Science.gov

Sample records for rrna single nucleotide

  1. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    PubMed

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method.

  2. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  3. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  4. Single Nucleotide Polymorphisms and Osteoarthritis

    PubMed Central

    Wang, Ting; Liang, Yuting; Li, Hong; Li, Haibo; He, Quanze; Xue, Ying; Shen, Cong; Zhang, Chunhua; Xiang, Jingjing; Ding, Jie; Qiao, Longwei; Zheng, Qiping

    2016-01-01

    Abstract Osteoarthritis (OA) is a complex disorder characterized by degenerative articular cartilage and is largely attributed to genetic risk factors. Single nucleotide polymorphisms (SNPs) are common DNA variants that have shown promising and efficiency, compared with positional cloning, to map candidate genes of complex diseases, including OA. In this study, we aim to provide an overview of multiple SNPs from a number of genes that have recently been linked to OA susceptibility. We also performed a comprehensive meta-analysis to evaluate the association of SNP rs7639618 of double von Willebrand factor A domains (DVWA) gene with OA susceptibility. A systematic search of studies on the association of SNPs with susceptibility to OA was conducted in PubMed and Google scholar. Studies subjected to meta-analysis include human and case-control studies that met the Hardy–Weinberg equilibrium model and provide sufficient data to calculate an odds ratio (OR). A total of 9500 OA cases and 9365 controls in 7 case-control studies relating to SNP rs7639618 were included in this study and the ORs with 95% confidence intervals (CIs) were calculated. Over 50 SNPs from different genes have been shown to be associated with either hip (23), or knee (20), or both (13) OA. The ORs of these SNPs for OA and the subtypes are not consistent. As to SNP rs7639618 of DVWA, increased knee OA risk was observed in all genetic models analyzed. Specifically, people from Asian with G-allele showed significantly increased risk of knee OA (A versus G: OR = 1.28, 95% CI 1.13–1.46; AA versus GG: OR = 1.60, 95% CI 1.25–2.05; GA versus GG: OR = 1.31, 95% CI 1.18–1.44; AA versus GA+GG: OR = 1.34, 95% CI 1.12–1.61; AA+GA versus GG: OR = 1.40, 95% CI 1.19–1.64), but not in Caucasians or with hip OA. Our results suggest that multiple SNPs play different roles in the pathogenesis of OA and its subtypes; SNP rs7639618 of DVWA gene is associated with a significantly increased

  5. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  6. From Single Nucleotide Polymorphism to Transcriptional Mechanism

    PubMed Central

    Martini, Sebastian; Nair, Viji; Patel, Sanjeevkumar R.; Eichinger, Felix; Nelson, Robert G.; Weil, E. Jennifer; Pezzolesi, Marcus G.; Krolewski, Andrzej S.; Randolph, Ann; Keller, Benjamin J.; Werner, Thomas; Kretzler, Matthias

    2013-01-01

    Genome-wide association studies have proven to be highly effective at defining relationships between single nucleotide polymorphisms (SNPs) and clinical phenotypes in complex diseases. Establishing a mechanistic link between a noncoding SNP and the clinical outcome is a significant hurdle in translating associations into biological insight. We demonstrate an approach to assess the functional context of a diabetic nephropathy (DN)-associated SNP located in the promoter region of the gene FRMD3. The approach integrates pathway analyses with transcriptional regulatory pattern-based promoter modeling and allows the identification of a transcriptional framework affected by the DN-associated SNP in the FRMD3 promoter. This framework provides a testable hypothesis for mechanisms of genomic variation and transcriptional regulation in the context of DN. Our model proposes a possible transcriptional link through which the polymorphism in the FRMD3 promoter could influence transcriptional regulation within the bone morphogenetic protein (BMP)-signaling pathway. These findings provide the rationale to interrogate the biological link between FRMD3 and the BMP pathway and serve as an example of functional genomics-based hypothesis generation. PMID:23434934

  7. Genetic epidemiology of single-nucleotide polymorphisms.

    PubMed

    Collins, A; Lonjou, C; Morton, N E

    1999-12-21

    On the causal hypothesis, most genetic determinants of disease are single-nucleotide polymorphisms (SNPs) that are likely to be selected as markers for positional cloning. On the proximity hypothesis, most disease determinants will not be included among markers but may be detected through linkage disequilibrium with other SNPs. In that event, allelic association among SNPs is an essential factor in positional cloning. Recent simulation based on monotonic population expansion suggests that useful association does not usually extend beyond 3 kb. This is contradicted by significant disequilibrium at much greater distances, with corresponding reduction in the number of SNPs required for a cost-effective genome scan. A plausible explanation is that cyclical expansions follow population bottlenecks that establish new disequilibria. Data on more than 1,000 locus pairs indicate that most disequilibria trace to the Neolithic, with no apparent difference between haplotypes that are random or selected through a major disease gene. Short duration may be characteristic of alleles contributing to disease susceptibility and haplotypes characteristic of particular ethnic groups. Alleles that are highly polymorphic in all ethnic groups may be older, neutral, or advantageous, in weak disequilibrium with nearby markers, and therefore less useful for positional cloning of disease genes. Significant disequilibrium at large distance makes the number of suitably chosen SNPs required for genome screening as small as 30,000, or 1 per 100 kb, with greater density (including less common SNPs) reserved for candidate regions.

  8. Testing evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences.

    PubMed

    Garcia-Mazcorro, Jose F

    2013-09-01

    The 16S rRNA gene has been widely used as a marker of gut bacterial diversity and phylogeny, yet we do not know the model of evolution that best explains the differences in its nucleotide composition within and among taxa. Over 46 000 good-quality near-full-length 16S rRNA gene sequences from five bacterial phyla were obtained from the ribosomal database project (RDP) by study and, when possible, by within-study characteristics (e.g. anatomical region). Using alignments (RDPX and MUSCLE) of unique sequences, the FINDMODEL tool available at http://www.hiv.lanl.gov/ was utilized to find the model of character evolution (28 models were available) that best describes the input sequence data, based on the Akaike information criterion. The results showed variable levels of agreement (from 33% to 100%) in the chosen models between the RDP-based and the MUSCLE-based alignments among the taxa. Moreover, subgroups of sequences (using either alignment method) from the same study were often explained by different models. Nonetheless, the different representatives of the gut microbiota were explained by different proportions of the available models. This is the first report using evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences. PMID:23808388

  9. Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

    PubMed Central

    Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-01-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

  10. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  11. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    PubMed

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  12. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  13. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  14. Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

    PubMed Central

    Takaiwa, F; Sugiura, M

    1982-01-01

    The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences. Images PMID:6281739

  15. Single nucleotide markers of D-loop for identification of Indian wild pig (Sus scrofa cristatus)

    PubMed Central

    Srivastava, Gaurav Kumar; Rajput, Nidhi; Jadav, Kajal Kumar; Shrivastav, Avadh Bihari; Joshi, Himanshu R.

    2015-01-01

    Aim: Partial fragment of D-loop region extending from 35 to 770 were compared with corresponding sequences of 16 wild pigs and 9 domestic pig breeds from different parts of the world for detection of single nucleotide polymorphism (SNP) markers in the region. The paper also reappraises SNP markers from two fragments of cytochrome b gene and a fragment 12S rRNA gene distinguishing the Indian wild pig from other pig species of the world. Materials and Methods: Deoxyribonucleic acid (DNA) was isolated from 14 and 12 tissue samples of Indian wild and domestic pigs, respectively, collected from Central India for characterization of the D-loop DNA sequences using universal primers. The sequences obtained were aligned along with the retrieved sequences to analyze species-specific SNP marker. Results: A total of 58 mitochondrial D-loop gene sequences of pig races were aligned to identify 1349 polymorphic sites in the fragment from nucleotide positions 35-770 bp and four SNP markers were identified to differentiate Indian wild pig from all the sequences investigated in this study. With the inclusion of cytochrome b gene and 12S rRNA gene fragments, the present study contributes to the total 15 SNP markers, which have been identified in the mitochondrial fragment of 1936 bp for identification of Indian wild pig. Conclusion: SNP markers have advantages over other marker types and do not require subsequent standardization to compare data across studies or laboratories. PMID:27047129

  16. Single nucleotide polymorphism analysis using different colored dye dimer probes

    NASA Astrophysics Data System (ADS)

    Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

    2006-09-01

    Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

  17. Genomic reduction assisted single nucleotide polymorphism discovery using 454-pyrosequencing.

    PubMed

    Maughan, Peter J; Udall, Joshua A; Jellen, Eric N

    2015-01-01

    We report the development of a simple genomic reduction protocol based on 454-pyrosequencing technology that discovers large numbers of single nucleotide polymorphisms (SNP) from pooled DNA samples. The method is based on the conservation of restriction endonuclease sites across samples and biotin separation for genomic reduction and the addition of multiplex identifier (MID) barcodes to each of the pooled samples to allow for postsequencing deconvolution of the pooled DNA fragments and SNP discovery. PMID:25373757

  18. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  19. Multiplex detection of single-nucleotide variations using molecular beacons.

    PubMed

    Marras, S A; Kramer, F R; Tyagi, S

    1999-02-01

    We demonstrate that single-nucleotide differences in a DNA sequence can be detected in homogeneous assays using molecular beacons. In this method, the region surrounding the site of a sequence variation is amplified in a polymerase chain reaction and the identity of the variant nucleotide is determined by observing which of four differently colored molecular beacons binds to the amplification product. Each of the molecular beacons is perfectly complementary to one variant of the target sequence and each is labeled with a different fluorophore. To demonstrate the specificity of these assays, we prepared four template DNAs that only differed from one another by the identity of the nucleotide at one position. Four amplification reactions were prepared, each containing all four molecular beacons, but each initiated with only one of the four template DNAs. The results show that in each reaction a fluorogenic response was elicited from the molecular beacon that was perfectly complementary to the amplified DNA, but not from the three molecular beacons whose probe sequence mismatched the target sequence. The color of the fluorescence that appeared in each tube during the course of the amplification indicated which nucleotide was present at the site of variation. These results demonstrate the extraordinary specificity of molecular beacons. Furthermore, the results illustrate how the ability to label molecular beacons with differently colored fluorophores enables simple multiplex assays to be carried out for genetic analysis.

  20. Single Nucleotide Polymorphisms and Linkage Disequilibrium in Sunflower

    PubMed Central

    Kolkman, Judith M.; Berry, Simon T.; Leon, Alberto J.; Slabaugh, Mary B.; Tang, Shunxue; Gao, Wenxiang; Shintani, David K.; Burke, John M.; Knapp, Steven J.

    2007-01-01

    Genetic diversity in modern sunflower (Helianthus annuus L.) cultivars (elite oilseed inbred lines) has been shaped by domestication and breeding bottlenecks and wild and exotic allele introgression−the former narrowing and the latter broadening genetic diversity. To assess single nucleotide polymorphism (SNP) frequencies, nucleotide diversity, and linkage disequilibrium (LD) in modern cultivars, alleles were resequenced from 81 genic loci distributed throughout the sunflower genome. DNA polymorphisms were abundant; 1078 SNPs (1/45.7 bp) and 178 insertions-deletions (INDELs) (1/277.0 bp) were identified in 49.4 kbp of DNA/genotype. SNPs were twofold more frequent in noncoding (1/32.1 bp) than coding (1/62.8 bp) sequences. Nucleotide diversity was only slightly lower in inbred lines (θ = 0.0094) than wild populations (θ = 0.0128). Mean haplotype diversity was 0.74. When extraploted across the genome (∼3500 Mbp), sunflower was predicted to harbor at least 76.4 million common SNPs among modern cultivar alleles. LD decayed more slowly in inbred lines than wild populations (mean LD declined to 0.32 by 5.5 kbp in the former, the maximum physical distance surveyed), a difference attributed to domestication and breeding bottlenecks. SNP frequencies and LD decay are sufficient in modern sunflower cultivars for very high-density genetic mapping and high-resolution association mapping. PMID:17660563

  1. Electroanalysis of single-nucleotide polymorphism by hairpin DNA architectures.

    PubMed

    Abi, Alireza; Ferapontova, Elena E

    2013-04-01

    Genetic analysis of infectious and genetic diseases and cancer diagnostics require the development of efficient tools for fast and reliable analysis of single-nucleotide polymorphism (SNP) in targeted DNA and RNA sequences often responsible for signalling disease onset. Here, we highlight the main trends in the development of electrochemical genosensors for sensitive and selective detection of SNP that are based on hairpin DNA architectures exhibiting better SNP recognition properties compared with linear DNA probes. SNP detection by electrochemical hairpin DNA beacons is discussed, and comparative analysis of the existing SNP sensing strategies based on enzymatic and nanoparticle signal amplification schemes is presented.

  2. Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

    PubMed

    Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

    2010-07-01

    Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

  3. Detecting Single-Nucleotide Substitutions Induced by Genome Editing.

    PubMed

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-01-01

    The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells.

  4. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina).

    PubMed

    Ferber, Steven; Reusch, Thorsten B H; Stam, Wytze T; Olsen, Jeanine L

    2008-11-01

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database (V1.2.1). SNP loci were genotyped using a single-base-extension approach which facilitated high-throughput genotyping with minimal optimization time. These markers show a wide range of variability among 25 eelgrass populations and will be useful for population genetic studies including evaluation of population structure, historical demography, and phylogeography. Potential applications include haplotype inference of physically linked SNPs and identification of genes under selection for temperature and desiccation stress.

  5. Y-Single Nucleotide Polymorphisms Diversity in Chinese Indigenous Horse.

    PubMed

    Han, Haoyuan; Zhang, Qin; Gao, Kexin; Yue, Xiangpeng; Zhang, Tao; Dang, Ruihua; Lan, Xianyong; Chen, Hong; Lei, Chuzhao

    2015-08-01

    In contrast to high genetic diversity of mitochondrial DNA (mtDNA), equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP) methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs) (Y-45701/997 and Y-50869) and one Y-indel (Y-45288) were identified. Of those, the Y-50869 (T>A) revealed the highest variation frequency (24.67%), whereas it was only 3.29% and 1.97% in Y-45288 (T/-) and Y-45701/997 (G>T) locus, respectively. These three mutations accounted for 27.96% of the total samples and identified five Y-SNP haplotypes, demonstrating genetic diversity of Y chromosome in Chinese horses. In addition, all the five Y-SNP haplotypes were shared by different breeds. Among 13 horse breeds analyzed, Balikun horse displayed the highest nucleotide diversity (π = 5.6×10(-4)) and haplotype diversity (h = 0.527), while Ningqiang horse showed the lowest nucleotide diversity (π = 0.00000) and haplotype diversity (h = 0.000). The results also revealed that Chinese horses had a different polymorphic pattern of Y chromosome from European and American horses. In conclusion, Chinese horses revealed genetic diversity of Y chromosome, however more efforts should be made to better understand the domestication and paternal origin of Chinese indigenous horses.

  6. Y-Single Nucleotide Polymorphisms Diversity in Chinese Indigenous Horse

    PubMed Central

    Han, Haoyuan; Zhang, Qin; Gao, Kexin; Yue, Xiangpeng; Zhang, Tao; Dang, Ruihua; Lan, Xianyong; Chen, Hong; Lei, Chuzhao

    2015-01-01

    In contrast to high genetic diversity of mitochondrial DNA (mtDNA), equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP) methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs) (Y-45701/997 and Y-50869) and one Y-indel (Y-45288) were identified. Of those, the Y-50869 (T>A) revealed the highest variation frequency (24.67%), whereas it was only 3.29% and 1.97% in Y-45288 (T/-) and Y-45701/997 (G>T) locus, respectively. These three mutations accounted for 27.96% of the total samples and identified five Y-SNP haplotypes, demonstrating genetic diversity of Y chromosome in Chinese horses. In addition, all the five Y-SNP haplotypes were shared by different breeds. Among 13 horse breeds analyzed, Balikun horse displayed the highest nucleotide diversity (π = 5.6×10−4) and haplotype diversity (h = 0.527), while Ningqiang horse showed the lowest nucleotide diversity (π = 0.00000) and haplotype diversity (h = 0.000). The results also revealed that Chinese horses had a different polymorphic pattern of Y chromosome from European and American horses. In conclusion, Chinese horses revealed genetic diversity of Y chromosome, however more efforts should be made to better understand the domestication and paternal origin of Chinese indigenous horses. PMID:26104513

  7. Single nucleotide polymorphisms in nucleotide excision repair genes, cancer treatment, and head and neck cancer survival

    PubMed Central

    Wyss, Annah B.; Weissler, Mark C.; Avery, Christy L.; Herring, Amy H.; Bensen, Jeannette T.; Barnholtz-Sloan, Jill S.; Funkhouser, William K.

    2014-01-01

    Purpose Head and neck cancers (HNC) are commonly treated with radiation and platinum-based chemotherapy, which produce bulky DNA adducts to eradicate cancerous cells. Because nucleotide excision repair (NER) enzymes remove adducts, variants in NER genes may be associated with survival among HNC cases both independently and jointly with treatment. Methods Cox proportional hazards models were used to estimate race-stratified (White, African American) hazard ratios (HRs) and 95 % confidence intervals for overall (OS) and disease-specific (DS) survival based on treatment (combinations of surgery, radiation, and chemotherapy) and 84 single nucleotide polymorphisms (SNPs) in 15 NER genes among 1,227 HNC cases from the Carolina Head and Neck Cancer Epidemiology Study. Results None of the NER variants evaluated were associated with survival at a Bonferroni-corrected alpha of 0.0006. However, rs3136038 [OS HR = 0.79 (0.65, 0.97), DS HR = 0.69 (0.51, 0.93)] and rs3136130 [OS HR = 0.78 (0.64, 0.96), DS HR = 0.68 (0.50, 0.92)] of ERCC4 and rs50871 [OS HR = 0.80 (0.64, 1.00), DS HR = 0.67 (0.48, 0.92)] of ERCC2 among Whites, and rs2607755 [OS HR = 0.62 (0.45, 0.86), DS HR = 0.51 (0.30, 0.86)] of XPC among African Americans were suggestively associated with survival at an uncorrected alpha of 0.05. Three SNP-treatment joint effects showed possible departures from additivity among Whites. Conclusions Our study, a large and extensive evaluation of SNPs in NER genes and HNC survival, identified mostly null associations, though a few variants were suggestively associated with survival and potentially interacted additively with treatment. PMID:24487794

  8. Current research status, databases and application of single nucleotide polymorphism.

    PubMed

    Javed, R; Mukesh

    2010-07-01

    Single Nucleotide Polymorphisms (SNPs) are the most frequent form of DNA variation in the genome. SNPs are genetic markers which are bi-allelic in nature and grow at a very fast rate. Current genomic databases contain information on several million SNPs. More than 6 million SNPs have been identified and the information is publicly available through the efforts of the SNP Consortium and others data bases. The NCBI plays a major role in facillating the identification and cataloging of SNPs through creation and maintenance of the public SNP database (dbSNP) by the biomedical community worldwide and stimulate many areas of biological research including the identification of the genetic components of disease. In this review article, we are compiling the existing SNP databases, research status and their application. PMID:21717869

  9. Single nucleotide polymorphisms in type 2 diabetes among Hispanic adults.

    PubMed

    Watson, Amanda L; Hu, Jie; Chiu, Norman H L

    2015-05-01

    In this pilot study, we explore the genetic variation that may relate to type 2 diabetes (T2D) among Hispanic adults. The genotypes of 36 Hispanic adults were analyzed by using the Cardio-Metabochip. The goal is to identify single nucleotide polymorphisms (SNPs) associated to T2D among Hispanic adults. A total of 26 SNPs were identified to be associated with T2D among Hispanic adults. None of these SNPs have been reported for T2D. By using the principle components analysis to analyze the genotype of 26 SNPs in 36 samples, the samples obtained from diabetic patients could be distinguished from the control samples. The findings support genetic involvement in T2D among Hispanic adults.

  10. ENGINES: exploring single nucleotide variation in entire human genomes

    PubMed Central

    2011-01-01

    Background Next generation ultra-sequencing technologies are starting to produce extensive quantities of data from entire human genome or exome sequences, and therefore new software is needed to present and analyse this vast amount of information. The 1000 Genomes project has recently released raw data for 629 complete genomes representing several human populations through their Phase I interim analysis and, although there are certain public tools available that allow exploration of these genomes, to date there is no tool that permits comprehensive population analysis of the variation catalogued by such data. Description We have developed a genetic variant site explorer able to retrieve data for Single Nucleotide Variation (SNVs), population by population, from entire genomes without compromising future scalability and agility. ENGINES (ENtire Genome INterface for Exploring SNVs) uses data from the 1000 Genomes Phase I to demonstrate its capacity to handle large amounts of genetic variation (>7.3 billion genotypes and 28 million SNVs), as well as deriving summary statistics of interest for medical and population genetics applications. The whole dataset is pre-processed and summarized into a data mart accessible through a web interface. The query system allows the combination and comparison of each available population sample, while searching by rs-number list, chromosome region, or genes of interest. Frequency and FST filters are available to further refine queries, while results can be visually compared with other large-scale Single Nucleotide Polymorphism (SNP) repositories such as HapMap or Perlegen. Conclusions ENGINES is capable of accessing large-scale variation data repositories in a fast and comprehensive manner. It allows quick browsing of whole genome variation, while providing statistical information for each variant site such as allele frequency, heterozygosity or FST values for genetic differentiation. Access to the data mart generating scripts and to

  11. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    PubMed

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  12. Single-nucleotide polymorphism PCR for the detection of Mycoplasma pneumoniae and determination of macrolide resistance in respiratory samples.

    PubMed

    Ji, Misuk; Lee, Nam-Sihk; Oh, Ji-Min; Jo, Ji Yoon; Choi, Eun Hwa; Yoo, Soo Jin; Kim, Hyo-Bin; Hwang, Sang-Hyun; Choi, Sang-Ho; Lee, Sang-Oh; Kim, Mi-Na; Sung, Heungsup

    2014-07-01

    The aim of this study was to develop a single-nucleotide polymorphism (SNP) PCR assay to be performed directly on respiratory samples for the simultaneous detection of Mycoplasma pneumoniae and its 23S rRNA gene mutations, which are responsible for macrolide resistance. For multiplex SNP PCR, two outer primers for amplification of the 23S rRNA gene and two mutant-specific primers for the discrimination of single base changes were designed. A total of 73M. pneumoniae-positive samples and 100M. pneumoniae-negative samples were analyzed using this assay. By SNP PCR, we detected two mutations conferring high-level macrolide resistance in 22 samples (A2063G from 20 and A2064G from 2 samples); these results are identical to those produced by the 23S rRNA gene sequencing of M. pneumoniae-positive samples. Thus, this assay can be used as a practical method for the simultaneous detection of M. pneumoniae and mutations associated with macrolide resistance directly from respiratory samples. PMID:24780151

  13. Single nucleotide polymorphism markers for genetic mapping in Drosophila melanogaster

    SciTech Connect

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-04-16

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that have recently revolutionized human, mouse and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila using an STS-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that the genome. The majority of these markers are single nucleotide polymorphisms (SNPs) and sequences for these variants are provided in an accessible format. The average density of the new markers is 1 marker per 225 kb on the autosomes and 1 marker per 1 Mb on the X chromosome. We include in this survey a set of P-element strains that provide additional utility for high-resolution mapping. We demonstrate one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community.

  14. Preterm birth and single nucleotide polymorphisms in cytokine genes

    PubMed Central

    Zhu, Qin; Sun, Jian

    2014-01-01

    Preterm birth (PTB) is an important issue in neonates because of its complications as well as high morbidity and mortality. The prevalence of PTB is approximately 12-13% in USA and 5-9% in many other developed countries. China represents 7.8% (approximately one million) of 14.9 million babies born prematurely annually worldwide. The rate of PTB is still increasing. Both genetic susceptibility and environmental factors are the major causes of PTB. Inflammation is regarded as an enabling characteristic factor of PTB. The aim of this review is to summarize the current literatures to illustrate the role of single nucleotide polymorphisms (SNPs) of cytokine genes in PTB. These polymorphisms are different among different geographic regions and different races, thus different populations may have different risk factors of PTB. SNPs affect the ability to metabolize poisonous substances and determine inflammation susceptibility, which in turn has an influence on reproduction-related risks and on delivery outcomes after exposure to environmental toxicants and pathogenic organisms. PMID:26835330

  15. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases

    PubMed Central

    Charlon, Thomas; Bossini-Castillo, Lara; Carmona, F. David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav

    2016-01-01

    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this “ancestry signal”, we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at https://github.com/ThomasChln/snpclust. PMID:27490238

  16. Single nucleotide polymorphism-based dispersal estimates using noninvasive sampling

    PubMed Central

    Norman, Anita J; Spong, Göran

    2015-01-01

    Quantifying dispersal within wild populations is an important but challenging task. Here we present a method to estimate contemporary, individual-based dispersal distance from noninvasively collected samples using a specialized panel of 96 SNPs (single nucleotide polymorphisms). One main issue in conducting dispersal studies is the requirement for a high sampling resolution at a geographic scale appropriate for capturing the majority of dispersal events. In this study, fecal samples of brown bear (Ursus arctos) were collected by volunteer citizens, resulting in a high sampling resolution spanning over 45,000 km2 in Gävleborg and Dalarna counties in Sweden. SNP genotypes were obtained for unique individuals sampled (n = 433) and subsequently used to reconstruct pedigrees. A Mantel test for isolation by distance suggests that the sampling scale was appropriate for females but not for males, which are known to disperse long distances. Euclidean distance was estimated between mother and offspring pairs identified through the reconstructed pedigrees. The mean dispersal distance was 12.9 km (SE 3.2) and 33.8 km (SE 6.8) for females and males, respectively. These results were significantly different (Wilcoxon’s rank-sum test: P-value = 0.02) and are in agreement with the previously identified pattern of male-biased dispersal. Our results illustrate the potential of using a combination of noninvasively collected samples at high resolution and specialized SNPs for pedigree-based dispersal models. PMID:26357536

  17. ADH single nucleotide polymorphism associations with alcohol metabolism in vivo

    PubMed Central

    Birley, Andrew J.; James, Michael R.; Dickson, Peter A.; Montgomery, Grant W.; Heath, Andrew C.; Martin, Nicholas G.; Whitfield, John B.

    2009-01-01

    We have previously found that variation in alcohol metabolism in Europeans is linked to the chromosome 4q region containing the ADH gene family. We have now typed 103 single nucleotide polymorphisms (SNPs) across this region to test for allelic associations with variation in blood and breath alcohol concentrations after an alcohol challenge. In vivo alcohol metabolism was modelled with three parameters that identified the absorption and rise of alcohol concentration following ingestion, and the rate of elimination. Alleles of ADH7 SNPs were associated with the early stages of alcohol metabolism, with additional effects in the ADH1A, ADH1B and ADH4 regions. Rate of elimination was associated with SNPs in the intragenic region between ADH7 and ADH1C, and across ADH1C and ADH1B. SNPs affecting alcohol metabolism did not correspond to those reported to affect alcohol dependence or alcohol-related disease. The combined SNP associations with early- and late-stage metabolism only account for approximately 20% of the total genetic variance linked to the ADH region, and most of the variance for in vivo alcohol metabolism linked to this region is yet to be explained. PMID:19193628

  18. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases.

    PubMed

    Charlon, Thomas; Martínez-Bueno, Manuel; Bossini-Castillo, Lara; Carmona, F David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav; Martín, Javier; Alarcón-Riquelme, Marta E

    2016-01-01

    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this "ancestry signal", we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at https://github.com/ThomasChln/snpclust. PMID:27490238

  19. Single nucleotide polymorphisms of Kit gene in Chinese indigenous horses.

    PubMed

    Han, Haoyuan; Mao, Chunchun; Chen, Ningbo; Lan, Xianyong; Chen, Hong; Lei, Chuzhao; Dang, Ruihua

    2016-02-01

    Kit gene is a genetic determinant of horse white coat color which has been a highly valued trait in horses for at least 2,000 years. Single nucleotide polymorphisms (SNPs) in Kit are of importance due to their strong associations with melanoblast survival during embryonic development. In this study, a mutation analysis of all 21 Kit exons in 14 Chinese domestic horse breeds revealed six SNPs (g.91214T>G, g.143245T>G, g.164297C>T, g.170189C>T, g.171356C>G, and g.171471G>A), which located in 5'-UTR region, intron 6, exon 15, exon 20, intron 20, and exon 21 of the equine Kit gene, respectively. Subsequently, these six SNPs loci were genotyped in 632 Chinese horses by PCR-RFLP or direct sequencing. The six SNPs together defined 18 haplotypes, demonstrating abundant haplotype diversities in Chinese horses. All the mutant alleles and haplotypes were shared among different breeds. But fewer mutations were detected in horses from China than that from abroad, indicating that Chinese horses belong to a more ancient genetic pool. This study will provide fundamental genetic information for evaluating the genetic diversity of Kit gene in Chinese indigenous horse breeds.

  20. Mapping of complex traits by single-nucleotide polymorphisms.

    PubMed Central

    Zhao, L P; Aragaki, C; Hsu, L; Quiaoit, F

    1998-01-01

    Molecular geneticists are developing the third-generation human genome map with single-nucleotide polymorphisms (SNPs), which can be assayed via chip-based microarrays. One use of these SNP markers is the ability to locate loci that may be responsible for complex traits, via linkage/linkage-disequilibrium analysis. In this communication, we describe a semiparametric method for combined linkage/linkage-disequilibrium analysis using SNP markers. Asymptotic results are obtained for the estimated parameters, and the finite-sample properties are evaluated via a simulation study. We also applied this technique to a simulated genome-scan experiment for mapping a complex trait with two major genes. This experiment shows that separate linkage and linkage-disequilibrium analyses correctly detected the signals of both major genes; but the rates of false-positive signals seem high. When linkage and linkage-disequilibrium signals were combined, the analysis yielded much stronger and clearer signals for the presence of two major genes than did two separate analyses. PMID:9634510

  1. Single nucleotide polymorphisms of Kit gene in Chinese indigenous horses.

    PubMed

    Han, Haoyuan; Mao, Chunchun; Chen, Ningbo; Lan, Xianyong; Chen, Hong; Lei, Chuzhao; Dang, Ruihua

    2016-02-01

    Kit gene is a genetic determinant of horse white coat color which has been a highly valued trait in horses for at least 2,000 years. Single nucleotide polymorphisms (SNPs) in Kit are of importance due to their strong associations with melanoblast survival during embryonic development. In this study, a mutation analysis of all 21 Kit exons in 14 Chinese domestic horse breeds revealed six SNPs (g.91214T>G, g.143245T>G, g.164297C>T, g.170189C>T, g.171356C>G, and g.171471G>A), which located in 5'-UTR region, intron 6, exon 15, exon 20, intron 20, and exon 21 of the equine Kit gene, respectively. Subsequently, these six SNPs loci were genotyped in 632 Chinese horses by PCR-RFLP or direct sequencing. The six SNPs together defined 18 haplotypes, demonstrating abundant haplotype diversities in Chinese horses. All the mutant alleles and haplotypes were shared among different breeds. But fewer mutations were detected in horses from China than that from abroad, indicating that Chinese horses belong to a more ancient genetic pool. This study will provide fundamental genetic information for evaluating the genetic diversity of Kit gene in Chinese indigenous horse breeds. PMID:27348891

  2. Single nucleotide polymorphism discovery in barley using autoSNPdb.

    PubMed

    Duran, Chris; Appleby, Nikki; Vardy, Megan; Imelfort, Michael; Edwards, David; Batley, Jacqueline

    2009-05-01

    Molecular markers are used to provide the link between genotype and phenotype, for the production of molecular genetic maps and to assess genetic diversity within and between related species. Single nucleotide polymorphisms (SNPs) are the most abundant molecular genetic marker. SNPs can be identified in silico, but care must be taken to ensure that the identified SNPs reflect true genetic variation and are not a result of errors associated with DNA sequencing. The SNP detection method autoSNP has been developed to identify SNPs from sequence data for any species. Confidence in the predicted SNPs is based on sequence redundancy, and haplotype co-segregation scores are calculated for a further independent measure of confidence. We have extended the autoSNP method to produce autoSNPdb, which integrates SNP and gene annotation information with a graphical viewer. We have applied this software to public barley expressed sequences, and the resulting database is available over the Internet. SNPs can be viewed and searched by sequence, functional annotation or predicted synteny with a reference genome, in this case rice. The correlation between SNPs and barley cultivar, expressed tissue type and development stage has been collated for ease of exploration. An average of one SNP per 240 bp was identified, with SNPs more prevalent in the 5' regions and simple sequence repeat (SSR) flanking sequences. Overall, autoSNPdb can provide a wealth of genetic polymorphism information for any species for which sequence data are available. PMID:19386041

  3. Single nucleotide polymorphisms associated with rat expressed sequences.

    PubMed

    Guryev, Victor; Berezikov, Eugene; Malik, Rainer; Plasterk, Ronald H A; Cuppen, Edwin

    2004-07-01

    Single nucleotide polymorphisms (SNPs) are the most common source of genetic variation in populations and are thus most likely to account for the majority of phenotypic and behavioral differences between individuals or strains. Although the rat is extensively studied for the latter, data on naturally occurring polymorphisms are mostly lacking. We have used publicly available sequences consisting of whole-genome shotgun (WGS), expressed sequence tag (EST), and mRNA data as a source for the in silico identification of SNPs in gene-coding regions and have identified a large collection of 33,305 high-quality candidate SNPs. Experimental verification of 471 candidate SNPs using a limited set of rat isolates revealed a confirmation rate of approximately 50%. Although the majority of SNPs were identified between Sprague-Dawley (EST data) and Brown Norway (WGS data) strains, we found that 66% of the verified variations are common among different rat strains. All SNPs were extensively annotated, including chromosomal and genetic map information, and nonsynonymous SNPs were analyzed by SIFT and PolyPhen prediction programs for their potential deleterious effect on protein function. Interestingly, we retrieved three SNPs from the database that result in the introduction of a premature stop codon and that could be confirmed experimentally. Two of these "in silico-identified knockouts" reside in interesting QTL regions. Data are publicly available via a Web interface (http://cascad.niob.knaw.nl), allowing simple and advanced search queries.

  4. Single Nucleotide Polymorphism in Patients with Moyamoya Disease

    PubMed Central

    2015-01-01

    Moyamoya disease (MMD) is a chronic, progressive, cerebrovascular occlusive disorder that displays various clinical features and results in cerebral infarct or hemorrhagic stroke. Specific genes associated with the disease have not yet been identified, making identification of at-risk patients difficult before clinical manifestation. Familial MMD is not uncommon, with as many as 15% of MMD patients having a family history of the disease, suggesting a genetic etiology. Studies of single nucleotide polymorphisms (SNPs) in MMD have mostly focused on mechanical stress on vessels, endothelium, and the relationship to atherosclerosis. In this review, we discuss SNPs studies targeting the genetic etiology of MMD. Genetic analyses in familial MMD and genome-wide association studies represent promising strategies for elucidating the pathophysiology of this condition. This review also discusses future research directions, not only to offer new insights into the origin of MMD, but also to enhance our understanding of the genetic aspects of MMD. There have been several SNP studies of MMD. Current SNP studies suggest a genetic contribution to MMD, but further reliable and replicable data are needed. A large cohort or family-based design would be important. Modern SNP studies of MMD depend on novel genetic, experimental, and database methods that will hopefully hasten the arrival of a consensus conclusion. PMID:26180609

  5. Inferring clonal evolution of tumors from single nucleotide somatic mutations

    PubMed Central

    2014-01-01

    Background High-throughput sequencing allows the detection and quantification of frequencies of somatic single nucleotide variants (SNV) in heterogeneous tumor cell populations. In some cases, the evolutionary history and population frequency of the subclonal lineages of tumor cells present in the sample can be reconstructed from these SNV frequency measurements. But automated methods to do this reconstruction are not available and the conditions under which reconstruction is possible have not been described. Results We describe the conditions under which the evolutionary history can be uniquely reconstructed from SNV frequencies from single or multiple samples from the tumor population and we introduce a new statistical model, PhyloSub, that infers the phylogeny and genotype of the major subclonal lineages represented in the population of cancer cells. It uses a Bayesian nonparametric prior over trees that groups SNVs into major subclonal lineages and automatically estimates the number of lineages and their ancestry. We sample from the joint posterior distribution over trees to identify evolutionary histories and cell population frequencies that have the highest probability of generating the observed SNV frequency data. When multiple phylogenies are consistent with a given set of SNV frequencies, PhyloSub represents the uncertainty in the tumor phylogeny using a “partial order plot”. Experiments on a simulated dataset and two real datasets comprising tumor samples from acute myeloid leukemia and chronic lymphocytic leukemia patients demonstrate that PhyloSub can infer both linear (or chain) and branching lineages and its inferences are in good agreement with ground truth, where it is available. Conclusions PhyloSub can be applied to frequencies of any “binary” somatic mutation, including SNVs as well as small insertions and deletions. The PhyloSub and partial order plot software is available from https://github.com/morrislab/phylosub/. PMID:24484323

  6. Events during eucaryotic rRNA transcription initiation and elongation: Conversion from the closed to the open promoter complex requires nucleotide substrates

    SciTech Connect

    Bateman, E.; Paule, M.R.

    1988-05-01

    Chemical footprinting and topological analysis were carried out on the Acanthamoeba castellanii rRNA transcription initiation factor (TIF) and RNA polymerase I complexes with DNA during transcription initiation and elongation. The results show that the binding of TIF and polymerase to the promoter does not alter the supercoiling of the DNA template and the template does not become sensitive to modification by diethylpyro-carbonate, which can identify melted DNA regions. Thus, in contrast to bacterial RNA polymerase, the eucaryotic RNA polymerase I-promoter complex is in a closed configuration preceding addition of nucleotides in vitro. Initiation and 3'-O-methyl CTP-limited translocation by RNA polymerase I results in separation of the polymerase-TIF footprints, leaving the TIF footprint unaltered. In contrast, initiation and translocation result in a significant change in the conformation of the polymerase-DNA complex, culminating in an unwound DNA region of at least 10 base pairs.

  7. The role of dietary nucleotides in single-stomached animals.

    PubMed

    Sauer, Nadja; Mosenthin, Rainer; Bauer, Eva

    2011-06-01

    The transition from liquid to solid feed during weaning results in morphological, histological and microbial changes in the young animal's intestinal tract and often is associated with diarrhoea. The ban of in-feed antibiotics in pig production in the European Union has led to increasing interest in alternatives to overcome weaning-associated problems. Among others, nucleotides may have the potential to alleviate health impairments due to weaning. Nucleotides are natural components of the non-protein fraction of milk and have important effects on the maintenance of health in young animals. Nucleotides and their related metabolic products play key roles in many biological processes and become essential dietary components when endogenous supply is insufficient for normal function. The present review summarises nucleotide composition of milk from different species, the biology of nucleotides and possible effects of dietary nucleotides on intestinal morphology and function, intestinal microbiota, immune function, nutrient metabolism, hepatic morphology and function as well as growth performance. Special attention is given to data available for pigs, and suggestions are made for inclusion of nucleotides in the diet to benefit piglets' health and reduce the consequences accompanying early weaning. PMID:21226977

  8. Collective judgment predicts disease-associated single nucleotide variants

    PubMed Central

    2013-01-01

    Background In recent years the number of human genetic variants deposited into the publicly available databases has been increasing exponentially. The latest version of dbSNP, for example, contains ~50 million validated Single Nucleotide Variants (SNVs). SNVs make up most of human variation and are often the primary causes of disease. The non-synonymous SNVs (nsSNVs) result in single amino acid substitutions and may affect protein function, often causing disease. Although several methods for the detection of nsSNV effects have already been developed, the consistent increase in annotated data is offering the opportunity to improve prediction accuracy. Results Here we present a new approach for the detection of disease-associated nsSNVs (Meta-SNP) that integrates four existing methods: PANTHER, PhD-SNP, SIFT and SNAP. We first tested the accuracy of each method using a dataset of 35,766 disease-annotated mutations from 8,667 proteins extracted from the SwissVar database. The four methods reached overall accuracies of 64%-76% with a Matthew's correlation coefficient (MCC) of 0.38-0.53. We then used the outputs of these methods to develop a machine learning based approach that discriminates between disease-associated and polymorphic variants (Meta-SNP). In testing, the combined method reached 79% overall accuracy and 0.59 MCC, ~3% higher accuracy and ~0.05 higher correlation with respect to the best-performing method. Moreover, for the hardest-to-define subset of nsSNVs, i.e. variants for which half of the predictors disagreed with the other half, Meta-SNP attained 8% higher accuracy than the best predictor. Conclusions Here we find that the Meta-SNP algorithm achieves better performance than the best single predictor. This result suggests that the methods used for the prediction of variant-disease associations are orthogonal, encoding different biologically relevant relationships. Careful combination of predictions from various resources is therefore a good strategy

  9. Network analysis of single nucleotide polymorphisms in asthma

    PubMed Central

    Renkonen, Jutta; Joenväärä, Sakari; Parviainen, Ville; Mattila, Pirkko; Renkonen, Risto

    2010-01-01

    Background: Asthma is a chronic inflammatory disease of the airways with a complex genetic background. In this study, we carried out a meta-analysis of single nucleotide polymorphisms (SNPs) thought to be associated with asthma. Methods: The literature (PubMed) was searched for SNPs within genes relevant in asthma. The SNP-modified genes were converted to corresponding proteins, and their protein–protein interactions were searched from six different databases. This interaction network was analyzed using annotated vocabularies (ontologies), such as the Gene Ontology and Nature pathway interaction databases. Results: In total, 127 genes with SNPs related to asthma were found in the literature. The corresponding proteins were then entered into a large protein–protein interaction network with the help of various databases. Ninety-six SNP-related proteins had more than one interacting protein each, and a network containing 309 proteins and 644 connections was generated. This network was significantly enriched with a gene ontology entitled “protein binding” and several of its daughter categories, including receptor binding and cytokine binding, when compared with the background human proteome. In the detailed analysis, the chemokine network, including eight proteins and 13 toll-like receptors, were shown to interact with each other. Of great interest are the nonsynonymous SNPs which code for an alternative amino acid sequence of proteins and, of the toll-like receptor network, TLR1, TLR4, TLR5, TLR6, TLR10, IL4R, and IL13 are among these. Conclusions: Protein binding, toll-like receptors, and chemokines dominated in the asthma-related protein interaction network. Systems level analysis of allergy-related mutations can provide new insights into the pathogenetic mechanisms of disease. PMID:21437052

  10. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  12. The application and performance of single nucleotide polymorphism markers for population genetic analyses of Lepidoptera

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single nucleotide polymorphisms (SNPs) are nucleotide substitution mutations that tend to be at high densities within eukaryotic genomes. The development of assays that detect allelic variation at SNP loci is attractive for genome mapping, population genetics, and phylogeographic applications. A p...

  13. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  14. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    NASA Astrophysics Data System (ADS)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  15. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    PubMed Central

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-01-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution. PMID:27677329

  16. Active community profiling via capillary electrophoresis single-strand conformation polymorphism analysis of amplified 16S rRNA and 16S rRNA genes.

    PubMed

    Hiibel, Sage R; Pruden, Amy; Crimi, Barbara; Reardon, Kenneth F

    2010-12-01

    Here, we report the validation and advancement of a high-throughput method for fingerprinting the active members of a microbial community. This method, termed active community profiling (ACP), provides information about both the composition and the activity of mixed microbial cultures via comparative measurements of amplified 16S rRNA (RNA) and 16S rRNA genes (DNA). Capillary electrophoresis is used to resolve single-strand conformation polymorphisms of polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products, producing electropherograms representative of the community structure. Active members of the community are distinguished by elevated RNA:DNA peak area ratios. Chemostat experiments with defined populations were conducted to validate the ACP approach. Using a pure culture of Escherichia coli, a direct correlation was found between the growth rate and the RNA:DNA peak ratio. In a second validation experiment, a binary culture of E. coli and Pseudomonas putida was subjected to a controlled environmental change consisting of a shift to anaerobic conditions. ACP revealed the expected cessation of growth of P. putida, an obligate aerobe, while the corresponding DNA-only analysis indicated no change in the culture. Finally, ACP was applied to a complex microbial community, and a novel binning approach was demonstrated for integrating the RNA and DNA electropherograms. ACP thus represents a significant advance from traditional DNA-based profiling techniques, which do not distinguish active from inactive or dead cells, and is well suited for high-throughput community analysis.

  17. Whole genome sequencing of a single Bos taurus animal for single nucleotide polymorphism discovery

    PubMed Central

    Eck, Sebastian H; Benet-Pagès, Anna; Flisikowski, Krzysztof; Meitinger, Thomas; Fries, Ruedi; Strom, Tim M

    2009-01-01

    Background The majority of the 2 million bovine single nucleotide polymorphisms (SNPs) currently available in dbSNP have been identified in a single breed, Hereford cattle, during the bovine genome project. In an attempt to evaluate the variance of a second breed, we have produced a whole genome sequence at low coverage of a single Fleckvieh bull. Results We generated 24 gigabases of sequence, mainly using 36-bp paired-end reads, resulting in an average 7.4-fold sequence depth. This coverage was sufficient to identify 2.44 million SNPs, 82% of which were previously unknown, and 115,000 small indels. A comparison with the genotypes of the same animal, generated on a 50 k oligonucleotide chip, revealed a detection rate of 74% and 30% for homozygous and heterozygous SNPs, respectively. The false positive rate, as determined by comparison with genotypes determined for 196 randomly selected SNPs, was approximately 1.1%. We further determined the allele frequencies of the 196 SNPs in 48 Fleckvieh and 48 Braunvieh bulls. 95% of the SNPs were polymorphic with an average minor allele frequency of 24.5% and with 83% of the SNPs having a minor allele frequency larger than 5%. Conclusions This work provides the first single cattle genome by next-generation sequencing. The chosen approach - low to medium coverage re-sequencing - added more than 2 million novel SNPs to the currently publicly available SNP resource, providing a valuable resource for the construction of high density oligonucleotide arrays in the context of genome-wide association studies. PMID:19660108

  18. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  19. High-throughput pyrosequencing for analysis of single-nucleotide polymorphisms

    NASA Astrophysics Data System (ADS)

    Ronaghi, Mostafa

    2002-06-01

    Pyrosequencing is a DNA sequencing technique that takes advantage of the cooperativity of four enzymes in a single- tube to determine the nucleotide composition of a DNA fragment in real-time. In this manuscript we describe the methodology and the use of this technology for analysis of single nucleotide polymorphisms, although, this technique has also been used for sequence determination of difficult secondary structures, mutation detection, EST sequencing, virus and bacteria typing, and re-sequencing of disease genes. Recent break-through has enabled long read data up to 200 nucleotides to be obtained in a single run. Automated microtiter plate based Pyrosequencing systems have been developed allowing DNA analyses of between 5000 to 50,000 samples per day. We are now miniaturizing this technique to reduce the cost for sequencing by at least two order of magnitudes. The array format proofs the feasibility of this system for DNA sequencing.

  20. Characterization of single nucleotide polymorphism markers for the green sea turtle (Chelonia mydas).

    PubMed

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-05-01

    We present data on 29 new single nucleotide polymorphism assays for the green sea turtle, Chelonia mydas. DNA extracts from 39 green turtles were used for two methods of single nucleotide polymorphism discovery. The first approach employed an amplified fragment length polymorphism technique. The second technique screened a microsatellite library. Allele-specific amplification assays were developed for high-throughput single nucleotide polymorphism genotyping and tested on two Pacific C. mydas nesting populations. Observed heterozygosities ranged from 0 to 0.95 for a Hawaiian population and from 0 to 0.85 for a Galapagos population. Each of the populations had one locus out of Hardy-Weinberg equilibrium, SSCM2b and SSCM5 for Hawaii and Galapagos, respectively. No loci showed significant genotypic linkage disequilibrium across an expanded set of four Pacific nesting populations. However, two loci, SSCM4 and SSCM10b showed linkage disequilibrium across three populations indicating possible association.

  1. Short PNA molecular beacons for real-time PCR allelic discrimination of single nucleotide polymorphisms.

    PubMed

    Petersen, Kenneth; Vogel, Ulla; Rockenbauer, Eszter; Nielsen, Kirsten Vang; Kølvraa, Steen; Bolund, Lars; Nexø, Bjørn

    2004-04-01

    The typing of a single nucleotide polymorphism with DNA probes is sometimes problematic because of the limited discriminating power of long DNA probes. As an alternative to existing assays, we have developed a real-time PCR assay for the genotyping of single nucleotide polymorphisms using short peptide nucleic acid (PNA) molecular beacons. A single nucleotide polymorphism in exon 6 of the XPD gene was chosen as the model system. The genotyping experiments were performed in the ABI 7700 using beacons labeled with either fluorescein or JOE, and in the Lightcycler using a fluorescein labeled beacon. QSY-7 was used as the quencher in all the beacons. The result of the genotyping was the same on both instruments and was in agreement with a previously performed RFLP genotyping of 79 samples. The length of PNA molecular beacons is significantly shorter than that of TaqMan or Lightcycler probes, making probe design and genotype discrimination easier.

  2. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  3. Direct evidence for redundant segmental replacement between multiple 18S rRNA genes in a single Prototheca strain.

    PubMed

    Ueno, Ryohei; Huss, Volker A R; Urano, Naoto; Watabe, Shugo

    2007-11-01

    Informational genes such as those encoding rRNAs are related to transcription and translation, and are thus considered to be rarely subject to lateral gene transfer (LGT) between different organisms, compared to operational genes having metabolic functions. However, several lines of evidence have suggested or confirmed the occurrence of LGT of DNA segments encoding evolutionarily variable regions of rRNA genes between different organisms. In the present paper, we show, for the first time to our knowledge, that variable regions of the 18S rRNA gene are segmentally replaced by multiple copies of different sequences in a single strain of the green microalga Prototheca wickerhamii, resulting in at least 17 genotypes, nine of which were actually transcribed. Recombination between different 18S rRNA genes occurred in seven out of eight variable regions (V1-V5 and V7-V9) of eukaryotic small subunit (SSU) rRNAs. While no recombination was observed in V1, one to three different recombination loci were demonstrated for the other regions. Such segmental replacement was also implicated for helix H37, which is defined as V6 of prokaryotic SSU rRNAs. Our observations provide direct evidence for redundant recombination of an informational gene, which encodes a component of mature ribosomes, in a single strain of one organism.

  4. Single Nucleotide Polymorphisms in Nucleotide Excision Repair Genes, Cigarette Smoking, and the Risk of Head and Neck Cancer

    PubMed Central

    Wyss, Annah B.; Herring, Amy H.; Avery, Christy L.; Weissler, Mark C.; Bensen, Jeannette T.; Barnholtz-Sloan, Jill S.; Funkhouser, William K.; Olshan, Andrew F.

    2013-01-01

    Background Cigarette smoking is associated with increased head and neck cancer (HNC) risk. Tobacco-related carcinogens are known to cause bulky DNA adducts. Nucleotide excision repair (NER) genes encode enzymes that remove adducts and may be independently associated with HNC, as well as modifiers of the association between smoking and HNC. Methods Using population-based case-control data from the Carolina Head and Neck Cancer Epidemiology Study (1,227 cases, 1,325 controls), race-stratified (white, African American) conventional and hierarchical logistic regression models were utilized to estimate odds ratios (OR) with 95% intervals (I) for the independent and joint effects of cigarette smoking and 84 single nucleotide polymorphisms (SNPs) from 15 NER genes on HNC risk. Results The odds of HNC were elevated among ever cigarette smokers, and increased with smoking duration and frequency. Among whites, rs4150403 on ERCC3 was associated with increased HNC odds (AA+AG vs. GG, OR=1.28, 95% I=1.01,1.61). Among African Americans, rs4253132 on ERCC6 was associated with decreased HNC odds (CC+CT vs. TT, OR=0.62, 95% I=0.45,0.86). Interactions between ever cigarette smoking and three SNPs (rs4253132 on ERCC6, rs2291120 on DDB2, and rs744154 on ERCC4) suggested possible departures from additivity among whites. Conclusions We did not find associations between some previously studied NER variants and HNC. We did identify new associations between two SNPs and HNC and three suggestive cigarette-SNP interactions to consider in future studies. Impact We conducted one of the most comprehensive evaluations of NER variants, identifying a few SNPs from biologically plausible candidate genes associated with HNC and possibly interacting with cigarette smoking. PMID:23720401

  5. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    PubMed

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments.

  6. Association of single nucleotide polymorphisms in candidate genes residing under quantitative trait loci in beef cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective was to assess the association of single nucleotide polymorphisms (SNP) developed on candidate genes residing under previously identified quantitative trait loci for marbling score and meat tenderness. Two hundred five SNP were identified on twenty candidate genes. Genes selected under ...

  7. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  8. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  9. Subtyping of Salmonella enterica subspecies I using single nucleotide polymorphisms in adenylate cyclase (cyaA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Methods to rapidly identify serotypes of Salmonella enterica subspecies I are of vital importance for protecting the safety of food. To supplement the serotyping method dkgB-linked intergenic sequence ribotyping (ISR), single nucleotide polymorphisms (SNPs) were characterized within adenylate cyclas...

  10. Increasing the number of single nucleotide polymorphisms used in genomic evaluation of dairy cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    GeneSeek designed a new version of the GeneSeek Genomic Profiler HD BeadChip for Dairy Cattle, which had >77,000 single nucleotide polymorphisms (SNPs). A set of >140,000 SNPs was selected that included all SNPs on the existing GeneSeek chip, all SNPs used in U.S. national genomic evaluations, SNPs ...

  11. Fluorescence-based detection of single-nucleotide changes in RNA using graphene oxide and DNAzyme.

    PubMed

    Hong, Chaesun; Kim, Dong-Min; Baek, Ahruem; Chung, Hyewon; Jung, Woong; Kim, Dong-Eun

    2015-04-01

    We report a simple fluorometric method for detection of single-nucleotide changes in RNA using graphene oxide (GO) and RNA-cleaving DNAzyme. The fluorescent DNA probe (F-DNA) was annealed to RNA fragments generated by RNA cleavage with DNAzyme specific to mutant RNA. The F-DNA-RNA duplex attenuated the quenching of F-DNA fluorescence by GO. PMID:25714982

  12. Verification of genetic identity of introduced cacao germplasm in Ghana using single nucleotide polymorphism (SNP) markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Accurate identification of individual genotypes is important for cacao (Theobroma cacao L.) breeding, germplasm conservation and seed propagation. The development of single nucleotide polymorphism (SNP) markers in cacao offers an effective way to use a high-throughput genotyping system for cacao gen...

  13. Characterization of 22 novel single nucleotide polymorphism markers in steelhead and rainbow trout

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thirty-two individuals representing coastal and inland populations of steelhead and rainbow trout (Oncorhynchus mykiss) were sequenced at 15 ESTs and 9 microsatellite loci to identify single nucleotide polymorphisms (SNPs). Sixty-two polymorphisms were discovered during the screen and 13 were devel...

  14. Clinical Relevance of Multiple Single-Nucleotide Polymorphisms in Pneumocystis jirovecii Pneumonia: Development of a Multiplex PCR-Single-Base-Extension Methodology▿

    PubMed Central

    Esteves, F.; Gaspar, J.; De Sousa, B.; Antunes, F.; Mansinho, K.; Matos, O.

    2011-01-01

    Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP. PMID:21389160

  15. Clinical relevance of multiple single-nucleotide polymorphisms in Pneumocystis jirovecii Pneumonia: development of a multiplex PCR-single-base-extension methodology.

    PubMed

    Esteves, F; Gaspar, J; De Sousa, B; Antunes, F; Mansinho, K; Matos, O

    2011-05-01

    Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP.

  16. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  17. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    PubMed Central

    Niraj, Diwesh Kumar; Kumar, Pushpendra; Mishra, Chinmoy; Narayan, Raj; Bhattacharya, Tarun Kumar; Shrivastava, Kush; Bhushan, Bharat; Tiwari, Ashok Kumar; Saxena, Vishesh; Sahoo, Nihar Ranjan; Sharma, Deepak

    2015-01-01

    Aim: An attempt has been made to study the Myxovirus resistant (Mx1) gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region), Fragment II of 148 bp (Exon 5 region), Fragment III of 161 bp (Exon 7 region), and Fragment IV of 176 bp (Exon 13 region) of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II) was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV) were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail. PMID:27047057

  18. OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

    NASA Astrophysics Data System (ADS)

    Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

    2016-09-01

    The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

  19. PEG-Labeled Nucleotides and Nanopore Detection for Single Molecule DNA Sequencing by Synthesis

    PubMed Central

    Kumar, Shiv; Tao, Chuanjuan; Chien, Minchen; Hellner, Brittney; Balijepalli, Arvind; Robertson, Joseph W. F.; Li, Zengmin; Russo, James J.; Reiner, Joseph E.; Kasianowicz, John J.; Ju, Jingyue

    2012-01-01

    We describe a novel single molecule nanopore-based sequencing by synthesis (Nano-SBS) strategy that can accurately distinguish four bases by detecting 4 different sized tags released from 5′-phosphate-modified nucleotides. The basic principle is as follows. As each nucleotide is incorporated into the growing DNA strand during the polymerase reaction, its tag is released and enters a nanopore in release order. This produces a unique ionic current blockade signature due to the tag's distinct chemical structure, thereby determining DNA sequence electronically at single molecule level with single base resolution. As proof of principle, we attached four different length PEG-coumarin tags to the terminal phosphate of 2′-deoxyguanosine-5′-tetraphosphate. We demonstrate efficient, accurate incorporation of the nucleotide analogs during the polymerase reaction, and excellent discrimination among the four tags based on nanopore ionic currents. This approach coupled with polymerase attached to the nanopores in an array format should yield a single-molecule electronic Nano-SBS platform. PMID:23002425

  20. Non-nearest-neighbor dependence of stability for group III RNA single nucleotide bulge loops.

    PubMed

    Kent, Jessica L; McCann, Michael D; Phillips, Daniel; Panaro, Brandon L; Lim, Geoffrey F S; Serra, Martin J

    2014-06-01

    Thirty-five RNA duplexes containing single nucleotide bulge loops were optically melted and the thermodynamic parameters for each duplex determined. The bulge loops were of the group III variety, where the bulged nucleotide is either a AG/U or CU/G, leading to ambiguity to the exact position and identity of the bulge. All possible group III bulge loops with Watson-Crick nearest-neighbors were examined. The data were used to develop a model to predict the free energy of an RNA duplex containing a group III single nucleotide bulge loop. The destabilization of the duplex by the group III bulge could be modeled so that the bulge nucleotide leads to the formation of the Watson-Crick base pair rather than the wobble base pair. The destabilization of an RNA duplex caused by the insertion of a group III bulge is primarily dependent upon non-nearest-neighbor interactions and was shown to be dependent upon the stability of second least stable stem of the duplex. In-line structure probing of group III bulge loops embedded in a hairpin indicated that the bulged nucleotide is the one positioned further from the hairpin loop irrespective of whether the resulting stem formed a Watson-Crick or wobble base pair. Fourteen RNA hairpins containing group III bulge loops, either 3' or 5' of the hairpin loop, were optically melted and the thermodynamic parameters determined. The model developed to predict the influence of group III bulge loops on the stability of duplex formation was extended to predict the influence of bulge loops on hairpin stability.

  1. Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

    PubMed

    Winterhagen, Patrick; Wünsche, Jens-Norbert

    2016-05-01

    Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population. PMID:27093244

  2. Using molecular beacons to detect single-nucleotide polymorphisms with real-time PCR.

    PubMed

    Mhlanga, M M; Malmberg, L

    2001-12-01

    Detection of single-nucleotide polymorphisms (SNPs) in high-throughput studies promises to be an expanding field of molecular medicine in the near future. Highly specific, simple, and accessible methods are needed to meet the rigorous requirements of single-nucleotide detection needed in pharmacogenomic studies, linkage analysis, and the detection of pathogens. Molecular beacons present such a solution for the high-throughput screening of SNPs in homogeneous assays using the polymerase chain reaction (PCR). Molecular beacons are probes that fluoresce on hybridization to their perfectly complementary targets. In recent years they have emerged as a leading genetic analysis tool in a wide range of contexts from quantification of RNA transcripts, to probes on microarrays, to single-nucleotide polymorphism detection. The majority of these methods use PCR to obtain sufficient amounts of sample to analyze. The use of molecular beacons with other amplification schemes has been reliably demonstrated, though PCR remains the method of choice. Here we discuss and present how to design and use molecular beacons to achieve reliable SNP genotyping and allele discrimination in real-time PCR. In addition, we provide a new means of analyzing data outputs from such real-time PCR assays that compensates for differences between sample condition, assay conditions, variations in fluorescent signal, and amplification efficiency. The mechanisms by which molecular beacons are able to have extraordinary specificity are also presented. PMID:11846616

  3. The method of single-nucleotide variations detection using capillary electrophoresis and molecular beacons.

    PubMed

    Wang, Jinhui; Wang, Wei; Liu, Yanhong; Duo, Libo; Huang, Lijuan; Jiang, Xiaofeng

    2009-09-01

    We demonstrate that single-nucleotide variations in a DNA sequence can be detected using capillary electrophoresis (CE) and molecular beacons (MBs). In this method, the region surrounding the site of a nucleotide variation was amplified in a polymerase chain reaction, then hybridize PCR products with each of MBs. The sequences of the PCR products are different at the site of 2,044 in exon of interleukin (IL)-13 which to be identified. Through denaturation, the PCR product became single strand and hybridized with the completely complementary MB. The MB-target duplexes were separated using CE and solution-based fluorescence techniques. The results show that in each reaction a fluorescent response was elicited from the molecular beacon which was perfectly complementary to the amplified DNA, but not from the other MB whose probe sequence mismatched the target sequence. The method of CE based on MBs is able to identify single-nucleotide variations in a DNA sequence and can discriminate the genotyping of the SNP between the homo- and heteroduplexes of DNA fragments.

  4. A new single nucleotide polymorphism in the ryanodine gene of chicken skeletal muscle.

    PubMed

    Droval, A A; Binneck, E; Marin, S R R; Paião, F G; Oba, A; Nepomuceno, A L; Shimokomaki, M

    2012-01-01

    Some genes affect meat quality in chickens. We looked for polymorphisms in the Gallus gallus α-RyR gene (homologous to RyR 1) that could be associated with PSE (pale, soft and exudative) meat. Because RyR genes are over 100,000 bp long and code for proteins with about 5000 amino acids, primers were designed to amplify a fragment of hotspot region 2, a region with a high density of mutations in other species. Total blood DNA was extracted from 50 birds, 25 that had PSE meat and 25 normal chickens. The DNA samples were amplified by PCR, cloned, sequenced, and used to identify single nucleotide polymorphisms (SNPs). The amplified fragment of α-RyR was 604 nucleotides in length; 181 nucleotides were similar to two exons from a hypothetical turkey cDNA sequence for α-RyR. A non-synonymous nucleotide substitution (G/A) was identified in at least one of the three sequenced clones obtained from nine animals, six PSE (HAL+) birds and three normal (HAL-) birds; they were heterozygous for this mutation. This SNP causes a change from Val to Met in the α-RYR protein. Since the frequencies of this SNP were not significantly different in the PSE versus normal chickens, it appears that this mutation (in heterozygosity) does not alter the structure or function of the muscle protein, making it an inappropriate candidate as a genetic marker for PSE meat.

  5. Identification of Bacteria in Formalin-Fixed, Paraffin-Embedded Heart Valve Tissue via 16S rRNA Gene Nucleotide Sequencing

    PubMed Central

    Imrit, Kavita; Goldfischer, Michael; Wang, Jie; Green, Jaime; Levine, Jerome; Lombardo, Joseph; Hong, Tao

    2006-01-01

    We applied 16S rRNA gene sequencing to identify bacterial species present in formalin-fixed, paraffin-embedded heart valve tissue. In 40% (12/30) of the cases, we were able to identify the bacterium to the species-genus level. For more recent cases (≤4 years), the success rate was significantly improved, to 70% (P < 0.001). PMID:16825394

  6. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly.

    PubMed

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-08-25

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2'-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2'-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  7. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly

    PubMed Central

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-01-01

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2′-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2′-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  8. High-throughput profiling of influenza A virus hemagglutinin gene at single-nucleotide resolution

    PubMed Central

    Wu, Nicholas C.; Young, Arthur P.; Al-Mawsawi, Laith Q.; Olson, C. Anders; Feng, Jun; Qi, Hangfei; Chen, Shu-Hwa; Lu, I.-Hsuan; Lin, Chung-Yen; Chin, Robert G.; Luan, Harding H.; Nguyen, Nguyen; Nelson, Stanley F.; Li, Xinmin; Wu, Ting-Ting; Sun, Ren

    2014-01-01

    Genetic research on influenza virus biology has been informed in large part by nucleotide variants present in seasonal or pandemic samples, or individual mutants generated in the laboratory, leaving a substantial part of the genome uncharacterized. Here, we have developed a single-nucleotide resolution genetic approach to interrogate the fitness effect of point mutations in 98% of the amino acid positions in the influenza A virus hemagglutinin (HA) gene. Our HA fitness map provides a reference to identify indispensable regions to aid in drug and vaccine design as targeting these regions will increase the genetic barrier for the emergence of escape mutations. This study offers a new platform for studying genome dynamics, structure-function relationships, virus-host interactions, and can further rational drug and vaccine design. Our approach can also be applied to any virus that can be genetically manipulated. PMID:24820965

  9. A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

    SciTech Connect

    Wong, G K; Hillier, L; Brandstrom, M; Croojmans, R; Ovcharenko, I; Gordon, L; Stubbs, L; Lucas, S; Glavina, T; Kaiser, P; Gunnarsson, U; Webber, C; Overton, I

    2005-02-20

    We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to their wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.

  10. Single-molecule microscopy reveals new insights into nucleotide selection by DNA polymerase I

    PubMed Central

    Markiewicz, Radoslaw P.; Vrtis, Kyle B.; Rueda, David; Romano, Louis J.

    2012-01-01

    The mechanism by which DNA polymerases achieve their extraordinary accuracy has been intensely studied because of the linkage between this process and mutagenesis and carcinogenesis. Here, we have used single-molecule fluorescence microscopy to study the process of nucleotide selection and exonuclease action. Our results show that the binding of Escherichia coli DNA polymerase I (Klenow fragment) to a primer-template is stabilized by the presence of the next correct dNTP, even in the presence of a large excess of the other dNTPs and rNTPs. These results are consistent with a model where nucleotide selection occurs in the open complex prior to the formation of a closed ternary complex. Our assay can also distinguish between primer binding to the polymerase or exonuclease domain and, contrary to ensemble-averaged studies, we find that stable exonuclease binding only occurs with a mismatched primer terminus. PMID:22669904

  11. Designing siRNA that distinguish between genes that differ by a single nucleotide.

    PubMed

    Schwarz, Dianne S; Ding, Hongliu; Kennington, Lori; Moore, Jessica T; Schelter, Janell; Burchard, Julja; Linsley, Peter S; Aronin, Neil; Xu, Zuoshang; Zamore, Phillip D

    2006-09-01

    Small interfering RNAs (siRNAs), the guides that direct RNA interference (RNAi), provide a powerful tool to reduce the expression of a single gene in human cells. Ideally, dominant, gain-of-function human diseases could be treated using siRNAs that specifically silence the mutant disease allele, while leaving expression of the wild-type allele unperturbed. Previous reports suggest that siRNAs can be designed with single nucleotide specificity, but no rational basis for the design of siRNAs with single nucleotide discrimination has been proposed. We systematically identified siRNAs that discriminate between the wild-type and mutant alleles of two disease genes: the human Cu, Zn superoxide dismutase (SOD1) gene, which contributes to the progression of hereditary amyotrophic lateral sclerosis through the gain of a toxic property, and the huntingtin (HTT) gene, which causes Huntington disease when its CAG-repeat region expands beyond approximately 35 repeats. Using cell-free RNAi reactions in Drosophila embryo lysate and reporter assays and microarray analysis of off-target effects in cultured human cells, we identified positions within an siRNA that are most sensitive to mismatches. We also show that purine:purine mismatches imbue an siRNA with greater discriminatory power than other types of base mismatches. siRNAs in which either a G:U wobble or a mismatch is located in the "seed" sequence, the specialized siRNA guide region responsible for target binding, displayed lower levels of selectivity than those in which the mismatch was located 3' to the seed; this region of an siRNA is critical for target cleavage but not siRNA binding. Our data suggest that siRNAs can be designed to discriminate between the wild-type and mutant alleles of many genes that differ by just a single nucleotide.

  12. Pyrosequencing with di-base addition for single nucleotide polymorphism genotyping.

    PubMed

    Pu, Dan; Mao, Chengguang; Cui, Lunbiao; Shi, Zhiyang; Xiao, Pengfeng

    2016-05-01

    We develop color code-based pyrosequencing with di-base addition for analysis of single nucleotide polymorphisms (SNPs). When a di-base is added into the polymerization, one or several two-color code(s) containing the type and the number of incorporated nucleotides will be produced. The code information obtained in a single run is useful to genotype SNPs as each allelic variant will give a specific pattern compared to the two other variants. Special care has to be taken while designing the di-base dispensation order. Here, we present a detailed protocol for establishing sequence-specific di-base addition to avoid nonsynchronous extension at the SNP sites. By using this technology, as few as 50 copies of DNA templates were accurately sequenced. Higher signals were produced and thus a relatively lower sample amount was required. Furthermore, the read length of per flow was increased, making simultaneous identification of multiple SNPs in a single sequencing run possible. Validation of the method was performed by using templates with two SNPs covering 37 bp and with three SNPs covering 58 bp as well as 82 bp. These SNPs were successfully genotyped by using only a sequencing primer in a single PCR/sequencing run. Our results demonstrated that this technology could be potentially developed into a powerful methodology to accurately determine SNPs so as to diagnose clinical settings.

  13. Pyrosequencing with di-base addition for single nucleotide polymorphism genotyping.

    PubMed

    Pu, Dan; Mao, Chengguang; Cui, Lunbiao; Shi, Zhiyang; Xiao, Pengfeng

    2016-05-01

    We develop color code-based pyrosequencing with di-base addition for analysis of single nucleotide polymorphisms (SNPs). When a di-base is added into the polymerization, one or several two-color code(s) containing the type and the number of incorporated nucleotides will be produced. The code information obtained in a single run is useful to genotype SNPs as each allelic variant will give a specific pattern compared to the two other variants. Special care has to be taken while designing the di-base dispensation order. Here, we present a detailed protocol for establishing sequence-specific di-base addition to avoid nonsynchronous extension at the SNP sites. By using this technology, as few as 50 copies of DNA templates were accurately sequenced. Higher signals were produced and thus a relatively lower sample amount was required. Furthermore, the read length of per flow was increased, making simultaneous identification of multiple SNPs in a single sequencing run possible. Validation of the method was performed by using templates with two SNPs covering 37 bp and with three SNPs covering 58 bp as well as 82 bp. These SNPs were successfully genotyped by using only a sequencing primer in a single PCR/sequencing run. Our results demonstrated that this technology could be potentially developed into a powerful methodology to accurately determine SNPs so as to diagnose clinical settings. PMID:26935928

  14. Designed thiazole orange nucleotides for the synthesis of single labelled oligonucleotides that fluoresce upon matched hybridization.

    PubMed

    Bethge, Lucas; Singh, Ishwar; Seitz, Oliver

    2010-05-21

    Probe molecules that enable the detection of specific DNA sequences are used in diagnostic and basic research. Most methods rely on the specificity of hybridization reactions, which complicates the detection of single base mutations at low temperature. Significant efforts have been devoted to the development of oligonucleotides that allow discrimination of single base mutations at temperatures where both the match and the mismatch probe-target complexes coexist. Oligonucleotides that contain environmentally sensitive fluorescence dyes such as thiazole orange (TO) provide single nucleotide specific fluorescence. However, most previously reported dye-DNA conjugates showed only little if any difference between the fluorescence of the single and the double stranded state. Here, we introduce a TO-containing acyclic nucleotide, which is coupled during automated oligonucleotide synthesis and provides for the desired fluorescence-up properties. The study reveals the conjugation mode as the most important issue. We show a design that leads to low fluorescence of the unbound probe (background) yet permits TO to adopt fluorescent binding modes after the probe-target complex has formed. In these probes, TO replaces a canonical nucleobase. Of note, the fluorescence of the "TO-base" remains low when a base mismatch is positioned in immediate vicinity.

  15. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    NASA Astrophysics Data System (ADS)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  16. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    PubMed

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  17. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  18. Regulatory single nucleotide polymorphisms at the beginning of intron 2 of the human KRAS gene.

    PubMed

    Antontseva, Elena V; Matveeva, Marina Yu; Bondar, Natalia P; Kashina, Elena V; Leberfarb, Elena Yu; Bryzgalov, Leonid O; Gervas, Polina A; Ponomareva, Anastasia A; Cherdyntseva, Nadezhda V; Orlov, Yury L; Merkulova, Tatiana I

    2015-12-01

    There are two regulatory single nucleotide polymorphisms (rSNPs) at the beginning of the second intron of the mouse K-ras gene that are strongly associated with lung cancer susceptibility. We performed functional analysis of three SNPs (rs12228277: T greater than A, rs12226937: G greater than A, and rs61761074: T greater than G) located in the same region of human KRAS. We found that rs12228277 and rs61761074 result in differential binding patterns of lung nuclear proteins to oligonucleotide probes corresponding two alternative alleles; in both cases, the transcription factor NF-Y is involved. G greater than A substitution (rs12226937) had no effect on the binding of lung nuclear proteins. However, all the nucleotide substitutions under study showed functional effects in a luciferase reporter assay. Among them, rs61761074 demonstrated a significant correlation with allele frequency in non-small-cell lung cancer (NSCLC). Taken together, the results of our study suggest that a T greater than G substitution at nucleotide position 615 in the second intron of the KRAS gene (rs61761074) may represent a promising genetic marker of NSCLC. PMID:26648033

  19. Single-nucleotide-resolution mapping of m6A and m6Am throughout the transcriptome.

    PubMed

    Linder, Bastian; Grozhik, Anya V; Olarerin-George, Anthony O; Meydan, Cem; Mason, Christopher E; Jaffrey, Samie R

    2015-08-01

    N(6)-methyladenosine (m6A) is the most abundant modified base in eukaryotic mRNA and has been linked to diverse effects on mRNA fate. Current mapping approaches localize m6A residues to transcript regions 100-200 nt long but cannot identify precise m6A positions on a transcriptome-wide level. Here we developed m6A individual-nucleotide-resolution cross-linking and immunoprecipitation (miCLIP) and used it to demonstrate that antibodies to m6A can induce specific mutational signatures at m6A residues after ultraviolet light-induced antibody-RNA cross-linking and reverse transcription. We found that these antibodies similarly induced mutational signatures at N(6),2'-O-dimethyladenosine (m6Am), a modification found at the first nucleotide of certain mRNAs. Using these signatures, we mapped m6A and m6Am at single-nucleotide resolution in human and mouse mRNA and identified small nucleolar RNAs (snoRNAs) as a new class of m6A-containing non-coding RNAs (ncRNAs). PMID:26121403

  20. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy.

    PubMed

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie

    2015-12-14

    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.

  1. Nanoparticle-based detection and quantification of DNA with single nucleotide polymorphism (SNP) discrimination selectivity

    PubMed Central

    Qin, Wei Jie; Yung, Lin Yue Lanry

    2007-01-01

    Sequence-specific DNA detection is important in various biomedical applications such as gene expression profiling, disease diagnosis and treatment, drug discovery and forensic analysis. Here we report a gold nanoparticle-based method that allows DNA detection and quantification and is capable of single nucleotide polymorphism (SNP) discrimination. The precise quantification of single-stranded DNA is due to the formation of defined nanoparticle-DNA conjugate groupings in the presence of target/linker DNA. Conjugate groupings were characterized and quantified by gel electrophoresis. A linear correlation between the amount of target DNA and conjugate groupings was found. For SNP detection, single base mismatch discrimination was achieved for both the end- and center-base mismatch. The method described here may be useful for the development of a simple and quantitative DNA detection assay. PMID:17720714

  2. C868T single nucleotide polymorphism and HIV type 1 disease progression among postpartum women in Kenya.

    PubMed

    Choi, Robert Y; Fowke, Keith R; Juno, Jennifer; Lohman-Payne, Barbara; Oyugi, Julius O; Brown, Elizabeth R; Bosire, Rose; John-Stewart, Grace; Farquhar, Carey

    2012-06-01

    The C868T single nucleotide polymorphism in the CD4 receptor encodes an amino acid substitution of tryptophan for arginine in the third domain. Previous studies suggest that C868T increases the risk of HIV-1 acquisition; however, the influence of this single nucleotide polymorphism (SNP) on disease progression has not been established. The presence of the C868T polymorphism was not statistically significantly associated with HIV-1 disease progression outcomes in a cohort of postpartum Kenyan women.

  3. Multicolor fluorescence detection for single nucleotide polymorphism genotyping using a filter-less fluorescence detector

    NASA Astrophysics Data System (ADS)

    Yamasaki, Keita; Nakazawa, Hirokazu; Misawa, Nobuo; Ishida, Makoto; Sawada, Kazuaki

    2013-06-01

    Single nucleotide polymorphism (SNP) analysis that is commonly performed using fluorescence is important in drug development and pathology research. In this study, to facilitate the analysis, multicolor fluorescence detection for SNP genotyping using a filter-less fluorescence detector (FFD) was investigated. FFDs do not require any optical filters for multicolor fluorescence detection. From the experimental results, FFD could identify 0 μM, 1 μM, and 10 μM solutions of Texas Red and fluorescein isothiocyanate. Moreover, a mixture of Texas Red and 6-FAM could be detected in the SNP genotyping simulation. Therefore, a small and low-cost SNP genotyping system is feasible.

  4. Investigation of bacterial nucleotide excision repair using single-molecule techniques

    PubMed Central

    Van Houten, Bennett; Kad, Neil

    2016-01-01

    Despite three decades of biochemical and structural analysis of the prokaryotic nucleotide excision repair (NER) system, many intriguing questions remain with regard to how the UvrA, UvrB, and UvrC proteins detect, verify and remove a wide range of DNA lesions. Single-molecule techniques have begun to allow more detailed understanding of the kinetics and action mechanism of this complex process. This article reviews how atomic force microscopy and fluorescence microscopy have captured new glimpses of how these proteins work together to mediate NER. PMID:24472181

  5. Predicting responses to sunitinib using single nucleotide polymorphisms: Progress and recommendations for future trials.

    PubMed

    Ganapathi, Ram N; Bukowski, Ronald M

    2011-12-30

    Targeted therapy with tyrosine kinase inhibitors has led to a substantial improvement in the standard of care for patients with advanced or metastatic clear cell renal cell carcinoma. Because the mechanism of action, metabolism and transport of tyrosine kinase inhibitors can affect outcome and toxicity, several investigators have pursued the identification of single nucleotide polymorphisms (SNPs) in genes associated with these actions. We discuss SNPs associated with outcome and toxicity following sunitinib therapy and provide recommendations for future trials to facilitate the use of SNPs in personalized therapy for this disease.

  6. Genome-wide single-nucleotide polymorphism analysis defines haplotype patterns in mouse

    PubMed Central

    Wiltshire, Tim; Pletcher, Mathew T.; Batalov, Serge; Barnes, S. Whitney; Tarantino, Lisa M.; Cooke, Michael P.; Wu, Hua; Smylie, Kevin; Santrosyan, Andrey; Copeland, Neal G.; Jenkins, Nancy A.; Kalush, Francis; Mural, Richard J.; Glynne, Richard J.; Kay, Steve A.; Adams, Mark D.; Fletcher, Colin F.

    2003-01-01

    The nature and organization of polymorphisms, or differences, between genomes of individuals are of great interest, because these variations can be associated with or even underlie phenotypic traits, including disease susceptibility. To gain insight into the genetic and evolutionary factors influencing such biological variation, we have examined the arrangement (haplotype) of single-nucleotide polymorphisms across the genomes of eight inbred strains of mice. These analyses define blocks of high or low diversity, often extending across tens of megabases that are delineated by abrupt transitions. These observations provide a striking contrast to the haplotype structure of the human genome. PMID:12612341

  7. DNA sequencing by a single molecule detection of labeled nucleotides sequentially cleaved from a single strand of DNA

    SciTech Connect

    Goodwin, P.M.; Schecker, J.A.; Wilkerson, C.W.; Hammond, M.L.; Ambrose, W.P.; Jett, J.H.; Martin, J.C.; Marrone, B.L.; Keller, R.A. ); Haces, A.; Shih, P.J.; Harding, J.D. )

    1993-01-01

    We are developing a laser-based technique for the rapid sequencing of large DNA fragments (several kb in size) at a rate of 100 to 1000 bases per second. Our approach relies on fluorescent labeling of the bases in a single fragment of DNA, attachment of this labeled DNA fragment to a support, movement of the supported DNA into a flowing sample stream, sequential cleavage of the end nucleotide from the DNA fragment with an exonuclease, and detection of the individual fluorescently labeled bases by laser-induced fluorescence.

  8. DNA sequencing by a single molecule detection of labeled nucleotides sequentially cleaved from a single strand of DNA

    SciTech Connect

    Goodwin, P.M.; Schecker, J.A.; Wilkerson, C.W.; Hammond, M.L.; Ambrose, W.P.; Jett, J.H.; Martin, J.C.; Marrone, B.L.; Keller, R.A.; Haces, A.; Shih, P.J.; Harding, J.D.

    1993-02-01

    We are developing a laser-based technique for the rapid sequencing of large DNA fragments (several kb in size) at a rate of 100 to 1000 bases per second. Our approach relies on fluorescent labeling of the bases in a single fragment of DNA, attachment of this labeled DNA fragment to a support, movement of the supported DNA into a flowing sample stream, sequential cleavage of the end nucleotide from the DNA fragment with an exonuclease, and detection of the individual fluorescently labeled bases by laser-induced fluorescence.

  9. Single Nucleotide Polymorphism–Single Nucleotide Polymorphism Interactions Among Inflammation Genes in the Genetic Architecture of Blood Pressure in the Framingham Heart Study

    PubMed Central

    de las Fuentes, Lisa; Rao, Dabeeru C.

    2015-01-01

    BACKGROUND Hypertension is a major global health burden, but, although systolic and diastolic blood pressure (BP) each have estimated heritability of at least 30%, <3% of their variance has been attributed to particular genetic variants. Few studies have shown interactions between pairs of single nucleotide polymorphisms (SNPs) to be associated with BP. Although many studies use a Bonferroni correction for multiple testing to control type I error, thereby potentially reducing power, false discovery rate (FDR) approaches are also used in genome-wide studies. Renal ion balance genes have been associated with BP regulation, but, although inflammation has been studied in connection with BP, few studies have reported associations between inflammation genes and BP. METHODS We analyzed SNP-SNP interactions among 31 SNPs from genes involved in renal ion balance and 30 SNPs from genes involved in inflammation using data from the Framingham Heart Study. RESULTS No evidence of association was found for interactions among renal ion balance SNPs for either systolic or diastolic BP. A group of 3 interactions involving 6 inflammation genes (IKBKB–NFKBIA, IKBKE–CHUK, and ADIPOR2–RETN) showed evidence of association with diastolic BP with an FDR of 4.2%; no single interaction reached experiment-wide significance. CONCLUSIONS This study identified promising and biologically plausible candidates for interactions between inflammation genes that may be associated with DBP. Analysis using the FDR may allow detection of signals in the presence of modest noise (false positives) that a stringent approach based on Bonferroni-corrected P value thresholds may miss. PMID:25063733

  10. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    PubMed Central

    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

    2016-01-01

    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  11. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes.

    PubMed

    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

    2016-01-01

    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene-currently annotated as intronic-fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  12. Association of the DIO2 gene single nucleotide polymorphisms with recurrent depressive disorder.

    PubMed

    Gałecka, Elżbieta; Talarowska, Monika; Orzechowska, Agata; Górski, Paweł; Bieńkiewicz, Małgorzata; Szemraj, Janusz

    2015-01-01

    Genetic factors may play a role in the etiology of depressive disorder. The type 2 iodothyronine deiodinase gene (DIO2) encoding the enzyme catalyzing the conversion of T4 to T3 is suggested to play a role in the recurrent depressive disorder (rDD). The current study investigates whether a specific single nucleotide polymorphism (SNP) of the DIO2 gene, Thr92Ala (T/C); rs 225014 or ORFa-Gly3Asp (C/T); rs 12885300, correlate with the risk for recurrent depression. Genotypes for these two single nucleotide polymorphisms (SNPs) were determined in 179 patients meeting the ICD-10 criteria for rDD group and in 152 healthy individuals (control group) using a polymerase chain reaction (PCR) based method. The specific variant of the DIO2 gene, namely the CC genotype of the Thr92Ala polymorphism, was more frequently found in healthy subjects than in patients with depression, what suggests that it could potentially serve as a marker of a lower risk for recurrent depressive disorder. The distribution of four haplotypes was also significantly different between the two study groups with the TC (Thr-Gly) haplotype more frequently detected in patients with depression. In conclusion, data generated from this study suggest for the first time that DIO2 gene may play a role in the etiology of the disease, and thus should be further investigated. PMID:26098717

  13. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

    PubMed

    Khrustaleva, A M; Gritsenko, O F; Klovach, N V

    2013-11-01

    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected. PMID:25470934

  14. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

    PubMed

    2013-11-01

    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected. PMID:25508561

  15. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing.

    PubMed

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R(2) = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. PMID:27120517

  16. Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

    2016-05-01

    We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

  17. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing.

    PubMed

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R(2) = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.

  18. A Locked Nucleic Acid Probe Based on Selective Salt-Induced Effect Detects Single Nucleotide Polymorphisms

    PubMed Central

    Zhang, Jing; Wu, Huizhe; Chen, Qiuchen; Zhao, Pengfei; Zhao, Haishan; Yao, Weifan; Wei, Minjie

    2015-01-01

    Detection of single based genetic mutation by using oligonucleotide probes is one of the common methods of detecting single nucleotide polymorphisms at known loci. In this paper, we demonstrated a hybridization system which included a buffer solution that produced selective salt-induced effect and a locked nucleic acid modified 12 nt oligonucleotide probe. The hybridization system is suitable for hybridization under room temperature. By using magnetic nanoparticles as carriers for PCR products, the SNPs (MDR1 C3435T/A) from 45 volunteers were analyzed, and the results were consistent with the results from pyrophosphoric acid sequencing. The method presented in this paper differs from the traditional method of using molecular beacons to detect SNPs in that it is suitable for research institutions lacking real-time quantitative PCR detecting systems, to detect PCR products at room temperature. PMID:26347880

  19. Multiplex single-nucleotide polymorphism typing of the human Y chromosome using TaqMan probes

    PubMed Central

    2011-01-01

    Background The analysis of human Y-chromosome variation in the context of population genetics and forensics requires the genotyping of dozens to hundreds of selected single-nucleotide polymorphisms (SNPs). In the present study, we developed a 121-plex (121 SNPs in a single array) TaqMan array capable of distinguishing most haplogroups and subhaplogroups on the Y-chromosome human phylogeny in Europe. Results We present data from 264 samples from several European areas and ethnic groups. The array developed in this study shows >99% accuracy of assignation to the Y human phylogeny (with an average call rate of genotypes >96%). Conclusions We have created and evaluated a robust and accurate Y-chromosome multiplex which minimises the possible errors due to mixup when typing the same sample in several independent reactions. PMID:21627798

  20. Estimating population size using single-nucleotide polymorphism-based pedigree data.

    PubMed

    Spitzer, Robert; Norman, Anita J; Schneider, Michael; Spong, Göran

    2016-05-01

    Reliable population estimates are an important aspect of sustainable wildlife management and conservation but can be difficult to obtain for rare and elusive species. Here, we test a new census method based on pedigree reconstruction recently developed by Creel and Rosenblatt (2013). Using a panel of 96 single-nucleotide polymorphisms (SNPs), we genotyped fecal samples from two Swedish brown bear populations for pedigree reconstruction. Based on 433 genotypes from central Sweden (CS) and 265 from northern Sweden (NS), the population estimates (N = 630 for CS, N = 408 for NS) fell within the 95% CI of the official estimates. The precision and accuracy improved with increasing sampling intensity. Like genetic capture-mark-recapture methods, this method can be applied to data from a single sampling session. Pedigree reconstruction combined with noninvasive genetic sampling may thus augment population estimates, particularly for rare and elusive species for which sampling may be challenging.

  1. Genotyping single nucleotide polymorphisms using different molecular beacon multiplexed within a suspended core optical fiber.

    PubMed

    Nguyen, Linh Viet; Giannetti, Sara; Warren-Smith, Stephen; Cooper, Alan; Selleri, Stefano; Cucinotta, Annamaria; Monro, Tanya

    2014-01-01

    We report a novel approach to genotyping single nucleotide polymorphisms (SNPs) using molecular beacons in conjunction with a suspended core optical fiber (SCF). Target DNA sequences corresponding to the wild- or mutant-type have been accurately recognized by immobilizing two different molecular beacons on the core of a SCF. The two molecular beacons differ by one base in the loop-probe and utilize different fluorescent indicators. Single-color fluorescence enhancement was obtained when the immobilized SCFs were filled with a solution containing either wild-type or mutant-type sequence (homozygous sample), while filling the immobilized SCF with solution containing both wild- and mutant-type sequences resulted in dual-color fluorescence enhancement, indicating a heterozygous sample. The genotyping was realized amplification-free and with ultra low-volume for the required DNA solution (nano-liter). This is, to our knowledge, the first genotyping device based on the combination of optical fiber and molecular beacons.

  2. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding.

  3. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie

    2015-11-01

    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct

  4. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

    PubMed Central

    Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

    2006-01-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

  5. Dynamic programming for single nucleotide polymorphism ID identification in systematic association studies.

    PubMed

    Yang, Cheng-Hong; Chuang, Li-Yeh; Cheng, Yu-Huei; Wen, Cheng-Hao; Chang, Hsueh-Wei

    2009-04-01

    Single nucleotide polymorphisms (SNPs) play an important role in personalized medicine. However, the SNP data reported in many association studies provide only the SNP nucleotide/amino acid position, without providing the SNP ID recorded in National Center for Biotechnology Information databases. A tool with the ability to provide SNP ID identification, with a user-friendly interface, is needed. In this paper, a dynamic programming algorithm was used to compare homologs when the processed input sequence is aligned with the SNP FASTA database. Our novel system provides a web-based tool that uses the National Center for Biotechnology Information dbSNP database, which provides SNP sequence identification and SNP FASTA formats. Freely selectable sequence formats for alignment can be used, including general sequence formats (ACGT, [dNTP1/dNTP2] or IUPAC formats) and orientation with bidirectional sequence matching. In contrast to the National Center for Biotechnology Information SNP-BLAST, the proposed system always provides the correct targeted SNP ID (SNP hit), as well as nearby SNPs (flanking hits), arranged in their chromosomal order and contig positions. The system also solves problems inherent in SNP-BLAST, which cannot always provide the correct SNP ID for a given input sequence. Therefore, this system constitutes a novel application which uses dynamic programming to identify SNP IDs from the literature and keyed-in sequences for systematic association studies. It is freely available at http://bio.kuas.edu.tw/SNPosition/.

  6. Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

    PubMed Central

    Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

    2013-01-01

    The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

  7. Assessment of the geographic origins of pinewood nematode isolates via single nucleotide polymorphism in effector genes.

    PubMed

    Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

    2013-01-01

    The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification.

  8. Cisplatin DNA damage and repair maps of the human genome at single-nucleotide resolution

    PubMed Central

    Hu, Jinchuan; Lieb, Jason D.; Sancar, Aziz; Adar, Sheera

    2016-01-01

    Cisplatin is a major anticancer drug that kills cancer cells by damaging their DNA. Cancer cells cope with the drug by removal of the damages with nucleotide excision repair. We have developed methods to measure cisplatin adduct formation and its repair at single-nucleotide resolution. “Damage-seq” relies on the replication-blocking properties of the bulky base lesions to precisely map their location. “XR-seq” independently maps the removal of these damages by capturing and sequencing the excised oligomer released during repair. The damage and repair maps we generated reveal that damage distribution is essentially uniform and is dictated mostly by the underlying sequence. In contrast, cisplatin repair is heterogeneous in the genome and is affected by multiple factors including transcription and chromatin states. Thus, the overall effect of damages in the genome is primarily driven not by damage formation but by the repair efficiency. The combination of the Damage-seq and XR-seq methods has the potential for developing novel cancer therapeutic strategies. PMID:27688757

  9. Subtyping of Salmonella enterica Subspecies I Using Single-Nucleotide Polymorphisms in Adenylate Cyclase

    PubMed Central

    Abdo, Zaid; Byers, Sara Overstreet; Kriebel, Patrick; Rothrock, Michael J.

    2016-01-01

    Abstract Methods to rapidly identify serotypes of Salmonella enterica subspecies I are of vital importance for protecting the safety of food. To supplement the serotyping method dkgB-linked intergenic sequence ribotyping (ISR), single-nucleotide polymorphisms were characterized within adenylate cyclase (cyaA). The National Center for Biotechnology Information (NCBI) database had 378 cyaA sequences from S. enterica subspecies I, which included 42 unique DNA sequences and 19 different amino acid sequences. Five representative isolates, namely serotypes Typhimurium, Kentucky, Enteritidis phage type PT4, and two variants of Enteritidis phage type PT13a, were differentiated within a microsphere-based fluidics system in cyaA by allele-specific primer extension. Validation against 25 poultry-related environmental Salmonella isolates representing 11 serotypes yielded a ∼89% success rate at identifying the serotype of the isolate, and a different region could be targeted to achieve 100%. When coupled with ISR, all serotypes were differentiated. Phage lineages of serotype Enteritidis 13a and 4 were identified, and a biofilm-forming strain of PT13a was differentiated from a smooth phenotype within phage type. Comparative ranking of mutation indices to genes such as the tRNA transferases, the diguanylate cyclases, and genes used for multilocus sequence typing indicated that cyaA is an appropriate gene for assessing epidemiological trends of Salmonella because of its relative stability in nucleotide composition. PMID:27035032

  10. Single nucleotide polymorphism profiling assay to confirm the identity of human tissues.

    PubMed

    Huijsmans, Ronald; Damen, Jan; van der Linden, Hans; Hermans, Mirjam

    2007-04-01

    To identify issues of sample mix-ups, various molecular techniques are currently used. These techniques, however, are time consuming and require experience and/or DNA sequencing equipment or have a relatively high risk of errors because of contamination. Therefore, a quick and straightforward single nucleotide polymorphism (SNP) profiling assay was developed to link human tissues to a source. SNPs are common sequence variations in the human genome, and each individual has a unique combination of these nucleotide variations. Using potentially mislabeled paraffin-embedded tissues, DNA was extracted and SNP profiles were determined by real-time polymerase chain reaction analysis of the purified DNA using a selection of 10 commercially available SNP amplification assays. These profiles were compared with profiles of the supposed owners. All issues (34 in total) of potential sample mix-ups during the last 3 years were adequately solved, with six cases described here. The SNP profiling assay provides a quick (within 24 hours), easy, and reliable way to link human samples to a source, without polymerase chain reaction postprocessing. The chance for two randomly chosen individuals to have an identical profile is 1 in 18,000. Solving potential sample mix-ups will secure downstream evaluations and critical decisions concerning the patients involved. PMID:17384212

  11. Investigation of single nucleotide polymorphism loci susceptible to degradation by ultraviolet light.

    PubMed

    Machida, Mitsuyo; Taki, Takashi; Shimada, Ryo; Kibayashi, Kazuhiko

    2016-10-01

    DNA in biological fluids is often degraded by environmental factors. Given that single nucleotide polymorphism (SNP) analyses require shorter amplicons than short tandem repeat (STR) analyses do, their use in human identification using degraded samples has recently attracted attention. Although various SNP loci are used to analyze degraded samples, it is unclear which ones are more appropriate. To characterize and identify SNP loci that are susceptible or resistant to degradation, we artificially degraded DNA, obtained from buccal swabs from 11 volunteers, by exposure to ultraviolet (UV) light for different durations (254 nm for 5, 15, 30, 60, or 120 min) and analyzed the resulting SNP loci. DNA degradation was assessed using gel electrophoresis, STR, and SNP profiling. DNA fragmentation occurred within 5 min of UV irradiation, and successful STR and SNP profiling decreased with increasing duration. However, 73% of SNP loci were still detected correctly in DNA samples irradiated for 120 min, a dose that rendered STR loci undetectable. The unsuccessful SNP typing and the base call failure of nucleotides neighboring the SNPs were traced to rs1031825, and we found that this SNP was susceptible to UV light. When comparing the detection efficiencies of STR and SNP loci, SNP typing was more successful than STR typing, making it effective when using degraded DNA. However, it is important to use rs1031825 with caution when interpreting SNP analyses of degraded DNA.

  12. Investigation of single nucleotide polymorphism loci susceptible to degradation by ultraviolet light.

    PubMed

    Machida, Mitsuyo; Taki, Takashi; Shimada, Ryo; Kibayashi, Kazuhiko

    2016-10-01

    DNA in biological fluids is often degraded by environmental factors. Given that single nucleotide polymorphism (SNP) analyses require shorter amplicons than short tandem repeat (STR) analyses do, their use in human identification using degraded samples has recently attracted attention. Although various SNP loci are used to analyze degraded samples, it is unclear which ones are more appropriate. To characterize and identify SNP loci that are susceptible or resistant to degradation, we artificially degraded DNA, obtained from buccal swabs from 11 volunteers, by exposure to ultraviolet (UV) light for different durations (254 nm for 5, 15, 30, 60, or 120 min) and analyzed the resulting SNP loci. DNA degradation was assessed using gel electrophoresis, STR, and SNP profiling. DNA fragmentation occurred within 5 min of UV irradiation, and successful STR and SNP profiling decreased with increasing duration. However, 73% of SNP loci were still detected correctly in DNA samples irradiated for 120 min, a dose that rendered STR loci undetectable. The unsuccessful SNP typing and the base call failure of nucleotides neighboring the SNPs were traced to rs1031825, and we found that this SNP was susceptible to UV light. When comparing the detection efficiencies of STR and SNP loci, SNP typing was more successful than STR typing, making it effective when using degraded DNA. However, it is important to use rs1031825 with caution when interpreting SNP analyses of degraded DNA. PMID:27570235

  13. Distribution of Fitness Effects Caused by Single-Nucleotide Substitutions in Bacteriophage f1

    PubMed Central

    Peris, Joan B.; Davis, Paulina; Cuevas, José M.; Nebot, Miguel R.; Sanjuán, Rafael

    2010-01-01

    Empirical knowledge of the fitness effects of mutations is important for understanding many evolutionary processes, yet this knowledge is often hampered by several sources of measurement error and bias. Most of these problems can be solved using site-directed mutagenesis to engineer single mutations, an approach particularly suited for viruses due to their small genomes. Here, we used this technique to measure the fitness effect of 100 single-nucleotide substitutions in the bacteriophage f1, a filamentous single-strand DNA virus. We found that approximately one-fifth of all mutations are lethal. Viable ones reduced fitness by 11% on average and were accurately described by a log-normal distribution. More than 90% of synonymous substitutions were selectively neutral, while those affecting intergenic regions reduced fitness by 14% on average. Mutations leading to amino acid substitutions had an overall mean deleterious effect of 37%, which increased to 45% for those changing the amino acid polarity. Interestingly, mutations affecting early steps of the infection cycle tended to be more deleterious than those affecting late steps. Finally, we observed at least two beneficial mutations. Our results confirm that high mutational sensitivity is a general property of viruses with small genomes, including RNA and single-strand DNA viruses infecting animals, plants, and bacteria. PMID:20382832

  14. A toll-like receptor 3 single nucleotide polymorphism in Japanese patients with sarcoidosis.

    PubMed

    Ikezoe, K; Handa, T; Tanizawa, K; Kubo, T; Ito, I; Sokai, A; Nakatsuka, Y; Nagai, S; Izumi, T; Mishima, M

    2015-03-01

    Toll-like receptor 3 (TLR3) may be associated with T helper 1 immune response. This study aimed to investigate the role of a functional TLR3 single nucleotide polymorphism (SNP) in sarcoidosis. We genotyped 220 Japanese patients with sarcoidosis and 140 controls for TLR3 SNP rs3775291 to analyze its association with susceptibility to sarcoidosis and assessed its relationship to clinical features in 172 patients over 2 years. The TLR3 rs3775291 genotype was not significantly associated with disease susceptibility. However, patients with cardiac sarcoidosis (CS) significantly more frequently had the TT genotype (p < 0.01) or the T allele (p < 0.05) than those patients without CS. We conclude that TLR3 SNP rs3775291 may affect cardiac involvement in Japanese patients with sarcoidosis.

  15. Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

    PubMed

    Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

    2009-07-14

    In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

  16. Epidemic population structure of extraintestinal pathogenic Escherichia coli determined by single nucleotide polymorphism pyrosequencing.

    PubMed

    Fernández-Romero, Natalia; Romero-Gómez, María Pilar; Gómez-Gil, María Rosa; Mingorance, Jesús

    2011-10-01

    We have developed an MLST-based scheme for typing Escherichia coli isolates using pyrosequencing of single nucleotide polymorphic positions (SNP). The SNP sequences are converted into allelic patterns and analyzed using the same approach used for MLST analyses. We have tested the method in two unselected collections of clinical isolates of E. coli obtained from blood and urine cultures. The two collections had a similar structure, 25% of the profiles (representing 68% of the isolates) were common to both, and 62% of the profiles (nearly 20% of the isolates) were unique. The four major profiles accounted for 44% of the isolates, and among these the most frequent one was related to the pandemic ST131 clone. The method is easy to implement and might be useful for typing large microbial collections. PMID:21723423

  17. Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases.

    PubMed

    Su, Yan; Peter Guengerich, F

    2016-06-01

    Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. © 2016 by John Wiley & Sons, Inc.

  18. Large-scale detection and application of expressed sequence tag single nucleotide polymorphisms in Nicotiana.

    PubMed

    Wang, Y; Zhou, D; Wang, S; Yang, L

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are widespread in the Nicotiana genome. Using an alignment and variation detection method, we developed 20,607,973 SNPs, based on the expressed sequence tag sequences of 10 Nicotiana species. The replacement rate was much higher than the transversion rate in the SNPs, and SNPs widely exist in the Nicotiana. In vitro verification indicated that all of the SNPs were high quality and accurate. Evolutionary relationships between 15 varieties were investigated by polymerase chain reaction with a special primer; the specific 302 locus of these sequence results clearly indicated the origin of Zhongyan 100. A database of Nicotiana SNPs (NSNP) was developed to store and search for SNPs in Nicotiana. NSNP is a tool for researchers to develop SNP markers of sequence data. PMID:26214460

  19. Estimating the genetic variance of major depressive disorder due to all single nucleotide polymorphisms.

    PubMed

    Lubke, Gitta H; Hottenga, Jouke Jan; Walters, Raymond; Laurin, Charles; de Geus, Eco J C; Willemsen, Gonneke; Smit, Jan H; Middeldorp, Christel M; Penninx, Brenda W J H; Vink, Jacqueline M; Boomsma, Dorret I

    2012-10-15

    Genome-wide association studies of psychiatric disorders have been criticized for their lack of explaining a considerable proportion of the heritability established in twin and family studies. Genome-wide association studies of major depressive disorder in particular have so far been unsuccessful in detecting genome-wide significant single nucleotide polymorphisms (SNPs). Using two recently proposed methods designed to estimate the heritability of a phenotype that is attributable to genome-wide SNPs, we show that SNPs on current platforms contain substantial information concerning the additive genetic variance of major depressive disorder. To assess the consistency of these two methods, we analyzed four other complex phenotypes from different domains. The pattern of results is consistent with estimates of heritability obtained in twin studies carried out in the same population.

  20. High-Throughput Sequencing Reveals Single Nucleotide Variants in Longer-Kernel Bread Wheat

    PubMed Central

    Chen, Feng; Zhu, Zibo; Zhou, Xiaobian; Yan, Yan; Dong, Zhongdong; Cui, Dangqun

    2016-01-01

    The transcriptomes of bread wheat Yunong 201 and its ethyl methanesulfonate derivative Yunong 3114 were obtained by next-sequencing technology. Single nucleotide variants (SNVs) in the wheat strains were explored and compared. A total of 5907 and 6287 non-synonymous SNVs were acquired for Yunong 201 and 3114, respectively. A total of 4021 genes with SNVs were obtained. The genes that underwent non-synonymous SNVs were significantly involved in ATP binding, protein phosphorylation, and cellular protein metabolic process. The heat map analysis also indicated that most of these mutant genes were significantly differentially expressed at different developmental stages. The SNVs in these genes possibly contribute to the longer kernel length of Yunong 3114. Our data provide useful information on wheat transcriptome for future studies on wheat functional genomics. This study could also help in illustrating the gene functions of the non-synonymous SNVs of Yunong 201 and 3114. PMID:27551288

  1. Large-scale detection and application of expressed sequence tag single nucleotide polymorphisms in Nicotiana.

    PubMed

    Wang, Y; Zhou, D; Wang, S; Yang, L

    2015-07-14

    Single nucleotide polymorphisms (SNPs) are widespread in the Nicotiana genome. Using an alignment and variation detection method, we developed 20,607,973 SNPs, based on the expressed sequence tag sequences of 10 Nicotiana species. The replacement rate was much higher than the transversion rate in the SNPs, and SNPs widely exist in the Nicotiana. In vitro verification indicated that all of the SNPs were high quality and accurate. Evolutionary relationships between 15 varieties were investigated by polymerase chain reaction with a special primer; the specific 302 locus of these sequence results clearly indicated the origin of Zhongyan 100. A database of Nicotiana SNPs (NSNP) was developed to store and search for SNPs in Nicotiana. NSNP is a tool for researchers to develop SNP markers of sequence data.

  2. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori

  3. A functional single nucleotide polymorphism of SET8 is prognostic for breast cancer.

    PubMed

    Liu, Ben; Zhang, Xining; Song, Fengju; Liu, Qun; Dai, Hongji; Zheng, Hong; Cui, Ping; Zhang, Lina; Zhang, Wei; Chen, Kexin

    2016-06-01

    A single-nucleotide polymorphism (SNP) locus rs16917496 (T > C) within the 3'-untranslated region (3'-UTR) of SET8 was associated with susceptibility in several malignancies including breast cancer. To further elucidate the prognostic relevance of this SNP in breast cancer, we conducted a clinical study as well as SET8 expression analysis in a cohort of 1,190 breast cancer patients. We demonstrated the expression levels of SET8 in TT genotype were higher than in CC genotypes, and high levels of SET8 were associated with poor survival. SET8 expression was significantly higher in breast tumor tissue than in paired adjacent normal tissue. In addition, survival analysis in 315 patients showed SNP rs16917496 was an independent prognostic factor of breast cancer outcome with TT genotype associated with poor survival compared with CC/CT genotypes. Thus, this SNP may serve as a genetic prognostic factor and a treatment target for breast cancer. Future studies are warranted.

  4. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

    2015-01-01

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  5. High-Throughput Sequencing Reveals Single Nucleotide Variants in Longer-Kernel Bread Wheat.

    PubMed

    Chen, Feng; Zhu, Zibo; Zhou, Xiaobian; Yan, Yan; Dong, Zhongdong; Cui, Dangqun

    2016-01-01

    The transcriptomes of bread wheat Yunong 201 and its ethyl methanesulfonate derivative Yunong 3114 were obtained by next-sequencing technology. Single nucleotide variants (SNVs) in the wheat strains were explored and compared. A total of 5907 and 6287 non-synonymous SNVs were acquired for Yunong 201 and 3114, respectively. A total of 4021 genes with SNVs were obtained. The genes that underwent non-synonymous SNVs were significantly involved in ATP binding, protein phosphorylation, and cellular protein metabolic process. The heat map analysis also indicated that most of these mutant genes were significantly differentially expressed at different developmental stages. The SNVs in these genes possibly contribute to the longer kernel length of Yunong 3114. Our data provide useful information on wheat transcriptome for future studies on wheat functional genomics. This study could also help in illustrating the gene functions of the non-synonymous SNVs of Yunong 201 and 3114. PMID:27551288

  6. Plasmonics nanoprobes: detection of single-nucleotide polymorphisms in the breast cancer BRCA1 gene.

    PubMed

    Wabuyele, Musundi B; Yan, Fei; Vo-Dinh, Tuan

    2010-09-01

    This paper describes the application of plasmonics-based nanoprobes that combine the modulation of the plasmonics effect to change the surface-enhanced Raman scattering (SERS) of a Raman label and the specificity of a DNA hairpin loop sequence to recognize and discriminate a variety of molecular target sequences. Hybridization with target DNA opens the hairpin and physically separates the Raman label from the metal nanoparticle thus reducing the plasmonics effect and quenching the SERS signal of the label. We have successfully demonstrated the specificity and selectivity of the nanoprobes in the detection of a single-nucleotide polymorphism (SNP) in the breast cancer BRCA1 gene in a homogenous solution at room temperature. In addition, the potential application of plasmonics nanoprobes for quantitative DNA diagnostic testing is discussed.

  7. PupaSuite: finding functional single nucleotide polymorphisms for large-scale genotyping purposes.

    PubMed

    Conde, Lucía; Vaquerizas, Juan M; Dopazo, Hernán; Arbiza, Leonardo; Reumers, Joke; Rousseau, Frederic; Schymkowitz, Joost; Dopazo, Joaquín

    2006-07-01

    We have developed a web tool, PupaSuite, for the selection of single nucleotide polymorphisms (SNPs) with potential phenotypic effect, specifically oriented to help in the design of large-scale genotyping projects. PupaSuite uses a collection of data on SNPs from heterogeneous sources and a large number of pre-calculated predictions to offer a flexible and intuitive interface for selecting an optimal set of SNPs. It improves the functionality of PupaSNP and PupasView programs and implements new facilities such as the analysis of user's data to derive haplotypes with functional information. A new estimator of putative effect of polymorphisms has been included that uses evolutionary information. Also SNPeffect database predictions have been included. The PupaSuite web interface is accessible through http://pupasuite.bioinfo.cipf.es and through http://www.pupasnp.org.

  8. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.

    PubMed

    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T

    2016-03-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  9. Role of single nucleotide polymorphisms in pharmacogenomics and their association with human diseases.

    PubMed

    Chaudhary, Renu; Singh, Bharat; Kumar, Manish; Gakhar, Surendra K; Saini, Adesh K; Parmar, Virinder S; Chhillar, Anil K

    2015-08-01

    Global statistical data shed light on an alarming trend that every year thousands of people die due to adverse drug reactions as each individual responds in a different way to the same drug. Pharmacogenomics has come up as a promising field in drug development and clinical medication in the past few decades. It has emerged as a ray of hope in preventing patients from developing potentially fatal complications due to adverse drug reactions. Pharmacogenomics also minimizes the exposure to drugs that are less/non-effective and sometimes even found toxic for patients. It is well reported that drugs elicit different responses in different individuals due to variations in the nucleotide sequences of genes encoding for biologically important molecules (drug-metabolizing enzymes, drug targets and drug transporters). Single nucleotide polymorphisms (SNPs), the most common type of polymorphism found in the human genome is believed to be the main reason behind 90% of all types of genetic variations among the individuals. Therefore, pharmacogenomics may be helpful in answering the question as to how inherited differences in a single gene have a profound effect on the mobilization and biological action of a drug. In the present review, we have discussed clinically relevant examples of SNP in associated diseases that can be utilized as markers for "better management of complex diseases" and attempted to correlate the drug response with genetic variations. Attention is also given towards the therapeutic consequences of inherited differences at the chromosomal level and how associated drug disposition and/or drug targets differ in various diseases as well as among the individuals. PMID:25996670

  10. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.

    PubMed

    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T

    2016-03-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity.

  11. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene

    PubMed Central

    Pruthviraj, D. R.; Usha, A. P.; Venkatachalapathy, R. T.

    2016-01-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5′-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  12. Generation of DNA single-strand displacement by compromised nucleotide excision repair

    PubMed Central

    Godon, Camille; Mourgues, Sophie; Nonnekens, Julie; Mourcet, Amandine; Coin, Fréderic; Vermeulen, Wim; Mari, Pierre-Olivier; Giglia-Mari, Giuseppina

    2012-01-01

    Nucleotide excision repair (NER) is a precisely coordinated process essential to avoid DNA damage-induced cellular malfunction and mutagenesis. Here, we investigate the mechanistic details and effects of the NER machinery when it is compromised by a pathologically significant mutation in a subunit of the repair/transcription factor TFIIH, namely XPD. In contrast to previous studies, we find that no single- or double-strand DNA breaks are produced at early time points after UV irradiation of cells bearing a specific XPD mutation, despite the presence of a clear histone H2AX phosphorylation (γH2AX) signal in the UV-exposed areas. We show that the observed γH2AX signal can be explained by the presence of longer single-strand gaps possibly generated by strand displacement. Our in vivo measurements also indicate a strongly reduced TFIIH-XPG binding that could promote single-strand displacement at the site of UV lesions. This finding not only highlights the crucial role of XPG's interactions with TFIIH for proper NER, but also sheds new light on how a faulty DNA repair process can induce extreme genomic instability in human patients. PMID:22863773

  13. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  14. Kelvin probe force microscopy of DNA-capped nanoparticles for single-nucleotide polymorphism detection

    NASA Astrophysics Data System (ADS)

    Lee, Hyungbeen; Lee, Sang Won; Lee, Gyudo; Lee, Wonseok; Lee, Jeong Hoon; Hwang, Kyo Seon; Yang, Jaemoon; Lee, Sang Woo; Yoon, Dae Sung

    2016-07-01

    Kelvin probe force microscopy (KPFM) is a robust toolkit for profiling the surface potential (SP) of biomolecular interactions between DNAs and/or proteins at the single molecule level. However, it has often suffered from background noise and low throughput due to instrumental or environmental constraints, which is regarded as limiting KPFM applications for detection of minute changes in the molecular structures such as single-nucleotide polymorphism (SNP). Here, we show KPFM imaging of DNA-capped nanoparticles (DCNP) that enables SNP detection of the BRCA1 gene owing to sterically well-adjusted DNA-DNA interactions that take place within the confined spaces of DCNP. The average SP values of DCNP interacting with BRCA1 SNP were found to be lower than the DCNP reacting with normal (non-mutant) BRCA1 gene. We also demonstrate that SP characteristics of DCNP with different substrates (e.g., Au, Si, SiO2, and Fe) provide us with a chance to attenuate or augment the SP signal of DCNP without additional enhancement of instrumentation capabilities.Kelvin probe force microscopy (KPFM) is a robust toolkit for profiling the surface potential (SP) of biomolecular interactions between DNAs and/or proteins at the single molecule level. However, it has often suffered from background noise and low throughput due to instrumental or environmental constraints, which is regarded as limiting KPFM applications for detection of minute changes in the molecular structures such as single-nucleotide polymorphism (SNP). Here, we show KPFM imaging of DNA-capped nanoparticles (DCNP) that enables SNP detection of the BRCA1 gene owing to sterically well-adjusted DNA-DNA interactions that take place within the confined spaces of DCNP. The average SP values of DCNP interacting with BRCA1 SNP were found to be lower than the DCNP reacting with normal (non-mutant) BRCA1 gene. We also demonstrate that SP characteristics of DCNP with different substrates (e.g., Au, Si, SiO2, and Fe) provide us with a

  15. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    PubMed Central

    2013-01-01

    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different

  16. On-chip detection of a single nucleotide polymorphism without polymerase amplification

    PubMed Central

    Han, Jinhee; Tan, Matthew; Sudheendra, Lakshmana; Weiss, Robert H.; Kennedy, Ian M.

    2014-01-01

    A nanoparticle-assembled photonic crystal (PC) array was used to detect single nucleotide polymorphism (SNP). The assay platform with PC nanostructure enhanced the fluorescent signal from nanoparticle-hybridized DNA complexes due to phase matching of excitation and emission. Nanoparticles coupled with probe DNA were trapped into nanowells in an array by using an electrophoretic particle entrapment system. The PC/DNA assay platform was able to identify a 1 base pair (bp) difference in synthesized nucleotide sequences that mimicked the mutation seen in a feline model of human autosomal dominant polycystic kidney disease (PKD) with a sensitivity of 0.9 fg/mL (50 aM)-sensitivity, which corresponds to 30 oligos/array. The reliability of the PC/DNA assay platform to detect SNP in a real sample was demonstrated by using genomic DNA (gDNA) extracted from the urine and blood of two PKD− wild type and three PKD positive cats. The standard curves for PKD positive (PKD+) and negative (PKD−) DNA were created using two feline-urine samples. An additional three urine samples were analyzed in a similar fashion and showed satisfactory agreement with the standard curve, confirming the presence of the mutation in affected urine. The limit of detection (LOD) was 0.005 ng/mL which corresponds to 6 fg per array for gDNA in urine and blood. The PC system demonstrated the ability to detect a number of genome equivalents for the PKD SNP that was very similar to the results reported with real time polymerase chain reaction (PCR). The favorable comparison with quantitative PCR suggests that the PC technology may find application well beyond the detection of the PKD SNP, into areas where a simple, cheap and portable nucleic acid analysis is desirable. PMID:25580203

  17. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm

    PubMed Central

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  18. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

    PubMed

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  19. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma

    PubMed Central

    2010-01-01

    Backgroud Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. Methods The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. Results The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Conclusion Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome. PMID:21110870

  20. Assessment of Linkage Disequilibrium in Potato Genome With Single Nucleotide Polymorphism Markers

    PubMed Central

    Simko, Ivan; Haynes, Kathleen G.; Jones, Richard W.

    2006-01-01

    The extent of linkage disequilibrium (LD) is an important factor in designing association mapping experiments. Unlike other plant species that have been analyzed so far for the extent of LD, cultivated potato (Solanum tuberosum L.), an outcrossing species, is a highly heterozygous autotetraploid. The favored genotypes of modern cultivars are maintained by vegetative propagation through tubers. As a first step in the LD analysis, we surveyed both coding and noncoding regions of 66 DNA fragments from 47 accessions for single nucleotide polymorphism (SNP). In the process, we combined information from the potato SNP database with experimental SNP detection. The total length of all analyzed fragments was >25 kb, and the number of screened sequence bases reached almost 1.4 million. Average nucleotide polymorphism (θ = 11.5 × 10−3) and diversity (π = 14.6 × 10−3) was high compared to the other plant species. The overall Tajima's D value (0.5) was not significant, but indicates a deficit of low-frequency alleles relative to expectation. To eliminate the possibility that an elevated D value occurs due to population subdivision, we assessed the population structure with probabilistic statistics. The analysis did not reveal any significant subdivision, indicating a relatively homogenous population structure. However, the analysis of individual fragments revealed the presence of subgroups in the fragment closely linked to the R1 resistance gene. Data pooled from all fragments show relatively fast decay of LD in the short range (r2 = 0.208 at 1 kb) but slow decay afterward (r2 = 0.137 at ∼70 kb). The estimate from our data indicates that LD in potato declines below 0.10 at a distance of ∼10 cM. We speculate that two conflicting factors play a vital role in shaping LD in potato: the outcrossing mating type and the very limited number of meiotic generations. PMID:16783002

  1. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

    PubMed

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  2. The distribution of fitness effects caused by single-nucleotide substitutions in an RNA virus

    PubMed Central

    Sanjuán, Rafael; Moya, Andrés; Elena, Santiago F.

    2004-01-01

    Little is known about the mutational fitness effects associated with single-nucleotide substitutions on RNA viral genomes. Here, we used site-directed mutagenesis to create 91 single mutant clones of vesicular stomatitis virus derived from a common ancestral cDNA and performed competition experiments to measure the relative fitness of each mutant. The distribution of nonlethal deleterious effects was highly skewed and had a long, flat tail. As expected, fitness effects depended on whether mutations were chosen at random or reproduced previously described ones. The effect of random deleterious mutations was well described by a log-normal distribution, with -19% reduction of average fitness; the effects distribution of preobserved deleterious mutations was better explained by a β model. The fit of both models was improved when combined with a uniform distribution. Up to 40% of random mutations were lethal. The proportion of beneficial mutations was unexpectedly high. Beneficial effects followed a γ distribution, with expected fitness increases of 1% for random mutations and 5% for preobserved mutations. PMID:15159545

  3. A single natural nucleotide mutation alters bacterial pathogen host-tropism

    PubMed Central

    Ward, Melissa J.; Selva, Laura; Guinane, Caitriona M.; González-Muñoz, Beatriz M.; Tristan, Anne; Foster, Simon J; Fitzgerald, J. Ross; Penadés, José R.

    2015-01-01

    The capacity of microbial pathogens to alter their host-tropism leading to epidemics in distinct host-species populations is a global public and veterinary health concern. In order to investigate the molecular basis of a bacterial host-switching event in a tractable host-species, we traced the evolutionary trajectory of the common rabbit clone of Staphylococcus aureus. We report that it evolved through a likely human-to-rabbit host jump over 40 years ago, and that only a single natural nucleotide mutation was required and sufficient to convert a human-specific S. aureus strain into one which could infect rabbits. Related mutations were identified at the same locus in other rabbit strains of distinct clonal origin, consistent with convergent evolution. This first report of a single mutation that was sufficient to alter the host-tropism of a micro-organism during its evolution highlights the capacity of some pathogens to readily expand into novel host-species populations. PMID:25685890

  4. Methods for human demographic inference using haplotype patterns from genomewide single-nucleotide polymorphism data.

    PubMed

    Lohmueller, Kirk E; Bustamante, Carlos D; Clark, Andrew G

    2009-05-01

    We propose a novel approximate-likelihood method to fit demographic models to human genomewide single-nucleotide polymorphism (SNP) data. We divide the genome into windows of constant genetic map width and then tabulate the number of distinct haplotypes and the frequency of the most common haplotype for each window. We summarize the data by the genomewide joint distribution of these two statistics-termed the HCN statistic. Coalescent simulations are used to generate the expected HCN statistic for different demographic parameters. The HCN statistic provides additional information for disentangling complex demography beyond statistics based on single-SNP frequencies. Application of our method to simulated data shows it can reliably infer parameters from growth and bottleneck models, even in the presence of recombination hotspots when properly modeled. We also examined how practical problems with genomewide data sets, such as errors in the genetic map, haplotype phase uncertainty, and SNP ascertainment bias, affect our method. Several modifications of our method served to make it robust to these problems. We have applied our method to data collected by Perlegen Sciences and find evidence for a severe population size reduction in northwestern Europe starting 32,500-47,500 years ago.

  5. Comparison of Sequencing Platforms for Single Nucleotide Variant Calls in a Human Sample

    PubMed Central

    Miller, Webb; Guillory, Joseph; Stinson, Jeremy; Seshagiri, Somasekar

    2013-01-01

    Next-generation sequencings platforms coupled with advanced bioinformatic tools enable re-sequencing of the human genome at high-speed and large cost savings. We compare sequencing platforms from Roche/454(GS FLX), Illumina/HiSeq (HiSeq 2000), and Life Technologies/SOLiD (SOLiD 3 ECC) for their ability to identify single nucleotide substitutions in whole genome sequences from the same human sample. We report on significant GC-related bias observed in the data sequenced on Illumina and SOLiD platforms. The differences in the variant calls were investigated with regards to coverage, and sequencing error. Some of the variants called by only one or two of the platforms were experimentally tested using mass spectrometry; a method that is independent of DNA sequencing. We establish several causes why variants remained unreported, specific to each platform. We report the indel called using the three sequencing technologies and from the obtained results we conclude that sequencing human genomes with more than a single platform and multiple libraries is beneficial when high level of accuracy is required. PMID:23405114

  6. High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification

    PubMed Central

    Faruqi, A Fawad; Hosono, Seiyu; Driscoll, Mark D; Dean, Frank B; Alsmadi, Osama; Bandaru, Rajanikanta; Kumar, Gyanendra; Grimwade, Brian; Zong, Qiuling; Sun, Zhenyu; Du, Yuefen; Kingsmore, Stephen; Knott, Tim; Lasken, Roger S

    2001-01-01

    Background Single nucleotide polymorphisms (SNPs) are the foundation of powerful complex trait and pharmacogenomic analyses. The availability of large SNP databases, however, has emphasized a need for inexpensive SNP genotyping methods of commensurate simplicity, robustness, and scalability. We describe a solution-based, microtiter plate method for SNP genotyping of human genomic DNA. The method is based upon allele discrimination by ligation of open circle probes followed by rolling circle amplification of the signal using fluorescent primers. Only the probe with a 3' base complementary to the SNP is circularized by ligation. Results SNP scoring by ligation was optimized to a 100,000 fold discrimination against probe mismatched to the SNP. The assay was used to genotype 10 SNPs from a set of 192 genomic DNA samples in a high-throughput format. Assay directly from genomic DNA eliminates the need to preamplify the target as done for many other genotyping methods. The sensitivity of the assay was demonstrated by genotyping from 1 ng of genomic DNA. We demonstrate that the assay can detect a single molecule of the circularized probe. Conclusions Compatibility with homogeneous formats and the ability to assay small amounts of genomic DNA meets the exacting requirements of automated, high-throughput SNP scoring. PMID:11511324

  7. Novel biosensing methodologies for improving the detection of single nucleotide polymorphism.

    PubMed

    Chang, Kai; Deng, Shaoli; Chen, Ming

    2015-04-15

    The growing volume of sequence data confirm more and more candidate single nucleotide polymorphisms (SNPs), which are believed to reveal the genetic basis of individual susceptibility to disease and the diverse responses to treatment. There is therefore an urgent demand for developing the sensitive, rapid, easy-to-use, and cost-effective method to identify SNPs. During the last two decades, biosensing techniques have been developed by integrating the unique specificity of biological reactions and the high sensitivity of physical sensors, which provided significant advantages for the detection of SNPs. In this feature article, we focused attention on the strategies of SNP genotyping based on biosensors, including nucleic acid analogs, surface ligation reaction, single base extension, mismatch binding protein, molecular beacon, rolling circle amplification, and strand-displacement amplification. In addition, the perspectives on their advantages, current limitations, and future trends were also discussed. The biosensing technique would provide a promising alternative for the detection of SNPs, and pave the way for the diagnosis of genetic diseases and the design of appropriate treatments.

  8. Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

    2010-12-01

    Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

  9. Single Nucleotide Polymorphism Array Genotyping is Equivalent to Metaphase Cytogenetics for Diagnosis of Turner Syndrome

    PubMed Central

    Prakash, Siddharth; Guo, Dongchuan; Maslen, Cheryl L.; Silberbach, Michael; Investigators, GenTAC; Milewicz, Dianna; Bondy, Carolyn A.

    2013-01-01

    Background Turner syndrome (TS) is a developmental disorder caused by partial or complete monosomy for the X chromosome in 1:2500 females. We hypothesized that single nucleotide polymorphism (SNP) array genotyping can provide superior resolution in comparison to metaphase karyotype analysis to facilitate genotype-phenotype correlations. Methods We genotyped 187 TS patients with 733,000 SNP marker arrays. All cases met diagnostic criteria for TS based on karyotypes (60%) or characteristic physical features. SNP array results confirmed the diagnosis of TS in 100% of cases. Results We identified a single X chromosome (45,X) in 113 cases. In 58 additional cases (31%), other mosaic cell lines were present including isochromosomes (16%), rings (5%) and Xp deletions (8%). The remaining cases were mosaic for monosomy X and normal male or female cell lines. Array-based models of X chromosome structure were compatible with karyotypes in 104 of 116 comparable cases (90%). We found that SNP array data did not detect X;autosome translocations (3 cases), but did identify 2 derivative Y chromosomes and 13 large copy number variants that were not detected by karyotyping. Conclusions Our data is the first systematic comparison between the two methods and supports the utility of SNP array genotyping to address clinical and research questions in TS. PMID:23743550

  10. A single-nucleotide substitution mutator phenotype revealed by exome sequencing of human colon adenomas.

    PubMed

    Nikolaev, Sergey I; Sotiriou, Sotirios K; Pateras, Ioannis S; Santoni, Federico; Sougioultzis, Stavros; Edgren, Henrik; Almusa, Henrikki; Robyr, Daniel; Guipponi, Michel; Saarela, Janna; Gorgoulis, Vassilis G; Antonarakis, Stylianos E; Halazonetis, Thanos D

    2012-12-01

    Oncogene-induced DNA replication stress is thought to drive genomic instability in cancer. In particular, replication stress can explain the high prevalence of focal genomic deletions mapping within very large genes in human tumors. However, the origin of single-nucleotide substitutions (SNS) in nonfamilial cancers is strongly debated. Some argue that cancers have a mutator phenotype, whereas others argue that the normal DNA replication error rates are sufficient to explain the number of observed SNSs. Here, we sequenced the exomes of 24, mostly precancerous, colon polyps. Analysis of the sequences revealed mutations in the APC, CTNNB1, and BRAF genes as the presumptive cancer-initiating events and many passenger SNSs. We used the number of SNSs in the various lesions to calculate mutation rates for normal colon and adenomas and found that colon adenomas exhibit a mutator phenotype. Interestingly, the SNSs in the adenomas mapped more often than expected within very large genes, where focal deletions in response to DNA replication stress also map. We propose that single-stranded DNA generated in response to oncogene-induced replication stress compromises the repair of deaminated cytosines and other damaged bases, leading to the observed SNS mutator phenotype.

  11. Wireless electrochemiluminescence bipolar electrode array for visualized genotyping of single nucleotide polymorphism.

    PubMed

    Khoshfetrat, Seyyed Mehdi; Ranjbari, Mitra; Shayan, Mohsen; Mehrgardi, Masoud A; Kiani, Abolfazl

    2015-08-18

    The development of simple, inexpensive, hand-held, user-friendly biosensor for high throughput and multiplexed genotyping of various single nucleotide polymorphisms (SNPs) in a single run experiment by a nonspecialist user is the main challenge in the analysis of DNA. Visualizing the signal and possibility to monitor SNPs by a digital camera opens a new horizon for the routine applications. In the present manuscript, a novel wireless electrochemiluminescence (ECL) DNA array is introduced for the visualized genotyping of different SNPs on the basis of ECL of luminol/hydrogen peroxide system on a bipolar electrode (BPE) array platform. After modification of anodic poles of the array with the DNA probe and its hybridization with the targets, genotyping of various SNPs is carried out by exposing the array to different monobase modified luminol-platinum nanoparticles (M-L-PtNPs). Upon the hybridization of M-L-PtNPs to mismatch sites, the ECL of luminol is followed using a photomultiplier tube (PMT) or digital camera and the images are analyzed by ImageJ software. This biosensor can detect even thermodynamically stable SNP (G-T mismatches) in the range of 2-600 pM. Also, by combining the advantages of BPE and the high visual sensitivity of ECL, it could be easily expected to achieve sensitive screening of different SNPs. The present biosensor demonstrates the capability for the discrimination between PCR products of normal, heterozygous, and homozygous beta thalassemia genetic disorders. PMID:26176414

  12. Digital camera and smartphone as detectors in paper-based chemiluminometric genotyping of single nucleotide polymorphisms.

    PubMed

    Spyrou, Elena M; Kalogianni, Despina P; Tragoulias, Sotirios S; Ioannou, Penelope C; Christopoulos, Theodore K

    2016-10-01

    Chemi(bio)luminometric assays have contributed greatly to various areas of nucleic acid analysis due to their simplicity and detectability. In this work, we present the development of chemiluminometric genotyping methods in which (a) detection is performed by using either a conventional digital camera (at ambient temperature) or a smartphone and (b) a lateral flow assay configuration is employed for even higher simplicity and suitability for point of care or field testing. The genotyping of the C677T single nucleotide polymorphism (SNP) of methylenetetrahydropholate reductase (MTHFR) gene is chosen as a model. The interrogated DNA sequence is amplified by polymerase chain reaction (PCR) followed by a primer extension reaction. The reaction products are captured through hybridization on the sensing areas (spots) of the strip. Streptavidin-horseradish peroxidase conjugate is used as a reporter along with a chemiluminogenic substrate. Detection of the emerging chemiluminescence from the sensing areas of the strip is achieved by digital camera or smartphone. For this purpose, we constructed a 3D-printed smartphone attachment that houses inexpensive lenses and converts the smartphone into a portable chemiluminescence imager. The device enables spatial discrimination of the two alleles of a SNP in a single shot by imaging of the strip, thus avoiding the need of dual labeling. The method was applied successfully to genotyping of real clinical samples. Graphical abstract Paper-based genotyping assays using digital camera and smartphone as detectors.

  13. Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.

    PubMed

    Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio

    2014-02-15

    A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained.

  14. Linkage Disequilibrium Mapping via Cladistic Analysis of Single-Nucleotide Polymorphism Haplotypes

    PubMed Central

    Durrant, Caroline; Zondervan, Krina T.; Cardon, Lon R.; Hunt, Sarah; Deloukas, Panos; Morris, Andrew P.

    2004-01-01

    We present a novel approach to disease-gene mapping via cladistic analysis of single-nucleotide polymorphism (SNP) haplotypes obtained from large-scale, population-based association studies, applicable to whole-genome screens, candidate-gene studies, or fine-scale mapping. Clades of haplotypes are tested for association with disease, exploiting the expected similarity of chromosomes with recent shared ancestry in the region flanking the disease gene. The method is developed in a logistic-regression framework and can easily incorporate covariates such as environmental risk factors or additional unlinked loci to allow for population structure. To evaluate the power of this approach to detect disease-marker association, we have developed a simulation algorithm to generate high-density SNP data with short-range linkage disequilibrium based on empirical patterns of haplotype diversity. The results of the simulation study highlight substantial gains in power over single-locus tests for a wide range of disease models, despite overcorrection for multiple testing. PMID:15148658

  15. Linkage disequilibrium mapping via cladistic analysis of single-nucleotide polymorphism haplotypes.

    PubMed

    Durrant, Caroline; Zondervan, Krina T; Cardon, Lon R; Hunt, Sarah; Deloukas, Panos; Morris, Andrew P

    2004-07-01

    We present a novel approach to disease-gene mapping via cladistic analysis of single-nucleotide polymorphism (SNP) haplotypes obtained from large-scale, population-based association studies, applicable to whole-genome screens, candidate-gene studies, or fine-scale mapping. Clades of haplotypes are tested for association with disease, exploiting the expected similarity of chromosomes with recent shared ancestry in the region flanking the disease gene. The method is developed in a logistic-regression framework and can easily incorporate covariates such as environmental risk factors or additional unlinked loci to allow for population structure. To evaluate the power of this approach to detect disease-marker association, we have developed a simulation algorithm to generate high-density SNP data with short-range linkage disequilibrium based on empirical patterns of haplotype diversity. The results of the simulation study highlight substantial gains in power over single-locus tests for a wide range of disease models, despite overcorrection for multiple testing.

  16. Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.

    PubMed

    Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio

    2014-02-15

    A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. PMID:24128588

  17. Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detection.

    PubMed

    Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon Alex; Lu, Yen-Wen

    2014-11-01

    A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production.

  18. Phylogenetic discovery bias in Bacillus anthracis using single-nucleotide polymorphisms from whole-genome sequencing

    PubMed Central

    Pearson, Talima; Busch, Joseph D.; Ravel, Jacques; Read, Timothy D.; Rhoton, Shane D.; U'Ren, Jana M.; Simonson, Tatum S.; Kachur, Sergey M.; Leadem, Rebecca R.; Cardon, Michelle L.; Van Ert, Matthew N.; Huynh, Lynn Y.; Fraser, Claire M.; Keim, Paul

    2004-01-01

    Phylogenetic reconstruction using molecular data is often subject to homoplasy, leading to inaccurate conclusions about phylogenetic relationships among operational taxonomic units. Compared with other molecular markers, single-nucleotide polymorphisms (SNPs) exhibit extremely low mutation rates, making them rare in recently emerged pathogens, but they are less prone to homoplasy and thus extremely valuable for phylogenetic analyses. Despite their phylogenetic potential, ascertainment bias occurs when SNP characters are discovered through biased taxonomic sampling; by using whole-genome comparisons of five diverse strains of Bacillus anthracis to facilitate SNP discovery, we show that only polymorphisms lying along the evolutionary pathway between reference strains will be observed. We illustrate this in theoretical and simulated data sets in which complex phylogenetic topologies are reduced to linear evolutionary models. Using a set of 990 SNP markers, we also show how divergent branches in our topologies collapse to single points but provide accurate information on internodal distances and points of origin for ancestral clades. These data allowed us to determine the ancestral root of B. anthracis, showing that it lies closer to a newly described “C” branch than to either of two previously described “A” or “B” branches. In addition, subclade rooting of the C branch revealed unequal evolutionary rates that seem to be correlated with ecological parameters and strain attributes. Our use of nonhomoplastic whole-genome SNP characters allows branch points and clade membership to be estimated with great precision, providing greater insight into epidemiological, ecological, and forensic questions. PMID:15347815

  19. Comparison of sequencing platforms for single nucleotide variant calls in a human sample.

    PubMed

    Ratan, Aakrosh; Miller, Webb; Guillory, Joseph; Stinson, Jeremy; Seshagiri, Somasekar; Schuster, Stephan C

    2013-01-01

    Next-generation sequencings platforms coupled with advanced bioinformatic tools enable re-sequencing of the human genome at high-speed and large cost savings. We compare sequencing platforms from Roche/454(GS FLX), Illumina/HiSeq (HiSeq 2000), and Life Technologies/SOLiD (SOLiD 3 ECC) for their ability to identify single nucleotide substitutions in whole genome sequences from the same human sample. We report on significant GC-related bias observed in the data sequenced on Illumina and SOLiD platforms. The differences in the variant calls were investigated with regards to coverage, and sequencing error. Some of the variants called by only one or two of the platforms were experimentally tested using mass spectrometry; a method that is independent of DNA sequencing. We establish several causes why variants remained unreported, specific to each platform. We report the indel called using the three sequencing technologies and from the obtained results we conclude that sequencing human genomes with more than a single platform and multiple libraries is beneficial when high level of accuracy is required.

  20. A single nucleotide polymorphism and sequence analysis of CSN1S1 gene promoter region in Chinese Bos grunniens (yak).

    PubMed

    Bai, W L; Yin, R H; Dou, Q L; Yang, J C; Zhao, S J; Ma, Z J; Yin, R L; Luo, G B; Zhao, Z H

    2010-01-01

    The aim of this study was to investigate the polymorphism of the CSN1S1 gene promoter region in 4 Chinese yak breeds, and compare the yak CSN1S1 gene promoter region sequences with other ruminants. A Polymerase Chain Reaction-Single Strand Conformation Polymorphism protocol was developed for rapid genotyping of the yak CSN1S1 gene. One hundred fifty-eight animals from 4 Chinese yak breeds were genotyped at the CSN1S1 locus using the protocol developed. A single nucleotide polymorphism of the CSN1S1 gene promoter region has been identified in all yak breeds investigated. The polymorphism consists of a single nucleotide substitution G-->A at position 386 of the CSN1S1 gene promoter region, resulting in two alleles named, respectively, G(386) and A(386), based on the nucleotide at position 386. The allele G(386) was found to be more common in the animals investigated. The corresponding nucleotide sequences in GenBank of yak (having the same nucleotides as allele G(386) in this study), bovine, water buffalo, sheep, and goat had similarity of 99.68%, 99.35%, 97.42%, 95.14%, and 94.19%, respectively, with the yak allele A(386.).

  1. Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle

    PubMed Central

    2013-01-01

    Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet

  2. Fluorescence detection of single-nucleotide polymorphisms using a thymidine-based molecular beacon.

    PubMed

    Liu, Chi-Wei; Lin, Yang-Wei; Huang, Chih-Ching; Chang, Huan-Tsung

    2009-04-15

    We have developed a universal molecular beacon (T(7)-MB-T(7)) for the detection of single-nucleotide polymorphisms (SNPs). The beacon, which contains a 19-mer loop and a stem comprising a pair of seven thymidine (T) bases, forms double-stranded structures with target DNA molecules, leading to increases in the fluorescence of ethidium bromide (EthBr) as a result of intercalation. The interactions of the beacon with perfectly matched (DNA(pm)) and single-base mismatched (DNA(mm)) DNA strands are stronger and weaker, respectively, than those with Hg(2+) ions. As a result, the fluorescence of a solution containing T(7)-MB-T(7), DNA(pm), EthBr, and Hg(2+) is higher than that of a corresponding solution containing T(7)-MB-T(7), DNA(mm), EthBr, and Hg(2+), because the former has a greater number of intercalation sites for EthBr. Under the optimal conditions (100 nM T(7)-MB-T(7), 20 mM NaCl, 5.0 microM Hg(2+), and 300 nM EthBr in 5.0 mM Tris-HCl solution, pH 7.4), the plot of the fluorescence intensity against the concentration of DNA(pm) was linear over the range 5.0-100 nM (R(2)=0.98). A similar probe, T(7)-MB(t)-T(7), is sensitive and selective for the detection of a gene associated with hereditary tyrosinemia type I. Relative to conventional MBs, our new probe offers the advantages of higher selectivity toward DNA, less nonspecific binding toward single-stranded-DNA-binding protein, greater resistance to nuclease digestion, and low cost; therefore, we suspect that this system holds great potential for practical studies of SNPs.

  3. Assessing the association of single nucleotide polymorphisms at the thyroglobulin gene with carcass traits in beef cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this study was to assess the association of single nucleotide polymorphisms in the thyroglobulin gene, including a previously reported marker in current industry use, with marbling score in beef cattle. Three populations, designated GPE6, GPE7, and GPE8, were studied. The GPE6 pop...

  4. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  5. Comparison of single nucleotide polymorphisms and simple sequence repeats in genotype identification and diversity assessment of cacao germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Accurate identification of individual genotypes in an efficient manner is especially important for cacao (Theobroma cacao L.) germplasm conservation and breeding. The development of single nucleotide polymorphism (SNP) markers in cacao offers the opportunity to use a high throughput genotyping syste...

  6. A high-density simple sequence repeat and single nucleotide polymorphism genetic map of the tetraploid cotton genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton genome complexity was investigated with a saturated molecular genetic map that combined several sets of microsatellites or simple sequence repeats (SSR) and the first major public set of single nucleotide polymorphism (SNP) markers in cotton genomes (Gossypium spp.), and that was constructed ...

  7. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  8. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  9. Detection of single-nucleotide variations by monitoring the blinking of fluorescence induced by charge transfer in DNA.

    PubMed

    Kawai, Kiyohiko; Majima, Tetsuro; Maruyama, Atsushi

    2013-08-19

    Charge transfer dynamics in DNA: Photo-induced charge separation and charge-recombination dynamics in DNA was assessed by monitoring the blinking of fluorescence. Single nucleotide variations, mismatch and one base deletion, were differentiated based on the length of the off-time of the blinking, which corresponds to the lifetime of the charge-separated state. PMID:23846860

  10. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    SciTech Connect

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A. . E-mail: BELL1@niehs.nih.gov

    2005-09-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes.

  11. Single nucleotide polymorphisms in microRNA binding sites of oncogenes: implications in cancer and pharmacogenomics.

    PubMed

    Manikandan, Mayakannan; Munirajan, Arasambattu Kannan

    2014-02-01

    Cancer, a complex genetic disease involving uncontrolled cell proliferation, is caused by inactivation of tumor suppressor genes and activation of oncogenes. A vast majority of these cancer causing genes are known targets of microRNAs (miRNAs) that bind to complementary sequences in 3' untranslated regions (UTR) of messenger RNAs and repress them from translation. Single Nucleotide Polymorphisms (SNPs) occurring naturally in such miRNA binding regions can alter the miRNA:mRNA interaction and can significantly affect gene expression. We hypothesized that 3'UTR SNPs in miRNA binding sites of proto-oncogenes could abrogate their post-transcriptional regulation, resulting in overexpression of oncogenic proteins, tumor initiation, progression, and modulation of drug response in cancer patients. Therefore, we developed a systematic computational pipeline that integrates data from well-established databases, followed stringent selection criteria and identified a panel of 30 high-confidence SNPs that may impair miRNA target sites in the 3' UTR of 54 mRNA transcripts of 24 proto-oncogenes. Further, 8 SNPs amidst them had the potential to determine therapeutic outcome in cancer patients. Functional annotation suggested that altogether these SNPs occur in proto-oncogenes enriched for kinase activities. We provide detailed in silico evidence for the functional effect of these candidate SNPs in various types of cancer.

  12. Single nucleotide polymorphisms in Brahman steers and their association with carcass and tenderness traits.

    PubMed

    Smith, T; Thomas, M G; Bidner, T D; Paschal, J C; Franke, D E

    2009-01-01

    Data from purebred Brahman steers (N = 467) were used to study the association of single nucleotide polymorphisms (SNP) with carcass traits and measures of tenderness. Fall weaned calves were grazed and fed in a subtropical environment and then harvested for processing in a commercial facility. Carcass data were recorded 24 h postmortem. Muscle samples and primal ribs were obtained to measure calpastatin activity and shear force. DNA was used to determine genotypes of thyroglobulin (TG5), calpastatin (CAST) and mu-calpain (CAPN 316 and CAPN 4751) SNP. Minor allele frequencies for CAST, CAPN 316 and CAPN 4751 were 0.342, 0.031, and 0.051, respectively. CAST genotypes were associated with calpastatin enzyme activity (P < 0.01) and shear force of steaks aged for 14-day postmortem (P < 0.05). CAPN 316 genotypes were also associated with variation in shear force of steaks aged for 14 days (P < 0.05). CAPN 4751 genotypes approached significance for association with shear force of steaks after 7 and 14 days (P < 0.08). Genotypes for TG5 were non-polymorphic (i.e., minor allele frequency = 0.004) and omitted from further analyses. Neither CAST nor CAPN SNP was associated with variation in other carcass traits. PMID:19224465

  13. Development and evaluation of single-nucleotide polymorphism markers in allotetraploid rapeseed (Brassica napus L.).

    PubMed

    Westermeier, Peter; Wenzel, Gerhard; Mohler, Volker

    2009-11-01

    Single-nucleotide polymorphisms (SNPs) and insertion-deletions (INDELs) are currently the important classes of genetic markers for major crop species. In this study, methods for developing SNP markers in rapeseed (Brassica napus L.) and their in silico mapping and use for genotyping are demonstrated. For the development of SNP and INDEL markers, 181 fragments from 121 different gene sequences spanning 86 kb were examined. A combination of different selection methods (genome-specific amplification, hetero-duplex analysis and sequence analysis) allowed the detection of 18 singular fragments that showed a total of 87 SNPs and 6 INDELs between 6 different rapeseed varieties. The average frequency of sequence polymorphism was estimated to be one SNP every 247 bp and one INDEL every 3,583 bp. Most SNPs and INDELs were found in non-coding regions. Polymorphism information content values for SNP markers ranged between 0.02 and 0.50 in a set of 86 varieties. Using comparative genetics data for B. napus and Arabidopsis thaliana, an allocation of SNP markers to linkage groups in rapeseed was achieved: a unique location was determined for seven gene sequences; two and three possible locations were found for six and four sequences, respectively. The results demonstrate the usefulness of existing genomic resources for SNP discovery in rapeseed.

  14. HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity

    PubMed Central

    Feng, Rui; Moldover, Brian; Passic, Shendra; Aiamkitsumrit, Benjamas; Dampier, Will; Wojno, Adam; Kilareski, Evelyn; Blakey, Brandon; Ku, Tse-Sheun Jade; Shah, Sonia; Sullivan, Neil T.; Jacobson, Jeffrey M.; Wigdahl, Brian

    2016-01-01

    The large majority of human immunodeficiency virus type 1 (HIV-1) markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs) contained within the viral promoter or long terminal repeat (LTR) in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES) Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter)/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count). PMID:27100290

  15. Association of single nucleotide polymorphism rs6983267 with the risk of prostate cancer

    PubMed Central

    Yang, Yuan; Wang, Wenjing; Zhang, Liangcai; Zhang, Shihua; Liu, Guiyou; Yu, Yingcui; Liao, Mingzhi

    2016-01-01

    Many studies have investigated the association between single nucleotide polymorphism (SNP) rs6983267 and the risk of prostate cancer. However, results of these studies are inconsistent. Therefore, we summarised available data and performed a meta-analysis to determine this association. Relevant articles were identified by searching the PubMed, Web of Science and Embase database. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated using random effects model. We used dominant model (GG + TG vs TT), recessive model (GG vs TG + TT) and additive model (GG +TT vs TG) to determine the association between the rs6983267 polymorphism and risk of prostate cancer. Summary, 9 studies involving 8726 participants were included in this meta-analysis. Overall, though no association was observed between the rs6983267 polymorphism and risk of prostate cancer, subgroup analysis according to ethnicity showed a significant association between the rs6983267 polymorphism and risk of prostate cancer among white European men [recessive model: GG vs TG + TT, OR=1.21, (95% CI: 1.03, 1.42), P=0.02]. Our results indicate that the GG genotype of the rs6983267 polymorphism will increase individual susceptibility to prostate cancer in white European men. PMID:27009866

  16. Common single nucleotide polymorphisms in immunoregulatory genes and multiple myeloma risk among women in Connecticut

    PubMed Central

    Lee, Kyoung-Mu; Baris, Dalsu; Zhang, Yawei; Hosgood, H. Dean; Menashe, Idan; Yeager, Meredith; Zahm, Shelia Hoar; Wang, Sophia S.; Purdue, Mark P.; Chanock, Stephen; Zheng, Tongzhang; Rothman, Nathaniel; Lan, Qing

    2010-01-01

    In light of the relationship between immune system dysregulation and multiple myeloma (MM) risk, we investigated whether genetic variation in 92 immune function genes among 77 gene regions are associated with MM susceptibility in a population-based case-control study (108 cases and 482 controls) conducted among Caucasian women in Connecticut. Tagging single-nucleotide polymorphisms (SNPs; N=870) were selected using a pairwise linkage-disequilibrium based algorithm. Odds ratios (ORs) and 95% confidence intervals (CIs) for SNP genotypes were estimated using unconditional logistic regression. Tests of association for gene regions were conducted using the minP test. We applied the false discovery rate (FDR) method to the minP test results as a means of controlling for multiple comparisons. The CD4 gene region located on 12p13-q13 (minP=0.0009), had an FDR value < 0.1. In this region, a total of six tag SNPs in two genes (CD4 and LAG3) were significantly associated with MM risk (Ptrend<0.05), with the strongest association observed for the CD4 variant rs11064392 (ORAG/GG=2.53, 95% CI=1.59–4.02). Our findings suggest that genetic variation in CD4 may influence susceptibility to MM. Additional studies are needed to replicate these findings and, more generally, to explore the manner in which genes receptors may influence the pathogenesis of this poorly understood malignancy. PMID:20568250

  17. Investigating single nucleotide polymorphism (SNP) density in the human genome and its implications for molecular evolution.

    PubMed

    Zhao, Zhongming; Fu, Yun-Xin; Hewett-Emmett, David; Boerwinkle, Eric

    2003-07-17

    We investigated the single nucleotide polymorphism (SNP) density across the human genome and in different genic categories using two SNP databases: Celera's CgsSNP, which includes SNPs identified by comparing genomic sequences, and Celera's RefSNP, which includes SNPs from a variety of sources and is biased toward disease-associated genes. Based on CgsSNP, the average numbers of SNPs per 10 kb was 8.33, 8.44, and 8.09 in the human genome, in intergenic regions, and in genic regions, respectively. In genic regions, the SNP density in intronic, exonic and adjoining untranslated regions was 8.21, 5.28, and 7.51 SNPs per 10 kb, respectively. The pattern of SNP density based on RefSNP was different from that based on CgsSNP, emphasizing its utility for genotype-phenotype association studies but not for most population genetic studies. The number of SNPs per chromosome was correlated with chromosome length, but the density of SNPs estimated by CgsSNP was not significantly correlated with the GC content of the chromosome. Based on CgsSNP, the ratio of nonsense to missense mutations (0.027), the ratio of missense to silent mutations (1.15), and the ratio of non-synonymous to synonymous mutations (1.18) was less than half of that expected in a human protein coding sequence under the neutral mutation theory, reflecting a role for natural selection, especially purifying selection. PMID:12909357

  18. SNPer: an R library for quantitative variant analysis on single nucleotide polymorphisms among influenza virus populations.

    PubMed

    Sangket, Unitsa; Vijasika, Sukanya; Noh, Hasnee; Chantratita, Wasun; Klungthong, Chonticha; Yoon, In Kyu; Fernandez, Stefan; Rutvisuttinunt, Wiriya

    2015-01-01

    Influenza virus (IFV) can evolve rapidly leading to genetic drifts and shifts resulting in human and animal influenza epidemics and pandemics. The genetic shift that gave rise to the 2009 influenza A/H1N1 pandemic originated from a triple gene reassortment of avian, swine and human IFVs. More minor genetic alterations in genetic drift can lead to influenza drug resistance such as the H274Y mutation associated with oseltamivir resistance. Hence, a rapid tool to detect IFV mutations and the potential emergence of new virulent strains can better prepare us for seasonal influenza outbreaks as well as potential pandemics. Furthermore, identification of specific mutations by closely examining single nucleotide polymorphisms (SNPs) in IFV sequences is essential to classify potential genetic markers associated with potentially dangerous IFV phenotypes. In this study, we developed a novel R library called "SNPer" to analyze quantitative variants in SNPs among IFV subpopulations. The computational SNPer program was applied to three different subpopulations of published IFV genomic information. SNPer queried SNPs data and grouped the SNPs into (1) universal SNPs, (2) likely common SNPs, and (3) unique SNPs. SNPer outperformed manual visualization in terms of time and labor. SNPer took only three seconds with no errors in SNP comparison events compared with 40 hours with errors using manual visualization. The SNPer tool can accelerate the capacity to capture new and potentially dangerous IFV strains to mitigate future influenza outbreaks. PMID:25876137

  19. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

    PubMed

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-07-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

  20. Varietal identification of tea (Camellia sinensis) using nanofluidic array of single nucleotide polymorphism (SNP) markers

    PubMed Central

    Fang, Wan-Ping; Meinhardt, Lyndel W; Tan, Hua-Wei; Zhou, Lin; Mischke, Sue; Zhang, Dapeng

    2014-01-01

    Apart from water, tea is the world’s most widely consumed beverage. Tea is produced in more than 50 countries with an annual production of approximately 4.7 million tons. The market segment for specialty tea has been expanding rapidly owing to increased demand, resulting in higher revenues and profits for tea growers and the industry. Accurate varietal identification is critically important to ensure traceability and authentication of premium tea products, which in turn contribute to on-farm conservation of tea genetic diversity. Using a set of single nucleotide polymorphism (SNP) markers developed from the expressed sequence tag (EST) database of Camilla senensis, we genotyped deoxyribonucleic acid (DNA) samples extracted from a diverse group of tea varieties, including both fresh and processed commercial loose-leaf teas. The validation led to the designation of 60 SNPs that unambiguously identified all 40 tested tea varieties with high statistical rigor (p<0.0001). Varietal authenticity and genetic relationships among the analyzed cultivars were further characterized by ordination and Bayesian clustering analysis. These SNP markers, in combination with a high-throughput genotyping protocol, effectively established and verified specific DNA fingerprints for all tested tea varieties. This method provides a powerful tool for variety authentication and quality control for the tea industry. It is also highly useful for the management of tea genetic resources and breeding, where accurate and efficient genotype identification is essential. PMID:26504544

  1. A STAT6 Intronic Single-Nucleotide Polymorphism is Associated with Clinical Malaria in Ghanaian Children.

    PubMed

    Amoako-Sakyi, Daniel; Adukpo, Selorme; Kusi, Kwadwo A; Dodoo, Daniel; Ofori, Michael F; Adjei, George O; Edoh, Dominic E; Asmah, Richard H; Brown, Charles; Adu, Bright; Obiri-Yeboah, Dorcas; Futagbi, Godfred; Abubakari, Sharif Buari; Troye-Blomberg, Marita; Akanmori, Bartholomew D; Goka, Bamenla Q; Arko-Mensah, John; Gyan, Ben A

    2016-01-01

    Malaria pathogenesis may be influenced by IgE responses and cytokine cross-regulation. Several mutations in the IL-4/STAT6 signaling pathway can alter cytokine cross-regulation and IgE responses during a Plasmodium falciparum malarial infection. This study investigated the relationship between a STAT6 intronic single-nucleotide polymorphism (rs3024974), total IgE, cytokines, and malaria severity in 238 Ghanaian children aged between 0.5 and 13 years. Total IgE and cytokine levels were measured by ELISA, while genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (RFLP). Compared with healthy controls, heterozygosity protected against clinical malaria: uncomplicated malaria (odds ratios [OR] = 0.13, P < 0.001), severe malarial anemia (OR = 0.18, P < 0.001), and cerebral malaria (OR = 0.39, P = 0.022). Levels of total IgE significantly differed among malaria phenotypes (P = 0.044) and rs3024974 genotypes (P = 0.037). Neither cytokine levels nor IL-6/IL-10 ratios were associated with malaria phenotypes or rs3024974 genotypes. This study suggests a role for rs3024974 in malaria pathogenesis and offers further insights into an IL-4/STAT6 pathway mutation in malaria pathogenesis. PMID:27279750

  2. Single nucleotide polymorphism in the neuroplastin locus associates with cortical thickness and intellectual ability in adolescents.

    PubMed

    Desrivières, S; Lourdusamy, A; Tao, C; Toro, R; Jia, T; Loth, E; Medina, L M; Kepa, A; Fernandes, A; Ruggeri, B; Carvalho, F M; Cocks, G; Banaschewski, T; Barker, G J; Bokde, A L W; Büchel, C; Conrod, P J; Flor, H; Heinz, A; Gallinat, J; Garavan, H; Gowland, P; Brühl, R; Lawrence, C; Mann, K; Martinot, M L P; Nees, F; Lathrop, M; Poline, J-B; Rietschel, M; Thompson, P; Fauth-Bühler, M; Smolka, M N; Pausova, Z; Paus, T; Feng, J; Schumann, G

    2015-02-01

    Despite the recognition that cortical thickness is heritable and correlates with intellectual ability in children and adolescents, the genes contributing to individual differences in these traits remain unknown. We conducted a large-scale association study in 1583 adolescents to identify genes affecting cortical thickness. Single-nucleotide polymorphisms (SNPs; n=54,837) within genes whose expression changed between stages of growth and differentiation of a human neural stem cell line were selected for association analyses with average cortical thickness. We identified a variant, rs7171755, associating with thinner cortex in the left hemisphere (P=1.12 × 10(-)(7)), particularly in the frontal and temporal lobes. Localized effects of this SNP on cortical thickness differently affected verbal and nonverbal intellectual abilities. The rs7171755 polymorphism acted in cis to affect expression in the human brain of the synaptic cell adhesion glycoprotein-encoding gene NPTN. We also found that cortical thickness and NPTN expression were on average higher in the right hemisphere, suggesting that asymmetric NPTN expression may render the left hemisphere more sensitive to the effects of NPTN mutations, accounting for the lateralized effect of rs7171755 found in our study. Altogether, our findings support a potential role for regional synaptic dysfunctions in forms of intellectual deficits. PMID:24514566

  3. A Single Nucleotide Polymorphism in Human APOBEC3C Enhances Restriction of Lentiviruses

    PubMed Central

    Wittkopp, Cristina J.; Adolph, Madison B.; Wu, Lily I.; Chelico, Linda; Emerman, Michael

    2016-01-01

    Humans express seven human APOBEC3 proteins, which can inhibit viruses and endogenous retroelements through cytidine deaminase activity. The seven paralogs differ in the potency of their antiviral effects, as well as in their antiviral targets. One APOBEC3, APOBEC3C, is exceptional as it has been found to only weakly block viruses and endogenous retroelements compared to other APOBEC3s. However, our positive selection analyses suggest that APOBEC3C has played a role in pathogen defense during primate evolution. Here, we describe a single nucleotide polymorphism in human APOBEC3C, a change from serine to isoleucine at position 188 (I188) that confers potent antiviral activity against HIV-1. The gain-of-function APOBEC3C SNP results in increased enzymatic activity and hypermutation of target sequences when tested in vitro, and correlates with increased dimerization of the protein. The I188 is widely distributed in human African populations, and is the ancestral primate allele, but is not found in chimpanzees or gorillas. Thus, while other hominids have lost activity of this antiviral gene, it has been maintained, or re-acquired, as a more active antiviral gene in a subset of humans. Taken together, our results suggest that APOBEC3C is in fact involved in protecting hosts from lentiviruses. PMID:27732658

  4. Association of single nucleotide polymorphism rs3803662 with the risk of breast cancer

    PubMed Central

    Yang, Yuan; Wang, Wenjing; Liu, Guiyou; Yu, Yingcui; Liao, Mingzhi

    2016-01-01

    Large scale association studies have identified the single nucleotide polymorphism rs3803662 associated with breast cancer risk. However, the sample size of most studies is too small. Here, we performed this meta-analysis to make the result more convincing. Relevant articles published up to 2016 were identified by searching the PubMed database. 13 studies, involving a total of 29405 participants, were included in the meta-analysis. Odds Ratios (ORs) with 95% confidence intervals (CIs) was calculated with random or fixed effects model. All data analyses were analyzed by Review Manger 5.3 software. In Caucasian subgroup: Dominant model (TT + CT vs CC): OR = 1.17 (1.06, 1.29), Recessive model (TT vs CT + CC): OR = 1.25 (1.13, 1.39) and Allele frequency (T vs C): OR = 1.15 (1.08, 1.22). The present meta-analysis suggests that rs3803662 polymorphism is significantly associated with breast cancer risk in Caucasian women, and we did not find the association in Asian women. PMID:27350156

  5. Alteration of Antiviral Signalling by Single Nucleotide Polymorphisms (SNPs) of Mitochondrial Antiviral Signalling Protein (MAVS)

    PubMed Central

    Xing, Fei; Matsumiya, Tomoh; Hayakari, Ryo; Yoshida, Hidemi; Kawaguchi, Shogo; Takahashi, Ippei; Nakaji, Shigeyuki; Imaizumi, Tadaatsu

    2016-01-01

    Genetic variation is associated with diseases. As a type of genetic variation occurring with certain regularity and frequency, the single nucleotide polymorphism (SNP) is attracting more and more attention because of its great value for research and real-life application. Mitochondrial antiviral signalling protein (MAVS) acts as a common adaptor molecule for retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs), which can recognize foreign RNA, including viral RNA, leading to the induction of type I interferons (IFNs). Therefore, MAVS is thought to be a crucial molecule in antiviral innate immunity. We speculated that genetic variation of MAVS may result in susceptibility to infectious diseases. To assess the risk of viral infection based on MAVS variation, we tested the effects of twelve non-synonymous MAVS coding-region SNPs from the National Center for Biotechnology Information (NCBI) database that result in amino acid substitutions. We found that five of these SNPs exhibited functional alterations. Additionally, four resulted in an inhibitory immune response, and one had the opposite effect. In total, 1,032 human genomic samples obtained from a mass examination were genotyped at these five SNPs. However, no homozygous or heterozygous variation was detected. We hypothesized that these five SNPs are not present in the Japanese population and that such MAVS variations may result in serious immune diseases. PMID:26954674

  6. Single nucleotide polymorphisms in DKK3 gene are associated with prostate cancer risk and progression

    PubMed Central

    Kim, Min Su; Lee, Ha Na; Kim, Hae Jong; Myung, Soon Chul

    2015-01-01

    ABSTRACT We had investigated whether sequence variants within DKK3 gene are associated with the development of prostate cancer in a Korean study cohort. We evaluated the association between 53 single nucleotide polymorphisms (SNPs) in the DKK3 gene and prostate cancer risk as well as clinical characteristics (PSA, clinical stage, pathological stage and Gleason score) in Korean men (272 prostate cancer subjects and 173 benign prostate hyperplasia subjects) using unconditional logistic regression analysis. Of the 53 SNPs and 25 common haplotypes, 5 SNPs and 4 haplotypes were associated with prostate cancer risk (P=0.02–0.04); 3 SNPs and 2 haplotypes were significantly associated with susceptibility to prostate cancer, however 2 SNPs and 2 haplotypes exhibited a significant protective effect on prostate cancer. Logistic analyses of the DKK3 gene polymorphisms with several prostate cancer related factors showed that several SNPs were significant; three SNPs and two haplotypes to PSA level, three SNPs and two haplotypes to clinical stage, nine SNPs and two haplotype to pathological stage, one SNP and one haplotypes to Gleason score. To the author's knowledge, this is the first report documenting that DKK3 polymorphisms are not only associated with prostate cancer but also related to prostate cancer-related factors. PMID:26689513

  7. Estrogen receptor alpha single nucleotide polymorphism as predictor of diabetes type 2 risk in hypogonadal men.

    PubMed

    Linnér, Carl; Svartberg, Johan; Giwercman, Aleksander; Giwercman, Yvonne Lundberg

    2013-06-01

    Estradiol (E2) is, apart from its role as a reproductive hormone, also important for cardiac function and bone maturation in both genders. It has also been shown to play a role in insulin production, energy expenditure and in inducing lipolysis. The aim of the study was to investigate if low circulating testosterone or E2 levels in combination with variants in the estrogen receptor alpha (ESR1) and estrogen receptor beta (ESR2) genes were of importance for the risk of type-2 diabetes. The single nucleotide polymorphisms rs2207396 and rs1256049, in ESR1 and ESR2, respectively, were analysed by allele specific PCR in 172 elderly men from the population-based Tromsø study. The results were adjusted for age. In individuals with low total (≤11 nmol/L) or free testosterone (≤0.18 nmol/L) being carriers of the variant A-allele in ESR1 was associated with 7.3 and 15.9 times, respectively, increased odds ratio of being diagnosed with diabetes mellitus type 2 (p = 0.025 and p = 0.018, respectively). Lower concentrations of E2 did not seem to increase the risk of being diagnosed with diabetes. In conclusion, in hypogonadal men, the rs2207396 variant in ESR1 predicts the risk of type 2 diabetes.

  8. Feasibility of mitochondrial single nucleotide polymorphisms to detect and identify Aspergillus fumigatus in clinical samples.

    PubMed

    Oliveira, Manuela; Lackner, Michaela; Amorim, António; Araujo, Ricardo

    2014-09-01

    Invasive aspergillosis (IA) is a concerning fungal infection among immunocompromised patients due to the poor outcomes in its treatment related with the delay in an accurate diagnosis. Therefore, this study aimed to select informative mitochondrial single nucleotide polymorphism (SNP) markers suitable for detection and identification of Aspergillus fumigatus in clinical specimens. Four mitochondrial SNP markers were selected (Cox_488, CytB_246, Nad1_802, and NC_171) and tested on clinical and environmental strains of Fumigati and non-Fumigati Aspergillus species (n=105). These markers were tested on clinical samples (n=37) obtained from patients with aspergillosis. The Cox_488 SNP was detected in all clinical samples, whereas complete profiles detecting all 4 SNPs were only obtained from 6 samples (1 lung biopsy, 2 abscesses, and 3 bronchoalveolar lavages) from patients with a probable or proven Aspergillus infection. The mitSNApfu approach based on mitochondrial markers constitutes a new and promising diagnostic approach that was applied successfully on clinical specimens from patients with proven or probable IA. Nevertheless, the assay requires further optimization (in respect to extraction procedures) and clinical validation to allow its application in routine diagnostics.

  9. Bioinformatics of varicella-zoster virus: Single nucleotide polymorphisms define clades and attenuated vaccine genotypes

    PubMed Central

    Chow, Vincent T.; Tipples, Graham A.; Grose, Charles

    2012-01-01

    Varicella zoster virus (VZV) is one of the human herpesviruses. To date, over 40 complete VZV genomes have been sequenced and analyzed. The VZV genome contains around 125,000 base pairs including 70 open reading frames (ORFs). Enumeration of single nucleotide polymorphisms (SNPs) has determined that the following ORFs are the most variable (in descending order): 62, 22, 29, 28, 37, 21, 54, 31, 1 and 55. ORF 62 is the major immediate early regulatory VZV gene. Further SNP analysis across the entire genome has led to the observation that VZV strains can be broadly grouped into clades within a phylogenetic tree. VZV strains collected in Singapore provided important sequence data for construction of the phylogenetic tree. Currently 5 VZV clades are recognized; they have been designated clades 1 through 5. Clades 1 and 3 include European/North American strains; clade 2 includes Asian strains, especially from Japan; and clade 5 includes strains from India. Clade 4 includes some strains from Europe, but its geographic origins need further documentation.. Within clade 1, five variant viruses have been isolated with a missense mutation in the gE (ORF 68) glycoprotein; these strains have an altered increased cell spread phenotype. Bioinformatics analyses of the attenuated vaccine strains have also been performed, with a subsequent discovery of a stop-codon SNP in ORFO as a likely attenuation determinant. Taken together, these VZV bioinformatics analyses have provided enormous insights into VZV phylogenetics as well as VZV SNPs associated with attenuation. PMID:23183312

  10. A single nucleotide polymorphism in BMP15 is associated with high response to ovarian stimulation.

    PubMed

    Hanevik, Hans Ivar; Hilmarsen, Hilde Tveitan; Skjelbred, Camilla Furu; Tanbo, Tom; Kahn, Jarl A

    2011-07-01

    There is substantial variability in ovarian response to exogenous gonadotrophins in women undergoing ovarian stimulation for IVF. Genetic variation in signalling pathways of the ovary may influence ovarian stimulation outcome. One previous study showed an association between single nucleotide polymorphisms (SNP) in the gene for bone morphogenetic protein 15 (BMP15) and ovarian hyperstimulation syndrome (OHSS). This article presents a retrospective case-controlled genetic-association study designed to test the association between SNP in the BMP15 gene and two clinically important outcomes of ovarian stimulation: low and high response. Blood samples from 53 high responders, 38 low responders and 100 controls were analysed for five SNP of interest. Odds ratios (OR) and 95% confidence intervals (95% CI) were estimated by a multivariate logistic regression model. We found an association between the BMP15 -9G allele and high response to ovarian stimulation (OR=2.7, 95% CI=1.3-5.7). This association confirms previous findings in a different population and strengthens the case for an association between this SNP and ovarian stimulation outcome.

  11. Association of Single Nucleotide Polymorphisms with Atrial Fibrillation and the Outcome after Catheter Ablation

    PubMed Central

    Hu, Yu-Feng; Wang, Hsueh-Hsiao; Yeh, Hung-I; Lee, Kun-Tai; Lin, Yenn-Jiang; Chang, Shih-Lin; Lo, Li-Wei; Tuan, Ta-Chuan; Li, Cheng-Hung; Chao, Tze-Fan; Chung, Fa-Po; Liao, Jo-Nan; Tang, Paul Wei Hua; Tsai, Wei-Chung; Chiou, Chuen-Wang; Chen, Shih-Ann

    2016-01-01

    Background The association of gene variants with atrial fibrillation (AF) type and the recurrence of AF after catheter ablation in Taiwan is still unclear. In this study, we aimed to investigate the relationships between gene variants, AF type, and the recurrence of AF. Methods In our investigation, we examined 383 consecutive patients with AF (61.9 ± 14.0 years; 63% men); of these 383 patients, 189 underwent catheter ablation for drug-refractory AF. Thereafter, the single nucleotide polymorphisms rs2200733, and rs7193343 were genotyped using real-time polymerase chain reaction. Results The rs7193343 variant was independently associated with non-paroxysmal AF (non-PAF). In the PAF group, the rs7193343 variant was independently associated with AF recurrence after catheter ablation. However, the rs2200733 variant was not associated with AF recurrence in this group. The combination of the rs7193343 and rs2200733 risk alleles was associated with a better predictive power in the PAF patients. In contrast, in the non-PAF group, the SNPs were not associated with recurrence. The rs7193343 and rs2200733 variants were not associated with different atrial voltage and activation times. Conclusions The rs7193343 variants were associated with AF recurrence after catheter ablation in PAF patients but not in non-PAF patients. The rs7193343 CC variant was independently associated with non-PAF. PMID:27713600

  12. Bayesian pedigree inference with small numbers of single nucleotide polymorphisms via a factor-graph representation.

    PubMed

    Anderson, Eric C; Ng, Thomas C

    2016-02-01

    We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. PMID:26450523

  13. Discovery and characterization of single nucleotide polymorphisms in coho salmon, Oncorhynchus kisutch.

    PubMed

    Starks, Hilary A; Clemento, Anthony J; Garza, John Carlos

    2016-01-01

    Molecular population genetic analyses have become an integral part of ecological investigation and population monitoring for conservation and management. Microsatellites have been the molecular marker of choice for such applications over the last several decades, but single nucleotide polymorphism (SNP) markers are rapidly expanding beyond model organisms. Coho salmon (Oncorhynchus kisutch) is native to the north Pacific Ocean and its tributaries, where it is the focus of intensive fishery and conservation activities. As it is an anadromous species, coho salmon typically migrate across multiple jurisdictional boundaries, complicating management and requiring shared data collection methods. Here, we describe the discovery and validation of a suite of novel SNPs and associated genotyping assays which can be used in the genetic analyses of this species. These assays include 91 that are polymorphic in the species and one that discriminates it from a sister species, Chinook salmon. We demonstrate the utility of these SNPs for population assignment and phylogeographic analyses, and map them against the draft trout genome. The markers constitute a large majority of all SNP markers described for coho salmon and will enable both population- and pedigree-based analyses across the southern part of the species native range. PMID:25965351

  14. Association between single nucleotide polymorphisms in p53 and abortion in Thoroughbred mares.

    PubMed

    Leon, Priscila Marques Moura de; Campos, Vinicus Farias; Thurow, Helena Strelow; Hartwig, Fernando Pires; Selau, Lisiane Priscila; Dellagostin, Odir Antonio; Neto, José Braccini; Deschamps, João Carlos; Seixas, Fabiana Kömmling; Collares, Tiago

    2012-08-01

    Single nucleotide polymorphisms (SNPs) in the p53 gene have been studied extensively in humans. The aims of this study were to determine the frequency of the Arg/Pro SNP in p53 in Thoroughbred mares on one stud in Brazil and to correlate p53 genotypes with reproductive performance. SNPs were detected by PCR-restriction fragment length polymorphism in blood samples from 105 horses and confirmed by sequencing. The allele frequency in Thoroughbred mares at codon 72 in exon 4 was 73.3% Arg/Pro, 17.1% Arg/Arg and 9.6% Pro/Pro. The presence of Arg/Pro was significantly associated with abortion (P=0.02), while Pro/Pro mares had a lower probability of abortion (P<0.05). Using a logistic regression model, the dominance effect was significant (P=0.044; odds ratio 7.94) for abortion and additive effects were not significant (P=0.26). p53 may play a role in equine reproduction.

  15. Functional Implications of the CLOCK 3111T/C Single-Nucleotide Polymorphism

    PubMed Central

    Ozburn, Angela R.; Purohit, Kush; Parekh, Puja K.; Kaplan, Gabrielle N.; Falcon, Edgardo; Mukherjee, Shibani; Cates, Hannah M.; McClung, Colleen A.

    2016-01-01

    Circadian rhythm disruptions are prominently associated with bipolar disorder (BD). Circadian rhythms are regulated by the molecular clock, a family of proteins that function together in a transcriptional–translational feedback loop. The CLOCK protein is a key transcription factor of this feedback loop, and previous studies have found that manipulations of the Clock gene are sufficient to produce manic-like behavior in mice (1). The CLOCK 3111T/C single-nucleotide polymorphism (SNP; rs1801260) is a genetic variation of the human CLOCK gene that is significantly associated with increased frequency of manic episodes in BD patients (2). The 3111T/C SNP is located in the 3′-untranslated region of the CLOCK gene. In this study, we sought to examine the functional implications of the human CLOCK 3111T/C SNP by transfecting a mammalian cell line (mouse embryonic fibroblasts isolated from Clock−/− knockout mice) with pcDNA plasmids containing the human CLOCK gene with either the T or C SNP at position 3111. We then measured circadian gene expression over a 24-h time period. We found that the CLOCK3111C SNP resulted in higher mRNA levels than the CLOCK 3111T SNP. Furthermore, we found that Per2, a transcriptional target of CLOCK, was also more highly expressed with CLOCK 3111C expression, indicating that the 3′-UTR SNP affects the expression, function, and stability of CLOCK mRNA. PMID:27148095

  16. Single nucleotide polymorphism screening, molecular characterization, and evolutionary aspects of chicken Piwi genes.

    PubMed

    Wang, H Z; Ma, T; Chang, G B; Wan, F; Liu, X P; Lu, L; Xu, L; Chen, J; Chen, G H

    2015-01-01

    The P-element-induced wimpy testis (Piwi) gene is involved in germline stem cell self-renewal, meiosis, RNA silencing, and transcriptional regulation. Piwi genes are relatively well conserved in many species, but their function in poultry species is unclear. In this study, Piwi genes were sequenced using a target-sequence capture assay in quail and 28 breeds of chicken. Single nucleotide polymorphisms (SNPs) and evolutionary aspects of these chicken breeds were then analyzed. We found that SNP sites existed mainly in the introns of a few chicken breeds, and we selected an SNP on intron 4 for further verification by Sanger sequencing, the results of which were similar to those obtained by the target-capture sequencing assay. The evolutionary analysis revealed that there were more mutations in the Chahua and Leghorn breeds than in the other breeds, and that the phylogenetic tree was divided into four main categories that suggested that Piwi is evolutionarily conserved, and mutations in the introns might be associated with gametogenesis. The screened SNPs can be used as candidate markers for Piwi, and our results provide basic information for the further study of Piwi function in poultry.

  17. Dynamic regulation of the transcription initiation landscape at single nucleotide resolution during vertebrate embryogenesis

    PubMed Central

    Nepal, Chirag; Hadzhiev, Yavor; Previti, Christopher; Haberle, Vanja; Li, Nan; Takahashi, Hazuki; Suzuki, Ana Maria M.; Sheng, Ying; Abdelhamid, Rehab F.; Anand, Santosh; Gehrig, Jochen; Akalin, Altuna; Kockx, Christel E.M.; van der Sloot, Antoine A.J.; van IJcken, Wilfred F.J.; Armant, Olivier; Rastegar, Sepand; Watson, Craig; Strähle, Uwe; Stupka, Elia; Carninci, Piero; Lenhard, Boris; Müller, Ferenc

    2013-01-01

    Spatiotemporal control of gene expression is central to animal development. Core promoters represent a previously unanticipated regulatory level by interacting with cis-regulatory elements and transcription initiation in different physiological and developmental contexts. Here, we provide a first and comprehensive description of the core promoter repertoire and its dynamic use during the development of a vertebrate embryo. By using cap analysis of gene expression (CAGE), we mapped transcription initiation events at single nucleotide resolution across 12 stages of zebrafish development. These CAGE-based transcriptome maps reveal genome-wide rules of core promoter usage, structure, and dynamics, key to understanding the control of gene regulation during vertebrate ontogeny. They revealed the existence of multiple classes of pervasive intra- and intergenic post-transcriptionally processed RNA products and their developmental dynamics. Among these RNAs, we report splice donor site-associated intronic RNA (sRNA) to be specific to genes of the splicing machinery. For the identification of conserved features, we compared the zebrafish data sets to the first CAGE promoter map of Tetraodon and the existing human CAGE data. We show that a number of features, such as promoter type, newly discovered promoter properties such as a specialized purine-rich initiator motif, as well as sRNAs and the genes in which they are detected, are conserved in mammalian and Tetraodon CAGE-defined promoter maps. The zebrafish developmental promoterome represents a powerful resource for studying developmental gene regulation and revealing promoter features shared across vertebrates. PMID:24002785

  18. Single nucleotide polymorphisms in the human corticosteroid-binding globulin promoter alter transcriptional activity.

    PubMed

    Li, Yue; Wu, Liang; Lei, JingHui; Zhu, Cheng; Wang, HongMei; Yu, XiaoGuang; Lin, HaiYan

    2012-08-01

    Corticosteroid-binding globulin (CBG) is a high-affinity plasma protein that transports glucocorticoids and progesterone. Others and we have reported non-synonymous single nucleotide polymorphisms (SNPs) that influence CBG production or steroid-binding activity. However, no promoter polymorphisms affecting the transcription of human CBG gene (Cbg) have been reported. In the present study we investigated function implications of six promoter SNPs, including -26 C/G, -54 C/T, -144 G/C, -161 A/G, -205 C/A, and -443/-444 AG/-, five of which are located within the first 205 base pairs of 5'-flanking region and close to the highly conserved footprinted elements, TATA-box, or CCAAT-box. Luciferase reporter assays demonstrated that basal activity of the promoter carrying -54 T or -161 G was significantly enhanced. The first three polymorphisms, -26 C/G, -54 C/T, and -144 G/C located close to the putative hepatic nuclear factor (HNF) 1 binding elements, altered the transactivation effect of HNF1β. We also found a negative promoter response to dexamethasone-activated glucocorticoid receptor (GR) α, although none of the SNPs affected its transrepression function. Our results suggest that human Cbg -26 C/G, -54 C/T, -144 G/C, and -161 A/G promoter polymorphisms alter transcriptional activity, and further studies are awaited to explore their association with physiological and pathological conditions.

  19. Single nucleotide polymorphisms to discriminate different classes of hybrid between wild Atlantic salmon and aquaculture escapees.

    PubMed

    Pritchard, Victoria L; Erkinaro, Jaakko; Kent, Matthew P; Niemelä, Eero; Orell, Panu; Lien, Sigbjørn; Primmer, Craig R

    2016-09-01

    Many wild Atlantic salmon (Salmo salar) populations are threatened by introgressive hybridization from domesticated fish that have escaped from aquaculture facilities. A detailed understanding of the hybridization dynamics between wild salmon and aquaculture escapees requires discrimination of different hybrid classes; however, markers currently available to discriminate the two types of parental genome have limited power to do this. Using a high-density Atlantic salmon single nucleotide polymorphism (SNP) array, in combination with pooled-sample allelotyping and an Fst outlier approach, we identified 200 SNPs that differentiated an important Atlantic salmon stock from the escapees potentially hybridizing with it. By simulating multiple generations of wild-escapee hybridization, involving wild populations in two major phylogeographic lineages and a genetically diverse set of escapees, we showed that both the complete set of SNPs and smaller subsets could reliably assign individuals to different hybrid classes up to the third hybrid (F3) generation. This set of markers will be a useful tool for investigating the genetic interactions between native wild fish and aquaculture escapees in many Atlantic salmon populations. PMID:27606009

  20. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

    PubMed

    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

    2016-03-15

    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs.

  1. Single nucleotide polymorphism array analysis defines a specific genetic fingerprint for well-differentiated cutaneous SCCs.

    PubMed

    Purdie, Karin J; Harwood, Catherine A; Gulati, Abha; Chaplin, Tracy; Lambert, Sally R; Cerio, Rino; Kelly, Gavin P; Cazier, Jean-Baptiste; Young, Bryan D; Leigh, Irene M; Proby, Charlotte M

    2009-06-01

    Cutaneous squamous cell carcinomas (cSCCs) are the second most frequent cancers in fair-skinned populations; yet, because of their genetic heterogeneity, the key molecular events in cSCC tumorigenesis remain poorly defined. We have used single nucleotide polymorphism microarray analysis to examine genome-wide allelic imbalance in 60 cSCCs using paired non-tumor samples. The most frequent recurrent aberrations were loss of heterozygosity at 3p and 9p, observed in 39 (65%) and 45 (75%) tumors, respectively. Microdeletions at 9p23 within the protein tyrosine phosphatase receptor type D (PTPRD) locus were identified in 9 (15%) samples, supporting a tumor suppressor role for PTPRD in cSCC. In addition, microdeletions at 3p14.2 were detected in 3 (5%) cSCCs, implicating the fragile histidine triad (FHIT) gene as a possible target for inactivation. Statistical analysis revealed that well-differentiated cSCCs demonstrated significantly fewer aberrations than moderately and poorly differentiated cSCCs; yet, despite a lower rate of allelic imbalance, some specific aberrations were observed equally frequently in both groups. No correlation was established between the frequency of chromosomal aberrations and immune or human papillomavirus status. Our data suggest that well-differentiated tumors are a genetically distinct subpopulation of cSCC.

  2. Association of single nucleotide polymorphisms in cell cycle regulatory genes with oral cancer susceptibility.

    PubMed

    Murali, Abitha; Nalinakumari, K R; Thomas, Shaji; Kannan, S

    2014-09-01

    Alterations in the regulation of the cell cycle are strongly linked to tumorigenesis, so genetic variants in genes critical to control of the cycle are good candidates to have their association with susceptibility to oral cancer assessed. In this hospital-based, case-control study of 445 patients who had been newly-diagnosed with oral cancer and 449 unaffected controls, we used a multigenic approach to examine the associations among a panel of 10 selected polymorphisms in the pathway of the cell cycle that were possibly susceptible to oral cancer. Six of 9 single nucleotide polymorphisms in the cell cycle showed significant risks for oral cancer, the highest risk being evident for p27 (rs34329; Odds ratio 3.05, 95% CI 2.12 to 4.40). A significant risk of oral cancer was also evident for individual polymorphisms of cyclin E (rs1406), cyclin H (rs3093816), cyclin D1-1 (rs647451), cyclin D2 (rs3217901) and Rb1-2 (rs3092904). The risk of oral cancer increased significantly as the number of unfavourable genotypes in the pathway increased, and so the results point to a stronger combined effect of polymorphisms in important cell cycle regulatory genes on predisposition to oral cancer. PMID:24947332

  3. HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity.

    PubMed

    Nonnemacher, Michael R; Pirrone, Vanessa; Feng, Rui; Moldover, Brian; Passic, Shendra; Aiamkitsumrit, Benjamas; Dampier, Will; Wojno, Adam; Kilareski, Evelyn; Blakey, Brandon; Ku, Tse-Sheun Jade; Shah, Sonia; Sullivan, Neil T; Jacobson, Jeffrey M; Wigdahl, Brian

    2016-01-01

    The large majority of human immunodeficiency virus type 1 (HIV-1) markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs) contained within the viral promoter or long terminal repeat (LTR) in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES) Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter)/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count).

  4. Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.).

    PubMed

    Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco

    2013-04-01

    Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs.

  5. Single Nucleotide Polymorphism Identification in Polyploids: A Review, Example, and Recommendations.

    PubMed

    Clevenger, Josh; Chavarro, Carolina; Pearl, Stephanie A; Ozias-Akins, Peggy; Jackson, Scott A

    2015-06-01

    Understanding the relationship between genotype and phenotype is a major biological question and being able to predict phenotypes based on molecular genotypes is integral to molecular breeding. Whole-genome duplications have shaped the history of all flowering plants and present challenges to elucidating the relationship between genotype and phenotype, especially in neopolyploid species. Although single nucleotide polymorphisms (SNPs) have become popular tools for genetic mapping, discovery and application of SNPs in polyploids has been difficult. Here, we summarize common experimental approaches to SNP calling, highlighting recent polyploid successes. To examine the impact of software choice on these analyses, we called SNPs among five peanut genotypes using different alignment programs (BWA-mem and Bowtie 2) and variant callers (SAMtools, GATK, and Freebayes). Alignments produced by Bowtie 2 and BWA-mem and analyzed in SAMtools shared 24.5% concordant SNPs, and SAMtools, GATK, and Freebayes shared 1.4% concordant SNPs. A subsequent analysis of simulated Brassica napus chromosome 1A and 1C genotypes demonstrated that, of the three software programs, SAMtools performed with the highest sensitivity and specificity on Bowtie 2 alignments. These results, however, are likely to vary among species, and we therefore propose a series of best practices for SNP calling in polyploids.

  6. Association of single nucleotide polymorphism rs6983267 with the risk of prostate cancer.

    PubMed

    Yang, Yuan; Wang, Wenjing; Zhang, Liangcai; Zhang, Shihua; Liu, Guiyou; Yu, Yingcui; Liao, Mingzhi

    2016-05-01

    Many studies have investigated the association between single nucleotide polymorphism (SNP) rs6983267 and the risk of prostate cancer. However, results of these studies are inconsistent. Therefore, we summarised available data and performed a meta-analysis to determine this association. Relevant articles were identified by searching the PubMed, Web of Science and Embase database. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated using random effects model. We used dominant model (GG + TG vs TT), recessive model (GG vs TG + TT) and additive model (GG +TT vs TG) to determine the association between the rs6983267 polymorphism and risk of prostate cancer. Summary, 9 studies involving 8726 participants were included in this meta-analysis. Overall, though no association was observed between the rs6983267 polymorphism and risk of prostate cancer, subgroup analysis according to ethnicity showed a significant association between the rs6983267 polymorphism and risk of prostate cancer among white European men [recessive model: GG vs TG + TT, OR=1.21, (95% CI: 1.03, 1.42), P=0.02]. Our results indicate that the GG genotype of the rs6983267 polymorphism will increase individual susceptibility to prostate cancer in white European men.

  7. rs621554 single nucleotide polymorphism of DLC1 is associated with breast cancer susceptibility and prognosis.

    PubMed

    Ding, Xia; Gao, Sumei; Yang, Qifeng

    2016-05-01

    Deleted in liver cancer 1 (DLC1) on chromosome 8p22, is an important tumor suppressor gene originally identified to be deleted in hepatocellular carcinoma. It can regulate the structure of the actin cytoskeleton and inhibit cell proliferation, motility and angiogenesis, which predominantly depends on its homology to rat RhoGAP. There are many genetic variants in DLC1, which may influence its antitumor efficacy. The rs621554 (IVS19+108C>T) polymorphism is a synonymous single nucleotide polymorphism (SNP) previously found to be associated with hepatocellular carcinoma. In the present study, 453 patients with breast cancer and 330 healthy females were analyzed using a cycling probe method. It was determined that the rs621554 polymorphism of DLC1 was associated with breast cancer susceptibility, with the CC and CT genotypes resulting in a higher risk of developing breast cancer. In regard to clinicopathological variables, it was demonstrated that the CT and CC genotype were associated with tumor size, lymph node metastasis and progesterone receptor status. Patients with the CT and CC genotype had shorter disease-free survival and overall survival rates compared with those with the TT genotype. Additionally, it was demonstrated that the rs621554 polymorphism was correlated with DLC1 expression at the mRNA level. These results suggested that the rs621554 polymorphism is associated with breast cancer susceptibility and prognosis, and may serve as a biomarker for breast cancer development and progression.

  8. Association of single nucleotide polymorphism rs3803662 with the risk of breast cancer.

    PubMed

    Yang, Yuan; Wang, Wenjing; Liu, Guiyou; Yu, Yingcui; Liao, Mingzhi

    2016-01-01

    Large scale association studies have identified the single nucleotide polymorphism rs3803662 associated with breast cancer risk. However, the sample size of most studies is too small. Here, we performed this meta-analysis to make the result more convincing. Relevant articles published up to 2016 were identified by searching the PubMed database. 13 studies, involving a total of 29405 participants, were included in the meta-analysis. Odds Ratios (ORs) with 95% confidence intervals (CIs) was calculated with random or fixed effects model. All data analyses were analyzed by Review Manger 5.3 software. In Caucasian subgroup: Dominant model (TT + CT vs CC): OR = 1.17 (1.06, 1.29), Recessive model (TT vs CT + CC): OR = 1.25 (1.13, 1.39) and Allele frequency (T vs C): OR = 1.15 (1.08, 1.22). The present meta-analysis suggests that rs3803662 polymorphism is significantly associated with breast cancer risk in Caucasian women, and we did not find the association in Asian women.

  9. StructMAn: annotation of single-nucleotide polymorphisms in the structural context

    PubMed Central

    Gress, Alexander; Ramensky, Vasily; Büch, Joachim; Keller, Andreas; Kalinina, Olga V.

    2016-01-01

    The next generation sequencing technologies produce unprecedented amounts of data on the genetic sequence of individual organisms. These sequences carry a substantial amount of variation that may or may be not related to a phenotype. Phenotypically important part of this variation often comes in form of protein-sequence altering (non-synonymous) single nucleotide variants (nsSNVs). Here we present StructMAn, a Web-based tool for annotation of human and non-human nsSNVs in the structural context. StructMAn analyzes the spatial location of the amino acid residue corresponding to nsSNVs in the three-dimensional (3D) protein structure relative to other proteins, nucleic acids and low molecular-weight ligands. We make use of all experimentally available 3D structures of query proteins, and also, unlike other tools in the field, of structures of proteins with detectable sequence identity to them. This allows us to provide a structural context for around 20% of all nsSNVs in a typical human sequencing sample, for up to 60% of nsSNVs in genes related to human diseases and for around 35% of nsSNVs in a typical bacterial sample. Each nsSNV can be visualized and inspected by the user in the corresponding 3D structure of a protein or protein complex. The StructMAn server is available at http://structman.mpi-inf.mpg.de. PMID:27150811

  10. Predicting Mendelian Disease-Causing Non-Synonymous Single Nucleotide Variants in Exome Sequencing Studies

    PubMed Central

    Bao, Su-Ying; Yang, Wanling; Ho, Shu-Leong; Song, Yong-Qiang; Sham, Pak C.

    2013-01-01

    Exome sequencing is becoming a standard tool for mapping Mendelian disease-causing (or pathogenic) non-synonymous single nucleotide variants (nsSNVs). Minor allele frequency (MAF) filtering approach and functional prediction methods are commonly used to identify candidate pathogenic mutations in these studies. Combining multiple functional prediction methods may increase accuracy in prediction. Here, we propose to use a logit model to combine multiple prediction methods and compute an unbiased probability of a rare variant being pathogenic. Also, for the first time we assess the predictive power of seven prediction methods (including SIFT, PolyPhen2, CONDEL, and logit) in predicting pathogenic nsSNVs from other rare variants, which reflects the situation after MAF filtering is done in exome-sequencing studies. We found that a logit model combining all or some original prediction methods outperforms other methods examined, but is unable to discriminate between autosomal dominant and autosomal recessive disease mutations. Finally, based on the predictions of the logit model, we estimate that an individual has around 5% of rare nsSNVs that are pathogenic and carries ∼22 pathogenic derived alleles at least, which if made homozygous by consanguineous marriages may lead to recessive diseases. PMID:23341771

  11. Single nucleotide polymorphism-based microarray analysis for the diagnosis of hydatidiform moles

    PubMed Central

    XIE, YINGJUN; PEI, XIAOJUAN; DONG, YU; WU, HUIQUN; WU, JIANZHU; SHI, HUIJUAN; ZHUANG, XUYING; SUN, XIAOFANG; HE, JIALING

    2016-01-01

    In clinical diagnostics, single nucleotide polymorphism (SNP)-based microarray analysis enables the detection of copy number variations (CNVs), as well as copy number neutral regions, that are absent of heterozygosity throughout the genome. The aim of the present study was to evaluate the effectiveness and sensitivity of SNP-based microarray analysis in the diagnosis of hydatidiform mole (HM). By using whole-genome SNP microarray analysis, villous genotypes were detected, and the ploidy of villous tissue was determined to identify HMs. A total of 66 villous tissues and two twin tissues were assessed in the present study. Among these samples, 11 were triploid, one was tetraploid, 23 were abnormal aneuploidy, three were complete genome homozygosity, and the remaining ones were normal ploidy. The most noteworthy finding of the present study was the identification of six partial HMs and three complete HMs from those samples that were not identified as being HMs on the basis of the initial diagnosis of experienced obstetricians. This study has demonstrated that the application of an SNP-based microarray analysis was able to increase the sensitivity of diagnosis for HMs with partial and complete HMs, which makes the identification of these diseases at an early gestational age possible. PMID:27151252

  12. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

    PubMed

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-07-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

  13. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

    PubMed Central

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-01-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

  14. Genome-wide analysis of single-nucleotide polymorphisms in human expressed sequences.

    PubMed

    Irizarry, K; Kustanovich, V; Li, C; Brown, N; Nelson, S; Wong, W; Lee, C J

    2000-10-01

    Single-nucleotide polymorphisms (SNPs) have been explored as a high-resolution marker set for accelerating the mapping of disease genes. Here we report 48,196 candidate SNPs detected by statistical analysis of human expressed sequence tags (ESTs), associated primarily with coding regions of genes. We used Bayesian inference to weigh evidence for true polymorphism versus sequencing error, misalignment or ambiguity, misclustering or chimaeric EST sequences, assessing data such as raw chromatogram height, sharpness, overlap and spacing, sequencing error rates, context-sensitivity and cDNA library origin. Three separate validations-comparison with 54 genes screened for SNPs independently, verification of HLA-A polymorphisms and restriction fragment length polymorphism (RFLP) testing-verified 70%, 89% and 71% of our predicted SNPs, respectively. Our method detects tenfold more true HLA-A SNPs than previous analyses of the EST data. We found SNPs in a large fraction of known disease genes, including some disease-causing mutations (for example, the HbS sickle-cell mutation). Our comprehensive analysis of human coding region polymorphism provides a public resource for mapping of disease genes (available at http://www.bioinformatics.ucla.edu/snp).

  15. Single-nucleotide polymorphism analysis of GH, GHR, and IGF-1 genes in minipigs.

    PubMed

    Tian, Y G; Yue, M; Gu, Y; Gu, W W; Wang, Y J

    2014-09-01

    Tibetan (TB) and Bama (BM) miniature pigs are two popular pig breeds that are used as experimental animals in China due to their small body size. Here, we analyzed single-nucleotide polymorphisms (SNPs) in gene fragments that are closely related to growth traits [growth hormone (GH), growth hormone receptor (GHR), and insulin-like growth factor (IGF)-1)] in these pig breeds and a large white (LW) control pig breed. On the basis of the analysis of 100 BMs, 108 TBs, and 50 LWs, the polymorphic distribution levels of GH, GHR, and IGF-1 were significantly different among these three pig breeds. According to correlation analyses between SNPs and five growth traits--body weight (BW), body length (BL), withers height (WH), chest circumference (CC), and abdomen circumference (AC)--three SNP loci in BMs and four SNP loci in TBs significantly affected growth traits. Three SNP sites in BMs and four SNP sites in TBs significantly affected growth traits. SNPs located in the GH gene fragment significantly affected BL and CC at locus 12 and BL at locus 45 in BMs, and also BW, WH, CC, and AC at locus 45 and WH and CC at locus 93 in TBs. One SNP at locus 85 in the BM GHR gene fragment significantly affected all growth traits. All indices were significantly reduced with a mixture of alleles at locus 85. These results provide more information regarding the genetic background of these minipig species and indicate useful selection markers for pig breeding programs. PMID:25098617

  16. Predicting mendelian disease-causing non-synonymous single nucleotide variants in exome sequencing studies.

    PubMed

    Li, Miao-Xin; Kwan, Johnny S H; Bao, Su-Ying; Yang, Wanling; Ho, Shu-Leong; Song, Yong-Qiang; Sham, Pak C

    2013-01-01

    Exome sequencing is becoming a standard tool for mapping Mendelian disease-causing (or pathogenic) non-synonymous single nucleotide variants (nsSNVs). Minor allele frequency (MAF) filtering approach and functional prediction methods are commonly used to identify candidate pathogenic mutations in these studies. Combining multiple functional prediction methods may increase accuracy in prediction. Here, we propose to use a logit model to combine multiple prediction methods and compute an unbiased probability of a rare variant being pathogenic. Also, for the first time we assess the predictive power of seven prediction methods (including SIFT, PolyPhen2, CONDEL, and logit) in predicting pathogenic nsSNVs from other rare variants, which reflects the situation after MAF filtering is done in exome-sequencing studies. We found that a logit model combining all or some original prediction methods outperforms other methods examined, but is unable to discriminate between autosomal dominant and autosomal recessive disease mutations. Finally, based on the predictions of the logit model, we estimate that an individual has around 5% of rare nsSNVs that are pathogenic and carries ~22 pathogenic derived alleles at least, which if made homozygous by consanguineous marriages may lead to recessive diseases. PMID:23341771

  17. Pairwise Kinship Analysis by the Index of Chromosome Sharing Using High-Density Single Nucleotide Polymorphisms

    PubMed Central

    Morimoto, Chie; Manabe, Sho; Kawaguchi, Takahisa; Kawai, Chihiro; Fujimoto, Shuntaro; Hamano, Yuya; Yamada, Ryo; Matsuda, Fumihiko; Tamaki, Keiji

    2016-01-01

    We developed a new approach for pairwise kinship analysis in forensic genetics based on chromosomal sharing between two individuals. Here, we defined “index of chromosome sharing” (ICS) calculated using 174,254 single nucleotide polymorphism (SNP) loci typed by SNP microarray and genetic length of the shared segments from the genotypes of two individuals. To investigate the expected ICS distributions from first- to fifth-degree relatives and unrelated pairs, we used computationally generated genotypes to consider the effect of linkage disequilibrium and recombination. The distributions were used for probabilistic evaluation of the pairwise kinship analysis, such as likelihood ratio (LR) or posterior probability, without allele frequencies and haplotype frequencies. Using our method, all actual sample pairs from volunteers showed significantly high LR values (i.e., ≥ 108); therefore, we can distinguish distant relationships (up to the fifth-degree) from unrelated pairs based on LR. Moreover, we can determine accurate degrees of kinship in up to third-degree relationships with a probability of > 80% using the criterion of posterior probability ≥ 0.90, even if the kinship of the pair is totally unpredictable. This approach greatly improves pairwise kinship analysis of distant relationships, specifically in cases involving identification of disaster victims or missing persons. PMID:27472558

  18. Bioanalytical approaches for the detection of single nucleotide polymorphisms by Surface Plasmon Resonance biosensors.

    PubMed

    Ermini, Maria Laura; Mariani, Stefano; Scarano, Simona; Minunni, Maria

    2014-11-15

    The mapping of specific single nucleotide polymorphisms (SNPs) in patients' genome is a main goal in theranostics, aiming to the development of therapies based on personalized medicine. In this review, Surface Plasmon Resonance (SPR) and Surface Plasmon Resonance imaging (SPRi) biosensors applied to the recognition of SNPs were reviewed, since these technologies are emerging in clinical diagnosis as powerful tools thanks to their analytical features, mainly the real-time and label-free monitoring based on array format for parallel analysis. Since the literature is heterogeneous, a critical classification and a systemic comparison of the analytical performances of published methods were here reviewed on the basis of the analytical strategy and the assay design. In particular, the use of helping agents (i.e. proteins, nanoparticles (NPs), intercalating agents) or artificial DNAs, often coupled to SPR to achieve allele discrimination and/or enhanced sensitivity, were here revised and classified. Finally, the real suitability of SPR biosensors to clinical diagnostics for SNPs detection was addressed by comparing their features and performances with those of other biosensors based on other techniques (e.g. electrochemical biosensors).

  19. A study of single nucleotide polymorphisms of GRIN2B in schizophrenia from Chinese Han population.

    PubMed

    Guo, Zhenming; Niu, Weibo; Bi, Yan; Zhang, Rui; Ren, Decheng; Hu, Jiaxin; Huang, Xiaoye; Wu, Xi; Cao, Yanfei; Yang, Fengping; Wang, Lu; Li, Weidong; Li, Xingwang; Xu, Yifeng; He, Lin; Yu, Tao; He, Guang

    2016-09-01

    Schizophrenia is a severe and complex mental disorder with high heritability. There is evidence that mutations in the gene of Nmethyl-d-aspartate-type glutamate receptors (NMDAR) are associated with schizophrenia. GRIN2B encodes a subunit of NMDARs, and has been identified as a candidate gene for many psychiatric disorders, especially schizophrenia. In this study, we investigated whether single nucleotide polymorphisms (SNPs) in GRIN2B were associated with schizophrenia. Four SNPs (rs890, rs1806191, rs219872, rs172677) were genotyped in 752 schizophrenic patients and 846 healthy controls of the Chinese Han population. Our results indicate differences in allele and genotype frequencies of rs890 between case and control. These results were assessed by adapting different genetic models (codominant, dominant, recessive, overdominant, log-additive models). After controlling for confounding factors including sex and age, rs890 remained associated with schizophrenia. In addition, rs890 and rs1806191 were found to form a haplotype associated with schizophrenia. In summary, our results indicate that the GRIN2B SNP rs890 might be associated with schizophrenia in the Chinese Han population. PMID:27453061

  20. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.

    PubMed

    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine

    2003-10-01

    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  1. Role of ADAM33 gene and associated single nucleotide polymorphisms in asthma.

    PubMed

    Sharma, Neeraj; Tripathi, Priya; Awasthi, Shally

    2011-04-01

    Asthma is a multifactorial disorder, primarily resulting from interactions between genetic and environmental factors. ADAM33 gene (located on chromosome 20p13) has been reported to play an important role in asthma. This review article is intended to include all of the publications, to date, which have assessed the association of ADAM33 gene polymorphisms as well as have shown the role of ADAM33 gene in airway remodeling and their expression with asthma. A PubMed search was performed for studies published between 1990 and 2010. The terms "ADAM33," "ADAM33 gene and asthma," and "ADAM33 gene polymorphisms" were used as search criteria. Based on available literature we can only speculate its role in the morphogenesis and functions of the lung. Fourteen studies conducted in different populations were found showing an association of ADAM33 gene polymorphisms with asthma. However, none of the single nucleotide polymorphisms (SNPs) of ADAM33 gene had found association with asthma across all ethnic groups. Because higher expression of ADAM33 is found in the fibroblast and smooth muscle cells of the lung, over- or underexpression of ADAM33 gene may result in alterations in airway remodeling and repair processes. However, no SNP of ADAM33 gene showed significant associations with asthma across all ethnic groups; the causative polymorphism, if any, still has to be identified.

  2. A Bioinformatics Approach to Prioritize Single Nucleotide Polymorphisms in TLRs Signaling Pathway Genes.

    PubMed

    Alipoor, Behnam; Ghaedi, Hamid; Omrani, Mir Davood; Bastami, Milad; Meshkani, Reza; Golmohammadi, Taghi

    2016-01-01

    It has been suggested that single nucleotide polymorphisms (SNPs) in genes involved in Toll-like receptors (TLRs) pathway may exhibit broad effects on function of this network and might contribute to a range of human diseases. However, the extent to which these variations affect TLR signaling is not well understood. In this study, we adopted a bioinformatics approach to predict the consequences of SNPs in TLRs network. The consequences of non-synonymous coding SNPs (nsSNPs) were predicted by SIFT, PolyPhen, PANTHER, SNPs&GO, I-Mutant, ConSurf and NetSurf tools. Structural visualization of wild type and mutant protein was performed using the project HOPE and Swiss PDB viewer. The influence of 5'-UTR and 3'- UTR SNPs were analyzed by appropriate computational approaches. Nineteen nsSNPs in TLRs pathway genes were found to have deleterious consequences as predicted by the combination of different algorithms. Moreover, our results suggested that SNPs located at UTRs of TLRs pathway genes may potentially influence binding of transcription factors or microRNAs. By applying a pathway-based bioinformatics analysis of genetic variations, we provided a prioritized list of potentially deleterious variants. These findings may facilitate the selection of proper variants for future functional and/or association studies. PMID:27478803

  3. Role of six single nucleotide polymorphisms, risk factors in coronary disease, in OLR1 alternative splicing

    PubMed Central

    Tejedor, J. Ramón; Tilgner, Hagen; Iannone, Camilla; Guigó, Roderic; Valcárcel, Juan

    2015-01-01

    The OLR1 gene encodes the oxidized low-density lipoprotein receptor (LOX-1), which is responsible for the cellular uptake of oxidized LDL (Ox-LDL), foam cell formation in atheroma plaques and atherosclerotic plaque rupture. Alternative splicing (AS) of OLR1 exon 5 generates two protein isoforms with antagonistic functions in Ox-LDL uptake. Previous work identified six single nucleotide polymorphisms (SNPs) in linkage disequilibrium that influence the inclusion levels of OLR1 exon 5 and correlate with the risk of cardiovascular disease. Here we use minigenes to recapitulate the effects of two allelic series (Low- and High-Risk) on OLR1 AS and identify one SNP in intron 4 (rs3736234) as the main contributor to the differences in exon 5 inclusion, while the other SNPs in the allelic series attenuate the drastic effects of this key SNP. Bioinformatic, proteomic, mutational and functional high-throughput analyses allowed us to define regulatory sequence motifs and identify SR protein family members (SRSF1, SRSF2) and HMGA1 as factors involved in the regulation of OLR1 AS. Our results suggest that antagonism between SRSF1 and SRSF2/HMGA1, and differential recognition of their regulatory motifs depending on the identity of the rs3736234 polymorphism, influence OLR1 exon 5 inclusion and the efficiency of Ox-LDL uptake, with potential implications for atherosclerosis and coronary disease. PMID:25904137

  4. A functional single nucleotide polymorphism of SET8 is prognostic for breast cancer

    PubMed Central

    Song, Fengju; Liu, Qun; Dai, Hongji; Zheng, Hong; Cui, Ping; Zhang, Lina; Zhang, Wei; Chen, Kexin

    2016-01-01

    A single-nucleotide polymorphism (SNP) locus rs16917496 (T > C) within the 3′-untranslated region (3′-UTR) of SET8 was associated with susceptibility in several malignancies including breast cancer. To further elucidate the prognostic relevance of this SNP in breast cancer, we conducted a clinical study as well as SET8 expression analysis in a cohort of 1,190 breast cancer patients. We demonstrated the expression levels of SET8 in TT genotype were higher than in CC genotypes, and high levels of SET8 were associated with poor survival. SET8 expression was significantly higher in breast tumor tissue than in paired adjacent normal tissue. In addition, survival analysis in 315 patients showed SNP rs16917496 was an independent prognostic factor of breast cancer outcome with TT genotype associated with poor survival compared with CC/CT genotypes. Thus, this SNP may serve as a genetic prognostic factor and a treatment target for breast cancer. Future studies are warranted. PMID:27144429

  5. Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

    NASA Astrophysics Data System (ADS)

    Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

    2013-09-01

    Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

  6. Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.

    PubMed

    Rotherham, D; Harbison, S A

    2011-04-15

    Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous.

  7. Single nucleotide polymorphisms to discriminate different classes of hybrid between wild Atlantic salmon and aquaculture escapees.

    PubMed

    Pritchard, Victoria L; Erkinaro, Jaakko; Kent, Matthew P; Niemelä, Eero; Orell, Panu; Lien, Sigbjørn; Primmer, Craig R

    2016-09-01

    Many wild Atlantic salmon (Salmo salar) populations are threatened by introgressive hybridization from domesticated fish that have escaped from aquaculture facilities. A detailed understanding of the hybridization dynamics between wild salmon and aquaculture escapees requires discrimination of different hybrid classes; however, markers currently available to discriminate the two types of parental genome have limited power to do this. Using a high-density Atlantic salmon single nucleotide polymorphism (SNP) array, in combination with pooled-sample allelotyping and an Fst outlier approach, we identified 200 SNPs that differentiated an important Atlantic salmon stock from the escapees potentially hybridizing with it. By simulating multiple generations of wild-escapee hybridization, involving wild populations in two major phylogeographic lineages and a genetically diverse set of escapees, we showed that both the complete set of SNPs and smaller subsets could reliably assign individuals to different hybrid classes up to the third hybrid (F3) generation. This set of markers will be a useful tool for investigating the genetic interactions between native wild fish and aquaculture escapees in many Atlantic salmon populations.

  8. The development and characterization of a 57K single nucleotide polymorphism array for rainbow trout.

    PubMed

    Palti, Y; Gao, G; Liu, S; Kent, M P; Lien, S; Miller, M R; Rexroad, C E; Moen, T

    2015-05-01

    In this study, we describe the development and characterization of the first high-density single nucleotide polymorphism (SNP) genotyping array for rainbow trout. The SNP array is publically available from a commercial vendor (Affymetrix). The SNP genotyping quality was high, and validation rate was close to 90%. This is comparable to other farm animals and is much higher than previous smaller scale SNP validation studies in rainbow trout. High quality and integrity of the genotypes are evident from sample reproducibility and from nearly 100% agreement in genotyping results from other methods. The array is very useful for rainbow trout aquaculture populations with more than 40 900 polymorphic markers per population. For wild populations that were confounded by a smaller sample size, the number of polymorphic markers was between 10 577 and 24 330. Comparison between genotypes from individual populations suggests good potential for identifying candidate markers for populations' traceability. Linkage analysis and mapping of the SNPs to the reference genome assembly provide strong evidence for a wide distribution throughout the genome with good representation in all 29 chromosomes. A total of 68% of the genome scaffolds and contigs were anchored through linkage analysis using the SNP array genotypes, including ~20% of the genome assembly that has not been previously anchored to chromosomes.

  9. Development of a cassava core collection based on single nucleotide polymorphism markers.

    PubMed

    Oliveira, E J; Ferreira, C F; Santos, V S; Oliveira, G A F

    2014-08-25

    Single nucleotide polymorphism (SNP) markers were used in the largest cassava (Manihot esculenta Crantz) germplasm collection from Brazil to develop core collections based on the maximization strategy. Subsets with 61, 64, 84, 128, 256, and 384 cassava accessions were selected and named PoHEU, MST64, PoRAN, MST128, MST256, and MST384, respectively. All the 798 alleles identified by 402 SNP markers in the entire collection were captured in all core collections. Only small alterations in the diversity parameters were observed for the different core collections compared with the complete collection. Because of the optimal adjustment of the validation parameters representative of the complete collection, the absence of genotypes with high genetic similarity and the maximization of the genetic distances between accessions of the PoHEU core collection, which contained 4.7% of the accessions of the complete collection, maximized the genetic conservation of this important cassava collection. Furthermore, the development of this core collection will allow concentrated efforts toward future characterization and agronomic evaluation of accessions to maximize the diversity and genetic gains in cassava breeding programs.

  10. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

    PubMed

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

    2016-06-01

    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations.

  11. In silico prediction of splice-altering single nucleotide variants in the human genome.

    PubMed

    Jian, Xueqiu; Boerwinkle, Eric; Liu, Xiaoming

    2014-12-16

    In silico tools have been developed to predict variants that may have an impact on pre-mRNA splicing. The major limitation of the application of these tools to basic research and clinical practice is the difficulty in interpreting the output. Most tools only predict potential splice sites given a DNA sequence without measuring splicing signal changes caused by a variant. Another limitation is the lack of large-scale evaluation studies of these tools. We compared eight in silico tools on 2959 single nucleotide variants within splicing consensus regions (scSNVs) using receiver operating characteristic analysis. The Position Weight Matrix model and MaxEntScan outperformed other methods. Two ensemble learning methods, adaptive boosting and random forests, were used to construct models that take advantage of individual methods. Both models further improved prediction, with outputs of directly interpretable prediction scores. We applied our ensemble scores to scSNVs from the Catalogue of Somatic Mutations in Cancer database. Analysis showed that predicted splice-altering scSNVs are enriched in recurrent scSNVs and known cancer genes. We pre-computed our ensemble scores for all potential scSNVs across the human genome, providing a whole genome level resource for identifying splice-altering scSNVs discovered from large-scale sequencing studies.

  12. [Association between single nucleotide polymorphism of MC4R gene and carcass traits in rabbits].

    PubMed

    Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia; Deng, Xiao-Song; Chen, Yun; Wan, Jie

    2008-12-01

    Single nucleotide polymorphisms in the coding sequence of melanoeortin-4 receptor (MC4R) gene were detected by PCR-SSCP and DNA sequencing method in Harbin white rabbit, Tianfu black rabbit, Belgian hare, ZIKA rabbit, and California rabbit breeds. A-->G conversion mutation at base position 237 was found with high frequency in Harbin white rabbit, Belgian hare, and Zika rabbit and low frequency in Tianfu black rabbit and California rabbit. The allele A was pre-dominant allele for each of meat rabbit breeds. AA genotype frequency was higher than AG genotype in the five studied rabbit breeds. GLM analysis for the effect of genotypes on performance traits demonstrated that AG genotype was significantly associated with body weight, eviscerated weight and feed conversion efficiency (P<0.05), but not significantly associated with cooking loss (P>0.05). It was concluded from the results that MC4R gene could be a candidate modifier gene that affects or controls body weight and carcass traits of rabbit.

  13. Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer

    PubMed Central

    Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E.; Bowtell, David; Bowtell, David; Chenevix-Trench, Georgia; deFazio, Anna; Gertig, Dorota; Green, Adle; Webb, Penelope; Hung, Jillian; Moore, Sue; Traficante, Nadia; Fereday, Sian; Harrap, Karen; Sadkowsky, Troy; Pandeya, Nirmala; Stuart-Harris, Robin; Kirsten, Fred; Rutovitz, Josie; Clingan, Peter; Glasgow, Amanda; Proietto, Anthony; Braye, Stephen; Otton, Greg; Shannon, Jennifer; Bonaventura, Tony; Stewart, James; Begbie, Stephen; Friedlander, Michael; Bell, David; Baron-Hay, Sally; Ferrier, Alan; Gard, Greg; Nevell, David; Pavlakis, Nick; Valmadre, Sue; Young, Barbara; Camaris, Catherine; Crouch, Roger; Edwards, Lyndal; Hacker, Neville; Marsden, Donald; Robertson, Greg; Beale, Phillip; Beith, Jane; Carter, Jonothan; Dalrymple, Chris; Hamilton, Anne; Houghton, Roger; Russell, Peter; Links, Matthew; Grygiel, John; Hill, Jane; Brand, Alison; Byth, Karen; Jaworski, Richard; Harnett, Paul; Sharma, Raghwa; Achen, Anita; Wain, Gerard; Ward, Bruce; Papadimos, David; Crandon, Alex; Cummings, Margaret; Horwood, Ken; Obermair, Andreas; Perrin, Lew; Wyld, David; Nicklin, Jim; Davy, Margaret; Oehler, Martin K; Hall, Chris; Dodd, Tom; Healy, Tabitha; Pittman, Ken; Henderson, Doug; Miller, John; Pierdes, John; Blomfield, Penny; Challis, David; McIntosh, Robert; Parker, Andrew; Brown, Bob; Rome, Robert; Allen, David; Grant, Peter; Hyde, Simon; Laurie, Rohan; Robbie, Melissa; Healy, David; Jobling, Tom; Manolitsas, Tom; McNealage, Jane; Rogers, Peter; Susil, Beatrice; Sumithran, Eric; Simpson, Ian; Phillips, Kelly; Rischin, Danny; Fox, Stephen; Johnson, Daryl; Waring, Paul; Lade, Stephen; Loughrey, Maurice; O’Callaghan, Neil; Murray, William; Billson, Virginia; Pyman, Jan; Neesham, Debra; Quinn, Michael; Underhill, Craig; Bell, Richard; Ng, Leong-Fook; Blum, Robert; Ganju, Vinod; Hammond, Ian; Leung, Yee; McCartney, Anthony; Buck, Martin; Haviv, Izak; Purdie, David; Whiteman, David; Zeps, Nikolajs; Malt, Mary-Rose; Mellon, Anne; Robertson, Randall; Bergh, Trish Vanden; Jones, Marian; Mackenzie, Patricia; Maidens, Jane; Nattress, Kath; Chiew, Yoke-Eng; Stenlake, Annie; Sullivan, Helen; Alexander, Barbara; Ashover, Pat; Brown, Sue; Corrish, Tracy; Green, Lyn; Jackman, Leah; Ferguson, Kaltin; Martin, Karen; Martyn, Adam; Ranieri, Barbara; White, Jo; Jayde, Victoria; Bowes, Leanne; Mamers, Pamela; Galletta, Laura; Giles, Debra; Hendley, Joy; Alsop, Katherine; Schmidt, Trudy; Shirley, Helen; Ball, Colleen; Young, Cherry; Viduka, Suzanna; Tran, Hoa; Bilic, Sanela; Glavinas, Lydia; Brooks, Julia; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L.; deFazio, Anna

    2014-01-01

    ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells. PMID:24810093

  14. In silico prediction of splice-altering single nucleotide variants in the human genome

    PubMed Central

    Jian, Xueqiu; Boerwinkle, Eric; Liu, Xiaoming

    2014-01-01

    In silico tools have been developed to predict variants that may have an impact on pre-mRNA splicing. The major limitation of the application of these tools to basic research and clinical practice is the difficulty in interpreting the output. Most tools only predict potential splice sites given a DNA sequence without measuring splicing signal changes caused by a variant. Another limitation is the lack of large-scale evaluation studies of these tools. We compared eight in silico tools on 2959 single nucleotide variants within splicing consensus regions (scSNVs) using receiver operating characteristic analysis. The Position Weight Matrix model and MaxEntScan outperformed other methods. Two ensemble learning methods, adaptive boosting and random forests, were used to construct models that take advantage of individual methods. Both models further improved prediction, with outputs of directly interpretable prediction scores. We applied our ensemble scores to scSNVs from the Catalogue of Somatic Mutations in Cancer database. Analysis showed that predicted splice-altering scSNVs are enriched in recurrent scSNVs and known cancer genes. We pre-computed our ensemble scores for all potential scSNVs across the human genome, providing a whole genome level resource for identifying splice-altering scSNVs discovered from large-scale sequencing studies. PMID:25416802

  15. HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity.

    PubMed

    Nonnemacher, Michael R; Pirrone, Vanessa; Feng, Rui; Moldover, Brian; Passic, Shendra; Aiamkitsumrit, Benjamas; Dampier, Will; Wojno, Adam; Kilareski, Evelyn; Blakey, Brandon; Ku, Tse-Sheun Jade; Shah, Sonia; Sullivan, Neil T; Jacobson, Jeffrey M; Wigdahl, Brian

    2016-01-01

    The large majority of human immunodeficiency virus type 1 (HIV-1) markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs) contained within the viral promoter or long terminal repeat (LTR) in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES) Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter)/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count). PMID:27100290

  16. Single nucleotide polymorphisms of ataxia telangiectasia mutated and the risk of papillary thyroid carcinoma.

    PubMed

    Song, Chang Myeon; Kwon, Tack-Kyun; Park, Byung Lae; Ji, Yong Bae; Tae, Kyung

    2015-01-01

    Genetic factors associated with susceptibility to papillary thyroid carcinoma (PTC) are not well known. We evaluated the association between single nucleotide polymorphisms (SNPs) of ataxia telangiectasia mutated (ATM) and the risk of PTC. A total of 437 histologically confirmed PTC cases and 184 cancer-free controls without thyroid nodules were recruited. Genotypes with respect to five ATM SNPs (rs189037, rs664677, rs373759, rs664143, and rs4585) were determined by the TaqMan assay, and odds ratios and 95% confidence intervals were obtained by logistic regression analysis. Linkage disequilibria and haplotypes were examined from the genotype data. When evaluated separately the genotype distributions of the five ATM SNPs were similar in the PTC cases and controls. Three ATM SNPs (rs373759, rs664143, and rs4585) were found to be in strong linkage disequilibrium (D' = 1.00, P < 0.001). When the three haplotypes (C-A-G), (T-G-T), and (C-G-T) of these three ATM SNP sites were analyzed, ATM haplotype (C-G-T) +/- was associated with a lower risk of PTC than ATM haplotype (C-G-T) -/- (P = 0.03) after adjusting for age and gender. Our results suggest that genetic polymorphisms of ATM may play an important role in the development of thyroid cancer in the Korean population.

  17. Nano-enabled bioanalytical approaches to ultrasensitive detection of low abundance single nucleotide polymorphisms

    PubMed Central

    Lapitan Jr., Lorico D. S.; Guo, Yuan

    2015-01-01

    Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914

  18. Polyacrylamide gel film immobilized molecular beacon array for single nucleotide mismatch detection.

    PubMed

    Wang, Yijin; Wang, Hong; Gao, Lu; Liu, Heping; Lu, Zuhong; He, Nongyue

    2005-04-01

    We reported polyacrylamide gel immobilized molecular beacon array for single nucleotide mismatch detection in this paper. Molecular beacons are oligonucleotide probes fluorescing upon hybridization to their complementary DNA/RNA targets with excellent sensitivity and high selectivity. The specially designed molecular beacon for immobilization contains a 15 base loop sequence with a 5 base pair stem, a polyT (20 bases) spacer, a 5'-end amino group for immobilization, a fluorescein in the middle of the sequence as the fluorophore, and a 3'-end DABCYL as the quencher. Between the 5'-end amino group and the stem, the polyT is used to minimize disability caused by 5'-end immobilization. The molecular beacon microarray was fabricated by a pin-based spotting robot and the hybridization was investigated by confocal microscope. A real-time hybridization process at room temperature was registered every minute for 20 min after the target solution was pumped into the hybridization cell. The result indicates that a polyacrylamide film coated glass slide provides an ideal solution-like environment for molecular beacon probes. The potential applications of this kind of molecular beacon array are mutation detection, disease mechanisms, disease diagnostics, etc. in a parallel, cost saving, and label-free detection way.

  19. Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

    2008-11-01

    Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

  20. Validation of Single Nucleotide Polymorphisms Associated with Carcass Traits in a Commercial Hanwoo Population

    PubMed Central

    Sudrajad, Pita; Sharma, Aditi; Dang, Chang Gwon; Kim, Jong Joo; Kim, Kwan Suk; Lee, Jun Heon; Kim, Sidong; Lee, Seung Hwan

    2016-01-01

    Four carcass traits, namely carcass weight (CW), eye muscle area (EMA), back fat thickness (BF), and marbling score (MS), are the main price decision parameters used for purchasing Hanwoo beef. The development of DNA markers for these carcass traits for use in a beef management system could result in substantial profit for beef producers in Korea. The objective of this study was to validate the association of highly significant single nucleotide polymorphisms (SNPs) identified in a previous genome-wide association study (GWAS) with the four carcass traits in a commercial Hanwoo population. We genotyped 83 SNPs distributed across all 29 autosomes in 867 steers from a Korean Hanwoo feedlot. Six SNPs, namely ARS-BFGL-NGS-22774 (Chr4, Pos:4889229), ARS-BFGL-NGS-100046 (Chr6, Pos:61917424), ARS-BFGL-NGS-39006 (Chr27, Pos:38059196), ARS-BFGL-NGS-18790 (Chr10, Pos:26489109), ARS-BFGL-NGS-43879 (Chr9, Pos:39964297), and BTB-00775794 (Chr20, Pos:20476265), were found to be associated with CW, EMA, BF, and MS. The ARS-BFGL-NGS-22774, BTB-00775794, and ARS-BFGL-NGS-39006 markers accounted for 1.80%, 1.72%, and 1.35% (p<0.01), respectively, of the phenotypic variance in the commercial Hanwoo population. Many genes located in close proximity to the significant SNPs identified in this study were previously reported to have roles in carcass traits. The results of this study could be useful for marker-assisted selection programs. PMID:26954199

  1. Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.).

    PubMed

    Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco

    2013-04-01

    Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. PMID:23415335

  2. The role of Vitamin D level and related single nucleotide polymorphisms in Crohn's disease.

    PubMed

    Carvalho, Andre Y O M; Bishop, Karen S; Han, Dug Yeo; Ellett, Stephanie; Jesuthasan, Amalini; Lam, Wen J; Ferguson, Lynnette R

    2013-09-27

    New Zealand has one of the highest rates of Crohn's Disease (CD) in the world, and there is much speculation as to why this might be. A high risk of CD has been associated with deficient or insufficient levels of Vitamin D (Vit D), lifestyle as well as various genetic polymorphisms. In this study we sought to analyse the relevance of serum Vit D levels, lifestyle and genotype to CD status. Serum samples were analysed for 25-OH-Vitamin D levels. DNA was isolated from blood and cheek-swabs, and Sequenom and ImmunoChip techniques were used for genotyping. Serum Vit D levels were significantly lower in CD patients (mean = 49.5 mg/L) than those found in controls (mean = 58.9 mg/L, p = 4.74 × 10⁻⁶). A total of seven single nucleotide polymorphisms were examined for effects on serum Vit D levels, with adjustment for confounding variables. Two variants: rs731236[A] (VDR) and rs732594[A] (SCUBE3) showed a significant association with serum Vit D levels in CD patients. Four variants: rs7975232[A] (VDR), rs732594[A] (SCUBE3), and rs2980[T] and rs2981[A] (PHF-11) showed a significant association with serum Vit D levels in the control group. This study demonstrates a significant interaction between Vit D levels and CD susceptibility, as well as a significant association between Vit D levels and genotype.

  3. The bovine 5' AMPK gene family: mapping and single nucleotide polymorphism detection.

    PubMed

    McKay, Stephanie D; White, Stephen N; Kata, Srinivas R; Loan, Raymond; Womack, James E

    2003-12-01

    The 5'-AMP-activated protein kinase (AMPK) family is an ancient stress response system whose primary function is regulation of cellular ATP. Activation of AMPK, which is instigated by environmental and nutritional stresses, initiates energy-conserving measures that protect the cell by inhibition and phosphorylation of key enzymes in energy-consuming biochemical pathways. The seven genes that comprise the bovine AMPK family were mapped in cattle by using a radiation hybrid panel. The seven genes mapped to six different cattle chromosomes, each with a LOD score greater than 10.0. PRKAA1 mapped to BTA 20, PRKAA2 and PRKAB2 to BTA 3, PRKAB1 to BTA 17, PRKAG1 to BTA 5, PRKAG2 to BTA 4, and PRKAG3 to BTA 2. Five of the seven genes mapped to regions expected from human/cattle comparative maps. PRKAB2 and PRKAG3, however, have not been mapped in humans. We predict these genes to be located on HSA 1 and 2, respectively. Additionally, one synonymous and one non-synonymous single nucleotide polymorphism (SNP) were detected in PRKAG3 in Bos taurus cattle. In an effort to determine ancestral origins, various herds of mixed breed cattle as well as other ruminant species were characterized for sequence variation in this region of PRKAG3. Owing to the physiological importance of this gene family, we believe that its individual genes are candidate genes for conferring resistance to diseases in cattle.

  4. [Association between single nucleotide polymorphism of MC4R gene and carcass traits in rabbits].

    PubMed

    Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia; Deng, Xiao-Song; Chen, Yun; Wan, Jie

    2008-12-01

    Single nucleotide polymorphisms in the coding sequence of melanoeortin-4 receptor (MC4R) gene were detected by PCR-SSCP and DNA sequencing method in Harbin white rabbit, Tianfu black rabbit, Belgian hare, ZIKA rabbit, and California rabbit breeds. A-->G conversion mutation at base position 237 was found with high frequency in Harbin white rabbit, Belgian hare, and Zika rabbit and low frequency in Tianfu black rabbit and California rabbit. The allele A was pre-dominant allele for each of meat rabbit breeds. AA genotype frequency was higher than AG genotype in the five studied rabbit breeds. GLM analysis for the effect of genotypes on performance traits demonstrated that AG genotype was significantly associated with body weight, eviscerated weight and feed conversion efficiency (P<0.05), but not significantly associated with cooking loss (P>0.05). It was concluded from the results that MC4R gene could be a candidate modifier gene that affects or controls body weight and carcass traits of rabbit. PMID:19073572

  5. Single nucleotide polymorphism profiling across the methotrexate pathway in normal subjects and patients with rheumatoid arthritis.

    PubMed

    Ranganathan, Prabha; Culverhouse, Robert; Marsh, Sharon; Ahluwalia, Ranjeet; Shannon, William D; Eisen, Seth; McLeod, Howard L

    2004-07-01

    Methotrexate (MTX) is a commonly used disease-modifying antirheumatic drug in rheumatoid arthritis (RA). Polymorphisms occur in several genes encoding key enzymes in the folic acid pathway, which is influenced by MTX, but have not been evaluated in patients with RA. The effect of race on allele frequency has also not been evaluated. In this study, the allele frequencies of polymorphisms in six key enzymes in the MTX-folate pathway in patients with RA and healthy controls, including several common racial groups were studied. European- and African-American patients with RA and European and African healthy controls were genotyped for 22 genetic loci in six genes in the MTX cellular pathway. Differences in genotype distributions between the different racial groups were evaluated using chi(2) tests. Allele frequencies were significantly different (p < 0.001) for eight single nucleotide polymorphisms between the European and African controls. The allele frequencies of two polymorphisms showed significant differences (p < 0.001) between the African- and European-American patients with RA. Thus, racial differences exist between the allele frequencies of several polymorphisms in enzymes in the MTX-folate pathway in patients with RA and healthy controls. Whether such differences contribute to a differential response to MTX in patients with RA deserves to be investigated.

  6. Single nucleotide polymorphisms in Brahman steers and their association with carcass and tenderness traits.

    PubMed

    Smith, T; Thomas, M G; Bidner, T D; Paschal, J C; Franke, D E

    2009-01-20

    Data from purebred Brahman steers (N = 467) were used to study the association of single nucleotide polymorphisms (SNP) with carcass traits and measures of tenderness. Fall weaned calves were grazed and fed in a subtropical environment and then harvested for processing in a commercial facility. Carcass data were recorded 24 h postmortem. Muscle samples and primal ribs were obtained to measure calpastatin activity and shear force. DNA was used to determine genotypes of thyroglobulin (TG5), calpastatin (CAST) and mu-calpain (CAPN 316 and CAPN 4751) SNP. Minor allele frequencies for CAST, CAPN 316 and CAPN 4751 were 0.342, 0.031, and 0.051, respectively. CAST genotypes were associated with calpastatin enzyme activity (P < 0.01) and shear force of steaks aged for 14-day postmortem (P < 0.05). CAPN 316 genotypes were also associated with variation in shear force of steaks aged for 14 days (P < 0.05). CAPN 4751 genotypes approached significance for association with shear force of steaks after 7 and 14 days (P < 0.08). Genotypes for TG5 were non-polymorphic (i.e., minor allele frequency = 0.004) and omitted from further analyses. Neither CAST nor CAPN SNP was associated with variation in other carcass traits.

  7. Pairwise Kinship Analysis by the Index of Chromosome Sharing Using High-Density Single Nucleotide Polymorphisms.

    PubMed

    Morimoto, Chie; Manabe, Sho; Kawaguchi, Takahisa; Kawai, Chihiro; Fujimoto, Shuntaro; Hamano, Yuya; Yamada, Ryo; Matsuda, Fumihiko; Tamaki, Keiji

    2016-01-01

    We developed a new approach for pairwise kinship analysis in forensic genetics based on chromosomal sharing between two individuals. Here, we defined "index of chromosome sharing" (ICS) calculated using 174,254 single nucleotide polymorphism (SNP) loci typed by SNP microarray and genetic length of the shared segments from the genotypes of two individuals. To investigate the expected ICS distributions from first- to fifth-degree relatives and unrelated pairs, we used computationally generated genotypes to consider the effect of linkage disequilibrium and recombination. The distributions were used for probabilistic evaluation of the pairwise kinship analysis, such as likelihood ratio (LR) or posterior probability, without allele frequencies and haplotype frequencies. Using our method, all actual sample pairs from volunteers showed significantly high LR values (i.e., ≥ 108); therefore, we can distinguish distant relationships (up to the fifth-degree) from unrelated pairs based on LR. Moreover, we can determine accurate degrees of kinship in up to third-degree relationships with a probability of > 80% using the criterion of posterior probability ≥ 0.90, even if the kinship of the pair is totally unpredictable. This approach greatly improves pairwise kinship analysis of distant relationships, specifically in cases involving identification of disaster victims or missing persons. PMID:27472558

  8. Discovering All Transcriptome Single-Nucleotide Polymorphisms and Scanning for Selection Signatures in Ducks (Anas platyrhynchos)

    PubMed Central

    Lin, Ruiyi; Du, Xiaoyong; Peng, Sixue; Yang, Liubin; Ma, Yunlong; Gong, Yanzhang; Li, Shijun

    2015-01-01

    The duck is one of the most economically important waterfowl as a source of meat, eggs, and feathers. Characterizing the genetic variation in duck species is an important step toward linking genes or genomic regions with phenotypes. Human-driven selection during duck domestication and subsequent breed formation has likely left detectable signatures in duck genome. In this study, we employed a panel of >1.4 million single-nucleotide polymorphisms (SNPs) identified from the RNA sequencing (RNA-seq) data of 15 duck individuals. The density of the resulting SNPs is significantly positively correlated with the density of genes across the duck genome, which demonstrates that the usage of the RNA-seq data allowed us to enrich variant functional categories, such as coding exons, untranslated regions (UTRs), introns, and downstream/upstream. We performed a complete scan of selection signatures in the ducks using the composite likelihood ratio (CLR) and found 76 candidate regions of selection, many of which harbor genes related to phenotypes relevant to the function of the digestive system and fat metabolism, including TCF7L2, EIF2AK3, ELOVL2, and fatty acid-binding protein family. This study illustrates the potential of population genetic approaches for identifying genomic regions affecting domestication-related phenotypes and further helps to increase the known genetic information about this economically important animal. PMID:26819540

  9. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  10. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  11. Electroactive chitosan nanoparticles for the detection of single-nucleotide polymorphisms using peptide nucleic acids.

    PubMed

    Kerman, Kagan; Saito, Masato; Tamiya, Eiichi

    2008-08-01

    Here we report an electrochemical biosensor that would allow for simple and rapid analysis of nucleic acids in combination with nuclease activity on nucleic acids and electroactive bionanoparticles. The detection of single-nucleotide polymorphisms (SNPs) using PNA probes takes advantage of the significant structural and physicochemical differences between the full hybrids and SNPs in PNA/DNA and DNA/DNA duplexes. Ferrocene-conjugated chitosan nanoparticles (Chi-Fc) were used as the electroactive indicator of hybridization. Chi-Fc had no affinity towards the neutral PNA probe immobilized on a gold electrode (AuE) surface. When the PNA probe on the electrode surface hybridized with a full-complementary target DNA, Chi-Fc electrostatically attached to the negatively-charged phosphate backbone of DNA on the surface and gave rise to a high electrochemical oxidation signal from ferrocene at approximately 0.30 V. Exposing the surface to a single-stranded DNA specific nuclease, Nuclease S1, was found to be very effective for removing the nonspecifically adsorbed SNP DNA. An SNP in the target DNA to PNA made it susceptible to the enzymatic digestion. After the enzymatic digestion and subsequent exposure to Chi-Fc, the presence of SNPs was determined by monitoring the changes in the electrical current response of Chi-Fc. The method provided a detection limit of 1 fM (S/N = 3) for the target DNA oligonucleotide. Additionally, asymmetric PCR was employed to detect the presence of genetically modified organism (GMO) in standard Roundup Ready soybean samples. PNA-mediated PCR amplification of real DNA samples was performed to detect SNPs related to alcohol dehydrogenase (ALDH). Chitosan nanoparticles are promising biomaterials for various analytical and pharmaceutical applications.

  12. Distribution of cytokine gene single nucleotide polymorphisms among a multi-ethnic Iranian population

    PubMed Central

    Kurdistani, Zana Karimi; Saberi, Samaneh; Talebkhan, Yeganeh; Oghalaie, Akbar; Esmaeili, Maryam; Mohajerani, Nazanin; Bababeik, Maryam; Hassanpour, Parisa; Barani, Shaghik; Farjaddoost, Ameneh; Ebrahimzadeh, Fatemeh; Trejaut, Jean; Mohammadi, Marjan

    2015-01-01

    Background: Cytokine gene single nucleotide polymorphisms (SNPs) are widely used to study susceptibility to complex diseases and as a tool for anthropological studies. Materials and Methods: To investigate cytokine SNPs in an Iranian multi-ethnic population, we have investigated 10 interleukin (IL) SNPs (IL-1β (C-511T, T-31C), IL-2 (G-384T), IL-4 (C-590T), IL-6 (G-174C), IL-8 (T-251A), IL-10 (G-1082A, C-819T, C-592A) and tumor necrosis factor-alpha (TNF-α) (G-308A) in 415 Iranian subjects comprising of 6 different ethnicities. Allelic and genotypic frequencies as well as Hardy-Weinberg equilibrium (HWE) were calculated by PyPop software. Population genetic indices including observed heterozygosity (Ho), expected heterozygosity (He), fixation index (FIS), the effective number of alleles (Ne) and polymorphism information content (PIC) were derived using Popgene 32 software. Multidimensional scaling (MDS) was constructed using Reynold's genetic distance obtained from the frequencies of cytokine gene polymorphism. Results: Genotypic distributions were consistent with the HWE assumptions, except for 3 loci (IL-4-590, IL-8-251 and IL-10-819) in Fars and 4 loci (IL-4-590, IL-6-174, IL-10-1082 and TNF-α-308) in Turks. Pairwise assessment of allelic frequencies, detected differences at the IL-4-590 locus in Gilakis versus Kurds (P = 0.028) and Lurs (P = 0.022). Mazanis and Gilakis displayed the highest (Ho= 0.50 ± 0.24) and lowest (Ho= 0.34 ± 0.16) mean observed heterozygosity, respectively. Conclusions: MDS analysis of our study population, in comparison with others, revealed that Iranian ethnicities except Kurds and Mazanis were tightly located within a single cluster with closest genetic affinity to Europeans. PMID:26436076

  13. Methods to Increase the Sensitivity of High Resolution Melting Single Nucleotide Polymorphism Genotyping in Malaria.

    PubMed

    Daniels, Rachel; Hamilton, Elizabeth J; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F; Hartl, Daniel L; Volkman, Sarah K

    2015-01-01

    Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs

  14. Methods to Increase the Sensitivity of High Resolution Melting Single Nucleotide Polymorphism Genotyping in Malaria

    PubMed Central

    Daniels, Rachel; Hamilton, Elizabeth J.; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F.; Hartl, Daniel L.; Volkman, Sarah K.

    2015-01-01

    Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs

  15. Donor Nucleotide-Binding Oligomerization-Containing Protein 2 (NOD2) Single Nucleotide Polymorphism 13 Is Associated with Septic Shock after Allogeneic Stem Cell Transplantation.

    PubMed

    Grube, Matthias; Brenmoehl, Julia; Rogler, Gerhard; Hahn, Joachim; Herr, Wolfgang; Holler, Ernst

    2015-08-01

    Single nucleotide polymorphisms (SNPs) within nucleotide-binding oligomerization domain-containing protein 2 (NOD2) and toll-like receptor (TLR) 5 genes have been recently associated with the incidence and outcome of infections. In this study, we analyzed 38 patients with septic shock after allogeneic stem cell transplantation (allo-SCT) for an association of SNPs within NOD2 and TLR5 genes, with susceptibility to septic shock. One hundred twenty-seven transplant recipients unaffected by any infectious complications were used as controls. We found a significant association between the presence of donor NOD2 SNP13 (3016_3017insC) and the incidence of septic shock (P = .002). In multivariate analysis, donor NOD2 SNP13 appeared as an independent risk factor for the incidence of septic shock after allo-SCT. No association was found for recipient SNPs (NOD2 and TLR5) and donor NOD2 SNP8, SNP12, and TLR5-Stop SNP. Our results suggest that NOD2 SNP13 has an impact on the pathophysiology of severe infectious complications and is an independent risk factor for the development of septic shock after allo-SCT.

  16. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    PubMed Central

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  17. Visual detection of single-nucleotide polymorphism with hairpin oligonucleotide-functionalized gold nanoparticles.

    PubMed

    He, Yuqing; Zeng, Kang; Gurung, Anant S; Baloda, Meenu; Xu, Hui; Zhang, Xibao; Liu, Guodong

    2010-09-01

    We report a simple, fast, and sensitive approach for visual detection of single-nucleotide polymorphism (SNP) based on hairpin oligonucleotide-functionalized gold nanoparticle (HO-Au-NP) and lateral flow strip biosensor (LFSB). The results presented here expand on prior work ( Mao , X. , Xu , H. , Zeng , Q. , Zeng , L. , and Liu , G. Chem. Commun. 2009 , 3065-3067 .) by providing new approach to prepare HO-Au-NP conjugates with a deoxyadenosine triphosphate (dATP) blocker, which shortens the preparation time of the conjugates from 50 to 8 h and lowers the detection limit 500 times. A hairpin oligonucleotide modified with a thiol at the 5'-end and a biotin at the 3'-end was conjugated with Au-NP through a self-assembling process. Following a blocking step with dATP, the hairpin structure of HO and dATP embed the biotin groups, and make the biotin groups in close proximity to the Au-NP surface, leading to the biotins being "inactive". The strategy of detecting SNP depends on the unique molecular recognition properties of HO to the perfect-matched DNA and single-base-mismatched DNA to generate different quantities of "active" biotin groups on the Au-NP surface. After hybridization reactions, the Au-NPs associated with the activated biotins are captured on the test zone of LFSB via the specific reaction between the activated biotin and preimmobilized streptavidin. Accumulation of Au-NPs produces the characteristic red bands, enabling visual detection of SNP. The preparations of HO-Au-NP conjugates with dATP and the parameters of assay were optimized systematically, and the abilities of detecting SNP were examined in details. The current approach is capable of discriminating as low as 10 pM of perfect-matched DNA and single-base-mismatched DNA within 25 min without instrumentation. Moreover, the approach provides a lower background and higher selectivity compared to the current molecular beacon-based SNP detection. The protocol should facilitate the simple, fast, and

  18. Functional and Structural Consequences of Damaging Single Nucleotide Polymorphisms in Human Prostate Cancer Predisposition Gene RNASEL.

    PubMed

    Datta, Amit; Mazumder, Md Habibul Hasan; Chowdhury, Afrin Sultana; Hasan, Md Anayet

    2015-01-01

    A commonly diagnosed cancer, prostate cancer (PrCa), is being regulated by the gene RNASEL previously known as PRCA1 codes for ribonuclease L which is an integral part of interferon regulated system that mediates antiviral and antiproliferative role of the interferons. Both somatic and germline mutations have been implicated to cause prostate cancer. With an array of available Single Nucleotide Polymorphism data on dbSNP this study is designed to sort out functional SNPs in RNASEL by implementing different authentic computational tools such as SIFT, PolyPhen, SNPs&GO, Fathmm, ConSurf, UTRScan, PDBsum, Tm-Align, I-Mutant, and Project HOPE for functional and structural assessment, solvent accessibility, molecular dynamics, and energy minimization study. Among 794 RNASEL SNP entries 124 SNPs were found nonsynonymous from which SIFT predicted 13 nsSNPs as nontolerable whereas PolyPhen-2 predicted 28. SNPs found on the 3' and 5' UTR were also assessed. By analyzing six tools having different perspectives an aggregate result was produced where nine nsSNPs were found to be most likely to exert deleterious effect. 3D models of mutated proteins were generated to determine the functional and structural effect of the mutations on ribonuclease L. The initial findings were reinforced by the results from I-Mutant and Project HOPE as these tools predicted significant structural and functional instability of the mutated proteins. Expasy-ProSit tool defined the mutations to be situated in the functional domains of the protein. Considering previous analysis this study revealed a conclusive result deducing the available SNP data on the database by identifying the most damaging three nsSNP rs151296858 (G59S), rs145415894 (A276V), and rs35896902 (R592H). As such studies involving polymorphisms of RNASEL were none to be found, the results of the current study would certainly be helpful in future prospects concerning prostate cancer in males. PMID:26236721

  19. Functional Impact of 14 Single Nucleotide Polymorphisms Causing Missense Mutations of Human α7 Nicotinic Receptor.

    PubMed

    Zhang, Qinhui; Du, Yingjie; Zhang, Jianliang; Xu, Xiaojun; Xue, Fenqin; Guo, Cong; Huang, Yao; Lukas, Ronald J; Chang, Yongchang

    2015-01-01

    The α7nicotinic receptor (nAChR) is a major subtype of the nAChRs in the central nervous system, and the receptor plays an important role in brain function. In the dbSNP database, there are 55 single nucleotide polymorphisms (SNPs) that cause missense mutations of the human α7nAChR in the coding region. In this study, we tested the impact of 14 SNPs that cause missense mutations in the agonist binding site or the coupling region between binding site and channel gate on the receptor function. The wild type or mutant receptors were expressed or co-expressed in Xenopus oocytes, and the agonist-induced currents were tested using two-electrode voltage clamp. Our results demonstrated that 6 mutants were nonfunctional, 4 mutants had reduced current expression, and 1 mutants altered ACh and nicotine efficacy in the opposite direction, and one additional mutant had slightly reduced agonist sensitivity. Interestingly, the function of most of these nonfunctional mutants could be rescued by α7nAChR positive allosteric modulator PNU-120596 and agonist-PAM 4BP-TQS. Finally, when coexpressed with the wild type, the nonfunctional mutants could also influence the receptor function. These changes of the receptor properties by the mutations could potentially have an impact on the physiological function of the α7nAChR-mediated cholinergic synaptic transmission and anti-inflammatory effects in the human SNP carriers. Rescuing the nonfunctional mutants could provide a novel way to treat the related disorders. PMID:26340537

  20. A deep catalog of autosomal single nucleotide variation in the pig.

    PubMed

    Bianco, Erica; Nevado, Bruno; Ramos-Onsins, Sebastián E; Pérez-Enciso, Miguel

    2015-01-01

    A comprehensive catalog of variability in a given species is useful for many important purposes, e.g., designing high density arrays or pinpointing potential mutations of economic or physiological interest. Here we provide a genomewide, worldwide catalog of single nucleotide variants by simultaneously analyzing the shotgun sequence of 128 pigs and five suid outgroups. Despite the high SNP missing rate of some individuals (up to 88%), we retrieved over 48 million high quality variants. Of them, we were able to assess the ancestral allele of more than 39M biallelic SNPs. We found SNPs in 21,455 out of the 25,322 annotated genes in pig assembly 10.2. The annotation showed that more than 40% of the variants were novel variants, not present in dbSNP. Surprisingly, we found a large variability in transition / transversion rate along the genome, which is very well explained (R2=0.79) primarily by genome differences in in CpG content and recombination rate. The number of SNPs per window also varied but was less dependent of known factors such as gene density, missing rate or recombination (R2=0.48). When we divided the samples in four groups, Asian wild boar (ASWB), Asian domestics (ASDM), European wild boar (EUWB) and European domestics (EUDM), we found a marked correlation in allele frequencies between domestics and wild boars within Asia and within Europe, but not across continents, due to the large evolutive distance between pigs of both continents (~1.2 MYA). In general, the porcine species showed a small percentage of SNPs exclusive of each population group. EUWB and EUDM were predicted to harbor a larger fraction of potentially deleterious mutations, according to the SIFT algorithm, than Asian samples, perhaps a result of background selection being less effective due to a lower effective population size in Europe. PMID:25789620

  1. Intragenic single nucleotide polymorphism haplotype analysis of SUR1 mutations in familial hyperinsulinism.

    PubMed

    Glaser, B; Furth, J; Stanley, C A; Baker, L; Thornton, P S; Landau, H; Permutt, M A

    1999-01-01

    Familial hyperinsulinism (HI; MIM# 256450) is an autosomal recessive disorder of pancreatic beta-cell function, characterized by inadequate suppression of insulin secretion despite severe recurrent fasting hypoglycemia. Subtotal pancreatectomy is frequently required to prevent permanent neurologic sequelae. The incidence of HI in the Caucasian population is estimated at 1:50,000, however an apparent increased incidence among Ashkenazi Jews and Saudi Arabian Arabs has been reported. A locus for HI was assigned by linkage analyses to human chromosome 11p15.1. The sulfonylurea receptor (MIM# 600509, SUR1) and the potassium channel, inwardly rectifying, subfamily J member 11 (MIM# 600937, KIR6.2) genes, 2 components of the beta-cell K(ATP) channel, are clustered in this chromosomal region, and mutations in these genes have been implicated in HI. We previously demonstrated that two mutations in the SUR1 gene are present on approximately 88% of HI-associated chromosomes in Ashkenazi Jewish patients. Haplotype analysis with microsatellite markers flanking the gene revealed that one mutation (delF1388), reported only in Ashkenazi probands, occurred on two related extended haplotypes. By contrast, the second, more common mutation (3992-9g-->a) was associated with nine different intergenic haplotypes and has been reported in non-Jewish HI patients as well. In this study, we evaluated disease-associated chromosomes from 41 Ashkenazi Jewish and 2 non-Jewish HI patients carrying the 3992-9g-->a mutation by assessing haplotypes defined by nine common single nucleotide polymorphisms (SNPs), six in the SUR1 gene, and three in the KIR6.2 gene. Our results indicate that all 54 chromosomes carrying the 3992-9g-->a mutation in the Jewish patients appear to have originated from one founder mutation, whereas the same mutation on chromosomes from non-Jewish patients originated independently. Furthermore, our findings have implications concerning the HI-associated chromosomes on which no

  2. LMNA gene single nucleotide polymorphisms in dilated cardiomyopathy of Han children

    PubMed Central

    Xie, Li-Jian; Xiao, Ting-Ting; Huang, Min; Shen, Jie

    2015-01-01

    Objective: To investigate whether LMNA gene mutation is associated with dilated cardiomyopathy (DCM) in Chinese Han Race children. Methods: DNA was isolated from 78 patients with DCM and 100 healthy Chinese children who served as controls. 12 exons in the functional regions and the adjacent part of introns of the LMNA gene were amplified with polymerase chain reactions (PCR) and the PCR products were sequenced with DNA sequencer. We compared the DNA sequence with Blast software online PubMed website. The differences of allele and genotype between the groups were detected by χ2 test. Results: No disease-causing mutation in LMNA gene was found in all DCM patients. Three nonsense single nucleotide polymorphisms (SNPs) were identified. ① The first is c.1908C>T (H566H, rs4641) which was located at exon 10 of LMNA gene. It was found in 29 DCM cases and 15 control subjects. Compared to healthy controls, the frequency of TT and TC genotypes, and the C allele were significantly increased in DCM patients (P<0.05). ② The second was c.861C>T (A287A, rs5380) which was located at exon 5 of LMNA gene. It was found in 9 DCM cases and 2 control subjects. The frequency of TC genotype was significantly increased in DCM patients (P<0.05). ③ The third was c.1338C>T (D446D, rs5058) which located at exon 7 of LMNA gene. It was found in 8 DCM cases and 3 control subjects. The frequency of TC genotype was significantly increased in DCM patients (P<0.05). Conclusion: The SNP of LMNA gene may be associated with the susceptivity of DCM in Chinese Han children. PMID:26379929

  3. Associations Between Single-Nucleotide Polymorphisms and Epidural Ropivacaine Consumption in Patients Undergoing Breast Cancer Surgery

    PubMed Central

    Liu, Jing; Jiang, Yongdong; Pang, Da; Xi, Hongjie; Liu, Yan

    2013-01-01

    Up to date, few published studies indicated the associations between genetic polymorphisms and epidural local anesthetics consumption. In this study, we investigated the associations between seven single-nucleotide polymorphisms (SNPs) and epidural ropivacaine consumption during breast cancer surgery in women from northeastern China. These seven SNPs (rs3803662 and rs12443621 in TNCR9, rs889312 in MAP3K1, rs3817198 in LSP1, rs13387042 at 2q35, rs13281615 at 8q24, and rs2046210 at 6q25.1) were identified by recent genome-wide association studies associated with tumor susceptibility. A total of 418 breast cancer women received thoracic epidural anesthesia with ropivacaine for elective mastectomy with axillary clearance. Their blood samples were genotyped for the seven SNPs using the SNaPshot method. For SNP rs13281615, the subjects with genotype AG and GG consumed a greater amount of the total epidural ropivacaine and the mean ropivacaine dose than the subjects with genotype AA (p=0.047 and p=0.003, respectively). Furthermore, no statistical differences were found in the total dose of ropivacaine, the mean consumption of ropivacaine, the onset of ropivacaine, or the initial dose of lidocaine among the three genotypic groups for the other six SNPs studied. Our study indicated that SNP rs13281615 at 8q24 was associated with the consumption of epidural ropivacaine during breast cancer surgery in northeastern Chinese women. It might provide new insights into the mechanisms of ropivacaine action and metabolism and facilitate the development of personalized medicine. PMID:23577780

  4. Single-Nucleotide Polymorphisms and Markers of Oxidative Stress in Healthy Women

    PubMed Central

    Minlikeeva, Albina N.; Browne, Richard W.; Ochs-Balcom, Heather M.; Marian, Catalin; Shields, Peter G.; Trevisan, Maurizio; Krishnan, Shiva; Modali, Ramakrishna; Seddon, Michael; Lehman, Teresa; Freudenheim, Jo L.

    2016-01-01

    Purpose There is accumulating evidence that oxidative stress is an important contributor to carcinogenesis. We hypothesized that genetic variation in genes involved in maintaining antioxidant/oxidant balance would be associated with overall oxidative stress. Methods We examined associations between single nucleotide polymorphisms (SNPs) in MnSOD, GSTP1, GSTM1, GPX1, GPX3, and CAT genes and thiobarbituric acid-reactive substances (TBARS), a blood biomarker of oxidative damage, in healthy white women randomly selected from Western New York (n = 1402). We used general linear models to calculate age-adjusted geometric means of TBARS across the variants. We also examined the associations within strata of menopausal status. Results For MnSOD, being heterozygous was associated with lower geometric means of TBARS (less oxidative stress), 1.28 mg/dL, compared to homozygous T-allele or homozygous C-allele,1.35 mg/dL, and 1.31 mg/dL correspondingly (p for trend = 0.01). This difference remained among postmenopausal women, 1.40 mg/dL for TT, 1.32 mg/dL for TC, and 1.34mg/dL for CC (p for trend 0.015); it was attenuated among premenopausal women. SNPs in the other genes examined (GSTP1, GSTM1, GPX1, GPX3, and CAT) were not associated with TBARS. Conclusions Our findings suggest that genetic variation in MnSOD gene may be associated with oxidative status, particularly among postmenopausal women. PMID:27271305

  5. The Discovery of Single-Nucleotide Polymorphisms—and Inferences about Human Demographic History

    PubMed Central

    Wakeley, John; Nielsen, Rasmus; Liu-Cordero, Shau Neen; Ardlie, Kristin

    2001-01-01

    A method of historical inference that accounts for ascertainment bias is developed and applied to single-nucleotide polymorphism (SNP) data in humans. The data consist of 84 short fragments of the genome that were selected, from three recent SNP surveys, to contain at least two polymorphisms in their respective ascertainment samples and that were then fully resequenced in 47 globally distributed individuals. Ascertainment bias is the deviation, from what would be observed in a random sample, caused either by discovery of polymorphisms in small samples or by locus selection based on levels or patterns of polymorphism. The three SNP surveys from which the present data were derived differ both in their protocols for ascertainment and in the size of the samples used for discovery. We implemented a Monte Carlo maximum-likelihood method to fit a subdivided-population model that includes a possible change in effective size at some time in the past. Incorrectly assuming that ascertainment bias does not exist causes errors in inference, affecting both estimates of migration rates and historical changes in size. Migration rates are overestimated when ascertainment bias is ignored. However, the direction of error in inferences about changes in effective population size (whether the population is inferred to be shrinking or growing) depends on whether either the numbers of SNPs per fragment or the SNP-allele frequencies are analyzed. We use the abbreviation “SDL,” for “SNP-discovered locus,” in recognition of the genomic-discovery context of SNPs. When ascertainment bias is modeled fully, both the number of SNPs per SDL and their allele frequencies support a scenario of growth in effective size in the context of a subdivided population. If subdivision is ignored, however, the hypothesis of constant effective population size cannot be rejected. An important conclusion of this work is that, in demographic or other studies, SNP data are useful only to the extent that

  6. Molecular Epidemiology of Mycoplasma pneumoniae: Genotyping Using Single Nucleotide Polymorphisms and SNaPshot Technology

    PubMed Central

    Touati, A.; Blouin, Y.; Sirand-Pugnet, P.; Renaudin, H.; Oishi, T.; Vergnaud, G.; Bébéar, C.

    2015-01-01

    Molecular typing of Mycoplasma pneumoniae is an important tool for identifying grouped cases and investigating outbreaks. In the present study, we developed a new genotyping method based on single nucleotide polymorphisms (SNPs) selected from the whole-genome sequencing of eight M. pneumoniae strains, using the SNaPshot minisequencing assay. Eight SNPs, localized in housekeeping genes, predicted lipoproteins, and adhesin P1 genes were selected for genotyping. These SNPs were evaluated on 140 M. pneumoniae clinical isolates previously genotyped by multilocus variable-number tandem-repeat analysis (MLVA-5) and adhesin P1 typing. This method was also adapted for direct use with clinical samples and evaluated on 51 clinical specimens. The analysis of the clinical isolates using the SNP typing method showed nine distinct SNP types with a Hunter and Gaston diversity index (HGDI) of 0.836, which is higher than the HGDI of 0.583 retrieved for the MLVA-4 typing method, where the nonstable Mpn1 marker was removed. A strong correlation with the P1 adhesin gene typing results was observed. The congruence was poor between MLVA-5 and SNP typing, indicating distinct genotyping schemes. Combining the results increased the discriminatory power. This new typing method based on SNPs and the SNaPshot technology is a method for rapid M. pneumoniae typing directly from clinical specimens, which does not require any sequencing step. This method is based on stable markers and provides information distinct from but complementary to MLVA typing. The combined use of SNPs and MLVA typing provides powerful discrimination of strains. PMID:26202117

  7. Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips

    PubMed Central

    Zhong, Xiao-bo; Reynolds, Robert; Kidd, Judith R.; Kidd, Kenneth K.; Jenison, Robert; Marlar, Richard A.; Ward, David C.

    2003-01-01

    Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30–40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate. PMID:12975525

  8. Characterization of single-nucleotide variation in Indian-origin rhesus macaques (Macaca mulatta)

    PubMed Central

    2011-01-01

    Background Rhesus macaques are the most widely utilized nonhuman primate model in biomedical research. Previous efforts have validated fewer than 900 single nucleotide polymorphisms (SNPs) in this species, which limits opportunities for genetic studies related to health and disease. Extensive information about SNPs and other genetic variation in rhesus macaques would facilitate valuable genetic analyses, as well as provide markers for genome-wide linkage analysis and the genetic management of captive breeding colonies. Results We used the available rhesus macaque draft genome sequence, new sequence data from unrelated individuals and existing published sequence data to create a genome-wide SNP resource for Indian-origin rhesus monkeys. The original reference animal and two additional Indian-origin individuals were resequenced to low coverage using SOLiD™ sequencing. We then used three strategies to validate SNPs: comparison of potential SNPs found in the same individual using two different sequencing chemistries, and comparison of potential SNPs in different individuals identified with either the same or different sequencing chemistries. Our approach validated approximately 3 million SNPs distributed across the genome. Preliminary analysis of SNP annotations suggests that a substantial number of these macaque SNPs may have functional effects. More than 700 non-synonymous SNPs were scored by Polyphen-2 as either possibly or probably damaging to protein function and these variants now constitute potential models for studying functional genetic variation relevant to human physiology and disease. Conclusions Resequencing of a small number of animals identified greater than 3 million SNPs. This provides a significant new information resource for rhesus macaques, an important research animal. The data also suggests that overall genetic variation is high in this species. We identified many potentially damaging non-synonymous coding SNPs, providing new opportunities to

  9. Functional Impact of 14 Single Nucleotide Polymorphisms Causing Missense Mutations of Human α7 Nicotinic Receptor

    PubMed Central

    Zhang, Qinhui; Du, Yingjie; Zhang, Jianliang; Xu, Xiaojun; Xue, Fenqin; Guo, Cong; Huang, Yao; Lukas, Ronald J.; Chang, Yongchang

    2015-01-01

    The α7nicotinic receptor (nAChR) is a major subtype of the nAChRs in the central nervous system, and the receptor plays an important role in brain function. In the dbSNP database, there are 55 single nucleotide polymorphisms (SNPs) that cause missense mutations of the human α7nAChR in the coding region. In this study, we tested the impact of 14 SNPs that cause missense mutations in the agonist binding site or the coupling region between binding site and channel gate on the receptor function. The wild type or mutant receptors were expressed or co-expressed in Xenopus oocytes, and the agonist-induced currents were tested using two-electrode voltage clamp. Our results demonstrated that 6 mutants were nonfunctional, 4 mutants had reduced current expression, and 1 mutants altered ACh and nicotine efficacy in the opposite direction, and one additional mutant had slightly reduced agonist sensitivity. Interestingly, the function of most of these nonfunctional mutants could be rescued by α7nAChR positive allosteric modulator PNU-120596 and agonist-PAM 4BP-TQS. Finally, when coexpressed with the wild type, the nonfunctional mutants could also influence the receptor function. These changes of the receptor properties by the mutations could potentially have an impact on the physiological function of the α7nAChR-mediated cholinergic synaptic transmission and anti-inflammatory effects in the human SNP carriers. Rescuing the nonfunctional mutants could provide a novel way to treat the related disorders. PMID:26340537

  10. A Single Nucleotide Polymorphism in Catalase Is Strongly Associated with Ovarian Cancer Survival

    PubMed Central

    Saed, Mohammed G.; Abusamaan, Mohammed S.; Dyson, Gregory; Diamond, Michael P.; Saed, Ghassan M.

    2015-01-01

    Ovarian cancer is the deadliest of all gynecologic cancers. Recent evidence demonstrates an association between enzymatic activity altering single nucleotide polymorphisms (SNP) with human cancer susceptibility. We sought to evaluate the association of SNPs in key oxidant and antioxidant enzymes with increased risk and survival in epithelial ovarian cancer. Individuals (n = 143) recruited were divided into controls, (n = 94): healthy volunteers, (n = 18), high-risk BRCA1/2 negative (n = 53), high-risk BRCA1/2 positive (n = 23) and ovarian cancer cases (n = 49). DNA was subjected to TaqMan SNP genotype analysis for selected oxidant and antioxidant enzymes. Of the seven selected SNP studied, no association with ovarian cancer risk (Pearson Chi-square) was found. However, a catalase SNP was identified as a predictor of ovarian cancer survival by the Cox regression model. The presence of this SNP was associated with a higher likelihood of death (hazard ratio (HR) of 3.68 (95% confidence interval (CI): 1.149–11.836)) for ovarian cancer patients. Kaplan-Meier survival analysis demonstrated a significant median overall survival difference (108 versus 60 months, p<0.05) for those without the catalase SNP as compared to those with the SNP. Additionally, age at diagnosis greater than the median was found to be a significant predictor of death (HR of 2.78 (95% CI: 1.022–7.578)). This study indicates a strong association with the catalase SNP and survival of ovarian cancer patients, and thus may serve as a prognosticator. PMID:26301412

  11. Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2014-11-01

    Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

  12. Identifying Litchi (Litchi chinensis Sonn.) Cultivars and Their Genetic Relationships Using Single Nucleotide Polymorphism (SNP) Markers

    PubMed Central

    Liu, Wei; Xiao, Zhidan; Bao, Xiuli; Yang, Xiaoyan; Fang, Jing; Xiang, Xu

    2015-01-01

    Litchi is an important fruit tree in tropical and subtropical areas of the world. However, there is widespread confusion regarding litchi cultivar nomenclature and detailed information of genetic relationships among litchi germplasm is unclear. In the present study, the potential of single nucleotide polymorphism (SNP) for the identification of 96 representative litchi accessions and their genetic relationships in China was evaluated using 155 SNPs that were evenly spaced across litchi genome. Ninety SNPs with minor allele frequencies above 0.05 and a good genotyping success rate were used for further analysis. A relatively high level of genetic variation was observed among litchi accessions, as quantified by the expected heterozygosity (He = 0.305). The SNP based multilocus matching identified two synonymous groups, ‘Heiye’ and ‘Wuye’, and ‘Chengtuo’ and ‘Baitangli 1’. A subset of 14 SNPs was sufficient to distinguish all the non-redundant litchi genotypes, and these SNPs were proven to be highly stable by repeated analyses of a selected group of cultivars. Unweighted pair-group method of arithmetic averages (UPGMA) cluster analysis divided the litchi accessions analyzed into four main groups, which corresponded to the traits of extremely early-maturing, early-maturing, middle-maturing, and late-maturing, indicating that the fruit maturation period should be considered as the primary criterion for litchi taxonomy. Two subpopulations were detected among litchi accessions by STRUCTURE analysis, and accessions with extremely early- and late-maturing traits showed membership coefficients above 0.99 for Cluster 1 and Cluster 2, respectively. Accessions with early- and middle-maturing traits were identified as admixture forms with varying levels of membership shared between the two clusters, indicating their hybrid origin during litchi domestication. The results of this study will benefit litchi germplasm conservation programs and facilitate maximum

  13. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms.

    PubMed

    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Magnussen, E; Jónsson, B; Jiang, X; Cheng, L; Bekkevold, D; Maes, G E; Bernatchez, L; Hansen, M M

    2014-06-01

    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea and Europe. Only two hybrids were observed among Sargasso Sea larvae, both backcrosses, but no F1 hybrids, that points to temporal variation in the occurrence of hybridization.

  14. Single Nucleotide Polymorphisms that Increase Expression of the GTPase RAC1 are Associated with Ulcerative Colitis

    PubMed Central

    Muise, Aleixo M; Walters, Thomas; Xu, Wei; Shen-Tu, Grace; Guo, Cong-Hui; Fattouh, Ramzi; Lam, Grace Y; Wolters, Victorien M; Bennitz, Joshua; Van Limbergen, Johan; Renbaum, Paul; Kasirer, Yair; Ngan, Bo-Yee; Turner, Dan; Denson, Lee A; Sherman, Philip M; Duerr, Richard H; Cho, Judy; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Glogauer, Michael; Silverberg, Mark S; Brumell, John H

    2011-01-01

    Background & Aims RAC1 is a GTPase that has an evolutionarily conserved role in coordinating immune defenses, from plants to mammals. Chronic inflammatory bowel diseases (IBD) are associated with dysregulation of immune defenses. We studied the role of RAC1 in IBD using human genetic and functional studies and animal models of colitis. Methods We used a candidate gene approach to HapMap-Tag single nucleotide polymorphisms (SNPs) in a discovery cohort; findings were confirmed in 2 additional cohorts. RAC1 mRNA expression was examined from peripheral blood cells of patients. Colitis was induced in mice with conditional disruption of Rac1 in phagocytes by administration of dextran sulphate sodium (DSS). Results We observed a genetic association between RAC1 with ulcerative colitis (UC) in a discovery cohort, 2 independent replication cohorts, and in combined analysis for the SNPs rs10951982 (Pcombined UC = 3.3 × 10–8, odds ratio [OR]=1.43 [1.26–1.63]) and rs4720672 (Pcombined UC=4.7 × 10–6, OR=1.36 [1.19–1.58]). Patients with IBD who had the rs10951982 risk allele had increased expression of RAC1, compared to those without this allele. Conditional disruption of Rac1 in macrophage and neutrophils of mice protected them against DSS-induced colitis. Conclusion Studies of human tissue samples and knockout mice demonstrated a role for the GTPase RAC1 in the development of UC; increased expression of RAC1 was associated with susceptibility to colitis. PMID:21684284

  15. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms.

    PubMed

    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Magnussen, E; Jónsson, B; Jiang, X; Cheng, L; Bekkevold, D; Maes, G E; Bernatchez, L; Hansen, M M

    2014-06-01

    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea and Europe. Only two hybrids were observed among Sargasso Sea larvae, both backcrosses, but no F1 hybrids, that points to temporal variation in the occurrence of hybridization. PMID:24424165

  16. [Phenotype predictions of the pathogenic nonsynonymous single nucleotide polymorphisms in deafness-causing gene COCH].

    PubMed

    Xuli, Qian; Xin, Cao

    2015-07-01

    The COCH (Coagulation factor C homology) gene, located in human chromosome 14q12-q13, is the first gene identified to cause vestibular dysfunction. COCH encodes cochlin, which contains an N-terminal LCCL (Limulus factor C, cochlin, and late gestation lung protein Lgl1) domain and a C-temimal vWFA (Von Willebrand factor type A) domain. Recently, functional research of COCH mutations and cochlin have come under the spotlight in the field of hereditary deafness. Approximately 16 mutations in COCH have been confirmed to date, among which 13 non-synonymous single nucleotide polymorphisms (nsSNPs) are the most common form of genetic variations. Nonetheless, there is poor knowledge on the relationship between the genotype and the phenotype of the other nsSNPs in COCH. Here we analyzed deleterious nsSNPs from all SNPs in the COCH gene in the vWFA domain based on different computational methods and identified eight potential pathogenic nsSNPs (I176T, R180Q, G265E, V269L, I368N, I372T, R416C and Y424D) after combining literatures with 3D structures. Meanwhile, the protein structures of six reported pathogenic nsSNPs (P51S, G87W, I109N, I109T, W117R and F121S) in the LCCL domain have been constructed, and we identified aberrant structural changes in loops and chains. The prediction of pathogenic mutations for COCH nsSNPs will provide a blueprint for screening pathogenic mutations, and it will be beneficial to the functional research of COCH and cochlin in this field. PMID:26351166

  17. Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis

    PubMed Central

    Goldstone, Robert J.; McLuckie, Joyce; Smith, David G. E.

    2015-01-01

    Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit–variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates. PMID:26677250

  18. Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis.

    PubMed

    Leão, Célia; Goldstone, Robert J; Bryant, Josephine; McLuckie, Joyce; Inácio, João; Smith, David G E; Stevenson, Karen

    2016-03-01

    Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit-variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates.

  19. Single nucleotide polymorphisms of the inflammatory cytokine genes in adults with chronic immune thrombocytopenic purpura.

    PubMed

    Satoh, Takashi; Pandey, Janardan P; Okazaki, Yuka; Yasuoka, Hidekata; Kawakami, Yutaka; Ikeda, Yasuo; Kuwana, Masataka

    2004-03-01

    Single nucleotide polymorphisms (SNPs) of inflammatory cytokine genes were examined in 84 adult Japanese patients with chronic immune thrombocytopenic purpura (ITP) and 56 race-matched healthy controls. The SNPs examined were within the genes encoding tumour necrosis factor (TNF)-alpha (-238 G/A and -308 G/A), TNF-beta (+252 G/A), and interleukin (IL)-1beta (-511 C/T and +3953 T/C). Of these SNPs, the frequency of the TNF-beta (+252) G/G phenotype was significantly higher in ITP patients than in healthy controls (21% vs. 7%, P = 0.04, odds ratio = 3.6, 95% confidence interval 1.1-11.1), while no significant association was detected for the other SNPs. The distribution of the TNF-beta (+252) phenotype was not associated with human leucocyte antigen class II alleles or the therapeutic response in ITP patients. The frequency of circulating anti-glycoprotein IIb/IIIa antibody-producing B cells was significantly higher in ITP patients with the TNF-beta (+252) G/G phenotype than in those with the G/A or A/A phenotype (11.9 +/- 4.9 vs. 6.8 +/- 4.9 and 3.7 +/- 2.8 per 10(5) peripheral blood mononuclear cells; P = 0.02 and P < 0.001, respectively). These findings suggest that the SNP located at TNF-beta (+252) contributes to susceptibility to chronic ITP by controlling the autoreactive B-cell responses to platelet membrane glycoproteins.

  20. Single nucleotide polymorphisms concordant with the horned/polled trait in Holsteins

    PubMed Central

    Cargill, Edward J; Nissing, Nick J; Grosz, Michael D

    2008-01-01

    Background Cattle that naturally do not grow horns are referred to as polled, a trait inherited in a dominant Mendelian fashion. Previous studies have localized the polled mutation (which is unknown) to the proximal end of bovine chromosome 1 in a region approximately 3 Mb in size. While a polled genetic test, Tru-Polled™, is commercially available from MetaMorphix Inc., Holsteins are not a validated breed for this test. Findings Approximately 160 kb were sequenced within the known polled region from 12 polled and 12 horned Holsteins. Analysis of the polymorphisms identified 13 novel single nucleotide polymorphisms (SNPs) that are concordant with the horned/polled trait. Three of the 13 SNPs are located in gene coding or regulatory regions (e.g., the untranslated region, or UTR) where one is located in the 3'UTR of a gene and the other two are located in the 5'UTR and coding region (synonymous SNP) of another gene. The 3'UTR of genes have been shown to be targets of microRNAs regulating gene expression. In silico analysis indicates the 3'UTR SNP may disrupt a microRNA target site. Conclusion These 13 novel SNPs concordant with the horned/polled trait in Holsteins represent a test panel for the breed and this is the first report to the authors' knowledge of SNPs within gene coding or regulatory regions concordant with the horned/polled trait in cattle. These SNPs will require further testing for verification and further study to determine if the 3'UTR SNP may have a functional effect on the polled trait in Holsteins. PMID:19063733

  1. Identification of single-nucleotide polymorphism markers associated with cortisol response to crowding in rainbow trout.

    PubMed

    Liu, Sixin; Vallejo, Roger L; Gao, Guangtu; Palti, Yniv; Weber, Gregory M; Hernandez, Alvaro; Rexroad, Caird E

    2015-06-01

    Understanding stress responses is essential for improving animal welfare and increasing agriculture production efficiency. Previously, we reported microsatellite markers associated with quantitative trait loci (QTL) affecting plasma cortisol response to crowding in rainbow trout. In this study, our main objectives were to identify single-nucleotide polymorphism (SNP) markers associated with cortisol response to crowding in rainbow trout using both GWAS (genome-wide association studies) and QTL mapping methods and to employ rapidly expanding genomic resources for rainbow trout toward the identification of candidate genes affecting this trait. A three-generation F2 mapping family (2008052) was genotyped using RAD-seq (restriction-site-associated DNA sequencing) to identify 4874 informative SNPs. GWAS identified 26 SNPs associated with cortisol response to crowding whereas QTL mapping revealed two significant QTL on chromosomes Omy8 and Omy12, respectively. Positional candidate genes were identified using marker sequences to search the draft genome assembly of rainbow trout. One of the genes in the QTL interval on Omy12 is a putative serine/threonine protein kinase gene that was differentially expressed in the liver in response to handling and confinement stress in our previous study. A homologue of this gene was differentially expressed in zebrafish embryos exposed to diclofenac, a nonsteroidal anti-inflammatory drug (NSAID) and an environmental toxicant. NSAIDs have been shown to affect the cortisol response in rainbow trout; therefore, this gene is a good candidate based on its physical position and expression. However, the reference genome resources currently available for rainbow trout require continued improvement as demonstrated by the unmapped SNPs and the putative assembly errors detected in this study.

  2. Relationships between Single Nucleotide Polymorphism Markers and Meat Quality Traits of Duroc Breeding Stocks in Korea

    PubMed Central

    Choi, J. S.; Jin, S. K.; Jeong, Y. H.; Jung, Y. C.; Jung, J. H.; Shim, K. S.; Choi, Y. I.

    2016-01-01

    This study was conducted to determine the relationships of five intragenic single nucleotide polymorphism (SNP) markers (protein kinase adenosine monophosphate-activated γ3 subunit [PRKAG3], fatty acid synthase [FASN], calpastatin [CAST], high mobility group AT-hook 1 [HMGA1], and melanocortin-4 receptor [MC4R]) and meat quality traits of Duroc breeding stocks in Korea. A total of 200 purebred Duroc gilts from 8 sires and 40 dams at 4 pig breeding farms from 2010 to 2011 reaching market weight (110 kg) were slaughtered and their carcasses were chilled overnight. Longissimus dorsi muscles were removed from the carcass after 24 h of slaughter and used to determine pork properties including carcass weight, backfat thickness, moisture, intramuscular fat, pH24h, shear force, redness, texture, and fatty acid composition. The PRKAG3, FASN, CAST, and MC4R gene SNPs were significantly associated with the meat quality traits (p<0.003). The meats of PRKAG3 (A 0.024/G 0.976) AA genotype had higher pH, redness and texture than those from PRKAG3 GG genotype. Meats of FASN (C 0.301/A 0.699) AA genotype had higher backfat thickness, texture, stearic acid, oleic acid and polyunsaturated fatty acid than FASN CC genotype. While the carcasses of CAST (A 0.373/G 0.627) AA genotype had thicker backfat, and lower shear force, palmitoleic acid and oleic acid content, they had higher stearic acid content than those from the CAST GG genotype. The MC4R (G 0.208/A 0.792) AA genotype were involved in increasing backfat thickness, carcass weight, moisture and saturated fatty acid content, and decreasing unsaturated fatty acid content in Duroc meat. These results indicated that the five SNP markers tested can be a help to select Duroc breed to improve carcass and meat quality properties in crossbred pigs. PMID:27507182

  3. Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

    SciTech Connect

    Tucker, Susan L.; Li Minghuan; Xu Ting; Gomez, Daniel; Yuan Xianglin; Yu Jinming; Liu Zhensheng; Yin Ming; Guan Xiaoxiang; Wang Lie; Wei Qingyi; Mohan, Radhe; Vinogradskiy, Yevgeniy; Martel, Mary; Liao Zhongxing

    2013-01-01

    Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk of severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.

  4. A lactotransferrin single nucleotide polymorphism demonstrates biological activity that can reduce susceptibility to caries.

    PubMed

    Fine, Daniel H; Toruner, Gokce A; Velliyagounder, Kabilan; Sampathkumar, Vandana; Godboley, Dipti; Furgang, David

    2013-05-01

    Streptococcus mutans is prominently linked to dental caries. Saliva's influence on caries is incompletely understood. Our goal was to identify a salivary protein with anti-S. mutans activity, characterize its genotype, and determine genotypic variants associated with S. mutans activity and reduced caries. An S. mutans affinity column was used to isolate active moieties from saliva obtained from a subject with minimal caries. The bound and eluted protein was identified as lactotransferrin (LTF) by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) analysis and confirmed by Western blotting with LTF antibody. A single nucleotide polymorphism (SNP) that produced a shift from arginine (R) to lysine (K) at amino acid position 47 in the LTF antimicrobial region (rs: 1126478) killed S. mutans in vitro. Saliva from a subject with moderate caries and with the LTF "wild-type" R form at position 47 had no such activity. A pilot genetic study (n = 30) showed that KK subjects were more likely to have anti-S. mutans activity than RR subjects (P = 0.001; relative risk = 3.6; 95% confidence interval [95% CI] = 1.5 to 11.13). Pretreatment of KK saliva with antibody to LTF reduced S. mutans killing in a dose-dependent manner (P = 0.02). KK subjects were less likely to have caries (P = 0.02). A synthetic 11-mer LTF/K peptide killed S. mutans and other caries-related bacteria, while the LTF/R peptide had no effect (P = 0.01). Our results provide functional evidence that the LTF/K variant results in both anti-S. mutans activity and reduced decay. We suggest that the LTF/K variant can influence oral microbial ecology in general and caries-provoking microbes specifically. PMID:23460521

  5. A Lactotransferrin Single Nucleotide Polymorphism Demonstrates Biological Activity That Can Reduce Susceptibility to Caries

    PubMed Central

    Toruner, Gokce A.; Velliyagounder, Kabilan; Sampathkumar, Vandana; Godboley, Dipti; Furgang, David

    2013-01-01

    Streptococcus mutans is prominently linked to dental caries. Saliva's influence on caries is incompletely understood. Our goal was to identify a salivary protein with anti-S. mutans activity, characterize its genotype, and determine genotypic variants associated with S. mutans activity and reduced caries. An S. mutans affinity column was used to isolate active moieties from saliva obtained from a subject with minimal caries. The bound and eluted protein was identified as lactotransferrin (LTF) by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) analysis and confirmed by Western blotting with LTF antibody. A single nucleotide polymorphism (SNP) that produced a shift from arginine (R) to lysine (K) at amino acid position 47 in the LTF antimicrobial region (rs: 1126478) killed S. mutans in vitro. Saliva from a subject with moderate caries and with the LTF “wild-type” R form at position 47 had no such activity. A pilot genetic study (n = 30) showed that KK subjects were more likely to have anti-S. mutans activity than RR subjects (P = 0.001; relative risk = 3.6; 95% confidence interval [95% CI] = 1.5 to 11.13). Pretreatment of KK saliva with antibody to LTF reduced S. mutans killing in a dose-dependent manner (P = 0.02). KK subjects were less likely to have caries (P = 0.02). A synthetic 11-mer LTF/K peptide killed S. mutans and other caries-related bacteria, while the LTF/R peptide had no effect (P = 0.01). Our results provide functional evidence that the LTF/K variant results in both anti-S. mutans activity and reduced decay. We suggest that the LTF/K variant can influence oral microbial ecology in general and caries-provoking microbes specifically. PMID:23460521

  6. Functional analysis of non-synonymous single nucleotide polymorphisms in human SLC26A9

    PubMed Central

    Chen, An-Ping; Chang, Min-Hwang; Romero, Michael F.

    2012-01-01

    Slc26 anion transporters play crucial roles in transepithelial Cl− absorption and HCO3− secretion; Slc26 protein mutations lead to several diseases. Slc26a9 functions as a Cl− channel and electrogenic Cl−-HCO3− exchanger, and can interact with CFTR. Slc26a9(−/−) mice have reduced gastric acid secretion, yet no human disease is currently associated with SLC26A9 coding mutations. Therefore, we tested the function of non-synonymous, coding, single nucleotide polymorphisms (cSNPs) of SLC26A9. Presently, eight cSNPs are NCBI-documented: Y70N, T127N, I384T, R575W, P606L, V622L, V744M and H748R. Using two-electrode voltage-clamp and anion selective electrodes, we measured the biophysical consequences of these cSNPs. Y70N (cytoplasmic N-terminus) displays higher channel activity and enhanced Cl−-HCO3− exchange. T127N (transmembrane) results in smaller halide currents but not for SCN−. V622L (STAS domain) and V744M (STAS adjacent) decreased plasma membrane expression which partially accounts for decreased whole cell currents. Nevertheless, V622L transport is reduced to ~50%. SLC26A9 polymorphisms lead to several function modifications (increased activity, decreased activity, altered protein expression) which could lead to a spectrum of pathophysiologies. Thus, knowing an individual’s SLC26A9 genetics becomes important for understanding disease potentially caused by SLC26A9 mutations or modifying diseases, e.g., cystic fibrosis. Our results also provide a framework to understand SLC26A9 transport modalities and structure-function relationships. PMID:22544634

  7. Associations of single nucleotide polymorphisms in the Pygo2 coding sequence with idiopathic oligospermia and azoospermia.

    PubMed

    Ge, S-Q; Grifin, J; Liu, L-H; Aston, K I; Simon, L; Jenkins, T G; Emery, B R; Carrell, D T

    2015-08-07

    Male infertility is often associated with a decreased sperm count. The Pygo2 gene is expressed in the elongating spermatid during chromatin remodeling; thus impairment in PYGO2 function might lead to spermatogenic arrest, sperm count reduction, and subsequent infertility. The aim of this study was to identify mutations in Pygo2 that might lead to idiopathic oligospermia and azoospermia. DNA was isolated from venous blood from 77 men with normal fertility and 195 men with idiopathic oligospermia or azoospermia. Polymerase chain reaction-sequencing analysis was performed for the three Pygo2 coding regions. Non-synonymous single nucleotide polymorphisms (SNPs) were detected and analyzed using SIFT, Polyphen-2, and Mutation Taster softwares to identify possible changes in protein structure that could affect phenotype. Pygo2 sequencing was successful for 178 patients (30 with mild or moderate oligospermia, 57 with severe oligospermia, and 91 with azoospermia). Three previously reported non-synonymous SNPs were identified in patients with azoospermia or severe oligospermic but not in those with mild or moderate oligozoopermia or normozoospermia. SNPs rs61758740 (M141I) and rs141722381 (N240I) cause the replacement of one hydrophobic or hydrophilic amino acid, respectively, with another, and SNP rs61758741 (K261E) causes the replacement of a basic amino acid with an acidic one. The software predictions demonstrated that SNP rsl41722381 would likely result in disrupted tertiary protein structure and thus could be involved in disease pathogenesis. Overall, this study demonstrated that SNPs in the coding region of Pygo2 might be one of the causative factors in idiopathic oligospermia and azoospermia, resulting in male infertility.

  8. A deep catalog of autosomal single nucleotide variation in the pig.

    PubMed

    Bianco, Erica; Nevado, Bruno; Ramos-Onsins, Sebastián E; Pérez-Enciso, Miguel

    2015-01-01

    A comprehensive catalog of variability in a given species is useful for many important purposes, e.g., designing high density arrays or pinpointing potential mutations of economic or physiological interest. Here we provide a genomewide, worldwide catalog of single nucleotide variants by simultaneously analyzing the shotgun sequence of 128 pigs and five suid outgroups. Despite the high SNP missing rate of some individuals (up to 88%), we retrieved over 48 million high quality variants. Of them, we were able to assess the ancestral allele of more than 39M biallelic SNPs. We found SNPs in 21,455 out of the 25,322 annotated genes in pig assembly 10.2. The annotation showed that more than 40% of the variants were novel variants, not present in dbSNP. Surprisingly, we found a large variability in transition / transversion rate along the genome, which is very well explained (R2=0.79) primarily by genome differences in in CpG content and recombination rate. The number of SNPs per window also varied but was less dependent of known factors such as gene density, missing rate or recombination (R2=0.48). When we divided the samples in four groups, Asian wild boar (ASWB), Asian domestics (ASDM), European wild boar (EUWB) and European domestics (EUDM), we found a marked correlation in allele frequencies between domestics and wild boars within Asia and within Europe, but not across continents, due to the large evolutive distance between pigs of both continents (~1.2 MYA). In general, the porcine species showed a small percentage of SNPs exclusive of each population group. EUWB and EUDM were predicted to harbor a larger fraction of potentially deleterious mutations, according to the SIFT algorithm, than Asian samples, perhaps a result of background selection being less effective due to a lower effective population size in Europe.

  9. Common single nucleotide variants underlying drug addiction: more than a decade of research.

    PubMed

    Bühler, Kora-Mareen; Giné, Elena; Echeverry-Alzate, Victor; Calleja-Conde, Javier; de Fonseca, Fernando Rodriguez; López-Moreno, Jose Antonio

    2015-09-01

    Drug-related phenotypes are common complex and highly heritable traits. In the last few years, candidate gene (CGAS) and genome-wide association studies (GWAS) have identified a huge number of single nucleotide polymorphisms (SNPs) associated with drug use, abuse or dependence, mainly related to alcohol or nicotine. Nevertheless, few of these associations have been replicated in independent studies. The aim of this study was to provide a review of the SNPs that have been most significantly associated with alcohol-, nicotine-, cannabis- and cocaine-related phenotypes in humans between the years of 2000 and 2012. To this end, we selected CGAS, GWAS, family-based association and case-only studies published in peer-reviewed international scientific journals (using the PubMed/MEDLINE and Addiction GWAS Resource databases) in which a significant association was reported. A total of 371 studies fit the search criteria. We then filtered SNPs with at least one replication study and performed meta-analysis of the significance of the associations. SNPs in the alcohol metabolizing genes, in the cholinergic gene cluster CHRNA5-CHRNA3-CHRNB4, and in the DRD2 and ANNK1 genes, are, to date, the most replicated and significant gene variants associated with alcohol- and nicotine-related phenotypes. In the case of cannabis and cocaine, a far fewer number of studies and replications have been reported, indicating either a need for further investigation or that the genetics of cannabis/cocaine addiction are more elusive. This review brings a global state-of-the-art vision of the behavioral genetics of addiction and collaborates on formulation of new hypothesis to guide future work.

  10. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    PubMed

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  11. Relationships between Single Nucleotide Polymorphism Markers and Meat Quality Traits of Duroc Breeding Stocks in Korea.

    PubMed

    Choi, J S; Jin, S K; Jeong, Y H; Jung, Y C; Jung, J H; Shim, K S; Choi, Y I

    2016-09-01

    This study was conducted to determine the relationships of five intragenic single nucleotide polymorphism (SNP) markers (protein kinase adenosine monophosphate-activated γ3 subunit [PRKAG3], fatty acid synthase [FASN], calpastatin [CAST], high mobility group AT-hook 1 [HMGA1], and melanocortin-4 receptor [MC4R]) and meat quality traits of Duroc breeding stocks in Korea. A total of 200 purebred Duroc gilts from 8 sires and 40 dams at 4 pig breeding farms from 2010 to 2011 reaching market weight (110 kg) were slaughtered and their carcasses were chilled overnight. Longissimus dorsi muscles were removed from the carcass after 24 h of slaughter and used to determine pork properties including carcass weight, backfat thickness, moisture, intramuscular fat, pH24h, shear force, redness, texture, and fatty acid composition. The PRKAG3, FASN, CAST, and MC4R gene SNPs were significantly associated with the meat quality traits (p<0.003). The meats of PRKAG3 (A 0.024/G 0.976) AA genotype had higher pH, redness and texture than those from PRKAG3 GG genotype. Meats of FASN (C 0.301/A 0.699) AA genotype had higher backfat thickness, texture, stearic acid, oleic acid and polyunsaturated fatty acid than FASN CC genotype. While the carcasses of CAST (A 0.373/G 0.627) AA genotype had thicker backfat, and lower shear force, palmitoleic acid and oleic acid content, they had higher stearic acid content than those from the CAST GG genotype. The MC4R (G 0.208/A 0.792) AA genotype were involved in increasing backfat thickness, carcass weight, moisture and saturated fatty acid content, and decreasing unsaturated fatty acid content in Duroc meat. These results indicated that the five SNP markers tested can be a help to select Duroc breed to improve carcass and meat quality properties in crossbred pigs.

  12. Analysis of the association of HOTAIR single nucleotide polymorphism (rs920778) and risk of cervical cancer.

    PubMed

    Qiu, Haifeng; Liu, Qiuli; Li, Juan; Wang, Xiujuan; Wang, Yuan; Yuan, Zhongfu; Li, Jing; Pei, Dong-Sheng

    2016-07-01

    We recently demonstrated that overexpression of HOTAIR (Hox transcript antisense intergenic RNA) was associated with tumor progression and radio-resistance in human cervical cancer. Considering the single nucleotide polymorphism (SNP) rs920778 (C>T) could influence HOTAIR expression and cancer predisposition in other malignancies, we herein investigated the association between rs920778 status and cervical cancer susceptibility in a Chinese population. Using the specific TaqMan PCR assay, we genotyped rs920778 in 215 cervical cancer patients and 430 age-matched healthy controls. As shown in our data, TT genotype of rs920778 was significantly correlated with the upregulation of HOTAIR (p = 0.008). Compared with the healthy control, TT genotype and T allele notably indicated a much higher risk of cervical cancer [TT genotype: odds ratio (OR) = 2.186, 95% confidence interval (CI) = 1.378-3.466, p = 0.003; T allele: OR = 1.556, 95% CI = 1.221-1.981]. In addition, we also found that the TT genotype of rs920778 was correlated with advanced tumor stage (p = 0.039), highly histological grade (p = 0.013), lympho node metastasis (p < 0.001) and positive infection of high risk HPV (p < 0.001). Among the patients who underwent concurrent chemo-radiotherapy, TT genotype carriers present notably resistance to the combination of EBRT + ICBT + cisplatin (p = 0.023). In conclusion, we firstly reported that TT genotype of HOTAIR rs920778 was significantly associated with the cervical cancer susceptibility. Moreover, the TT genotype of rs920778 might be a potent prognostic marker in cervical cancer patients.

  13. A Single Nucleotide Polymorphism in Catalase Is Strongly Associated with Ovarian Cancer Survival.

    PubMed

    Belotte, Jimmy; Fletcher, Nicole M; Saed, Mohammed G; Abusamaan, Mohammed S; Dyson, Gregory; Diamond, Michael P; Saed, Ghassan M

    2015-01-01

    Ovarian cancer is the deadliest of all gynecologic cancers. Recent evidence demonstrates an association between enzymatic activity altering single nucleotide polymorphisms (SNP) with human cancer susceptibility. We sought to evaluate the association of SNPs in key oxidant and antioxidant enzymes with increased risk and survival in epithelial ovarian cancer. Individuals (n = 143) recruited were divided into controls, (n = 94): healthy volunteers, (n = 18), high-risk BRCA1/2 negative (n = 53), high-risk BRCA1/2 positive (n = 23) and ovarian cancer cases (n = 49). DNA was subjected to TaqMan SNP genotype analysis for selected oxidant and antioxidant enzymes. Of the seven selected SNP studied, no association with ovarian cancer risk (Pearson Chi-square) was found. However, a catalase SNP was identified as a predictor of ovarian cancer survival by the Cox regression model. The presence of this SNP was associated with a higher likelihood of death (hazard ratio (HR) of 3.68 (95% confidence interval (CI): 1.149-11.836)) for ovarian cancer patients. Kaplan-Meier survival analysis demonstrated a significant median overall survival difference (108 versus 60 months, p<0.05) for those without the catalase SNP as compared to those with the SNP. Additionally, age at diagnosis greater than the median was found to be a significant predictor of death (HR of 2.78 (95% CI: 1.022-7.578)). This study indicates a strong association with the catalase SNP and survival of ovarian cancer patients, and thus may serve as a prognosticator.

  14. Single nucleotide polymorphism array profiling identifies distinct chromosomal aberration patterns across colorectal adenomas and carcinomas.

    PubMed

    Zarzour, Peter; Boelen, Lies; Luciani, Fabio; Beck, Dominik; Sakthianandeswaren, Anuratha; Mouradov, Dmitri; Sieber, Oliver M; Hawkins, Nicholas J; Hesson, Luke B; Ward, Robyn L; Wong, Jason W H

    2015-05-01

    The progression of benign colorectal adenomas into cancer is associated with the accumulation of chromosomal aberrations. Even though patterns and frequencies of chromosomal aberrations have been well established in colorectal carcinomas, corresponding patterns of aberrations in adenomas are less well documented. The aim of this study was to profile chromosomal aberrations across colorectal adenomas and carcinomas to provide a better insight into key changes during tumor initiation and progression. Single nucleotide polymorphism array analysis was performed on 216 colorectal tumor/normal matched pairs, comprising 60 adenomas and 156 carcinomas. While many chromosomal aberrations were specific to carcinomas, those with the highest frequency in carcinomas (amplification of chromosome 7, 13q, and 20q; deletion of 17p and chromosome 18; LOH of 1p, chromosome 4, 5q, 8p, 17p, chromosome 18, and 20p) were also identified in adenomas. Hierarchical clustering using chromosomal aberrations revealed three distinct subtypes. Interestingly, these subtypes were only partially dependent on tumor staging. A cluster of colorectal cancer patients with frequent chromosomal deletions had the least favorable prognosis, and a number of adenomas (n = 9) were also present in the cluster suggesting that, at least in some tumors, the chromosomal aberration pattern is determined at a very early stage of tumor formation. Finally, analysis of LOH events revealed that copy-neutral/gain LOH (CN/G-LOH) is frequent (>10%) in carcinomas at 5q, 11q, 15q, 17p, chromosome 18, 20p, and 22q. Deletion of the corresponding region is sometimes present in adenomas, suggesting that LOH at these loci may play an important role in tumor initiation.

  15. NEDD4 single nucleotide polymorphism rs2271289 is associated with keloids in Chinese Han population.

    PubMed

    Zhao, Ying; Liu, Sheng-Li; Xie, Jian; Ding, Mao-Qian; Lu, Meng-Zhu; Zhang, Lan-Fang; Yao, Xiu-Hua; Hu, Bai; Lu, Wen-Sheng; Zheng, Xiao-Dong

    2016-01-01

    Keloids are abnormally raised fibroproliferative lesions that usually occur following cutaneous traumas. Recently, a large-scale genome-wide association study (GWAS) has identified multiple single nucleotide polymorphisms (SNPs) in three genetic loci that are associated with keloids in Japanese population. Subsequently, two reported loci 1q41 (rs873549 and rs1442440) and 15q21.3 (rs2271289) for keloids were confirmed in selected Chinese population. The association of these SNPs with clinical features of keloids, has not yet been studied. To explore the role of these SNPs in the pathogenesis of keloids, we performed a case-controlled study in another independent Chinese Han population to analyze the correlation between 4 SNPs (rs873549, rs2118610, rs1511412, rs2271289) and keloids phenotypes. 309 keloids patients and 1080 control subjects were included. The results showed that, in the dominant mode of inheritance, the minor allele T of SNP rs2271289 had significantly higher odd ratios (ORs) in the severe keloid group compared with both the controls and the mild keloid group. The ORs were maintained after Bonferroni's correction (OR: 4.09, 95% CI: 1.78-9.37, P-value 3.25E-04). The ratio of the severe: mild OR for rs2271289 (dominant model) is (4.73/1.84=2.57). Similar associations in SNP rs2271289 were seen for groups with no family history and multiplesite compared with the control groups. No associations between keloid number, family history or severity relative to the controls were observed for the other three SNPs. Our data support that rs2271289 is strongly associated with severe keloids and might contribute to the complexity of clinical features of keloids. PMID:27158346

  16. Single-channel properties of ionic channels gated by cyclic nucleotides.

    PubMed Central

    Bucossi, G; Nizzari, M; Torre, V

    1997-01-01

    This paper presents an extensive analysis of single-channel properties of cyclic nucleotide gated (CNG) channels, obtained by injecting into Xenopus laevis oocytes the mRNA encoding for the alpha and beta subunits from bovine rods. When the alpha and beta subunits of the CNG channel are coexpressed, at least three types of channels with different properties are observed. One type of channel has well-resolved, multiple conductive levels at negative voltages, but not at positive voltages. The other two types of channel are characterized by flickering openings, but are distinguished because they have a low and a high conductance. The alpha subunit of CNG channels has a well-defined conductance of about 28 pS, but multiple conductive levels are observed in mutant channels E363D and T364M. The conductance of these open states is modulated by protons and the membrane voltage, and has an activation energy around 44 kJ/mol. The relative probability of occupying any of these open states is independent of the cGMP concentration, but depends on extracellular protons. The open probability in the presence of saturating cGMP was 0.78, 0.47, 0.5, and 0.007 in the w.t. and mutants E363D, T364M, and E363G, and its dependence on temperature indicates that the thermodynamics of the transition between the closed and open state is also affected by mutations in the pore region. These results suggest that CNG channels have different conductive levels, leading to the existence of multiple open states in homomeric channels and to the flickering behavior in heteromeric channels, and that the pore is an essential part of the gating of CNG channels. PMID:9138564

  17. Relationships between Single Nucleotide Polymorphism Markers and Meat Quality Traits of Duroc Breeding Stocks in Korea.

    PubMed

    Choi, J S; Jin, S K; Jeong, Y H; Jung, Y C; Jung, J H; Shim, K S; Choi, Y I

    2016-09-01

    This study was conducted to determine the relationships of five intragenic single nucleotide polymorphism (SNP) markers (protein kinase adenosine monophosphate-activated γ3 subunit [PRKAG3], fatty acid synthase [FASN], calpastatin [CAST], high mobility group AT-hook 1 [HMGA1], and melanocortin-4 receptor [MC4R]) and meat quality traits of Duroc breeding stocks in Korea. A total of 200 purebred Duroc gilts from 8 sires and 40 dams at 4 pig breeding farms from 2010 to 2011 reaching market weight (110 kg) were slaughtered and their carcasses were chilled overnight. Longissimus dorsi muscles were removed from the carcass after 24 h of slaughter and used to determine pork properties including carcass weight, backfat thickness, moisture, intramuscular fat, pH24h, shear force, redness, texture, and fatty acid composition. The PRKAG3, FASN, CAST, and MC4R gene SNPs were significantly associated with the meat quality traits (p<0.003). The meats of PRKAG3 (A 0.024/G 0.976) AA genotype had higher pH, redness and texture than those from PRKAG3 GG genotype. Meats of FASN (C 0.301/A 0.699) AA genotype had higher backfat thickness, texture, stearic acid, oleic acid and polyunsaturated fatty acid than FASN CC genotype. While the carcasses of CAST (A 0.373/G 0.627) AA genotype had thicker backfat, and lower shear force, palmitoleic acid and oleic acid content, they had higher stearic acid content than those from the CAST GG genotype. The MC4R (G 0.208/A 0.792) AA genotype were involved in increasing backfat thickness, carcass weight, moisture and saturated fatty acid content, and decreasing unsaturated fatty acid content in Duroc meat. These results indicated that the five SNP markers tested can be a help to select Duroc breed to improve carcass and meat quality properties in crossbred pigs. PMID:27507182

  18. Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales.

    PubMed

    Gu, Wanjun; Gurguis, Christopher I; Zhou, Jin J; Zhu, Yihua; Ko, Eun-A; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

    2015-10-01

    Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

  19. Single nucleotide polymorphisms predisposing to asthma in children of Mauritian Indian and Chinese Han ethnicity.

    PubMed

    Ramphul, K; Lv, J; Hua, L; Liu, Q H; Fang, D Z; Ji, R X; Bao, Y X

    2014-05-01

    Our objective was to investigate the distributions of six single nucleotide polymorphisms (SNPs) MS4A2 E237G, MS4A2 C-109T, ADRB2 R16G, IL4RA I75V, IL4 C-590T, and IL13 C1923T in Mauritian Indian and Chinese Han children with asthma. This case-control association study enrolled 382 unrelated Mauritian Indian children, 193 with asthma and 189 healthy controls, and 384 unrelated Chinese Han children, 192 with asthma and 192 healthy controls. The SNP loci were genotyped using polymerase chain reaction (PCR)-restriction fragment length polymorphism for the Chinese Han samples and TaqMan real-time quantitative PCR for the Mauritian Indian samples. In the Mauritian Indian children, there was a significant difference in the distribution of IL13 C1923T between the asthma and control groups (P=0.033). The frequency of IL13 C1923T T/T in the Mauritian Indian asthma group was significantly higher than in the control group [odds ratio (OR)=2.119, 95% confidence interval=1.048-4.285]. The Chinese Han children with asthma had significantly higher frequencies of MS4A2 C-109T T/T (OR=1.961, P=0.001) and ADRB2 R16G A/A (OR=2.575, P=0.000) than the control group. The IL13 C1923T locus predisposed to asthma in Mauritian Indian children, which represents an ethnic difference from the Chinese Han population. The MS4A2 C-109T T/T and ADRB2 R16G A/A genotypes were associated with asthma in the Chinese Han children.

  20. Alu-associated enhancement of single nucleotide polymorphisms in the human genome.

    PubMed

    Ng, Siu-Kin; Xue, Hong

    2006-03-01

    Identifying features shaping the architecture of sequence variations is important for understanding genome evolution and mapping disease loci. In this study, high-resolution scanning of Alu-centered alignments of the human genome sequences has revealed a striking elevation of the frequency of single nucleotide polymorphisms (SNP) in the body and tail of Alu sequences compared to flanking regions. This enhancement in SNP density is evident for all twenty-four chromosomes, and in both the Alu-body and Alu-tail, which together may be referred to as the Alu-SNPs. Reduced levels of Alu-SNPs in the sex chromosomes, especially in the non-recombining NRY region of the Y chromosome, are consistent with recombination events playing an important role in the enhancement. The Alu elements are unstable recombination-mutation hotspots in the human genome, and it is suggested that the Alu-SNPs represent a key manifestation of this instability. Variations in Alu-SNPs among the HapMap populations of northern and western European ancestry (CEU), Han Chinese from Beijing (CHB), Japanese from Tokyo (JPT), and Yoruba from Ibadan, Nigeria (YRI) indicate that the Alu-SNPs provide useful sequence markers, in addition to the Alu-insertion polymorphisms themselves, for the delineation of human genome evolution. That Alu-SNP levels are highest in the youngest Alu-Y, intermediate in the Alu-S of intermediate age, and lowest in the oldest Alu-J is consistent with the occurrence of not only genetic drift but also natural selection on the Alu-SNPs. Such evolutionary selection in turn suggests that Alu-SNPs might include potential sites of disease association, and therefore deserve detailed investigation. PMID:16380220

  1. Single nucleotide polymorphisms in G protein signaling pathway genes in preeclampsia.

    PubMed

    Kvehaugen, Anne Stine; Melien, Oyvind; Holmen, Oddgeir Lingaas; Laivuori, Hannele; Oian, Pål; Andersgaard, Alice Beathe; Dechend, Ralf; Staff, Anne Cathrine

    2013-03-01

    Preeclampsia is a pregnancy specific disorder and a risk factor for later cardiovascular disease. The cause and detailed pathophysiology remains unknown. G protein signaling is involved in a variety of physiological processes, including blood pressure regulation. We assessed whether distributions of 3 single nucleotide polymorphisms in genes coding for components of G protein signaling pathways that have been associated with hypertension differ between women with preeclampsia and normotensive pregnant women; the G protein β3 subunit gene (GNB3) C825T polymorphism (rs5443), the angiotensin II type 1 receptor gene (AGTR1) 3'UTR A1166C polymorphism (rs5186), and the regulator of G protein signaling 2 gene (RGS2) 3'UTR C1114G polymorphism (rs4606). Two separate Norwegian study populations were used; a large population based study and a smaller, but clinically well-described pregnancy biobank. A descriptive study of 43 women with eclampsia was additionally included. In the population-based study, an increased odds of preeclampsia (odds ratio, 1.21; [95% confidence interval, 1.05-1.40]; P=0.009) and recurrent preeclampsia (odds ratio, 1.43; [95% confidence interval, 1.06-1.92];, P=0.017) was found in women carrying the rs4606 CG or GG genotype. In early-onset preeclamptic patients with decidual spiral artery biopsies available (n=24), the rs4606 CG or GG genotype was more frequent in those with acute atherosis (resembling early stage of atherosclerosis) compared with those without: odds ratio, 15.0; (95% confidence interval, 2.02-111.2); P=0.004. No association was found between preeclampsia and the rs5443 or the rs5186. The genotype distribution in eclamptic women was not different from preeclamptic women. In conclusion, RGS2 rs4606 may affect the risk and progression of preeclampsia.

  2. Wavelet-based identification of DNA focal genomic aberrations from single nucleotide polymorphism arrays

    PubMed Central

    2011-01-01

    Background Copy number aberrations (CNAs) are an important molecular signature in cancer initiation, development, and progression. However, these aberrations span a wide range of chromosomes, making it hard to distinguish cancer related genes from other genes that are not closely related to cancer but are located in broadly aberrant regions. With the current availability of high-resolution data sets such as single nucleotide polymorphism (SNP) microarrays, it has become an important issue to develop a computational method to detect driving genes related to cancer development located in the focal regions of CNAs. Results In this study, we introduce a novel method referred to as the wavelet-based identification of focal genomic aberrations (WIFA). The use of the wavelet analysis, because it is a multi-resolution approach, makes it possible to effectively identify focal genomic aberrations in broadly aberrant regions. The proposed method integrates multiple cancer samples so that it enables the detection of the consistent aberrations across multiple samples. We then apply this method to glioblastoma multiforme and lung cancer data sets from the SNP microarray platform. Through this process, we confirm the ability to detect previously known cancer related genes from both cancer types with high accuracy. Also, the application of this approach to a lung cancer data set identifies focal amplification regions that contain known oncogenes, though these regions are not reported using a recent CNAs detecting algorithm GISTIC: SMAD7 (chr18q21.1) and FGF10 (chr5p12). Conclusions Our results suggest that WIFA can be used to reveal cancer related genes in various cancer data sets. PMID:21569311

  3. Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

    PubMed

    Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

    2006-06-01

    Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs. PMID:16706918

  4. Influence of physical inactivity on associations between single nucleotide polymorphisms and genetic predisposition to childhood obesity.

    PubMed

    Xi, Bo; Wang, Chunyu; Wu, Lijun; Zhang, Meixian; Shen, Yue; Zhao, Xiaoyuan; Wang, Xingyu; Mi, Jie

    2011-06-01

    Childhood obesity is a complex disease that is influenced by both genetic and environmental factors. The authors' aim was to determine whether sedentary behavior and physical activity modulate the association between single nucleotide polymorphisms (SNPs) and obesity risk in Chinese children. A population-based study was carried out in 2,848 children (6-18 years of age) in Beijing, China, in 2004. It included 1,229 obese cases and 1,619 normal-weight controls. Lifestyle information was collected through the use of a validated questionnaire, and 6 SNPs were genotyped. The association between the 6 SNPs and obesity risk was modulated by sedentary behavior and physical activity. A higher risk of obesity was observed in children who carried the high-risk alleles of the 6 SNPs and engaged in sedentary behavior ≥2 hours/day outside of school or participated in low or moderate physical activity. Most notably, the association between 5 SNPs (Fas apoptotic inhibitory molecule 2 rs7138803, Niemann-Pick disease, type C1 rs1805081, fat mass- and obesity-associated gene rs6499640, melanocortin 4 receptor gene rs17782313, and brain-derived neurotrophic factor rs6265) and obesity risk was only observed in children who had moderate-to-low physical activity levels or engaged in sedentary behavior, regardless of which risk alleles they carried. The results indicated that encouraging less sedentary behavior and higher levels of physical activity could alleviate the influence of risk alleles on genetic predisposition to childhood obesity, thereby serving as a promising prevention strategy.

  5. TRPC6 Single Nucleotide Polymorphisms and Progression of Idiopathic Membranous Nephropathy

    PubMed Central

    Hofstra, Julia M.; Coenen, Marieke J. H.; Schijvenaars, Mascha M. V. A. P.; Berden, Jo H. M.; van der Vlag, Johan; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Wetzels, Jack F. M.; Nijenhuis, Tom

    2014-01-01

    Background Activating mutations in the Transient Receptor Potential channel C6 (TRPC6) cause autosomal dominant focal segmental glomerular sclerosis (FSGS). TRPC6 expression is upregulated in renal biopsies of patients with idiopathic membranous glomerulopathy (iMN) and animal models thereof. In iMN, disease progression is characterized by glomerulosclerosis. In addition, a context-dependent TRPC6 overexpression was recently suggested in complement-mediated podocyte injury in e.g. iMN. Hence, we hypothesized that genetic variants in TRPC6 might affect susceptibility to development or progression of iMN. Methods & Results Genomic DNA was isolated from blood samples of 101 iMN patients and 292 controls. By direct sequencing of the entire TRPC6 gene, 13 single nucleotide polymorphisms (SNPs) were identified in the iMN cohort, two of which were causing an amino acid substitution (rs3802829; Pro15Ser and rs36111323, Ala404Val). No statistically significant differences in genotypes or allele frequencies between patients and controls were observed. Clinical outcome in patients was determined (remission n = 26, renal failure n = 46, persistent proteinuria n = 29, follow-up median 80 months {range 51–166}). The 13 identified SNPs showed no association with remission or renal failure. There were no differences in genotypes or allele frequencies between patients in remission and progressors. Conclusions Our data suggest that TRPC6 polymorphisms do not affect susceptibility to iMN, or clinical outcome in iMN. PMID:25019165

  6. Genome-wide single nucleotide polymorphisms reveal population history and adaptive divergence in wild guppies.

    PubMed

    Willing, Eva-Maria; Bentzen, Paul; van Oosterhout, Cock; Hoffmann, Margarete; Cable, Joanne; Breden, Felix; Weigel, Detlef; Dreyer, Christine

    2010-03-01

    Adaptation of guppies (Poecilia reticulata) to contrasting upland and lowland habitats has been extensively studied with respect to behaviour, morphology and life history traits. Yet population history has not been studied at the whole-genome level. Although single nucleotide polymorphisms (SNPs) are the most abundant form of variation in many genomes and consequently very informative for a genome-wide picture of standing natural variation in populations, genome-wide SNP data are rarely available for wild vertebrates. Here we use genetically mapped SNP markers to comprehensively survey genetic variation within and among naturally occurring guppy populations from a wide geographic range in Trinidad and Venezuela. Results from three different clustering methods, Neighbor-net, principal component analysis (PCA) and Bayesian analysis show that the population substructure agrees with geographic separation and largely with previously hypothesized patterns of historical colonization. Within major drainages (Caroni, Oropouche and Northern), populations are genetically similar, but those in different geographic regions are highly divergent from one another, with some indications of ancient shared polymorphisms. Clear genomic signatures of a previous introduction experiment were seen, and we detected additional potential admixture events. Headwater populations were significantly less heterozygous than downstream populations. Pairwise F(ST) values revealed marked differences in allele frequencies among populations from different regions, and also among populations within the same region. F(ST) outlier methods indicated some regions of the genome as being under directional selection. Overall, this study demonstrates the power of a genome-wide SNP data set to inform for studies on natural variation, adaptation and evolution of wild populations.

  7. Postzygotic single-nucleotide mosaicisms in whole-genome sequences of clinically unremarkable individuals

    PubMed Central

    Huang, August Y; Xu, Xiaojing; Ye, Adam Y; Wu, Qixi; Yan, Linlin; Zhao, Boxun; Yang, Xiaoxu; He, Yao; Wang, Sheng; Zhang, Zheng; Gu, Bowen; Zhao, Han-Qing; Wang, Meng; Gao, Hua; Gao, Ge; Zhang, Zhichao; Yang, Xiaoling; Wu, Xiru; Zhang, Yuehua; Wei, Liping

    2014-01-01

    Postzygotic single-nucleotide mutations (pSNMs) have been studied in cancer and a few other overgrowth human disorders at whole-genome scale and found to play critical roles. However, in clinically unremarkable individuals, pSNMs have never been identified at whole-genome scale largely due to technical difficulties and lack of matched control tissue samples, and thus the genome-wide characteristics of pSNMs remain unknown. We developed a new Bayesian-based mosaic genotyper and a series of effective error filters, using which we were able to identify 17 SNM sites from ∼80× whole-genome sequencing of peripheral blood DNAs from three clinically unremarkable adults. The pSNMs were thoroughly validated using pyrosequencing, Sanger sequencing of individual cloned fragments, and multiplex ligation-dependent probe amplification. The mutant allele fraction ranged from 5%-31%. We found that C→T and C→A were the predominant types of postzygotic mutations, similar to the somatic mutation profile in tumor tissues. Simulation data showed that the overall mutation rate was an order of magnitude lower than that in cancer. We detected varied allele fractions of the pSNMs among multiple samples obtained from the same individuals, including blood, saliva, hair follicle, buccal mucosa, urine, and semen samples, indicating that pSNMs could affect multiple sources of somatic cells as well as germ cells. Two of the adults have children who were diagnosed with Dravet syndrome. We identified two non-synonymous pSNMs in SCN1A, a causal gene for Dravet syndrome, from these two unrelated adults and found that the mutant alleles were transmitted to their children, highlighting the clinical importance of detecting pSNMs in genetic counseling. PMID:25312340

  8. A self-assembled deoxyribonucleic acid concatemer for sensitive detection of single nucleotide polymorphism.

    PubMed

    Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen

    2013-12-01

    Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. PMID:24267087

  9. Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

    PubMed Central

    Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

    2015-01-01

    Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

  10. A single nucleotide polymorphism in NEUROD1 is associated with production traits in Nelore beef cattle.

    PubMed

    de Oliveira, P S N; Tizioto, P C; Malago, W; do Nascimento, M L; Cesar, A S M; Diniz, W J S; de Souza, M M; Lanna, D P D; Tullio, R R; Mourão, G B; de A Mudadu, M; Coutinho, L L; de A Regitano, L C

    2016-01-01

    Feed efficiency and carcass characteristics are late-measured traits. The detection of molecular markers associated with them can help breeding programs to select animals early in life, and to predict breeding values with high accuracy. The objective of this study was to identify polymorphisms in the functional and positional candidate gene NEUROD1 (neurogenic differentiation 1), and investigate their associations with production traits in reference families of Nelore cattle. A total of 585 steers were used, from 34 sires chosen to represent the variability of this breed. By sequencing 14 animals with extreme residual feed intake (RFI) values, seven single nucleotide polymorphisms (SNPs) in NEUROD1 were identified. The investigation of marker effects on the target traits RFI, backfat thickness (BFT), ribeye area (REA), average body weight (ABW), and metabolic body weight (MBW) was performed with a mixed model using the restricted maximum likelihood method. SNP1062, which changes cytosine for guanine, had no significant association with RFI or REA. However, we found an additive effect on ABW (P ≤ 0.05) and MBW (P ≤ 0.05), with an estimated allele substitution effect of -1.59 and -0.93 kg0.75, respectively. A dominant effect of this SNP for BFT was also found (P ≤ 0.010). Our results are the first that identify NEUROD1 as a candidate that affects BFT, ABW, and MBW. Once confirmed, the inclusion of this SNP in dense panels may improve the accuracy of genomic selection for these traits in Nelore beef cattle as this SNP is not currently represented on SNP chips. PMID:27420997

  11. Shifting Paradigm of Association Studies: Value of Rare Single-Nucleotide Polymorphisms

    PubMed Central

    Gorlov, Ivan P.; Gorlova, Olga Y.; Sunyaev, Shamil R.; Spitz, Margaret R.; Amos, Christopher I.

    2008-01-01

    Summary Currently, single-nucleotide polymorphisms (SNPs) with minor allele frequency (MAF) of >5% are preferentially used in case-control association studies of common human diseases. Recent technological developments enable inexpensive and accurate genotyping of a large number of SNPs in thousands of cases and controls, which can provide adequate statistical power to analyze SNPs with MAF <5%. Our purpose was to determine whether evaluating rare SNPs in case-control association studies could help identify causal SNPs for common diseases. We suggest that slightly deleterious SNPs (sdSNPs) subjected to weak purifying selection are major players in genetic control of susceptibility to common diseases. We compared the distribution of MAFs of synonymous SNPs with that of nonsynonymous SNPs (1) predicted to be benign, (2) predicted to be possibly damaging, and (3) predicted to be probably damaging by PolyPhen. Our sources of data were the International HapMap Project, ENCODE, and the SeattleSNPs project. We found that the MAF distribution of possibly and probably damaging SNPs was shifted toward rare SNPs compared with the MAF distribution of benign and synonymous SNPs that are not likely to be functional. We also found an inverse relationship between MAF and the proportion of nsSNPs predicted to be protein disturbing. On the basis of this relationship, we estimated the joint probability that a SNP is functional and would be detected as significant in a case-control study. Our analysis suggests that including rare SNPs in genotyping platforms will advance identification of causal SNPs in case-control association studies, particularly as sample sizes increase. PMID:18179889

  12. Contribution of protein Z gene single-nucleotide polymorphism to systemic lupus erythematosus in Egyptian patients.

    PubMed

    Yousry, Sherif M; Shahin, Rasha M H; El Refai, Rasha M

    2016-09-01

    Protein Z has been reported to exert an important role in inhibiting coagulation. Polymorphisms in the protein Z gene (PROZ) may affect protein Z levels and thus play a role in thrombosis. This study aimed to investigate the prevalence and clinical significance of protein Z gene G79A polymorphism in Egyptian patients with systemic lupus erythematosus (SLE). We studied the distribution of the protein Z gene (rs17882561) (G79A) single-nucleotide polymorphism by PCR-restriction fragment length polymorphism in 100 Egyptian patients with SLE and 100 age, sex, and ethnically matched controls. There was no statistically significant difference in the distribution of the genotypes between SLE patients and the control group in our study (P = 0.103). But a statistically significant difference in the frequency of the alleles between SLE patients and controls was observed (P = 0.024). Also a significant association was detected between protein Z genotypes (and also A allele) and thrombosis, which is one of the manifestations of SLE (P = 0.004 and P = 0.001, respectively). Moreover, we observed a significant association between the protein Z AA and GA genotypes (and also A allele) and the presence of anticardiolipin antibodies (P = 0.016 and P = 0.004, respectively). The minor A allele of the G79A polymorphism in the protein Z gene might contribute to the genetic susceptibility of SLE in Egyptian patients. Also, an influence for this polymorphism on some of the disease manifestations has been elucidated, so protein Z G79A AG/AA may be a risk factor for thrombosis.

  13. Fluorescence detection of single nucleotide polymorphisms using a universal molecular beacon.

    PubMed

    Lin, Yang-Wei; Ho, Hsin-Tsung; Huang, Chih-Ching; Chang, Huan-Tsung

    2008-11-01

    We present a simple and novel assay-employing a universal molecular beacon (MB) in the presence of Hg(2+)-for the detection of single nucleotide polymorphisms (SNPs) based on Hg(2+)-DNA complexes inducing a conformational change in the MB. The MB (T(7)-MB) contains a 19-mer loop and a stem of a pair of seven thymidine (T) bases, a carboxyfluorescein (FAM) unit at the 5'-end, and a 4-([4-(dimethylamino)phenyl]azo)benzoic acid (DABCYL) unit at the 3'-end. Upon formation of Hg(2+)-T(7)-MB complexes through T-Hg(2+)-T bonding, the conformation of T(7)-MB changes from a random coil to a folded structure, leading to a decreased distance between the FAM and DABCYL units and, hence, increased efficiency of fluorescence resonance energy transfer (FRET) between the FAM and DABCYL units, resulting in decreased fluorescence intensity of the MB. In the presence of complementary DNA, double-stranded DNA complexes form (instead of the Hg(2+)-T(7)-MB complexes), with FRET between the FAM and DABCYL units occurring to a lesser extent than in the folded structure. Under the optimal conditions (20 nM T(7)-MB, 20 mM NaCl, 1.0 muM Hg(2+), 5.0 mM phosphate buffer solution, pH 7.4), the linear plot of the fluorescence intensity against the concentration of perfectly matched DNA was linear over the range 2-30 nM (R(2) = 0.991), with a limit of detection of 0.5 nM at a signal-to-noise ratio of 3. This new probe provides higher selectivity toward DNA than that exhibited by conventional MBs.

  14. Single nucleotide polymorphism and haplotype effects associated with somatic cell score in German Holstein cattle

    PubMed Central

    2014-01-01

    Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131

  15. Single nucleotide polymorphisms in CRTC1 and BARX1 are associated with esophageal adenocarcinoma

    PubMed Central

    van Nistelrooij, Anna M. J.; van der Korput, Hetty A. G. M.; Broer, Linda; van Marion, Ronald; van Berge Henegouwen, Mark I.; van Noesel, Carel J.; Biermann, Katharina; Spaander, Manon C. W.; Tilanus, Hugo W.; van Lanschot, J. Jan B.; Hofman, Albert; Uitterlinden, André G.; Wijnhoven, Bas P. L.; Dinjens, Winand N. M.

    2015-01-01

    Objective: Recently, single nucleotide polymorphisms (SNPs) associated with esophageal adenocarcinoma (EAC) and Barrett's esophagus (BE) were identified; rs10419226 (CRTC1), rs11789015 (BARX1), rs2687201 (FOXP1), rs2178146 (FOXF1), rs3111601 (FOXF1), and rs9936833 (FOXF1). These findings indicate that genetic susceptibility could play a role in the initiation of EAC in BE patients. The aim of this study was to validate the association between these previously identified SNPs and the risk of EAC in an independent and large case–control study. Design: Six SNPs found to be associated with EAC and BE were genotyped by a multiplex SNaPshot analysis in 1071 EAC patients diagnosed and treated in the Netherlands. Allele frequencies were compared to a control group derived from the Rotterdam Study, a population-based prospective cohort study (n = 6206). Logistic regression analysis and meta-analysis were performed to calculate odds ratios (OR). Results: Rs10419226 (CRTC1) showed a significantly increased EAC risk for the minor allele (OR = 1.17, P = 0.001), and rs11789015 (BARX1) showed a significantly decreased risk for the minor allele (OR = 0.85, P = 0.004) in the logistic regression analysis. The meta-analysis of the original GWAS and the current study revealed an improved level of significance for rs10419226 (CRTC1) (OR = 1.18, P = 6.66 × 10–10) and rs11789015 (BARX1) (OR = 0.83, P = 1.13 × 10–8). Conclusions: This independent and large Dutch case–control study confirms the association of rs10419226 (CRTC1) and rs11789015 (BARX1) with the risk of EAC. These findings suggest a contribution of the patient genetic make-up to the development of EAC and might contribute to gain more insight in the etiology of this cancer. PMID:26085818

  16. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms

    PubMed Central

    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Magnussen, E; Jónsson, B; Jiang, X; Cheng, L; Bekkevold, D; Maes, G E; Bernatchez, L; Hansen, M M

    2014-01-01

    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea and Europe. Only two hybrids were observed among Sargasso Sea larvae, both backcrosses, but no F1 hybrids, that points to temporal variation in the occurrence of hybridization. PMID:24424165

  17. Role of two single nucleotide polymorphisms in secreted frizzled related protein 1 and bladder cancer risk.

    PubMed

    Rogler, Anja; Hoja, Sabine; Socher, Eileen; Nolte, Elke; Wach, Sven; Wieland, Wolf; Hofstädter, Ferdinand; Goebell, Peter J; Wullich, Bernd; Hartmann, Arndt; Stoehr, Robert

    2013-01-01

    In this study, we determined the genotype distribution of two single nucleotide polymorphisms (SNPs) in secreted frizzled related protein 1 (SFRP1), rs3242 and rs921142, in a Caucasian bladder cancer case-control study. Allelic variants of the SNPs were determined using restriction fragment length polymorphism (RFLP) analysis and partly verified by sequencing analysis. Overall, DNA from 188 consecutive and 215 early-onset bladder cancer patients (≤45 years) as well as from 332 controls was investigated. Potential microRNA binding sites were determined for rs3242, and microRNA expression was analysed in cell lines and tumour specimens. We observed a remarkable distribution difference in rs3242 between bladder cancer patients and healthy controls (p=0.05). Additionally, we found a significant difference in genotype distribution (p=0.032), resulting from the difference of early-onset patients and the control group (p=0.007). The risk allele T showed increased frequency in the early-onset patient group (p=0.002). Genotype-dependent differences of microRNA binding capacity were predicted in SFRP1 mRNA for two microRNAs. Hsa-miR-3646 showed strong expression in cell lines and tumour tissue, whereas hsa-miR-603 exhibited weak expression. The rs921142 SNP showed no significant association with bladder cancer risk. This is the first study to describe an association of the SFRP1 SNP rs3242 and bladder cancer risk as well as the influence of rs3242 on genotype-dependent microRNA capacity on SFRP1 mRNA. The onset of bladder seems to be associated with the increased occurrence of the T-allele in rs3242. PMID:24133576

  18. Role of two single nucleotide polymorphisms in secreted frizzled related protein 1 and bladder cancer risk

    PubMed Central

    Rogler, Anja; Hoja, Sabine; Socher, Eileen; Nolte, Elke; Wach, Sven; Wieland, Wolf; Hofstädter, Ferdinand; Goebell, Peter J; Wullich, Bernd; Hartmann, Arndt; Stoehr, Robert

    2013-01-01

    In this study, we determined the genotype distribution of two single nucleotide polymorphisms (SNPs) in secreted frizzled related protein 1 (SFRP1), rs3242 and rs921142, in a Caucasian bladder cancer case-control study. Allelic variants of the SNPs were determined using restriction fragment length polymorphism (RFLP) analysis and partly verified by sequencing analysis. Overall, DNA from 188 consecutive and 215 early-onset bladder cancer patients (≤45 years) as well as from 332 controls was investigated. Potential microRNA binding sites were determined for rs3242, and microRNA expression was analysed in cell lines and tumour specimens. We observed a remarkable distribution difference in rs3242 between bladder cancer patients and healthy controls (p=0.05). Additionally, we found a significant difference in genotype distribution (p=0.032), resulting from the difference of early-onset patients and the control group (p=0.007). The risk allele T showed increased frequency in the early-onset patient group (p=0.002). Genotype-dependent differences of microRNA binding capacity were predicted in SFRP1 mRNA for two microRNAs. Hsa-miR-3646 showed strong expression in cell lines and tumour tissue, whereas hsa-miR-603 exhibited weak expression. The rs921142 SNP showed no significant association with bladder cancer risk. This is the first study to describe an association of the SFRP1 SNP rs3242 and bladder cancer risk as well as the influence of rs3242 on genotype-dependent microRNA capacity on SFRP1 mRNA. The onset of bladder seems to be associated with the increased occurrence of the T-allele in rs3242. PMID:24133576

  19. Association of a single nucleotide polymorphism in titin gene with marbling in Japanese Black beef cattle

    PubMed Central

    Yamada, Takahisa; Sasaki, Seiki; Sukegawa, Shin; Yoshioka, Sachiyo; Takahagi, Youichi; Morita, Mitsuo; Murakami, Hiroshi; Morimatsu, Fumiki; Fujita, Tatsuo; Miyake, Takeshi; Sasaki, Yoshiyuki

    2009-01-01

    Background Marbling defined by the amount and distribution of intramuscular fat is an economically important trait of beef cattle in Japan. We have recently reported that single nucleotide polymorphisms (SNPs) in the endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 (EDG1) gene were associated with marbling in Japanese Black beef cattle. As well as EDG1, the titin (TTN) gene, involved in myofibrillogenesis, has been previously shown to possess expression difference in musculus longissimus muscle between low-marbled and high-marbled steer groups, and to be located within genomic region of a quantitative trait locus for marbling. Thus TTN was considered as a positional functional candidate for the gene responsible for marbling. In this study, we explored SNP in TTN and analyzed association of the SNP with marbling. Findings A SNP in the promoter region of TTN, referred to as g.231054C>T, was the only difference detected between high- and low-marbled steer groups. The SNP was associated with marbling in 3 experiments using 101 sires (P = 0.004), 848 paternal half-sib progeny steers from 5 sires heterozygous for the g.231054C>T (P = 0.046), and 820 paternal half-sib progeny steers from 3 sires homozygous for C allele at the g.231054C>T (P = 0.051), in Japanese Black beef cattle. The effect of genotypes of the SNP on subcutaneous fat thickness was not statistically significant (P > 0.05). Conclusion These findings suggest that in addition to the EDG1 SNPs, the TTN SNP polymorphism is associated with marbling and may be useful for effective marker-assisted selection to increase the levels of marbling in Japanese Black beef cattle. Further replicate studies will be needed to confirm the allelic association observed here, and to expand the results to evaluate all possible genotypic combinations of alleles. PMID:19419586

  20. Discovery and verification of functional single nucleotide polymorphisms in regulatory genomic regions: Current and developing technologies

    PubMed Central

    Chorley, Brian N.; Wang, Xuting; Campbell, Michelle R.; Pittman, Gary S.; Noureddine, Maher A.; Bell, Douglas A.

    2008-01-01

    The most common form of genetic variation, single nucleotide polymorphisms or SNPs, can affect the way an individual responds to the environment and modify disease risk. Although most of the millions of SNPs have little or no effect on gene regulation and protein activity, there are many circumstances where base changes can have deleterious effects. Non-synonymous SNPs that result in amino acid changes in proteins have been studied because of their obvious impact on protein activity. It is well known that SNPs within regulatory regions of the genome can result in disregulation of gene transcription. However, the impact of SNPs located in putative regulatory regions, or rSNPs, is harder to predict for two primary reasons. First, the mechanistic roles of non-coding genomic sequence remain poorly defined. Second, experimental validation of the functional consequences of rSNPs is often slow and laborious. In this review, we summarize traditional and novel methodologies for candidate rSNPs selection, in particular in silico techniques that aid in candidate rSNP selection. Additionally we will discuss molecular biological techniques that assess the impact of rSNPs on binding of regulatory machinery, as well as functional consequences on transcription. Standard techniques such as EMSA and luciferase reporter constructs are still widely used to assess effects of rSNPs on binding and gene transcription; however, these protocols are often bottlenecks in the discovery process. Therefore, we highlight novel and developing high-throughput protocols that promise to aid in shortening the process of rSNP validation. Given the large amount of genomic information generated from a multitude of re-sequencing and genome-wide SNP array efforts, future focus should be to develop validation techniques that will allow greater understanding of the impact these polymorphisms have on human health and disease. PMID:18565787

  1. Gene expression, single nucleotide variant and fusion transcript discovery in archival material from breast tumors.

    PubMed

    Norton, Nadine; Sun, Zhifu; Asmann, Yan W; Serie, Daniel J; Necela, Brian M; Bhagwate, Aditya; Jen, Jin; Eckloff, Bruce W; Kalari, Krishna R; Thompson, Kevin J; Carr, Jennifer M; Kachergus, Jennifer M; Geiger, Xochiquetzal J; Perez, Edith A; Thompson, E Aubrey

    2013-01-01

    Advantages of RNA-Seq over array based platforms are quantitative gene expression and discovery of expressed single nucleotide variants (eSNVs) and fusion transcripts from a single platform, but the sensitivity for each of these characteristics is unknown. We measured gene expression in a set of manually degraded RNAs, nine pairs of matched fresh-frozen, and FFPE RNA isolated from breast tumor with the hybridization based, NanoString nCounter (226 gene panel) and with whole transcriptome RNA-Seq using RiboZeroGold ScriptSeq V2 library preparation kits. We performed correlation analyses of gene expression between samples and across platforms. We then specifically assessed whole transcriptome expression of lincRNA and discovery of eSNVs and fusion transcripts in the FFPE RNA-Seq data. For gene expression in the manually degraded samples, we observed Pearson correlations of >0.94 and >0.80 with NanoString and ScriptSeq protocols, respectively. Gene expression data for matched fresh-frozen and FFPE samples yielded mean Pearson correlations of 0.874 and 0.783 for NanoString (226 genes) and ScriptSeq whole transcriptome protocols respectively, p<2x10(-16). Specifically for lincRNAs, we observed superb Pearson correlation (0.988) between matched fresh-frozen and FFPE pairs. FFPE samples across NanoString and RNA-Seq platforms gave a mean Pearson correlation of 0.838. In FFPE libraries, we detected 53.4% of high confidence SNVs and 24% of high confidence fusion transcripts. Sensitivity of fusion transcript detection was not overcome by an increase in depth of sequencing up to 3-fold (increase from ~56 to ~159 million reads). Both NanoString and ScriptSeq RNA-Seq technologies yield reliable gene expression data for degraded and FFPE material. The high degree of correlation between NanoString and RNA-Seq platforms suggests discovery based whole transcriptome studies from FFPE material will produce reliable expression data. The RiboZeroGold ScriptSeq protocol performed

  2. Genotyping Single Nucleotide Polymorphisms and Copy Number Variability of the FCGRs Expressed on NK Cells.

    PubMed

    Erbe, Amy K; Wang, Wei; Gallenberger, Mikayla; Hank, Jacquelyn A; Sondel, Paul M

    2016-01-01

    Natural killer (NK) cells are one of the main effector immune cells involved in antibody-dependent cell-mediated cytotoxicity (ADCC). Upon recognition of cell-bound IgG antibodies, which occurs through Fc gamma receptors (FCGRs) expressed on the cell surface of NK cells, NK cells become activated and lyse target tumor or infected cells. The FCGRs, FCGR3A and FCGR2C, expressed on the surface of NK cells have single nucleotide polymorphisms (SNPs) that result in differential activity of NK cells. In addition to SNP genetic variation within each of these genes, the FCGRs are subject to copy number variation (CNV), which leads to variable protein expression levels on the cell surface. Studies have found that FCGR genotype for FCGR3A and FCGR2C is associated with variation in the response to immunotherapy.Due to high sequence homology within FCGR3 and FCGR2 families, there are difficulties associated with genotyping these specific receptors related to cross-amplification of non-targeted FCGRs. To improve specificity for both FCGR3A and FCGR2C, Rnase-H (RH) primers were designed to amplify specifically FCGR3A (while not co-amplifying FCGR3B) and FCGR2C (while not co-amplifying FCGR2B). In addition, fluorescently labeled locked nucleic acid (LNA) probes provide additional precision for determination of the SNPs within both FCGR3A and FCGR2C. For CNV determination, separate fluorescently labeled probes for FCGR3A, and for FCGR2C, can be used with the same RH primers for each gene. These probes can be combined in the same well with control primers/probe for a known diploid gene and used to calculate the copy number of both FCGR3A and FCGR2C. Here we provide new detailed methodology that allows for the specific amplification of these FCGRs in a single PCR reaction, allowing for genotyping of both the SNPs and CNVs using real-time PCR.

  3. Single nucleotide polymorphisms in genes associated with isoniazid resistance in Mycobacterium tuberculosis.

    PubMed

    Ramaswamy, Srinivas V; Reich, Robert; Dou, Shu-Jun; Jasperse, Linda; Pan, Xi; Wanger, Audrey; Quitugua, Teresa; Graviss, Edward A

    2003-04-01

    Isoniazid (INH) is a central component of drug regimens used worldwide to treat tuberculosis. Previous studies have identified resistance-associated mutations in katG, inhA, kasA, ndh, and the oxyR-ahpC intergenic region. DNA microarray-based experiments have shown that INH induces several genes in Mycobacterium tuberculosis that encode proteins physiologically relevant to the drug's mode of action. To gain further insight into the molecular genetic basis of INH resistance, 20 genes implicated in INH resistance were sequenced for INH resistance-associated mutations. Thirty-eight INH-monoresistant clinical isolates and 86 INH-susceptible isolates of M. tuberculosis were obtained from the Texas Department of Health and the Houston Tuberculosis Initiative. Epidemiologic independence was established for all isolates by IS6110 restriction fragment length polymorphism analysis. Susceptible isolates were matched with resistant isolates by molecular genetic group and IS6110 profiles. Spoligotyping was done with isolates with five or fewer IS6110 copies. A major genetic group was established on the basis of the polymorphisms in katG codon 463 and gyrA codon 95. MICs were determined by the E-test. Semiquantitative catalase assays were performed with isolates with mutations in the katG gene. When the 20 genes were sequenced, it was found that 17 (44.7%) INH-resistant isolates had a single-locus, resistance-associated mutation in the katG, mabA, or Rv1772 gene. Seventeen (44.7%) INH-resistant isolates had resistance-associated mutations in two or more genes, and 76% of all INH-resistant isolates had a mutation in the katG gene. Mutations were also identified in the fadE24, Rv1592c, Rv1772, Rv0340, and iniBAC genes, recently shown by DNA-based microarray experiments to be upregulated in response to INH. In general, the MICs were higher for isolates with mutations in katG and the isolates had reduced catalase activities. The results show that a variety of single nucleotide

  4. Nucleotide replacement at two sites can be directed by modified single-stranded oligonucleotides in vitro and in vivo.

    PubMed

    Agarwal, Sheba; Gamper, Howard B; Kmiec, Eric B

    2003-01-01

    Studies involving the alteration of DNA sequences by modified single-stranded oligonucleotides in vitro and in vivo have revealed potential applications for functional genomics. Repair of a replacement, deletion, or insertion mutation has already been achieved with molecules having lengths between 25 and 74 bases. But, other vector parameters still remain to be explored. Here, the position of the single base in the vector directing the alteration was examined and the optimal site was found to be at or near the center of the vector. If that position is staggered 3' or 5', the frequencies of gene repair in vitro decreases. The potential of a single vector to direct two nucleotide changes at a specific site in a target sequence was also examined. Both targeted bases are corrected together at the same frequency if the sites are separated by three bases, but conversion linkage decreases precipitously when the distance is expanded to 15 and 27 nucleotides, respectively. These results suggest that single oligonucleotides can be used to direct nucleotide exchange at two independent sites, a reaction characteristic that may be useful for many genomics applications.

  5. A fluorescence light-up Ag nanocluster probe that discriminates single-nucleotide variants by emission color.

    PubMed

    Yeh, Hsin-Chih; Sharma, Jaswinder; Shih, Ie-Ming; Vu, Dung M; Martinez, Jennifer S; Werner, James H

    2012-07-18

    Rapid and precise screening of small genetic variations, such as single-nucleotide polymorphisms (SNPs), among an individual's genome is still an unmet challenge at point-of-care settings. One crucial step toward this goal is the development of discrimination probes that require no enzymatic reaction and are easy to use. Here we report a new type of fluorescent molecular probe, termed a chameleon NanoCluster Beacon (cNCB), that lights up into different colors upon binding SNP targets. NanoCluster Beacons (NCBs) are collections of a small number of Ag atoms templated on single-stranded DNA that fluoresce strongly when placed in proximity to particular DNA sequences, termed enhancers. Here we show the fluorescence emission color of a NCB can change substantially (a shift of 60-70 nm in the emission maximum) depending upon the alignment between the silver nanocluster and the DNA enhancer sequence. Chameleon NCBs exploit this color shift to directly detect SNPs, based on the fact that different SNPs produce a different alignment between the Ag nanocluster and the enhancer. This SNP detection method has been validated on all single-nucleotide substitution scenarios in three synthetic DNA targets, in six disease-related SNP targets, and in two clinical samples taken from patients with ovarian serous borderline tumors. Samples with single-nucleotide variations can be easily identified by the naked eye under UV excitation, making this method a reliable and low-cost assay with a simple readout format.

  6. Comprehensive analysis reveals how single nucleotides contribute to noncoding RNA function in bacterial quorum sensing.

    PubMed

    Rutherford, Steven T; Valastyan, Julie S; Taillefumier, Thibaud; Wingreen, Ned S; Bassler, Bonnie L

    2015-11-01

    Five homologous noncoding small RNAs (sRNAs), called the Qrr1-5 sRNAs, function in the Vibrio harveyi quorum-sensing cascade to drive its operation. Qrr1-5 use four different regulatory mechanisms to control the expression of ∼ 20 mRNA targets. Little is known about the roles individual nucleotides play in mRNA target selection, in determining regulatory mechanism, or in defining Qrr potency and dynamics of target regulation. To identify the nucleotides vital for Qrr function, we developed a method we call RSort-Seq that combines saturating mutagenesis, fluorescence-activated cell sorting, high-throughput sequencing, and mutual information theory to explore the role that every nucleotide in Qrr4 plays in regulation of two mRNA targets, luxR and luxO. Companion biochemical assays allowed us to assign specific regulatory functions/underlying molecular mechanisms to each important base. This strategy yielded a regional map of nucleotides in Qrr4 vital for stability, Hfq interaction, stem-loop formation, and base pairing to both luxR and luxO, to luxR only, and to luxO only. In terms of nucleotides critical for sRNA function, the RSort-Seq analysis provided strikingly different results from those predicted by commonly used regulatory RNA-folding algorithms. This approach is applicable to any RNA-RNA interaction, including sRNAs in other bacteria and regulatory RNAs in higher organisms.

  7. Comprehensive analysis reveals how single nucleotides contribute to noncoding RNA function in bacterial quorum sensing

    PubMed Central

    Rutherford, Steven T.; Valastyan, Julie S.; Taillefumier, Thibaud; Wingreen, Ned S.; Bassler, Bonnie L.

    2015-01-01

    Five homologous noncoding small RNAs (sRNAs), called the Qrr1-5 sRNAs, function in the Vibrio harveyi quorum-sensing cascade to drive its operation. Qrr1-5 use four different regulatory mechanisms to control the expression of ∼20 mRNA targets. Little is known about the roles individual nucleotides play in mRNA target selection, in determining regulatory mechanism, or in defining Qrr potency and dynamics of target regulation. To identify the nucleotides vital for Qrr function, we developed a method we call RSort-Seq that combines saturating mutagenesis, fluorescence-activated cell sorting, high-throughput sequencing, and mutual information theory to explore the role that every nucleotide in Qrr4 plays in regulation of two mRNA targets, luxR and luxO. Companion biochemical assays allowed us to assign specific regulatory functions/underlying molecular mechanisms to each important base. This strategy yielded a regional map of nucleotides in Qrr4 vital for stability, Hfq interaction, stem-loop formation, and base pairing to both luxR and luxO, to luxR only, and to luxO only. In terms of nucleotides critical for sRNA function, the RSort-Seq analysis provided strikingly different results from those predicted by commonly used regulatory RNA-folding algorithms. This approach is applicable to any RNA–RNA interaction, including sRNAs in other bacteria and regulatory RNAs in higher organisms. PMID:26483489

  8. Label-free hybridization detection of a single nucleotide mismatch by immobilization of molecular beacons on an agarose film.

    PubMed

    Wang, Hong; Li, Jiong; Liu, Heping; Liu, Quanjun; Mei, Qian; Wang, Yijin; Zhu, Jijun; He, Nongyue; Lu, Zuhong

    2002-06-15

    We developed a new technique to immobilize a set of molecular beacons on an agarose film-coated slide and found that it has the ability to identify a single nucleotide difference in label-free DNA targets. The annealing properties, specificity and hybridization dynamics of the present technique were compared with those of the conventional technique that directly immobilizes molecular beacons on a planar glass slide. It is demonstrated that the molecular beacon array on an agarose film has high quench efficiency, an excellent discrimination ratio for single nucleotide mismatches and a short detection time. We hypothesize that such a low fluorescence background and high specificity molecular beacon array will find practical applications in label-free, high-throughput mutation analysis and disease diagnosis.

  9. Genome-Wide Single-Nucleotide Polymorphism Array Analysis Improves Prognostication of Acute Lymphoblastic Leukemia/Lymphoma.

    PubMed

    Wang, Yunhong; Miller, Sue; Roulston, Diane; Bixby, Dale; Shao, Lina

    2016-07-01

    Chromosomal abnormalities are important for the risk stratification of acute lymphoblastic leukemia/lymphoma (ALL). However, approximately 30% of pediatric and 50% of adult patients lack abnormalities with clinical relevance by traditional cytogenetic analysis. We integrated cytogenetic, fluorescence in situ hybridization, and whole-genome single-nucleotide polymorphism array results from 60 consecutive clinical ALL cases. By cytogenetic and/or fluorescence in situ hybridization analyses, recurring abnormalities with clinical relevance were observed in 33 B-cell ALL (B-ALL), including t(9;22), hyperdiploidy, KMT2A translocation, ETV6-RUNX1, intrachromosomal amplification of chromosome 21, near haploidy or low hypodiploidy, and t(8;22). Single-nucleotide polymorphism array analysis found additional aberrations with prognostic or therapeutic implication in 21 B-ALL and two T-cell ALL, including IKZF1 deletion, intrachromosomal amplification of chromosome 21 (one case with a normal karyotype), low hypodiploidy (two cases with a normal karyotype), and one case each with fusion genes ETV6-NTRK3, CRLF2-P2RY8, NUP214-ABL1, and SET-NUP214. IKZF1 deletion was noted in nine B-ALL with t(9;22), one B-ALL with t(4;11), five B-ALL with a normal karyotype, and three B-ALL with nonrecurring karyotypic abnormalities. Combining single-nucleotide polymorphism array with chromosome and fluorescence in situ hybridization assays, the detection rate for clinically significant abnormal results increased from 56% to 75%. Whole-genome single-nucleotide polymorphism array analysis detects cytogenetically undetectable clinically significant aberrations and should be routinely applied at diagnosis of ALL. PMID:27161658

  10. Use of the Illumina GoldenGate assay for single nucleotide polymorphism (SNP) genotyping in cereal crops.

    PubMed

    Chao, Shiaoman; Lawley, Cindy

    2015-01-01

    Highly parallel genotyping assays, such as the GoldenGate assay developed by Illumina, capable of interrogating up to 3,072 single nucleotide polymorphisms (SNPs) simultaneously, have greatly facilitated genome-wide studies, particularly for crops with large and complex genome structures. In this report, we provide detailed information and guidelines regarding genomic DNA preparation, SNP assay design, SNP assay protocols, and genotype calling using Illumina's GenomeStudio software. PMID:25373766

  11. Genome-Wide Single-Nucleotide Polymorphism Array Analysis Improves Prognostication of Acute Lymphoblastic Leukemia/Lymphoma.

    PubMed

    Wang, Yunhong; Miller, Sue; Roulston, Diane; Bixby, Dale; Shao, Lina

    2016-07-01

    Chromosomal abnormalities are important for the risk stratification of acute lymphoblastic leukemia/lymphoma (ALL). However, approximately 30% of pediatric and 50% of adult patients lack abnormalities with clinical relevance by traditional cytogenetic analysis. We integrated cytogenetic, fluorescence in situ hybridization, and whole-genome single-nucleotide polymorphism array results from 60 consecutive clinical ALL cases. By cytogenetic and/or fluorescence in situ hybridization analyses, recurring abnormalities with clinical relevance were observed in 33 B-cell ALL (B-ALL), including t(9;22), hyperdiploidy, KMT2A translocation, ETV6-RUNX1, intrachromosomal amplification of chromosome 21, near haploidy or low hypodiploidy, and t(8;22). Single-nucleotide polymorphism array analysis found additional aberrations with prognostic or therapeutic implication in 21 B-ALL and two T-cell ALL, including IKZF1 deletion, intrachromosomal amplification of chromosome 21 (one case with a normal karyotype), low hypodiploidy (two cases with a normal karyotype), and one case each with fusion genes ETV6-NTRK3, CRLF2-P2RY8, NUP214-ABL1, and SET-NUP214. IKZF1 deletion was noted in nine B-ALL with t(9;22), one B-ALL with t(4;11), five B-ALL with a normal karyotype, and three B-ALL with nonrecurring karyotypic abnormalities. Combining single-nucleotide polymorphism array with chromosome and fluorescence in situ hybridization assays, the detection rate for clinically significant abnormal results increased from 56% to 75%. Whole-genome single-nucleotide polymorphism array analysis detects cytogenetically undetectable clinically significant aberrations and should be routinely applied at diagnosis of ALL.

  12. Single nucleotide polymorphisms in the IS900 sequence of Mycobacterium avium subsp. paratuberculosis are strain type specific.

    PubMed

    Castellanos, Elena; Aranaz, Alicia; de Juan, Lucia; Alvarez, Julio; Rodríguez, Sabrina; Romero, Beatriz; Bezos, Javier; Stevenson, Karen; Mateos, Ana; Domínguez, Lucas

    2009-07-01

    Insertion sequence IS900 is used as a target for the identification of Mycobacterium avium subsp. paratuberculosis. Previous reports have revealed single nucleotide polymorphisms within IS900. This study, which analyzed the IS900 sequences of a panel of isolates representing M. avium subsp. paratuberculosis strain types I, II, and III, revealed conserved type-specific polymorphisms that could be utilized as a tool for diagnostic and epidemiological purposes.

  13. Novel, Compound Heterozygous, Single Nucleotide Variants in MARS2 Associated with Developmental Delay, Poor Growth, and Sensorineural Hearing Loss

    PubMed Central

    Webb, Bryn D.; Wheeler, Patricia G.; Hagen, Jacob J.; Cohen, Ninette; Linderman, Michael D.; Diaz, George A.; Naidich, Thomas P.; Rodenburg, Richard J.; Houten, Sander M.; Schadt, Eric E.

    2015-01-01

    Novel, single nucleotide mutations were identified in the mitochondrial methionyl amino-acyl-tRNA synthetase gene (MARS2) via whole exome sequencing in two affected siblings with developmental delay, poor growth, and sensorineural hearing loss. We show that compound heterozygous mutations c.550C>T:p.Gln184* and c.424C>T:p.Arg142Trp in MARS2 lead to decreased MARS2 protein levels in patient lymphoblasts. Analysis of respiratory complex (RC) enzyme activities in patient fibroblasts revealed decreased Complex I and IV activities. Immunoblotting of patient fibroblast and lymphoblast samples revealed reduced protein levels of NDUFB8 and COXII, representing Complex I and IV respectively. Additionally, overexpression of wild-type MARS2 in patient fibroblasts increased NDUFB8 and COXII protein levels. These findings suggest that recessive single nucleotide mutations in MARS2 are causative for a new mitochondrial translation deficiency disorder with a primary phenotype including developmental delay and hypotonia. Identification of additional patients with single nucleotide mutations in MARS2 is necessary to determine if pectus carinatum is also a consistent feature of this syndrome. PMID:25754315

  14. Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress.

    PubMed

    Dikmen, S; Wang, X-z; Ortega, M S; Cole, J B; Null, D J; Hansen, P J

    2015-12-01

    Dairy cows with increased rectal temperature experience lower milk yield and fertility. Rectal temperature during heat stress is heritable, so genetic selection for body temperature regulation could reduce effects of heat stress on production. One aim of the study was to validate the relationship between genotype and heat tolerance for single nucleotide polymorphisms (SNPs) previously associated with resistance to heat stress. A second aim was to identify new SNPs associated with heat stress resistance. Thermotolerance was assessed in lactating Holsteins during the summer by measuring rectal temperature (a direct measurement of body temperature regulation; n = 435), respiration rate (an indirect measurement of body temperature regulation, n = 450) and sweating rate (the major evaporative cooling mechanism in cattle, n = 455). The association between genotype and thermotolerance was evaluated for 19 SNPs previously associated with rectal temperature from a genomewide analysis study (GWAS), four SNPs previously associated with change in milk yield during heat stress from GWAS, 2 candidate gene SNPs previously associated with rectal temperature and respiration rate during heat stress (ATPA1A and HSP70A) and 66 SNPs in genes previously shown to be associated with reproduction, production or health traits in Holsteins. For SNPs previously associated with heat tolerance, regions of BTA4, BTA6 and BTA24 were associated with rectal temperature; regions of BTA6 and BTA24 were associated with respiration rate; and regions of BTA5, BTA26 and BTA29 were associated with sweating rate. New SNPs were identified for rectal temperature (n = 12), respiration rate (n = 8) and sweating rate (n = 3) from among those previously associated with production, reproduction or health traits. The SNP that explained the most variation were PGR and ASL for rectal temperature, ACAT2 and HSD17B7 for respiration rate, and ARL6IP1 and SERPINE2 for sweating rate. ARL6IP1 was associated with all three

  15. Identification and characterization of human xylosyltransferase II promoter single nucleotide variants.

    PubMed

    Faust, Isabel; Böker, Kai Oliver; Eirich, Christina; Akkermann, Dagmar; Kuhn, Joachim; Knabbe, Cornelius; Hendig, Doris

    2015-03-20

    The human isoenzymes xylosyltransferase-I and -II (XT-I, XT-II) catalyze the rate-limiting step in proteoglycan biosynthesis. Therefore, serum XT activity, mainly representing XT-II activity, displays a powerful biomarker to quantify the actual proteoglycan synthesis rate. Serum XT activity is increased up to 44% in disorders which are characterized by an altered proteoglycan metabolism, whereby underlying regulatory mechanisms remain unclear. The aim of this study was to investigate new regulatory pathways by identifying and characterizing naturally occurring XYLT2 promoter sequence variants as well as their potential influence on promoter activity and serum XT activity. XYLT2 promoter single nucleotide variants (SNVs) were identified and genotyped in the genomic DNA of 100 healthy blood donors by promoter amplification and sequencing or restriction fragment length polymorphism analysis. The SNVs were characterized by an in silico analysis considering genetic linkage and transcription factor binding sites (TBSs). The influence of SNVs on promoter activity and serum XT activity was determined by dual luciferase reporter assay and HPLC-ESI mass spectrometry. Allele frequencies of seven XYLT2 promoter sequence variants identified were investigated. In silico analyses revealed a strong genetic linkage of SNVs c.-80delG and c.-188G > A, c.-80delG and c.-1443G > A, as well as c.-188G > A and c.-1443G > A. However, despite the generation of several SNV-associated changes in TBSs in silico, XYLT2 promoter SNVs did not significantly affect promoter activity. Serum XT activities of SNV carriers deviated up to 8% from the wild-type, whereby the differences were also not statistically significant. This is the first study which identifies, genotypes and characterizes XYLT2 promoter SNVs. Our results reveal a weak genetic heterogeneity and a strong conservation of the human XYLT2 promoter region. Since the SNVs detected could be excluded as causatives for strong

  16. Single nucleotide polymorphisms in interleukin-6 and their association with venous thromboembolism.

    PubMed

    Yadav, Umesh; Mahemuti, Ailiman; Hu, Xuemei; Abudureheman, Kailibinure; Xia, Yuning; Tang, Baopeng; Upur, Halmurat

    2015-06-01

    The aim of the present study was to reveal the contribution of single nucleotide polymorphisms of the interleukin‑6 (IL‑6) gene and the progression of venous thromboembolism (VTE). A case‑control study composed of 246 VTE patients, including 160 from the Han population (76 males and 84 females, mean age 57.41±13.25 years), 86 from the Uyghur population (41 males and 45 females, mean age 51.61±13.73 years) and 292 gender and ethnicity‑matched control participants, including 170 from the Han population (91 males and 79 females, mean age 55.82±11.83 years) and 122 from the Uyghur population (64 males and 58 females, mean age 53.52±13.64 years) were enrolled in the present study. The results demonstrated that the serum levels of IL‑6, C‑reactive protein (CRP), D‑dimer, fibrinogen, plasminogen activator inhibitor‑1 and leptin were significantly higher in the VTE group compared with the control group (P<0.05). The frequencies of the ‑572C/G promoter polymorphisms of the IL‑6 genotypes CC, CG and GG were identified to be 34, 48 and 18% in the Han population and 33, 47 and 20% in the Uyghur population, respectively. The allele frequency distributions of the C and G alleles were 58 and 42% in the Han population and 56 and 43% in the Uyghur population, respectively. Significant differences were identified in the ‑572C/G promoter polymorphisms between the VTE group and the control group (P<0.05). For the ‑597G/A polymorphism, all individuals carried the GG and GA genotype; AA genotypes were not detected. Logistic regression analysis was used to identify the risk factors for VTE, adjusting by confounding factors, the results of which demonstrated that the CC homozygote of the IL‑6 ‑572G/C, CRP, IL‑6 and high‑density lipoprotein‑cholesterol were independent risk factors of VTE (P<0.05). In conclusion, the ‑572G/C genotype of IL‑6 may be a genetic marker of VTE in the Han and Uyghur populations. PMID:25625484

  17. A Transcriptome Map of Actinobacillus pleuropneumoniae at Single-Nucleotide Resolution Using Deep RNA-Seq.

    PubMed

    Su, Zhipeng; Zhu, Jiawen; Xu, Zhuofei; Xiao, Ran; Zhou, Rui; Li, Lu; Chen, Huanchun

    2016-01-01

    Actinobacillus pleuropneumoniae is the pathogen of porcine contagious pleuropneumoniae, a highly contagious respiratory disease of swine. Although the genome of A. pleuropneumoniae was sequenced several years ago, limited information is available on the genome-wide transcriptional analysis to accurately annotate the gene structures and regulatory elements. High-throughput RNA sequencing (RNA-seq) has been applied to study the transcriptional landscape of bacteria, which can efficiently and accurately identify gene expression regions and unknown transcriptional units, especially small non-coding RNAs (sRNAs), UTRs and regulatory regions. The aim of this study is to comprehensively analyze the transcriptome of A. pleuropneumoniae by RNA-seq in order to improve the existing genome annotation and promote our understanding of A. pleuropneumoniae gene structures and RNA-based regulation. In this study, we utilized RNA-seq to construct a single nucleotide resolution transcriptome map of A. pleuropneumoniae. More than 3.8 million high-quality reads (average length ~90 bp) from a cDNA library were generated and aligned to the reference genome. We identified 32 open reading frames encoding novel proteins that were mis-annotated in the previous genome annotations. The start sites for 35 genes based on the current genome annotation were corrected. Furthermore, 51 sRNAs in the A. pleuropneumoniae genome were discovered, of which 40 sRNAs were never reported in previous studies. The transcriptome map also enabled visualization of 5'- and 3'-UTR regions, in which contained 11 sRNAs. In addition, 351 operons covering 1230 genes throughout the whole genome were identified. The RNA-Seq based transcriptome map validated annotated genes and corrected annotations of open reading frames in the genome, and led to the identification of many functional elements (e.g. regions encoding novel proteins, non-coding sRNAs and operon structures). The transcriptional units described in this study

  18. Single Nucleotide Polymorphisms and Osteoarthritis: An Overview and a Meta-Analysis.

    PubMed

    Wang, Ting; Liang, Yuting; Li, Hong; Li, Haibo; He, Quanze; Xue, Ying; Shen, Cong; Zhang, Chunhua; Xiang, Jingjing; Ding, Jie; Qiao, Longwei; Zheng, Qiping

    2016-02-01

    Osteoarthritis (OA) is a complex disorder characterized by degenerative articular cartilage and is largely attributed to genetic risk factors. Single nucleotide polymorphisms (SNPs) are common DNA variants that have shown promising and efficiency, compared with positional cloning, to map candidate genes of complex diseases, including OA. In this study, we aim to provide an overview of multiple SNPs from a number of genes that have recently been linked to OA susceptibility. We also performed a comprehensive meta-analysis to evaluate the association of SNP rs7639618 of double von Willebrand factor A domains (DVWA) gene with OA susceptibility. A systematic search of studies on the association of SNPs with susceptibility to OA was conducted in PubMed and Google scholar. Studies subjected to meta-analysis include human and case-control studies that met the Hardy-Weinberg equilibrium model and provide sufficient data to calculate an odds ratio (OR). A total of 9500 OA cases and 9365 controls in 7 case-control studies relating to SNP rs7639618 were included in this study and the ORs with 95% confidence intervals (CIs) were calculated. Over 50 SNPs from different genes have been shown to be associated with either hip (23), or knee (20), or both (13) OA. The ORs of these SNPs for OA and the subtypes are not consistent. As to SNP rs7639618 of DVWA, increased knee OA risk was observed in all genetic models analyzed. Specifically, people from Asian with G-allele showed significantly increased risk of knee OA (A versus G: OR = 1.28, 95% CI 1.13-1.46; AA versus GG: OR = 1.60, 95% CI 1.25-2.05; GA versus GG: OR = 1.31, 95% CI 1.18-1.44; AA versus GA+GG: OR = 1.34, 95% CI 1.12-1.61; AA+GA versus GG: OR = 1.40, 95% CI 1.19-1.64), but not in Caucasians or with hip OA. Our results suggest that multiple SNPs play different roles in the pathogenesis of OA and its subtypes; SNP rs7639618 of DVWA gene is associated with a significantly increased risk of knee OA in

  19. Mitochondrial localization of the OAS1 p46 isoform associated with a common single nucleotide polymorphism

    PubMed Central

    2014-01-01

    Background The expression of 2′-5′-Oligoadenylate synthetases (OASs) is induced by type 1 Interferons (IFNs) in response to viral infection. The OAS proteins have a unique ability to produce 2′-5′ Oligoadenylates, which bind and activate the ribonuclease RNase L. The RNase L degrades cellular RNAs which in turn inhibits protein translation and induces apoptosis. Several single nucleotide polymorphisms (SNPs) in the OAS1 gene have been associated with disease. We have investigated the functional effect of two common SNPs in the OAS1 gene. The SNP rs10774671 affects splicing to one of the exons in the OAS1 gene giving rise to differential expression of the OAS1 isoforms, and the SNP rs1131454 (former rs3741981) resides in exon 3 giving rise to OAS1 isoforms with either a Glycine or a Serine at position 162 in the core OAS unit. Results We have used three human cell lines with different genotypes in the OAS1 SNP rs10774671, HeLa cells with the AA genotype, HT1080 cells with AG, and Daudi cells with GG. The main OAS1 isoform expressed in Daudi and HT1080 cells was p46, and the main OAS1 isoform expressed in HeLa cells was p42. In addition, low levels of the OAS1 p52 mRNA was detected in HeLa cells and p48 mRNA in Daudi cells, and trace amounts of p44a mRNA were detected in the three cell lines treated with type 1 interferon. We show that the OAS1 p46 isoform was localized in the mitochondria in Daudi cells, whereas the OAS1 isoforms in HeLa cells were primarily localized in cytoplasmic vacuoles/lysosomes. By using recombinantly expressed OAS1 mutant proteins, we found that the OAS1 SNP rs1131454 (former rs3741981) did not affect the enzymatic OAS1 activity. Conclusions The SNP rs10774671 determines differential expression of the OAS1 isoforms. In Daudi and HT1080 cells the p46 isoform is the most abundantly expressed isoform associated with the G allele, whereas in HeLa cells the most abundantly expressed isoform is p42 associated with the A allele. The SNP rs

  20. Identification and characterization of human xylosyltransferase II promoter single nucleotide variants.

    PubMed

    Faust, Isabel; Böker, Kai Oliver; Eirich, Christina; Akkermann, Dagmar; Kuhn, Joachim; Knabbe, Cornelius; Hendig, Doris

    2015-03-20

    The human isoenzymes xylosyltransferase-I and -II (XT-I, XT-II) catalyze the rate-limiting step in proteoglycan biosynthesis. Therefore, serum XT activity, mainly representing XT-II activity, displays a powerful biomarker to quantify the actual proteoglycan synthesis rate. Serum XT activity is increased up to 44% in disorders which are characterized by an altered proteoglycan metabolism, whereby underlying regulatory mechanisms remain unclear. The aim of this study was to investigate new regulatory pathways by identifying and characterizing naturally occurring XYLT2 promoter sequence variants as well as their potential influence on promoter activity and serum XT activity. XYLT2 promoter single nucleotide variants (SNVs) were identified and genotyped in the genomic DNA of 100 healthy blood donors by promoter amplification and sequencing or restriction fragment length polymorphism analysis. The SNVs were characterized by an in silico analysis considering genetic linkage and transcription factor binding sites (TBSs). The influence of SNVs on promoter activity and serum XT activity was determined by dual luciferase reporter assay and HPLC-ESI mass spectrometry. Allele frequencies of seven XYLT2 promoter sequence variants identified were investigated. In silico analyses revealed a strong genetic linkage of SNVs c.-80delG and c.-188G > A, c.-80delG and c.-1443G > A, as well as c.-188G > A and c.-1443G > A. However, despite the generation of several SNV-associated changes in TBSs in silico, XYLT2 promoter SNVs did not significantly affect promoter activity. Serum XT activities of SNV carriers deviated up to 8% from the wild-type, whereby the differences were also not statistically significant. This is the first study which identifies, genotypes and characterizes XYLT2 promoter SNVs. Our results reveal a weak genetic heterogeneity and a strong conservation of the human XYLT2 promoter region. Since the SNVs detected could be excluded as causatives for strong

  1. A Transcriptome Map of Actinobacillus pleuropneumoniae at Single-Nucleotide Resolution Using Deep RNA-Seq

    PubMed Central

    Su, Zhipeng; Zhu, Jiawen; Xu, Zhuofei; Xiao, Ran; Zhou, Rui; Li, Lu; Chen, Huanchun

    2016-01-01

    Actinobacillus pleuropneumoniae is the pathogen of porcine contagious pleuropneumoniae, a highly contagious respiratory disease of swine. Although the genome of A. pleuropneumoniae was sequenced several years ago, limited information is available on the genome-wide transcriptional analysis to accurately annotate the gene structures and regulatory elements. High-throughput RNA sequencing (RNA-seq) has been applied to study the transcriptional landscape of bacteria, which can efficiently and accurately identify gene expression regions and unknown transcriptional units, especially small non-coding RNAs (sRNAs), UTRs and regulatory regions. The aim of this study is to comprehensively analyze the transcriptome of A. pleuropneumoniae by RNA-seq in order to improve the existing genome annotation and promote our understanding of A. pleuropneumoniae gene structures and RNA-based regulation. In this study, we utilized RNA-seq to construct a single nucleotide resolution transcriptome map of A. pleuropneumoniae. More than 3.8 million high-quality reads (average length ~90 bp) from a cDNA library were generated and aligned to the reference genome. We identified 32 open reading frames encoding novel proteins that were mis-annotated in the previous genome annotations. The start sites for 35 genes based on the current genome annotation were corrected. Furthermore, 51 sRNAs in the A. pleuropneumoniae genome were discovered, of which 40 sRNAs were never reported in previous studies. The transcriptome map also enabled visualization of 5'- and 3'-UTR regions, in which contained 11 sRNAs. In addition, 351 operons covering 1230 genes throughout the whole genome were identified. The RNA-Seq based transcriptome map validated annotated genes and corrected annotations of open reading frames in the genome, and led to the identification of many functional elements (e.g. regions encoding novel proteins, non-coding sRNAs and operon structures). The transcriptional units described in this study

  2. Single-nucleotide polymorphisms in PSCA and the risk of breast cancer in a Chinese population

    PubMed Central

    Wang, Meng; Wang, Xijing; Fu, Sidney W.; Liu, Xinghan; Jin, Tianbo; Kang, Huafeng; Ma, Xiaobin; Lin, Shuai; Guan, Haitao; Zhang, Shuqun; Liu, Kang; Dai, Cong; Zhu, Yuyao; Dai, Zhijun

    2016-01-01

    This study explored the associations between common PSCA single-nucleotide polymorphisms (rs2294008, rs2978974, and rs2976392) and breast cancer among 560 breast cancer cases and 583 controls (Chinese Han women). We found rs2294008 was significantly associated with a high risk of breast cancer (homozygote model, odds ratio [OR]: 1.67, 95% confidence interval [CI]: 1.06–2.59; recessive, OR: 1.64, 95% CI: 1.06–2.53). And stratification by menopausal status revealed an association of the minor allele of rs2294008 with breast cancer risk among premenopausal (homozygote model, OR: 2.41, 95% CI: 1.03–5.66; recessive, OR: 2.80, 95 % CI: 1.21–6.47) and postmenopausal women (allele model, OR: 1.29, 95% CI: 1.01–1.65). Rs2978974 influenced the breast cancer risk among postmenopausal women in heterozygote model (OR: 1.47, 95% CI: 1.05–2.07). When stratified by clinicopathologic features, the T allele of rs2294008 was associated with progesterone receptor status (homozygote model, OR: 1.98, 95% CI: 1.08–3.63; recessive, OR: 1.87, 95% CI: 1.04–3.37), and the rs2976392 polymorphism was associated with high lymph node metastasis risk in homozygote model (OR: 2.09, 95%CI: 1.01–4.31). Further haplotype analysis suggested that Trs2294008 Ars2976392 Grs2978974 haplotype enhances breast cancer risk (OR:1.52, 95%CI:1.23-1.89, P<0.001). Therefore, among Chinese Han women, the PSCA rs2294008, rs2978974, and rs2976392 minor alleles are associated with increased breast cancer risk especially in progesterone receptor positive breast cancer patients, with breast cancer risk in postmenopausal women, and with high lymph node metastasis risk, respectively. Moreover, Trs2294008 Ars2976392 Grs2978974 haplotype was associated with significantly increased risk of breast cancer. PMID:27050280

  3. Phosphodiesterase 3A rs7134375 single nucleotide polymorphism and serum lipid levels

    PubMed Central

    WANG, WEI; YIN, RUI-XING; WU, DONG-FENG; AUNG, LYNN HTET HTET; HUANG, PING; ZENG, XIAO-NA; HUANG, KE-KE; LIN, QUAN-ZHEN; WU, JIAN; GUO, TAO

    2014-01-01

    The association between the phosphodiesterase 3A (PDE3A) rs7134375 single nucleotide polymorphism (SNP) and serum lipid levels are not well understood in the general population. The present study was performed in order to detect the association between the rs7134375 SNP and serum lipid levels in the Guangxi Mulao and Han populations. The genotypes of the PDE3A rs7134375 SNP in 761 subjects of the Mulao population and 774 subjects of the Han Chinese population were determined by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. It was observed that serum low-density lipoprotein cholesterol and apolipoprotein B levels were higher in the Mulao population than in the Han population (P<0.05 for each). The frequencies of the C and A alleles were 72.14 and 27.86% in the Mulao population, and 78.55 and 21.45% in the Han population (P<0.01), respectively. The frequencies of the CC, CA and AA genotypes were 52.04, 40.21 and 7.75% in the Mulao population, and 61.50, 34.11 and 4.39% in the Han population (P<0.01), respectively. The frequencies of the C and A alleles were 74.89 and 25.11% in Mulao females, and 68.08 and 31.92% in Mulao males (P<0.01), respectively. The serum triglyceride (TG) levels were different among the genotypes in the Mulao population; however, not in the Han population (P<0.01), and the A allele carriers exhibited lower TG levels than the A allele noncarriers. The serum lipid parameters were also correlated with several environmental factors in the two ethnic groups (P<0.05-0.001). It was concluded that the genotypic and allelic frequencies of the rs7134375 SNP are different between the Mulao and Han populations. In addition, the PDE3A rs7134375 SNP is associated with serum TG levels in the Mulao population, however, not in the Han population. PMID:24604378

  4. Spatial distribution of single-nucleotide polymorphisms related to fungicide resistance and implications for sampling.

    PubMed

    Van der Heyden, H; Dutilleul, P; Brodeur, L; Carisse, O

    2014-06-01

    Spatial distribution of single-nucleotide polymorphisms (SNPs) related to fungicide resistance was studied for Botrytis cinerea populations in vineyards and for B. squamosa populations in onion fields. Heterogeneity in this distribution was characterized by performing geostatistical analyses based on semivariograms and through the fitting of discrete probability distributions. Two SNPs known to be responsible for boscalid resistance (H272R and H272Y), both located on the B subunit of the succinate dehydrogenase gene, and one SNP known to be responsible for dicarboximide resistance (I365S) were chosen for B. cinerea in grape. For B. squamosa in onion, one SNP responsible for dicarboximide resistance (I365S homologous) was chosen. One onion field was sampled in 2009 and another one was sampled in 2010 for B. squamosa, and two vineyards were sampled in 2011 for B. cinerea, for a total of four sampled sites. Cluster sampling was carried on a 10-by-10 grid, each of the 100 nodes being the center of a 10-by-10-m quadrat. In each quadrat, 10 samples were collected and analyzed by restriction fragment length polymorphism polymerase chain reaction (PCR) or allele specific PCR. Mean SNP incidence varied from 16 to 68%, with an overall mean incidence of 43%. In the geostatistical analyses, omnidirectional variograms showed spatial autocorrelation characterized by ranges of 21 to 1 m. Various levels of anisotropy were detected, however, with variograms computed in four directions (at 0°, 45°, 90°, and 135° from the within-row direction used as reference), indicating that spatial autocorrelation was prevalent or characterized by a longer range in one direction. For all eight data sets, the β-binomial distribution was found to fit the data better than the binomial distribution. This indicates local aggregation of fungicide resistance among sampling units, as supported by estimates of the parameter θ of the β-binomial distribution of 0.09 to 0.23 (overall median value = 0

  5. Spatial distribution of single-nucleotide polymorphisms related to fungicide resistance and implications for sampling.

    PubMed

    Van der Heyden, H; Dutilleul, P; Brodeur, L; Carisse, O

    2014-06-01

    Spatial distribution of single-nucleotide polymorphisms (SNPs) related to fungicide resistance was studied for Botrytis cinerea populations in vineyards and for B. squamosa populations in onion fields. Heterogeneity in this distribution was characterized by performing geostatistical analyses based on semivariograms and through the fitting of discrete probability distributions. Two SNPs known to be responsible for boscalid resistance (H272R and H272Y), both located on the B subunit of the succinate dehydrogenase gene, and one SNP known to be responsible for dicarboximide resistance (I365S) were chosen for B. cinerea in grape. For B. squamosa in onion, one SNP responsible for dicarboximide resistance (I365S homologous) was chosen. One onion field was sampled in 2009 and another one was sampled in 2010 for B. squamosa, and two vineyards were sampled in 2011 for B. cinerea, for a total of four sampled sites. Cluster sampling was carried on a 10-by-10 grid, each of the 100 nodes being the center of a 10-by-10-m quadrat. In each quadrat, 10 samples were collected and analyzed by restriction fragment length polymorphism polymerase chain reaction (PCR) or allele specific PCR. Mean SNP incidence varied from 16 to 68%, with an overall mean incidence of 43%. In the geostatistical analyses, omnidirectional variograms showed spatial autocorrelation characterized by ranges of 21 to 1 m. Various levels of anisotropy were detected, however, with variograms computed in four directions (at 0°, 45°, 90°, and 135° from the within-row direction used as reference), indicating that spatial autocorrelation was prevalent or characterized by a longer range in one direction. For all eight data sets, the β-binomial distribution was found to fit the data better than the binomial distribution. This indicates local aggregation of fungicide resistance among sampling units, as supported by estimates of the parameter θ of the β-binomial distribution of 0.09 to 0.23 (overall median value = 0

  6. A Simple Strategy for Development of Single Nucleotide Polymorphisms from Non-Model Species and Its Application in Panax

    PubMed Central

    Li, Ming Rui; Wang, Xin Feng; Zhang, Cui; Wang, Hua Ying; Shi, Feng Xue; Xiao, Hong Xing; Li, Lin Feng

    2013-01-01

    Single nucleotide polymorphisms (SNPs) are widely employed in the studies of population genetics, molecular breeding and conservation genetics. In this study, we explored a simple route to develop SNPs from non-model species based on screening the library of single copy nuclear genes (SCNGs). Through application of this strategy in Panax, we identified 160 and 171 SNPs from P. quinquefolium and P. ginseng, respectively. Our results demonstrated that both P. ginseng and P. quinquefolium possessed a high level of nucleotide diversity. The number of haplotype per locus ranged from 1 to 12 for P. ginseng and from 1 to 9 for P. quinquefolium, respectively. The nucleotide diversity of total sites (πT) varied between 0.000 and 0.023 for P. ginseng and 0.000 and 0.035 for P. quinquefolium, respectively. These findings suggested that this approach is well suited for SNP discovery in non-model organisms and is easily employed in standard genetics laboratory studies. PMID:24351835

  7. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  8. High-level azithromycin resistance occurs in Neisseria gonorrhoeae as a result of a single point mutation in the 23S rRNA genes.

    PubMed

    Chisholm, Stephanie A; Dave, Jayshree; Ison, Catherine A

    2010-09-01

    High-level azithromycin resistance (AZM-HR), defined as a MIC of > or = 256 mg/liter, emerged in Neisseria gonorrhoeae in the United Kingdom in 2004. To determine the mechanism of this novel phenotype, isolates from the United Kingdom that were AZM-HR (n, 19), moderately AZM resistant (MICs, 2 to 8 mg/liter) (n, 26), or sensitive (MICs, 0.12 to 0.25 mg/liter) (n, 4) were screened for methylase (erm) genes and for mutations in the mtrR promoter region, associated with efflux pump upregulation. All AZM-resistant isolates and 12 sensitive isolates were screened for mutations in domain V of each 23S rRNA allele. All AZM-HR isolates contained the A2059G mutation (Escherichia coli numbering) in three (3 isolates) or four (16 isolates) 23S rRNA alleles. Most (22/26) moderately AZM resistant isolates contained the C2611T mutation in at least 3/4 alleles. The remainder contained four wild-type alleles, as did 8/12 sensitive isolates, while one allele was mutated in the remaining four sensitive isolates. Serial passage of AZM-sensitive colonies on an erythromycin-containing medium selected AZM-HR if the parent strain already contained mutation A2059G in one 23S rRNA allele. The resultant AZM-HR strains contained four mutated alleles. Eight isolates (five moderately AZM resistant and three AZM-HR) contained mutations in the mtrR promoter. No methylase genes were detected. This is the first evidence that AZM-HR in gonococci may result from a single point mutation (A2059G) in the peptidyltransferase loop in domain V of the 23S rRNA gene. Mutation of a single allele is insufficient to confer AZM-HR, but AZM-HR can develop under selection pressure. The description of a novel resistance mechanism will aid in screening for the AZM-HR phenotype. PMID:20585125

  9. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.

    PubMed

    Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu

    2016-01-01

    Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

  10. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology

    PubMed Central

    Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N.; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu

    2016-01-01

    Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

  11. Single nucleotide polymorphisms in premature ovarian failure-associated genes in a Chinese Hui population

    PubMed Central

    MA, LILI; CHEN, YAN; MEI, SI; LIU, CHUNLIAN; MA, XIAOHONG; LI, YONGLI; JIANG, YINZHI; HA, LINGXIA; XU, XIAN

    2015-01-01

    Premature ovarian failure (POF) is an ovarian defect characterized by the premature depletion of ovarian follicles in individuals <40 years old, and is a major cause of infertility in females. Genetic factors are considered to be responsible for the development of POF, however, the exact pathogenesis remains to be elucidated in the majority of cases. In the present study, the single nucleotide polymorphisms (SNPs) of growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15), inhibin βB (INHBB) and follicle stimulating hormone receptor (FSHR) genes were investigated, and their association with POF in a Chinese Hui population of the Ningxia Hui Autonomous Region in western China was evaluated. Peripheral blood samples were collected from 63 patients diagnosed with POF (POF group) and 58 normal control individuals (control group), from which the genomic DNA was isolated. The GDF9, BMP15, INHBB and FSHR genes were amplified using polymerase chain reaction assays, and their SNPs were determined by sequencing. In the four SNPs identified across the GDF9 loci, D57Y (169G>T), rs1049127 (546G>A), rs254286 (447C>T) and rs254285 (969C>G), the frequencies of the 546G>A genotype and allele A were significantly higher in the POF group, compared with the normal control group (34.92, vs. 6.90%; P<0.05 and 19.05, vs. 3.23%; P<0.05, repsectively), while no significant differences were observed in the occur rence of the c.447C>T and c.969C>G mutations between the two groups (60.32, vs. 50% and 50.79, vs. 55.17%, repsectively). The c.169G>T mutation within the GDF9 gene was only detected in two patients with POF, and the mutation did not occur in the normal control group. A total of three SNPs were detected within the BMP15 gene, including rs3810682 (−9C>G), rs79377927 (788_789insTCT) and rs17003221 (852C>T), and no significant differences were observed in the frequencies of the 9C>G and 852C>T genotypes between the POF and control groups (7.94, vs. 6.90% and 4

  12. Single nucleotide polymorphisms in premature ovarian failure-associated genes in a Chinese Hui population.

    PubMed

    Ma, Lili; Chen, Yan; Mei, Si; Liu, Chunlian; Ma, Xiaohong; Li, Yongli; Jiang, Yinzhi; Ha, Lingxia; Xu, Xian

    2015-08-01

    Premature ovarian failure (POF) is an ovarian defect characterized by the premature depletion of ovarian follicles in individuals <40 years old, and is a major cause of infertility in females. Genetic factors are considered to be responsible for the development of POF, however, the exact pathogenesis remains to be elucidated in the majority of cases. In the present study, the single nucleotide polymorphisms (SNPs) of growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15), inhibin βB (INHBB) and follicle stimulating hormone receptor (FSHR) genes were investigated, and their association with POF in a Chinese Hui population of the Ningxia Hui Autonomous Region in western China was evaluated. Peripheral blood samples were collected from 63 patients diagnosed with POF (POF group) and 58 normal control individuals (control group), from which the genomic DNA was isolated. The GDF9, BMP15, INHBB and FSHR genes were amplified using polymerase chain reaction assays, and their SNPs were determined by sequencing. In the four SNPs identified across the GDF9 loci, D57Y (169G>T), rs1049127 (546G>A), rs254286 (447C>T) and rs254285 (969C>G), the frequencies of the 546G>A genotype and allele A were significantly higher in the POF group, compared with the normal control group (34.92, vs. 6.90%; P<0.05 and 19.05, vs. 3.23%; P<0.05, respectively), while no significant differences were observed in the occurrence of the c.447C>T and c.969C>G mutations between the two groups (60.32, vs. 50% and 50.79, vs. 55.17%, respectively). The c.169G>T mutation within the GDF9 gene was only detected in two patients with POF, and the mutation did not occur in the normal control group. A total of three SNPs were detected within the BMP15 gene, including rs3810682 (-9C>G), rs79377927 (788_789insTCT) and rs17003221 (852C>T), and no significant differences were observed in the frequencies of the -9C>G and 852C>T genotypes between the POF and control groups (7.94, vs. 6.90% and 4

  13. Effects of single-base substitutions within the acanthamoeba castellanii rRNA promoter on transcription and on binding of transcription initiation factor and RNA polymerase I

    SciTech Connect

    Kownin, P.; Bateman, E.; Paule, M.R.

    1988-02-01

    Single-point mutations were introduced into the promoter region of the Acanthamoeba castellanii rRNA gene by chemical mutagen treatment of a single-stranded clone in vitro, followed by reverse transcription and cloning of the altered fragment. The promoter mutants were tested for transcription initiation factor (TIF) binding by a template commitment assay plus DNase I footprinting and for transcription by an in vitro runoff assay. Point mutations within the previously identified TIF interaction region (between -20 and -47, motifs A and B) indicated that TIF interacts most strongly with a sequence centered at -29 and less tightly with sequences upstream and downstream. Some alterations of the base sequence closer to the transcription start site (and outside the TIF-protected site) also significantly decrease specific RNA synthesis in vitro. These were within the region which is protected from DNAse I digestion by polymerase I, but these mutations did not detectably affect the binding of polymerase to the promoter.

  14. Real-time visualization of conformational changes within single MloK1 cyclic nucleotide-modulated channels.

    PubMed

    Rangl, Martina; Miyagi, Atsushi; Kowal, Julia; Stahlberg, Henning; Nimigean, Crina M; Scheuring, Simon

    2016-09-20

    Eukaryotic cyclic nucleotide-modulated (CNM) ion channels perform various physiological roles by opening in response to cyclic nucleotides binding to a specialized cyclic nucleotide-binding domain. Despite progress in structure-function analysis, the conformational rearrangements underlying the gating of these channels are still unknown. Here, we image ligand-induced conformational changes in single CNM channels from Mesorhizobium loti (MloK1) in real-time, using high-speed atomic force microscopy. In the presence of cAMP, most channels are in a stable conformation, but a few molecules dynamically switch back and forth (blink) between at least two conformations with different heights. Upon cAMP depletion, more channels start blinking, with blinking heights increasing over time, suggestive of slow, progressive loss of ligands from the tetramer. We propose that during gating, MloK1 transitions from a set of mobile conformations in the absence to a stable conformation in the presence of ligand and that these conformations are central for gating the pore.

  15. Real-time visualization of conformational changes within single MloK1 cyclic nucleotide-modulated channels

    PubMed Central

    Rangl, Martina; Miyagi, Atsushi; Kowal, Julia; Stahlberg, Henning; Nimigean, Crina M.; Scheuring, Simon

    2016-01-01

    Eukaryotic cyclic nucleotide-modulated (CNM) ion channels perform various physiological roles by opening in response to cyclic nucleotides binding to a specialized cyclic nucleotide-binding domain. Despite progress in structure-function analysis, the conformational rearrangements underlying the gating of these channels are still unknown. Here, we image ligand-induced conformational changes in single CNM channels from Mesorhizobium loti (MloK1) in real-time, using high-speed atomic force microscopy. In the presence of cAMP, most channels are in a stable conformation, but a few molecules dynamically switch back and forth (blink) between at least two conformations with different heights. Upon cAMP depletion, more channels start blinking, with blinking heights increasing over time, suggestive of slow, progressive loss of ligands from the tetramer. We propose that during gating, MloK1 transitions from a set of mobile conformations in the absence to a stable conformation in the presence of ligand and that these conformations are central for gating the pore. PMID:27647260

  16. Real-time visualization of conformational changes within single MloK1 cyclic nucleotide-modulated channels.

    PubMed

    Rangl, Martina; Miyagi, Atsushi; Kowal, Julia; Stahlberg, Henning; Nimigean, Crina M; Scheuring, Simon

    2016-01-01

    Eukaryotic cyclic nucleotide-modulated (CNM) ion channels perform various physiological roles by opening in response to cyclic nucleotides binding to a specialized cyclic nucleotide-binding domain. Despite progress in structure-function analysis, the conformational rearrangements underlying the gating of these channels are still unknown. Here, we image ligand-induced conformational changes in single CNM channels from Mesorhizobium loti (MloK1) in real-time, using high-speed atomic force microscopy. In the presence of cAMP, most channels are in a stable conformation, but a few molecules dynamically switch back and forth (blink) between at least two conformations with different heights. Upon cAMP depletion, more channels start blinking, with blinking heights increasing over time, suggestive of slow, progressive loss of ligands from the tetramer. We propose that during gating, MloK1 transitions from a set of mobile conformations in the absence to a stable conformation in the presence of ligand and that these conformations are central for gating the pore. PMID:27647260

  17. Studying Bordetella pertussis populations by use of SNPeX, a simple high-throughput single nucleotide polymorphism typing method.

    PubMed

    Zeddeman, Anne; Witteveen, Sandra; Bart, Marieke J; van Gent, Marjolein; van der Heide, Han G J; Heuvelman, Kees J; Schouls, Leo M; Mooi, Frits R

    2015-03-01

    Large outbreaks of pertussis occur despite vaccination. A first step in the analyses of outbreaks is strain typing. However, the typing of Bordetella pertussis, the causative agent of pertussis, is problematic because the available assays are insufficiently discriminatory, not unequivocal, time-consuming, and/or costly. Here, we describe a single nucleotide primer extension assay for the study of B. pertussis populations, SNPeX (single nucleotide primer extension), which addresses these problems. The assay is based on the incorporation of fluorescently labeled dideoxynucleotides (ddNTPs) at the 3' end of allele-specific poly(A)-tailed primers and subsequent analysis with a capillary DNA analyzer. Each single nucleotide polymorphism (SNP) primer has a specific length, and as a result, up to 20 SNPs can be determined in one SNPeX reaction. Importantly, PCR amplification of target DNA is not required. We selected 38 SNPeX targets from the whole-genome sequencing data of 74 B. pertussis strains collected from across the world. The SNPeX-based phylogenetic trees preserved the general tree topology of B. pertussis populations based on whole-genome sequencing, with a minor loss of details. We envisage a strategy whereby SNP types (SnpTs) are quickly identified with the SNPeX assay during an outbreak, followed by whole-genome sequencing (WGS) of a limited number of isolates representing predominant SnpTs and the incorporation of novel SNPs in the SNPeX assay. The flexibility of the SNPeX assay allows the method to evolve along with the pathogen, making it a promising method for studying outbreaks of B. pertussis and other pathogens.

  18. A single nucleotide polymorphism in the promoter region of let-7 family is associated with lung cancer risk in Chinese.

    PubMed

    Shen, L Q; Xie, Y Z; Qian, X F; Zhuang, Z X; Jiao, Y; Qi, X F

    2015-01-01

    Lung cancer is a complex polygenic disease and many genetic factors are involved in the development of the disease. As one of the most important and widely studied families of microRNA, let-7 appears to play an important role in initiation and progression of lung cancer. Any small changes in miRNA level or its target point can cause significant changes in gene function. In this study, we examined whether a single-nucleotide polymorphism in the promoter region of the let-7 family (rs10877887) is associated with the susceptibility to and prognosis of lung adenocarcinoma cancer. A hospital-based case-control research model was used in our study. The single-nucleotide polymorphism was genotyped in 69 lung cancer patients and 75 healthy controls by direct sequencing. The correlation between rs10877887 genotypes and the susceptibility to lung cancer was evaluated using an unconditional logistic regression model. Populations with the CT+CC genotype had a significantly increased AC risk compared to those with the TT genotype (CT+CC vs TT: P = 0.043, OR = 2.032, 95%CI = 1.018-4.054). Furthermore, the risk effect was greater in subgroups of females over 60 years old (CT+CC vs TT: OR = 6.857, 95%CI = 1.425-33.008, P = 0.012), and the C allele were confirmed to be a risk factor related to lung cancer in these females (P = 0.012). The single-nucleotide polymorphism rs10877887 in the promoter region of the let-7 family was found to be responsible for the susceptibility to lung adenocarcinoma cancer in Chinese individuals. This association was significantly stronger in females who were more than 60 years old.

  19. Correlation between TGF-β1 gene 29 T > C single nucleotide polymorphism and clinicopathological characteristics of osteosarcoma.

    PubMed

    Wu, Yang; Zhao, Jinmin; He, Maolin

    2015-07-01

    Transforming growth factor (TGF)-β1 is the most abundant growth factor in human bone. Several polymorphisms have been described in the TGF-β1 gene. To explore the correlation between TGF-β1 gene single nucleotide polymorphism and the clinicopathological characteristics of osteosarcoma. TaqMAN PCR technique was used to detect the TGF-β1 gene polymorphism of 124 patients with osteosarcoma from last follow-up and 136 healthy controls. The difference of gender, age, and allele frequency between patient group and control group with χ (2) text were tested. The relationship between single nucleotide polymorphism and the risk of osteosarcoma with logistic regression and different survival rates of different genotypic patients with osteosarcoma through Kaplan-Meier were analyzed. There is no remarkable difference of the three genotypes in TGF-β1 gene 509C > T locus between the patient group and control group (P = 0.26). However, there are significant distributive differences in 29 T > C genotype (P = 0.04), which shows that patients carrying TT genotype have more risk to get osteosarcoma than patients carrying CC genotype (odds ratio (OR) = 2.10, 95 % confidence interval (CI) = 1.08-4.05). The percentage of T allele frequency of patient group, as 60.1 %, is larger than the control group, as 48.9 %. By comparing with patients carrying CC genotype, patients carrying TT genotype have two times risk of metastasis (OR = 2.30, 95 % CI = 1.05-5.06), and most of them are in the period of Enneking IIB (OR = 2.54, 95 % CI = 1.18-5.51). The survival analysis indicates that there is no any significant decrease when there is recurrence in patients carrying TT genotype. The morbidity and metastasis of osteosarcoma are relevant to TGF-β1 gene 29 T > C single nucleotide polymorphism.

  20. Studying Bordetella pertussis populations by use of SNPeX, a simple high-throughput single nucleotide polymorphism typing method.

    PubMed

    Zeddeman, Anne; Witteveen, Sandra; Bart, Marieke J; van Gent, Marjolein; van der Heide, Han G J; Heuvelman, Kees J; Schouls, Leo M; Mooi, Frits R

    2015-03-01

    Large outbreaks of pertussis occur despite vaccination. A first step in the analyses of outbreaks is strain typing. However, the typing of Bordetella pertussis, the causative agent of pertussis, is problematic because the available assays are insufficiently discriminatory, not unequivocal, time-consuming, and/or costly. Here, we describe a single nucleotide primer extension assay for the study of B. pertussis populations, SNPeX (single nucleotide primer extension), which addresses these problems. The assay is based on the incorporation of fluorescently labeled dideoxynucleotides (ddNTPs) at the 3' end of allele-specific poly(A)-tailed primers and subsequent analysis with a capillary DNA analyzer. Each single nucleotide polymorphism (SNP) primer has a specific length, and as a result, up to 20 SNPs can be determined in one SNPeX reaction. Importantly, PCR amplification of target DNA is not required. We selected 38 SNPeX targets from the whole-genome sequencing data of 74 B. pertussis strains collected from across the world. The SNPeX-based phylogenetic trees preserved the general tree topology of B. pertussis populations based on whole-genome sequencing, with a minor loss of details. We envisage a strategy whereby SNP types (SnpTs) are quickly identified with the SNPeX assay during an outbreak, followed by whole-genome sequencing (WGS) of a limited number of isolates representing predominant SnpTs and the incorporation of novel SNPs in the SNPeX assay. The flexibility of the SNPeX assay allows the method to evolve along with the pathogen, making it a promising method for studying outbreaks of B. pertussis and other pathogens. PMID:25568442

  1. Rapid Non-Crosslinking Aggregation of DNA-Functionalized Gold Nanorods and Nanotriangles for Colorimetric Single-Nucleotide Discrimination.

    PubMed

    Wang, Guoqing; Akiyama, Yoshitsugu; Takarada, Tohru; Maeda, Mizuo

    2016-01-01

    Gold nanoparticles modified with DNA duplexes are rapidly and spontaneously aggregated at high ionic strength. In contrast, this aggregation is greatly suppressed when the DNA duplex has a single-base mismatch or a single-nucleotide overhang located at the outermost surface of the particle. These colloidal features emerge irrespective of the size and composition of the particle core; however, the effects of the shape remain unexplored. Using gold nanorods and nanotriangles (nanoplatelets), we show herein that both remarkable rapidity in colloidal aggregation and extreme susceptibility to DNA structural perturbations are preserved, regardless of the shape and aspect ratio of the core. It is also demonstrated that the DNA-modified gold nanorods and nanotriangles are applicable to naked-eye detection of a single-base difference in a gene model. The current study corroborates the generality of the unique colloidal properties of DNA-functionalized nanoparticles, and thus enhances the feasibility of their practical use.

  2. Detection of single nucleotide variations by a hybridization proximity assay based on molecular beacons and luminescence resonance energy transfer.

    PubMed

    Root, Douglas D; Vaccaro, Carlos; Zhang, Zhiling; Castro, Miguel

    2004-09-01

    A powerful combination of molecular beacon and luminescence resonance energy transfer technology reveals alterations in nucleic acid structure by as little as a single nucleotide in a novel hybridization proximity assay. The assay measures the length of a single-stranded target when a terbium chelate-labeled molecular beacon hybridizes to one side of the nucleic acid segment to be measured and an acceptor probe carrying a convention fluorophore hybridizes to the opposite end of the target. Using a test sequence shortened incrementally by deleting single nucleotides, this assay reports a nearly linear relationship between sequence length and the distance separating acceptor and donor probes. Consequently, this assay can be used to detect alternative splicing, allele types, rearrangements, insertion, and deletion events by measuring separation distances within a predefined region. Furthermore, the use of terbium chelates in molecular beacons can produce exceptionally high signal-to-background ratios compared to the use of conventional fluorophores. Principles of optimal probe design are investigated experimentally and by computational simulations of plausible molecular beacon folding. Some molecular beacon designs form dimers that reduce their maximal response to target sequences. A simple assay to detect such dimers is reported as a tool to help improve the design of molecular beacons. Optimally designed molecular beacons with terbium chelates and hybridization proximity assays are expected to expand their applications in the analysis and screening of genetic diseases.

  3. Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease.

    PubMed

    Sifrim, Alejandro; Van Houdt, Jeroen Kj; Tranchevent, Leon-Charles; Nowakowska, Beata; Sakai, Ryo; Pavlopoulos, Georgios A; Devriendt, Koen; Vermeesch, Joris R; Moreau, Yves; Aerts, Jan

    2012-01-01

    The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org.

  4. Single nucleotide polymorphisms of cathepsin S and the risks of asthma attack induced by acaroid mites

    PubMed Central

    Li, Chaopin; Chen, Qi; Jiang, Yuxin; Liu, Zhiming

    2015-01-01

    To investigate association between the three single nucleotide polymorphisms (SNPs, rs146456111, rs143154304 and rs147260142) in cathepsin S (Cat S) and the risks of allergic asthma attack induced by the acaroid mites in the Chinese population. A case-control study was performed in 412 cases and 454 volunteers/controls to evaluate the effects of three SNPs in Cat S on the risks of asthma attack. The genotypes were determined using polymerase chain reaction (PCR) and cleaved amplification polymorphism sequence-tagged sites (PCR-RFLP). The frequencies of genotypes and alleles in these SNPs in the asthmatic group were also analyzed between the two groups. The locus of rs146456111 in Cat S gene, the allele frequency of A and C in asthmatic group were significantly different from the control group (χ2 = 184.425, P = 0.000), and the difference was significant regarding the distribution of the genotypes (AA, AC, and CC) between asthmatic subjects and normal controls (χ2 = 177.915, P = 0.000). Logistic regression analysis revealed that the AC, CC, and AC + CC genotypes were significantly increased with the risk of asthma (AC vs. AA, OR = 4.013, 95% CI = 2.989-4.751, P = 0.000; CC vs. AA, OR = 3.167, 95% CI = 2.483-3.785, P = 0.000; AC + CC vs. AA, OR = 3.418, 95% CI = 2.381-4.214, P = 0.000, respectively), compared with AA genotype. Moreover, by comparison with allele A, allele C (OR = 2.187, 95% CI = 1.743-2.281, P < 0.001) tended to increase the risk of asthma; For the locus of rs143154304, compared with the allele frequency G with A in control group, there was no difference (χ2 = 1.434, P = 0.231) in that of asthmatic group, as well as the distributions of the genotypes (AA, AG, and GG) between asthmatic subjects and normal controls (χ2 = 1.997, P = 0.369); Logistic regression analysis showed that the AG, GG, and AG + GG genotypes were no risk to asthma (AG vs. AA, OR = 0.991, 95% CI = 0.625-1.507, P = 0.968; GG vs. AA, OR = 0.812, 95% CI = 0.525-1.258, P = 0

  5. Single nucleotide polymorphisms of cathepsin S and the risks of asthma attack induced by acaroid mites.

    PubMed

    Li, Chaopin; Chen, Qi; Jiang, Yuxin; Liu, Zhiming

    2015-01-01

    To investigate association between the three single nucleotide polymorphisms (SNPs, rs146456111, rs143154304 and rs147260142) in cathepsin S (Cat S) and the risks of allergic asthma attack induced by the acaroid mites in the Chinese population. A case-control study was performed in 412 cases and 454 volunteers/controls to evaluate the effects of three SNPs in Cat S on the risks of asthma attack. The genotypes were determined using polymerase chain reaction (PCR) and cleaved amplification polymorphism sequence-tagged sites (PCR-RFLP). The frequencies of genotypes and alleles in these SNPs in the asthmatic group were also analyzed between the two groups. The locus of rs146456111 in Cat S gene, the allele frequency of A and C in asthmatic group were significantly different from the control group (χ(2) = 184.425, P = 0.000), and the difference was significant regarding the distribution of the genotypes (AA, AC, and CC) between asthmatic subjects and normal controls (χ(2) = 177.915, P = 0.000). Logistic regression analysis revealed that the AC, CC, and AC + CC genotypes were significantly increased with the risk of asthma (AC vs. AA, OR = 4.013, 95% CI = 2.989-4.751, P = 0.000; CC vs. AA, OR = 3.167, 95% CI = 2.483-3.785, P = 0.000; AC + CC vs. AA, OR = 3.418, 95% CI = 2.381-4.214, P = 0.000, respectively), compared with AA genotype. Moreover, by comparison with allele A, allele C (OR = 2.187, 95% CI = 1.743-2.281, P < 0.001) tended to increase the risk of asthma; For the locus of rs143154304, compared with the allele frequency G with A in control group, there was no difference (χ(2) = 1.434, P = 0.231) in that of asthmatic group, as well as the distributions of the genotypes (AA, AG, and GG) between asthmatic subjects and normal controls (χ(2) = 1.997, P = 0.369); Logistic regression analysis showed that the AG, GG, and AG + GG genotypes were no risk to asthma (AG vs. AA, OR = 0.991, 95% CI = 0.625-1.507, P = 0.968; GG vs. AA, OR = 0.812, 95% CI = 0.525-1.258, P

  6. Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

    PubMed

    van Binsbergen, R; Veerkamp, R F; Calus, M P L

    2012-04-01

    The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances.

  7. Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.

    PubMed

    Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej

    2016-01-01

    Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes. PMID:26386690

  8. Genome wide DNA copy number analysis in cholangiocarcinoma using high resolution molecular inversion probe single nucleotide polymorphism assay.

    PubMed

    Arnold, Alexander; Bahra, Marcus; Lenze, Dido; Bradtmöller, Maren; Guse, Katrin; Gehlhaar, Claire; Bläker, Hendrik; Heppner, Frank L; Koch, Arend

    2015-10-01

    In order to study molecular similarities and differences of intrahepatic (IH-CCA) and extrahepatic (EH-CCA) cholangiocarcinoma, 24 FFPE tumor samples (13 IH-CCA, 11 EH-CCA) were analyzed for whole genome copy number variations (CNVs) using a new high-density Molecular Inversion Probe Single Nucleotide Polymorphism (MIP SNP) assay. Common in both tumor subtypes the most frequent losses were detected on chromosome 1p, 3p, 6q and 9 while gains were mostly seen in 1q, 8q as well as complete chromosome 17 and 20. Applying the statistical GISTIC (Genomic Identification of Significant Targets in Cancer) tool we identified potential novel candidate tumor suppressor- (DBC1, FHIT, PPP2R2A) and oncogenes (LYN, FGF19, GRB7, PTPN1) within these regions of chromosomal instability. Next to common aberrations in IH-CCA and EH-CCA, we additionally found significant differences in copy number variations on chromosome 3 and 14. Moreover, due to the fact that mutations in the Isocitrate dehydrogenase (IDH-1 and IDH-2) genes are more frequent in our IH-CCA than in our EH-CCA samples, we suggest that the tumor subtypes have a different molecular profile. In conclusion, new possible target genes within regions of high significant copy number aberrations were detected using a high-density Molecular Inversion Probe Single Nucleotide Polymorphism (MIP SNP) assay, which opens a future perspective of fast routine copy number and marker gene identification for gene targeted therapy.

  9. Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.

    PubMed

    Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej

    2016-01-01

    Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.

  10. dbWGFP: a database and web server of human whole-genome single nucleotide variants and their functional predictions

    PubMed Central

    Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui

    2016-01-01

    The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. PMID:26989155

  11. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    PubMed

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM. PMID:25987962

  12. dbWGFP: a database and web server of human whole-genome single nucleotide variants and their functional predictions.

    PubMed

    Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui

    2016-01-01

    The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. PMID:26989155

  13. Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach

    PubMed Central

    Fusari, Corina M; Lia, Verónica V; Hopp, H Esteban; Heinz, Ruth A; Paniego, Norma B

    2008-01-01

    Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD) and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs) and short insertion and/or deletions (indels) to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056), as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88). Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2), with a large proportion of the inbred lines being assigned to one of them (G1). Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data) than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance). Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop improvement

  14. Nonsynonymous Single-Nucleotide Variations on Some Posttranslational Modifications of Human Proteins and the Association with Diseases

    PubMed Central

    Sun, Bo; Zhang, Menghuan; Cui, Peng; Li, Hong; Jia, Jia; Li, Yixue; Xie, Lu

    2015-01-01

    Protein posttranslational modifications (PTMs) play key roles in a variety of protein activities and cellular processes. Different PTMs show distinct impacts on protein functions, and normal protein activities are consequences of all kinds of PTMs working together. With the development of high throughput technologies such as tandem mass spectrometry (MS/MS) and next generation sequencing, more and more nonsynonymous single-nucleotide variations (nsSNVs) that cause variation of amino acids have been identified, some of which result in the damage of PTMs. The damaged PTMs could be the reason of the development of some human diseases. In this study, we elucidated the proteome wide relationship of eight damaged PTMs to human inherited diseases and cancers. Some human inherited diseases or cancers may be the consequences of the interactions of damaged PTMs, rather than the result of single damaged PTM site. PMID:26495027

  15. A single nucleotide polymorphism of the TNRC9 gene associated with breast cancer risk in Chinese Han women.

    PubMed

    Chen, F; Zhou, J; Xue, Y; Yang, S; Xiong, M; Li, Y; Liu, Q

    2014-01-01

    A single nucleotide polymorphism (SNP) in the TNRC9 gene was identified as a breast cancer susceptibility genetic variant in recent genome-wide association studies of women of European ancestry. We investigated whether TNRC9 polymorphisms are associated with risk of breast cancer in Chinese women of the Han nationality. We genotyped the SNPs rs3803662, rs1362548, rs1123428 in 870 women, including 388 breast cancer patients and 482 healthy controls, via the PCR-single strand conformation polymorphism procedure and by sequence detection. We found that the T allele and the TT genotype of the SNP rs38033662 is significantly associated with risk for breast cancer in Chinese Han women; however, no significant association was found for rs1362548 or rs1123428. We conclude that SNP rs3803662 is a putative risk factor for breast cancer in Chinese Han women.

  16. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  17. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  18. Genotyping single-nucleotide polymorphisms of human genes involved in organophosphate detoxification by high-resolution melting.

    PubMed

    Kurdyukov, Ivan; Rodionov, Gennady; Radilov, Andrey; Babakov, Vladimir

    2014-08-01

    Paraoxonase-1 (PON1) and butyrylcholinesterase (BCHE) are natural bioscavengers of organophosphate acetylcholinesterase inhibitors in the human body, which can determine individual sensitivity to organophosphate toxicity. Interindividual differences in activity of PON1 (catalytic bioscavenger) and substrate specificity are strongly associated with the substitution of two amino acids: Leu/Met (L/M) at position 55 (rs854560) and Gln/Arg (Q/R) at position 192 (rs662). In the case of BCHE (stoichiometric bioscavenger) substitution, Ala/Thr (A/T) at position 539 produces the so-called "K-variant" of the enzyme (rs1803274). Threonine allele is often co-inherited with an atypical BCHE allele (rs1799807). The atypical variant of BCHE displays a lower affinity for cholinesterase inhibitors. Genotyping rs662 and rs1803274 single-nucleotide polymorphisms (SNP) by high-resolution melting (HRM) is facilitated by the nucleotide substitution A>G (G>A), which resulted in a changed number of hydrogen bonds in the PCR product and, consequently, shifted T m. In the case of rs854560, genotyping is complicated by the nucleotide substitution T>A, which has no significant effect on the T m of the PCR product. An addition of a small quantity of LL homozygote DNA into the reaction mixture before PCR discriminates the three genotypes by the melt curves due to different amounts of heteroduplexes formed in the LM and MM samples. HRM analysis can be applied for genotyping human rs854560, rs662, and rs1803274 SNPs. PMID:24705954

  19. Best practices for evaluating single nucleotide variant calling methods for microbial genomics

    PubMed Central

    Olson, Nathan D.; Lund, Steven P.; Colman, Rebecca E.; Foster, Jeffrey T.; Sahl, Jason W.; Schupp, James M.; Keim, Paul; Morrow, Jayne B.; Salit, Marc L.; Zook, Justin M.

    2015-01-01

    Innovations in sequencing technologies have allowed biologists to make incredible advances in understanding biological systems. As experience grows, researchers increasingly recognize that analyzing the wealth of data provided by these new sequencing platforms requires careful attention to detail for robust results. Thus far, much of the scientific Communit’s focus for use in bacterial genomics has been on evaluating genome assembly algorithms and rigorously validating assembly program performance. Missing, however, is a focus on critical evaluation of variant callers for these genomes. Variant calling is essential for comparative genomics as it yields insights into nucleotide-level organismal differences. Variant calling is a multistep process with a host of potential error sources that may lead to incorrect variant calls. Identifying and resolving these incorrect calls is critical for bacterial genomics to advance. The goal of this review is to provide guidance on validating algorithms and pipelines used in variant calling for bacterial genomics. First, we will provide an overview of the variant calling procedures and the potential sources of error associated with the methods. We will then identify appropriate datasets for use in evaluating algorithms and describe statistical methods for evaluating algorithm performance. As variant calling moves from basic research to the applied setting, standardized methods for performance evaluation and reporting are required; it is our hope that this review provides the groundwork for the development of these standards. PMID:26217378

  20. A single nucleotide polymorphism analysis of the LAMA1 gene in Japanese patients with high myopia

    PubMed Central

    Sasaki, Sayaka; Ota, Masao; Meguro, Akira; Nishizaki, Ritsuko; Okada, Eiichi; Mok, Jeewon; Kimura, Tetusya; Oka, Akira; Katsuyama, Yoshihiko; Ohno, Shigeaki; Inoko, Hidetoshi; Mizuki, Nobuhisa

    2007-01-01

    Although a myopia susceptibility gene has not yet been elucidated, ten candidate regions (MYP1–MYP10) have been associated with myopia by linkage analysis employing large pedigrees. We report herein on the results of our analysis pertaining to polymorphisms of LAMA1 (alpha subunit of laminin), a promising candidate gene for high myopia present in the MYP2 region of Japanese subjects with high myopia. Three hundred and thirty Japanese subjects with high myopia at a level of greater than −9.25 D and ethnically and sex matched 330 normal controls without high myopia was enrolled in this study. The thirteen SNPs located on the LAMA1 gene were analyzed using PCR and SNP-specific fluorogenic probes. Two of the SNPs were monomorphic and none of the 11 SNPs showed statistically significant association with high myopia in the Japanese population. There is no convincing evidence to prove a connection between nucleotide sequence variations in LAMA1 and high myopia. The pairwise linkage disequilibrium (LD) mapping disclosed a strong value (D' > 0.8) and narrow ranged block within these SNPs. PMID:19668483

  1. Relative effects of mutability and selection on single nucleotide polymorphisms in transcribed regions of the human genome

    PubMed Central

    Gorlov, Ivan P; Gorlova, Olga Y; Amos, Christopher I

    2008-01-01

    Motivation Single nucleotide polymorphisms (SNPs) are the most common type of genetic variation in humans. However, the factors that affect SNP density are poorly understood. The goal of this study was to estimate the relative effects of mutability and selection on SNP density in transcribed regions of human genes. It is important for prediction of the regions that harbor functional polymorphisms. Results We used frequency-validated SNPs resulting from single-nucleotide substitutions. SNPs were subdivided into five functional categories: (i) 5' untranslated region (UTR) SNPs, (ii) 3' UTR SNPs, (iii) synonymous SNPs, (iv) SNPs producing conservative missense mutations, and (v) SNPs producing radical missense mutations. Each of these categories was further subdivided into nine mutational categories on the basis of the single-nucleotide substitution type. Thus, 45 functional/mutational categories were analyzed. The relative mutation rate in each mutational category was estimated on the basis of published data. The proportion of segregating sites (PSSs) for each functional/mutational category was estimated by dividing the observed number of SNPs by the number of potential sites in the genome for a given functional/mutational category. By analyzing each functional group separately, we found significant positive correlations between PSSs and relative mutation rates (Spearman's correlation coefficient, at least r = 0.96, df = 9, P < 0.001). We adjusted the PSSs for the mutation rate and found that the functional category had a significant effect on SNP density (F = 5.9, df = 4, P = 0.001), suggesting that selection affects SNP density in transcribed regions of the genome. We used analyses of variance and covariance to estimate the relative effects of selection (functional category) and mutability (relative mutation rate) on the PSSs and found that approximately 87% of variation in PSS was due to variation in the mutation rate and approximately 13% was due to selection

  2. IntSplice: prediction of the splicing consequences of intronic single-nucleotide variations in the human genome.

    PubMed

    Shibata, Akihide; Okuno, Tatsuya; Rahman, Mohammad Alinoor; Azuma, Yoshiteru; Takeda, Jun-Ichi; Masuda, Akio; Selcen, Duygu; Engel, Andrew G; Ohno, Kinji

    2016-07-01

    Precise spatiotemporal regulation of splicing is mediated by splicing cis-elements on pre-mRNA. Single-nucleotide variations (SNVs) affecting intronic cis-elements possibly compromise splicing, but no efficient tool has been available to identify them. Following an effect-size analysis of each intronic nucleotide on annotated alternative splicing, we extracted 105 parameters that could affect the strength of the splicing signals. However, we could not generate reliable support vector regression models to predict the percent-splice-in (PSI) scores for normal human tissues. Next, we generated support vector machine (SVM) models using 110 parameters to directly differentiate pathogenic SNVs in the Human Gene Mutation Database and normal SNVs in the dbSNP database, and we obtained models with a sensitivity of 0.800±0.041 (mean and s.d.) and a specificity of 0.849±0.021. Our IntSplice models were more discriminating than SVM models that we generated with Shapiro-Senapathy score and MaxEntScan::score3ss. We applied IntSplice to a naturally occurring and nine artificial intronic mutations in RAPSN causing congenital myasthenic syndrome. IntSplice correctly predicted the splicing consequences for nine of the ten mutants. We created a web service program, IntSplice (http://www.med.nagoya-u.ac.jp/neurogenetics/IntSplice) to predict splicing-affecting SNVs at intronic positions from -50 to -3. PMID:27009626

  3. Are sites with multiple single nucleotide variants in cancer genomes a consequence of drivers, hypermutable sites or sequencing errors?

    PubMed Central

    Carr, Antony M.

    2016-01-01

    Across independent cancer genomes it has been observed that some sites have been recurrently hit by single nucleotide variants (SNVs). Such recurrently hit sites might be either (i) drivers of cancer that are postively selected during oncogenesis, (ii) due to mutation rate variation, or (iii) due to sequencing and assembly errors. We have investigated the cause of recurrently hit sites in a dataset of >3 million SNVs from 507 complete cancer genome sequences. We find evidence that many sites have been hit significantly more often than one would expect by chance, even taking into account the effect of the adjacent nucleotides on the rate of mutation. We find that the density of these recurrently hit sites is higher in non-coding than coding DNA and hence conclude that most of them are unlikely to be drivers. We also find that most of them are found in parts of the genome that are not uniquely mappable and hence are likely to be due to mapping errors. In support of the error hypothesis, we find that recurently hit sites are not randomly distributed across sequences from different laboratories. We fit a model to the data in which the rate of mutation is constant across sites but the rate of error varies. This model suggests that ∼4% of all SNVs are errors in this dataset, but that the rate of error varies by thousands-of-fold between sites. PMID:27688957

  4. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    SciTech Connect

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P. ); Kasper, C.K. )

    1991-02-15

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.

  5. Are sites with multiple single nucleotide variants in cancer genomes a consequence of drivers, hypermutable sites or sequencing errors?

    PubMed Central

    Carr, Antony M.

    2016-01-01

    Across independent cancer genomes it has been observed that some sites have been recurrently hit by single nucleotide variants (SNVs). Such recurrently hit sites might be either (i) drivers of cancer that are postively selected during oncogenesis, (ii) due to mutation rate variation, or (iii) due to sequencing and assembly errors. We have investigated the cause of recurrently hit sites in a dataset of >3 million SNVs from 507 complete cancer genome sequences. We find evidence that many sites have been hit significantly more often than one would expect by chance, even taking into account the effect of the adjacent nucleotides on the rate of mutation. We find that the density of these recurrently hit sites is higher in non-coding than coding DNA and hence conclude that most of them are unlikely to be drivers. We also find that most of them are found in parts of the genome that are not uniquely mappable and hence are likely to be due to mapping errors. In support of the error hypothesis, we find that recurently hit sites are not randomly distributed across sequences from different laboratories. We fit a model to the data in which the rate of mutation is constant across sites but the rate of error varies. This model suggests that ∼4% of all SNVs are errors in this dataset, but that the rate of error varies by thousands-of-fold between sites.

  6. Single nucleotide polymorphisms in rye (Secale cereale L.): discovery, frequency, and applications for genome mapping and diversity studies.

    PubMed

    Varshney, R K; Beier, U; Khlestkina, E K; Kota, R; Korzun, V; Graner, A; Börner, A

    2007-04-01

    To elucidate the potential of single nucleotide polymorphism (SNP) markers in rye, a set of 48 barley EST (expressed sequence tag) primer pairs was employed to amplify from DNA prepared from five rye inbred lines. A total of 96 SNPs and 26 indels (insertion-deletions) were defined from the sequences of 14 of the resulting amplicons, giving an estimated frequency of 1 SNP per 58 bp and 1 indel per 214 bp in the rye transcriptome. A mean of 3.4 haplotypes per marker with a mean expected heterozygosity of 0.66 were observed. The nucleotide diversity index (pi) was estimated to be in the range 0.0059-0.0530. To improve assay cost-effectiveness, 12 of the 14 SNPs were converted to a cleaved amplified polymorphic sequence (CAPS) format. The resulting 12 SNP loci mapped to chromosomes 1R, 3R, 4R, 5R, 6R, and 7R, at locations consistent with their known map positions in barley. SNP genotypic data were compared with genomic simple sequence repeat (SSR) and EST-derived SSR genotypic data collected from the same templates. This showed a broad equivalence with respect to genetic diversity between these different data types. PMID:17345059

  7. Breast cancer risk, dietary intake, and methylenetetrahydrofolate reductase (MTHFR)single nucleotide polymorphisms.

    PubMed

    Alshatwi, Ali A

    2010-07-01

    Diet plays an important role in DNA methylation, synthesis, and repair; intake has been associated with breast cancer. The folate-metabolizing enzyme, methylenetetrahydrofolate reductase (MTHFR) is polymorphic at nucleotides 677 (C-->T), resulting in allozymes with altered activity and is thus believed to cause interindividual differences in cancer risk susceptibility. I evaluated this polymorphism and its effect on the food intake and breast cancer risk association in a population-based case-control study of 100 breast cancer cases and 100 controls using a real-time PCR based assay. All subjects completed in-person interviews, which included a food-frequency questionnaire. Unconditional logistic regression models were used to calculate odds ratios and their 95% confidence intervals, after adjusting for potential confounding factors. Cases and controls were similar in the distribution ofMTHFRpolymorphisms at codon 677 (41.4% cases and 41.8% controls carried theTallele). An inverse association of breast cancer risk with food intake was observed in all genotype groups, particularly among subjects with the677TTgenotype. Compared with those with the677CCgenotype and high food intake frequency, the adjusted odds ratios (95% confidence intervals) associated with low food intake were 1.94 (1.15-3.26), 2.17 (1.34-3.51), and 2.51 (1.37-4.60) for subjects who hadCC,CT, andTTgenotypes (Pfor interaction, 0.05). Results of this study suggest that theMTHFR C677T polymorphism may modify the association between dietary intake and breast cancer risk. PMID:20417243

  8. Significant association of methylenetetrahydrofolate reductase single nucleotide polymorphisms with prostate cancer susceptibility in taiwan.

    PubMed

    Wu, Hsi-Chin; Chang, Chao-Hsiang; Tsai, Ru-Yin; Lin, Chih-Hsueh; Wang, Rou-Fen; Tsai, Chia-Wen; Chen, Kuen-Bao; Yao, Chun-Hsu; Chiu, Chang-Fang; Bau, Da-Tian; Lin, Cheng-Chieh

    2010-09-01

    Prostate cancer is the most common cause of cancer death in men and is a major health problem worldwide. Methylene tetrahydrofolate reductase (MTHFR) plays an important role in folate metabolism and is also an important source of DNA methylation and DNA synthesis (nucleotide synthesis). To assess the association and interaction of genotypic polymorphisms in MTHFR and lifestyle factors with prostate cancer in Taiwan, we investigated two well-known polymorphic variants of MTHFR, C677T (rs1801133) and A1298C (rs1801131), analyzed the association of specific genotypes with prostate cancer susceptibility, and discussed their joint effects with individual habits on prostate cancer risk. In total, 218 patients with prostate cancer and 436 healthy controls recruited from the China Medical Hospital in central Taiwan were genotyped for these polymorphisms with prostate cancer susceptibility. We found the MTHFR C677T but not the A1298C genotype was differently distributed between the prostate cancer and control groups. The T allele of MTHFR C677T conferred a significantly (p=0.0011) decreased risk of prostate cancer. As for the A1298C polymorphism, there was no difference in distribution between the prostate cancer and control groups. Gene interactions with smoking were significant for MTHFR C677T polymorphism. The MTHFR C677T CT and TT genotypes in association with smoking conferred a decreased risk of 0.501 (95% confidence interval=0.344-0.731) for prostate cancer. Our results provide the first evidence that the C allele of MTHFR C677T may be associated with the development of prostate cancer and may be a novel useful marker for primary prevention and anticancer intervention.

  9. High volume molecular genetic identification of single nucleotide polymorphisms using Genetic Bit Analysis Application to human genetic diagnosis

    SciTech Connect

    Boyce-Jacino, M.T.; Reynolds, J.; Nikiforov, T.

    1994-09-01

    The most common type of genetic disease-associated mutation is the single nucleotide polymorphism (SNP). Because most genetic diseases can be caused by multiple SNPs in the same gene, effective routine diagnosis of complex genetic diseases is dependent on a simple and reliable method of interrogating SNP sites. Molecular Tool`s solid phase assay capable of direct genotyping (single base sequencing) of SNP sites, Genetic Bit Analysis (GBA), involves hybridization-capture of a single-stranded PCR product to a sequence-specific, microtiter plate-bound oligonucleotide primer. The captured PCR product then acts as template for single-base extension of the capture primer across the polymorphic site, enabling direct determination of the base composition of the polymorphism through a simple colormetric assay. Genotyping in a high volume, semi-automated, processing system with a current capacity of 100 SNP interrogations per technician per day enables the screening of candidate mutations rapidly and cost-effectively, critically important to comprehensive genetic diagnosis. Using this gel-free technology, we have developed prototype diagnostic tests for CFTR and ApoE polymorphisms which enable direct sequencing of the polymorphic base at each site of interest. Routine clinical diagnosis of genetically complex diseases such as cystic fibrosis is dependent on this combination of robust biochemistry and simple format. Additionally, the ability to transfer the format and biochemistry to any disease gene of interest enables the broad application of this technology to clinical diagnostics, especially for genetically complex diseases.

  10. Using Amino-Labeled Nucleotide Probes for Simultaneous Single Molecule RNA-DNA FISH

    PubMed Central

    Wu, Jun; Shao, Fangwei; Zhang, Li-Feng

    2014-01-01

    Using amino-labeled oligonucleotide probes, we established a simple, robust and low-noise method for simultaneous detection of RNA and DNA by fluorescence in situ hybridization, a highly useful tool to study the large pool of long non-coding RNAs being identified in the current research. With probes either chemically or biologically synthesized, we demonstrate that the method can be applied to study a wide range of RNA and DNA targets at the single-cell and single-molecule level in cellular contexts. PMID:25226542

  11. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.

    PubMed

    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah

    2016-01-01

    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP). PMID:27509930

  12. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.

    PubMed

    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah

    2016-01-01

    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP).

  13. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    PubMed Central

    Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.

    2015-01-01

    Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965

  14. Distribution of human single-nucleotide polymorphisms is approximated by the power law and represents a fractal structure.

    PubMed

    Gouda, Norio; Shiwa, Yuh; Akashi, Motohiro; Yoshikawa, Hirofumi; Kasahara, Ken; Furusawa, Mitsuru

    2016-05-01

    Single-nucleotide polymorphisms (SNPs) are one of the main causes of evolution. The distribution of human SNPs, which were examined in detail genomewide, was analyzed. Three discrete databases of human SNPs were used for this analysis, and similar results were obtained from these databases. It was found that the distribution of the distance between SNPs was approximated by the power law, and the shape of the regions including SNPs had the so-called fractal structure. Although the reason why the distribution of SNPs obeys such a certain law of physics is unclear, a speculation was attempted in connection with the three-dimensional structure of human chromatin which has a fractal structure. PMID:27030000

  15. In Silico Model-Driven Assessment of the Effects of Single Nucleotide Polymorphisms (SNPs) on Human Red Blood Cell Metabolism

    PubMed Central

    Jamshidi, Neema; Wiback, Sharon J.; Palsson, Bernhard Ø.

    2002-01-01

    The completion of the human genome project and the construction of single nucleotide polymorphism (SNP) maps have lead to significant efforts to find SNPs that can be linked to pathophysiology. In silico models of complete biochemical reaction networks relate a cell's individual reactions to the function of the entire network. Sequence variations can in turn be related to kinetic properties of individual enzymes, thus allowing an in silico model-driven assessment of the effects of defined SNPs on overall cellular functions. This process is applied to defined SNPs in two key enzymes of human red blood cell metabolism: glucose-6-phosphate dehydrogenase and pyruvate kinase. The results demonstrate the utility of in silico models in providing insight into differences between red cell function in patients with chronic and nonchronic anemia. In silico models of complex cellular processes are thus likely to aid in defining and understanding key SNPs in human pathophysiology. PMID:12421755

  16. The Clinical Utility of a Single-Nucleotide Polymorphism Microarray in Patients With Epilepsy at a Tertiary Medical Center.

    PubMed

    Hrabik, Sarah A; Standridge, Shannon M; Greiner, Hansel M; Neilson, Derek E; Pilipenko, Valentina V; Zimmerman, Sarah L; Connor, Jessica A; Spaeth, Christine G

    2015-11-01

    Microarray testing has revolutionized clinical cytogenetics, as it provides a significantly higher resolution and greater clinical yield than karyotype analysis. This study assessed the clinical utility of single-nucleotide polymorphism microarray in patients with epilepsy. Study subjects were patients between the ages of birth to 23 years who were diagnosed with epilepsy and had a microarray performed at Cincinnati Children's Hospital Medical Center. Statistical analysis explored the association of microarray results and brain magnetic resonance imaging (MRI), seizure type, and structural malformations. Approximately 17.7% (26/147) of participants had an abnormal microarray as defined by laboratory guidelines. There were no differences in frequency of abnormal brain MRI or seizure type between the abnormal and normal microarray groups. There was a higher prevalence of musculoskeletal malformations (P < .0035) and cardiovascular malformations (P < .0081) in subjects with abnormal microarrays. Clinicians should consider microarray analysis in individuals who have epilepsy, especially in combination with musculoskeletal malformation or cardiovascular malformation.

  17. Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

    NASA Astrophysics Data System (ADS)

    Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

    2012-04-01

    A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

  18. [Intra- and interpopulation variability of southwestern Kamchatka sockeye salmon Oncorhynchus nerka inferred from the data on single nucleotide polymorphism].

    PubMed

    Khrustaleva, A M; Klovach, N V; Gritsenko, O F; Seeb, J E

    2014-07-01

    The variability of 45 single nucleotide polymorphism (SNP) loci was studied in nine samples of the sockeye salmon Oncorhynchus nerka from the rivers of southwestern Kamchatka. The Wahlund effect, gametic disequilibrium at some loci, and a decrease in interpopulation genetic diversity estimates observed in samples from the Bolshaya River outlet are explained in terms of the samples' heterogeneity. Partitioning of mixed samples using some biological characteristics of the individuals led to a noticeable decrease in the frequency of these phenomena. It was demonstrated that the allelic diversity between the populations within the river Plotnikovs accounted for the larger part of genetic variation, as compared to the differentiation between the basins. The SNP loci responsible for intra- and interpopulation differentiation of sockeye salmon from the rivers of southwestern Kamchatka were identified. Some recommendations for field population genetic studies of Asian sockeye salmon were formulated. PMID:25720142

  19. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

    2016-04-01

    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  20. From the periphery to centre stage: de novo single nucleotide variants play a key role in human genetic disease.

    PubMed

    Ku, Chee-Seng; Tan, Eng King; Cooper, David N

    2013-04-01

    Human germline mutations arise anew during meiosis in every generation. Such spontaneously occurring genetic variants are termed de novo mutations. Although the introduction of microarray based approaches led to the discovery of numerous de novo copy number variants underlying a range of human genetic conditions, de novo single nucleotide variants (SNVs) remained refractory to analysis at the whole genome level until the advent of next generation sequencing technologies such as whole genome sequencing and whole exome sequencing. These approaches have recently allowed the estimation of the mutation rate of de novo SNVs and greatly increased our understanding of their contribution to human genetic disease. Indeed, de novo SNVs have been found to underlie various common human neurodevelopmental conditions such as schizophrenia, autism and intellectual disability, as well as sporadic cases of rare Mendelian disorders. In many cases, however, confirmation of the pathogenicity of identified de novo SNVs remains a major challenge. PMID:23396985

  1. A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

    2013-01-01

    In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

  2. Single nucleotide polymorphisms in the dystroglycan gene do not correlate with disease severity in hereditary inclusion body myopathy.

    PubMed

    Gottlieb, Emily; Ciccone, Carla; Darvish, Daniel; Naiem-Cohen, Shahrouz; Dalakas, Marinos C; Savelkoul, Paul J; Krasnewich, Donna M; Gahl, William A; Huizing, Marjan

    2005-01-01

    Aberrant glycosylation of dystroglycan occurs in certain muscular dystrophies, including hereditary inclusion body myopathy (HIBM). HIBM harbors a widely varying clinical severity and age of onset, which raised the suspicion of the presence of disease modifier genes. We considered the highly polymorphic dystroglycan gene (DAG1) as a feasible candidate modifier gene. DAG1 genomic DNA was sequenced for 32 HIBM patients, mainly of Persian-Jewish descent. Five novel DAG1 single nucleotide polymorphisms (SNPs) were identified, bringing the total number of SNPs to 19. However, no direct correlation between DAG1 SNPs and clinical severity of HIBM could be detected. Several identified SNPs substitute an amino acid and might modulate dystroglycan function or glycosylation status, and deserve further research. These data are valuable for future studies on the role of DAG1 in HIBM and other muscular dystrophies, especially those dystrophies that involve abnormal glycosylation of dystroglycan.

  3. Association between single nucleotide polymorphism-genotype and outcome of patients with chronic lymphocytic leukemia in a randomized chemotherapy trial

    PubMed Central

    Wade, Rachel; Di Bernardo, Maria Chiara; Richards, Sue; Rossi, Davide; Crowther-Swanepoel, Dalemari; Gaidano, Gianluca; Oscier, David G.; Catovsky, Daniel; Houlston, Richard S.

    2011-01-01

    Background There is variability in the outcome of patients with chronic lymphocytic leukemia with apparently the same stage of disease. Identifying genetic variants that influence patients’ outcome and response to treatment may provide important insights into the biology of the disease. Design and Methods We investigated the possibility that genetic variation influences outcome by conducting a genome-wide analysis of 346,831 single nucleotide polymorphisms in 356 patients entered into a phase III trial comparing the efficacy of fludarabine, chlorambucil, and fludarabine with cyclophosphamide as first-line treatment. Genotypes were linked to individual patients’ outcome data and response to chemotherapy. The association between genotype and progression-free survival was assessed by Cox regression analysis adjusting for treatment and clinicopathology. Results The strongest associations were shown for rs1949733 (ACOX3; P=8.22x10-7), rs1342899 (P=7.72x10−7) and rs11158493 (PPP2R5E; P=8.50×10−7). In addition, the 52 single nucleotide polymorphisms associated at P<10−4 included rs438034 (CENPF; P=4.86×10−6), previously correlated with cancer progression, and rs2255235 (B2M; P=3.10×10−5) and rs2064501 (IL22RA2; P=4.81×10−5) which map to B-cell genes. Conclusions Our findings provide evidence that genetic variation is a determinant of progression-free survival of patients with chronic lymphocytic leukemia. Specific associations warrant further analyses. (Clinicaltrials.gov identifier: NCT00004218) PMID:21659360

  4. A single origin and moderate bottleneck during domestication of soybean (Glycine max): implications from microsatellites and nucleotide sequences.

    PubMed

    Guo, Juan; Wang, Yunsheng; Song, Chi; Zhou, Jianfeng; Qiu, Lijuan; Huang, Hongwen; Wang, Ying

    2010-09-01

    Background and Aims It is essential to illuminate the evolutionary history of crop domestication in order to understand further the origin and development of modern cultivation and agronomy; however, despite being one of the most important crops, the domestication origin and bottleneck of soybean (Glycine max) are poorly understood. In the present study, microsatellites and nucleotide sequences were employed to elucidate the domestication genetics of soybean. Methods The genomes of 79 landrace soybeans (endemic cultivated soybeans) and 231 wild soybeans (G. soja) that represented the species-wide distribution of wild soybean in East Asia were scanned with 56 microsatellites to identify the genetic structure and domestication origin of soybean. To understand better the domestication bottleneck, four nucleotide sequences were selected to simulate the domestication bottleneck. Key Results Model-based analysis revealed that most of the landrace genotypes were assigned to the inferred wild soybean cluster of south China, South Korea and Japan. Phylogeny for wild and landrace soybeans showed that all landrace soybeans formed a single cluster supporting a monophyletic origin of all the cultivars. The populations of the nearest branches which were basal to the cultivar lineage were wild soybeans from south China. The coalescent simulation detected a bottleneck severity of K' = 2 during soybean domestication, which could be explained by a foundation population of 6000 individuals if domestication duration lasted 3000 years. Conclusions As a result of integrating geographic distribution with microsatellite genotype assignment and phylogeny between landrace and wild soybeans, a single origin of soybean in south China is proposed. The coalescent simulation revealed a moderate genetic bottleneck with an effective wild soybean population used for domestication estimated to be approximately 2 % of the total number of ancestral wild soybeans. Wild soybeans in Asia, especially in

  5. Single-Nucleotide Variations in Cardiac Arrhythmias: Prospects for Genomics and Proteomics Based Biomarker Discovery and Diagnostics

    PubMed Central

    Abunimer, Ayman; Smith, Krista; Wu, Tsung-Jung; Lam, Phuc; Simonyan, Vahan; Mazumder, Raja

    2014-01-01

    Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs) that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs). For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome) of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO) analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases. PMID:24705329

  6. A single nucleotide polymorphism in the MTOR gene is associated with recurrent spontaneous abortion in the Chinese female population.

    PubMed

    Xiang, Huifen; Liu, Shengnan; Zong, Chen; Li, Zelian; Liu, Yunyun; Ma, Xu; Cao, Yunxia

    2015-01-01

    Recurrent spontaneous abortion (RSA) is a multi-factor disease. The mammalian target of the the rapamycin (MTOR) gene has been reported to be involved in mouse embryo development and regulates the proliferation of embryonic stem cells. Our study explored the relationship between the single nucleotide polymorphism (SNP) rs17027478 in the promoter region of MTOR gene and the development of RSA. A total of 306 patients with RSA and 127 healthy females as the controls were recruited in the case-control study. The predesigned TaqMan SNP Genotyping Assay was adopted to analyze the association between rs17027478 and the development of RSA. Quantitative real-time reverse transcription polymerase chain reaction and luciferase reporter assays were conducted to analyze the function of the variant. It was found that a significant association exists between the variant and the risk of RSA among the patients who experienced no less than three spontaneous abortions (p = 0.043). However, the significant difference disappeared among the total samples (p = 0.524). Furthermore, we observed lower MTOR mRNA levels in the blood of RSA patients compared with healthy females (p = 0.020). The luciferase reporter assay showed that the rs17027478A allele significantly reduced the luciferase activity (p = 0.029). The results demonstrated that the variant rs17027478 in the promoter region of MTOR might be a good candidate responsible for the pathogenesis of RSA. Abbreviations RSA recurrent spontaneous abortion MTOR mammalian target of rapamycin SNP single nucleotide polymorphism qRT-PCR quantitative real-time polymerase chain reaction URSA unexplained recurrent spontaneous abortion mTORC1 mTOR complex 1 ESC embryonic stem cells HKE-293 human embryonic kidney 293 cells HWE Hardy-Weinberg equilibrium ANOVA one-way analysis of variance.

  7. Noncoding somatic and inherited single-nucleotide variants converge to promote ESR1 expression in breast cancer.

    PubMed

    Bailey, Swneke D; Desai, Kinjal; Kron, Ken J; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A; Treloar, Aislinn E; Dowar, Mark; Thu, Kelsie L; Cescon, David W; Silvester, Jennifer; Yang, S Y Cindy; Wu, Xue; Pezo, Rossanna C; Haibe-Kains, Benjamin; Mak, Tak W; Bedard, Philippe L; Pugh, Trevor J; Sallari, Richard C; Lupien, Mathieu

    2016-10-01

    Sustained expression of the estrogen receptor-α (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon estrogen stimulation to establish an oncogenic expression program. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers, suggesting that other mechanisms underlie the persistent expression of ESR1. We report significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by rs9383590, a functional inherited single-nucleotide variant (SNV) that accounts for several breast cancer risk-associated loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer. PMID:27571262

  8. InPhaDel: integrative shotgun and proximity-ligation sequencing to phase deletions with single nucleotide polymorphisms

    PubMed Central

    Patel, Anand; Edge, Peter; Selvaraj, Siddarth; Bansal, Vikas; Bafna, Vineet

    2016-01-01

    Phasing of single nucleotide (SNV), and structural variations into chromosome-wide haplotypes in humans has been challenging, and required either trio sequencing or restricting phasing to population-based haplotypes. Selvaraj et al. demonstrated single individual SNV phasing is possible with proximity ligated (HiC) sequencing. Here, we demonstrate HiC can phase structural variants into phased scaffolds of SNVs. Since HiC data is noisy, and SV calling is challenging, we applied a range of supervised classification techniques, including Support Vector Machines and Random Forest, to phase deletions. Our approach was demonstrated on deletion calls and phasings on the NA12878 human genome. We used three NA12878 chromosomes and simulated chromosomes to train model parameters. The remaining NA12878 chromosomes withheld from training were used to evaluate phasing accuracy. Random Forest had the highest accuracy and correctly phased 86% of the deletions with allele-specific read evidence. Allele-specific read evidence was found for 76% of the deletions. HiC provides significant read evidence for accurately phasing 33% of the deletions. Also, eight of eight top ranked deletions phased by only HiC were validated using long range polymerase chain reaction and Sanger. Thus, deletions from a single individual can be accurately phased using a combination of shotgun and proximity ligation sequencing. InPhaDel software is available at: http://l337x911.github.io/inphadel/. PMID:27105843

  9. Highly selective single nucleotide polymorphism recognition by a chiral (5S) PNA beacon.

    PubMed

    Totsingan, Filbert; Tedeschi, Tullia; Sforza, Stefano; Corradini, Roberto; Marchelli, Rosangela

    2009-01-01

    A chiral peptide nucleic acid (PNA) beacon containing a C-5 modified monomer based on L-lysine was synthesized. The terminal amino group of the lysine side chain was linked to a spacer for future applications on surfaces. The PNA beacon bears a carboxyfluorescein fluorophore and a dabcyl quencher at opposite ends. The DNA binding properties were compared with those of a homologous PNA beacon containing only achiral monomers. Both beacons underwent a fluorescence increase in the presence of complementary DNA, with higher efficiency and higher selectivity (evaluated using single mismatched DNA sequences) observed for the chiral monomer containing PNA. Ion exchange (IE) HPLC with fluorimetric detection was used in combination with the beacon for the selective detection of complementary DNA. A fluorescent peak corresponding to the PNA beacon:DNA duplex was observed at a very low detection limit (1 nM). The discriminating capacity of the chiral PNA beacon for a single mismatch was found to be superior to those observed with the unmodified one, thus confirming the potency of chirality for increasing the affinity and specificity of DNA recognition.

  10. TLR7 Gln11Leu single nucleotide polymorphism and susceptibility to cutaneous melanoma

    PubMed Central

    ELEFANTI, LISA; SACCO, GIORGIA; STAGNI, CAMILLA; RASTRELLI, MARCO; MENIN, CHIARA; RUSSO, IRENE; ALAIBAC, MAURO

    2016-01-01

    Cutaneous melanoma is a life-threatening skin cancer. Its incidence is rapidly increasing, and early diagnosis is the main factor able to improve its poor prognosis. Toll-like receptors (TLRs) are transmembrane glycoproteins that recognize pathogen- and damage-associated molecular patterns, against which TLRs activate the innate immune response and initiate the adaptive immune response. Genetic variations of these receptors may alter the immune system, and are involved in evolution and susceptibility to various diseases, including cancer. The aim of the present study was to evaluate whether the presence of TLR7 glutamine (Gln) 11 leucine (Leu) polymorphism confers an increased susceptibility to cutaneous melanoma. For that purpose, a case-control study was performed with 182 melanoma cases and 89 controls. To highlight the possible association between the aforementioned polymorphism and the susceptibility to melanoma, 93 cases of single melanoma and 89 cases of multiple primary melanoma (MPM) were compared in the present study. Since the TLR7 gene is localized on the chromosome X, the allelic frequency of the Gln11Leu polymorphism was analyzed separately in males and females. The distribution of allele frequencies between melanoma cases and controls (P=0.245) and between single melanoma and MPM cases (P=0.482) was not significant. Therefore, the present results do not suggest an association between TLR7 Gln11Leu polymorphism and susceptibility to cutaneous melanoma. Further studies are required to analyze the influence of other TLR polymorphisms on the susceptibility to malignant melanoma and the involvement of innate immunity in this malignancy. PMID:27347137

  11. Comparison of significant single nucleotide polymorphisms selections in GWAS for complex traits.

    PubMed

    Frąszczak, M; Szyda, J

    2016-05-01

    The goal of this study was to compare significant SNP selection approaches in the context of complex traits based on SNP estimates obtained by models: a model fitting a single SNP (M1), a model fitting a single SNP and a random polygenic effect (M2), the nonparametric CAR score (M3), a SNP-BLUP model with random effects of all SNPs fitted simultaneously (M4). There were 46,267 SNPs tested in a population of 2601 Holstein Friesian bulls, four traits (milk and fat yields, somatic cell score, non-return rate for heifers) were considered. The numbers of SNPs selected as significant differed among models. M1 selected a very large number of SNPs, except for a NRH in which no SNPs were significant. M2 and M3 both selected similar and low number of SNPs for each trait. M4 selected more SNPs than M2 and M3. Considering linkage disequilibrium between SNPs, for MY M2 and M3 selected SNPs more highly correlated with each other than in the case of M4, while for FY M3 selection contained more correlated SNPs than M2 and M4. In conclusion, if the research interest is to identify SNPs not only with strong, but also with moderate effects on a complex trait a multiple-SNP model is recommended. Such models are capable of accounting for at least a part of linkage disequilibrium between SNPs through the design matrix of SNP effects. Functional annotation of SNPs significant in M4 reveals good correspondence between selected polymorphisms and functional information as well as with QTL mapping results. PMID:26294278

  12. Single nucleotide polymorphisms in β-tubulin selected in Onchocerca volvulus following repeated ivermectin treatment: possible indication of resistance selection.

    PubMed

    Nana-Djeunga, Hugues; Bourguinat, Catherine; Pion, Sébastien D S; Kamgno, Joseph; Gardon, Jacques; Njiokou, Flobert; Boussinesq, Michel; Prichard, Roger K

    2012-09-01

    The control of onchocerciasis or river blindness by mass treatment of the population with ivermectin (IVM) has been a great success until now, so that in certain foci its elimination has become feasible. However, after more than 20 years of repeated IVM mass treatment, the disease still persists in many endemic countries. Sub-optimal responses and genetic changes have been reported in Onchocerca volvulus populations under high IVM pressure but more work is needed to determine whether resistance is developing. The situation needs to be urgently clarified to preserve the achievements of onchocerciasis control programs. In this study, O. volvulus adult worms were collected from the same individuals, before IVM exposure and following three years of annual or three-monthly treatments at 150 μg/kg or 800 μg/kg. Four single nucleotide polymorphisms (SNPs) occurring in the β-tubulin gene of these parasites were investigated. We found changes in genotype frequencies in O. volvulus β-tubulin gene associated with IVM treatments. The SNP at position 1545 (A/G) showed a significant increase in frequency of the less common nucleotide in the female worms following treatment. After 13 three-monthly treatments, female worm homozygotes with the less common genotype, prior to treatment, increased in frequency. The selected homozygotes, as well as heterozygotes, appeared to be less fertile (without or with very few embryonic stages in their uteri) than the wild-type homozygotes. These results provide additional evidence for genetic selection and strengthen the warning that selection for IVM resistance may be occurring in some O. volvulus populations. PMID:22677339

  13. Single nucleotide polymorphism (SNP) at the GHR gene and its associations with chicken growth and fat deposition traits.

    PubMed

    Ouyang, J H; Xie, L; Nie, Q; Luo, C; Liang, Y; Zeng, H; Zhang, X

    2008-03-01

    1. The growth hormone receptor (GHR) plays crucial roles on chicken growth and metabolism. 2. The full cDNA of the chicken GHR gene was scanned for single nucleotide polymorphisms (SNP) by means of denaturing high-performance liquid chromatography (DHPLC). Three SNP, C6540334T, C6542011T and G6631778A, were genotyped in a F(2) designed full-sib resource population to analyse their associations with chicken growth and fat deposition traits. 3. Fifty-five SNP and two other variations were identified in the 8908 bp region of the GHR gene. Among the 55 SNP, 10 were located in coding exons (6 resulted in changes of amino acids) and 45 were in non-coding regions (introns, 5'UTR and 3'UTR). The nucleotide diversity (theta), corrected for sample size of chicken GHR gene, is 1.45 x 10(-3). Fourteen PCR-RFLP markers were developed in the chicken GHR gene. 4. The G6631778A was associated with body weight at 63 d (BW63), dressed weight (DW) and subcutaneous fat thickness (SFT), BW35 and BW49 (P < 0.01) as well as hatch weight (HW) and BW42 in the male population. However, G6631778A was only associated with BW28 in the female population. G rather than A was dominant for chicken growth and fat deposition. Haplotypes based on the three SNP were associated with BW21, BW70, BW77 and SFT, BW7, BW35, BW42, BW49 and BW56 in males, and associated with BW7 and BW14 in females. For growth in males, the H2 and H6 haplotypes had positive and negative effects, respectively; meanwhile H6 was predominant for fat deposition.

  14. Methodology for single nucleotide polymorphism selection in promoter regions for clinical use. An example of its applicability

    PubMed Central

    Marques, Herlander; Freitas, José; Medeiros, Rui; Longatto-Filho, Adhemar

    2016-01-01

    Genetic variability in humans can explain many differences in disease risk factors. Polymorphism-related studies focus mainly on the single nucleotide polymorphisms (SNPs) of coding regions of the genes. SNPs on DNA binding motifs of the promoter region have been less explored. On a recent study of SNPs in patients with non-Hodgkin lymphomas we faced the problem of SNP selection from promoter regions and developed a practical methodology for clinical studies. The process consists in identifying SNPs in the coding and promoter regions of the antigen-processing system using the ‘dbSNP’ database. With the ‘HapMap’ program, we select SNPs with frequencies >20% in Caucasian populations. For coding regions, we sought biologically and clinically relevant SNPs described in the literature. For the promoter regions, we determined their chromosomal location on ‘QiagenSABioscience’ site database. The nucleotide sequence of ancestral and variant alleles is available in the ‘dbSNP’. These sequences were used in ‘Promoter TESS’ to determine binding differences of transcription factors. Each sequence may have affinity to different TFs. Thus, SNP selection on the promoter regions was based in the differences on TF binding pattern between the old and the new allele. The potential clinical relevance of the new TFs was also evaluated before the final selection. With this approach, we found that almost half of the relevant SNP fall within the promoter region. In conclusion, we were able to develop a methodology of oriented selection of promoter regions of human genes, comparing the TF with affinity to the ancestral allele with the TF to a variant allele. We selected those SNPs that change the TF’s affinity to a pattern with functional significance. PMID:27766139

  15. Direct PCR amplification of the 16S rRNA gene from single microbial cells isolated from an Antarctic iceberg using laser microdissection microscopy

    NASA Astrophysics Data System (ADS)

    Yanagihara, Katsuhiko; Niki, Hironori; Baba, Tomoya

    2011-09-01

    Here, we describe a technique that allows the genetic linage analysis of 16S rRNA genes in bacteria observed under a microscope. The technique includes the isolation of microbial cells using a laser microdissection microscope, lysis of the cells, and amplification of the 16S rRNA genes in the isolated cells without interference by bacterial DNA contamination from the experimental environment or reagents. Using this technique, we successfully determined 15 16S rRNA gene sequences in cells isolated from an Antarctic iceberg. These sequences showed 94%-100% identity to their closest strains, which included bacteria that occur in aqueous, marine, and soil environments.

  16. Single nucleotide polymorphisms in intron 1 and intron 2 of Larimichthys crocea growth hormone gene are correlated with growth traits

    NASA Astrophysics Data System (ADS)

    Ni, Jing; You, Feng; Xu, Jianhe; Xu, Dongdong; Wen, Aiyun; Wu, Zhihao; Xu, Yongli; Zhang, Peijun

    2012-03-01

    The growth hormone gene ( GH) affects animal growth and is a potential target for genetic studies of variation related to growth traits. In this study, we analyzed single nucleotide polymorphisms (SNPs) in GH intron regions and their associations with growth traits in large yellow croaker, Larimichthys crocea, from Zhejiang and Fujian stocks. The results of PCR-single strand conformation polymorphism showed two haplotypes of intron 1, named AA and AB genotypes, in Zhejiang stock. AB exhibited an SNP at position 196 (G→A) that was negatively correlated with body height and positively correlated with standard length/body height ( P≤0.05). Two different genotypes, CC and CD, were identified in intron 2 in Fujian stock, with CD showing an SNP at position 692 (T→C). The CD genotype had a significantly positive correlation with both weight and total length ( P≤0.01). These basic data highlight the potential for using GH as a genetic marker of fish growth in marker assisted selection.

  17. Analysis of single nucleotide polymorphism among Varicella-Zoster Virus and identification of vaccine-specific sites.

    PubMed

    Jeon, Jeong Seon; Won, Youn Hee; Kim, In Kyo; Ahn, Jin Hyun; Shin, Ok Sarah; Kim, Jung Hwan; Lee, Chan Hee

    2016-09-01

    Varicella-zoster virus (VZV) is a causative agent for chickenpox and zoster. Live attenuated vaccines have been developed based on Oka and MAV/06 strains. In order to understand the molecular mechanisms of attenuation, complete genome sequences of vaccine and wild-type strains were compared and single nucleotide polymorphism (SNP) was analyzed. ORF22 and ORF62 contained the highest number of SNPs. The detailed analysis of the SNPs suggested 24 potential vaccine-specific sites. All the mutational events found in vaccine-specific sites were transitional, and most of them were substitution of AT to GC pair. Interestingly, 18 of the vaccine-specific sites of the vaccine strains appeared to be genetically heterogeneous. The probability of a single genome of vaccine strain to contain all 24 vaccine-type sequences was calculated to be less than 4%. The average codon adaptation index (CAI) value of the vaccine strains was significantly lower than the CAI value of the clinical strains.

  18. One single nucleotide difference alters the differential expression of spliced RNAs between HBV genotypes A and D.

    PubMed

    Huang, Chien-Chiao; Kuo, Tzer-Min; Yeh, Chau-Ting; Hu, Cheng-Po; Chen, Ya-Ling; Tsai, Yue-Lin; Chen, Mong-Liang; Chou, Yu-Chi; Chang, Chungming

    2013-06-01

    Hepatitis B virus (HBV) is generally classified into eight genotypes (A to H) based on genomic sequence divergence. The sequence variation among the different HBV genotypes suggests that the spliced RNAs should be different from genotype to genotype. However, the cis-acting element involved in the modulation of the distinct expression profiles of spliced HBV RNAs remains unidentified. Moreover, the biological role of splicing in the life cycle of HBV is not yet understood. In this study, spliced RNAs generated from genotypes A and D were carefully characterized in transfected HepG2 cells. The species and frequency of the spliced RNAs were dramatically different in the two genotypes. Of note, a population of multiply spliced RNAs with intron 2067-2350 excision was identified in HBV genotype A-transfected HepG2 cells, but not in genotype D transfected HepG2 cells. Further, we found a single nucleotide difference (2335) located within the polypyrimidine tract of the splice acceptor site 2350 between the two genotypes, and a single base substitution at 2335 was able to convert the splicing pattern of genotype D (or genotype A) to that of genotype A (or genotype D). These findings suggest that different unique splice sites may be preferentially used in different HBV genotypes resulting in distinct populations of spliced RNAs. The possible significance of the distinct spliced RNAs generated from the different HBV genotypes in HBV infection is discussed.

  19. Prediction of rare single-nucleotide causative mutations for muscular diseases in pooled next-generation sequencing experiments.

    PubMed

    Ferraro, Maria Brigida; Savarese, Marco; Di Fruscio, Giuseppina; Nigro, Vincenzo; Guarracino, Mario Rosario

    2014-09-01

    Next-generation sequencing (NGS) is a new approach for biomedical research, useful for the diagnosis of genetic diseases in extremely heterogeneous conditions. In this work, we describe how data generated by high-throughput NGS experiments can be analyzed to find single nucleotide polymorphisms (SNPs) in DNA samples of patients affected by neuromuscular disorders. In particular, we consider untagged pooled NGS data, where DNA samples of different individuals are combined in a single experiment, still providing information with an uncertainty limited to only two patients. At the moment, only few publications address the problem of SNPs detection in pooled experiments, and existing tools are often inaccurate. We propose a computational procedure consisting of two parts. In the first, data are filtered by means of decision rules. The second phase is based on a supervised classification technique. In the present work, we compare different de facto standard supervised and unsupervised procedures to identify and classify variants potentially related to muscular diseases, and we discuss results in terms of statistical and biological validation.

  20. Multiple detection of single nucleotide polymorphism by microarray-based resonance light scattering assay with enlarged gold nanoparticle probes.

    PubMed

    Gao, Jiaxue; Ma, Lan; Lei, Zhen; Wang, Zhenxin

    2016-03-01

    The mapping of specific single nucleotide polymorphisms (SNPs) in patients' genome is a critical process for the development of personalized therapy. In this work, a DNA microarray-based resonance light scattering (RLS) assay has been developed for multiplexed detection of breast cancer related SNPs with high sensitivity and selectivity. After hybridization of the desired target single-stranded DNAs (ssDNAs) with the ssDNA probes on a microarray, the polyvalent ssDNA modified 13 nm gold nanoparticles (GNPs) are employed to label the hybridization reaction through the formation of a three-stranded DNA system. The H2O2-mediated enlargement of GNPs is then used to enhance the RLS signal. The microarray-based RLS assay provides a detection limit of 10 pM (S/N = 3) for the target ssDNA and determines an allele frequency as low as 1.0% in the target ssDNA cocktail. Combined with an asymmetric PCR technique, the proposed assay shows good accuracy and sensitivity in profiling 4 SNPs related to breast cancer of three selected cell lines.

  1. Association between single-nucleotide polymorphisms of fatty acid synthase gene and meat quality traits in Datong Yak (Bos grunniens).

    PubMed

    Chu, M; Wu, X Y; Guo, X; Pei, J; Jiao, F; Fang, H T; Liang, C N; Ding, X Z; Bao, P J; Yan, P

    2015-03-30

    Fatty acid synthase (FASN) is a key enzyme in fatty acid anabolism that plays an important role in the fat deposit of eukaryotic cells. Therefore, in this study, we detected 2 novel single-nucleotide polymorphisms (SNPs) in the FASN gene in 313 adult individuals of Datong yak using polymerase chain reaction-single strand conformation polymorphism and DNA sequencing techniques. SNP g.5477C>T is located in intron 3 of FASN, and 3 genotypes, HH, HG, and GG, were detected in this mutation site. SNP g.16930T>A is located in exon 37 of FASN, and 2 genotypes, EE and EF, were detected in this site. Association analysis of these 2 SNPs with meat quality traits showed that in SNP g.5477C>T, yaks with the HH genotype and HG genotype had significantly higher intramuscular fat content than individuals with the GG genotype (P < 0.01). In SNP g.16930T>A, yaks with the EE genotype also had significantly higher IMF content than individuals with the EF genotype (P < 0.01). The results indicate that FASN may be used as a candidate gene affecting intramuscular fat content in Datong yaks.

  2. Multiple detection of single nucleotide polymorphism by microarray-based resonance light scattering assay with enlarged gold nanoparticle probes.

    PubMed

    Gao, Jiaxue; Ma, Lan; Lei, Zhen; Wang, Zhenxin

    2016-03-01

    The mapping of specific single nucleotide polymorphisms (SNPs) in patients' genome is a critical process for the development of personalized therapy. In this work, a DNA microarray-based resonance light scattering (RLS) assay has been developed for multiplexed detection of breast cancer related SNPs with high sensitivity and selectivity. After hybridization of the desired target single-stranded DNAs (ssDNAs) with the ssDNA probes on a microarray, the polyvalent ssDNA modified 13 nm gold nanoparticles (GNPs) are employed to label the hybridization reaction through the formation of a three-stranded DNA system. The H2O2-mediated enlargement of GNPs is then used to enhance the RLS signal. The microarray-based RLS assay provides a detection limit of 10 pM (S/N = 3) for the target ssDNA and determines an allele frequency as low as 1.0% in the target ssDNA cocktail. Combined with an asymmetric PCR technique, the proposed assay shows good accuracy and sensitivity in profiling 4 SNPs related to breast cancer of three selected cell lines. PMID:26899365

  3. Single nucleotide polymorphism analysis of the endopolygalacturonase gene in peach and its potential use in crossbreeding programs.

    PubMed

    Jiao, Y; Ma, R; Yu, M

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are the most abundant sequence variations found in plant genomes and are widely used as molecular genetic markers in genetic diversity studies and crossbreeding programs. In this study, we examined 113 DNA sequences of the endopolygalacturonase (endo-PG) gene from 67 peach accessions and found a total of 56 SNPs and 6 insertion/deletions (indels), with a frequency of 3, 1, and 3% for the transitions, transversions, and indels, respectively. Meanwhile, the majority of the observed SNPs were found in the intron regions, while only 2 variable sites and a single indel were detected in the exon regions. A dendrogram was obtained using neighbor-joining cluster analysis and divided into 2 main groups, providing evidence that most of the accessions of the clingstone nonmelting flesh phenotypes generally clustered together and were comparatively nonrelated to the "stony hard" peach cultivars, which were in a different branch altogether. Furthermore, 4 major haplotypes were formed and 3 cleaved amplified polymorphic sequence primer sets were mined according to fruit texture and stone adhesion, displaying their potential as candidate molecular markers for discriminating genotypes. This research will assist peach genetic enhancement by introducing a novel crossbreeding strategy. PMID:25966181

  4. Analysis of single nucleotide polymorphism among Varicella-Zoster Virus and identification of vaccine-specific sites.

    PubMed

    Jeon, Jeong Seon; Won, Youn Hee; Kim, In Kyo; Ahn, Jin Hyun; Shin, Ok Sarah; Kim, Jung Hwan; Lee, Chan Hee

    2016-09-01

    Varicella-zoster virus (VZV) is a causative agent for chickenpox and zoster. Live attenuated vaccines have been developed based on Oka and MAV/06 strains. In order to understand the molecular mechanisms of attenuation, complete genome sequences of vaccine and wild-type strains were compared and single nucleotide polymorphism (SNP) was analyzed. ORF22 and ORF62 contained the highest number of SNPs. The detailed analysis of the SNPs suggested 24 potential vaccine-specific sites. All the mutational events found in vaccine-specific sites were transitional, and most of them were substitution of AT to GC pair. Interestingly, 18 of the vaccine-specific sites of the vaccine strains appeared to be genetically heterogeneous. The probability of a single genome of vaccine strain to contain all 24 vaccine-type sequences was calculated to be less than 4%. The average codon adaptation index (CAI) value of the vaccine strains was significantly lower than the CAI value of the clinical strains. PMID:27376245

  5. Chimeric RNA-DNA molecular beacons for quantification of nucleic acids, single nucleotide polymophisms, and nucleic acid damage.

    PubMed

    El-Yazbi, Amira F; Loppnow, Glen R

    2013-05-01

    Single nucleotide polymorphisms (SNPs) are the main cause for variations in the human genome. DNA lesions, such as cyclobutane pyrimidine dimers (CPDs), [6-4] pyrimidine-pyrimidinones, dewar pyrimidinones, and photohydrates, can subsequently lead to mutagenesis, carcinogenesis, and cell death. Much effort has focused on methods for detecting DNA, SNPs, or damaged nucleic acids. However, almost all of the proposed methods consist of multistep procedures, are limited to specific types of damage, some of these methods require expensive instruments, and some suffer from a high level of interferences. In this paper, we present a novel, simple, mix-and-read assay for the detection of nucleic acids that is general for all types of SNPs and nucleic acid damage. This method uses a chimeric RNA-DNA molecular beacon (chMB). The calibration curve of the chMB for detecting single base mismatch and ultraviolet (UV)-induced DNA damage shows good linearity (R(2) = 0.981 and 0.996, respectively) and limits of detection of 10.4 ± 2.2 and 8.64 ± 1.2 nM, respectively. The chimeric RNA-DNA MB proves to be a more sensitive and selective tool for the quantification of nucleic acids, DNA mismatches, and UV-induced DNA damage than DNA MBs.

  6. Differentiation of Erwinia amylovora and Erwinia pyrifoliae strains with single nucleotide polymorphisms and by synthesis of dihydrophenylalanine.

    PubMed

    Gehring, I; Geider, K

    2012-07-01

    Fire blight has spread from North America to New Zealand, Europe, and the Mediterranean region. We were able to differentiate strains from various origins with a novel PCR method. Three Single Nucleotide Polymorphisms (SNPs) in the Erwinia amylovora genome were characteristic of isolates from North America and could distinguish them from isolates from other parts of the world. They were derived from the galE, acrB, and hrpA genes of strains Ea273 and Ea1/79. These genes were analyzed by conventional PCR (cPCR) and quantitative PCR (qPCR) with differential primer annealing temperatures. North-American E. amylovora strains were further differentiated according to their production of L: -2,5-dihydrophenylalanine (DHP) as tested by growth inhibition of the yeast Rhodotorula glutinis. E. amylovora fruit tree (Maloideae) and raspberry (rubus) strains were also differentiated by Single Strand Conformational Polymorphism analysis. Strains from the related species Erwinia pyrifoliae isolated in Korea and Japan were all DHP positive, but were differentiated from each other by SNPs in the galE gene. Differential PCR is a rapid and simple method to distinguish E. amylovora as well as E. pyrifoliae strains according to their geographical origin.

  7. Computational Refinement of Functional Single Nucleotide Polymorphisms Associated with ATM Gene

    PubMed Central

    George Priya Doss, C.; Rajith, B.

    2012-01-01

    Background Understanding and predicting molecular basis of disease is one of the major challenges in modern biology and medicine. SNPs associated with complex disorders can create, destroy, or modify protein coding sites. Single amino acid substitutions in the ATM gene are the most common forms of genetic variations that account for various forms of cancer. However, the extent to which SNPs interferes with the gene regulation and affects cancer susceptibility remains largely unknown. Principal findings We analyzed the deleterious nsSNPs associated with ATM gene based on different computational methods. An integrative scoring system and sequence conservation of amino acid residues was adapted for a priori nsSNP analysis of variants associated with cancer. We further extended our approach on SNPs that could potentially influence protein Post Translational Modifications in ATM gene. Significance In the lack of adequate prior reports on the possible deleterious effects of nsSNPs, we have systematically analyzed and characterized the functional variants in both coding and non coding region that can alter the expression and function of ATM gene. In silico characterization of nsSNPs affecting ATM gene function can aid in better understanding of genetic differences in disease susceptibility. PMID:22529920

  8. Single nucleotide polymorphisms for feed efficiency and performance in crossbred beef cattle

    PubMed Central

    2014-01-01

    Background This study was conducted to: (1) identify new SNPs for residual feed intake (RFI) and performance traits within candidate genes identified in a genome wide association study (GWAS); (2) estimate the proportion of variation in RFI explained by the detected SNPs; (3) estimate the effects of detected SNPs on carcass traits to avoid undesirable correlated effects on these economically important traits when selecting for feed efficiency; and (4) map the genes to biological mechanisms and pathways. A total number of 339 SNPs corresponding to 180 genes were tested for association with phenotypes using a single locus regression (SLRM) and genotypic model on 726 and 990 crossbred animals for feed efficiency and carcass traits, respectively. Results Strong evidence of associations for RFI were located on chromosomes 8, 15, 16, 18, 19, 21, and 28. The strongest association with RFI (P = 0.0017) was found with a newly discovered SNP located on BTA 8 within the ELP3 gene. SNPs rs41820824 and rs41821600 on BTA 16 within the gene HMCN1 were strongly associated with RFI (P = 0.0064 and P = 0.0033, respectively). A SNP located on BTA 18 within the ZNF423 gene provided strong evidence for association with RFI (P = 0.0028). Genomic estimated breeding values (GEBV) from 98 significant SNPs were moderately correlated (0.47) to the estimated breeding values (EBVs) from a mixed animal model. The significant (P < 0.05) SNPs (98) explained 26% of the genetic variance for RFI. In silico functional analysis for the genes suggested 35 and 39 biological processes and pathways, respectively for feed efficiency traits. Conclusions This study identified several positional and functional candidate genes involved in important biological mechanisms associated with feed efficiency and performance. Significant SNPs should be validated in other populations to establish their potential utilization in genetic improvement programs. PMID:24476087

  9. Genome-Wide Association Study between Single Nucleotide Polymorphisms and Flight Speed in Nellore Cattle

    PubMed Central

    Valente, Tiago Silva; Baldi, Fernando; Sant’Anna, Aline Cristina; Albuquerque, Lucia Galvão; Paranhos da Costa, Mateus José Rodrigues

    2016-01-01

    Introduction Cattle temperament is an important factor that affects the profitability of beef cattle enterprises, due to its relationship with productivity traits, animal welfare and labor safety. Temperament is a complex phenotype often assessed by measuring a series of behavioral traits, which result from the effects of multiple environmental and genetic factors, and their interactions. The aims of this study were to perform a genome-wide association study and detect genomic regions, potential candidate genes and their biological mechanisms underlying temperament, measured by flight speed (FS) test in Nellore cattle. Materials and Methods The genome-wide association study (GWAS) was performed using a single-step procedure (ssGBLUP) which combined simultaneously all 16,600 phenotypes from genotyped and non-genotyped animals, full pedigree information of 162,645 animals and 1,384 genotyped animals in one step. The animals were genotyped with High Density Bovine SNP BeadChip which contains 777,962 SNP markers. After quality control (QC) a total of 455,374 SNPs remained. Results Heritability estimated for FS was 0.21 ± 0.02. Consecutive SNPs explaining 1% or more of the total additive genetic variance were considered as windows associated with FS. Nine candidate regions located on eight different Bos taurus chromosomes (BTA) (1 at 73 Mb, 2 at 65 Mb, 5 at 22 Mb and 119 Mb, 9 at 98 Mb, 11 at 67 Mb, 15 at 16 Mb, 17 at 63 Kb, and 26 at 47 Mb) were identified. The candidate genes identified in these regions were NCKAP5 (BTA2), PARK2 (BTA9), ANTXR1 (BTA11), GUCY1A2 (BTA15), CPE (BTA17) and DOCK1 (BTA26). Among these genes PARK2, GUCY1A2, CPE and DOCK1 are related to dopaminergic system, memory formation, biosynthesis of peptide hormone and neurotransmitter and brain development, respectively. Conclusions Our findings allowed us to identify nine genomic regions (SNP windows) associated with beef cattle temperament, measured by FS test. Within these windows, six promising

  10. Discriminating a Single Nucleotide Difference for Enhanced miRNA Detection Using Tunable Graphene and Oligonucleotide Nanodevices.

    PubMed

    Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V

    2015-09-15

    In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.

  11. Comparison of the nucleotide sequences of 16S rRNA, 444 Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis agent isolates from Northern California.

    PubMed

    Chae, J S; Foley, J E; Dumler, J S; Madigan, J E

    2000-04-01

    We examined 11 naturally occurring isolates of Ehrlichia equi in horses and two human granulocytic ehrlichiosis agent isolates in California for sequence diversity in three genes. Ehrlichia equi isolates were from Sierra (n = 6), Mendocino (n = 3), Sonoma (n = 1), and Marin (n = 1) counties, and human granulocytic ehrlichiosis (HGE) agent isolates were obtained from Humboldt county. PCR with specific primers for 16S rRNA, 444 Ep-ank and groESL heat shock operon genes successfully produced amplicons for all 13 clinical samples. The 444 Ep-ank gene of the HGE agent and E. equi isolates from northern California is different from the eastern U.S. isolates BDS and USG3. The translated amino acid sequence of the groESL heat shock operon gene fragment is identical among E. equi, the HGE agent, and E. phagocytophila, with the exception of the northern Californian equine CASOLJ isolate. Microheterogeneity was observed in the 16S rRNA gene sequences of HGE agent and E. equi isolates from northern California. These results suggest that E. equi and the HGE agent found in California are similar or identical but may differ from the isolates of equine and human origin found in the eastern United States. PMID:10747108

  12. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  13. Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

  14. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  15. Development of Single Nucleotide Polymorphism markers in Theobroma cacao and comparison to Simple Sequence Repeat markers for genotyping of Cameroon clones.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single Nucleotide Polymorphism (SNP) markers are increasingly being used in crop breeding programs, slowly replacing Simple Sequence Repeats (SSR) and other markers. SNPs provide many benefits over SSRs, including ease of analysis and unambiguous results across various platforms. We have identifie...

  16. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  17. Rational design of antisense oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective suppression of mutant Huntingtin in the CNS

    PubMed Central

    Østergaard, Michael E.; Southwell, Amber L.; Kordasiewicz, Holly; Watt, Andrew T.; Skotte, Niels H.; Doty, Crystal N.; Vaid, Kuljeet; Villanueva, Erika B.; Swayze, Eric E.; Frank Bennett, C.; Hayden, Michael R.; Seth, Punit P.

    2013-01-01

    Autosomal dominant diseases such as Huntington’s disease (HD) are caused by a gain of function mutant protein and/or RNA. An ideal treatment for these diseases is to selectively suppress expression of the mutant allele while preserving expression of the wild-type variant. RNase H active antisense oligonucleotides (ASOs) or small interfering RNAs can achieve allele selective suppression of gene expression by targeting single nucleotide polymorphisms (SNPs) associated with the repeat expansion. ASOs have been previously shown to discriminate single nucleotide changes in targeted RNAs with ∼5-fold selectivity. Based on RNase H enzymology, we enhanced single nucleotide discrimination by positional incorporation of chemical modifications within the oligonucleotide to limit RNase H cleavage of the non-targeted transcript. The resulting oligonucleotides demonstrate >100-fold discrimination for a single nucleotide change at an SNP site in the disease causing huntingtin mRNA, in patient cells and in a completely humanized mouse model of HD. The modified ASOs were also well tolerated after injection into the central nervous system of wild-type animals, suggesting that their tolerability profile is suitable for advancement as potential allele-selective HD therapeutics. Our findings lay the foundation for efficient allele-selective downregulation of gene expression using ASOs—an outcome with broad application to HD and other dominant genetic disorders. PMID:23963702

  18. Allelic imbalance analysis by high-density single-nucleotide polymorphic allele (SNP) array with whole genome amplified DNA

    PubMed Central

    Wong, Kwong-Kwok; Tsang, Yvonne T. M.; Shen, Jianhe; Cheng, Rita S.; Chang, Yi-Mieng; Man, Tsz-Kwong; Lau, Ching C.

    2004-01-01

    Besides their use in mRNA expression profiling, oligonucleotide microarrays have also been applied to single-nucleotide polymorphism (SNP) and loss of heterozygosity (LOH) or allelic imbalance studies. In this report, we evaluate the reliability of using whole genome amplified DNA for analysis with an oligonucleotide microarray containing 11 560 SNPs to detect allelic imbalance and chromosomal copy number abnormalities. Whole genome SNP analyses were performed with DNA extracted from osteosarcoma tissues and patient-matched blood. SNP calls were then generated by Affymetrix® GeneChip® DNA Analysis Software. In two osteosarcoma cases, using unamplified DNA, we identified 793 and 1070 SNP loci with allelic imbalance, respectively. In a parallel experiment with amplified DNA, 78% and 83% of these SNP loci with allelic imbalance was detected. The average false-positive rate is 13.8%. Furthermore, using the Affymetrix® GeneChip® Chromosome Copy Number Tool to analyze the SNP array data, we were able to detect identical chromosomal regions with gain or loss in both amplified and unamplified DNA at cytoband resolution. PMID:15148342

  19. Study of Three Single Nucleotide Polymorphisms in the SLC6A14 Gene in Association with Male Infertility.

    PubMed

    Noveski, P; Mircevska, M; Plaseski, T; Peterlin, B; Plaseska-Karanfilska, D

    2014-12-01

    Although several genetic causes of male infertility are known, the condition in around 60.0-75.0% of infertile male patients appears to be idiopathic. In some, genetic causes may be polygenic and require several low-penetrance genes to produce a phenotype outcome. In others, pleiotropy, when a gene can produce several phenotypic traits, may be involved. We have investigated whether single nucleotide polymorphisms (SNPs) in the SLC6A14 [solute carrier family 6 (amino acid transporter), member 14] gene are associated with male infertility. This gene has previously been linked with obesity and cystic fibrosis, which are associated with male infertility. It has a role in the transport of tryptophan and synthesis of serotonin that are important for normal spermatogenesis and testicular function. We have analyzed three SNPs (rs2312054, rs2071877 and rs2011162) in 370 infertile men and 241 fertile controls from two different populations (Macedonian and Slovenian). We found that the rs2011162(G) allele and rs2312054(A)-rs2071877(C)-rs2011162(G) haplotype are present at lower frequencies in the infertile rather than the fertile men (p = 0.044 and p = 0.0144, respectively). We concluded that the SLC6A14 gene may be a population-specific, low-penetrance locus which confers susceptibility to male infertility/subfertility. Additional follow-up studies of a large number of infertile men of different ethnic backgrounds are needed to confirm such a susceptibility.

  20. Single nucleotide polymorphisms associated with carcass traits in a population of Brahman and Brahman-influenced steers.

    PubMed

    Royer, A M; Shivers, C; Riley, D G; Elzo, M A; Garcia, M D

    2016-01-01

    Brahman cattle are important in tropical regions due to their ability to tolerate excessive heat and parasites. However, Brahman cattle exhibit lower carcass quality characteristics when compared to Bos taurus breeds. The objective of this study was to evaluate potential associations between single nucleotide polymorphisms (SNPs) in six candidate genes for carcass quality and composition traits in a population of Brahman and Brahman-influenced steers. Steers were evaluated through the American Brahman Breeders Association carcass evaluation project in Gonzales, Texas. Carcass traits measured included hot carcass weight, ribeye area, marbling score, yield grade, quality grade, dressing percent, and Warner-Bratzler shear force score. Six previously described candidate genes were chosen for SNP analysis based on their previous association with growth and carcass traits. Candidate genes utilized in the current study included calpastatin (CAST), calpain (CAPN3), thyroglobulin (TG), growth hormone, insulin growth factor 1, and adiponectin. Six unique SNPs from three candidate genes (TG, CAST, and CAPN3) were significantly associated (P < 0.001) with carcass quality traits (marbling score and quality grade). A genotypic effect was observed for all significant SNPs, with differing levels of performance observed for animals inheriting different genotypes. Although multiple SNPs in the current study were significantly (P < 0.001) associated with growth and carcass traits, they should be validated in larger populations prior to implementation in selection strategies. PMID:27420951

  1. From single nucleotide substitutions up to chromosomal deletions: genetic pause of leucism-associated disorders in animals.

    PubMed

    Fleck, Katharina; Erhardt, Georg; Lühken, Gesine

    2016-01-01

    Leucism is characterized by a complete or partial white skin and hair in combination with pigmented irides, which can be vivid blue or heterochromatic. This is due to a complete or partial lack of melanocytes. The underlying pathogenesis is a disturbed emigration or differentiation of neural crest-derived cells. Therefore, leucistic phenotypes can be associated with defects, which mainly impair sensory organs and nerves. In humans, a well-known example is the Waardenburg syndrome. Leucism-associated disorders were also described in mouse, rat, hamster, rabbit, mink, cat, dog, pig, sheep, llama, alpaca, cattle and horse. In some of these species already identified causal mutations affect the genes EDN3, EDNRB, KIT, MITF, PAX3, SILV and SOX10. Defect alleles represent different types of genetic variation, ranging from single nucleotide substitutions up to larger chromosomal deletions. Some of the defect alleles produce desired coat color patterns. In some but not all cases, available genetic tests enable breeders to avoid production of animals affected by a leucism-associated disorder. PMID:27529988

  2. No association of single nucleotide polymorphisms in the micro-opioid receptor subunit gene with idiopathic generalized epilepsy.

    PubMed

    Barratt, Catherine; Lai, Teck; Nashef, Lina; Valentin, Antonio; Fisniku, Leonora; Moran, Nicholas; Asherson, Philip; Makoff, Andrew

    2006-10-01

    We have investigated the reported association (p = 0.019) between the A118G single nucleotide polymorphism (SNP) of the opioid receptor micro subunit gene (OPRM1) and idiopathic absence epilepsy (IAE). Five SNPs, including A118G, were investigated by association studies in a sample of 240 probands with idiopathic generalized epilepsy (IGE), including 110 with IAE, and 257 controls. No significant association was found for A118G with IGE or IAE. The difference between the two studies was in the control samples that had significantly different allele frequencies (p = 0.00005), suggesting that population stratification may explain the earlier significant association with IAE. In the current study, none of the other four SNPs was significantly associated with IGE or IAE. Our results provide no support for association of A118G with either IAE or IGE and also exclude association in our sample of a small-to-moderate gene effect with IGE from a large part of OPRM1.

  3. Genome-wide association mapping for wood characteristics in Populus identifies an array of candidate single nucleotide polymorphisms.

    PubMed

    Porth, Ilga; Klapšte, Jaroslav; Skyba, Oleksandr; Hannemann, Jan; McKown, Athena D; Guy, Robert D; DiFazio, Stephen P; Muchero, Wellington; Ranjan, Priya; Tuskan, Gerald A; Friedmann, Michael C; Ehlting, Juergen; Cronk, Quentin C B; El-Kassaby, Yousry A; Douglas, Carl J; Mansfield, Shawn D

    2013-11-01

    Establishing links between phenotypes and molecular variants is of central importance to accelerate genetic improvement of economically important plant species. Our work represents the first genome-wide association study to the inherently complex and currently poorly understood genetic architecture of industrially relevant wood traits. Here, we employed an Illumina Infinium 34K single nucleotide polymorphism (SNP) genotyping array that generated 29,233 high-quality SNPs in c. 3500 broad-based candidate genes within a population of 334 unrelated Populus trichocarpa individuals to establish genome-wide associations. The analysis revealed 141 significant SNPs (α ≤ 0.05) associated with 16 wood chemistry/ultrastructure traits, individually explaining 3-7% of the phenotypic variance. A large set of associations (41% of all hits) occurred in candidate genes preselected for their suggested a priori involvement with secondary growth. For example, an allelic variant in the FRA8 ortholog explained 21% of the total genetic variance in fiber length, when the trait's heritability estimate was considered. The remaining associations identified SNPs in genes not previously implicated in wood or secondary wall formation. Our findings provide unique insights into wood trait architecture and support efforts for population improvement based on desirable allelic variants.

  4. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    PubMed

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions. PMID:26544948

  5. Genetic scores based on risk-associated single nucleotide polymorphisms (SNPs) can reveal inherited risk of renal cell carcinoma.

    PubMed

    Wu, Yishuo; Zhang, Ning; Li, Kaiwen; Chen, Haitao; Lin, Xiaolin; Yu, Yang; Gou, Yuancheng; Hou, Jiangang; Jiang, Deke; Na, Rong; Wang, Xiang; Ding, Qiang; Xu, Jianfeng

    2016-04-01

    The objective of this study was to evaluate whether renal cell carcinoma (RCC) risk-associated single nucleotide polymorphisms (SNPs) could reflect the individual inherited risks of RCC. A total of 346 RCC patients and 1,130 controls were recruited in this case-control study. Genetic scores were calculated for each individual based on the odds ratios and frequencies of risk-associated SNPs. Four SNPs were significantly associated with RCC in Chinese population. Two genetic score models were established, genetic score 1 (rs10054504, rs7023329 and rs718314) and genetic score 2 (rs10054504, rs7023329 and rs1049380). For genetic score 1, the individual likelihood of RCC with low (<0.8), medium (0.8-1.2) and high (≥1.2) genetic score 1 was 15.61%, 22.25% and 33.92% respectively (P-trend=6.88×10(-7)). For genetic score 2, individual with low (<0.8), medium (0.8-1.2) and high (≥1.2) genetic score 2 would have likelihood of RCC as 14.39%, 24.54% and 36.48%, respectively (P-trend=1.27×10(-10)). The area under the receiver operating curve (AUC) of genetic score 1 was 0.626, and AUC of genetic score 2 was 0.658. We concluded that genetic score can reveal personal risk and inherited risk of RCC, especially when family history is not available.

  6. Single nucleotide polymorphisms in the bovine genome are associated with the number of oocytes collected during ovum pick up.

    PubMed

    Santos-Biase, W K F; Biase, F H; Buratini, J; Balieiro, J; Watanabe, Y F; Accorsi, M F; Ferreira, C R; Stranieri, P; Caetano, A R; Meirelles, F V

    2012-10-01

    The number of follicles recruited in each estrous cycle has gained practical importance in artificial reproductive technology, as it determines the oocyte yield from ultrasound-guided ovum pickup for in vitro embryo production. We aimed to identify single nucleotide polymorphisms (SNPs) in bovine genes related to reproductive physiology and evaluate the association between the candidate SNPs and the number of oocytes collected from ultrasound-guided ovum pickup. We sequenced genomic segments of GDF9, FGF8, FGF10 and BMPR2 and identified seventeen SNPs in the Bos taurus and Bos indicus breeds. Two SNPs cause amino acid changes in the proteins GDF9 and FGF8. Three SNPs in GDF9, FGF8 and BMPR2 were genotyped in 217 Nelore cows (B. indicus), while two previously identified mutations in LHCGR and mitochondrial DNA (mtDNA) were genotyped in the same group. The polymorphisms in GDF9, FGF8, BMRP2 and LHCGR were significantly associated (P<0.01) with the number of oocytes collected by ovum pickup, whereas the SNP in the mtDNA was not. In addition, we estimated an allelic substitution effect of 1.13±0.01 (P<0.01) oocytes for the SNP in the FGF8 gene. The results we report herein provide further evidence to support the hypothesis that genetic variability is an important component of the number of antral follicles in the bovine ovary.

  7. Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

    PubMed

    Arruda, Mônica Barcellos; Campagnari, Francine; de Almeida, Tailah Bernardo; Couto-Fernandez, José Carlos; Tanuri, Amilcar; Cardoso, Cynthia Chester

    2016-01-01

    Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME) influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs) in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs), and 8 to protease inhibitors (PIs) containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001), while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009). Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies. PMID:27648838

  8. High performance computing enabling exhaustive analysis of higher order single nucleotide polymorphism interaction in Genome Wide Association Studies

    PubMed Central

    2015-01-01

    Genome-wide association studies (GWAS) are a common approach for systematic discovery of single nucleotide polymorphisms (SNPs) which are associated with a given disease. Univariate analysis approaches commonly employed may miss important SNP associations that only appear through multivariate analysis in complex diseases. However, multivariate SNP analysis is currently limited by its inherent computational complexity. In this work, we present a computational framework that harnesses supercomputers. Based on our results, we estimate a three-way interaction analysis on 1.1 million SNP GWAS data requiring over 5.8 years on the full "Avoca" IBM Blue Gene/Q installation at the Victorian Life Sciences Computation Initiative. This is hundreds of times faster than estimates for other CPU based methods and four times faster than runtimes estimated for GPU methods, indicating how the improvement in the level of hardware applied to interaction analysis may alter the types of analysis that can be performed. Furthermore, the same analysis would take under 3 months on the currently largest IBM Blue Gene/Q supercomputer "Sequoia" at the Lawrence Livermore National Laboratory assuming linear scaling is maintained as our results suggest. Given that the implementation used in this study can be further optimised, this runtime means it is becoming feasible to carry out exhaustive analysis of higher order interaction studies on large modern GWAS. PMID:25870758

  9. An automatic high-throughput single nucleotide polymorphism genotyping approach based on universal tagged arrays and magnetic nanoparticles.

    PubMed

    Li, Song; Liu, Hongna; Jia, Yingying; Mou, Xianbo; Deng, Yan; Lin, Lin; Liu, Bin; He, Nongyue

    2013-04-01

    Recent developments in highly parallel genome-wide studies are transforming the association of human health and diseases. In these studies, multiple SNP loci from large amount of samples need to be investigated to obtain a result with a high degree of confidence. Herein, we describe a novel, cost-effective and automated method for high-throughput single nucleotide polymorphisms (SNPs) genotyping based on universal tagged array and magnetic separation. By using two kinds of functionalized magnetic nanoparticles, the whole operation procedure including genome DNA extraction and SNP genotyping can be automatically performed by JANUS automated workstation (Perkin Elmer Inc.). Four different SNPs loci from 80 samples were scored using only one pair of universal dual-color probes, the phase of numerous SNPs can be automated assessed simultaneously. The results demonstrated that the expected scores and good discrimination were obtained between the two alleles from these four SNP loci. Due to adequately taking the advantages of high parallel read-out and intrinsically scalable properties of microarray, and the automated magnetic separation handling technology is highly adaptable fro multiplexing sample preparation and automated SNP analysis, also avoid the complex procedure including purification and concentration, the new strategy is high-throughput, simple, flexible, cost-effective, and will be very suitable for large-scale genotyping.

  10. Identification of Novel GRM1 Mutations and Single Nucleotide Polymorphisms in Prostate Cancer Cell Lines and Tissues

    PubMed Central

    Ali, Shafat; Shourideh, Mojgan; Koochekpour, Shahriar

    2014-01-01

    Metabotropic glutamate receptor 1 (GRM1) signaling has been implicated in benign and malignant disorders including prostate cancer (PCa). To further explore the role of genetic alterations of GRM1 in PCa, we screened the entire human GRM1 gene including coding sequence, exon-intron junctions, and flanking untranslated regions (UTRs) for the presence of mutations and single nucleotide polymorphisms (SNPs) in several PCa cell lines and matched tumor-normal tissues from Caucasian Americans (CAs) and African Americans (AAs). We used bidirectional sequencing, allele-specific PCR, and bioinformatics to identify the genetic changes in GRM1 and to predict their functional role. A novel missense mutation identified at C1744T (582 Pro > Ser) position of GRM1 gene in a primary AA-PCa cell line (E006AA) was predicted to affect the protein stability and functions. Another novel mutation identified at exon-intron junction of exon-8 in C4-2B cell line resulted in alteration of the GRM1 splicing donor site. In addition, we found missense SNP at T2977C (993 Ser > Pro) position and multiple non-coding mutations and SNPs in 3′-UTR of GRM1 gene in PCa cell lines and tissues. These novel mutations may contribute to the disease by alterations in GRM1 gene splicing, receptor activation, and post-receptor downstream signaling. PMID:25062106

  11. Invited commentary: a single nucleotide polymorphism in BMP15 is associated with high response to controlled ovarian hyperstimulation.

    PubMed

    Abir, Ronit; Fisch, Benjamin

    2011-07-01

    A report has been published which shows a connection between single nucleotide polymorphisms (SNP) in the bone morphogenetic protein 15 (BMP15) gene and ovarian hyperstimulation syndrome (OHSS) in women, similar to reported effects of heterozygous BMP15 point mutations in sheep. The report also describes the near-significant presence of another BMP15 gene SNP correlated with a low response to ovarian stimulation. Previous studies associated two SNP with anovulation or infertility in women with polycystic ovary syndrome, and heterozygosity for another BMP15 SNP resulted in ovarian dysgenesis and hypergonadotrophic failure. In sheep, homozygous point mutations or immunization against BMP15 led to follicular developmental arrest, ovarian dysgenesis and streak ovaries. In mammalian (including human) ovaries BMP15 and its three receptors were shown to be expressed from primary or primordial follicular stages, suggesting that BMP15 might also be involved in activating primordial follicles, and could possibly serve as a marker of follicular reserve. BMP15 also inhibited follicle stimulating hormone receptor expression, was associated with cumulus expansion and its high follicular-fluid concentration was correlated with improved oocyte and embryo quality. Thus, BMP15 seems to be an important regulator of ovarian function. Further studies are needed to clarify its roles in human female fertility.

  12. High performance computing enabling exhaustive analysis of higher order single nucleotide polymorphism interaction in Genome Wide Association Studies.

    PubMed

    Goudey, Benjamin; Abedini, Mani; Hopper, John L; Inouye, Michael; Makalic, Enes; Schmidt, Daniel F; Wagner, John; Zhou, Zeyu; Zobel, Justin; Reumann, Matthias

    2015-01-01

    Genome-wide association studies (GWAS) are a common approach for systematic discovery of single nucleotide polymorphisms (SNPs) which are associated with a given disease. Univariate analysis approaches commonly employed may miss important SNP associations that only appear through multivariate analysis in complex diseases. However, multivariate SNP analysis is currently limited by its inherent computational complexity. In this work, we present a computational framework that harnesses supercomputers. Based on our results, we estimate a three-way interaction analysis on 1.1 million SNP GWAS data requiring over 5.8 years on the full "Avoca" IBM Blue Gene/Q installation at the Victorian Life Sciences Computation Initiative. This is hundreds of times faster than estimates for other CPU based methods and four times faster than runtimes estimated for GPU methods, indicating how the improvement in the level of hardware applied to interaction analysis may alter the types of analysis that can be performed. Furthermore, the same analysis would take under 3 months on the currently largest IBM Blue Gene/Q supercomputer "Sequoia" at the Lawrence Livermore National Laboratory assuming linear scaling is maintained as our results suggest. Given that the implementation used in this study can be further optimised, this runtime means it is becoming feasible to carry out exhaustive analysis of higher order interaction studies on large modern GWAS. PMID:25870758

  13. Expression of the Alpha Tocopherol Transfer Protein gene is regulated by Oxidative Stress and Common Single Nucleotide Polymorphisms

    PubMed Central

    Ulatowski, Lynn; Dreussi, Cara; Noy, Noa; Barnholtz-Sloan, Jill; Klein, Eric; Manor, Danny

    2012-01-01

    Vitamin E (α-tocopherol) is the major lipid soluble antioxidant in most animal species. By controlling the secretion of vitamin E from the liver, the α-tocopherol transfer protein (αTTP) regulates whole-body distribution and levels of this vital nutrient. However, the mechanism(s) that regulate the expression of this protein are poorly understood. Here we report that transcription of the TTPA gene in immortalized human hepatocytes (IHH) is induced by oxidative stress and by hypoxia, by agonists of the nuclear receptors PPARα and RXR, and by increased cAMP levels. The data show further that induction of TTPA transcription by oxidative stress is mediated by an already-present transcription factor, and does not require de novo protein synthesis. Silencing of the cAMP response element binding (CREB) transcription factor attenuated transcriptional responses of the TTPA gene to added peroxide, suggesting that CREB mediates responses of this gene to oxidative stress. Using a 1.9 Kb proximal segment of the human TTPA promoter together with site-directed mutagenesis approach, we found that single nucleotide polymorphisms (SNPs) that are commonly found in healthy humans dramatically affect promoter activity. These observations suggest that oxidative stress and individual genetic makeup contribute to vitamin E homeostasis in humans. These findings may explain the variable responses to vitamin E supplementation observed in human clinical trials. PMID:23079030

  14. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    PubMed Central

    Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard

    2014-01-01

    High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323

  15. A Multipurpose, High-Throughput Single-Nucleotide Polymorphism Chip for the Dengue and Yellow Fever Mosquito, Aedes aegypti.

    PubMed

    Evans, Benjamin R; Gloria-Soria, Andrea; Hou, Lin; McBride, Carolyn; Bonizzoni, Mariangela; Zhao, Hongyu; Powell, Jeffrey R

    2015-05-01

    The dengue and yellow fever mosquito, Aedes aegypti, contributes significantly to global disease burden. Genetic study of Aedes aegypti is essential to understanding its evolutionary history, competence as a disease vector, and the effects and efficacy of vector control methods. The prevalence of repeats and transposable elements in the Aedes aegypti genome complicates marker development and makes genome-wide genetic study challenging. To overcome these challenges, we developed a high-throughput genotyping chip, Axiom_aegypti1. This chip screens for 50,000 single-nucleotide polymorphisms present in Aedes aegypti populations from around the world. The array currently used genotypes 96 samples simultaneously. To ensure that these markers satisfy assumptions commonly made in many genetic analyses, we tested for Mendelian inheritance and linkage disequilibrium in laboratory crosses and a wild population, respectively. We have validated more than 25,000 of these markers to date, and expect this number to increase with more sampling. We also present evidence of the chip's efficacy in distinguishing populations throughout the world. The markers on this chip are ideal for applications ranging from population genetics to genome-wide association studies. This tool makes rapid, cost-effective, and comparable genotype data attainable to diverse sets of Aedes aegypti researchers, from those interested in potential range shifts due to climate change to those characterizing the genetic underpinnings of its competence to transmit disease. PMID:25721127