bacterial diversity of Taxus rhizosphere: culture-independent and culture-dependent approaches.

PubMed

Hao, Da Cheng; Ge, Guang Bo; Yang, Ling

2008-07-01

The regional variability of Taxus rhizosphere bacterial community composition and diversity was studied by comparative analysis of three large 16S rRNA gene clone libraries from the Taxus rhizosphere in different regions of China (subtropical and temperate regions). One hundred and forty-six clones were screened for three libraries. Phylogenetic analysis of 16S rRNA gene sequences demonstrated that the abundance of sequences affiliated with Gammaproteobacteria, Betaproteobacteria, and Actinobacteria was higher in the library from the T. xmedia rhizosphere of the temperate region compared with the subtropical Taxus mairei rhizosphere. On the other hand, Acidobacteria was more abundant in libraries from the subtropical Taxus mairei rhizosphere. Richness estimates and diversity indices of three libraries revealed major differences, indicating a higher richness in the Taxus rhizosphere bacterial communities of the subtropical region and considerable variability in the bacterial community composition within this region. By enrichment culture, a novel Actinobacteria strain DICP16 was isolated from the T. xmedia rhizosphere of the temperate region and was identified as Leifsonia shinshuensis sp. via 16S rRNA gene and gyrase B sequence analyses. DICP16 was able to remove the xylosyl group from 7-xylosyl-10-deacetylbaccatin III and 7-xylosyl-10-deacetylpaclitaxel, thereby making the xylosyltaxanes available as sources of 10-deacetylbaccatin III and the anticancer drug paclitaxel. Taken together, the present studies provide, for the first time, the knowledge of the biodiversity of microorganisms populating Taxus rhizospheres.

Partial gene sequences for the A subunit of methyl-coenzyme M reductase (mcrI) as a phylogenetic tool for the family Methanosarcinaceae

NASA Technical Reports Server (NTRS)

Springer, E.; Sachs, M. S.; Woese, C. R.; Boone, D. R.

1995-01-01

Representatives of the family Methanosarcinaceae were analyzed phylogenetically by comparing partial sequences of their methyl-coenzyme M reductase (mcrI) genes. A 490-bp fragment from the A subunit of the gene was selected, amplified by the PCR, cloned, and sequenced for each of 25 strains belonging to the Methanosarcinaceae. The sequences obtained were aligned with the corresponding portions of five previously published sequences, and all of the sequences were compared to determine phylogenetic distances by Fitch distance matrix methods. We prepared analogous trees based on 16S rRNA sequences; these trees corresponded closely to the mcrI trees, although the mcrI sequences of pairs of organisms had 3.01 +/- 0.541 times more changes than the respective pairs of 16S rRNA sequences, suggesting that the mcrI fragment evolved about three times more rapidly than the 16S rRNA gene. The qualitative similarity of the mcrI and 16S rRNA trees suggests that transfer of genetic information between dissimilar organisms has not significantly affected these sequences, although we found inconsistencies between some mcrI distances that we measured and and previously published DNA reassociation data. It is unlikely that multiple mcrI isogenes were present in the organisms that we examined, because we found no major discrepancies in multiple determinations of mcrI sequences from the same organism. Our primers for the PCR also match analogous sites in the previously published mcrII sequences, but all of the sequences that we obtained from members of the Methanosarcinaceae were more closely related to mcrI sequences than to mcrII sequences, suggesting that members of the Methanosarcinaceae do not have distinct mcrII genes.

A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

PubMed

Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

2015-03-01

The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific micropollutants. This work is an important step towards developing tools to predict biotransformation rates in WWTPs based on taxonomic composition. Copyright © 2014 Elsevier Ltd. All rights reserved.

Resources and costs for microbial sequence analysis evaluated using virtual machines and cloud computing.

PubMed

Angiuoli, Samuel V; White, James R; Matalka, Malcolm; White, Owen; Fricke, W Florian

2011-01-01

The widespread popularity of genomic applications is threatened by the "bioinformatics bottleneck" resulting from uncertainty about the cost and infrastructure needed to meet increasing demands for next-generation sequence analysis. Cloud computing services have been discussed as potential new bioinformatics support systems but have not been evaluated thoroughly. We present benchmark costs and runtimes for common microbial genomics applications, including 16S rRNA analysis, microbial whole-genome shotgun (WGS) sequence assembly and annotation, WGS metagenomics and large-scale BLAST. Sequence dataset types and sizes were selected to correspond to outputs typically generated by small- to midsize facilities equipped with 454 and Illumina platforms, except for WGS metagenomics where sampling of Illumina data was used. Automated analysis pipelines, as implemented in the CloVR virtual machine, were used in order to guarantee transparency, reproducibility and portability across different operating systems, including the commercial Amazon Elastic Compute Cloud (EC2), which was used to attach real dollar costs to each analysis type. We found considerable differences in computational requirements, runtimes and costs associated with different microbial genomics applications. While all 16S analyses completed on a single-CPU desktop in under three hours, microbial genome and metagenome analyses utilized multi-CPU support of up to 120 CPUs on Amazon EC2, where each analysis completed in under 24 hours for less than $60. Representative datasets were used to estimate maximum data throughput on different cluster sizes and to compare costs between EC2 and comparable local grid servers. Although bioinformatics requirements for microbial genomics depend on dataset characteristics and the analysis protocols applied, our results suggests that smaller sequencing facilities (up to three Roche/454 or one Illumina GAIIx sequencer) invested in 16S rRNA amplicon sequencing, microbial single-genome and metagenomics WGS projects can achieve cost-efficient bioinformatics support using CloVR in combination with Amazon EC2 as an alternative to local computing centers.

Resources and Costs for Microbial Sequence Analysis Evaluated Using Virtual Machines and Cloud Computing

PubMed Central

Angiuoli, Samuel V.; White, James R.; Matalka, Malcolm; White, Owen; Fricke, W. Florian

2011-01-01

Background The widespread popularity of genomic applications is threatened by the “bioinformatics bottleneck” resulting from uncertainty about the cost and infrastructure needed to meet increasing demands for next-generation sequence analysis. Cloud computing services have been discussed as potential new bioinformatics support systems but have not been evaluated thoroughly. Results We present benchmark costs and runtimes for common microbial genomics applications, including 16S rRNA analysis, microbial whole-genome shotgun (WGS) sequence assembly and annotation, WGS metagenomics and large-scale BLAST. Sequence dataset types and sizes were selected to correspond to outputs typically generated by small- to midsize facilities equipped with 454 and Illumina platforms, except for WGS metagenomics where sampling of Illumina data was used. Automated analysis pipelines, as implemented in the CloVR virtual machine, were used in order to guarantee transparency, reproducibility and portability across different operating systems, including the commercial Amazon Elastic Compute Cloud (EC2), which was used to attach real dollar costs to each analysis type. We found considerable differences in computational requirements, runtimes and costs associated with different microbial genomics applications. While all 16S analyses completed on a single-CPU desktop in under three hours, microbial genome and metagenome analyses utilized multi-CPU support of up to 120 CPUs on Amazon EC2, where each analysis completed in under 24 hours for less than $60. Representative datasets were used to estimate maximum data throughput on different cluster sizes and to compare costs between EC2 and comparable local grid servers. Conclusions Although bioinformatics requirements for microbial genomics depend on dataset characteristics and the analysis protocols applied, our results suggests that smaller sequencing facilities (up to three Roche/454 or one Illumina GAIIx sequencer) invested in 16S rRNA amplicon sequencing, microbial single-genome and metagenomics WGS projects can achieve cost-efficient bioinformatics support using CloVR in combination with Amazon EC2 as an alternative to local computing centers. PMID:22028928

Ballistosporomyces changbaiensis sp. nov. and Ballistosporomyces bomiensis sp. nov., two novel species isolated from shrub plant leaves.

PubMed

Han, Pei-Jie; Li, Ai-Hua; Wang, Qi-Ming; Bai, Feng-Yan

2016-07-01

Four strains, CB 266(T), CB 272, XZ 44D1(T) and XZ 49D2, isolated from shrub plant leaves in China were identified as two novel species of the genus Ballistosporomyces by the sequence analysis of the small subunit of ribosomal RNA (SSU rRNA), the D1/D2 domains of the large subunit of rRNA (LSU rRNA) and internal transcribed spacer (ITS) + 5.8S rRNA region, and physiological comparisons. Ballistosporomyces changbaiensis sp. nov. (type strain CB 266(T) = CGMCC 2.02298(T) = CBS 10124(T), Mycobank number MB 815700) and Ballistosporomyces bomiensis sp. nov. (type strain XZ 44D1(T) = CGMCC 2.02661(T) = CBS 12512(T), Mycobank number MB 815701) are proposed to accommodate these two new species.

Evidence for a close phylogenetic relationship between Melissococcus pluton, the causative agent of European foulbrood disease, and the genus Enterococcus.

PubMed

Cai, J; Collins, M D

1994-04-01

The 16S rRNA gene sequence of Melissococcus pluton, the causative agent of European foulbrood disease, was determined in order to investigate the phylogenetic relationships between this organism and other low-G + C-content gram-positive bacteria. A comparative sequence analysis revealed that M. pluton is a close phylogenetic relative of the genus Enterococcus.

The complete mitochondrial genome of dhole Cuon alpinus: phylogenetic analysis and dating evolutionary divergence within Canidae.

PubMed

Zhang, Honghai; Chen, Lei

2011-03-01

The dhole (Cuon alpinus) is the only existent species in the genus Cuon (Carnivora: Canidae). In the present study, the complete mitochondrial genome of the dhole was sequenced. The total length is 16672 base pairs which is the shortest in Canidae. Sequence analysis revealed that most mitochondrial genomic functional regions were highly consistent among canid animals except the CSB domain of the control region. The difference in length among the Canidae mitochondrial genome sequences is mainly due to the number of short segments of tandem repeated in the CSB domain. Phylogenetic analysis was progressed based on the concatenated data set of 14 mitochondrial genes of 8 canid animals by using maximum parsimony (MP), maximum likelihood (ML) and Bayesian (BI) inference methods. The genera Vulpes and Nyctereutes formed a sister group and split first within Canidae, followed by that in the Cuon. The divergence in the genus Canis was the latest. The divarication of domestic dogs after that of the Canis lupus laniger is completely supported by all the three topologies. Pairwise sequence divergence data of different mitochondrial genes among canid animals were also determined. Except for the synonymous substitutions in protein-coding genes, the control region exhibits the highest sequence divergences. The synonymous rates are approximately two to six times higher than those of the non-synonymous sites except for a slightly higher rate in the non-synonymous substitution between Cuon alpinus and Vulpes vulpes. 16S rRNA genes have a slightly faster sequence divergence than 12S rRNA and tRNA genes. Based on nucleotide substitutions of tRNA genes and rRNA genes, the times since divergence between dhole and other canid animals, and between domestic dogs and three subspecies of wolves were evaluated. The result indicates that Vulpes and Nyctereutes have a close phylogenetic relationship and the divergence of Nyctereutes is a little earlier. The Tibetan wolf may be an archaic pedigree within wolf subspecies. The genetic distance between wolves and domestic dogs is less than that among different subspecies of wolves. The domestication of dogs was about 1.56-1.92 million years ago or even earlier.

Proposals for revival of Streptomyces setonii and reclassification of S. fimicarius as a later synonym of S. setonii and S. albovinaceus as a later synonym of S. globisporus based on combined 16S rRNA-gyrB gene analysis

USDA-ARS?s Scientific Manuscript database

The 16S rRNA and gyrB genes of 22 Streptomyces species belonging to the Streptomyces griseus cluster were sequenced, and their taxonomic positions were re-evaluated. For correct analysis, all of the publicly available sequences of the species were collected and compared with those obtained in this s...

A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

PubMed

Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

2017-05-10

Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .

Anaerobic Ammonium-Oxidizing Bacteria in Cow Manure Composting.

PubMed

Wang, Tingting; Cheng, Lijun; Zhang, Wenhao; Xu, Xiuhong; Meng, Qingxin; Sun, Xuewei; Liu, Huajing; Li, Hongtao; Sun, Yu

2017-07-28

Composting is widely used to transform waste into valuable agricultural organic fertilizer. Anaerobic ammonium-oxidizing (anammox) bacteria play an important role in the global nitrogen cycle, but their role in composting remains poorly understood. In the present study, the community structure, diversity, and abundance of anammox bacteria were analyzed using cloning and sequencing methods by targeting the 16S rRNA gene and the hydrazine oxidase gene ( hzo ) in samples isolated from compost produced from cow manure and rice straw. A total of 25 operational taxonomic units were classified based on 16S rRNA gene clone libraries, and 14 operational taxonomic units were classified based on hzo gene clone libraries. The phylogenetic tree analysis of the 16S rRNA gene and deduced HZO protein sequences from the corresponding encoding genes indicated that the majority of the obtained clones were related to the known anammox bacteria Candidatus "Brocadia," Candidatus "Kuenenia," and Candidatus "Scalindua." The abundances of anammox bacteria were determined by quantitative PCR, and between 2.13 × 10 5 and 1.15 × 10 6 16S rRNA gene copies per gram of compost were found. This study provides the first demonstration of the existence of anammox bacteria with limited diversity in cow manure composting.

MULTIPLE ENZYME RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS FOR HIGH RESOLUTION DISTINCTION OF PSEUDOMONAS (SENSU STRICTO) 16S RRNA GENES

EPA Science Inventory

Pseudomonas specific 16S rDNA PCR amplification and multiple enzyme restriction fragment length polymorphism (MERFLP) analysis using a single digestion mixture of Alu I, Hinf I, Rsa I, and Tru 9I distinguished 150 published sequences and reference strains of authentic Pseudomonas...

Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore

PubMed Central

Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

2016-01-01

INTRODUCTION Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. METHODS Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. RESULTS Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. CONCLUSION The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. PMID:26805667

Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore.

PubMed

Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

2016-12-01

Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. Copyright: © Singapore Medical Association

Niche and neutral processes both shape community structure in parallelized, aerobic, single carbon-source enrichments

DOE Data Explorer

Flynn, Theodore M.; Koval, Jason C.; Greenwald, Stephanie M.; Owens, Sarah M.; Kemner, Kenneth M.; Antonopoulos, Dionysios A.

2017-01-01

We present DNA sequence data in FASTA-formatted files from aerobic environmental microcosms inoculated with a sole carbon source. DNA sequences are of 16S rRNA genes present in DNA extracted from each microcosm along with the environmental samples (soil, water) used to inoculate them. These samples were sequenced using the Illumina MiSeq platform at the Environmental Sample Preparation and Sequencing Facility at Argonne National Laboratory. This data is compatible with standard microbiome analysis pipelines (e.g., QIIME, mothur, etc.).

Acidovorax anthurii sp. nov., a new phytopathogenic bacterium which causes bacterial leaf-spot of anthurium.

PubMed

Gardan, L; Dauga, C; Prior, P; Gillis, M; Saddler, G S

2000-01-01

The bacterial leaf-spot of anthurium emerged during the 1980s, in the French West Indies and Trinidad. This new bacterial disease is presently wide spread and constitutes a serious limiting factor for commercial anthurium production. Twenty-nine strains isolated from leaf-spots of naturally infected anthurium were characterized and compared with reference strains belonging to the Comamonadaceae family, the genera Ralstonia and Burkholderia, and representative fluorescent pseudomonads. From artificial inoculations 25 out of 29 strains were pathogenic on anthurium. Biochemical and physiological tests, fatty acid analysis, DNA-DNA hybridization, 16S rRNA gene sequence analysis, DNA-16S RNA hybridization were performed. The 25 pathogenic strains on anthurium were clustered in one phenon closely related to phytopathogenic strains of the genus Acidovorax. Anthurium strains were 79-99% (deltaTm range 0.2-1.6) related to the strain CFBP 3232 and constituted a discrete DNA homology group indicating that they belong to the same species. DNA-rRNA hybridization, 16S rRNA sequence and fatty acid analysis confirmed that this new species belongs to the beta-subclass of Proteobacteria and to rRNA superfamily III, to the family of Comamonadaceae and to the genus Acidovorax. The name Acidovorax anthurii is proposed for this new phytopathogenic bacterium. The type strain has been deposited in the Collection Française des Bactéries Phytopathogènes as CFBP 3232T.

New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain.

PubMed

Criado-Fornelio, A; Rey-Valeiron, C; Buling, A; Barba-Carretero, J C; Jefferies, R; Irwin, P

2007-03-31

The prevalence of hematozoan infections (Hepatozoon canis and Babesia sp., particularly Babesia canis vogeli) in canids from Venezuela, Thailand and Spain was studied by amplification and sequencing of the 18S rRNA gene. H. canis infections caused simultaneously by two different isolates were confirmed by RFLP analysis in samples from all the geographic regions studied. In Venezuela, blood samples from 134 dogs were surveyed. Babesia infections were found in 2.24% of the dogs. Comparison of sequences of the 18S rRNA gene indicated that protozoan isolates were genetically identical to B. canis vogeli from Japan and Brazil. H. canis infected 44.77 per cent of the dogs. A representative sample of Venezuelan H. canis isolates (21.6% of PCR-positives) was sequenced. Many of them showed 18S rRNA gene sequences identical to H. canis Spain 2, albeit two less frequent genotypes were found in the sample studied. In Thailand, 20 dogs were analyzed. No infections caused by Babesia were diagnosed, whereas 30 per cent of the dogs were positive to hematozoan infection. Two protozoa isolates showing 99.7-100% identity to H. canis Spain 2 were found. In Spain, 250 dogs were studied. B. canis vogeli infected 0.01% of the animals. The sequence of the 18S rRNA gene in Spanish isolates of this protozoa was closely related to those previously deposited in GenBank (> 99% identity). Finally, 20 red foxes were screened for hematozoans employing semi-nested PCR and primers designed to detect Babesia/Theileria. Fifty percent of the foxes were positive to Theileria annae. In addition, it was found that the PCR assay was able as well to detect Hepatozoon infections. Thirty five percent of the foxes were infected with two different H. canis isolates showing 99.8-100% identity to Curupira 1 from Brazil.

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Description of Groenewaldozyma gen. nov. for placement of Candida auringiensis, Candida salmanticensis and Candida tartarivorans.

PubMed

Kurtzman, Cletus P

2016-07-01

DNA sequence analyses have demonstrated that species of the polyphyletic anamorphic ascomycete genus Candida may be members of described teleomorphic genera, members of the Candida tropicalis clade upon which the genus Candida is circumscribed, or members of isolated clades that represent undescribed genera. From phylogenetic analysis of gene sequences from nuclear large subunit rRNA, mitochondrial small subunit rRNA and cytochrome oxidase II, Candida auringiensis (NRRL Y-17674(T), CBS 6913(T)), Candida salmanticensis (NRRL Y-17090(T), CBS 5121(T)), and Candida tartarivorans (NRRL Y-27291(T), CBS 7955(T)) were shown to be members of an isolated clade and are proposed for reclassification in the genus Groenewaldozyma gen. nov. (MycoBank MB 815817). Neighbouring taxa include species of the Wickerhamiella clade and Candida blankii.

Accurate, Rapid Taxonomic Classification of Fungal Large-Subunit rRNA Genes

PubMed Central

Liu, Kuan-Liang; Porras-Alfaro, Andrea; Eichorst, Stephanie A.

2012-01-01

Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project (http://rdp.cme.msu.edu/classifier/classifier.jsp). PMID:22194300

Using secondary structure to identify ribosomal numts: cautionary examples from the human genome.

PubMed

Olson, Link E; Yoder, Anne D

2002-01-01

The identification of inadvertently sequenced mitochondrial pseudogenes (numts) is critical to any study employing mitochondrial DNA sequence data. Failure to discriminate numts correctly can confound phylogenetic reconstruction and studies of molecular evolution. This is especially problematic for ribosomal mtDNA genes. Unlike protein-coding loci, whose pseudogenes tend to accumulate diagnostic frameshift or premature stop mutations, functional ribosomal genes are not constrained to maintain a reading frame and can accumulate insertion-deletion events of varying length, particularly in nonpairing regions. Several authors have advocated using structural features of the transcribed rRNA molecule to differentiate functional mitochondrial rRNA genes from their nuclear paralogs. We explored this approach using the mitochondrial 12S rRNA gene and three known 12S numts from the human genome in the context of anthropoid phylogeny and the inferred secondary structure of primate 12S rRNA. Contrary to expectation, each of the three human numts exhibits striking concordance with secondary structure models, with little, if any, indication of their pseudogene status, and would likely escape detection based on structural criteria alone. Furthermore, we show that the unwitting inclusion of a particularly ancient (18-25 Myr old) and surprisingly cryptic human numt in a phylogenetic analysis would yield a well-supported but dramatically incorrect conclusion regarding anthropoid relationships. Though we endorse the use of secondary structure models for inferring positional homology wholeheartedly, we caution against reliance on structural criteria for the discrimination of rRNA numts, given the potential fallibility of this approach.

Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

PubMed

Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

2012-07-01

Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Lactobacillus gorillae sp. nov., isolated from the faeces of captive and wild western lowland gorillas (Gorilla gorilla gorilla).

PubMed

Tsuchida, Sayaka; Kitahara, Maki; Nguema, Pierre Philippe Mbehang; Norimitsu, Saeko; Fujita, Shiho; Yamagiwa, Juichi; Ngomanda, Alfred; Ohkuma, Moriya; Ushida, Kazunari

2014-12-01

Four strains of Gram-staining-positive, anaerobic rods were isolated from the faeces of western lowland gorillas (Gorilla gorilla gorilla). Three strains, KZ01(T), KZ02 and KZ03, were isolated at the Kyoto City Zoo, Japan, and one strain, GG02, was isolated in the Moukalaba-Doudou National Park, Gabon. These strains were investigated taxonomically. These strains belonged to the Lactobacillus reuteri phylogenetic group according to phylogenetic analysis based on 16S rRNA gene sequences and specific phenotypic characteristics. Phylogenetic analysis of their 16S rRNA gene sequences revealed that strains KZ01(T), KZ02, KZ03 and GG02 formed a single monophyletic cluster and had a distinct line of descent. Based on sequence similarity of the 16S rRNA gene, Lactobacillus fermentum JCM 1173(T) (96.6 %) was the closest neighbour to these novel strains, although it was clear that these strains belonged to a different species. Partial pheS sequences also supported these relationships. DNA-DNA relatedness between strain KZ01(T) and L. fermentum JCM 1173(T) was less than 22 % and the DNA G+C content of strain KZ01(T) was 50.7 mol%. The cell-wall peptidoglycan type was A4β (l-Orn-d-Asp) and the major fatty acids were C16 : 0, C18 : 1ω9c and C19 : 1 cyclo 9,10. Therefore, based on phylogenetic, phenotypic and physiological evidence, these strains represent a novel species of the genus Lactobacillus, for which the name Lactobacillus gorillae sp. nov. is proposed. The type strain is KZ01(T) ( = JCM 19575(T) = DSM 28356(T)). © 2014 IUMS.

Fontibacillus aquaticus gen. nov., sp. nov., isolated from a warm spring.

PubMed

Saha, P; Krishnamurthi, S; Bhattacharya, A; Sharma, R; Chakrabarti, T

2010-02-01

A novel facultatively anaerobic strain, designated GPTSA 19(T), was isolated from a warm spring and characterized using a polyphasic approach. The strain behaved as Gram-negative in the Gram staining procedure but showed a Gram-positive reaction in the aminopeptidase test. The novel strain was a mesophilic rod with ellipsoidal endospores. On the basis of 16S rRNA gene sequence analysis, the strain showed closest similarity (96.0 %) with Paenibacillus motobuensis MC10(T). The gene sequence similarity of the novel strain with other species of the genus Paenibacillus was <95.8 %. The novel strain also had PAEN 515F and 682F signature sequence stretches in the 16S rRNA gene that are usually found in most species of the genus Paenibacillus. The strain possessed anteiso-C(15 : 0) as the major fatty acid and MK-7 as the predominant menaquinone. Polar lipids included diphosphatidylglycerol (DPG), phosphatidylglycerol (PG), phosphatidylethanolamine (PE), six unknown phospholipids (PLs), one aminophospholipid (PN), three glycolipids (GLs), two aminolipids (ALs), one aminophosphoglycolipid (APGL) and three unknown lipids (ULs). The polar lipid profile of the novel strain, especially as regards ALs, GLs and PLs, distinguished it from the recognized type species of the genus Paenibacillus, Paenibacillus polymyxa, as well as from its closest relative P. motobuensis. Based on phenotypic and chemotaxonomic characteristics and analysis of the 16S rRNA gene sequence, the new strain merits the rank of a novel genus for which the name Fontibacillus gen. nov. is proposed. The type species of the new genus is Fontibacillus aquaticus gen. nov., sp. nov. with the type strain GPTSA 19(T) (=MTCC 7155(T)=DSM 17643(T)).

High-Throughput Identification and Screening of Novel Methylobacterium Species Using Whole-Cell MALDI-TOF/MS Analysis

PubMed Central

Tani, Akio; Sahin, Nurettin; Matsuyama, Yumiko; Enomoto, Takashi; Nishimura, Naoki; Yokota, Akira; Kimbara, Kazuhide

2012-01-01

Methylobacterium species are ubiquitous α-proteobacteria that reside in the phyllosphere and are fed by methanol that is emitted from plants. In this study, we applied whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (WC-MS) to evaluate the diversity of Methylobacterium species collected from a variety of plants. The WC-MS spectrum was reproducible through two weeks of cultivation on different media. WC-MS spectrum peaks of M. extorquens strain AM1 cells were attributed to ribosomal proteins, but those were not were also found. We developed a simple method for rapid identification based on spectra similarity. Using all available type strains of Methylobacterium species, the method provided a certain threshold similarity value for species-level discrimination, although the genus contains some type strains that could not be easily discriminated solely by 16S rRNA gene sequence similarity. Next, we evaluated the WC-MS data of approximately 200 methylotrophs isolated from various plants with MALDI Biotyper software (Bruker Daltonics). Isolates representing each cluster were further identified by 16S rRNA gene sequencing. In most cases, the identification by WC-MS matched that by sequencing, and isolates with unique spectra represented possible novel species. The strains belonging to M. extorquens, M. adhaesivum, M. marchantiae, M. komagatae, M. brachiatum, M. radiotolerans, and novel lineages close to M. adhaesivum, many of which were isolated from bryophytes, were found to be the most frequent phyllospheric colonizers. The WC-MS technique provides emerging high-throughputness in the identification of known/novel species of bacteria, enabling the selection of novel species in a library and identification without 16S rRNA gene sequencing. PMID:22808262

The Effect of Dietary Supplementation with Spent Cider Yeast on the Swine Distal Gut Microbiome

PubMed Central

Upadrasta, Aditya; O’Sullivan, Lisa; O’Sullivan, Orla; Sexton, Noel; Lawlor, Peadar G.; Hill, Colin; Fitzgerald, Gerald F.; Stanton, Catherine; Ross, R. Paul

2013-01-01

Background There is an increasing need for alternatives to antibiotics for promoting animal health, given the increasing problems associated with antibiotic resistance. In this regard, we evaluated spent cider yeast as a potential probiotic for modifying the gut microbiota in weanling pigs using pyrosequencing of 16S rRNA gene libraries. Methodology and Principal Findings Piglets aged 24–26 days were assigned to one of two study groups; control (n = 12) and treatment (n = 12). The control animals were fed with a basal diet and the treatment animals were fed with basal diet in combination with cider yeast supplement (500 ml cider yeast containing ∼7.6 log CFU/ml) for 21 days. Faecal samples were collected for 16s rRNA gene compositional analysis. 16S rRNA compositional sequencing analysis of the faecal samples collected from day 0 and day 21 revealed marked differences in microbial diversity at both the phylum and genus levels between the control and treatment groups. This analysis confirmed that levels of Salmonella and Escherichia were significantly decreased in the treatment group, compared with the control (P<0.001). This data suggest a positive influence of dietary supplementation with live cider yeast on the microbial diversity of the pig distal gut. Conclusions/Significance The effect of dietary cider yeast on porcine gut microbial communities was characterized for the first time using 16S rRNA gene compositional sequencing. Dietary cider yeast can potentially alter the gut microbiota, however such changes depend on their endogenous microbiota that causes a divergence in relative response to that given diet. PMID:24130736

Molecular confirmation of Hepatozoon canis in Mauritius.

PubMed

Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel

2018-01-01

In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.

Transfer of Bacillus halodenitrificans Denariaz et al. 1989 to the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.

PubMed

Yoon, Jung-Hoon; Oh, Tae-Kwang; Park, Yong-Ha

2004-11-01

A Gram-variable, endospore-forming moderately halophilic rod, strain SF-121, was isolated from a marine solar saltern of the Yellow Sea in Korea. The result of 16S rRNA gene sequence analysis showed that strain SF-121 has highest sequence similarity (99.7 %) with the type strain of Bacillus halodenitrificans. Phylogenetic analyses based on 16S rRNA gene sequences revealed that B. halodenitrificans DSM 10037(T) and strain SF-121 are more closely related to the genus Virgibacillus than to the genus Bacillus. Strain SF-121 and B. halodenitrificans DSM 10037(T) exhibited 16S rRNA gene similarity levels of 95.3-97.5 % with the type strains of Virgibacillus species and 94.0 % with the type strain of Bacillus subtilis. DNA-DNA relatedness and phenotypic data indicated that B. halodenitrificans DSM 10037(T) and strain SF-121 are members of the same species. B. halodenitrificans DSM 10037(T) and strain SF-121 exhibited DNA-DNA relatedness values of 9-11 % with the type strains of Virgibacillus carmonensis and Virgibacillus marismortui. On the basis of the phenotypic, chemotaxonomic, phylogenetic and genetic data, B. halodenitrificans should be reclassified in the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.

Bacterial diversity in Adélie penguin, Pygoscelis adeliae, guano: molecular and morpho-physiological approaches.

PubMed

Zdanowski, Marek K; Weglenski, Piotr; Golik, Pawel; Sasin, Joanna M; Borsuk, Piotr; Zmuda, Magdalena J; Stankovic, Anna

2004-11-01

The total number of bacteria and culturable bacteria in Adélie penguin (Pygoscelis adeliae) guano was determined during 42 days of decomposition in a location adjacent to the rookery in Admiralty Bay, King George Island, Antarctica. Of the culturable bacteria, 72 randomly selected colonies were described using 49 morpho-physiological tests, 27 of which were subsequently considered significant in characterizing and differentiating the isolates. On the basis of the nucleotide sequence of a fragment of the 16S rRNA gene in each of 72 pure isolates, three major phylogenetic groups were identified, namely the Moraxellaceae/Pseudomonadaceae (29 isolates), the Flavobacteriaceae (14), and the Micrococcaceae (29). Grouping of the isolates on the basis of morpho-physiological tests (whether 49 or 27 parameters) showed similar results to those based on 16S rRNA gene sequences. Clusters were characterized by considerable intra-cluster variation in both 16S rRNA gene sequences and morpho-physiological responses. High diversity in abundance and morphometry of total bacterial communities during penguin guano decomposition was supported by image analysis of epifluorescence micrographs. The results indicate that the bacterial community in penguin guano is not only one of the richest in Antarctica, but is extremely diverse, both phylogenetically and morpho-physiologically.

Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.

PubMed

Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad

2014-11-01

Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species.

rpoB Gene Sequencing for Identification of Corynebacterium Species

PubMed Central

Khamis, Atieh; Raoult, Didier; La Scola, Bernard

2004-01-01

The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970

Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes.

PubMed

Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita

2015-12-01

Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)]. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

PubMed

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

Bacterial Community Dynamics during Production of Registered Designation of Origin Salers Cheese as Evaluated by 16S rRNA Gene Single-Strand Conformation Polymorphism Analysis

PubMed Central

Duthoit, Frédérique; Godon, Jean-Jacques; Montel, Marie-Christine

2003-01-01

Microbial dynamics during processing and ripening of traditional cheeses such as registered designation of origin Salers cheese, an artisanal cheese produced in France, play an important role in the elaboration of sensory qualities. The aim of the present study was to obtain a picture of the dynamics of the microbial ecosystem of RDO Salers cheese by using culture-independent methods. This included DNA extraction, PCR, and single-strand conformation polymorphism (SSCP) analysis. Bacterial and high-GC% gram-positive bacterial primers were used to amplify V2 or V3 regions of the 16S rRNA gene. SSCP patterns revealed changes during the manufacturing of the cheese. Patterns of the ecosystems of cheeses that were provided by three farmers were also quite different. Cloning and sequencing of the 16S rRNA gene revealed sequences related to lactic acid bacteria (Lactococcus lactis, Streptococcus thermophilus, Enterococcus faecium, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Lactobacillus plantarum, and Lactobacillus pentosus), which were predominant during manufacturing and ripening. Bacteria belonging to the high-GC% gram-positive group (essentially corynebacteria) were found by using specific primers. The present molecular approach can effectively describe the ecosystem of artisanal dairy products. PMID:12839752

A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

NASA Technical Reports Server (NTRS)

Winker, S.; Woese, C. R.

1991-01-01

The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy

PubMed Central

Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin

2016-01-01

ABSTRACT Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. IMPORTANCE In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study investigated the bacterial communities during and after Superstorm Sandy to provide fine time point resolution of dynamic changes in bacterial composition. This study adds to the current literature by revealing the variation in bacterial community structure during the course of a storm. This study employed high-throughput DNA sequencing, which generated a deep analysis of inter- and intracommunity responses during a significant storm event. This study has highlighted the utility of applying high-throughput sequencing for water quality monitoring purposes, as this approach enabled a more comprehensive investigation of the bacterial community structure. Altogether, these data suggest a drastic restructuring of the stream bacterial community during a storm event and highlight the potential of high-throughput sequencing approaches for assessing the microbiological quality of our environment. PMID:27060115

Small subunit ribosomal RNA genes of tabanids and hippoboscids (Diptera: Brachycera): evolutionary relationships and comparison with other Diptera.

PubMed

Carreno, R A; Barta, J R

1998-11-01

The small subunit ribosomal RNA (SSU rRNA) genes of hippoboscid (Ornithoica vicina Walker) and tabanid (Chrysops niger Macquart) Diptera were sequenced to determine their phylogenetic position within the order and to determine whether or not extensive hypervariable regions in this gene are widespread in the Diptera. A parsimony analysis of an alignment containing 8 dipteran sequences produced a single most parsimonious tree that placed O. vicina as sister group to Drosophila melanogaster Meigen. The tabanid Chrysops niger was sister group to the asilomorphan taxa, and the sister group to the Brachycera was a Tipula sp. although this relationship was not supported by bootstrap analysis. The hippoboscid and tabanid sequences contain extensive hypervariable regions in the V2, V4, V6, and V7 regions as do other Diptera. When these regions of the alignment were excluded from the phylogenetic analysis, a single most parsimonious tree was found. This tree had an identical overall topology to the tree obtained from the total data set. The hypervariable regions in parts of the dipteran SSU rRNA genes were more extensive in the nematocerous dipteran sequences used in this study than in the other dipteran representatives; these hypervariable regions may be of more utility in inferring relationship among species and subspecies than at the suprageneric level.

Characterization of strains of Weissella fabalis sp. nov. and Fructobacillus tropaeoli from spontaneous cocoa bean fermentations.

PubMed

Snauwaert, Isabel; Papalexandratou, Zoi; De Vuyst, Luc; Vandamme, Peter

2013-05-01

Six facultatively anaerobic, non-motile lactic acid bacteria were isolated from spontaneous cocoa bean fermentations carried out in Brazil, Ecuador and Malaysia. Phylogenetic analysis revealed that one of these strains, designated M75(T), isolated from a Brazilian cocoa bean fermentation, had the highest 16S rRNA gene sequence similarity towards Weissella fabaria LMG 24289(T) (97.7%), W. ghanensis LMG 24286(T) (93.3%) and W. beninensis LMG 25373(T) (93.4%). The remaining lactic acid bacteria isolates, represented by strain M622, showed the highest 16S rRNA gene sequence similarity towards the type strain of Fructobacillus tropaeoli (99.9%), a recently described species isolated from a flower in South Africa. pheS gene sequence analysis indicated that the former strain represented a novel species, whereas pheS, rpoA and atpA gene sequence analysis indicated that the remaining five strains belonged to F. tropaeoli; these results were confirmed by DNA-DNA hybridization experiments towards their respective nearest phylogenetic neighbours. Additionally, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry proved successful for the identification of species of the genera Weissella and Fructobacillus and for the recognition of the novel species. We propose to classify strain M75(T) ( = LMG 26217(T)  = CCUG 61472(T)) as the type strain of the novel species Weissella fabalis sp. nov.

Isolation and molecular identification of endophytic diazotrophs from seeds and stems of three cereal crops.

PubMed

Liu, Huawei; Zhang, Lei; Meng, Aihua; Zhang, Junbiao; Xie, Miaomiao; Qin, Yaohong; Faulk, Dylan Chase; Zhang, Baohong; Yang, Shushen; Qiu, Li

2017-01-01

Ten strains of endophytic diazotroph were isolated and identified from the plants collected from three different agricultural crop species, wheat, rice and maize, using the nitrogen-free selective isolation conditions. The nitrogen-fixing ability of endophytic diazotroph was verified by the nifH-PCR assay that showed positive nitrogen fixation ability. These identified strains were classified by 879F-RAPD and 16S rRNA sequence analysis. RAPD analyses revealed that the 10 strains were clustered into seven 879F-RAPD groups, suggesting a clonal origin. 16S rRNA sequencing analyses allowed the assignment of the 10 strains to known groups of nitrogen-fixing bacteria, including organisms from the genera Paenibacillus, Enterobacter, Klebsiella and Pantoea. These representative genus are not endophytic diazotrophs in the conventional sense. They may have obtained nitrogen fixation ability through lateral gene transfer, however, the evolutionary forces of lateral gene transfer are not well known. Molecular identification results from 16S rRNA analyses were also confirmed by morphological and biochemical data. The test strains SH6A and MZB showed positive effect on the growth of plants.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences

PubMed Central

2012-01-01

Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR) are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas. PMID:23256920

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction.

PubMed

Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

2014-01-01

Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

PubMed

Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P

1999-12-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

NASA Technical Reports Server (NTRS)

Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

1999-01-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Isolation and Characterization of Burkholderia rinojensis sp. nov., a Non-Burkholderia cepacia Complex Soil Bacterium with Insecticidal and Miticidal Activities

PubMed Central

Fernandez, Lorena E.; Koivunen, Marja; Yang, April; Flor-Weiler, Lina; Marrone, Pamela G.

2013-01-01

Isolate A396, a bacterium isolated from a Japanese soil sample demonstrated strong insecticidal and miticidal activities in laboratory bioassays. The isolate was characterized through biochemical methods, fatty acid methyl ester (FAME) analysis, sequencing of 16S rRNA, multilocus sequence typing and analysis, and DNA-DNA hybridization. FAME analysis matched A396 to Burkholderia cenocepacia, but this result was not confirmed by 16S rRNA or DNA-DNA hybridization. 16S rRNA sequencing indicated closest matches with B. glumae and B. plantarii. DNA-DNA hybridization experiments with B. plantarii, B. glumae, B. multivorans, and B. cenocepacia confirmed the low genetic similarity (11.5 to 37.4%) with known members of the genus. PCR-based screening showed that A396 lacks markers associated with members of the B. cepacia complex. Bioassay results indicated two mechanisms of action: through ingestion and contact. The isolate effectively controlled beet armyworms (Spodoptera exigua; BAW) and two-spotted spider mites (Tetranychus urticae; TSSM). In diet overlay bioassays with BAW, 1% to 4% (vol/vol) dilution of the whole-cell broth caused 97% to 100% mortality 4 days postexposure, and leaf disc treatment bioassays attained 75% ± 22% mortality 3 days postexposure. Contact bioassays led to 50% larval mortality, as well as discoloration, stunting, and failure to molt. TSSM mortality reached 93% in treated leaf discs. Activity was maintained in cell-free supernatants and after heat treatment (60°C for 2 h), indicating that a secondary metabolite or excreted thermostable enzyme might be responsible for the activity. Based on these results, we describe the novel species Burkholderia rinojensis, a good candidate for the development of a biocontrol product against insect and mite pests. PMID:24096416

Analysis of the Gull Fecal Microbial Community Reveals the Dominance of Catellicoccus marimammalium in Relation to Culturable Enterococci

PubMed Central

Koskey, Amber M.; Fisher, Jenny C.; Traudt, Mary F.; Newton, Ryan J.

2014-01-01

Gulls are prevalent in beach environments and can be a major source of fecal contamination. Gulls have been shown to harbor a high abundance of fecal indicator bacteria (FIB), such as Escherichia coli and enterococci, which can be readily detected as part of routine beach monitoring. Despite the ubiquitous presence of gull fecal material in beach environments, the associated microbial community is relatively poorly characterized. We generated comprehensive microbial community profiles of gull fecal samples using Roche 454 and Illumina MiSeq platforms to investigate the composition and variability of the gull fecal microbial community and to measure the proportion of FIB. Enterococcaceae and Enterobacteriaceae were the two most abundant families in our gull samples. Sequence comparisons between short-read data and nearly full-length 16S rRNA gene clones generated from the same samples revealed Catellicoccus marimammalium as the most numerous taxon among all samples. The identification of bacteria from gull fecal pellets cultured on membrane-Enterococcus indoxyl-β-d-glucoside (mEI) plates showed that the dominant sequences recovered in our sequence libraries did not represent organisms culturable on mEI. Based on 16S rRNA gene sequencing of gull fecal isolates cultured on mEI plates, 98.8% were identified as Enterococcus spp., 1.2% were identified as Streptococcus spp., and none were identified as C. marimammalium. Illumina deep sequencing indicated that gull fecal samples harbor significantly higher proportions of C. marimammalium 16S rRNA gene sequences (>50-fold) relative to typical mEI culturable Enterococcus spp. C. marimammalium therefore can be confidently utilized as a genetic marker to identify gull fecal pollution in the beach environment. PMID:24242244

Genetic diversity among Babesia rossi detected in naturally infected dogs in Abeokuta, Nigeria, based on 18S rRNA gene sequences.

PubMed

Takeet, Michael I; Oyewusi, Adeoye J; Abakpa, Simon A V; Daramola, Olukayode O; Peters, Sunday O

2017-03-01

Adequate knowledge of the genetic diversity among Babesia species infecting dogs is necessary for a better understanding of the epidemiology and control of canine babesiosis. Hence, this study determined the genetic diversity among the Babesia rossi detected in dogs presented for routine examination in Veterinary Hospitals in Abeokuta, Nigeria. Blood were randomly collected from 209 dogs. Field-stained thin smears were made and DNA extracted from the blood. Partial region of the 18S small subunit ribosomal RNA (rRNA) gene was amplified, sequenced and analysed. Babesia species was detected in 16 (7.7%) of the dogs by microscopy. Electrophoresed PCR products from 39 (18.66%) dogs revealed band size of 450 bp and 2 (0.95%) dogs had band size of 430 bp. The sequences obtained from 450 bp amplicon displayed homology of 99.74% (387/388) with partial sequences of 18S rRNA gene of Babesia rossi in the GeneBank. Of the two sequences that had 430 bp amplicon, one was identified as T. annulata and second as T. ovis. A significantly (p<0.05) higher prevalence of B. rossi was detected by PCR compared to microscopy. The mean PCV of Babesia infected dogs was significantly (p<0.05) lower than non-infected dogs. Phylogenetic analysis revealed minimal diversity among B. rossi with the exception of one sequence that was greatly divergent from the others. This study suggests that more than one genotype of B. rossi may be in circulation among the dog population in the study area and this may have potential implication on clinical outcome of canine babesiosis.

Onset and establishment of diazotrophs and other bacterial associates in the early life history stages of the coral Acropora millepora.

PubMed

Lema, Kimberley A; Bourne, David G; Willis, Bette L

2014-10-01

Early establishment of coral-microbial symbioses is fundamental to the fitness of corals, but comparatively little is known about the onset and succession of bacterial communities in their early life history stages. In this study, bacterial associates of the coral Acropora millepora were characterized throughout the first year of life, from larvae and 1-week-old juveniles reared in laboratory conditions in the absence of the dinoflagellate endosymbiont Symbiodinium to field-outplanted juveniles with established Symbiodinium symbioses, and sampled at 2 weeks and at 3, 6 and 12 months. Using an amplicon pyrosequencing approach, the diversity of both nitrogen-fixing bacteria and of bacterial communities overall was assessed through analysis of nifH and 16S rRNA genes, respectively. The consistent presence of sequences affiliated with diazotrophs of the order Rhizobiales (23-58% of retrieved nifH sequences; 2-12% of 16S rRNA sequences), across all samples from larvae to 12-month-old coral juveniles, highlights the likely functional importance of this nitrogen-fixing order to the coral holobiont. Dominance of Roseobacter-affiliated sequences (>55% of retrieved 16S rRNA sequences) in larvae and 1-week-old juveniles, and the consistent presence of sequences related to Oceanospirillales and Altermonadales throughout all early life history stages, signifies their potential importance as coral associates. Increased diversity of bacterial communities once juveniles were transferred to the field, particularly of Cyanobacteria and Deltaproteobacteria, demonstrates horizontal (environmental) uptake of coral-associated bacterial communities. Although overall bacterial communities were dynamic, bacteria with likely important functional roles remain stable throughout early life stages of Acropora millepora. © 2014 John Wiley & Sons Ltd.

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

High-Throughput rRNA Gene Sequencing Reveals High
and Complex Bacterial Diversity Associated with
Brazilian Coffee Bean Fermentation

PubMed Central

Vinícius de Melo, Gilberto

2018-01-01

Summary Coffee bean fermentation is a spontaneous, on-farm process involving the action of different microbial groups, including bacteria and fungi. In this study, high-throughput sequencing approach was employed to study the diversity and dynamics of bacteria associated with Brazilian coffee bean fermentation. The total DNA from fermenting coffee samples was extracted at different time points, and the 16S rRNA gene with segments around the V4 variable region was sequenced by Illumina high-throughput platform. Using this approach, the presence of over eighty bacterial genera was determined, many of which have been detected for the first time during coffee bean fermentation, including Fructobacillus, Pseudonocardia, Pedobacter, Sphingomonas and Hymenobacter. The presence of Fructobacillus suggests an influence of these bacteria on fructose metabolism during coffee fermentation. Temporal analysis showed a strong dominance of lactic acid bacteria with over 97% of read sequences at the end of fermentation, mainly represented by the Leuconostoc and Lactococcus. Metabolism of lactic acid bacteria was associated with the high formation of lactic acid during fermentation, as determined by HPLC analysis. The results reported in this study confirm the underestimation of bacterial diversity associated with coffee fermentation. New microbial groups reported in this study may be explored as functional starter cultures for on-farm coffee processing.

Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from cowpea grown in semi-arid Brazil.

PubMed

Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson

2014-03-01

16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).

Bacterial taxa associated with the hematophagous mite Dermanyssus gallinae detected by 16S rRNA PCR amplification and TTGE fingerprinting.

PubMed

Valiente Moro, Claire; Thioulouse, Jean; Chauve, Claude; Normand, Philippe; Zenner, Lionel

2009-01-01

Dermanyssus gallinae (Arthropoda, Mesostigmata) is suspected to be involved in the transmission of a wide variety of pathogens, but nothing is known about its associated non-pathogenic bacterial community. To address this question, we examined the composition of bacterial communities in D. gallinae collected from standard poultry farms in Brittany, France. Genetic fingerprints of bacterial communities were generated by temporal temperature gradient gel electrophoresis (TTGE) separation of individual polymerase chain reaction (PCR)-amplified 16S rRNA gene fragments, followed by DNA sequence analysis. Most of the sequences belonged to the Proteobacteria and Firmicute phyla, with a majority of sequences corresponding to the Enterobacteriales order and the Staphylococcus genus. By using statistical analysis, we showed differences in biodiversity between poultry farms. We also determined the major phylotypes that compose the characteristic microbiota associated with D. gallinae. Saprophytes, opportunistic pathogens and pathogenic agents such as Pasteurella multocida, Erysipelothrix rhusiopathiae and sequences close to the genus Aerococcus were identified. Endosymbionts such as Schineria sp., Spiroplasma sp. Anistosticta, "Candidatus Cardinium hertigii" and Rickettsiella sp. were also present in the subdominant bacterial community. Identification of potential targets within the symbiont community may be considered in the future as a means of ectoparasite control.

Streptococcus ovuberis sp. nov., isolated from a subcutaneous abscess in the udder of a sheep.

PubMed

Zamora, Leydis; Pérez-Sancho, Marta; Fernández-Garayzábal, Jose Francisco; Orden, Jose Antonio; Domínguez-Bernal, Gustavo; de la Fuente, Ricardo; Domínguez, Lucas; Vela, Ana Isabel

2017-11-01

One unidentified, Gram-stain-positive, catalase-negative coccus-shaped organism was recovered from a subcutaneous abscess of the udder of a sheep and subjected to a polyphasic taxonomic analysis. Based on cellular morphology and biochemical criteria, the isolate was tentatively assigned to the genus Streptococcus, although the organism did not appear to match any recognized species. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus and showed that the nearest phylogenetic relatives of the unknown coccus corresponded to Streptococcus moroccensis and Streptococcus cameli (95.9 % 16S rRNA gene sequence similarity). The sodA sequence analysis showed less than 89.3 % sequence similarity with the currently recognized species of the genus Streptococcus. The novel bacterial isolate was distinguished from close relatives of the genus Streptococcusby using biochemical tests. A mass spectrometry profile was also obtained for the novel isolate using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as a representative of a novel species of the genus Streptococcus, Streptococcus ovuberis sp. nov. The type strain of Streptococcus ovuberissp. nov. is VB15-00779 T (=CECT 9179 T =CCUG 69612 T ).

Pseudomonas aestus sp. nov., a plant growth-promoting bacterium isolated from mangrove sediments.

PubMed

Vasconcellos, Rafael L F; Santos, Suikinai Nobre; Zucchi, Tiago Domingues; Silva, Fábio Sérgio Paulino; Souza, Danilo Tosta; Melo, Itamar Soares

2017-10-01

Strain CMAA 1215 T , a Gram-reaction-negative, aerobic, catalase positive, polarly flagellated, motile, rod-shaped (0.5-0.8 × 1.3-1.9 µm) bacterium, was isolated from mangrove sediments, Cananéia Island, Brazil. Analysis of the 16S rRNA gene sequences showed that strain CMAA 1215 T forms a distinct phyletic line within the Pseudomonas putida subclade, being closely related to P. plecoglossicida ATCC 700383 T , P. monteilii NBRC 103158 T , and P. taiwanensis BCRC 17751 T of sequence similarity of 98.86, 98.73, and 98.71%, respectively. Genomic comparisons of the strain CMAA 1215 T with its closest phylogenetic type strains using average nucleotide index (ANI) and DNA:DNA relatedness approaches revealed 84.3-85.3% and 56.0-63.0%, respectively. A multilocus sequence analysis (MLSA) performed concatenating 16S rRNA, gyrB and rpoB gene sequences from the novel species was related with Pseudomonas putida subcluster and formed a new phylogenetic lineage. The phenotypic, physiological, biochemical, and genetic characteristics support the assignment of CMAA 1215 T to the genus Pseudomonas, representing a novel species. The name Pseudomonas aestus sp.nov. is proposed, with CMAA 1215 T (=NRRL B-653100 T  = CBMAI 1962 T ) as the type strain.

Phenotypic, Genotypic, and Antimicrobial Characteristics of Streptococcus halichoeri Isolates from Humans, Proposal To Rename Streptococcus halichoeri as Streptococcus halichoeri subsp. halichoeri, and Description of Streptococcus halichoeri subsp. hominis subsp. nov., a Bacterium Associated with Human Clinical Infections.

PubMed

Shewmaker, P L; Whitney, A M; Humrighouse, B W

2016-03-01

Phenotypic, genotypic, and antimicrobial characteristics of six phenotypically distinct human clinical isolates that most closely resembled the type strain of Streptococcus halichoeri isolated from a seal are presented. Sequencing of the 16S rRNA, rpoB, sodA, and recN genes; comparative whole-genome analysis; conventional biochemical and Rapid ID 32 Strep identification methods; and antimicrobial susceptibility testing were performed on the human isolates, the type strain of S. halichoeri, and type strains of closely related species. The six human clinical isolates were biochemically indistinguishable from each other and showed 100% 16S rRNA, rpoB, sodA, and recN gene sequence similarity. Comparative 16S rRNA gene sequencing analysis revealed 98.6% similarity to S. halichoeri CCUG 48324(T), 97.9% similarity to S. canis ATCC 43496(T), and 97.8% similarity to S. ictaluri ATCC BAA-1300(T). A 3,530-bp fragment of the rpoB gene was 98.8% similar to the S. halichoeri type strain, 84.6% to the S. canis type strain, and 83.8% to the S. ictaluri type strain. The S. halichoeri type strain and the human clinical isolates were susceptible to the antimicrobials tested based on CLSI guidelines for Streptococcus species viridans group with the exception of tetracycline and erythromycin. The human isolates were phenotypically distinct from the type strain isolated from a seal; comparative whole-genome sequence analysis confirmed that the human isolates were S. halichoeri. On the basis of these results, a novel subspecies, Streptococcus halichoeri subsp. hominis, is proposed for the human isolates and Streptococcus halichoeri subsp. halichoeri is proposed for the gray seal isolates. The type strain of the novel subspecies is SS1844(T) = CCUG 67100(T) = LMG 28801(T). Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Anticancer property of sediment actinomycetes against MCF-7 and MDA-MB-231 cell lines.

PubMed

Ravikumar, S; Fredimoses, M; Gnanadesigan, M

2012-02-01

To investigate the anticancer property of marine sediment actinomycetes against two different breast cancer cell lines. In vitro anticancer activity was carried out against breast (MCF-7 and MDA-MB-231) cancer cell lines. Partial sequences of the 16s rRNA gene, phylogenetic tree construction, multiple sequence analysis and secondary structure analysis were also carried out with the actinomycetes isolates. Of the selected five actinomycete isolates, ACT01 and ACT02 showed the IC50 value with (10.13±0.92) and (22.34±5.82) µg/mL concentrations, respectively for MCF-7 cell line at 48 h, but ACT01 showed the minimum (18.54±2.49 µg/mL) level of IC50 value with MDA-MB-231 cell line. Further, the 16s rRNA partial sequences of ACT01, ACT02, ACT03, ACT04 and ACT05 isolates were also deposited in NCBI data bank with the accession numbers of GQ478246, GQ478247, GQ478248, GQ478249 and GQ478250, respectively. The phylogenetic tree analysis showed that, the isolates of ACT02 and ACT03 were represented in group I and III, respectively, but ACT01 and ACT02 were represented in group II. The multiple sequence alignment of the actinomycete isolates showed that, the maximum identical conserved regions were identified with the nucleotide regions of 125 to 221st base pairs, 65 to 119th base pairs and 55, 48 and 31st base pairs. Secondary structure prediction of the 16s rRNA showed that, the maximum free energy was consumed with ACT03 isolate (-45.4 kkal/mol) and the minimum free energy was consumed with ACT04 isolate (-57.6 kkal/mol). The actinomycete isolates of ACT01 and ACT02 (GQ478246 and GQ478247) which are isolated from sediment sample can be further used as anticancer agents against breast cancer cell lines.

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

PubMed

Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

1989-10-20

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

PubMed Central

Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

2000-01-01

Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

Prescreening of microbial populations for the assessment of sequencing potential.

PubMed

Hanning, Irene B; Ricke, Steven C

2011-01-01

Next-generation sequencing (NGS) is a powerful tool that can be utilized to profile and compare microbial populations. By amplifying a target gene present in all bacteria and subsequently sequencing amplicons, the bacteria genera present in the populations can be identified and compared. In some scenarios, little to no difference may exist among microbial populations being compared in which case a prescreening method would be practical to determine which microbial populations would be suitable for further analysis by NGS. Denaturing density-gradient electrophoresis (DGGE) is relatively cheaper than NGS and the data comparing microbial populations are ready to be viewed immediately after electrophoresis. DGGE follows essentially the same initial methodology as NGS by targeting and amplifying the 16S rRNA gene. However, as opposed to sequencing amplicons, DGGE amplicons are analyzed by electrophoresis. By prescreening microbial populations with DGGE, more efficient use of NGS methods can be accomplished. In this chapter, we outline the protocol for DGGE targeting the same gene (16S rRNA) that would be targeted for NGS to compare and determine differences in microbial populations from a wide range of ecosystems.

PCR detection of Anaplasma phagocytophilum in goat flocks in an area endemic for tick-borne fever in Switzerland.

PubMed

Silaghi, C; Scheuerle, M C; Friche Passos, L M; Thiel, C; Pfister, K

2011-02-01

Central Switzerland is a highly endemic region for tick-borne fever (TBF) in cattle, however, little is known about A. phagocytophilum in goats. In the present study, 72 animals from six goat flocks (373 EDTA blood-samples) in Central Switzerland were analysed for A. phagocytophilum DNA. A real-time PCR targeting the msp2 gene of A. phagocytophilum was performed and in positive samples the partial 165 rRNA, groEL and msp4 gene were amplified for sequence analysis. Four DNA extracts were positive. Different sequence types on basis of the amplified genes were found. For comparison, sequences of A. phagocytophilum from 12 cattle (originating from Switzerland and Southern Germany) were analysed. The 165 rRNA gene sequences from cattle were all identical amongst each other, but the groEL and msp4 gene differed depending on the origin of the cattle samples and differed from the variants from goats. This study clearly provides molecular evidence for the presence of different types of A. phagocytophilum in goat flocks in Switzerland, a fact which deserves more thorough attention in clinical studies.

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.

PubMed

Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas

2012-08-01

The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

Seasonal Diversity of Planktonic Protists in Southwestern Alberta Rivers over a 1-Year Period as Revealed by Terminal Restriction Fragment Length Polymorphism and 18S rRNA Gene Library Analyses

PubMed Central

Thomas, Matthew C.; Selinger, L. Brent

2012-01-01

The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure. PMID:22685143

Diversity and population structure of Marine Group A bacteria in the Northeast subarctic Pacific Ocean.

PubMed

Allers, Elke; Wright, Jody J; Konwar, Kishori M; Howes, Charles G; Beneze, Erica; Hallam, Steven J; Sullivan, Matthew B

2013-02-01

Marine Group A (MGA) is a candidate phylum of Bacteria that is ubiquitous and abundant in the ocean. Despite being prevalent, the structural and functional properties of MGA populations remain poorly constrained. Here, we quantified MGA diversity and population structure in relation to nutrients and O(2) concentrations in the oxygen minimum zone (OMZ) of the Northeast subarctic Pacific Ocean using a combination of catalyzed reporter deposition fluorescence in situ hybridization (CARD-FISH) and 16S small subunit ribosomal RNA (16S rRNA) gene sequencing (clone libraries and 454-pyrotags). Estimates of MGA abundance as a proportion of total bacteria were similar across all three methods although estimates based on CARD-FISH were consistently lower in the OMZ (5.6%±1.9%) than estimates based on 16S rRNA gene clone libraries (11.0%±3.9%) or pyrotags (9.9%±1.8%). Five previously defined MGA subgroups were recovered in 16S rRNA gene clone libraries and five novel subgroups were defined (HF770D10, P262000D03, P41300E03, P262000N21 and A714018). Rarefaction analysis of pyrotag data indicated that the ultimate richness of MGA was very nearly sampled. Spearman's rank analysis of MGA abundances by CARD-FISH and O(2) concentrations resulted in significant correlation. Analyzed in more detail by 16S rRNA pyrotag sequencing, MGA operational taxonomic units affiliated with subgroups Arctic95A-2 and A714018 comprised 0.3-2.4% of total bacterial sequences and displayed strong correlations with decreasing O(2) concentration. This study is the first comprehensive description of MGA diversity using complementary techniques. These results provide a phylogenetic framework for interpreting future studies on ecotype selection among MGA subgroups, and suggest a potentially important role for MGA in the ecology and biogeochemistry of OMZs.

Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

PubMed

Curtiss, W C; Vournakis, J N

1984-01-01

Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

Emergence of new types of Theileria orientalis in Australian cattle and possible cause of theileriosis outbreaks

PubMed Central

2011-01-01

Theileria parasites cause a benign infection of cattle in parts of Australia where they are endemic, but have, in recent years, been suspected of being responsible for a number of outbreaks of disease in cattle near the coast of New South Wales. The objective of this study was to identify and characterize the species of Theileria in cattle on six farms in New South Wales where disease outbreaks have occurred, and compare with Theileria from three disease-free farms in Queensland that is endemic for Theileria. Special reference was made to sub-typing of T. orientalis by type-specific PCR and sequencing of the small subunit (SSU) rRNA gene, and sequence analysis of the gene encoding a polymorphic merozoite/piroplasm surface protein (MPSP) that may be under immune selection. Nucleotide sequencing of SSU rRNA and MPSP genes revealed the presence of four Theileria genotypes: T. orientalis (buffeli), T. orientalis (ikeda), T. orientalis (chitose) and T. orientalis type 4 (MPSP) or type C (SSU rRNA). The majority of animals showed mixed infections while a few showed single infection. When MPSP nucleotide sequences were translated into amino acids, base transition did not change amino acid composition of the protein product, suggesting possible silent polymorphism. The occurrence of ikeda and type 4 (type C) previously not reported to occur and silent mutation is thought to have enhanced parasite evasion of the host immune response causing the outbreak. PMID:21338493

Redescription and molecular phylogeny of the type species for two main metopid genera, Metopus es (Müller, 1776) Lauterborn, 1916 and Brachonella contorta (Levander, 1894) Jankowski, 1964 (Metopida, Ciliophora), based on broad geographic sampling.

PubMed

Bourland, William; Rotterova, Johana; Čepička, Ivan

2017-06-01

Metopid ciliates occupy terrestrial, freshwater, and marine habitats worldwide, playing important roles as predominant consumers of bacteria, flagellates, algae, and diatoms in hypoxic environments. Metopus and Brachonella are the most species-rich metopid genera, however most of their species have not been studied by modern methods Here, we report the morphologic, morphometric and molecular characterization, and phylogeny of Metopus es and Brachonella contorta, both types of their respective genera, collected in a broad global sampling effort. Five strains of M. es and three strains of B. contorta were studied in detail, providing the first correlation of morphology, morphometrics, and 18S rRNA gene sequencing for both. We submitted 29 new 18S rRNA gene sequences to GenBank. Phylogenetic analyses yielded trees of similar topology. A strongly supported Metopus es clade is sister to the Brachonella contorta clade. Our analysis shows genus Metopus is not monophyletic. The monophyly of Brachonella cannot yet be determined due to lack of sequences for other species of this genus in molecular databases. Both species appear to have a global distribution. Metopus es was not found in Africa, probably reflecting low sampling effort. Strains of both species showed low 18S rRNA gene sequence divergence despite wide geographic separation. Copyright © 2016 Elsevier GmbH. All rights reserved.

Campylobacter iguaniorum sp. nov., isolated from reptiles

USDA-ARS?s Scientific Manuscript database

During samplings of reptiles for Epsilonproteobacteria, Campylobacter strains were isolated from lizards and chelonians not belonging to any of the established taxa. Initial AFLP, PCR, and 16S rRNA sequence analysis showed that these strains were most closely related to Campylobacter fetus and Campy...

Serological detection and molecular characterization of piroplasmids in equids in Brazil.

PubMed

Vieira, Maria Isabel Botelho; Costa, Márcio Machado; de Oliveira, Mateus Tonial; Gonçalves, Luiz Ricardo; André, Marcos Rogério; Machado, Rosangela Zacarias

2018-03-01

Equine piroplasmosis is a disease caused by the hemoparasites Babesia caballi and Theileria equi and is considered to be the most important parasitic infection affecting Equidae. The objective of the present study was to carry out an epidemiological molecular and serological survey for the presence of these two protozoal organisms in equids from the northwestern region of the State of Rio Grande do Sul (RS), south Brazil. For this purpose, blood samples were collected from 90 equids in the city of Passo Fundo, RS, Brazil. Those were animals used for sport activities, outdoor recreational riding, and work including cattle herding and mounted patrol. Anti-T. equi and anti-B. caballi IgG antibodies were detected in the sera of those animals by commercial ELISA kits. The molecular diagnosis of equine piroplasmosis due to T. equi or B. caballi (or both) consisted in the amplification of the 18S rRNA gene by nested PCR followed by sequencing of the amplified PCR product and sequence comparison and phylogenetic analysis of the isolates; 17 (18.9%) and 5 (5.55%) out of the 90 serum samples tested in this study were positive for T. equi and B. caballi, respectively. Piroplasmid 18S rRNA gene fragments were detected by PCR in 24.4% (22/90) of the samples analysed and shared 99-100% identity with sequences of T. equi by BLASTn. Samples for the phylogenetic analysis were divided into 2 groups. In group A, there was close phylogenetic relationship between 4 sequences and sequences previously reported along the US-Mexico border, in South Africa, and in Brazil. There was a phylogenetic proximity between 5 samples from group B and samples tested by other authors in the US and Spain. Variation of the 18S rRNA gene allowed the identification of 9 new T. equi genotypes in the geographical region studied. Copyright © 2017 Elsevier B.V. All rights reserved.

Phylogenetic analysis of simian Plasmodium spp. infecting Anopheles balabacensis Baisas in Sabah, Malaysia

PubMed Central

Manin, Benny O.; Daim, Sylvia; Vythilingam, Indra; Drakeley, Chris

2017-01-01

Background Anopheles balabacensis of the Leucospyrus group has been confirmed as the primary knowlesi malaria vector in Sabah, Malaysian Borneo for some time now. Presently, knowlesi malaria is the only zoonotic simian malaria in Malaysia with a high prevalence recorded in the states of Sabah and Sarawak. Methodology/Principal findings Anopheles spp. were sampled using human landing catch (HLC) method at Paradason village in Kudat district of Sabah. The collected Anopheles were identified morphologically and then subjected to total DNA extraction and polymerase chain reaction (PCR) to detect Plasmodium parasites in the mosquitoes. Identification of Plasmodium spp. was confirmed by sequencing the SSU rRNA gene with species specific primers. MEGA4 software was then used to analyse the SSU rRNA sequences and bulid the phylogenetic tree for inferring the relationship between simian malaria parasites in Sabah. PCR results showed that only 1.61% (23/1,425) of the screened An. balabacensis were infected with one or two of the five simian Plasmodium spp. found in Sabah, viz. Plasmodium coatneyi, P. inui, P. fieldi, P. cynomolgi and P. knowlesi. Sequence analysis of SSU rRNA of Plasmodium isolates showed high percentage of identity within the same Plasmodium sp. group. The phylogenetic tree based on the consensus sequences of P. knowlesi showed 99.7%–100.0% nucleotide identity among the isolates from An. balabacensis, human patients and a long-tailed macaque from the same locality. Conclusions/Significance This is the first study showing high molecular identity between the P. knowlesi isolates from An. balabacensis, human patients and a long-tailed macaque in Sabah. The other common simian Plasmodium spp. found in long-tailed macaques and also detected in An. balabacensis were P. coatneyi, P. inui, P. fieldi and P. cynomolgi. The high percentage identity of nucleotide sequences between the P. knowlesi isolates from the long-tailed macaque, An. balabacensis and human patients suggests a close genetic relationship between the parasites from these hosts. PMID:28968395

Microeukaryotic diversity in marine environments, an analysis of surface layer sediments from the East Sea.

PubMed

Park, Soo-Je; Park, Byoung-Joon; Pham, Vinh Hoa; Yoon, Dae-No; Kim, Si-Kwan; Rhee, Sung-Keun

2008-06-01

Molecular techniques, based on clone library of 18S rRNA gene, were employed to ascertain the diversity of microeukaryotic organisms in sediments from the East Sea. A total of 261 clones were recovered from surface sediments. Most of the clone sequences (90%) were affiliated with protists, dominated by Ciliates (18%) and Dinoflagellates (19%) of Alveolates, phototrophic Stramenopiles (11%), and Cercozoa (20%). Many of the clones were related to uncultivated eukaryotes clones retrieved from anoxic environments with several highly divergent 18S rRNA gene sequences. However, no clones were related to cultivated obligate anaerobic protists. Protistan communities between subsurface layers of 1 and 9 cm shared 23% of total phylotypes which comprised 64% of total clones retrieved. Analysis of diversity indices and rarefaction curve showed that the protistan community within the 1 cm layer exhibited higher diversity than the 9 cm layer. Our results imply that diverse protists remain to be uncovered within marine benthic environments.

Pulmonary Actinomyces graevenitzii infection presenting as organizing pneumonia diagnosed by PCR analysis.

PubMed

Fujita, Yu; Iikura, Motoyasu; Horio, Yuko; Ohkusu, Kiyofumi; Kobayashi, Nobuyuki

2012-08-01

We report what is believed to be the first case of pulmonary Actinomyces graevenitzii infection presenting as organizing pneumonia. Fever and night sweats developed in a 69-year-old male. The only abnormal laboratory data were an elevated erythrocyte sedimentation rate and C-reactive protein level. On chest images, multiple consolidations with air bronchograms were seen in the bilateral lungs. Histological examination from lung biopsy revealed a pattern of organizing pneumonia with microabscesses, but definitive diagnosis was not obtained because culture from lung specimen was negative. A. graevenitzii was eventually identified in the lung biopsy specimen by detection of an Actinomyces-specific PCR product followed by 16S rRNA gene sequencing. The patient was treated with high-dose ampicillin intravenously for 1 month, followed by oral amoxicillin and clarithromycin for 6 months, and recovered. We suggest that actinomycosis can present as organizing pneumonia, and identification of infection by PCR analysis and rRNA gene sequencing is a useful strategy in cases that are difficult to diagnose.

A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

PubMed

Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

2017-06-01

For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ruminococcus champanellensis sp. nov., a cellulose-degrading bacterium from human gut microbiota.

PubMed

Chassard, Christophe; Delmas, Eve; Robert, Céline; Lawson, Paul A; Bernalier-Donadille, Annick

2012-01-01

A strictly anaerobic, cellulolytic strain, designated 18P13(T), was isolated from a human faecal sample. Cells were Gram-positive non-motile cocci. Strain 18P13(T) was able to degrade microcrystalline cellulose but the utilization of soluble sugars was restricted to cellobiose. Acetate and succinate were the major end products of cellulose and cellobiose fermentation. 16S rRNA gene sequence analysis revealed that the isolate belonged to the genus Ruminococcus of the family Ruminococcaceae. The closest phylogenetic relative was the ruminal cellulolytic strain Ruminococcus flavefaciens ATCC 19208(T) (<95% 16S rRNA gene sequence similarity). The DNA G+C content of strain 18P13(T) was 53.05±0.7 mol%. On the basis of phylogenetic analysis, and morphological and physiological data, strain 18P13(T) can be differentiated from other members of the genus Ruminococcus with validly published names. The name Ruminococcus champanellensis sp. nov. is proposed, with 18P13(T) (=DSM 18848(T)=JCM 17042(T)) as the type strain.

Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

2002-01-01

MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

Rapid identification of oral Actinomyces species cultivated from subgingival biofilm by MALDI-TOF-MS

PubMed Central

Stingu, Catalina S.; Borgmann, Toralf; Rodloff, Arne C.; Vielkind, Paul; Jentsch, Holger; Schellenberger, Wolfgang; Eschrich, Klaus

2015-01-01

Background Actinomyces are a common part of the residential flora of the human intestinal tract, genitourinary system and skin. Isolation and identification of Actinomyces by conventional methods is often difficult and time consuming. In recent years, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) has become a rapid and simple method to identify bacteria. Objective The present study evaluated a new in-house algorithm using MALDI-TOF-MS for rapid identification of different species of oral Actinomyces cultivated from subgingival biofilm. Design Eleven reference strains and 674 clinical strains were used in this study. All the strains were preliminarily identified using biochemical methods and then subjected to MALDI-TOF-MS analysis using both similarity-based analysis and classification methods (support vector machine [SVM]). The genotype of the reference strains and of 232 clinical strains was identified by sequence analysis of the 16S ribosomal RNA (rRNA). Results The sequence analysis of the 16S rRNA gene of all references strains confirmed their previous identification. The MALDI-TOF-MS spectra obtained from the reference strains and the other clinical strains undoubtedly identified as Actinomyces by 16S rRNA sequencing were used to create the mass spectra reference database. Already a visual inspection of the mass spectra of different species reveals both similarities and differences. However, the differences between them are not large enough to allow a reliable differentiation by similarity analysis. Therefore, classification methods were applied as an alternative approach for differentiation and identification of Actinomyces at the species level. A cross-validation of the reference database representing 14 Actinomyces species yielded correct results for all species which were represented by more than two strains in the database. Conclusions Our results suggest that a combination of MALDI-TOF-MS with powerful classification algorithms, such as SVMs, provide a useful tool for the differentiation and identification of oral Actinomyces. PMID:25597306

Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

PubMed Central

Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

1998-01-01

We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

Molecular characterization of Hepatozoon felis in Rhipicephalus sanguineus ticks infested on captive lions (Panthera leo).

PubMed

Bhusri, Benjaporn; Sariya, Ladawan; Mongkolphan, Chalisa; Suksai, Parut; Kaewchot, Supakarn; Changbunjong, Tanasak

2017-09-01

Hepatozoon spp. are protozoan parasites that infect a wide range of domestic and wild animals. The infection occurs by ingestion of an infected tick. This study was carried out to detect and characterize Hepatozoon spp. in ticks collected from captive lions ( Panthera leo ) in Thailand based on the partial 18S rRNA gene sequence. A total of 30 ticks were collected and identified as Rhipicephalus sanguineus . The collected ticks were separated into 10 tick pools by sex and life stages. Of the 10 tick pools examined, only one (10%) was found to be infected with the Hepatozoon species. Sequencing and phylogenetic analysis showed a clustering of the partial 18S rRNA gene sequence like that of H. felis from the GenBank database. This is the first report of H. felis in R. sanguineus ticks collected from captive lions in Thailand. Our results indicated that R. sanguineus may be a possible vector of feline Hepatozoon in Thailand.

The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

PubMed

Root-Bernstein, Robert; Root-Bernstein, Meredith

2016-05-21

We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Chromobacterium sphagni sp. nov., an insecticidal bacterium isolated from Sphagnum bogs.

PubMed

Blackburn, Michael B; Farrar, Robert R; Sparks, Michael E; Kuhar, Daniel; Mitchell, Ashaki; Gundersen-Rindal, Dawn E

2017-09-01

Sixteen isolates of Gram-reaction-negative, motile, violet-pigmented bacteria were isolated from Sphagnum bogs in West Virginia and Maine, USA. 16S rRNA gene sequences and fatty acid analysis revealed a high degree of relatedness among the isolates, and genome sequencing of two isolates, IIBBL 14B-1T and IIBBL 37-2 (from West Virginia and Maine, respectively), revealed highly similar genomic sequences. The average nucleotide identity (gANI) calculated for these two isolates was found to be in excess of 99 %, but did not exceed 88 % when comparing either isolate with genomic sequences of Chromobacterium violaceum ATCC 12472T, C. haemolyticum DSM 19808T, C. piscinae ND17, C. subtsugae PRAA4-1T, C. vaccinii MWU205T or C. amazonense CBMAI 310T. Collectively, gANI and 16S rRNA gene sequence comparisons suggested that isolates IIBBL 14B-1T and IIBBL 37-2 were most closely related to C. subtsugae, but represented a distinct species. We propose the name Chromobacterium sphagni sp. nov. for this taxon; the type strain is IIBBL 14B-1T (=NRRL B-67130T=JCM 31882T).

Seasonal effects in a lake sediment archaeal community of the Brazilian Savanna.

PubMed

Rodrigues, Thiago; Catão, Elisa; Bustamante, Mercedes M C; Quirino, Betania F; Kruger, Ricardo H; Kyaw, Cynthia M

2014-01-01

The Cerrado is a biome that corresponds to 24% of Brazil's territory. Only recently microbial communities of this biome have been investigated. Here we describe for the first time the diversity of archaeal communities from freshwater lake sediments of the Cerrado in the dry season and in the transition period between the dry and rainy seasons, when the first rains occur. Gene libraries were constructed, using Archaea-specific primers for the 16S rRNA and amoA genes. Analysis revealed marked differences between the archaeal communities found in the two seasons. I.1a and I.1c Thaumarchaeota were found in greater numbers in the transition period, while MCG Archaea was dominant on the dry season. Methanogens were only found in the dry season. Analysis of 16S rRNA sequences revealed lower diversity on the transition period. We detected archaeal amoA sequences in both seasons, but there were more OTUs during the dry season. These sequences were within the same cluster as Nitrosotalea devanaterra's amoA gene. The principal coordinate analysis (PCoA) test revealed significant differences between samples from different seasons. These results provide information on archaeal diversity in freshwater lake sediments of the Cerrado and indicates that rain is likely a factor that impacts these communities.

New lipid-dependent Malassezia species from parrots.

PubMed

Cabañes, F Javier; Coutinho, S Dall' Acqua; Puig, Laura; Bragulat, M Rosa; Castellá, Gemma

2016-01-01

All the currently recognized Malassezia species have been isolated from mammals. However, only a few of them have been isolated from birds. In fact, birds have been less frequently studied as carriers of Malassezia yeasts than mammals. In this study we describe two new taxa, Malassezia brasiliensis sp. nov. and Malassezia psittaci sp. nov. The isolates studied in this publication were isolated from pet parrots from Brazil. They were characterized using the current morphological and physiological identification scheme. DNA sequencing and analysis of the D1/D2 regions of the 26S rRNA gene, the ITS-5.8S rRNA gene sequences and the β-tubulin gene were also performed. The strains proposed as new species did not completely fit the phenotypic profiles of any the described species. The validation of these new species was supported by analysis of the genes studied. The multilocus sequence analysis of the three loci provides robust support to delineate these species. These studies confirm the separation of these two new species from the other species of the genus Malassezia, as well as the presence of lipid-dependent Malassezia yeasts on parrots. Copyright © 2016 Asociación Española de Micología. Published by Elsevier Espana. All rights reserved.

Identification of a novel 16S rRNA gene variant of Actinomyces funkei from six patients with purulent infections.

PubMed

Hinić, V; Straub, C; Schultheiss, E; Kaempfer, P; Frei, R; Goldenberger, D

2013-07-01

Little is known about the clinical significance and laboratory diagnosis of Actinomyces funkei. In this report we describe six clinical cases where A. funkei was isolated from purulent, polymicrobial infections. Conventional identification procedures were compared with molecular methods including matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique. Analysis of the full 16S rRNA gene sequence of the six investigated strains revealed differences from the A. funkei type strain. DNA-DNA hybridization showed that the clinical strains represent a novel 16S rRNA gene variant within the species of A. funkei. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

The Development of a Novel qPCR Assay-Set for Identifying Fecal Contamination Originating from Domestic Fowls and Waterfowl in Israel.

PubMed

Ohad, Shoshanit; Ben-Dor, Shifra; Prilusky, Jaime; Kravitz, Valeria; Dassa, Bareket; Chalifa-Caspi, Vered; Kashi, Yechezkel; Rorman, Efrat

2016-01-01

The emerging microbial source tracking (MST) methodologies aim to identify fecal contamination originating from domestic and wild animals, and from humans. Avian MST is especially challenging, primarily because the Aves class includes both domesticated and wild species with highly diverse habitats and dietary characteristics. The quest for specific fecal bacterial MST markers can be difficult with respect to attaining sufficient assay sensitivity and specificity. The present study utilizes high throughput sequencing (HTS) to screen bacterial 16S rRNA genes from fecal samples collected from both domestic and wild avian species. Operational taxonomic unit (OTU) analysis was then performed, from which sequences were retained for downstream quantitative polymerase chain reaction (qPCR) marker development. Identification of unique avian host DNA sequences, absent in non-avian hosts, was then carried out using a dedicated database of bacterial 16S rRNA gene taken from the Ribosomal Database Project. Six qPCR assays were developed targeting the 16S rRNA gene of Lactobacillus, Gallibacterium, Firmicutes, Fusobacteriaceae, and other bacteria. Two assays (Av4143 and Av163) identified most of the avian fecal samples and demonstrated sensitivity values of 91 and 70%, respectively. The Av43 assay only identified droppings from battery hens and poultry, whereas each of the other three assays (Av24, Av13, and Av216) identified waterfowl species with lower sensitivities values. The development of an MST assay-panel, which includes both domestic and wild avian species, expands the currently known MST analysis capabilities for decoding fecal contamination.

Lactobacillus futsaii sp. nov., isolated from fu-tsai and suan-tsai, traditional Taiwanese fermented mustard products.

PubMed

Chao, Shiou-Huei; Kudo, Yuko; Tsai, Ying-Chieh; Watanabe, Koichi

2012-03-01

Three Gram-stain-positive strains were isolated from fermented mustard and were rod-shaped, non-motile, asporogenous, facultatively anaerobic, homofermentative and did not exhibit catalase activity. Comparative analyses of 16S rRNA, pheS and rpoA gene sequences demonstrated that the novel strains were members of the genus Lactobacillus. On the basis of 16S rRNA gene sequence analysis, the type strains of Lactobacillus crustorum (98.7% similarity), Lactobacillus farciminis (98.9%) and Lactobacillus mindensis (97.9%) were the closest neighbours. However, DNA-DNA reassociation values with these strains were less than 50%. Phenotypic and genotypic features demonstrated that these isolates represent a novel species of the genus Lactobacillus, for which the name Lactobacillus futsaii sp. nov. is proposed; the type strain is YM 0097(T) (=JCM 17355(T)=BCRC 80278(T)).

Lactobacillus hammesii sp. nov., isolated from French sourdough.

PubMed

Valcheva, Rosica; Korakli, Maher; Onno, Bernard; Prévost, Hervé; Ivanova, Iskra; Ehrmann, Matthias A; Dousset, Xavier; Gänzle, Michael G; Vogel, Rudi F

2005-03-01

Twenty morphologically different strains were chosen from French wheat sourdough isolates. Cells were Gram-positive, non-spore-forming, non-motile rods. The isolates were identified using amplified-fragment length polymorphism, randomly amplified polymorphic DNA and 16S rRNA gene sequence analysis. All isolates were members of the genus Lactobacillus. They were identified as representing Lactobacillus plantarum, Lactobacillus paralimentarius, Lactobacillus sanfranciscensis, Lactobacillus spicheri and Lactobacillus sakei. However, two isolates (LP38(T) and LP39) could be clearly discriminated from recognized Lactobacillus species on the basis of genotyping methods. 16S rRNA gene sequence similarity and DNA-DNA relatedness data indicate that the two strains belong to a novel Lactobacillus species, for which the name Lactobacillus hammesii is proposed. The type strain is LP38(T) (=DSM 16381(T)=CIP 108387(T)=TMW 1.1236(T)).

Phylogeny and classification of bacteria in the genera Clavibacter and Rathayibacter on the basis of 16s rRNA gene sequence analyses.

PubMed

Lee, I M; Bartoszyk, I M; Gundersen-Rindal, D E; Davis, R E

1997-07-01

A phylogenetic analysis by parsimony of 16S rRNA gene sequences (16S rDNA) revealed that species and subspecies of Clavibacter and Rathayibacter form a discrete monophyletic clade, paraphyletic to Corynebacterium species. Within the Clavibacter-Rathayibacter clade, four major phylogenetic groups (subclades) with a total of 10 distinct taxa were recognized: (I) species C. michiganensis; (II) species C. xyli; (III) species R. iranicus and R. tritici; and (IV) species R. rathayi. The first three groups form a monophyletic cluster, paraphyletic to R. rathayi. On the basis of the phylogeny inferred, reclassification of members of Clavibacter-Rathayibacter group is proposed. A system for classification of taxa in Clavibacter and Rathayibacter was developed based on restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S rDNA sequences. The groups delineated on the basis of RFLP patterns of 16S rDNA coincided well with the subclades delineated on the basis of phylogeny. In contrast to previous classification systems, which are based primarily on phenotypic properties and are laborious, the RFLP analyses allow for rapid differentiation among species and subspecies in the two genera.

Reassessment of the taxonomic position of Burkholderia andropogonis and description of Robbsia andropogonis gen. nov., comb. nov.

PubMed

Lopes-Santos, Lucilene; Castro, Daniel Bedo Assumpção; Ferreira-Tonin, Mariana; Corrêa, Daniele Bussioli Alves; Weir, Bevan Simon; Park, Duckchul; Ottoboni, Laura Maria Mariscal; Neto, Júlio Rodrigues; Destéfano, Suzete Aparecida Lanza

2017-06-01

The phylogenetic classification of the species Burkholderia andropogonis within the Burkholderia genus was reassessed using 16S rRNA gene phylogenetic analysis and multilocus sequence analysis (MLSA). Both phylogenetic trees revealed two main groups, named A and B, strongly supported by high bootstrap values (100%). Group A encompassed all of the Burkholderia species complex, whi.le Group B only comprised B. andropogonis species, with low percentage similarities with other species of the genus, from 92 to 95% for 16S rRNA gene sequences and 83% for conserved gene sequences. Average nucleotide identity (ANI), tetranucleotide signature frequency, and percentage of conserved proteins POCP analyses were also carried out, and in the three analyses B. andropogonis showed lower values when compared to the other Burkholderia species complex, near 71% for ANI, from 0.484 to 0.724 for tetranucleotide signature frequency, and around 50% for POCP, reinforcing the distance observed in the phylogenetic analyses. Our findings provide an important insight into the taxonomy of B. andropogonis. It is clear from the results that this bacterial species exhibits genotypic differences and represents a new genus described herein as Robbsia andropogonis gen. nov., comb. nov.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

High-resolution phylogenetic microbial community profiling

DOE PAGES

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin; ...

2016-02-09

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

PubMed Central

Salvi, Daniele; Macali, Armando; Mariottini, Paolo

2014-01-01

The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

Molecular phylogenetics and systematics of the bivalve family Ostreidae based on rRNA sequence-structure models and multilocus species tree.

PubMed

Salvi, Daniele; Macali, Armando; Mariottini, Paolo

2014-01-01

The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassostreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized [corrected]. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

PubMed Central

Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

2017-01-01

Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.

PubMed

Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne

2011-06-01

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Clostridium sphenoides Chronic Osteomyelitis Diagnosed Via Matrix-Assisted Laser Desorption Ionization Time of Flight Mass Spectrometry, Conflicting With 16S rRNA Sequencing but Confirmed by Whole Genome Sequencing.

PubMed

Perkins, Matthew J; Snesrud, Erik; McGann, Patrick; Duplessis, Christopher A

2017-01-01

We report a case of successful treatment of chronic osteomyelitis (emanating from contaminated soil exposure) caused by Clostridium sphenoides, an organism infrequently identified as a cause of human infection and more saliently osteomyelitis (only 1 reported case in the literature). Additional impetus for reporting this case resides in the insights gained regarding pathogen identification exploiting sophisticated molecular platforms coupled to traditional microbial culture-based methods. The fastidious nature of cultivating anaerobic organisms required initial attempts at 16S rRNA sequencing to identify a Clostridium species (Clostridium celerecrescens). However, on exploiting matrix-assisted laser desorption ionization time of flight (MALDI TOF) technology, C. sphenoides was identified, and confirmed on whole genome sequencing. The discrepancies noted in the varying platforms require vigilance to seek complementary testing for conflicting results. Although highly accurate, the MALDI TOF and 16S rRNA sequencing platforms are not immune to false identification particularly in differentiating closely related organisms. More germane, whole genome sequencing should be entertained when conflicting results are obtained from MALDI TOF and 16S rRNA sequencing. Precise species and/or strain level identification can be clinically relevant as antimicrobial sensitivity profiles may be discrepant between closely related species influencing clinical outcomes. Thus, it is incumbent on us to strive to acquire the correct species characterization when resources allow to dictate optimal treatment. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.

ISOLATION AND IDENTIFICATION OF FRESHWATER BACTERIA ANTAGONISTIC TO GIARDIA INTESTINALIS CYSTS

EPA Science Inventory

We have isolated three freshwater bacterial strains that demonstrate the ability to degrade Giardia intestinalis cysts. These strains have been identified by 16S rRNA sequencing and phylogenetic analysis as belonging to the Flavobacterium columnare clade of the ...

Molecular identification and characterization of Anaplasma platys and Ehrlichia canis in dogs in Mexico.

PubMed

Almazán, Consuelo; González-Álvarez, Vicente H; Fernández de Mera, Isabel G; Cabezas-Cruz, Alejandro; Rodríguez-Martínez, Rafael; de la Fuente, José

2016-03-01

The tick-borne pathogens Ehrlichia canis and Anaplasma platys are the causative agents of canine monocytic ehrlichiosis (CME) and canine cyclic thrombocytopenia (CCT). Although molecular evidence of E. canis has been shown, phylogenetic analysis of this pathogen has not been performed and A. platys has not been identified in Mexico, where the tick vector Rhipicephalus sanguineus sensu lato (s.l.) is common. The aim of this research was to screen, identify and characterize E. canis and A. platys by PCR and phylogenetic analysis in dogs from La Comarca Lagunera, a region formed by three municipalities, Torreon, Gomez-Palacio and Lerdo, in the Northern states of Coahuila and Durango, Mexico. Blood samples and five engorged R. sanguineus s.l. ticks per animal were collected from 43 females and 57 male dogs presented to veterinary clinics or lived in the dog shelter from La Comarca Lagunera. All the sampled dogs were apparently healthy and PCR for Anaplasma 16S rRNA, Ehrlichia 16S rRNA, and E. canis trp36 were performed. PCR products were sequenced and used for phylogenetic analysis. PCR products were successfully amplified in 31% of the samples using primers for Anaplasma 16S rRNA, while 10% and 4% amplified products using primers for Ehrlichia 16S rRNA and E. canis trp36 respectively. Subsequent sequencing and phylogenetic analyses of these products showed that three samples corresponded to A. platys and four to E. canis. Based on the analysis of trp36 we confirmed that the E. canis strains isolated from Mexico belong to a conservative clade of E. canis and are closely related to strains from USA. In conclusion, this is the first molecular identification of A. platys and the first molecular characterization and phylogenetic study of both A. platys and E. canis in dogs in Mexico. Copyright © 2015 Elsevier GmbH. All rights reserved.

Molecular characterization of trichomonads from feces of dogs with diarrhea.

PubMed

Gookin, Jody L; Birkenheuer, Adam J; St John, Victoria; Spector, Michelle; Levy, Michael G

2005-08-01

Trichomonads are occasionally observed in the feces of dogs with diarrhea. On the basis of superficial morphological appearance, these infections have been attributed to opportunistic overgrowth of the commensal, Pentatrichomonas hominis. However, molecular characterization of canine trichomonads has never been reported. This study was performed to determine, by means of rRNA gene sequence analysis, the identity of trichomonads observed in feces from dogs with diarrhea. Total DNA was isolated from fecal samples obtained from a 3-mo-old mixed breed dog and litter of German Shepherd puppies having profuse liquid diarrhea containing numerous trichomonads. Total DNA was subject to PCR amplification of partial 18S rRNA gene or 5.8S, ITS1, ITS2, and partial 18S and 28S rRNA genes using species-specific and universal primers, respectively. Products of 642 and 1864 base-pair length were amplified and cloned. On the basis of rRNA gene sequence, the trichomonads observed in the single dog and the litter of puppies shared 100% identity with Tritrichomonas foetus and P. hominis, respectively. The present study is the first to establish the molecular identity of trichomonads infecting dogs with diarrhea. These studies validate the longstanding assumption that canine trichomoniasis may be attributed to P. hominis. Importantly, these studies additionally recognize that canine trichomoniasis may also be caused by infection with T. foetus.

Matrix-Assisted Laser Desorption Ionization (MALDI)-Time of Flight Mass Spectrometry- and MALDI Biotyper-Based Identification of Cultured Biphenyl-Metabolizing Bacteria from Contaminated Horseradish Rhizosphere Soil▿

PubMed Central

Uhlik, Ondrej; Strejcek, Michal; Junkova, Petra; Sanda, Miloslav; Hroudova, Miluse; Vlcek, Cestmir; Mackova, Martina; Macek, Tomas

2011-01-01

Bacteria that are able to utilize biphenyl as a sole source of carbon were extracted and isolated from polychlorinated biphenyl (PCB)-contaminated soil vegetated by horseradish. Isolates were identified using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). The usage of MALDI Biotyper for the classification of isolates was evaluated and compared to 16S rRNA gene sequence analysis. A wide spectrum of bacteria was isolated, with Arthrobacter, Serratia, Rhodococcus, and Rhizobium being predominant. Arthrobacter isolates also represented the most diverse group. The use of MALDI Biotyper in many cases permitted the identification at the level of species, which was not achieved by 16S rRNA gene sequence analyses. However, some isolates had to be identified by 16S rRNA gene analyses if MALDI Biotyper-based identification was at the level of probable or not reliable identification, usually due to a lack of reference spectra included in the database. Overall, this study shows the possibility of using MALDI-TOF MS and MALDI Biotyper for the fast and relatively nonlaborious identification/classification of soil isolates. At the same time, it demonstrates the dominant role of employing 16S rRNA gene analyses for the identification of recently isolated strains that can later fill the gaps in the protein-based identification databases. PMID:21821747

Penicillium simile sp. nov. revealed by morphological and phylogenetic analysis.

PubMed

Davolos, Domenico; Pietrangeli, Biancamaria; Persiani, Anna Maria; Maggi, Oriana

2012-02-01

The morphology of three phenetically identical Penicillium isolates, collected from the bioaerosol in a restoration laboratory in Italy, displayed macro- and microscopic characteristics that were similar though not completely ascribable to Penicillium raistrickii. For this reason, a phylogenetic approach based on DNA sequencing analysis was performed to establish both the taxonomic status and the evolutionary relationships of these three peculiar isolates in relation to previously described species of the genus Penicillium. We used four nuclear loci (both rRNA and protein coding genes) that have previously proved useful for the molecular investigation of taxa belonging to the genus Penicillium at various evolutionary levels. The internal transcribed spacer region (ITS1-5.8S-ITS2), domains D1 and D2 of the 28S rDNA, a region of the tubulin beta chain gene (benA) and part of the calmodulin gene (cmd) were amplified by PCR and sequenced. Analysis of the rRNA genes and of the benA and cmd sequence data indicates the presence of three isogenic isolates belonging to a genetically distinct species of the genus Penicillium, here described and named Penicillium simile sp. nov. (ATCC MYA-4591(T)  = CBS 129191(T)). This novel species is phylogenetically different from P. raistrickii and other related species of the genus Penicillium (e.g. Penicillium scabrosum), from which it can be distinguished on the basis of morphological trait analysis.

Exploration of the Genomic Diversity and Core Genome of the Bifidobacterium adolescentis Phylogenetic Group by Means of a Polyphasic Approach

PubMed Central

Duranti, Sabrina; Turroni, Francesca; Milani, Christian; Foroni, Elena; Bottacini, Francesca; Dal Bello, Fabio; Ferrarini, Alberto; Delledonne, Massimo; van Sinderen, Douwe

2013-01-01

In the current work, we describe genome diversity and core genome sequences among representatives of three bifidobacterial species, i.e., Bifidobacterium adolescentis, Bifidobacterium catenulatum, and Bifidobacterium pseudocatenulatum, by employing a polyphasic approach involving analysis of 16S rRNA gene and 16S-23S internal transcribed spacer (ITS) sequences, pulsed-field gel electrophoresis (PFGE), and comparative genomic hybridization (CGH) assays. PMID:23064340

Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

PubMed

Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

2013-01-01

The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

Bacterial discrimination by means of a universal array approach mediated by LDR (ligase detection reaction)

PubMed Central

Busti, Elena; Bordoni, Roberta; Castiglioni, Bianca; Monciardini, Paolo; Sosio, Margherita; Donadio, Stefano; Consolandi, Clarissa; Rossi Bernardi, Luigi; Battaglia, Cristina; De Bellis, Gianluca

2002-01-01

Background PCR amplification of bacterial 16S rRNA genes provides the most comprehensive and flexible means of sampling bacterial communities. Sequence analysis of these cloned fragments can provide a qualitative and quantitative insight of the microbial population under scrutiny although this approach is not suited to large-scale screenings. Other methods, such as denaturing gradient gel electrophoresis, heteroduplex or terminal restriction fragment analysis are rapid and therefore amenable to field-scale experiments. A very recent addition to these analytical tools is represented by microarray technology. Results Here we present our results using a Universal DNA Microarray approach as an analytical tool for bacterial discrimination. The proposed procedure is based on the properties of the DNA ligation reaction and requires the design of two probes specific for each target sequence. One oligo carries a fluorescent label and the other a unique sequence (cZipCode or complementary ZipCode) which identifies a ligation product. Ligated fragments, obtained in presence of a proper template (a PCR amplified fragment of the 16s rRNA gene) contain either the fluorescent label or the unique sequence and therefore are addressed to the location on the microarray where the ZipCode sequence has been spotted. Such an array is therefore "Universal" being unrelated to a specific molecular analysis. Here we present the design of probes specific for some groups of bacteria and their application to bacterial diagnostics. Conclusions The combined use of selective probes, ligation reaction and the Universal Array approach yielded an analytical procedure with a good power of discrimination among bacteria. PMID:12243651

Genetic Diversity Among Botulinum Neurotoxin Producing Clostridial Strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hill, K K; Smith, T J; Helma, C H

2006-07-06

Clostridium botulinum is a taxonomic designation for many diverse anaerobic spore forming rod-shaped bacteria which have the common property of producing botulinum neurotoxins (BoNTs). The BoNTs are exoneurotoxins that can cause severe paralysis and even death in humans and various other animal species. A collection of 174 C. botulinum strains were examined by amplified fragment length polymorphism (AFLP) analysis and by sequencing of the 16S rRNA gene and BoNT genes to examine genetic diversity within this species. This collection contained representatives of each of the seven different serotypes of botulinum neurotoxins (BoNT A-G). Analysis of the16S rRNA sequences confirmed earliermore » reports of at least four distinct genomic backgrounds (Groups I-IV) each of which has independently acquired one or more BoNT serotypes through horizontal gene transfer. AFLP analysis provided higher resolution, and can be used to further subdivide the four groups into sub-groups. Sequencing of the BoNT genes from serotypes A, B and E in multiple strains confirmed significant sequence variation within each serotype. Four distinct lineages within each of the BoNT A and B serotypes, and five distinct lineages of serotype E strains were identified. The nucleotide sequences of the seven serotypes of BoNT were compared and show varying degrees of interrelatedness and recombination as has been previously noted for the NTNH gene which is linked to BoNT. These analyses contribute to the understanding of the evolution and phylogeny within this species and assist in the development of improved diagnostics and therapeutics for treatment of botulism.« less

Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

PubMed Central

Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

2014-01-01

For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

Molecular Characterization and Phylogenetic Analysis of Anaplasma spp. and Ehrlichia spp. Isolated from Various Ticks in Southeastern and Northwestern Regions of Iran.

PubMed

Jafar Bekloo, Ahmad; Ramzgouyan, Maryam Roya; Shirian, Sadegh; Faghihi, Faezeh; Bakhshi, Hassan; Naseri, Fatemeh; Sedaghat, Mehdi; Telmadarraiy, Zakkyeh

2018-05-01

Anaplasma/Ehrlichia species are tick-transmitted pathogens that cause infections in humans and numerous domestic and wild animal species. There is no information available on the molecular characteristics and phylogenetic position of Anaplasma/Ehrlichia spp. isolated from tick species from different geographic locations in Iran. The aim of this study was to determine the prevalence, molecular characteristics, and phylogenetic relationship of both Anaplasma spp. and Ehrlichia spp. in tick species isolated from different domestic animals from two different geographical locations of Iran. A total of 930 ticks were collected from 93 cattle, 250 sheep, and 587 goats inhabiting the study areas. The collected ticks were then investigated for the presence of Anaplasma/Ehrlichia spp. using nested PCR based on the 16S rRNA gene, followed by sequencing. Sequence analysis was done based on the data published in the GenBank on Anaplasma/Ehrlichia spp. isolates using bioinformatic tools such as the standard nucleotide BLAST. Genome of Anaplasma or Ehrlichia spp. was detected in 14 ticks collected in Heris, including 5 Dermacentor marginatus, 1 Haemaphysalis erinacei, 3 Hyalomma anatolicum, and 4 Rhipicephalus sanguineus, also in 29 ticks collected in Chabahar, including 14 R. sanguineus, 8 D. marginatus, 3 Hyalomma Anatolicum, and 4 Hyalomma dromedarii. Partial analysis of the 16S rRNA gene sequence of positive samples collected from goats and sheep showed that they were infected with Anaplasma/Ehrlichia spp. that were 94-98% identical to ovine Anaplasma and 91-96% identical to Neoehrlichia and Ehrlichia spp. The various ticks identified in this study suggest the possible emergence of tick-borne diseases in animals and humans in these regions. R. sanguineus and D. marginatus seem to be predominant vectors responsible for anaplasmosis in these regions. Partial sequence analysis of the 16S rRNA gene showed that A. ovis is genetically polymorphic in these regions. Furthermore, an association between the genetic heterogeneity of this microorganism and the geographical regions of Anaplasma strains was found. This study also showed that those ticks that were collected from the same geographical origin were infected with closely related strains of Anaplasma.

Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy

Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less

Depletion of Unwanted Nucleic Acid Templates by Selective Cleavage: LNAzymes, Catalytically Active Oligonucleotides Containing Locked Nucleic Acids, Open a New Window for Detecting Rare Microbial Community Members

PubMed Central

Dolinšek, Jan; Dorninger, Christiane; Lagkouvardos, Ilias; Wagner, Michael

2013-01-01

Many studies of molecular microbial ecology rely on the characterization of microbial communities by PCR amplification, cloning, sequencing, and phylogenetic analysis of genes encoding rRNAs or functional marker enzymes. However, if the established clone libraries are dominated by one or a few sequence types, the cloned diversity is difficult to analyze by random clone sequencing. Here we present a novel approach to deplete unwanted sequence types from complex nucleic acid mixtures prior to cloning and downstream analyses. It employs catalytically active oligonucleotides containing locked nucleic acids (LNAzymes) for the specific cleavage of selected RNA targets. When combined with in vitro transcription and reverse transcriptase PCR, this LNAzyme-based technique can be used with DNA or RNA extracts from microbial communities. The simultaneous application of more than one specific LNAzyme allows the concurrent depletion of different sequence types from the same nucleic acid preparation. This new method was evaluated with defined mixtures of cloned 16S rRNA genes and then used to identify accompanying bacteria in an enrichment culture dominated by the nitrite oxidizer “Candidatus Nitrospira defluvii.” In silico analysis revealed that the majority of publicly deposited rRNA-targeted oligonucleotide probes may be used as specific LNAzymes with no or only minor sequence modifications. This efficient and cost-effective approach will greatly facilitate tasks such as the identification of microbial symbionts in nucleic acid preparations dominated by plastid or mitochondrial rRNA genes from eukaryotic hosts, the detection of contaminants in microbial cultures, and the analysis of rare organisms in microbial communities of highly uneven composition. PMID:23263968

Pedobacter tournemirensis sp. nov., isolated from a fault water sample of a deep Toarcian argillite layer.

PubMed

Urios, Laurent; Intertaglia, Laurent; Magot, Michel

2013-01-01

A Gram-negative bacterium, designated TF5-37.2-LB10(T), was isolated from subsurface water of the Toarcian geological layer of Tournemire, France. Cells were non-motile straight rods that formed cream to light pink colonies on 10-fold diluted LB agar. Strain TF5-37.2-LB10(T) contained menaquinone 7 and its major fatty acids were iso-C(15 : 0), summed feature 3 (iso-C(15 : 0) 2-OH and/or C(16 : 1)ω7c), iso-C(17 : 0) 3-OH and iso-C(17 : 1)ω9c. The G+C content of the genomic DNA was 46 mol%. Phylogenetic analysis of the 16S rRNA gene sequence placed strain TF5-37.2-LB10(T) within the genus Pedobacter, family Sphingobacteriaceae. Pedobacter composti TR6-06(T) and Pedobacter oryzae DSM 19973(T) were the closest phylogenetic relatives (93.5 and 93.3 % 16S rRNA gene sequence similarity, respectively). On the basis of 16S rRNA gene sequence comparison and physiological and biochemical characteristics, strain TF5-37.2-LB10(T) represents a novel species of the genus Pedobacter, for which the name Pedobacter tournemirensis sp. nov. is proposed. The type strain is TF5-37.2-LB10(T) (= DSM 23085(T) = CIP 110085(T) = MOLA 820(T)).

Insights into the diversity of eukaryotes in acid mine drainage biofilm communities.

PubMed

Baker, Brett J; Tyson, Gene W; Goosherst, Lindsey; Banfield, Jillian F

2009-04-01

Microscopic eukaryotes are known to have important ecosystem functions, but their diversity in most environments remains vastly unexplored. Here we analyzed an 18S rRNA gene library from a subsurface iron- and sulfur-oxidizing microbial community growing in highly acidic (pH < 0.9) runoff within the Richmond Mine at Iron Mountain (northern California). Phylogenetic analysis revealed that the majority (68%) of the sequences belonged to fungi. Protists falling into the deeply branching lineage named the acidophilic protist clade (APC) and the class Heterolobosea were also present. The APC group represents kingdom-level novelty, with <76% sequence similarity to 18S rRNA gene sequences of organisms from other environments. Fluorescently labeled oligonucleotide rRNA probes were designed to target each of these groups in biofilm samples, enabling abundance and morphological characterization. Results revealed that the populations vary significantly with the habitat and no group is ubiquitous. Surprisingly, many of the eukaryotic lineages (with the exception of the APC) are closely related to neutrophiles, suggesting that they recently adapted to this extreme environment. Molecular analyses presented here confirm that the number of eukaryotic species associated with the acid mine drainage (AMD) communities is low. This finding is consistent with previous results showing a limited diversity of archaea, bacteria, and viruses in AMD environments and suggests that the environmental pressures and interplay between the members of these communities limit species diversity at all trophic levels.

Lucinidae/sulfur-oxidizing bacteria: ancestral heritage or opportunistic association? Further insights from the Bohol Sea (the Philippines).

PubMed

Brissac, Terry; Merçot, Hervé; Gros, Olivier

2011-01-01

The first studies of the 16S rRNA gene diversity of the bacterial symbionts found in lucinid clams did not clarify how symbiotic associations had evolved in this group. Indeed, although species-specific associations deriving from a putative ancestral symbiotic association have been described (coevolution scenario), associations between the same bacterial species and various host species (opportunistic scenario) have also been described. Here, we carried out a comparative molecular analysis of hosts, based on 18S and 28S rRNA gene sequences, and of symbionts, based on 16S rRNA gene sequences, to determine as to which evolutionary scenario led to modern lucinid/symbiont associations. For all sequences analyzed, we found only three bacterial symbiont species, two of which are harbored by lucinids colonizing mangrove swamps. The last symbiont is the most common and was found to be independent of biotope or depth. Another interesting feature is the similarity of ctenidial organization of lucinids from the Philippines to those described previously, with the exception that two bacterial morphotypes were observed in two different species (Gloverina rectangularis and Myrtea flabelliformis). Thus, there is apparently no specific association between Lucinidae and their symbionts, the association taking place according to which bacterial species is present in the environment. FEMS Microbiology Ecology © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. No claim to original French government works.

Pseudomonas fluorescens-like bacteria from the stomach: a microbiological and molecular study.

PubMed

Patel, Saurabh Kumar; Pratap, Chandra Bhan; Verma, Ajay Kumar; Jain, Ashok Kumar; Dixit, Vinod Kumar; Nath, Gopal

2013-02-21

To characterize oxidase- and urease-producing bacterial isolates, grown aerobically, that originated from antral biopsies of patients suffering from acid peptic diseases. A total of 258 antral biopsy specimens were subjected to isolation of bacteria followed by tests for oxidase and urease production, acid tolerance and aerobic growth. The selected isolates were further characterized by molecular techniques viz. amplifications for 16S rRNA using universal eubacterial and HSP60 gene specific primers. The amplicons were subjected to restriction analysis and partial sequencing. A phylogenetic tree was generated using unweighted pair group method with arithmetic mean (UPGMA) from evolutionary distance computed with bootstrap test of phylogeny. Assessment of acidity tolerance of bacteria isolated from antrum was performed using hydrochloric acid from 10(-7) mol/L to 10(-1) mol/L. Of the 258 antral biopsy specimens collected from patients, 179 (69.4%) were positive for urease production by rapid urease test and 31% (80/258) yielded typical Helicobacter pylori (H. pylori) after 5-7 d of incubation under a microaerophilic environment. A total of 240 (93%) antral biopsies yielded homogeneous semi-translucent and small colonies after overnight incubation. The partial 16S rRNA sequences revealed that the isolates had 99% similarity with Pseudomonas species. A phylogenetic tree on the basis of 16S rRNA sequences denoted that JQ927226 and JQ927227 were likely to be related to Pseudomonas fluorescens (P. fluorescens). On the basis of HSP60 sequences applied to the UPGMA phylogenetic tree, it was observed that isolated strains in an aerobic environment were likely to be P. fluorescens, and HSP60 sequences had more discriminatory potential rather than 16S rRNA sequences. Interestingly, this bacterium was acid tolerant for hours at low pH. Further, a total of 250 (96.9%) genomic DNA samples of 258 biopsy specimens and DNA from 240 bacterial isolates were positive for the 613 bp amplicons by targeting P. fluorescens-specific conserved putative outer membrane protein gene sequences. This study indicates that bacterial isolates from antral biopsies grown aerobically were P. fluorescens, and thus acid-tolerant bacteria other than H. pylori can also colonize the stomach and may be implicated in pathogenesis/protection.

Identification and molecular survey of Borrelia burgdorferi sensu lato in sika deer (Cervus nippon) from Jilin Province, north-eastern China.

PubMed

Zhai, Bintao; Niu, Qingli; Yang, Jifei; Liu, Zhijie; Liu, Junlong; Yin, Hong; Zeng, Qiaoying

2017-02-01

Lyme disease caused by Borrelia burgdorferi sensu lato (s.l.) is a common disease of domestic animals and wildlife worldwide. Sika deer is first-grade state-protected wildlife animals in China and have economic consequences for humans. It is reported that sika deer may serve as an important reservoir host for several species of B. burgdorferi s.l. and may transmit these species to humans and animals. However, little is known about the presence of Borrelia pathogens in sika deer in China. In this study, the existence and prevalence of Borrelia sp. in sika deer from four regions of Jilin Province in China was assessed. Seventy-one blood samples of sika deer were collected and tested by nested-PCRs based on 16S ribosomal RNA (16S rRNA), outer surface protein A (OspA), flagenllin (fla), and 5S-23S rRNA intergenic spacer (5S-23S rRNA) genes of B. burgdorferi s.l. Six (8.45%) samples were positive for Borrelia sp. based on sequences of 4 genes. The positive samples were detected 18 for 16S rRNA, 10 for OspA, 16 for fla and 6 for 5S-23S, with the positive rates 25.35% (95% CI=3.8-35.6), 14.08% (95% CI=3.0-21.6), 22.54% (95% CI=4.3-36.9) and 8.45% (95% CI=1.7-22.9), respectively. Sequence analysis of the positive PCR products revealed that the partial 4 genes sequences in this study were all most similar to the sequences of B. garinii and B. burgdorferi sensu stricto (s.s.), no other Borrelia genospecies were found. This is the first report of Borrelia pathogens in sika deer in China. The findings in this study indicated that sika deer as potential natural host and may spread Lyme disease pathogen to animals, ticks, and even humans. Copyright © 2016. Published by Elsevier B.V.

Drivers of cyanobacterial diversity and community composition in mangrove soils in south-east Brazil.

PubMed

Rigonato, Janaina; Kent, Angela D; Alvarenga, Danillo O; Andreote, Fernando D; Beirigo, Raphael M; Vidal-Torrado, Pablo; Fiore, Marli F

2013-04-01

Cyanobacteria act as primary producers of carbon and nitrogen in nutrient-poor ecosystems such as mangroves. This important group of microorganisms plays a critical role in sustaining the productivity of mangrove ecosystems, but the structure and function of cyanobacteria assemblages can be perturbed by anthropogenic influences. The aim of this work was to assess the community structure and ecological drivers that influence the cyanobacterial community harboured in two Brazilian mangrove soils, and examine the long-term effects of oil contamination on these keystone species. Community fingerprinting results showed that, although cyanobacterial communities are distinct between the two mangroves, the structure and diversity of the assemblages exhibit similar responses to environmental gradients. In each ecosystem, cyanobacteria occupying near-shore areas were similar in composition, indicating importance of marine influences for structuring the community. Analysis of 16S rRNA sequences revealed the presence of diverse cyanobacterial communities in mangrove sediments, with clear differences among mangrove habitats along a transect from shore to forest. While near-shore sites in both mangroves were mainly occupied by Prochlorococcus and Synechococcus genera, sequences retrieved from other mangrove niches were mainly affiliated with uncultured cyanobacterial 16S rRNA. The most intriguing finding was the large number of potentially novel cyanobacteria 16S rRNA sequences obtained from a previously oil-contaminated site. The abundance of cyanobacterial 16S rRNA sequences observed in sites with a history of oil contamination was significantly lower than in the unimpacted areas. This study emphasized the role of environmental drivers in determining the structure of cyanobacterial communities in mangrove soils, and suggests that anthropogenic impacts may also act as ecological filters that select cyanobacterial taxa. These results are an important contribution to our understanding of the composition and relative abundance of previously poorly described cyanobacterial assemblages in mangrove ecosystems. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Bayesian, maximum parsimony and UPGMA models for inferring the phylogenies of antelopes using mitochondrial markers.

PubMed

Khan, Haseeb A; Arif, Ibrahim A; Bahkali, Ali H; Al Farhan, Ahmad H; Al Homaidan, Ali A

2008-10-06

This investigation was aimed to compare the inference of antelope phylogenies resulting from the 16S rRNA, cytochrome-b (cyt-b) and d-loop segments of mitochondrial DNA using three different computational models including Bayesian (BA), maximum parsimony (MP) and unweighted pair group method with arithmetic mean (UPGMA). The respective nucleotide sequences of three Oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) and an out-group (Addax nasomaculatus) were aligned and subjected to BA, MP and UPGMA models for comparing the topologies of respective phylogenetic trees. The 16S rRNA region possessed the highest frequency of conserved sequences (97.65%) followed by cyt-b (94.22%) and d-loop (87.29%). There were few transitions (2.35%) and none transversions in 16S rRNA as compared to cyt-b (5.61% transitions and 0.17% transversions) and d-loop (11.57% transitions and 1.14% transversions) while comparing the four taxa. All the three mitochondrial segments clearly differentiated the genus Addax from Oryx using the BA or UPGMA models. The topologies of all the gamma-corrected Bayesian trees were identical irrespective of the marker type. The UPGMA trees resulting from 16S rRNA and d-loop sequences were also identical (Oryx dammah grouped with Oryx leucoryx) to Bayesian trees except that the UPGMA tree based on cyt-b showed a slightly different phylogeny (Oryx dammah grouped with Oryx gazella) with a low bootstrap support. However, the MP model failed to differentiate the genus Addax from Oryx. These findings demonstrate the efficiency and robustness of BA and UPGMA methods for phylogenetic analysis of antelopes using mitochondrial markers.

Bayesian, Maximum Parsimony and UPGMA Models for Inferring the Phylogenies of Antelopes Using Mitochondrial Markers

PubMed Central

Khan, Haseeb A.; Arif, Ibrahim A.; Bahkali, Ali H.; Al Farhan, Ahmad H.; Al Homaidan, Ali A.

2008-01-01

This investigation was aimed to compare the inference of antelope phylogenies resulting from the 16S rRNA, cytochrome-b (cyt-b) and d-loop segments of mitochondrial DNA using three different computational models including Bayesian (BA), maximum parsimony (MP) and unweighted pair group method with arithmetic mean (UPGMA). The respective nucleotide sequences of three Oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) and an out-group (Addax nasomaculatus) were aligned and subjected to BA, MP and UPGMA models for comparing the topologies of respective phylogenetic trees. The 16S rRNA region possessed the highest frequency of conserved sequences (97.65%) followed by cyt-b (94.22%) and d-loop (87.29%). There were few transitions (2.35%) and none transversions in 16S rRNA as compared to cyt-b (5.61% transitions and 0.17% transversions) and d-loop (11.57% transitions and 1.14% transversions) while comparing the four taxa. All the three mitochondrial segments clearly differentiated the genus Addax from Oryx using the BA or UPGMA models. The topologies of all the gamma-corrected Bayesian trees were identical irrespective of the marker type. The UPGMA trees resulting from 16S rRNA and d-loop sequences were also identical (Oryx dammah grouped with Oryx leucoryx) to Bayesian trees except that the UPGMA tree based on cyt-b showed a slightly different phylogeny (Oryx dammah grouped with Oryx gazella) with a low bootstrap support. However, the MP model failed to differentiate the genus Addax from Oryx. These findings demonstrate the efficiency and robustness of BA and UPGMA methods for phylogenetic analysis of antelopes using mitochondrial markers. PMID:19204824

Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

PubMed Central

Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

2000-01-01

Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

Literature Reference for Entamoeba histolytica (Journal of Clinical Microbiology. 2005. 43(11): 5491–5497)

EPA Pesticide Factsheets

Procedures are described for analysis of clinical samples and may be adapted for assessment of solid, particulate, liquid and water samples. The method is a real-time PCR assay that targets the 18S rRNA gene sequence of Entamoeba histolytica.

Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species

USDA-ARS?s Scientific Manuscript database

Phylogenetic relatedness among ascomycetous yeast genera (subphylum Saccharomycotina, phylum Ascomycota) has been uncertain. In the present study, type species of 70 currently recognized genera are compared from divergence in the nearly entire nuclear gene sequences for large subunit rRNA, small sub...

Agarivorans gilvus sp. nov. Isolated From Seaweed

USDA-ARS?s Scientific Manuscript database

A novel agarase-producing, non-endospore-forming marine bacterium WH0801T was isolated from a fresh seaweed sample collected from the coast of Weihai, China. Preliminary characterization based on 16S rRNA gene sequence analysis showed that WH0801T shared 96.1% identity with Agarivorans albus MKT 10...

Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

PubMed

Chun, J; Huq, A; Colwell, R R

1999-05-01

Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

Identification of bacterial endophytes associated with traditional medicinal plant Tridax procumbens Linn.

PubMed

Preveena, Jagadesan; Bhore, Subhash J

2013-01-01

In traditional medicine, Tridax procumbens Linn. is used in the treatment of injuries and wounds. The bacterial endophytes (BEs) of medicinal plants could produce medicinally important metabolites found in their hosts; and hence, the involvement of BEs in conferring wound healing properties to T. Procumbens cannot be ruled out. But, we do not know which types of BEs are associated with T. Procumbens. The objective of this study was to investigate the fast growing and cultivable BEs associated with T. procumbens. Leaves and stems of healthy T. Procumbens plants were collected and cultivable BEs were isolated from surface-sterilized leaf and stem tissue samples using Luria-Bertani (LB) agar (medium) at standard conditions. A polymerase chain reaction was employed to amplify 16S rRNA coding gene fragments from the isolates. Cultivable endophytic bacterial isolates (EBIs) were identified using 16S rRNA gene nucleotide sequence similarity based method of bacterial identification. Altogether, 50 culturable EBIs were isolated. 16S rRNA gene nucleotide sequences analysis using the Basic Local Alignment Search Tool (BLAST) revealed identities of the EBIs. Analysis reveals that cultivable Bacillus spp., Cronobacter sakazakii, Enterobacter spp., Lysinibacillus sphaericus, Pantoea spp., Pseudomonas spp. and Terribacillus saccharophilus are associated with T. Procumbens. Based on the results, we conclude that 24 different types of culturable BEs are associated with traditionally used medicinal plant, T. Procumbens, and require further study.

Multicolor microRNA FISH effectively differentiates tumor types

PubMed Central

Renwick, Neil; Cekan, Pavol; Masry, Paul A.; McGeary, Sean E.; Miller, Jason B.; Hafner, Markus; Li, Zhen; Mihailovic, Aleksandra; Morozov, Pavel; Brown, Miguel; Gogakos, Tasos; Mobin, Mehrpouya B.; Snorrason, Einar L.; Feilotter, Harriet E.; Zhang, Xiao; Perlis, Clifford S.; Wu, Hong; Suárez-Fariñas, Mayte; Feng, Huichen; Shuda, Masahiro; Moore, Patrick S.; Tron, Victor A.; Chang, Yuan; Tuschl, Thomas

2013-01-01

MicroRNAs (miRNAs) are excellent tumor biomarkers because of their cell-type specificity and abundance. However, many miRNA detection methods, such as real-time PCR, obliterate valuable visuospatial information in tissue samples. To enable miRNA visualization in formalin-fixed paraffin-embedded (FFPE) tissues, we developed multicolor miRNA FISH. As a proof of concept, we used this method to differentiate two skin tumors, basal cell carcinoma (BCC) and Merkel cell carcinoma (MCC), with overlapping histologic features but distinct cellular origins. Using sequencing-based miRNA profiling and discriminant analysis, we identified the tumor-specific miRNAs miR-205 and miR-375 in BCC and MCC, respectively. We addressed three major shortcomings in miRNA FISH, identifying optimal conditions for miRNA fixation and ribosomal RNA (rRNA) retention using model compounds and high-pressure liquid chromatography (HPLC) analyses, enhancing signal amplification and detection by increasing probe-hapten linker lengths, and improving probe specificity using shortened probes with minimal rRNA sequence complementarity. We validated our method on 4 BCC and 12 MCC tumors. Amplified miR-205 and miR-375 signals were normalized against directly detectable reference rRNA signals. Tumors were classified using predefined cutoff values, and all were correctly identified in blinded analysis. Our study establishes a reliable miRNA FISH technique for parallel visualization of differentially expressed miRNAs in FFPE tumor tissues. PMID:23728175

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE PAGES

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

2016-05-03

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Azospirillum zeae sp. nov., a diazotrophic bacterium isolated from rhizosphere soil of Zea mays.

PubMed

Mehnaz, Samina; Weselowski, Brian; Lazarovits, George

2007-12-01

Two free-living nitrogen-fixing bacterial strains, N6 and N7(T), were isolated from corn rhizosphere. A polyphasic taxonomic approach, including morphological characterization, Biolog analysis, DNA-DNA hybridization, and 16S rRNA, cpn60 and nifH gene sequence analysis, was taken to analyse the two strains. 16S rRNA gene sequence analysis indicated that strains N6 and N7(T) both belonged to the genus Azospirillum and were closely related to Azospirillum oryzae (98.7 and 98.8 % similarity, respectively) and Azospirillum lipoferum (97.5 and 97.6 % similarity, respectively). DNA-DNA hybridization of strains N6 and N7(T) showed reassociation values of 48 and 37 %, respectively, with A. oryzae and 43 % with A. lipoferum. Sequences of the nifH and cpn60 genes of both strains showed 99 and approximately 95 % similarity, respectively, with those of A. oryzae. Chemotaxonomic characteristics (Q-10 as quinone system, 18 : 1omega7c as major fatty acid) and G+C content of the DNA (67.6 mol%) were also similar to those of members of the genus Azospirillum. Gene sequences and Biolog and fatty acid analysis showed that strains N6 and N7(T) differed from the closely related species A. lipoferum and A. oryzae. On the basis of these results, it is proposed that these nitrogen-fixing strains represent a novel species. The name Azospirillum zeae sp. nov. is suggested, with N7(T) (=NCCB 100147(T)=LMG 23989(T)) as the type strain.

Biochemical characterization and phylogenetic analysis based on 16S rRNA sequences for V-factor dependent members of Pasteurellaceae derived from laboratory rats.

PubMed

Hayashimoto, Nobuhito; Ueno, Masami; Tkakura, Akira; Itoh, Toshio

2007-06-01

Phylogenetic analysis based on 16S rRNA sequences with sequence data of some bacterial species of Pasteurellaceae related to rodents deposited in GenBank was performed along with biochemical characterization for the 20 strains of V-factor dependent members of Pasteurellaceae derived from laboratory rats to obtain basic information and to investigate the taxonomic positions. The results of biochemical tests for all strains were identical except for three tests, the ornithine decarboxylase test, and fermentation tests of D(+) mannose and D(+) xylose. The biochemical properties of 8 of 20 strains that showed negative results for the fermentation test of D(+) xylose agreed with those of Haemophilus parainfluenzae complex. By phylogenetic analysis, the strains were divided into two clusters that agreed with the results of the fermentation test of xylose (group I: negative reaction for xylose, group II: positive reaction for xylose). The clusters were independent of other bacterial species of Pasteurellaceae tested. The sequences of the strains in group I showed 99.7-99.8% similarity and the strains in group II showed 99.3-99.7% similarity. None of the strains in group I had a close relation with Haemophilus parainfluenzae by phylogenetic analysis, although they showed the same biochemical properties. In conclusion, the strains had characteristic biochemical properties and formed two independent groups within the "rodent cluster" of Pasteurellaceae that differed in the results of the fermentation test of xylose. Therefore, they seemed to be hitherto undescribed taxa in Pasteurellaceae.

Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

PubMed

Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

2013-01-16

The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

Diversity of cultured photosynthetic flagellates in the North East Pacific and Arctic Oceans in summer

NASA Astrophysics Data System (ADS)

Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

2012-06-01

During the MALINA cruise (summer 2009) an extensive effort was undertaken to isolate phytoplankton strains from the North East (NE) Pacific Ocean, the Bering Strait, and the Beaufort Sea. Strains were isolated by flow cytometry sorting (FCS) and pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18S rRNA gene sequence similarity) mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas) which was almost the only phytoplankter recovered within picoplankton (≤ 2 μm) size range. Strains of Arctic Micromonas as well as three unidentified strains related to the same genus were identified in further details by sequencing the Internal Transcribed Spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. The unidentified strains form a genotype likely belonging to a new genus within the family Mamiellaceae to which Micromonas belongs. Other green algae genotypes from the genera Nephroselmis, Chlamydomonas, Pyramimonas were also isolated whereas Heterokontophyta included Pelagophyceae, Dictyochophyceae and Chrysophyceae. Dictyochophyceae included Pedinellales which could not be identified to the genus level whereas Chrysophyceae comprised Dinobryon faculiferum. Moreover, we isolated Rhodomonas sp. as well as a few Haptophyta and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by Scanning Electron Microscopy (SEM) and 28S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

Diversity of cultured photosynthetic flagellates in the northeast Pacific and Arctic Oceans in summer

NASA Astrophysics Data System (ADS)

Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

2012-11-01

During the MALINA cruise (summer 2009), an extensive effort was undertaken to isolate phytoplankton strains from the northeast (NE) Pacific Ocean, the Bering Strait, the Chukchi Sea, and the Beaufort Sea. In order to characterise the main photosynthetic microorganisms occurring in the Arctic during the summer season, strains were isolated by flow cytometry sorting (FCS) and single cell pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18 S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18 S rRNA gene sequence similarity), mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas), which was nearly the only phytoplankter recovered within the picoplankton (< 2 μm) size range. Strains of Arctic Micromonas as well as other strains from the same class (Mamiellophyceae) were identified in further detail by sequencing the internal transcribed spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18 S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. Three other Mamiellophyceae strains likely belong to a new genus. Other green algae from the genera Nephroselmis, Chlamydomonas, and Pyramimonas were also isolated, whereas Heterokontophyta included some unidentified Pelagophyceae, Dictyochophyceae (Pedinellales), and Chrysophyceae (Dinobryon faculiferum). Moreover, we isolated some Cryptophyceae (Rhodomonas sp.) as well as a few Prymnesiophyceae and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by scanning electron microscopy (SEM) and 28 S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28 S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

Insight into the validity of Leptobrachium guangxiense (Anura: Megophryidae): evidence from mitochondrial DNA sequences and morphological characters.

PubMed

Chen, Weicai; Zhang, Wei; Zhou, Shichu; Li, Ning; Huang, Yong; Mo, Yunming

2013-01-01

Lepobrachiun guangxiense Fei, Mo, Ye and Jiang, 2009 (Anura: Megophryidae), is presently thought to be endemic to Shangsi, Guangxi Province, China. A molecular phylogenetic analysis and morphological data were performed to gain insight into the phylogenetic position of this species. Maximum parsimony, maximum likelihood, and Bayesian inference methods were employed to reconstruct phylogenetic relationship, using 1914 bp of sequences from mtDNA genes of 12S rRNA, tRNAVal and 16S rRNA. Topologies revealed that L. guangxiense and Tam Dao (Vietnam) L. chapaense lineage (3A) formed a monophyletic group with well-supported values. The uncorrected p-distance of ~1.4k bp 16S rRNA data-sets between Tam Dao L. chapaense lineage (3A) and L. guangxiense is only 0.1%. Morphologically, L. guangxiense and Tam Dao L. chapaense lineage (3A) shared the same characters, and are distinguishable from "true" L. chapaense from the type locality in Sa Pa, Vietnam. Based on morphological characters and mitochondrial DNA, we suggested that the Tam Dao lineages of L. chapaense are conspecific with L. guangxiense. This represents a range extension for L. guangxiense, and a new country record for Vietnam.

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

Phylogenetic analysis of Haemaphysalis erinacei Pavesi, 1884 (Acari: Ixodidae) from China, Turkey, Italy and Romania.

PubMed

Hornok, Sándor; Wang, Yuanzhi; Otranto, Domenico; Keskin, Adem; Lia, Riccardo Paolo; Kontschán, Jenő; Takács, Nóra; Farkas, Róbert; Sándor, Attila D

2016-12-15

Haemaphysalis erinacei is one of the few ixodid tick species for which valid names of subspecies exist. Despite their disputed taxonomic status in the literature, these subspecies have not yet been compared with molecular methods. The aim of the present study was to investigate the phylogenetic relationships of H. erinacei subspecies, in the context of the first finding of this tick species in Romania. After morphological identification, DNA was extracted from five adults of H. e. taurica (from Romania and Turkey), four adults of H. e. erinacei (from Italy) and 17 adults of H. e. turanica (from China). From these samples fragments of the cytochrome c oxidase subunit 1 (cox1) and 16S rRNA genes were amplified via PCR and sequenced. Results showed that cox1 and 16S rRNA gene sequence divergences between H. e. taurica from Romania and H. e. erinacei from Italy were below 2%. However, the sequence divergences between H. e. taurica from Romania and H. e. turanica from China were high (up to 7.3% difference for the 16S rRNA gene), exceeding the reported level of sequence divergence between closely related tick species. At the same time, two adults of H. e. taurica from Turkey had higher 16S rRNA gene similarity to H. e. turanica from China (up to 97.5%) than to H. e. taurica from Romania (96.3%), but phylogenetically clustered more closely to H. e. taurica than to H. e. turanica. This is the first finding of H. erinacei in Romania, and the first (although preliminary) phylogenetic comparison of H. erinacei subspecies. Phylogenetic analyses did not support that the three H. erinacei subspecies evaluated here are of equal taxonomic rank, because the genetic divergence between H. e. turanica from China and H. e. taurica from Romania exceeded the usual level of sequence divergence between closely related tick species, suggesting that they might represent different species. Therefore, the taxonomic status of the subspecies of H. erinacei needs to be revised based on a larger number of specimens collected throughout its geographical range.

Transcriptional and phylogenetic analysis of five complete ambystomatid salamander mitochondrial genomes.

PubMed

Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal

2005-04-11

We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger salamander complex species also produced robustly supported trees. The D-loop, used in previous molecular phylogenetic studies of the complex, was found to contain a relatively low level of variation and we identified mitochondrial regions with higher rates of molecular evolution that are more useful in resolving relationships among species. Our results show the benefit of using complete genome mitochondrial information in studies of recently and rapidly diverged taxa.

Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex

PubMed Central

Weber, Carolyn F.; King, Gary M.

2017-01-01

Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai‘i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia, respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia: Paraburkholderia hiiakae sp. nov. (type strain I2T = DSM 28029T = LMG 27952T); Paraburkholderia paradisi sp. nov. (type strain WAT = DSM 28027T = LMG 27949T); Paraburkholderia peleae sp. nov. (type strain PP52-1T = DSM 28028T = LMG 27950T); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1T = DSM 28030T = LMG 28140T). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38T = DSM 28031T = LMG 28138T). PMID:28270796

Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex.

PubMed

Weber, Carolyn F; King, Gary M

2017-01-01

Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai'i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia , respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia : Paraburkholderia hiiakae sp. nov. (type strain I2 T = DSM 28029 T = LMG 27952 T ); Paraburkholderia paradisi sp. nov. (type strain WA T = DSM 28027 T = LMG 27949 T ); Paraburkholderia peleae sp. nov. (type strain PP52-1 T = DSM 28028 T = LMG 27950 T ); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1 T = DSM 28030 T = LMG 28140 T ). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38 T = DSM 28031 T = LMG 28138 T ).

Status of the Microbial Census

PubMed Central

Schloss, Patrick D.; Handelsman, Jo

2004-01-01

Over the past 20 years, more than 78,000 16S rRNA gene sequences have been deposited in GenBank and the Ribosomal Database Project, making the 16S rRNA gene the most widely studied gene for reconstructing bacterial phylogeny. While there is a general appreciation that these sequences are largely unique and derived from diverse species of bacteria, there has not been a quantitative attempt to describe the extent of sequencing efforts to date. We constructed rarefaction curves for each bacterial phylum and for the entire bacterial domain to assess the current state of sampling and the relative taxonomic richness of each phylum. This analysis quantifies the general sense among microbiologists that we are a long way from a complete census of the bacteria on Earth. Moreover, the analysis indicates that current sampling strategies might not be the most effective ones to describe novel diversity because there remain numerous phyla that are globally distributed yet poorly sampled. Based on the current level of sampling, it is not possible to estimate the total number of bacterial species on Earth, but the minimum species richness is 35,498. Considering previous global species richness estimates of 107 to 109, we are certain that this estimate will increase with additional sequencing efforts. The data support previous calls for extensive surveys of multiple chemically disparate environments and of specific phylogenetic groups to advance the census most rapidly. PMID:15590780

Methylobacterium phyllosphaerae sp. nov., a pink-pigmented, facultative methylotroph from the phyllosphere of rice.

PubMed

Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Kwon, Soon-Wo; Sa, Tong-Min

2009-01-01

A pink-pigmented, aerobic, facultatively methylotrophic bacterial strain, CBMB27T, isolated from leaf tissues of rice (Oryza sativa L. 'Dong-Jin'), was analysed using a polyphasic taxonomic approach. Comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Methylobacterium oryzae, Methylobacterium fujisawaense and Methylobacterium mesophilicum; strain CBMB27T showed sequence similarities of 98.3, 98.5 and 97.3 %, respectively, to the type strains of these three species. DNA-DNA hybridization experiments revealed low levels (<38 %) of DNA-DNA relatedness between strain CBMB27T and its closest relatives. The sequence of the 1-aminocyclopropane-1-carboxylate deaminase gene (acdS) in strain CBMB27T differed from those of close relatives. The major fatty acid of the isolate was C(18 : 1)omega7c and the G+C content of the genomic DNA was 66.8 mol%. Based on the results of 16S rRNA gene sequence analysis, DNA-DNA hybridization, and physiological and biochemical characterization, which enabled the isolate to be differentiated from all recognized species of the genus Methylobacterium, it was concluded that strain CBMB27T represents a novel species in the genus Methylobacterium for which the name Methylobacterium phyllosphaerae sp. nov. is proposed (type strain CBMB27T =LMG 24361T =KACC 11716T =DSM 19779T).

Phylogeny of culturable cyanobacteria from Brazilian mangroves.

PubMed

Silva, Caroline Souza Pamplona; Genuário, Diego Bonaldo; Vaz, Marcelo Gomes Marçal Vieira; Fiore, Marli Fátima

2014-03-01

The cyanobacterial community from Brazilian mangrove ecosystems was examined using a culture-dependent method. Fifty cyanobacterial strains were isolated from soil, water and periphytic samples collected from Cardoso Island and Bertioga mangroves using specific cyanobacterial culture media. Unicellular, homocytous and heterocytous morphotypes were recovered, representing five orders, seven families and eight genera (Synechococcus, Cyanobium, Cyanobacterium, Chlorogloea, Leptolyngbya, Phormidium, Nostoc and Microchaete). All of these novel mangrove strains had their 16S rRNA gene sequenced and BLAST analysis revealed sequence identities ranging from 92.5 to 99.7% when they were compared with other strains available in GenBank. The results showed a high variability of the 16S rRNA gene sequences among the genotypes that was not associated with the morphologies observed. Phylogenetic analyses showed several branches formed exclusively by some of these novel 16S rRNA gene sequences. BLAST and phylogeny analyses allowed for the identification of Nodosilinea and Oxynema strains, genera already known to exhibit poor morphological diacritic traits. In addition, several Nostoc and Leptolyngbya morphotypes of the mangrove strains may represent new generic entities, as they were distantly affiliated with true genera clades. The presence of non-ribosomal peptide synthetase, polyketide synthase, microcystin and saxitoxin genes were detected in 20.5%, 100%, 37.5% and 33.3%, respectively, of the 44 tested isolates. A total of 134 organic extracts obtained from 44 strains were tested against microorganisms, and 26% of the extracts showed some antimicrobial activity. This is the first polyphasic study of cultured cyanobacteria from Brazilian mangrove ecosystems using morphological, genetic and biological approaches. Copyright © 2014 Elsevier GmbH. All rights reserved.

Evaluation of Faecalibacterium 16S rDNA genetic markers for accurate identification of swine faecal waste by quantitative PCR.

PubMed

Duan, Chuanren; Cui, Yamin; Zhao, Yi; Zhai, Jun; Zhang, Baoyun; Zhang, Kun; Sun, Da; Chen, Hang

2016-10-01

A genetic marker within the 16S rRNA gene of Faecalibacterium was identified for use in a quantitative PCR (qPCR) assay to detect swine faecal contamination in water. A total of 146,038 bacterial sequences were obtained using 454 pyrosequencing. By comparative bioinformatics analysis of Faecalibacterium sequences with those of numerous swine and other animal species, swine-specific Faecalibacterium 16S rRNA gene sequences were identified and Polymerase Chain Okabe (PCR) primer sets designed and tested against faecal DNA samples from swine and non-swine sources. Two PCR primer sets, PFB-1 and PFB-2, showed the highest specificity to swine faecal waste and had no cross-reaction with other animal samples. PFB-1 and PFB-2 amplified 16S rRNA gene sequences from 50 samples of swine with positive ratios of 86 and 90%, respectively. We compared swine-specific Faecalibacterium qPCR assays for the purpose of quantifying the newly identified markers. The quantification limits (LOQs) of PFB-1 and PFB-2 markers in environmental water were 6.5 and 2.9 copies per 100 ml, respectively. Of the swine-associated assays tested, PFB-2 was more sensitive in detecting the swine faecal waste and quantifying the microbial load. Furthermore, the microbial abundance and diversity of the microbiomes of swine and other animal faeces were estimated using operational taxonomic units (OTUs). The species specificity was demonstrated for the microbial populations present in various animal faeces. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification of a microsporidian isolate from Cnaphalocrocis Medinalis and its pathogenicity to Bombyx mori.

PubMed

Huang, Xuhua; Qi, Guangjun; Pan, Zhixin; Zhu, Fangrong; Huang, Yuanjiao; Wu, Yonghu

2014-11-01

A microsporidian, CmM2, was isolated from Cnaphalocrocis medinalis. The biological characters, molecular analysis and pathogenicity of CmM2 were studied. The spore of CmM2 is long oval in shape and 3.45 ± 0.25 × 1.68 ± 0.18 µm in size, the life cycle includes meronts, sporonts, sporoblasts, and spores, with typical diplokaryon in each stage, propagated in binary fission. There is positive coagulation reaction between CmM2 and the polyclonal antibody of Nosema bombycis (N.b.). CmM2 spores is binuclear, and has 10-12 polar filament coils. The small subunit ribosomal RNA (SSU rRNA) gene sequence of CmM2 was obtained by PCR amplification and sequencing, the phylogenetic tree based on SSU rRNA sequences had been constructed, and the similarity and genetic distance of SSU rRNA sequences were analyzed, showed that CmM2 was grouped in the Nosema clade. The 50% infectious concentration of CmM2 to Bombyx mori is 4.72 × 10(4)  spores ml(-1) , and the germinative infection rate is 12.33%. The results showed that CmM2 is classified into genus Nosema, as Nosema sp. CmM2, and has a heavy infectivity to B. mori. The result indicated as well that it is valuable taxonomic determination for microsporidian isolates based on both biological characters and molecular evidence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bacterioplankton diversity and community composition in the Southern Lagoon of Venice.

PubMed

Simonato, Francesca; Gómez-Pereira, Paola R; Fuchs, Bernhard M; Amann, Rudolf

2010-04-01

The Lagoon of Venice is a large water basin that exchanges water with the Northern Adriatic Sea through three large inlets. In this study, the 16S rRNA approach was used to investigate the bacterial diversity and community composition within the southern basin of the Lagoon of Venice and at one inlet in October 2007 and June 2008. Comparative sequence analysis of 645 mostly partial 16S rRNA gene sequences indicated high diversity and dominance of Alphaproteobacteria, Gammaproteobacteria and Bacteroidetes at the lagoon as well as at the inlet station, therefore pointing to significant mixing. Many of these sequences were close to the 16S rRNA of marine, often coastal, bacterioplankton, such as the Roseobacter clade, the family Vibrionaceae, and class Flavobacteria. Sequences of Actinobacteria were indicators of a freshwater input. The composition of the bacterioplankton was quantified by catalyzed reporter deposition fluorescence in situ hybridization (CARD-FISH) with a set of rRNA-targeted oligonucleotide probes. CARD-FISH counts corroborated the dominance of members of the phyla Alphaproteobacteria, Gammaproteobacteria and Bacteroidetes. When assessed by a probe set for the quantification of selected clades within Alphaproteobacteria and Gammaproteobacteria, bacterioplankton composition differed between October 2007 and June 2008, and also between the inlet and the lagoon. In particular, members of the readily culturable copiotrophic gammaproteobacterial genera Vibrio, Alteromonas and Pseudoalteromonas were enriched in the southern basin of the Lagoon of Venice. Interestingly, the alphaproteobacterial SAR11 clade and related clusters were also present in high abundances at the inlet and within the lagoon, which was indicative of inflow of water from the open sea.

Cultivable Anaerobic Microbiota of Severe Early Childhood Caries▿¶

PubMed Central

Tanner, A. C. R.; Mathney, J. M. J.; Kent, R. L.; Chalmers, N. I.; Hughes, C. V.; Loo, C. Y.; Pradhan, N.; Kanasi, E.; Hwang, J.; Dahlan, M. A.; Papadopolou, E.; Dewhirst, F. E.

2011-01-01

Severe early childhood caries (ECC), while strongly associated with Streptococcus mutans using selective detection (culture, PCR), has also been associated with a widely diverse microbiota using molecular cloning approaches. The aim of this study was to evaluate the microbiota of severe ECC using anaerobic culture. The microbial composition of dental plaque from 42 severe ECC children was compared with that of 40 caries-free children. Bacterial samples were cultured anaerobically on blood and acid (pH 5) agars. Isolates were purified, and partial sequences for the 16S rRNA gene were obtained from 5,608 isolates. Sequence-based analysis of the 16S rRNA isolate libraries from blood and acid agars of severe ECC and caries-free children had >90% population coverage, with greater diversity occurring in the blood isolate library. Isolate sequences were compared with taxon sequences in the Human Oral Microbiome Database (HOMD), and 198 HOMD taxa were identified, including 45 previously uncultivated taxa, 29 extended HOMD taxa, and 45 potential novel groups. The major species associated with severe ECC included Streptococcus mutans, Scardovia wiggsiae, Veillonella parvula, Streptococcus cristatus, and Actinomyces gerensceriae. S. wiggsiae was significantly associated with severe ECC children in the presence and absence of S. mutans detection. We conclude that anaerobic culture detected as wide a diversity of species in ECC as that observed using cloning approaches. Culture coupled with 16S rRNA identification identified over 74 isolates for human oral taxa without previously cultivated representatives. The major caries-associated species were S. mutans and S. wiggsiae, the latter of which is a candidate as a newly recognized caries pathogen. PMID:21289150

Cyanobacterial diversity in extreme environments in Baja California, Mexico: a polyphasic study.

PubMed

López-Cortés, A; García-Pichel, F; Nübel, U; Vázquez-Juárez, R

2001-12-01

Cyanobacterial diversity from two geographical areas of Baja California Sur, Mexico, were studied: Bahia Concepcion, and Ensenada de Aripez. The sites included hypersaline ecosystems, sea bottom, hydrothermal springs, and a shrimp farm. In this report we describe four new morphotypes, two are marine epilithic from Bahia Concepcion, Dermocarpa sp. and Hyella sp. The third, Geitlerinema sp., occurs in thermal springs and in shrimp ponds, and the fourth, Tychonema sp., is from a shrimp pond. The partial sequences of the 16S rRNA genes and the phylogenetic relationship of four cyanobacterial strains (Synechococcus cf. elongatus, Leptolyngbya cf. thermalis, Leptolyngbya sp., and Geitlerinema sp.) are also presented. Polyphasic studies that include the combination of light microscopy, cultures and the comparative analysis of 16S rRNA gene sequences provide the most powerful approach currently available to establish the diversity of these oxygenic photosynthetic microorganisms in culture and in nature.

Bacteremia due to Moraxella atlantae in a cancer patient.

PubMed

De Baere, Thierry; Muylaert, An; Everaert, Els; Wauters, Georges; Claeys, Geert; Verschraegen, Gerda; Vaneechoutte, Mario

2002-07-01

A gram-negative alkaline phosphatase- and pyrrolidone peptidase-positive rod-shaped bacterium (CCUG 45702) was isolated from two aerobic blood cultures from a female cancer patient. No identification could be reached using phenotypic techniques. Amplification of the tRNA intergenic spacers revealed fragments with lengths of 116, 133, and 270 bp, but no such pattern was present in our reference library. Sequencing of the 16S rRNA gene revealed its identity as Moraxella atlantae, a species isolated only rarely and published only once as causing infection. In retrospect, the phenotypic characteristics fit the identification as M. atlantae (formerly known as CDC group M-3). Comparative 16S rRNA sequence analysis indicates that M. atlantae, M. lincolnii, and M. osloensis might constitute three separate genera within the MORAXELLACEAE: After treatment with amoxicillin-clavulanic acid for 2 days, fever subsided and the patient was dismissed.

Bacteremia Due to Moraxella atlantae in a Cancer Patient

PubMed Central

De Baere, Thierry; Muylaert, An; Everaert, Els; Wauters, Georges; Claeys, Geert; Verschraegen, Gerda; Vaneechoutte, Mario

2002-01-01

A gram-negative alkaline phosphatase- and pyrrolidone peptidase-positive rod-shaped bacterium (CCUG 45702) was isolated from two aerobic blood cultures from a female cancer patient. No identification could be reached using phenotypic techniques. Amplification of the tRNA intergenic spacers revealed fragments with lengths of 116, 133, and 270 bp, but no such pattern was present in our reference library. Sequencing of the 16S rRNA gene revealed its identity as Moraxella atlantae, a species isolated only rarely and published only once as causing infection. In retrospect, the phenotypic characteristics fit the identification as M. atlantae (formerly known as CDC group M-3). Comparative 16S rRNA sequence analysis indicates that M. atlantae, M. lincolnii, and M. osloensis might constitute three separate genera within the Moraxellaceae. After treatment with amoxicillin-clavulanic acid for 2 days, fever subsided and the patient was dismissed. PMID:12089312

Root-knot nematodes in golf course greens of the western United States

USDA-ARS?s Scientific Manuscript database

A survey of 238 golf courses in ten of the Western U.S. found root-knot nematodes (Meloidogyne spp.) in 60 % of the putting greens sampled. Sequence and phylogenetic analyses of 18S rRNA, D2-D3 of 28S rRNA, ITS-rRNA and mtDNA gene sequences were used to identify specimens from 110 golf courses. The...

Phylogeny of Theileria buffeli genotypes identified in the South African buffalo (Syncerus caffer) population.

PubMed

Chaisi, Mamohale E; Collins, Nicola E; Oosthuizen, Marinda C

2014-08-29

Theileria buffeli/orientalis is a group of benign and mildly pathogenic species of cattle and buffalo in various parts of the world. In a previous study, we identified T. buffeli in blood samples originating from the African buffalo (Syncerus caffer) in the Hluhluwe-iMfolozi Game Park (HIP) and the Addo Elephant Game Park (AEGP) in South Africa. The aim of this study was to characterise the 18S rRNA gene and complete internal transcribed spacer (ITS1-5.8S-ITS2) region of T. buffeli samples, and to establish the phylogenetic position of this species based on these loci. The 18S rRNA gene and the complete ITS region were amplified from DNA extracted from blood samples originating from buffalo in HIP and AEGP. The PCR products were cloned and the resulting recombinants sequenced. We identified novel T. buffeli-like 18S rRNA and ITS genotypes from buffalo in the AEGP, and novel Theileria sinensis-like 18S rRNA genotypes from buffalo in the HIP. Phylogenetic analyses indicated that the T. buffeli-like sequences were similar to T. buffeli sequences from cattle and buffalo in China and India, and the T. sinensis-like sequences were similar to T. sinensis 18S rRNA sequences of cattle and yak in China. There was extensive sequence variation between the novel T. buffeli genotypes of the African buffalo and previously described T. buffeli and T. sinensis genotypes. The presence of organisms with T. buffeli-like and T. sinensis-like genotypes in the African buffalo could be of significant importance, particularly to the cattle industry in South Africa as these animals might act as sources of infections to naïve cattle. This is the first report on the characterisation of the full-length 18S rRNA gene and ITS region of T. buffeli and T. sinensis genotypes in South Africa. Our study provides invaluable information towards the classification of this complex group of benign and mildly pathogenic species. Copyright © 2014 Elsevier B.V. All rights reserved.

A phylogenetic comparison of urease-positive thermophilic Campylobacter (UPTC) and urease-negative (UN) C. lari.

PubMed

Hirayama, Junichi; Tazumi, Akihiro; Hayashi, Kyohei; Tasaki, Erina; Kuribayashi, Takashi; Moore, John E; Millar, Beverley C; Matsuda, Motoo

2011-06-01

In the present study, the reliability of full-length gene sequence information for several genes including 16S rRNA was examined, for the discrimination of the two representative Campylobacter lari taxa, namely urease-negative (UN) C. lari and urease-positive thermophilic Campylobacter (UPTC). As previously described, 16S rRNA gene sequence are not reliable for the molecular discrimination of UN C. lari from UPTC organisms employing both the unweighted pair group method using arithmetic means analysis (UPGMA) and neighbor joining (NJ) methods. In addition, three composite full-length gene sequences (ciaB, flaC and vacJ) out of seven gene loci examined were reliable for discrimination employing dendrograms constructed by the UPGMA method. In addition, all the dendrograms of the NJ phylogenetic trees constructed based on the nine gene information were not reliable for the discrimination. Three composite full-length gene sequences (ciaB, flaC and vacJ) were reliable for the molecular discrimination between UN C. lari and UPTC organisms employing the UPGMA method, as well as among four thermophilic Campylobacter species. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Single sample resolution of rare microbial dark matter in a marine invertebrate metagenome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Ian J.; Weyna, Theodore R.; Fong, Stephen S.

Direct, untargeted sequencing of environmental samples (metagenomics) and de novo genome assembly enable the study of uncultured and phylogenetically divergent organisms. However, separating individual genomes from a mixed community has often relied on the differential-coverage analysis of multiple, deeply sequenced samples. In the metagenomic investigation of the marine bryozoan Bugula neritina, we uncovered seven bacterial genomes associated with a single B. neritina individual that appeared to be transient associates, two of which were unique to one individual and undetectable using certain “universal” 16S rRNA primers and probes. We recovered high quality genome assemblies for several rare instances of “microbial darkmore » matter,” or phylogenetically divergent bacteria lacking genomes in reference databases, from a single tissue sample that was not subjected to any physical or chemical pre-treatment. One of these rare, divergent organisms has a small (593 kbp), poorly annotated genome with low GC content (20.9%) and a 16S rRNA gene with just 65% sequence similarity to the closest reference sequence. Lastly, our findings illustrate the importance of sampling strategy and de novo assembly of metagenomic reads to understand the extent and function of bacterial biodiversity.« less

Prevalence of pathogenic bacteria in Ixodes ricinus ticks in Central Bohemia.

PubMed

Klubal, Radek; Kopecky, Jan; Nesvorna, Marta; Sparagano, Olivier A E; Thomayerova, Jana; Hubert, Jan

2016-01-01

Bacteria associated with the tick Ixodes ricinus were assessed in specimens unattached or attached to the skin of cats, dogs and humans, collected in the Czech Republic. The bacteria were detected by PCR in 97 of 142 pooled samples including 204 ticks, i.e. 1-7 ticks per sample, collected at the same time from one host. A fragment of the bacterial 16S rRNA gene was amplified, cloned and sequenced from 32 randomly selected samples. The most frequent sequences were those related to Candidatus Midichloria midichlori (71% of cloned sequences), followed by Diplorickettsia (13%), Spiroplasma (3%), Rickettsia (3%), Pasteurella (3%), Morganella (3%), Pseudomonas (2%), Bacillus (1%), Methylobacterium (1%) and Phyllobacterium (1%). The phylogenetic analysis of Spiroplasma 16S rRNA gene sequences showed two groups related to Spiroplasma eriocheiris and Spiroplasma melliferum, respectively. Using group-specific primers, the following potentially pathogenic bacteria were detected: Borellia (in 20% of the 142 samples), Rickettsia (12%), Spiroplasma (5%), Diplorickettsia (5%) and Anaplasma (2%). In total, 68% of I. ricinus samples (97/142) contained detectable bacteria and 13% contained two or more putative pathogenic groups. The prevalence of tick-borne bacteria was similar to the observations in other European countries.

Single sample resolution of rare microbial dark matter in a marine invertebrate metagenome

DOE PAGES

Miller, Ian J.; Weyna, Theodore R.; Fong, Stephen S.; ...

2016-09-29

Direct, untargeted sequencing of environmental samples (metagenomics) and de novo genome assembly enable the study of uncultured and phylogenetically divergent organisms. However, separating individual genomes from a mixed community has often relied on the differential-coverage analysis of multiple, deeply sequenced samples. In the metagenomic investigation of the marine bryozoan Bugula neritina, we uncovered seven bacterial genomes associated with a single B. neritina individual that appeared to be transient associates, two of which were unique to one individual and undetectable using certain “universal” 16S rRNA primers and probes. We recovered high quality genome assemblies for several rare instances of “microbial darkmore » matter,” or phylogenetically divergent bacteria lacking genomes in reference databases, from a single tissue sample that was not subjected to any physical or chemical pre-treatment. One of these rare, divergent organisms has a small (593 kbp), poorly annotated genome with low GC content (20.9%) and a 16S rRNA gene with just 65% sequence similarity to the closest reference sequence. Lastly, our findings illustrate the importance of sampling strategy and de novo assembly of metagenomic reads to understand the extent and function of bacterial biodiversity.« less