Sample records for rubella

  1. [Rubella (German measles)--still a major infectious disease].

    PubMed

    Stock, Ingo

    2012-01-01

    Rubella viruses are single-stranded ribonucleic acid viruses, which are surrounded by a lipid-containing membrane. From the taxonomic point of view, these serologically uniform viruses belong to the family of Togaviridae, and to the genus Rubivirus. After birth, infection with rubella virus occurs through inhalation of contaminated droplets. In children infected after birth, rubella viruses usually cause uncomplicated diseases that are associated with an unspecific rash (postnatal rubella). Rubella virus infections in adults might be more severe and can be accompanied by complications such as joint pain and inflammation in the joints. Rubella virus infection during pregnancy can lead to the infection of the fetus. In the first and second trimester of pregnancy, fetal rubella infection often lead to severe abnormalities of the newborn, which are summarized as rubella embryopathy or congenital rubella syndrome. One of these disorders, the Gregg syndrome, is associated with serious damage to heart, ears and eyes of the newborn. Therefore, in suspected cases of rubella virus infection during pregnancy, or after contact of a pregnant woman with an infected person, a serological diagnosis must be performed. The diagnosis of an acute rubella virus infection usually consists of the detection of rubella-specific IgM. Critical to avoiding a rubella virus infection is the immune prophylaxis, for which a live attenuated vaccine, usually given as trivalent vaccine against measles, mumps and rubella (MMR vaccine), is available. Since the introduction of the rubella vaccination in the 1970s, in many areas of the world the number of rubella diseases has declined dramatically. Nevertheless, rubella is still widespread in some countries, and still occurs in Germany. Postnatal rubella virus infections can be treated symptomatically. A specific (antiviral) therapy is not available.

  2. Seroprevalence of rubella in school girls and pregnant women.

    PubMed

    Karakoc, Gulbin Bingol; Altintas, Derya Ufuk; Kilinc, Banu; Karabay, Aysun; Mungan, Neslihan Onenli; Yilmaz, Mustafa; Evliyaoglu, Nurdan

    2003-01-01

    Many studies have been assigned to investigate the surveillance of congenital rubella syndrome, acquired rubella and seroprevalence in different countries to determine the new vaccination program and national vaccination schedules. Seroprevalence of rubella in Turkey is still insufficient and national immunization schedules do not include routine rubella vaccination. In this study we aimed to investigate the seroprevalence of rubella at child bearing age in an unvaccinated population in Adana, southern Turkey, to help determine whether routine rubella vaccination is necessary, if so when it should be administered. Ninety-four school girls aged 12-18 years living in Adana were selected for the study and stratified according to the socioeconomic status of their parents and evaluated for rubella antibodies. One hundred pregnant women aged 18-25 years and 100 pregnant women aged 26-35 years were sampled rubella antibodies. Rubella specific IgG antibody was measured qualitatively and quantitatively by using microparticule enzyme immune assay technology. Rubella specific IgG antibody was positive in 87-94 school girls (92.5%). The geometric mean rubella specific IgG antibody value was found be 148.14 IU/ml. No correlation was found between socioeconomic status and rubella seropositivity (p = 0.6521). In all pregnant women rubella specific IgG antibody was found to be positive. In conclusion rubella vaccination should be considered carefully in developing countries. Because of the high seropositivity to rubella in our region we do not recommend rubella vaccination in early childhood. Yet this is a preliminary study and further studies with larger population size are needed to determine the national immunization policy for rubella.

  3. Epidemiology of rubella and congenital rubella syndrome in Japan before 1989.

    PubMed

    Ueda, Kohji

    2016-04-07

    Epidemiological studies of rubella and congenital rubella syndrome (CRS) in Japan have been conducted since the first nationwide rubella epidemic of 1965-1969 and subsequent epidemics of 1975-1977, 1982, 1987-1988, and 1992-1993. Rubella was non-endemic in Japan before the 1975-1977 epidemic, and endemic thereafter. Japan started a selective rubella vaccination program for junior high school girls in 1977, and universal rubella vaccination of children of both sexes in 1989. No nationwide rubella epidemics have occurred since 1994. Only three children with CRS were reported in Japan before 1964; however, many children with CRS were identified in 1965 when a rubella epidemic struck Okinawa, which has many the United States military bases. After the 1965-1969 and 1975-1977 rubella epidemics on the Japanese mainland, small numbers of children with CRS were identified (hospital survey). These findings led to the hypothesis that, compared to U.S. rubella virus strains, Japanese strains of rubella virus are less teratogenic. This hypothesis strongly affected the development of rubella vaccines in Japan. However, retrospective seroepidemiological studies attributed the CRS in many children in Okinawa to the high rate of rubella infection in pregnant women. According to the survey conducted at special schools for the deaf, 83, 232, 77, and 167 children were born with CRS on the Japanese mainland respectively after the 1965-1969, 1975-1977, 1982, and 1987-1988 nationwide rubella epidemics, suggesting that the incidence of CRS in Japan is in fact comparable to that in the U.S. and Europe. Rubella epidemics in children have been effectively prevented since 1994. However, a rubella outbreak among adult males and CRS occurred between 2012 and 2014. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. [Molecular-biological properties of the rubella virus strains isolated in St. Petersburg].

    PubMed

    Buzitskaia, Zh V; Sirotkin, A K; Gudkova, T M; Prochukhanova, A P; Karpov, A V; Tsybalova, L M; Kiselev, O I

    2012-01-01

    In the surveillance of rubella in the northwest region of Russia samples of nasopharyngeal swabs from 37 patients with rubella, which were treated in the 442nd district military hospital named after Z.P. Solovyov in autumn 2007 were screened for the rubella virus using RK-13 cell line, 22 strains of rubella virus were isolated. Gene sequencing of E1 region of rubella virus isolates was carried out. Rubella virus strains isolated in St. Petersburg during the 2007 outbreak belonged to rubella virus genotype 1E. The morphogenesis of RK-13 cells with formation of replication complexes and enveloped virions of rubella virus was shown.

  5. Rubella outbreaks following virus importations: the experience of Chile.

    PubMed

    Gallegos, Doris; Olea, Andrea; Sotomayor, Viviana; González, Claudia; Muñoz, Juan Carlos; Ramos, Mónica; Espinoza, M Cecilia; Mendoza, Gladys; Torres, Graciela; Espiñeira, Emilio; Andrade, Winston; Fernández, Jorge; Fasce, Rodrigo

    2011-09-01

    Strategies for accelerated control of rubella and congenital rubella syndrome (CRS) in Chile included mass vaccination of women of childbearing age in 1999 but did not include vaccination of adult men. We reviewed data from Chile's integrated surveillance system for measles, rubella, and CRS from 2004 through 2009 and describe the epidemiology of rubella outbreaks and implementation of control measures in 2005 and 2007 following mass vaccination of women. Population estimates from census data were used to calculate rubella incidence rates. The age distribution of rubella cases during 2007 was compared with rubella vaccination opportunities by birth cohort to orient mass vaccination of adult men. In 2005, an institutional outbreak of rubella occurred among male naval recruits 18-22 years of age, with 46 confirmed cases over a 5-month period. Beginning in March 2007, rubella outbreaks among young adults in the capital of Santiago spread throughout Chile, resulting in >4000 confirmed rubella cases. Delayed control measures and rapid dissemination among young adults led to widespread transmission. From 2007 through 2009, rubella incidence was highest among adult men not included in previous vaccination strategies. Mass vaccination of men 19-29 years of age was conducted in November 2007 to interrupt rubella transmission. Chile's experience suggests that vaccination strategies for rubella and CRS elimination need to include both men and women.

  6. Comparing the rubella seronegativity in pregnant women who received one dose of rubella vaccine at different ages in Taiwan.

    PubMed

    Shih, Ching-Tang; Chang, Yuan-Chun; Wang, Huey-Lan; Lin, Ching-Chiang

    2016-09-14

    Vaccination is the best strategy to prevent rubella and congenital rubella. The aim of our study was to assess the immunity to rubella and determine rubella virus antibody titers in pregnant women who were offered a single dose of rubella vaccine at different ages of their lives. A total 15,067 rubella IgG antibody test results for Taiwanese pregnant women who received routine prenatal checkup at Fooyin University Hospital from 1999 to 2014 were analyzed in this study. The women were divided into five birth cohorts in order to compare their rubella seronegativities and antibody titers according to the different period of rubella vaccination policy in Taiwan. The total rubella seronegativity rate was 11.2% (95% CI: 10.7-11.7%) and the mean rubella antibody titers was 51.0IU/mL (SD=54.7IU/mL). The junior school cohort has the lowest rubella seronegativity of 7.6% (95% CI: 6.9-8.2%). The seronegativities were significantly high in the preschool cohort and in the 15-month-old cohort, 14.9% (95% CI: 13.2-16.6%) and 14.8% (95% CI: 11.5-18.1%), respectively. The OR values were 2.1 (95% CI: 1.8-2.5, p<0.001) in the preschool cohort and 2.2 (95% CI: 1.6-2.8, p<0.001) in the 15-month-old cohort, respectively, against the junior school cohort. Women in the 15-month-old cohort have lowest average rubella IgG titer, 25.4IU/mL. The total rubella seronegativity rate was 11.2% in all native pregnant women. Women who received one dose rubella vaccine at preschool and 15-month-old have highest seronegativities. The 15-month-old cohort has the lowest average rubella IgG titer. We recommend a revised catch-up immunization policy to women who received one dose rubella vaccine at a younger age. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Rubella immunity among pregnant women aged 15-44 years, Namibia, 2010.

    PubMed

    Jonas, Anna; Cardemil, Cristina V; Beukes, Anita; Anderson, Raydel; Rota, Paul A; Bankamp, Bettina; Gary, Howard E; Sawadogo, Souleymane; Patel, Sadhna V; Zeko, Sikota; Muroua, Clementine; Gaeb, Esegiel; Wannemuehler, Kathleen; Gerber, Sue; Goodson, James L

    2016-08-01

    The level of rubella susceptibility among women of reproductive age in Namibia is unknown. Documenting the risk of rubella will help estimate the potential burden of disease in Namibian women and the risk of congenital rubella syndrome (CRS) in infants, and will guide strategies for the introduction of rubella vaccine. A total of 2044 serum samples from pregnant Namibian women aged 15-44 years were tested for rubella immunoglobulin G antibody; the samples were obtained during the 2010 National HIV Sentinel Survey. The proportion of women seropositive for rubella was determined by 5-year age strata, and factors associated with seropositivity were analyzed by logistic regression, including age, gravidity, HIV status, facility type, and urban/rural status. Overall rubella seroprevalence was 85% (95% confidence interval (CI) 83-86%). Seroprevalence varied by age group (83-90%) and health district (71-100%). In the multivariable model, women from urban residences had higher odds of seropositivity as compared to women from rural residences (odds ratio 1.40, 95% CI 1.09-1.81). In the absence of a routine rubella immunization program, the high level of rubella seropositivity suggests rubella virus transmission in Namibia, yet 15% of pregnant Namibian women remain susceptible to rubella. The introduction of rubella vaccine will help reduce the risk of rubella in pregnant women and CRS in infants. Published by Elsevier Ltd.

  8. [Laboratory diagnostics and monitoring of virus circulation in surveillance system for rubella in Belarus].

    PubMed

    Samoĭlovich, E O; Semeĭko, G V; Ermolovich, M A; Svirchevskaia, E Iu

    2010-01-01

    To summarize data on laboratory diagnostics of prenatal and postnatal rubella and molecular monitoring of rubella virus circulation in Belarus obtained during implementation of rubella elimination program. Serum samples from 2314 persons were tested on the presence of IgM to rubella virus and measles virus (in case of negative result on rubella) using respective enzyme immunoassays. Virological testing using RT-PCR as well as genotyping on the basis of E1 gene fragment sequencing were also performed. Two viruses isolated in Belarus were set as reference strains of genotypes 1G and 1h. Implementation of laboratory diagnostics allowed to differentiate cases of rubella from other exanthematous infections, significantly increase the number of laboratory-confirmed cases among all reported cases, and show presence of endemic circulation of rubella virus strains of 3 different genotypes (1G, 1E, and 1h) in Belarus (2004-2006). In 2006, when relatively high incidence of rubella was reported in the country (24.39 per 100,000 population), the risk of congenital rubella syndrome was not less than 9 per 100,000 births. Conducted in October 2005-May 2006 additional rounds of immunization against rubella (>1 million people were vaccinated) decreased incidence to single cases. Obtained data show achievability of indigenous rubella elemination by 2010. Revealed genetic diversity of rubella virus strains allowed to update the International classification of wild rubella viruses.

  9. Rubella: Current Status, Diagnosis, Outbreak Control, and Use of Rubella Vaccine in Females of Childbearing Age.

    ERIC Educational Resources Information Center

    Preblud, Stephen R.

    1984-01-01

    Widespread rubella vaccination of young children with a secondary emphasis on vaccinating susceptible adolescents and young adults has prevented epidemics of rubella and congenital rubella syndrome. Benefits of ensuring high immunity levels in college students, quick response to disease outbreak, and safety and efficacy of rubella vaccine in this…

  10. Rubella epidemic caused by genotype 1E rubella viruses in Beijing, China, in 2007–2011

    PubMed Central

    2013-01-01

    Background A series of different rubella vaccination strategies were implemented to control rubella and prevent congenital rubella virus infection in Beijing, China. The rubella vaccine was available in 1995 in Beijing, and was introduced into the Beijing immunization program (vaccine recipients at their own expense vaccination) in 2000, and was introduced into the National Expanded Program on Immunization (vaccine recipients free vaccination) in 2006. Rubella virological surveillance started in Beijing in 2007. Results The reported rubella incidence rate has decreased dramatically due to the introduction of the vaccine in Beijing since 1995. However, rubella epidemics occurred regardless in 2001 and 2007. The incidence rate among the floating population has gradually increased since 2002, reaching 2 or more times that in the permanent resident population. The peak age of rubella cases gradually changed from <15 years of age to adults after 2005. Phylogenetic analysis was performed and a phylogenetic tree was constructed based on the World Health Organization standard sequence window for rubella virus isolates. All Beijing rubella virus isolates belong to genotype 1E/cluster1 and were clustered interspersed with viruses from other provinces in China. The effective number of infections indicated by a Bayesian skyline plot remained constant from 2007 to 2011. Conclusions The proportion of rubella cases among the floating population has increased significantly in Beijing since 2002, and the disease burden gradually shifted to the older age group (15- to 39-year olds), which has become a major group with rubella infection since 2006. Genotype 1E rubella virus continuously caused a rubella epidemic in Beijing in 2007–2011 and was the predominant virus, and all Beijing genotype 1E viruses belong to cluster 1, which is also widely circulated throughout the country. PMID:23596982

  11. Genotypes of Rubella Virus and the Epidemiology of Rubella Infections in the Democratic Republic of the Congo, 2004–2013

    PubMed Central

    Pukuta, Elizabeth; Waku-Kouomou, Diane; Abernathy, Emily; Illunga, Benoit Kebela; Obama, Ricardo; Mondonge, Vital; Dahl, Benjamin A.; Maresha, Balcha G.; Icenogle, Joseph; Muyembe, Jean-Jacques

    2017-01-01

    Rubella is a viral infection that may cause fetal death or congenital defects, known as congenital rubella syndrome (CRS), during early pregnancy. The World Health Organization (WHO) recommends that countries assess the burden of rubella and CRS, including the determination of genotypes of circulating viruses. The goal of this study was to identify the genotypes of rubella viruses in the Democratic Republic of the Congo (DRC). Serum or throat swab samples were collected through the measles surveillance system. Sera that tested negative for measles IgM antibody were tested for rubella IgM antibody. Serum collected within 4 days of rash onset and throat swabs were screened by real-time RT-PCR for rubella virus RNA. For positive samples, an amplicon of the E1 glycoprotein gene was amplified by RT-PCR and sequenced. 11733 sera were tested for rubella IgM and 2816 (24%) were positive; 145 (5%) were tested for the presence of rubella RNA by real-time RT-PCR and 10 (7%) were positive. Seventeen throat swabs were analyzed by RT-PCR and three were positive. Sequences were obtained from eight of the positive samples. Phylogenetic analysis showed that the DRC rubella viruses belonged to genotypes 1B, 1E, 1G, and 2B. This report provides the first information on the genotypes of rubella virus circulating in the DRC. These data contribute to a better understanding of rubella burden and the dynamics of rubella virus circulation in Africa. Efforts to establish rubella surveillance in the DRC are needed to support rubella elimination in Africa. PMID:27479298

  12. Genotypes of rubella virus and the epidemiology of rubella infections in the Democratic Republic of the Congo, 2004-2013.

    PubMed

    Pukuta, Elizabeth; Waku-Kouomou, Diane; Abernathy, Emily; Illunga, Benoit Kebela; Obama, Ricardo; Mondonge, Vital; Dahl, Benjamin A; Maresha, Balcha G; Icenogle, Joseph; Muyembe, Jean-Jacques

    2016-10-01

    Rubella is a viral infection that may cause fetal death or congenital defects, known as congenital rubella syndrome (CRS), during early pregnancy. The World Health Organization (WHO) recommends that countries assess the burden of rubella and CRS, including the determination of genotypes of circulating viruses. The goal of this study was to identify the genotypes of rubella viruses in the Democratic Republic of the Congo (DRC). Serum or throat swab samples were collected through the measles surveillance system. Sera that tested negative for measles IgM antibody were tested for rubella IgM antibody. Serum collected within 4 days of rash onset and throat swabs were screened by real-time RT-PCR for rubella virus RNA. For positive samples, an amplicon of the E1 glycoprotein gene was amplified by RT-PCR and sequenced. 11733 sera were tested for rubella IgM and 2816 (24%) were positive; 145 (5%) were tested for the presence of rubella RNA by real-time RT-PCR and 10 (7%) were positive. Seventeen throat swabs were analyzed by RT-PCR and three were positive. Sequences were obtained from eight of the positive samples. Phylogenetic analysis showed that the DRC rubella viruses belonged to genotypes 1B, 1E, 1G, and 2B. This report provides the first information on the genotypes of rubella virus circulating in the DRC. These data contribute to a better understanding of rubella burden and the dynamics of rubella virus circulation in Africa. Efforts to establish rubella surveillance in the DRC are needed to support rubella elimination in Africa. J. Med. Virol. 88:1677-1684, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Rubella epidemic caused by genotype 1E rubella viruses in Beijing, China, in 2007-2011.

    PubMed

    Chen, Meng; Zhu, Zhen; Liu, Donglei; Huang, Guohong; Huang, Fang; Wu, Jiang; Zhang, Tiegang; Xu, Wenbo; Pang, Xinghuo

    2013-04-18

    A series of different rubella vaccination strategies were implemented to control rubella and prevent congenital rubella virus infection in Beijing, China. The rubella vaccine was available in 1995 in Beijing, and was introduced into the Beijing immunization program (vaccine recipients at their own expense vaccination) in 2000, and was introduced into the National Expanded Program on Immunization (vaccine recipients free vaccination) in 2006. Rubella virological surveillance started in Beijing in 2007. The reported rubella incidence rate has decreased dramatically due to the introduction of the vaccine in Beijing since 1995. However, rubella epidemics occurred regardless in 2001 and 2007. The incidence rate among the floating population has gradually increased since 2002, reaching 2 or more times that in the permanent resident population. The peak age of rubella cases gradually changed from <15 years of age to adults after 2005. Phylogenetic analysis was performed and a phylogenetic tree was constructed based on the World Health Organization standard sequence window for rubella virus isolates. All Beijing rubella virus isolates belong to genotype 1E/cluster1 and were clustered interspersed with viruses from other provinces in China. The effective number of infections indicated by a Bayesian skyline plot remained constant from 2007 to 2011. The proportion of rubella cases among the floating population has increased significantly in Beijing since 2002, and the disease burden gradually shifted to the older age group (15- to 39-year olds), which has become a major group with rubella infection since 2006. Genotype 1E rubella virus continuously caused a rubella epidemic in Beijing in 2007-2011 and was the predominant virus, and all Beijing genotype 1E viruses belong to cluster 1, which is also widely circulated throughout the country.

  14. [Analysis of epidemiological and genetic characteristics of rubella viruses in China from 2007 to 2008].

    PubMed

    Zhu, Zhen; Guo, Xue-bin; Cui, Ai-li

    2009-06-01

    To understand the epidemiological and genetic characteristics of rubella viruses in China (excluded Hongkong, Macao and Taiwan areas, the same below) from 2007 to 2008, and to provide the basis for the development of rubella immunization strategy. Both rubella epidemiology data from rubella disease surveillance information management system and rubella virology data from National measles Laboratory surveillance data base were analyzed. The reported rubella incidence rate was 5.70/100,000 in 2007 and 9.11/100,000 in 2008 and the reported cases distributed in the whole country. The predominant proportions of rubella cases were <15-years-old children which accounted for 80.94% and 81.85% of total cases in 2007 and 2008 respectively. And the highest number of cases belong to 6-10 age groups, which accounted for 43.24% and 44.13% of total cases in 2007 and 2008 respectively. 1E genotype was the predominant genotype of rubella viruses in China during 2007-2008, and the nucleotide homology of the rubella isolates was 98.1%-100%. The rubella Serology diagnosis, virological and serological surveillance should be strengthened. Practicable vaccine immunization strategy for different age groups should be established to achieve the goal of prevention and control of rubella and congenital rubella syndrome.

  15. Congenital rubella syndrome in a child born to Liberian refugees: clinical and public health perspectives.

    PubMed

    Plotinsky, Rachel N; Talbot, Elizabeth A; Kellenberg, Joan E; Reef, Susan E; Buseman, Sandra K; Wright, Karen D; Modlin, John F

    2007-05-01

    We describe a case of congenital rubella syndrome with typical stigmata in an infant born in New Hampshire to Liberian refugees. The infant's clinical specimens were tested for rubella. Rubella immunity status was sought for contacts. The infant's specimen cultures grew wild-type rubella virus; serum immunoglobulin M and G were positive. Eighteen of 20 contacts were rubella-immune. Family's transit history, mother's vaccination history, and infant's estimated gestational age supported congenital infection acquired overseas. Clinicians should maintain vigilance for congenital rubella syndrome in infants with relevant stigmata, particularly those whose mothers are from countries with nonexistent or recently implemented rubella vaccination programs.

  16. Epidemiology of rubella virus cases in the pre-vaccination era of Ethiopia, 2009-2015.

    PubMed

    Getahun, Mekonen; Beyene, Berhane; Gallagher, Kathleen; Ademe, Ayesheshem; Teshome, Birke; Tefera, Mesfin; Asha, Anjelo; Afework, Aklog; Assefa, Esete; HaileMariam, Yoseph; HaileGiorgis, Yonas; Ketema, Hiwot; Shiferaw, Dejenie; Bekele, Ayenachew; Jima, Daddi; Kebede, Amha

    2016-11-18

    Rubella is a common mild rash illness caused by rubella virus. The majority of infections occur in children and young adults. The infection is the cause of a serious birth defect known as Congenital Rubella Syndrome (CRS) when a woman acquires infection early in pregnancy. Ethiopia has not yet established rubella virus surveillance and has not yet introduced rubella vaccine into the routine immunization program. We characterize the epidemiology of laboratory confirmed rubella virus cases collected through measles surveillance from 2009 to 2015 to better understand the burden of the disease in the country. A descriptive analysis was made to characterize rubella cases reported through the national measles case based surveillance system. The measles case definition was used to capture potential rubella cases. A suspected measles case was a person with generalized rash and fever with cough, or coryza or conjunctivitis. Those cases whose sera were negative for measles IgM antibodies were tested for rubella IgM antibody. A confirmed rubella case was a person who tested positive for rubella IgM. Only laboratory confirmed rubella cases were analyzed in this article. Between 2009 and 2015, a total of 28,284 serum/plasma samples were collected and tested for measles IgM antibody and 11,151 (39.4%) were found positive. A total of 17,066 measles IgM negative or indeterminate samples were tested for rubella virus IgM and 2615 (15.3%) were found positive during the same period. Of 2615 confirmed rubella cases, 52.2% were females. The age of confirmed cases ranged from one month to 42 years with a mean age of 7.3 years. Three-fourth of all confirmed rubella cases were aged less than 10 years. The number of laboratory confirmed rubella cases linearly increased from 83 in 2009 to 856 in 2013 but dropped to 222 and 319 in 2014 and 2015 respectively. Higher number of cases occurred in the hot dry season (January through June) and in the central and western part of Ethiopia with 127 lab-confirmed outbreaks in the study period. Based on our analysis, rubella was found to be endemic throughout Ethiopia. Children below the age of 10 years were the most affected. The burden of rubella cases varied from year to year but had a seasonal peak in March. To better understand the magnitude of rubella prior to vaccine introduction, establishing rubella surveillance system, conducting sero-prevalence studies among child bearing age females and establishing CRS sentinel surveillance among young infants are critical.

  17. Susceptibility of Rubella Among Pregnant Women Attending the Antenatal Clinic in a Tertiary Care Hospital, Jabalpur, Central India.

    PubMed

    Kori, Bhupesh K; Singh, Kavita N; Sharma, Ravendra K; Sharma, Bhagwati S; Badkur, Poorva; Barde, Pradip V

    2017-03-01

    The purpose of this study was to evaluate rubella susceptibility of pregnant women from central India as rubella infection can be devastating for the newborn if it occurs in the mother in the first trimester of pregnancy, which may lead to congenital rubella syndrome (CRS). There are very few studies about seroprevalence of rubella from India and none from central India. The study was conducted among women attending the obstetric department of a tertiary care hospital, in which 369 antenatal cases were tested for the presence of immunoglobulin G antibody for rubella and its titer. Data were analyzed using statistical tests. A total of 141 (38.2%) women were found susceptible to rubella. There was no significant difference in rubella susceptibility among different socioeconomic classes, ages, and gravidity. A large proportion of pregnant women were found to be rubella susceptible, posing immense threat of CRS to their newborns. A robust program for rubella immunization targeting young adult women is needed to avoid CRS.

  18. Rubella in Poland in 2013.

    PubMed

    Korczyńska, Monika Roberta; Paradowska-Stankiewicz, Iwona

    2015-01-01

    In 2004, Poland has adopted the WHO goal of rubella elimination and congenital rubella syndrome prevention. The main target of the Programme is to stop transmission of the virus in the environment and prevention of congenital rubella in children. This can be achieved by carrying out the vaccination. Participation in the rubella elimination program requires clinical diagnosis of rubella cases and their confirmation with laboratory test. In Poland, until 2003, national vaccination recommendation included a dose of rubella vaccine only for girls aged 13 years. Among men, the incidence of measles remained high creating a risk of infection of non-immune pregnant women which may lead to the development of congenital rubella syndrome in the child. To assess epidemiological situation of rubella in Poland in 2013, including vaccination coverage in Polish population. The descriptive analysis was based on data retrieved from routine mandatory surveillance system and published in the annual bulletins "Infectious diseases and poisonings in Poland in 2013" and "Vaccinations in Poland in 2013" (MP. Czarkowski, Warszawa 2014, NIZP-PZH, GIS). In 2013, there was big epidemic of rubella in Poland--with 38,548 registered cases (6 times more than in 2012), incidence 84.4 per 100,000 (5 times higher than in the previous year). The highest incidence rate, regardless of gender and the environment, was observed among adolescents aged 15-19 years (911.6 per 100,000). The incidence of rubella in boys and men was significantly higher than the incidence in girls and women (181.4 versus 23.9). In 2013, two cases of congenital rubella syndrome were registered. Rubella epidemic which occurred in Poland in 2013 was the result of use in the past vaccination against rubella only for girls 13 years of age. The proportion of laboratory tests confirming/excluding rubella infection is still very low in Poland. In 2013, only 0.2% of rubella cases were laboratory confirmed.

  19. An epidemiological assessment towards elimination of rubella and congenital rubella syndrome in Singapore.

    PubMed

    Chua, Ying Xian; Ang, Li Wei; Low, Constance; James, Lyn; Cutter, Jeffery L; Goh, Kee Tai

    2015-06-17

    In line with regional and global goals for the elimination of rubella and congenital rubella syndrome (CRS), we reviewed the epidemiological situation in Singapore, based on surveillance reports on rubella and CRS, national immunization coverage and seroprevalence surveys. The aim of our review was to identify current gaps and steps taken to achieve the targets set by the World Health Organization (WHO) Western Pacific Regional Office (WPRO). Epidemiological data on clinical and laboratory-confirmed rubella cases, including CRS, notified to the Communicable Diseases Division, Ministry of Health, Singapore, from 2003 to 2013 were collated and analyzed. Vaccination coverage against rubella was obtained from the National Immunization Registry and School Health Services of the Health Promotion Board. The changing prevalence of rubella was determined from periodic serological surveys. The incidence of indigenous rubella cases per million population decreased from 37.2 in 2008 to 7.6 in 2013 and there had been no indigenous case of CRS in 2012 and 2013. Therapeutic abortions performed due to rubella infections had become uncommon. The annual measles, mumps, and rubella (MMR) vaccination coverage in childhood population remained high ranging from 93% to 96%. The overall susceptibility to rubella in women aged 18-44 years had reduced significantly from 15.8% in 2004 to 11.0% in 2010. The prevalence of IgG antibody against rubella among Singapore children aged 1-17 years was maintained at 87.3% in 2008-2010. All available data indicated that Singapore has made good progress towards the elimination of rubella and CRS. It has attained the targets set by the WHO WPRO for 2015. In preparation for verification of rubella elimination, an enhanced surveillance system has been implemented to ensure that all reported cases are laboratory confirmed, and genotyping of rubella virus strains isolated is carried out to provide evidence for interruption of endemic transmission. Copyright © 2015. Published by Elsevier Ltd.

  20. Rubella elimination programme strengthened through measles elimination programme in Catalonia.

    PubMed

    Domínguez, Angela; Torner, Nuria; Martínez, Ana; Costa, Josep; Plans, Pere; Ciruela, Pilar; Salleras, Lluís

    2006-02-27

    The drastic fall in rubella cases recorded in Catalonia from 1988 on, when the second dose of Measles-Mumps-Rubella (MMR) vaccine was implemented, and especially from 1998, when the measles elimination programme began, led to the introduction, in May 2002, of the rubella and congenital rubella syndrome elimination by 2005 programme. From May 2002 to May 2004, 13 suspected rubella cases were reported to the Statutory Disease Reporting System; of these, one postnatal case and one congenital rubella case were confirmed (15.4%), both being imported cases. Through the screening of viruses established in the measles elimination programme, 28 possible cases were analyzed and six (21.4%) confirmed imported postnatal rubella cases were detected. The small number and imported nature of the cases of rubella and the detection of the majority of the confirmed cases through the measles elimination programme, strongly suggests that both programmes should continue.

  1. Rubella virus genotypes in the People's Republic of China between 1979 and 2007: a shift in endemic viruses during the 2001 Rubella Epidemic.

    PubMed

    Zhu, Zhen; Abernathy, Emily; Cui, Aili; Zhang, Yan; Zhou, Shujie; Zhang, Zhenying; Wang, Changyin; Wang, Tongzhan; Ling, Hua; Zhao, Chunfang; Chen, Yingqiong; He, Jilan; Sun, Li; Chen, Xia; Tang, Jihai; Feng, Daxin; Wang, Yan; Ba, Zhuoma; Fan, Lixia; Chen, Haiyun; Pan, Zhengfan; Zhan, Jun; Chen, Hui; Zhou, Shunde; Zheng, Lei; Gao, Hui; Liang, Yong; Dai, Defang; Icenogle, Joseph; Xu, Wenbo

    2010-05-01

    The incidence of rubella cases in China from 1991 to 2007 was reviewed, and the nucleotide sequences from 123 rubella viruses collected during 1999 to 2007 and 4 viral sequences previously reported from 1979 to 1984 were phylogenetically analyzed. Rubella vaccination was not included in national immunization programs in China before 2007. Changes in endemic viruses were compared with incidences of rubella epidemics. The results showed that rubella epidemics occur approximately every 6 to 8 years (1993/1994, 2001, and 2007), and a shift of disease burden to susceptible young adults was observed. The Chinese rubella virus sequences were categorized into 5 of the 13 rubella virus genotypes, 1a, 1E, 1F, 2A, and 2B; cocirculations of these different genotypes were found in China. In Anhui province, a shift in the predominant genotype from 1F and 2B to 1E coincided with the 2001 rubella epidemic. This shift may have occurred throughout China during 2001 to 2007. This study investigated the genotype distribution of rubella viruses in China over a 28-year period to establish an important genetic baseline in China during its prevaccination era.

  2. Rubella in Poland in 2012.

    PubMed

    Rogalska, Justyna

    2014-01-01

    In 2004, Poland has adopted the WHO goal of rubella elimination and congenital rubella syndrome prevention. Participation in the rubella elimination program requires clinical diagnosis of rubella to be confirmed with laboratory test. In Poland, until 2003, national vaccination recommendation included a dose of rubella vaccine only for girls aged 13 years. Among men, the incidence of measles remained high creating a risk of infection of non-immune pregnant women which may lead to the development of congenital rubella syndrome in the child. To assess epidemiological situation of rubella in Poland in 2012, including vaccination coverage in Polish population. The descriptive analysis was based on data retrieved from routine mandatory surveillance system and published in the annual bulletins "Infectious diseases and poisonings in Poland in 2012" and "Vaccinations in Poland in 2012". In 2012, there was a significant increase in the number of cases of rubella - 6 263 cases (in 2011, 4 290 cases) - and the increase in incidence (from 11.1 per 100 thousand. 16.3). The highest incidence rate, regardless of gender and the environment, was observed among adolescents aged 15-19 years (118.0 per 100 000). As in 2011, the incidence of rubella in boys and men was higher than the incidence in girls and women (25.6 versus 7.5). In 2012, no cases of congenital rubella syndrome were registered. The proportion of laboratory tests confirming/excluding rubella infection is still very low in Poland. In 2012, only 0.2% of rubella cases were laboratory confirmed.

  3. Rubella in Poland in 2014

    PubMed

    Paradowska-Stankiewicz, Iwona; Rogalska, Justyna; Polkowska, Aleksandra

    2016-01-01

    In 2004, Poland has adopted the WHO goal of rubella elimination and congenital rubella syndrome prevention. The main target of the Programme is to stop transmission of the virus in the environment and prevention of congenital rubella in children. In Poland participation in the rubella elimination program requires clinical diagnosis of rubella cases and their confirmation with laboratory tests. Vaccination against rubella was introduced in 1987, initially only in 13 - year-old girls. Since 2003, single jab vaccination against rubella, measles and mumps is used (MMR vaccine for all children: primary vaccination at the age 13-15 months and a booster vaccination at the age of 10). To assess epidemiological situation of rubella in Poland in 2014, including vaccination coverage in Polish population. The descriptive analysis was based on data retrieved from routine mandatory surveillance system and published in the annual bulletins “Infectious diseases and poisonings in Poland in 2014” and “Vaccinations in Poland in 2014” (MP. Czarkowski, Warszawa 2014, NIZP-PZH, GIS). In 2014, there was a significant decrease in the number of rubella cases - with registered 5891 cases (in 2013 - 38 548 cases) - and a decline in incidence (from 101.1 per 100 000 to 15.3). The highest incidence, regardless of gender and the environment was observed in the age group 5-6 years (respectively 93.8 and 109.4 per 100 000). Similarly to 2013, rubella incidence of males was higher than the incidence in girls and women (20.0 versus 10.9). In 2014, no cases of congenital rubella syndrome were registered. The proportion of laboratory tests confirming/excluding rubella infection is still very low in Poland. In 2014, only 0.6% of rubella cases were laboratory confirmed.

  4. Development of an improved RT-LAMP assay for detection of currently circulating rubella viruses.

    PubMed

    Abo, H; Okamoto, K; Anraku, M; Otsuki, N; Sakata, M; Icenogle, J; Zheng, Q; Kurata, T; Kase, T; Komase, K; Takeda, M; Mori, Y

    2014-10-01

    Rubella virus is the causative agent of rubella. The symptoms are usually mild, and characterized by a maculopapular rash and fever. However, rubella infection in pregnant women sometimes can result in the birth of infants with congenital rubella syndrome (CRS). Global efforts have been made to reduce and eliminate CRS. Although a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for detection of rubella virus has been reported, the primers contained several mismatched nucleotides with the genomes of currently circulating rubella virus strains. In the present study, a new RT-LAMP assay was established. The detection limit of this assay was 100-1000PFU/reaction of viruses for all rubella genotypes, except for genotype 2C, which is not commonly found in the current era. Therefore, the new RT-LAMP assay can successfully detect all current rubella virus genotypes, and does not require sophisticated devices like TaqMan real-time PCR systems. This assay should be a useful assay for laboratory diagnosis of rubella and CRS. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Rubella virus as a possible etiological agent of Fuchs heterochromic iridocyclitis.

    PubMed

    Suzuki, Jun; Goto, Hiroshi; Komase, Katsuhiro; Abo, Hitoshi; Fujii, Kaoru; Otsuki, Noriyuki; Okamoto, Kiyoko

    2010-10-01

    To determine whether rubella virus is involved in the pathogenesis of Fuchs heterochromic iridocyclitis (FHI). Fourteen patients (14 eyes) diagnosed with FHI based on characteristic ocular manifestations and eight control subjects were studied. Aqueous humor (AH) samples from 14 FHI patients and one vitreous sample from a FHI patient were analyzed for intraocular antibody production against rubella virus by calculation of the Goldmann-Witmer coefficient (GWC). Viral detection by nested polymerase chain reaction and isolation by culture in RK-13 cells were conducted in nine FHI patients. In addition to laboratory examinations, medical history of rubella virus vaccination was also obtained. Ten patients with FHI examined showed intraocular synthesis of rubella virus antibodies (GWC > 3). A high index of rubella virus antibody production was also found in the vitreous sample (GWC = 30.6). GWC in all control subjects were below detectable level. The rubella genome was detected in two of nine patients, and rubella virus was isolated from one of nine patients with FHI. None of the patients with FHI had been vaccinated against rubella. Our laboratory data strongly suggest a relationship between FHI and rubella virus.

  6. Rubella

    PubMed Central

    Lambert, Nathaniel; Strebel, Peter; Orenstein, Walter; Icenogle, Joseph; Poland, Gregory A.

    2015-01-01

    Rubella remains an important pathogen globally with approximately 100,000 cases of congenital rubella syndrome estimated to occur each year. Rubella vaccine is highly effective and safe when used across a population and, as a result, endemic rubella transmission has been interrupted in the Americas since 2009. Incomplete rubella vaccination programs result in continued disease transmission as evidenced by recent large outbreaks in Japan and elsewhere. Herein, we provide current results regarding rubella control, elimination and eradication policies, and a brief review of new laboratory diagnostics. In addition, we provide novel information regarding rubella vaccine immunogenetics and review the emerging evidence of inter-individual variability in humoral and cell-mediated innate and adaptive immune responses to rubella vaccine and their association with HLA alleles, haplotypes, and single nucleotide polymorphisms across the human genome. Finally, we conclude with a call for further research in rubella vaccine immunogenetics and its ability to inform a vaccinomics-level approach to novel vaccine candidate development and the need for a next generation vaccine that is affordable, easy to administer, and does not require a cold chain for optimal immunogenicity. PMID:25576992

  7. Characterization of the Risks of Adverse Outcomes Following Rubella Infection in Pregnancy.

    PubMed

    Thompson, Kimberly M; Simons, Emily A; Badizadegan, Kamran; Reef, Susan E; Cooper, Louis Z

    2016-07-01

    Although most infections with the rubella virus result in relatively minor sequelae, rubella infection in early pregnancy may lead to severe adverse outcomes for the fetus. First recognized in 1941, congenital rubella syndrome (CRS) can manifest with a diverse range of symptoms, including congenital cataracts, glaucoma, and cardiac defects, as well as hearing and intellectual disability. The gestational age of the fetus at the time of the maternal rubella infection impacts the probability and severity of outcomes, with infection in early pregnancy increasing the risks of spontaneous termination (miscarriage), fetal death (stillbirth), birth defects, and reduced survival for live-born infants. Rubella vaccination continues to change the epidemiology of rubella and CRS globally, but no models currently exist to evaluate the economic benefits of rubella management. This systematic review provides an overall assessment of the weight of the evidence for the outcomes associated with rubella infections in the first 20 weeks of pregnancy. We identified, evaluated, and graded 31 studies (all from developed countries) that reported on the pregnancy outcomes of at least 30 maternal rubella infections. We used the available evidence to estimate the increased risks of spontaneous termination, fetal death, infant death, and CRS as a function of the timing of rubella infection in pregnancy and decisions about induced termination. These data support the characterization of the disability-adjusted life years for outcomes associated with rubella infection in pregnancy. We find significant impacts associated with maternal rubella infections in early pregnancy, which economic analyses will miss if they only focus on live births of CRS cases. Our estimates of fetal loss from increased induced terminations due to maternal rubella infections provide context that may help to explain the relatively low numbers of observed CRS cases per year despite potentially large burdens of disease. Our comprehensive review of the weight of the evidence of all pregnancy outcomes demonstrates the importance of including all outcomes in models that characterize rubella-related disease burdens and costs. © 2014 Society for Risk Analysis.

  8. Vaccination in secondary school students expedites rubella control and prevents congenital rubella syndrome.

    PubMed

    He, Hanqing; Yan, Rui; Tang, Xuewen; Zhou, Yang; Deng, Xuan; Xie, Shuyun

    2016-11-30

    In order to control the spread of rubella and reduce the risk for congenital rubella syndrome, an additional rubella vaccination program was set up for all secondary school students since 2008 in Zhejiang, China. We conducted a descriptive analysis of rubella incidence among different age groups from 2005 to 2015 and a serosurvey of female subjects aged 15-39 years to understand the possible effects of this immunization program. The average annual rubella incidence rate had decreased from 15.86 per 100,000 population (2005-2007) to 0.75 per 100,000 population (2013-2015) in Zhejiang. The decrease in the rate of rubella incidence in girls aged 15-19 years was more accelerated (from 138.30 to 0.34 per 100,000) than in the total population during 2008-2015 (from 32.20 to 0.46 per 100,000). Of 1225 female subjects in the serosurvey, 256 (20.9%) were not immune to rubella. The proportion of subjects immune to rubella was significantly different among different age groups (Wald χ2 = 22.19, p = 0.000), and subjects aged 15-19 years old had the highest immunity (88.0%). Rubella antibody levels were significantly lower in women aged 25-30 years with 26.7% of them not immune, followed by the group aged 20-24 years (25.0%) and 30-35 years (24.5%). Rubella vaccine included in the Expanded Program on Immunization together with vaccination activities for secondary school students can help in rubella control, particularly in targeted age groups in the program. Seroprevalence of antibodies to the rubella virus amongst the female population within childbearing age in Zhejiang, China, is still too low to provide immunity. In addition to vaccination programs in the secondary schools, rubella vaccination should also be encouraged in women of childbearing age, which can be done effectively combined with pre-marital examination in China.

  9. About Rubella (German Measles, Three-Day Measles)

    MedlinePlus

    ... Professionals Pregnancy and Rubella Rubella Vaccination Travelers’ Health Information on Rubella Laboratory Testing CDC Laboratory Testing & Procedures Serology RNA Detection Genetic Analysis Specimen Collection, Storage, & Shipment Sample Submission Q&A ...

  10. Rubella (German Measles, Three-Day Measles) Photos

    MedlinePlus

    ... Professionals Pregnancy and Rubella Rubella Vaccination Travelers’ Health Information on Rubella Laboratory Testing CDC Laboratory Testing & Procedures Serology RNA Detection Genetic Analysis Specimen Collection, Storage, & Shipment Sample Submission Q&A ...

  11. Case based rubella surveillance in Abia State, South East Nigeria, 2007-2011.

    PubMed

    Umeh, Chukwuemeka Anthony; Onyi, Stella Chioma

    2014-01-01

    Introduction. Rubella infection has the potential of causing severe fetal birth defects collectively called congenital rubella syndrome (CRS) if the mother is infected early in pregnancy. However, little is known about rubella and CRS epidemiology in Nigeria and rubella vaccines are still not part of routine childhood immunization in Nigeria. Methods. Analysis of confirmed cases of rubella in Abia State, Nigeria from 2007 to 2011 detected through Abia State Integrated Disease Surveillance and Response system. Results. Of the 757 febrile rash cases, 81(10.7%) tested positive for rubella immunoglobulin M (IgM). New rubella infection decreased from 6.81/1,000,000 population in 2007 to 2.28/1,000,000 in 2009 and increased to 6.34/1,000,000 in 2011. The relative risk of rubella was 1.5 (CI [0.98-2.28]) times as high in females compared to males and 1.6 times (CI [0.90-2.91]) as high in rural areas compared to urban areas. Eighty six percent of rubella infections occurred in children less than 15 years with a high proportion of cases occurring between 5 and 14 years. Conclusion. Rubella infection in Abia State, Nigeria is predominantly in those who are younger than 15 years old. It is also more prevalent in females and in those living in rural areas of the state. Unfortunately, there is no surveillance of CRS in Nigeria and so the public health impact of rubella infection in the state is not known. Efforts should be made to expand the rubella surveillance in Nigeria to incorporate surveillance for CRS.

  12. Rubella Virus Genotypes in the People's Republic of China between 1979 and 2007: a Shift in Endemic Viruses during the 2001 Rubella Epidemic▿ †

    PubMed Central

    Zhu, Zhen; Abernathy, Emily; Cui, Aili; Zhang, Yan; Zhou, Shujie; Zhang, Zhenying; Wang, Changyin; Wang, Tongzhan; Ling, Hua; Zhao, Chunfang; Chen, Yingqiong; He, Jilan; Sun, Li; Chen, Xia; Tang, Jihai; Feng, Daxin; Wang, Yan; Ba, Zhuoma; Fan, Lixia; Chen, Haiyun; Pan, Zhengfan; Zhan, Jun; Chen, Hui; Zhou, Shunde; Zheng, Lei; Gao, Hui; Liang, Yong; Dai, Defang; Icenogle, Joseph; Xu, Wenbo

    2010-01-01

    The incidence of rubella cases in China from 1991 to 2007 was reviewed, and the nucleotide sequences from 123 rubella viruses collected during 1999 to 2007 and 4 viral sequences previously reported from 1979 to 1984 were phylogenetically analyzed. Rubella vaccination was not included in national immunization programs in China before 2007. Changes in endemic viruses were compared with incidences of rubella epidemics. The results showed that rubella epidemics occur approximately every 6 to 8 years (1993/1994, 2001, and 2007), and a shift of disease burden to susceptible young adults was observed. The Chinese rubella virus sequences were categorized into 5 of the 13 rubella virus genotypes, 1a, 1E, 1F, 2A, and 2B; cocirculations of these different genotypes were found in China. In Anhui province, a shift in the predominant genotype from 1F and 2B to 1E coincided with the 2001 rubella epidemic. This shift may have occurred throughout China during 2001 to 2007. This study investigated the genotype distribution of rubella viruses in China over a 28-year period to establish an important genetic baseline in China during its prevaccination era. PMID:20351211

  13. Rubella Surveillance and Diagnostic Testing among a Low-Prevalence Population, New York City, 2012–2013

    PubMed Central

    Zucker, Jane R.; Giancotti, Francesca R.; Abernathy, Emily; Icenogle, Joseph; Rakeman, Jennifer L.; Rosen, Jennifer B.

    2017-01-01

    ABSTRACT The New York City Department of Health and Mental Hygiene (DOHMH) receives clinical and laboratory reports for rubella. Because rubella immunoglobulin M (IgM) assays may produce false-positive results and rubella infections may be asymptomatic, interpretation of positive IgM results can be challenging. Rubella reports received by DOHMH in 2012 to 2013 were reviewed. The rubella IgM testing purpose was determined through case investigation. Results of IgM testing by indirect enzyme-linked immunosorbent assay (ELISA) and capture enzyme immunoassay (EIA) were compared to determine positive predictive value (PPV) and specificity. DOHMH received 199 rubella reports; 2 were true cases. Of all reports, 77.9% were tested for rubella IgM erroneously, 19.6% were tested for diagnostic purposes, 2.0% had unknown test purpose, and 0.5% were not tested. PPV of indirect ELISA was 6% overall, 14% for diagnostic tests, and 0% for tests ordered erroneously. PPV of capture EIA was 29% overall, 50% for diagnostic tests, and 0% for tests ordered erroneously. Overall, specificity was 52% for indirect ELISA and 85% for capture EIA. Limiting rubella IgM testing to patients for whom rubella diagnosis is suspected and using a more specific IgM assay have the potential to reduce false-positive rubella IgM results. PMID:28701468

  14. Cryo-Electron Tomography of Rubella Virus

    PubMed Central

    Battisti, Anthony J.; Yoder, Joshua D.; Plevka, Pavel; Winkler, Dennis C.; Mangala Prasad, Vidya; Kuhn, Richard J.; Frey, Teryl K.; Steven, Alasdair C.

    2012-01-01

    Rubella virus is the only member of the Rubivirus genus within the Togaviridae family and is the causative agent of the childhood disease known as rubella or German measles. Here, we report the use of cryo-electron tomography to examine the three-dimensional structure of rubella virions and compare their structure to that of Ross River virus, a togavirus belonging the genus Alphavirus. The ectodomains of the rubella virus glycoproteins, E1 and E2, are shown to be organized into extended rows of density, separated by 9 nm on the viral surface. We also show that the rubella virus nucleocapsid structure often forms a roughly spherical shell which lacks high density at its center. While many rubella virions are approximately spherical and have dimensions similar to that of the icosahedral Ross River virus, the present results indicate that rubella exhibits a large degree of pleomorphy. In addition, we used rotation function calculations and other analyses to show that approximately spherical rubella virions lack the icosahedral organization which characterizes Ross River and other alphaviruses. The present results indicate that the assembly mechanism of rubella virus, which has previously been shown to differ from that of the alphavirus assembly pathway, leads to an organization of the rubella virus structural proteins that is different from that of alphaviruses. PMID:22855483

  15. Cryo-electron tomography of rubella virus.

    PubMed

    Battisti, Anthony J; Yoder, Joshua D; Plevka, Pavel; Winkler, Dennis C; Prasad, Vidya Mangala; Kuhn, Richard J; Frey, Teryl K; Steven, Alasdair C; Rossmann, Michael G

    2012-10-01

    Rubella virus is the only member of the Rubivirus genus within the Togaviridae family and is the causative agent of the childhood disease known as rubella or German measles. Here, we report the use of cryo-electron tomography to examine the three-dimensional structure of rubella virions and compare their structure to that of Ross River virus, a togavirus belonging the genus Alphavirus. The ectodomains of the rubella virus glycoproteins, E1 and E2, are shown to be organized into extended rows of density, separated by 9 nm on the viral surface. We also show that the rubella virus nucleocapsid structure often forms a roughly spherical shell which lacks high density at its center. While many rubella virions are approximately spherical and have dimensions similar to that of the icosahedral Ross River virus, the present results indicate that rubella exhibits a large degree of pleomorphy. In addition, we used rotation function calculations and other analyses to show that approximately spherical rubella virions lack the icosahedral organization which characterizes Ross River and other alphaviruses. The present results indicate that the assembly mechanism of rubella virus, which has previously been shown to differ from that of the alphavirus assembly pathway, leads to an organization of the rubella virus structural proteins that is different from that of alphaviruses.

  16. Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

    PubMed

    Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

    2018-01-30

    Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  17. Health economics of rubella: a systematic review to assess the value of rubella vaccination

    PubMed Central

    2013-01-01

    Background Most cases of rubella and congenital rubella syndrome (CRS) occur in low- and middle-income countries. The World Health Organization (WHO) has recently recommended that countries accelerate the uptake of rubella vaccination and the GAVI Alliance is now supporting large scale measles-rubella vaccination campaigns. We performed a review of health economic evaluations of rubella and CRS to identify gaps in the evidence base and suggest possible areas of future research to support the planned global expansion of rubella vaccination and efforts towards potential rubella elimination and eradication. Methods We performed a systematic search of on-line databases and identified articles published between 1970 and 2012 on costs of rubella and CRS treatment and the costs, cost-effectiveness or cost-benefit of rubella vaccination. We reviewed the studies and categorized them by the income level of the countries in which they were performed, study design, and research question answered. We analyzed their methodology, data sources, and other details. We used these data to identify gaps in the evidence and to suggest possible future areas of scientific study. Results We identified 27 studies: 11 cost analyses, 11 cost-benefit analyses, 4 cost-effectiveness analyses, and 1 cost-utility analysis. Of these, 20 studies were conducted in high-income countries, 5 in upper-middle income countries and two in lower-middle income countries. We did not find any studies conducted in low-income countries. CRS was estimated to cost (in 2012 US$) between $4,200 and $57,000 per case annually in middle-income countries and up to $140,000 over a lifetime in high-income countries. Rubella vaccination programs, including the vaccination of health workers, children, and women had favorable cost-effectiveness, cost-utility, or cost-benefit ratios in high- and middle-income countries. Conclusions Treatment of CRS is costly and rubella vaccination programs are highly cost-effective. However, in order for research to support the global expansion of rubella vaccination and the drive towards rubella elimination and eradication, additional studies are required in low-income countries, to tackle methodological limitations, and to determine the most cost-effective programmatic strategies for increased rubella vaccine coverage. PMID:23627715

  18. Health economics of rubella: a systematic review to assess the value of rubella vaccination.

    PubMed

    Babigumira, Joseph B; Morgan, Ian; Levin, Ann

    2013-04-29

    Most cases of rubella and congenital rubella syndrome (CRS) occur in low- and middle-income countries. The World Health Organization (WHO) has recently recommended that countries accelerate the uptake of rubella vaccination and the GAVI Alliance is now supporting large scale measles-rubella vaccination campaigns. We performed a review of health economic evaluations of rubella and CRS to identify gaps in the evidence base and suggest possible areas of future research to support the planned global expansion of rubella vaccination and efforts towards potential rubella elimination and eradication. We performed a systematic search of on-line databases and identified articles published between 1970 and 2012 on costs of rubella and CRS treatment and the costs, cost-effectiveness or cost-benefit of rubella vaccination. We reviewed the studies and categorized them by the income level of the countries in which they were performed, study design, and research question answered. We analyzed their methodology, data sources, and other details. We used these data to identify gaps in the evidence and to suggest possible future areas of scientific study. We identified 27 studies: 11 cost analyses, 11 cost-benefit analyses, 4 cost-effectiveness analyses, and 1 cost-utility analysis. Of these, 20 studies were conducted in high-income countries, 5 in upper-middle income countries and two in lower-middle income countries. We did not find any studies conducted in low-income countries. CRS was estimated to cost (in 2012 US$) between $4,200 and $57,000 per case annually in middle-income countries and up to $140,000 over a lifetime in high-income countries. Rubella vaccination programs, including the vaccination of health workers, children, and women had favorable cost-effectiveness, cost-utility, or cost-benefit ratios in high- and middle-income countries. Treatment of CRS is costly and rubella vaccination programs are highly cost-effective. However, in order for research to support the global expansion of rubella vaccination and the drive towards rubella elimination and eradication, additional studies are required in low-income countries, to tackle methodological limitations, and to determine the most cost-effective programmatic strategies for increased rubella vaccine coverage.

  19. Facts about Rubella for Adults

    MedlinePlus

    ... rubella-containing vaccine or other acceptable evidence of immunity to rubella. College and university students, healthcare personnel, ... MMR vaccine or have other acceptable evidence of immunity to rubella, regardless of age, to ensure adequate ...

  20. Status of global virologic surveillance for rubella viruses.

    PubMed

    Abernathy, Emily S; Hübschen, Judith M; Muller, Claude P; Jin, Li; Brown, David; Komase, Katsuhiro; Mori, Yoshio; Xu, Wenbo; Zhu, Zhen; Siqueira, Marilda M; Shulga, Sergey; Tikhonova, Nina; Pattamadilok, Sirima; Incomserb, Patcha; Smit, Sheilagh B; Akoua-Koffi, Chantal; Bwogi, Josephine; Lim, Wilina W L; Woo, Gibson K S; Triki, Hinda; Jee, Youngmee; Mulders, Mick N; de Filippis, Ana Maria Bispo; Ahmed, Hinda; Ramamurty, Nalini; Featherstone, David; Icenogle, Joseph P

    2011-07-01

    The suspected measles case definition captures rubella cases. Therefore, measles surveillance will be improved in the course of the control and eventual elimination of rubella transmission. One aspect of rubella control, virologic surveillance, is reviewed here. A systematic nomenclature for rubella viruses (RVs) based on 13 genotypes has been established and is updated when warranted by increases in information about RVs. From 2005 through 2010, the genotypes of RVs most frequently reported were 1E, 1G, and 2B, and genotypes 1a, 1B, 1C, 1h, 1j, and 2C were less frequently reported. Virologic surveillance can support rubella control and elimination. Synopses of rubella virologic surveillance in various countries, regions, and globally are given, including characterization of viruses from imported cases in a country that has eliminated rubella and studies of endemic viruses circulating in countries without rubella control objectives. Current challenges are discussed. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2011.

  1. Epidemiological and molecular characterization of rubella virus isolated in São Paulo, Brazil during 1997-2004.

    PubMed

    Figueiredo, C A; Oliveira, M I; Curti, S P; Afonso, A M S; Frugis Yu, A L; Araújo, J; Oliveira, D B; Durigon, E L

    2012-11-01

    Rubella virus (RV) infection during the early stages of pregnancy can lead to serious birth defects, known as the congenital rubella syndrome (CRS). In 2003, the Pan American Health Organization (PAHO) adopted a resolution calling for the elimination of rubella and the congenital rubella syndrome (CRS) in the Americas by the year 2010. Brazil will have implemented the recommended PAHO strategy for elimination and interruption of endemic rubella virus transmission. The characterization of genotypes during the final stages of rubella elimination is important for determining whether new rubella isolates represent endemic transmission or importations. Samples (blood, urine, cerebrospinal fluid, and throat swabs) collected from patients with symptoms suggestive of rubella infection in 1997-2004 were isolated in cell culture and genotyped. Twenty-eight sequences were analyzed and two genotypes were identified: 1a and 1G. The information reported in this paper will contribute to understanding the molecular epidemiology of RV in São Paulo, Brazil. Copyright © 2012 Wiley Periodicals, Inc.

  2. Survey of rubella knowledge and acceptability of rubella vaccination among Brazilian adults prior to mass vaccination.

    PubMed

    Vieira, Juliana Costa; Carvalho, Marlene Tavares Barros de; Checchia, Ricardo L; Trombiere, Marcier; Flannery, Brendan

    2011-10-01

    Evaluate knowledge of rubella and acceptability of vaccination and identify sources of health information among brazilian adults to inform communication strategies for a national vaccination campaign to eliminate rubella and congenital rubella syndrome (CRS). From 5-8 July 2008 a qualitative telephone survey was conducted among a nonprobabilistic sample of brazilian adults 18 to 65 years of age (n = 1 023) from all five geographic regions of Brazil to measure knowledge of rubella and willingness to receive the vaccine and to identify sources of health information. Frequencies of responses were stratified by respondents' sex, age, education, and income. Although 69.9% of respondents said they knew what rubella was, actual knowledge of the disease was limited, with only 29.9% answering affirmatively when asked if they would recognize symptoms of rubella infection. Self-reported knowledge increased with increasing age, education, and income, and was higher among women than men. A total of 94.5% of the respondents expressed willingness to be vaccinated for rubella elimination. The most frequently mentioned sources of health information were television and doctors. Despite limited knowledge of rubella, brazilian adults expressed willingness to be vaccinated for disease elimination.

  3. Imported Genotype 2B Rubella Virus Caused the 2012 Outbreak in Anqing City, China.

    PubMed

    Zhu, Zhen; Pan, Guixia; Zhou, Shujie; Dai, Jingjing; Chen, Xia; Tang, Jihai; Chen, Shuping; Zheng, Yilun; Song, Jie; Xu, Wenbo

    2015-01-01

    A rubella outbreak occurred in Anqing city of Anhui province, China, from February to July of 2012, and a total of 241 clinically diagnosed or lab-confirmed patients were reported. The highest number of rubella cases during this outbreak was recorded in teenagers between 10 and 19 years of age who had not previously received the rubella vaccine. Genotyping results indicated that the genotype 2B rubella virus (RV) was responsible for the outbreak. However, a phylogenetic analysis showed that the genotype 2B RVs isolated in Anqing City were not related to 2B RVs found in other cities of Anhui province and in other provinces of China, thus providing evidence for importation. After importation, the transmission of Anqing RVs was interrupted owing to an effective immunization campaign against rubella, suggesting the timeliness and effectiveness of contingency vaccination. Strengthening rubella surveillance, including the integration of epidemiologic information and laboratory data, is a vital strategy for rubella control and elimination. In addition, except for routine immunization, targeted supplementary immunization activities aimed at susceptible groups according to sero-epidemiological surveillance data also play a key role in stopping the continuous transmission of rubella viruses and in preventing further congenital rubella syndrome cases.

  4. Persistence of Immunity Acquired after a Single Dose of Rubella Vaccine in Japan.

    PubMed

    Okafuji, Takao; Okafuji, Teruo; Nakayama, Tetsuo

    2016-05-20

    To date, Takahashi, Matsuura, and TO-336 strains of live-attenuated rubella vaccine have been used in Japan. Japan implemented a single-dose rubella vaccination program until 2006. However, few reports are available on the persistence of immunity after this vaccination program. We collected 276 serum samples from January 2009 to December 2011 at Okafuji Pediatric Clinic and assessed the immune status of these samples against rubella virus during 1-10 years after vaccination with a single dose of Takahashi rubella vaccine. Regional outbreak of rubella did not occur during 1999-2011. The collected serum samples were tested for antibodies against the rubella virus by performing a standard hemagglutination inhibition (HAI) test. Our results showed that all the tested serum samples contained antibodies against the rubella virus 10 years after the vaccination. Geometric mean titer of HAI antibodies was 1:180 and decreased to 1:68 at 10 years after the vaccination. The levels of HAI antibodies decreased logarithmically with time after the vaccination. In conclusion, vaccine-acquired immunity after vaccination with a single dose of live-attenuated Takahashi rubella vaccine was retained for at least 10 years when rubella was under regional control.

  5. External Quality Assessment for Rubella Virus RNA Detection Using Armored RNA in China.

    PubMed

    Zhang, D; Lin, G; Yi, L; Hao, M; Fan, G; Yang, X; Peng, R; Ding, J; Zhang, K; Zhang, R; Li, J

    2017-02-01

    Although tremendous efforts have been made to reduce rubella incidence, there are still 300 new cases of congenital rubella syndrome daily; thus, rubella infections remain one of the leading causes of preventable congenital birth defects. An effective surveillance system, which could be achieved and maintained by using an external quality assessment program, is critical for prevention and control of this disease. Armored RNAs, which are noninfectious and RNase-resistant, were used for encapsulation of the E1 gene of rubella virus and for preparation of a 10-specimen panel for external quality assessment. Thirty-two laboratories across mainland China that used nucleic acid tests for rubella virus RNA detection were included in the external quality assessment program organized by the National Center for Clinical Laboratories of China. Different kinds of commercial kits were used by the laboratories for nucleic acid extraction and TaqMan real-time reverse-transcription PCR for rubella virus RNA detection; 99.2% sensitivity and 100% specificity were achieved in this external quality assessment program. Most of the participating laboratories obtained accurate results for rubella nucleic acid tests, thereby achieving the quality required for regional rubella and congenital rubella syndrome elimination.

  6. Case based rubella surveillance in Abia State, South East Nigeria, 2007–2011

    PubMed Central

    Umeh, Chukwuemeka Anthony

    2014-01-01

    Introduction. Rubella infection has the potential of causing severe fetal birth defects collectively called congenital rubella syndrome (CRS) if the mother is infected early in pregnancy. However, little is known about rubella and CRS epidemiology in Nigeria and rubella vaccines are still not part of routine childhood immunization in Nigeria. Methods. Analysis of confirmed cases of rubella in Abia State, Nigeria from 2007 to 2011 detected through Abia State Integrated Disease Surveillance and Response system. Results. Of the 757 febrile rash cases, 81(10.7%) tested positive for rubella immunoglobulin M (IgM). New rubella infection decreased from 6.81/1,000,000 population in 2007 to 2.28/1,000,000 in 2009 and increased to 6.34/1,000,000 in 2011. The relative risk of rubella was 1.5 (CI [0.98–2.28]) times as high in females compared to males and 1.6 times (CI [0.90–2.91]) as high in rural areas compared to urban areas. Eighty six percent of rubella infections occurred in children less than 15 years with a high proportion of cases occurring between 5 and 14 years. Conclusion. Rubella infection in Abia State, Nigeria is predominantly in those who are younger than 15 years old. It is also more prevalent in females and in those living in rural areas of the state. Unfortunately, there is no surveillance of CRS in Nigeria and so the public health impact of rubella infection in the state is not known. Efforts should be made to expand the rubella surveillance in Nigeria to incorporate surveillance for CRS. PMID:25289179

  7. Rubella immune status of neonates - a window towards seroprevalence among childbearing women.

    PubMed

    Pejcic, Iris; Rankovic Janevski, Milica; Knezevic, Aleksandra; Jevtovic, Djordje; Stanojevic, Maja

    2016-08-19

    When contracted in pregnancy, rubella may cause serious chronic infection of the fetus and development of Congenital Rubella Syndrome. Despite widespread application of rubella vaccination, periodical outbreaks are still being reported worldwide. The aim of this study was to determine rubella seroprevalence and antibody levels in neonates in Serbia as a proxy of maternal serostatus. ELISA based serological testing for rubella was done in 599 neonates treated at the Institute of Neonatology in Belgrade, from January 2010 to December 2011. All individuals with rubella IgG concentration ≥10 IU/ml were considered seropositive for rubella. The mean age of enrolled neonates was 18 ± 6 days. The overall seroprevalence of rubella IgG antibodies among the tested neonates was 540/599(90.2 %, 95 % CI: 87.5-92.3). Seropositivity rate among sera of the neonates enrolled in 2010 was significantly higher than those collected in 2011 (p < 0.0001). There was no difference in average maternal age, gestational age or frequency of receiving blood products among the two study years. Significant high seropositivity rate was observed among neonates from mother aged >30 as compared to those from mothers aged <20 years (p = 0.02). Significant difference was also found between average IgG titers in the two study years (79 IU/mL in 2010 vs. 46 IU/mL in 2011, p < 0.0001). We report on high rubella seroprevalence among newborns in Serbia, as a proxy of rubella serostatus of childbearing aged women. Notably, declining trend of rubella antibodies toward diminishing titers suggest the importance of sustained rubella serosurvey and antenatal screening at the national level.

  8. The etiology of Rubella IgM positivity in patients with rubella-like illness in Iran from 2011 to 2013.

    PubMed

    Khorrami, Seyed Mahmood Seyed; Mokhtari-Azad, Talat; Yavarian, Jila; Nasab, Gazal Sadat Fatemi; Naseri, Maryam; Jandaghi, Nazanin Zahra Shafiei

    2015-11-01

    Rubella is a mild self-limiting contagious viral disease caused by the rubella virus (RV). Although symptoms are often mild, the concern is centralized around the possible effect on a fetus growth and development in case of primary infection during early months of pregnancy. Recently acquired rubella is commonly confirmed by RV-specific IgM antibody detection in the serum. However, rubella primary infection is not always the only cause of IgM positivity. Other possible causes of rubella IgM positivity may include IgM persistence following vaccination or naturally acquired infection or even re-infection. Moreover, nonspecific IgM reactivity can cause false-positive results. There are few articles to differentiate the aetiology of rash in rubella-like illnesses. However, limited studies have been conducted on clarifying the source of IgM positivity in these cases. This article reports the study of 10,896 clinical cases demonstrating rubella-like illness between 2011 and 2013 in Iran. The rate of IgM positivity among these cases was 0.52% (57 cases). As predicted based on the high coverage of vaccination in Iran fewer than 16% of cases with ELISA IgM positive result, were due to current rubella primary infections. The greater part of the positive IgM reactions occurred in cross reactivity with other viruses (31.6%) or in prolonged IgM response post vaccination (24.6%). This research confirmed that the positive result of rubella IgM assay in vaccinated individuals is mainly caused by prolonged IgM production, rubella re-infection, and false positivity due to infection with other viruses, rather than the rubella primary infection itself. © 2015 Wiley Periodicals, Inc.

  9. Evolution and Use of Dynamic Transmission Models for Measles and Rubella Risk and Policy Analysis.

    PubMed

    Thompson, Kimberly M

    2016-07-01

    The devastation caused by periodic measles outbreaks motivated efforts over more than a century to mathematically model measles disease and transmission. Following the identification of rubella, which similarly presents with fever and rash and causes congenital rubella syndrome (CRS) in infants born to women first infected with rubella early in pregnancy, modelers also began to characterize rubella disease and transmission. Despite the relatively large literature, no comprehensive review to date provides an overview of dynamic transmission models for measles and rubella developed to support risk and policy analysis. This systematic review of the literature identifies quantitative measles and/or rubella dynamic transmission models and characterizes key insights relevant for prospective modeling efforts. Overall, measles and rubella represent some of the relatively simplest viruses to model due to their ability to impact only humans and the apparent life-long immunity that follows survival of infection and/or protection by vaccination, although complexities arise due to maternal antibodies and heterogeneity in mixing and some models considered potential waning immunity and reinfection. This review finds significant underreporting of measles and rubella infections and widespread recognition of the importance of achieving and maintaining high population immunity to stop and prevent measles and rubella transmission. The significantly lower transmissibility of rubella compared to measles implies that all countries could eliminate rubella and CRS by using combination of measles- and rubella-containing vaccines (MRCVs) as they strive to meet regional measles elimination goals, which leads to the recommendation of changing the formulation of national measles-containing vaccines from measles only to MRCV as the standard of care. © 2016 Society for Risk Analysis.

  10. Screening for potential susceptibility to rubella in an antenatal population: A multivariate analysis.

    PubMed

    Snell, Luke Blagdon; Smith, Colette; Chaytor, Shelley; McRae, Kathryn; Patel, Mauli; Griffiths, Paul

    2017-09-01

    Rubella causes disease in the fetus. Immunity to rubella is therefore, routinely screened in pregnant women. In this retrospective observational study, we assessed the levels of potential susceptibility to rubella in the population of a north London antenatal clinic. Risk factors for potential susceptibility to rubella and changes in potential susceptibility to rubella over time were studied. Almost all women were screened for potential susceptibility to rubella (99.8%). The majority were predicted to be immune (96.8%). Women booking in later years within the study period showed higher levels of potential susceptibility to rubella. Booking during each subsequent year in the study gave women an odds ratio of 0.91 (CI:0.84, 0.98, P = 0.009) of being predicted to have immunity against rubella. Age was associated with predicted immunity to rubella, with a 5.1% (CI:3.3%, 6.9%, P < 0.001) increased likelihood for every year older. Previous pregnancy was predictive of immunity against rubella with an odds ratio of 1.41 (CI 1.21, 1.61, P = 0.001). Those from a non-white ethnicity were less likely to have antibodies predictive of immunity (OR: 0.730, CI: 0.581, 0.879 P < 0.001). Country of birth was associated with differences in potential susceptibility, with those being born outside of the British Isles having an odds ratio for predicted immunity of 0.63 (CI:0.35,0.91, P = 0.001). Being born in a high-risk country for rubella non-immunity was also a risk factor, giving an odds ratio of predicted immunity to rubella of 0.55 (CI:0.32, 0.77, P < 0.001). © 2017 Wiley Periodicals, Inc.

  11. Rubella in Sub-Saharan Africa and sensorineural hearing loss: a case control study.

    PubMed

    Caroça, Cristina; Vicente, Vera; Campelo, Paula; Chasqueira, Maria; Caria, Helena; Silva, Susana; Paixão, Paulo; Paço, João

    2017-02-01

    Rubella infection can affect several organs and cause birth defects that are responsible for congenital rubella syndrome (CRS). Congenital hearing loss is the most common symptom of this syndrome, occurring in approximately 60% of CRS cases. Worldwide, over 100 000 babies are born with CRS every year. There is no specific treatment for rubella, but the disease is preventable by vaccination. Since 1969, the rubella vaccine has been implemented in many countries, but in Africa, only a few countries routinely immunize against rubella. The aim of this study was to estimate the rate of infection from the wild-type rubella virus in São Tomé and Príncipe by determining rubella seroprevalence with a DBS method. The goal of this study was to reinforce the need for implementation of the rubella vaccine in this country. As secondary objectives, the validation of a DBS method was first attempted and an association between seroprevalence and hearing loss was assessed. We collected samples from individuals observed during humanitarian missions in São Tomé and Príncipe. All individuals underwent an audiometric evaluation, and a drop of blood was collected for the dried blood spot (DBS). We define two groups: the case group (individuals with unilateral or bilateral hearing loss (HL)) and the control group (individuals with two normal ears). Patients were excluded if they suffered from conductive HL, if they showed evidence of possible causes of HL, if they had developmental delay or if they refused to participate in the study. Among the 315 subjects, we found 64.1% individuals with IgG for the rubella virus, 32.1% without immunity for the rubella virus and 3.8% who were borderline. In the control group, 62.6% were positive for the rubella IgG, whereas in the case group, 72% were positive. Analyzing both groups, with ages ranging from 2 to 14 years of age and from 15 to 35 years of age, we found a seroprevalence of 50.3% to rubella in the younger group and 82.1% in the older group, with a significant difference between cases and control group noted within the younger patients (p = 0.025). Rubella is a disease that can be prevented. Rubella infections are still very common in São Tomé and Príncipe, and women of child-bearing age are still at risk for rubella infection during pregnancy, justifying the urgency of vaccination against rubella. A statistically significant association between the group of children under 14 years of age with HL and immunity for rubella was observed in this country, although this study did not allow us to establish a cause-effect relationship between rubella infection and SNHL.

  12. How useful is a history of rubella vaccination for determination of disease susceptibility? A cross-sectional study at a public funded health clinic in Malaysia

    PubMed Central

    2013-01-01

    Background Identification of pregnant women susceptible to rubella is important as vaccination can be given postpartum to prevent future risks of congenital rubella syndrome. However, in Malaysia, rubella antibody screening is not offered routinely to pregnant women in public funded health clinics due to cost constraint. Instead, a history of rubella vaccination is asked to be provided to establish the women’s risk for rubella infection. The usefulness of this history, however, is not established. Thus, this paper aimed to determine the usefulness of a history of rubella vaccination in determining rubella susceptibility in pregnant women. Methods A cross-sectional study was conducted on 500 pregnant women attending a public funded health clinic. Face-to-face interviews were conducted, and demographic data and history of rubella vaccination were obtained. Anti-rubella IgG test was performed. Results A majority of the women (66.6%) had a positive vaccination history. Of these, 92.2% women were immune. A third (33.4%) of the women had a negative or unknown vaccination history, but 81.4% of them were immune to rubella. The sensitivity and specificity of a history of rubella vaccination in identifying disease susceptibility was 54.4% (95% CI: 40.7, 67.4%) and 69.3% (95% CI: 64.7, 73.5%) respectively; the positive predictive value was 18.6% (95% CI: 13.1, 25.5%) and the negative predictive value was 92.2% (95% CI: 88.6, 94.7%). Conclusions A vaccination history of rubella had a poor diagnostic value in predicting rubella susceptibility. However, obtaining a vaccination history is inexpensive compared with performing a serological test. A cost-utility analysis would be useful in determining which test (history versus serological test) is more cost-effective in a country with resource constraint. PMID:23368977

  13. How useful is a history of rubella vaccination for determination of disease susceptibility? A cross-sectional study at a public funded health clinic in Malaysia.

    PubMed

    Cheong, Ai Theng; Tong, Seng Fah; Khoo, Ee Ming

    2013-01-31

    Identification of pregnant women susceptible to rubella is important as vaccination can be given postpartum to prevent future risks of congenital rubella syndrome. However, in Malaysia, rubella antibody screening is not offered routinely to pregnant women in public funded health clinics due to cost constraint. Instead, a history of rubella vaccination is asked to be provided to establish the women's risk for rubella infection. The usefulness of this history, however, is not established. Thus, this paper aimed to determine the usefulness of a history of rubella vaccination in determining rubella susceptibility in pregnant women. A cross-sectional study was conducted on 500 pregnant women attending a public funded health clinic. Face-to-face interviews were conducted, and demographic data and history of rubella vaccination were obtained. Anti-rubella IgG test was performed. A majority of the women (66.6%) had a positive vaccination history. Of these, 92.2% women were immune. A third (33.4%) of the women had a negative or unknown vaccination history, but 81.4% of them were immune to rubella. The sensitivity and specificity of a history of rubella vaccination in identifying disease susceptibility was 54.4% (95% CI: 40.7, 67.4%) and 69.3% (95% CI: 64.7, 73.5%) respectively; the positive predictive value was 18.6% (95% CI: 13.1, 25.5%) and the negative predictive value was 92.2% (95% CI: 88.6, 94.7%). A vaccination history of rubella had a poor diagnostic value in predicting rubella susceptibility. However, obtaining a vaccination history is inexpensive compared with performing a serological test. A cost-utility analysis would be useful in determining which test (history versus serological test) is more cost-effective in a country with resource constraint.

  14. Rubella Surveillance and Diagnostic Testing among a Low-Prevalence Population, New York City, 2012-2013.

    PubMed

    Isaac, Beth M; Zucker, Jane R; Giancotti, Francesca R; Abernathy, Emily; Icenogle, Joseph; Rakeman, Jennifer L; Rosen, Jennifer B

    2017-09-01

    The New York City Department of Health and Mental Hygiene (DOHMH) receives clinical and laboratory reports for rubella. Because rubella immunoglobulin M (IgM) assays may produce false-positive results and rubella infections may be asymptomatic, interpretation of positive IgM results can be challenging. Rubella reports received by DOHMH in 2012 to 2013 were reviewed. The rubella IgM testing purpose was determined through case investigation. Results of IgM testing by indirect enzyme-linked immunosorbent assay (ELISA) and capture enzyme immunoassay (EIA) were compared to determine positive predictive value (PPV) and specificity. DOHMH received 199 rubella reports; 2 were true cases. Of all reports, 77.9% were tested for rubella IgM erroneously, 19.6% were tested for diagnostic purposes, 2.0% had unknown test purpose, and 0.5% were not tested. PPV of indirect ELISA was 6% overall, 14% for diagnostic tests, and 0% for tests ordered erroneously. PPV of capture EIA was 29% overall, 50% for diagnostic tests, and 0% for tests ordered erroneously. Overall, specificity was 52% for indirect ELISA and 85% for capture EIA. Limiting rubella IgM testing to patients for whom rubella diagnosis is suspected and using a more specific IgM assay have the potential to reduce false-positive rubella IgM results. Copyright © 2017 American Society for Microbiology.

  15. The utility of measles and rubella IgM serology in an elimination setting, Ontario, Canada, 2009-2014.

    PubMed

    Bolotin, Shelly; Lim, Gillian; Dang, Vica; Crowcroft, Natasha; Gubbay, Jonathan; Mazzulli, Tony; Schabas, Richard

    2017-01-01

    In Canada, measles was eliminated in 1998 and rubella in 2000. Effective measles and rubella surveillance is vital in elimination settings, hinging on reliable laboratory methods. However, low-prevalence settings affect the predictive value of laboratory tests. We conducted an analysis to determine the performance of measles and rubella IgM testing in a jurisdiction where both infections are eliminated. 21,299 test results were extracted from the Public Health Ontario Laboratories database and 1,239 reports were extracted from the Ontario Integrated Public Health Information System (iPHIS) from 2008 and 2010 for measles and rubella, respectively, to 2014. Deterministic linkage resulted in 658 linked measles records (2009-2014) and 189 linked rubella records (2010-2014). Sixty-six iPHIS measles entries were classified as confirmed cases, of which 53 linked to laboratory data. Five iPHIS rubella entries were classified as confirmed, all linked to IgM results. The positive predictive value was 17.4% for measles and 3.6% for rubella. Sensitivity was 79.2% for measles and 100.0% for rubella. Specificity was 65.7% for measles and 25.8% for rubella. Our study confirms that a positive IgM alone does not confirm a measles case in elimination settings. This has important implications for countries that are working towards measles and rubella elimination.

  16. Problem of rubella in Poland after compensatory outbreak in 2013

    PubMed

    Abramczuk, Edyta; Częścik, Agnieszka; Pancer, Katarzyna; Gut, Włodzimierz

    The attempt to estimate the real number of rubella cases in the years 2015-2016 in Poland was presented in this paper. The relations between number of reported cases of measles in 2006-2015y., the number of laboratory-confirmed cases of rubella among cases suspected of measles and the proportion of rubella among patients suspected of measles in the last 10 years as well as the results of serological examination in samples from 74 patients suspected of rubella collected in the first half of 2016 year were analysed. The sera from patients suspected of rubella were collected in cooperation with the State Sanitary Inspection. The analysis of data collected during the study-cases of suspected measles (2006-2016) and rubella infections (in 2016y.) indicated high over-registration of rubella in recent years in Poland, which is associated with a very low rate of laboratory confirmed cases.

  17. Rubella susceptibility in pregnant women and results of a postpartum immunization strategy in Catalonia, Spain.

    PubMed

    Vilajeliu, Alba; García-Basteiro, Alberto L; Valencia, Salomé; Barreales, Saul; Oliveras, Laura; Calvente, Valentín; Goncé, Anna; Bayas, José M

    2015-04-08

    Elimination of congenital rubella syndrome depends not only on effective childhood immunization but also on the identification and immunization of rubella susceptible women. We assessed rubella susceptibility among pregnant women and evaluated the adherence and response to postpartum immunization with measles, mumps and rubella (MMR) vaccine. Cross-sectional study of women who gave birth at the Hospital Clinic de Barcelona (Spain) between January 2008 and December 2013. Antenatal serological screening for rubella was performed in all women during pregnancy. In rubella-susceptible women, two doses of MMR vaccine were recommended following birth. We evaluated rubella serological response to MMR vaccination in mothers who complied with the recommendations. A total of 22,681 pregnant women were included in the study. The mean age was 32.3 years (SD 5.6), and 73.6% were primipara. The proportion of immigrants ranged from 43.4% in 2010 to 38.5% in 2012. The proportion of women susceptible to rubella was 5.9% (1328). Susceptibility to rubella declined with increasing maternal age. Immigrant pregnant women were more susceptible to rubella (7.6%) than women born in Spain (4.6%). Multivariate analyses showed that younger age (≤19 years) aOR 1.7 (95% CI 1.1-2.5), primiparas aOR 1.3 (95% CI 1.1-1.5) and immigrant women aOR 1.6 (95% CI 1.4-1.8) were more likely to be susceptible. The second dose of MMR vaccine was received by 57.2% (718/1256) of rubella-susceptible women, with the highest proportion being immigrant women compared with women born in Spain. After vaccination, all women showed rubella immunity. The higher rubella susceptibility found in the three youngest age groups and in immigrant women highlights the relevance of antenatal screening, in order to ensure identification and postpartum immunization. The postpartum immunization strategy is an opportunity to protect women of childbearing age and consequently prevent occurrence of CRS, and to increase vaccination coverage against rubella and other vaccine-preventable diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Genomic characterization of a persistent rubella virus from a case of Fuch' uveitis syndrome in a 73 year old man.

    PubMed

    Abernathy, Emily; Peairs, Randall R; Chen, Min-hsin; Icenogle, Joseph; Namdari, Hassan

    2015-08-01

    Many cases of Fuchs' uveitis have been associated with persistent rubella virus infection. A 73-year-old male patient with typical Fuchs' Uveitis Syndrome (FUS) first experienced heterochromia of the left eye at the age fourteen, when rubella was endemic in the US. The purposes of this report are to describe the patient's FUS clinical presentations and to characterize the virus detected in the vitreous fluid. The patient underwent a therapeutic pars plana vitrectomy in May 2013. A real-time RT-PCR assay for rubella virus was performed on the vitreous fluid by Focus Diagnostics. Additional real-time RT-PCR assays for rubella virus detection and RT-PCR assays for generation of templates for sequencing were performed at the Centers for Disease Control and Prevention (CDC). The results from Focus Diagnostics were positive for rubella virus RNA. Real-time RT-PCR assays at CDC were also positive for rubella virus. A rubella virus sequence of 739 nucleotides was determined and phylogenetic analysis showed that the virus was the sole member of a new phylogenetic group when compared to reference virus sequences. While FUS remains a clinical diagnosis, findings in this case support the association between rubella virus and the disease. Phylogenetic analysis provided evidence that this rubella virus was likely a previously undetected genotype which is no longer circulating. Since the patient had rubella prior to 1955, this sequence is from the earliest rubella virus yet characterized. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Global Progress Toward Rubella and Congenital Rubella Syndrome Control and Elimination - 2000-2014.

    PubMed

    Grant, Gavin B; Reef, Susan E; Dabbagh, Alya; Gacic-Dobo, Marta; Strebel, Peter M

    2015-09-25

    Rubella virus usually causes a mild fever and rash in children and adults. However, infection during pregnancy, especially during the first trimester, can result in miscarriage, fetal death, stillbirth, or a constellation of congenital malformations known as congenital rubella syndrome (CRS). In 2011, the World Health Organization (WHO) updated guidance on the preferred strategy for introduction of rubella-containing vaccine (RCV) into national routine immunization schedules, including an initial vaccination campaign usually targeting children aged 9 months-15 years . The Global Vaccine Action Plan endorsed by the World Health Assembly in 2012 and the Global Measles and Rubella Strategic Plan (2012-2020) published by Measles and Rubella Initiative partners in 2012 both include goals to eliminate rubella and CRS in at least two WHO regions by 2015, and at least five WHO regions by 2020 (2,3). This report updates a previous report and summarizes global progress toward rubella and CRS control and elimination during 2000-2014. As of December 2014, RCV had been introduced in 140 (72%) countries, an increase from 99 (51%) countries in 2000 (for this report, WHO member states are referred to as countries). Reported rubella cases declined 95%, from 670,894 cases in 102 countries in 2000 to 33,068 cases in 162 countries in 2014, although reporting is inconsistent. To achieve the 2020 Global Vaccine Action Plan rubella and CRS elimination goals, RCV introduction needs to continue as country criteria indicating readiness are met, and rubella and CRS surveillance need to be strengthened to ensure that progress toward elimination can be measured.

  20. Imported Genotype 2B Rubella Virus Caused the 2012 Outbreak in Anqing City, China

    PubMed Central

    Dai, Jingjing; Chen, Xia; Tang, Jihai; Chen, Shuping; Zheng, Yilun; Song, Jie; Xu, Wenbo

    2015-01-01

    A rubella outbreak occurred in Anqing city of Anhui province, China, from February to July of 2012, and a total of 241 clinically diagnosed or lab-confirmed patients were reported. The highest number of rubella cases during this outbreak was recorded in teenagers between 10 and 19 years of age who had not previously received the rubella vaccine. Genotyping results indicated that the genotype 2B rubella virus (RV) was responsible for the outbreak. However, a phylogenetic analysis showed that the genotype 2B RVs isolated in Anqing City were not related to 2B RVs found in other cities of Anhui province and in other provinces of China, thus providing evidence for importation. After importation, the transmission of Anqing RVs was interrupted owing to an effective immunization campaign against rubella, suggesting the timeliness and effectiveness of contingency vaccination. Strengthening rubella surveillance, including the integration of epidemiologic information and laboratory data, is a vital strategy for rubella control and elimination. In addition, except for routine immunization, targeted supplementary immunization activities aimed at susceptible groups according to sero-epidemiological surveillance data also play a key role in stopping the continuous transmission of rubella viruses and in preventing further congenital rubella syndrome cases. PMID:26402467

  1. Epidemiological and molecular investigation of a rubella outbreak, Romania, 2011 to 2012

    PubMed Central

    Lazar, Mihaela; Abernathy, Emily; Chen, Min-hsin; Icenogle, Joseph; Janta, Denisa; Stanescu, Aurora; Pistol, Adriana; Santibanez, Sabine; Mankertz, Annette; Hübschen, Judith M; Mihaescu, Grigore; Necula, Gheorghe; Lupulescu, Emilia

    2016-01-01

    We describe a rubella outbreak that occurred in Romania between September 2011 and December 2012. During this period 24,627 rubella cases, 41.1% (n=10,134) of which female, were notified based on clinical criteria, and a total of 6,182 individuals were found serologically positive for IgM-specific rubella antibody. The median age of notified cases was 18 years (range: <1–65) and the most affected age group 15 to 19 years (n=16,245 cases). Of all notified cases, 24,067 cases (97.7%) reported no history of vaccination. Phylogenetic analysis of 19 sequences (739 nucleotides each), from 10 districts of the country revealed that the outbreak was caused by two distinct rubella virus strains of genotype 2B, which co-circulated with both temporal and geographical overlap. In addition to the 6,182 IgM-positive rubella cases, 28 cases of congenital rubella syndrome (CRS) were identified, including 11 neonatal deaths and one stillbirth. The outbreak underscores the need to encourage higher vaccination uptake in the population, particularly in women of reproductive age, and to strengthen epidemiological and laboratory investigations of suspected rubella cases. Genetic characterisation of wild-type rubella virus is an essential component to enhance surveillance and here we report rubella virus sequences from Romania. PMID:27684329

  2. Epidemiological Evaluation of Rubella Virus Infection among Pregnant Women in Ibadan, Nigeria.

    PubMed

    Adewumi, Olubusuyi M; Olayinka, Oluseyi A; Olusola, Babatunde A; Faleye, Temitope O C; Sule, Waidi F; Adesina, Olubukola

    2015-01-01

    Rubella is a vaccine-preventable, mild rash-inducing viral disease with complications that include a spectrum of birth defects in the developing fetus, especially if the infection is acquired in the early months of pregnancy. Consequently, the primary objective of global rubella control programs is prevention of congenital rubella infection and associated birth defects. Despite the availability of safe and effective vaccines, and the elimination of the rubella virus in many developed countries, substantial commitment to rubella control has not been demonstrated in developing countries. This study appraises immunity to rubella, and consequently makes appropriate recommendations aimed at facilitating effective control. A cross-sectional sero-surveillance study was carried out among defined 272 consenting ante-natal clinic attendees in south-western, Nigeria. Prevalence rates of 91.54% and 1.84% were recorded for the anti-rubella virus (anti-RV) IgG and IgM, respectively. Also, 90.7% and 92.3% of the women aged ≤30 years and >30 years, respectively, had detectable anti-RV IgG. No significant association (p = 0.94) was recorded between anti-RV IgG detection and age of the women. Previous exposure and susceptibility of significant fraction of the population to rubella infection were confirmed. Considerable political commitment and promotion of free rubella immunization specifically for women with childbearing potential were recommended.

  3. Shedding of Rubella Virus among Infants with Congenital Rubella Syndrome Born in Tokyo, Japan, 2013-2014.

    PubMed

    Sugishita, Yoshiyuki; Akiba, Tetsuya; Sumitomo, Masami; Hayata, Noriko; Hasegawa, Michiya; Tsunoda, Tokuko; Okazaki, Terue; Murauchi, Konomi; Hayashi, Yukinao; Kai, Akemi; Seki, Naomi; Kayebeta, Aya; Iwashita, Yuuko; Kurita, Masayuki; Tahara, Narumi

    2016-09-21

    Rubella is usually a mild illness, with febrile rash being its main symptom. However, serious consequences of rubella infection can result when the infection occurs during the early stages of pregnancy. After the occurrence of a rubella outbreak in Japan that was observed from 2012 to 2013, 45 infants were reportedly born with congenital rubella syndrome (CRS). We prospectively followed the 15 CRS cases reported in Tokyo to determine the virus shedding periods by using nested reverse transcriptase-polymerase chain reaction to detect rubella virus genes. Throast swabs were used for virus detection. The virus shedding period was measured from birth until the time when the sample last tested positive followed by 2 consecutive negative samples. Kaplan-Meier method was used to estimate the proportion of cases remaining positive for rubella virus genes over time. The proportion of CRS cases shedding virus dropped steadily after birth, dropping to 33.8% at 6 months and 16.9% at 12 months. Our findings also suggested that the earlier the mother's onset of rubella during pregnancy, the longer the infant remained positive. Based on our findings, we believe that infants with CRS should be monitored for rubella virus shedding until 1 year of age.

  4. Inferring rubella outbreak risk from seroprevalence data in Belgium.

    PubMed

    Abrams, Steven; Kourkouni, Eleni; Sabbe, Martine; Beutels, Philippe; Hens, Niel

    2016-12-07

    Rubella is usually a mild disease for which infections often pass by unnoticed. In approximately 50% of the cases, there are no or only few clinical symptoms. However, rubella contracted during early pregnancy could lead to spontaneous abortion, to central nervous system defects, or to one of a range of other serious and debilitating conditions in a newborn such as the congenital rubella syndrome. Before the introduction of mass vaccination, rubella was a common childhood infection occurring all over the world. However, since the introduction of rubella antigen-containing vaccines, the incidence of rubella has declined dramatically in high-income countries. Recent large-scale mumps outbreaks, one of the components in the combined measles-mumps-rubella vaccine, occurring in countries throughout Europe with high vaccination coverage, provide evidence of pathogen-specific waning of vaccine-induced immunity and primary vaccine failure. In addition, recent measles outbreaks affecting populations with suboptimal vaccination coverages stress the importance of maintaining high vaccination coverages. In this paper, we focus on the assessment of rubella outbreak risk using a previously developed method to identify geographic regions of high outbreak potential. The methodology relies on 2006 rubella seroprevalence data and vaccination coverage data from Belgium and information on primary and secondary vaccine failure obtained from extensive literature reviews. We estimated the rubella outbreak risk in Belgium to be low, however maintaining high levels of immunisation and surveillance are of utmost importance to avoid future outbreaks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Immunity to polio, measles and rubella in women of child-bearing age and estimated congenital rubella syndrome incidence, Cambodia, 2012.

    PubMed

    Mao, B; Chheng, K; Wannemuehler, K; Vynnycky, E; Buth, S; Soeung, S C; Reef, S; Weldon, W; Quick, L; Gregory, C J

    2015-07-01

    Significant gaps in immunity to polio, measles, and rubella may exist in adults in Cambodia and threaten vaccine-preventable disease (VPD) elimination and control goals, despite high childhood vaccination coverage. We conducted a nationwide serological survey during November-December 2012 of 2154 women aged 15-39 years to assess immunity to polio, measles, and rubella and to estimate congenital rubella syndrome (CRS) incidence. Measles and rubella antibodies were detected by IgG ELISA and polio antibodies by microneutralization testing. Age-structured catalytic models were fitted to rubella serological data to predict CRS cases. Overall, 29.8% of women lacked immunity to at least one poliovirus (PV); seroprevalence to PV1, PV2 and PV3 was 85.9%, 93.4% and 83.3%, respectively. Rubella and measles antibody seroprevalence was 73.3% and 95.9%, respectively. In the 15-19 years age group, 48.2% [95% confidence interval (CI) 42.4-54.1] were susceptible to either PV1 or PV3, and 40.3% (95% CI 33.0-47.5) to rubella virus. Based on rubella antibody seroprevalence, we estimate that >600 infants are born with CRS in Cambodia annually. Significant numbers of Cambodian women are still susceptible to polio and rubella, especially those aged 15-19 years, emphasizing the need to include adults in VPD surveillance and a potential role for vaccination strategies targeted at adults.

  6. [Genetic characterization analysis on epidemic rubella virus strains isolated in Liaoning from 2007 to 2012].

    PubMed

    Wang, Yan; Ma, Yan; Xu, Xiao-Ting; Fan, Xue-Song; Lin, Qian; Sui, Dan; Yin, Ye; Wu, Feng-Tong; Pan, Bai-Ling; Liu, Guang-Yuan; Wang, Ji-Jian; Han, Yue; Guo, Jun-Qiao; Zhao, Zhuo

    2013-11-01

    To analyze the genetic characterization of epidemic rubella virus strains isolated in Liaoning from 2007-2012, a total of 145 rubella virus strains were isolated using Vero/Slam cell line from the patients' throat swabs during rubella outbreaks and sporadics cases in Liaoning Province from 2007 to 2012. Fragments of 945 nucleotides containing 1E gene from 145 rubella virus isolates were amplified by RT-PCR, the PCR products were sequenced and analyzed. Based on the 739 nucleotides of 1E gene, the phylogenetic trees were constructed with 32 WHO rubella reference strains of 13 genotypes downloaded from GenBank and 145 rubella virus strains. The results showed that the 145 rubella virus strains in 2007 -2012 belonged to genotype 1E, nucleotide acids and amino acids similarities were 97.2%-100.0% and 97.6%-100.0%, respectively. Compared to the 1E reference strains(Rvi/ Dezhou.CHN/02, RVi/MYS/01), the nucleotide acids and amino acids similarities were 96.6%-99.2% and 98.2%-100.0%, respectively except for one amino acid change (Val246-Ala246) of RVi/Shenyang. Liaoning. CHN/13.11/13, and Asp262-Asn262 of RVi/Shenyang. Liaoning. CHN/13.11/4 and RVi/Liaoyang. Liaoning. CHN/26. 11/2. there had no change found in the important antigenic epitope sites, the hemagglutination inhibition and neutralization epitopes of the other rubella viruses. All the 145 strains isolated had the same amino acid change (Leu338--Phe338) in E1 protein. These findings suggested that genotype 1E of rubella virus was the predominant genotype in Liaoning province. the rubella prevailed in recent six years was mainly caused by rubella viruses genotype 1E with multi-transmission routes.

  7. Rubella Immune Status in Pregnant Women in a Northern Mexican City

    PubMed Central

    Alvarado-Esquivel, Cosme; Hernandez-Tinoco, Jesus; Sanchez-Anguiano, Luis Francisco; Ramos-Nevarez, Agar; Cerrillo-Soto, Sandra Margarita; Salas-Pacheco, Jose Manuel; Sandoval-Carrillo, Ada Agustina; Martinez-Ramirez, Lucio; Antuna-Salcido, Elizabeth Irasema; Guido-Arreola, Carlos Alberto

    2016-01-01

    Background The seroepidemiology of rubella virus infection in pregnant women in northern Mexico is largely unknown. We sought to determine the seroprevalence of rubella virus infection in pregnant women in the northern Mexican city of Durango, Mexico. Seroprevalence association with the socio-demographic, clinical and behavioral characteristics of the pregnant women was also investigated. Methods Through a cross-sectional study, we determined the seroprevalence of IgG and IgM anti-rubella virus in 279 pregnant women (mean age 29.17 ± 5.96 years; range 15 - 43 years) attending in a clinic of family medicine using enzyme-linked fluorescent assays. A questionnaire was used to obtain the socio-demographic, clinical and behavioral characteristics of the pregnant women. The association of rubella seropositivity and characteristics of the women was assessed by bivariate and multivariate analyses. Results Anti-rubella IgG antibodies (≥ 15 IU/mL) were found in 271 (97.1%) of the 279 pregnant women examined. None of the 279 pregnant women were positive for anti-rubella IgM antibodies. Multivariate analysis of socio-demographic, clinical and behavioral variables showed that seroreactivity to rubella virus was positively associated with national trips (OR = 7.39; 95% CI: 1.41 - 38.78; P = 0.01), and negatively associated with age (OR = 0.26; 95% CI: 0.06 - 0.99; P = 0.04). Conclusions Rate of rubella immunity in pregnant women in the northern Mexican city of Durango is high. However, nearly 3% of pregnant women are susceptible to rubella in our setting. Risk factors associated with rubella seropositivity found in this study may be useful for optimal design of preventive measures against rubella and its sequelae. PMID:27540439

  8. Active surveillance for congenital rubella syndrome in Yangon, Myanmar.

    PubMed Central

    Thant, Kyaw-Zin; Oo, Win-Mar; Myint, Thein-Thein; Shwe, Than-Nu; Han, Aye-Maung; Aye, Khin-Mar; Aye, Kay-Thi; Moe, Kyaw; Thein, Soe; Robertson, Susan E.

    2006-01-01

    OBJECTIVE: Rubella vaccine is not included in the immunization schedule in Myanmar. Although surveillance for outbreaks of measles and rubella is conducted nationwide, there is no routine surveillance for congenital rubella syndrome (CRS). Therefore, we organized a study to assess the burden of CRS. METHODS: From 1 December 2000 to 31 December 2002 active surveillance for CRS was conducted among children aged 0-17 months at 13 hospitals and 2 private clinics in Yangon, the capital city. Children with suspected CRS had a standard examination and a blood sample was obtained. All serum samples were tested for rubella-specific IgM; selected samples were tested for rubella-specific IgG and for rubella RNA by reverse transcriptase-polymerase chain reaction (RT-PCR). FINDINGS: A total of 81 children aged 0-17 months were suspected of having CRS. Of these, 18 children had laboratory-confirmed CRS (7 were IgM positive; 7 were RT-PCR positive; and 10 were IgG positive at > 6 months of age). One additional child who tested positive by RT-PCR and whose mother had had rubella during pregnancy but who had a normal clinical examination was classified as having congenital rubella infection. During 2001-02 no rubella outbreaks were detected in Yangon Division. In the 31 urban townships of Yangon Division, the annual incidence was 0.1 laboratory-confirmed cases of CRS per 1000 live births. CONCLUSION: This is the first population-based study of CRS incidence from a developing country during a rubella-endemic period; the incidence of CRS is similar to endemic rates found in industrialized countries during the pre-vaccine era. Rubella-specific IgG tests proved practical for diagnosing CRS in children aged > 6 months. This is one of the first studies to report on the use of rubella-specific RT-PCR directly on serum samples; further studies are warranted to confirm the utility of this method as an additional means of diagnosing CRS. PMID:16501710

  9. Evaluation of a commercial rubella IgM assay for use on oral fluid samples for diagnosis and surveillance of congenital rubella syndrome and postnatal rubella.

    PubMed

    Vijaylakshmi, P; Muthukkaruppan, V R; Rajasundari, A; Korukluoglu, G; Nigatu, W; L A Warrener; Samuel, D; Brown, D W G

    2006-12-01

    Clinical diagnosis (surveillance) of rubella is unreliable and laboratory confirmation is essential. Detection of virus specific IgM in serum is the most commonly used method. However, the use of serum necessitates the drawing of blood, either through venipuncture or finger/heel prick, which can be difficult in young babies. Oral fluid samples have proved useful as an alternative, less invasive sample for virus specific IgM detection however until recently no commercial rubella IgM tests were available, restricting the usefulness of this approach. To evaluate the performance of the Microimmune Rubella IgM capture EIA using oral fluid samples from outbreaks as well as in cases of suspected congenital rubella syndrome (CRS). Paired serum and oral fluids were collected from cases during a rubella outbreak in three provinces in Turkey. Matched serum and oral fluid samples were collected from children with suspected CRS in an active surveillance programme at the Aravind Eye Hospital in South India. Serum samples were collected as part of the measles surveillance programme in Ethiopia. On serum samples the sensitivity and specificity of the Microimmune Rubella IgM capture EIA compared to Behring Enzygnost rubella IgM test was 96.9% (62/64; 95% CI 94.2-100%) and 100% (53/53; 95% CI 93.2-100%). On oral fluids compared to matched Behring results on serum the sensitivity was 95.5% (42/44; 95% CI 84.5-99.4%). The sensitivity and specificity of Microimmune Rubella IgM capture EIA on oral fluids from suspected CRS cases compared to serum results using Behring Enzygnost IgM assay was 100% (95% CI 84.5-100%) and 100% (95% CI 95.8-100.0%) respectively. Microimmune Rubella IgM capture EIA has adequate performance for diagnosis and surveillance of rubella in outbreak using either serum or oral fluid specimens.

  10. Study of rubella candidate vaccine based on a structurally modified plant virus.

    PubMed

    Trifonova, Ekaterina A; Zenin, Vladimir A; Nikitin, Nikolai A; Yurkova, Maria S; Ryabchevskaya, Ekaterina M; Putlyaev, Egor V; Donchenko, Ekaterina K; Kondakova, Olga A; Fedorov, Alexey N; Atabekov, Joseph G; Karpova, Olga V

    2017-08-01

    A novel rubella candidate vaccine based on a structurally modified plant virus - spherical particles (SPs) - was developed. SPs generated by the thermal remodelling of the tobacco mosaic virus are promising platforms for the development of vaccines. SPs combine unique properties: biosafety, stability, high immunogenicity and the effective adsorption of antigens. We assembled in vitro and characterised complexes (candidate vaccine) based on SPs and the rubella virus recombinant antigen. The candidate vaccine induced a strong humoral immune response against rubella. The IgG isotypes ratio indicated the predominance of IgG1 which plays a key role in immunity to natural rubella infection. The immune response was generally directed against the rubella antigen within the complexes. We suggest that SPs can act as a platform (depot) for the rubella antigen, enhancing specific immune response. Our results demonstrate that SPs-antigen complexes can be an effective and safe candidate vaccine against rubella. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Insights from epidemiological game theory into gender-specific vaccination against rubella.

    PubMed

    Shim, Eunha; Kochin, Beth; Galvani, Alison

    2009-10-01

    Rubella is a highly contagious childhood disease that causes relatively mild symptoms. However, rubella can result in severe congenital defects, known as congenital rubella syndrome (CRS), if transmitted from a mother to a fetus. Consequently, women have higher incentive to vaccinate against rubella than men do. Within the population vaccination reduces transmission but also increases the average age of infection and possibly the risk of CRS among unvaccinated females. To evaluate how the balance among these factors results in optimal coverage of vaccination, we developed a game theoretic age-structured epidemiological model of rubella transmission and vaccination. We found that high levels of vaccination for both genders are most effective in maximizing average utility across the population by decreasing the risk of CRS and reducing transmission of rubella. By contrast, the demands for vaccines driven by self-interest among males and females are 0% and 100% acceptance, respectively, if the cost of vaccination is relatively low. Our results suggest that the rubella vaccination by males that is likely to be achieved on voluntary basis without additional incentives would have been far lower than the population optimum, if rubella vaccine were offered separately instead of combined with measles and mumps vaccination as the MMR vaccine.

  12. Progress in Rubella and Congenital Rubella Syndrome Control and Elimination - Worldwide, 2000-2016.

    PubMed

    Grant, Gavin B; Reef, Susan E; Patel, Minal; Knapp, Jennifer K; Dabbagh, Alya

    2017-11-17

    Although rubella virus infection usually causes a mild fever and rash illness in children and adults, infection during pregnancy, especially during the first trimester, can result in miscarriage, fetal death, stillbirth, or infants with a constellation of congenital malformations known as congenital rubella syndrome (CRS) (1). Rubella is a leading vaccine-preventable cause of birth defects. Preventing these adverse pregnancy outcomes is the focus of rubella vaccination programs. In 2011, the World Health Organization (WHO) updated guidance on the preferred strategy for introduction of rubella-containing vaccine (RCV) into national immunization schedules and recommended an initial vaccination campaign, usually targeting children aged 9 months-14 years (1). The Global Vaccine Action Plan 2011-2020 (GVAP), endorsed by the World Health Assembly in 2012, includes goals to eliminate rubella in at least five of the six WHO regions by 2020 (2). This report updates a previous report (3) and summarizes global progress toward rubella and CRS control and elimination from 2000 to 2016. As of December 2016, 152 (78%) of 194 countries had introduced RCV into the national immunization schedule, representing an increase of 53 countries since 2000, including 20 countries that introduced RCV after 2012.

  13. Epidemiological and molecular investigation of a rubella outbreak, Romania, 2011 to 2012.

    PubMed

    Lazar, Mihaela; Abernathy, Emily; Chen, Min-Hsin; Icenogle, Joseph; Janta, Denisa; Stanescu, Aurora; Pistol, Adriana; Santibanez, Sabine; Mankertz, Annette; Hübschen, Judith M; Mihaescu, Grigore; Necula, Gheorghe; Lupulescu, Emilia

    2016-09-22

    We describe a rubella outbreak that occurred in Romania between September 2011 and December 2012. During this period 24,627 rubella cases, 41.1% (n=10,134) of which female, were notified based on clinical criteria, and a total of 6,182 individuals were found serologically positive for IgM-specific rubella antibody. The median age of notified cases was 18 years (range: <1-65) and the most affected age group 15 to 19 years (n=16,245 cases). Of all notified cases, 24,067 cases (97.7%) reported no history of vaccination. Phylogenetic analysis of 19 sequences (739 nucleotides each), from 10 districts of the country revealed that the outbreak was caused by two distinct rubella virus strains of genotype 2B, which co-circulated with both temporal and geographical overlap. In addition to the 6,182 IgM-positive rubella cases, 28 cases of congenital rubella syndrome (CRS) were identified, including 11 neonatal deaths and one stillbirth. The outbreak underscores the need to encourage higher vaccination uptake in the population, particularly in women of reproductive age, and to strengthen epidemiological and laboratory investigations of suspected rubella cases. Genetic characterisation of wild-type rubella virus is an essential component to enhance surveillance and here we report rubella virus sequences from Romania. This article is copyright of The Authors, 2016.

  14. Characterization of rubella-specific humoral immunity following two doses of MMR vaccine using proteome microarray technology

    PubMed Central

    Haralambieva, Iana H.; Gibson, Michael J.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Warner, Nathaniel D.; Grill, Diane E.

    2017-01-01

    Introduction//Background The lack of standardization of the currently used commercial anti-rubella IgG antibody assays leads to frequent misinterpretation of results for samples with low/equivocal antibody concentration. The use of alternative approaches in rubella serology could add new information leading to a fuller understanding of rubella protective immunity and neutralizing antibody response after vaccination. Methods We applied microarray technology to measure antibodies to all rubella virus proteins in 75 high and 75 low rubella virus-specific antibody responders after two MMR vaccine doses. These data were used in multivariate penalized logistic regression modeling of rubella-specific neutralizing antibody response after vaccination. Results We measured antibodies to all rubella virus structural proteins (i.e., the glycoproteins E1 and E2 and the capsid C protein) and to the non-structural protein P150. Antibody levels to each of these proteins were: correlated with the neutralizing antibody titer (p<0.006); demonstrated differences between the high and the low antibody responder groups (p<0.008); and were components of the model associated with/predictive of vaccine-induced rubella virus-specific neutralizing antibody titers (misclassification error = 0.2). Conclusion Our study supports the use of this new technology, as well as the use of antibody profiles/patterns (rather than single antibody measures) as biomarkers of neutralizing antibody response and correlates of protective immunity in rubella virus serology. PMID:29145521

  15. Rubella Virus-associated Anterior Uveitis in a Vaccinated Patient: A Case Report.

    PubMed

    ten Berge, Josianne C E M; van Daele, Paul L A; Rothova, Aniki

    2016-01-01

    Rubella virus is involved in the pathogenesis of Fuchs heterochromic uveitis and almost all cases in Europe show an active antibody production in the aqueous humor against rubella virus. Herein we report a case of a fully vaccinated patient with common variable immunodeficiency who developed unilateral Fuchs heterochromic uveitis secondary to rubella virus which was proven by intraocular fluid examination. Awareness of rubella associated anterior uveitis should remain also in vaccinated patients, especially those without a fully competent immune system.

  16. Rubella antibodies in Australian immunoglobulin products.

    PubMed

    Young, Megan K; Bertolini, Joseph; Kotharu, Pushpa; Maher, Darryl; Cripps, Allan W

    2017-08-03

    Rubella antibodies are not routinely measured in immunoglobulin products and there is a lack of information on the titer in Australian products. To facilitate future studies of the effectiveness of passive immunisation for preventing rubella and congenital rubella syndrome, this study measured the concentration of rubella-specific antibodies in Australian intramuscular (IM) and intravenous (IV) human immunoglobulin products suitable for post-exposure prophylaxis using a chemiluminescent immunoassay. The GMT ± GSD for the IM product was 19 ± 1.2 IU/mg (2980 ± 1.2 IU/mL). The GMT ± GSD for the IV product was 12 ± 1.5 IU/mg (729 ± 1.5 IU/mL). At present, Australian guidelines recommend offering non-immune pregnant women exposed to rubella 20 mL of intramuscular immunoglobulin within 72 hours of exposure. This equates to 42,160 IU of rubella antibodies if the lowest titer obtained for the Australian IM product is considered. The same dose would be delivered by 176 mL of the Australian IV product at the lowest measured rubella-specific antibody titer.

  17. Phylogenetic Analysis of Rubella Viruses Identified in Uganda, 2003–2012

    PubMed Central

    Namuwulya, Prossy; Abernathy, Emily; Bukenya, Henry; Bwogi, Josephine; Tushabe, Phionah; Birungi, Molly; Seguya, Ronald; Kabaliisa, Theopista; Alibu, Vincent P.; Kayondo, Jonathan K.; Rivailler, Pierre; Icenogle, Joseph; Bakamutumaho, Barnabas

    2014-01-01

    Molecular data on rubella viruses are limited in Uganda despite the importance of congenital rubella syndrome (CRS). Routine rubella vaccination, while not administered currently in Uganda, is expected to begin by 2015. The World Health Organization recommends that countries without rubella vaccination programs assess the burden of rubella and CRS before starting a routine vaccination program. Uganda is already involved in integrated case-based surveillance, including laboratory testing to confirm measles and rubella, but molecular epidemiologic aspects of rubella circulation have so far not been documented in Uganda. Twenty throat swab or oral fluid samples collected from 12 districts during routine rash and fever surveillance between 2003 and 2012 were identified as rubella virus RNA positive and PCR products encompassing the region used for genotyping were sequenced. Phylogenetic analysis of the 20 sequences identified 19 genotype 1G viruses and 1 genotype 1E virus. Genotype-specific trees showed that the Uganda viruses belonged to specific clusters for both genotypes 1G and 1E and grouped with similar sequences from neighboring countries. Genotype 1G was predominant in Uganda. More epidemiological and molecular epidemiological data are required to determine if genotype 1E is also endemic in Uganda. The information obtained in this study will assist the immunization program in monitoring changes in circulating genotypes. PMID:24700073

  18. Phylogenetic analysis of rubella viruses identified in Uganda, 2003-2012.

    PubMed

    Namuwulya, Prossy; Abernathy, Emily; Bukenya, Henry; Bwogi, Josephine; Tushabe, Phionah; Birungi, Molly; Seguya, Ronald; Kabaliisa, Theopista; Alibu, Vincent P; Kayondo, Jonathan K; Rivailler, Pierre; Icenogle, Joseph; Bakamutumaho, Barnabas

    2014-12-01

    Molecular data on rubella viruses are limited in Uganda despite the importance of congenital rubella syndrome (CRS). Routine rubella vaccination, while not administered currently in Uganda, is expected to begin by 2015. The World Health Organization recommends that countries without rubella vaccination programs assess the burden of rubella and CRS before starting a routine vaccination program. Uganda is already involved in integrated case-based surveillance, including laboratory testing to confirm measles and rubella, but molecular epidemiologic aspects of rubella circulation have so far not been documented in Uganda. Twenty throat swab or oral fluid samples collected from 12 districts during routine rash and fever surveillance between 2003 and 2012 were identified as rubella virus RNA positive and PCR products encompassing the region used for genotyping were sequenced. Phylogenetic analysis of the 20 sequences identified 19 genotype 1G viruses and 1 genotype 1E virus. Genotype-specific trees showed that the Uganda viruses belonged to specific clusters for both genotypes 1G and 1E and grouped with similar sequences from neighboring countries. Genotype 1G was predominant in Uganda. More epidemiological and molecular epidemiological data are required to determine if genotype 1E is also endemic in Uganda. The information obtained in this study will assist the immunization program in monitoring changes in circulating genotypes. © 2014 Wiley Periodicals, Inc.

  19. Transitioning Lessons Learned and Assets of the Global Polio Eradication Initiative to Global and Regional Measles and Rubella Elimination.

    PubMed

    Kretsinger, Katrina; Strebel, Peter; Kezaala, Robert; Goodson, James L

    2017-07-01

    The Global Polio Eradication Initiative has built an extensive infrastructure with capabilities and resources that should be transitioned to measles and rubella elimination efforts. Measles continues to be a major cause of child mortality globally, and rubella continues to be the leading infectious cause of birth defects. Measles and rubella eradication is feasible and cost saving. The obvious similarities in strategies between polio elimination and measles and rubella elimination include the use of an extensive surveillance and laboratory network, outbreak preparedness and response, extensive communications and social mobilization networks, and the need for periodic supplementary immunization activities. Polio staff and resources are already connected with those of measles and rubella, and transitioning existing capabilities to measles and rubella elimination efforts allows for optimized use of resources and the best opportunity to incorporate important lessons learned from polio eradication, and polio resources are concentrated in the countries with the highest burden of measles and rubella. Measles and rubella elimination strategies rely heavily on achieving and maintaining high vaccination coverage through the routine immunization activity infrastructure, thus creating synergies with immunization systems approaches, in what is termed a "diagonal approach." © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  20. Serological statuses of pregnant women in an urban Brazilian population before and after the 2008 rubella immunization campaign.

    PubMed

    Avila Moura, Adriana; Mello, Maria Júlia Gonçalves de; Correia, Jailson B

    2016-01-20

    Vaccinating populations against rubella aims to mitigate viral circulation and to ensure that women of childbearing age are immunized to reduce the incidence of congenital rubella syndrome. This study determined the serological statuses of pregnant women in an urban Brazilian population before and after the national rubella immunization campaign that was undertaken in 2008, and it assessed the socio-demographic factors associated with seronegativity. Pregnant women living in Maceió, Alagoas, Brazil, who participated in a municipal prenatal screening program that involved blood tests for rubella, were assessed between June 2007 and May 2012. Socio-demographic factors associated with seronegativity were assessed, including the year of the blood test, categorized as before or after the 2008 immunization campaign, and the women's birth cohorts, the women's ethnicities, the gestational ages at the first prenatal visit, and the women's districts of residence. A total of 54,717 capillary blood samples were tested for rubella. The prevalence of pregnant women who were seronegative for rubella declined from 9.4% before the national immunization campaign to 2.8% after the national immunization campaign. Women were more likely to be seronegative for rubella before and after the immunization campaign if they were born between 1990 and 2000 or delayed starting prenatal care. The decline in the prevalence of pregnant women who were seronegative for rubella to <5% indicates that the 2008 Brazilian rubella immunization campaign was successful in Maceió. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Acute Rubella Virus Infection among Women with Spontaneous Abortion in Mwanza City, Tanzania.

    PubMed

    Lulandala, Lukombodzo; Mirambo, Mariam M; Matovelo, Dismas; Gumodoka, Balthazar; Mshana, Stephen E

    2017-03-01

    Acute rubella virus infection in early pregnancy has been associated with poor pregnancy outcome ranging from spontaneous abortion, stillbirth and multiple birth defects known as Congenital Rubella Syndrome (CRS). Despite its importance the prevalence of acute rubella virus infections is not known among women with spontaneous abortion in most centres in developing countries. The present study was aimed to determine the seroprevalence of acute rubella infection among women with spontaneous abortion in Mwanza city. A total of 268 women with spontaneous abortion were enrolled from four different hospitals in Mwanza city between November 2015 and April 2016. Blood samples were collected; sera were extracted and stored at -80°C until processing. Acute rubella virus infection was diagnosed by the detection of rubella specific IgM antibodies using indirect Enzyme Linked Immunosorbent Assay (ELISA) as per manufacturer's instructions. Data were analysed by using STATA version 11. The mean age of enrolled women was 26.3±5.6 years. The prevalence of acute rubella virus infection was found to be 9/268 (3.7%, 95% CI: 1-5). Only women residing in urban areas (AOR: 5.65, 95% CI: 1.15-27.77, p=0.035) were found to predict acute rubella virus infection among cases with spontaneous abortion in Mwanza city. About four out of hundred women residing in urban areas with spontaneous abortion in Mwanza are acutely infected with rubella virus highlighting the potential of this virus in contributing to poor pregnancy outcome in this setting.

  2. Congenital rubella still a public health problem in Italy: analysis of national surveillance data from 2005 to 2013.

    PubMed

    Giambi, C; Filia, A; Rota, M C; Del Manso, M; Declich, S; Nacca, G; Rizzuto, E; Bella, A

    2015-04-23

    In accordance with the goal of the World Health Organization Regional Office for Europe, the Italian national measles and rubella elimination plan aims to reduce the incidence of congenital rubella cases to less than one case per 100,000 live births by the end of 2015. We report national surveillance data for congenital rubella and rubella in pregnancy from 2005 to 2013. A total of 75 congenital rubella infections were reported; the national annual mean incidence was 1.5/100,000 live births, including probable and confirmed cases according to European Union case definition. Two peaks occurred in 2008 and 2012 (5.0 and 3.6/100,000 respectively). Overall, 160 rubella infections in pregnancy were reported; 69/148 women were multiparous and 38/126 had had a rubella antibody test before pregnancy. Among reported cases, there were 62 infected newborns, 31 voluntary abortions, one stillbirth and one spontaneous abortion. A total of 24 newborns were unclassified and 14 women were lost to follow-up, so underestimation is likely. To improve follow-up of cases, systematic procedures for monitoring infected mothers and children were introduced in 2013. To prevent congenital rubella, antibody screening before pregnancy and vaccination of susceptible women, including post-partum and post-abortum vaccination, should be promoted. Population coverage of two doses of measles-mumps-rubella vaccination of ≥ 95% should be maintained and knowledge of health professionals improved.

  3. Impact of the two-dose rubella vaccination regimen on incidence of rubella seronegativity in gravidae aged 25 years and younger

    PubMed Central

    Sahota, Daljit S.; Lao, Terence T.

    2017-01-01

    Objective This study compared the incidence of rubella seronegativity among gravidae of 25 year-old and younger, between those born in Hong Kong after 1983 when the two-dose rubella vaccination was implemented, versus gravidae born before, to examine the impact of the two-dose regimen. Methods In this retrospective cohort study, the incidence of antenatal rubella seronegativity in our parturients managed in1997-2015 was analysed by their age from ≤16 to 25 years, and the effect of year of birth was determined adjusting for confounding factors including teenage status, obstetric history, anthropometric factors, and health parameters including anaemia, thalassaemia trait and hepatitis B carrier status. Results Among the 12743 gravidae, the 6103 gravidae born after 1983 had overall higher rubella seronegativity (9.1% versus 4.4%, OR 2.061, 95% CI 1.797–2.364), with significant difference (p = 0.006) and inverse correlation (p<0.001) with age, in contrast to the 6640 gravidae born in/before 1983 whom there was significant difference (p = 0.027) but a positive correlation (p = 0.008) with age. For each year of age, the former had significantly higher incidence of rubella seronegativity except for those of ≤16 years. Regression analysis confirmed that birth after 1983 was independently associated with rubella seronegativity (aOR 2.207, 95% CI 1.902–2.562). Conclusion There was a significant trend between rubella seronegativity with age in young gravidae, but the pattern was opposite between gravidae born after versus in/before 1983, with the former having a higher incidence of seronegativity at all ages. Young women covered by the two-dose rubella immunisation programme have a paradoxically higher incidence of rubella seronegativity. PMID:28854204

  4. Impact of the two-dose rubella vaccination regimen on incidence of rubella seronegativity in gravidae aged 25 years and younger.

    PubMed

    Hui, Shuk Yi Annie; Sahota, Daljit S; Lao, Terence T

    2017-01-01

    This study compared the incidence of rubella seronegativity among gravidae of 25 year-old and younger, between those born in Hong Kong after 1983 when the two-dose rubella vaccination was implemented, versus gravidae born before, to examine the impact of the two-dose regimen. In this retrospective cohort study, the incidence of antenatal rubella seronegativity in our parturients managed in1997-2015 was analysed by their age from ≤16 to 25 years, and the effect of year of birth was determined adjusting for confounding factors including teenage status, obstetric history, anthropometric factors, and health parameters including anaemia, thalassaemia trait and hepatitis B carrier status. Among the 12743 gravidae, the 6103 gravidae born after 1983 had overall higher rubella seronegativity (9.1% versus 4.4%, OR 2.061, 95% CI 1.797-2.364), with significant difference (p = 0.006) and inverse correlation (p<0.001) with age, in contrast to the 6640 gravidae born in/before 1983 whom there was significant difference (p = 0.027) but a positive correlation (p = 0.008) with age. For each year of age, the former had significantly higher incidence of rubella seronegativity except for those of ≤16 years. Regression analysis confirmed that birth after 1983 was independently associated with rubella seronegativity (aOR 2.207, 95% CI 1.902-2.562). There was a significant trend between rubella seronegativity with age in young gravidae, but the pattern was opposite between gravidae born after versus in/before 1983, with the former having a higher incidence of seronegativity at all ages. Young women covered by the two-dose rubella immunisation programme have a paradoxically higher incidence of rubella seronegativity.

  5. Rubella outbreak investigation, Gokwe North District, Midlands province, Zimbabwe, 2014 - a case control study.

    PubMed

    Makoni, Annamercy Chenaimoyo; Chemhuru, Milton; Bangure, Donewell; Gombe, Notion Tafara; Tshimanga, Mufuta

    2015-01-01

    Rubella is a contagious disease, caused by rubella virus and transmitted via the respiratory route. Rubella in pregnancy may cause Congenital Rubella Syndrome (CRS), characterized by multiple defects to the brain, heart, eyes and ears. Gokwe North experienced an increase in rubella cases from 6 cases (24 June 2014) to 374 cases (12 August 2014). The study was conducted to determine risk factors associated with contracting rubella. A 1:1 unmatched case control study was conducted. A case was a child <15 years, resided in Gokwe North, with maculopapular rash and tested positive for rubella specific IgM or was linked epidemiologically to a laboratory confirmed case. Blood was collected for laboratory diagnosis. An interviewer administered questionnaire was used. Epi Info™ was used to analyze data. Eighty eight cases and 88 controls were recruited, median age for cases was 7 years (Q1 = 4, Q3 = 8) and 6 years (Q1 = 3, Q3 = 9) for controls. Independent risk factors for contracting rubella were; classmate contact (AOR 9.44; (95% CI 4.29-20.77)) and having >3 children in a household (AOR 2.59; 95%CI (1.23-5.42)). Only 10.2% and 6.8% of the caregivers' cases and controls respectively, knew rubella is spread through contact with an infected person (p = 0.57). Majority of caregivers (97.8%) reported to the health facility within two days of onset of rash. Outbreak was driven by contact at school and was spread into the community through school children. Screening and isolation of the sick controlled the outbreak. Routine rubella vaccination could be considered to prevent similar outbreaks.

  6. Rubella virus immunization status in preconception period among Chinese women of reproductive age: A nation-wide, cross-sectional study.

    PubMed

    Zhou, Qiongjie; Wang, Qiaomei; Shen, Haiping; Zhang, Yiping; Zhang, Shikun; Li, Xiaotian; Acharya, Ganesh

    2017-05-25

    Population-based studies on sero-epidemiology of Rubella in women before conception are lacking. The aim of this study was to investigate the sero-prevalence of Rubella in a nationwide survey among Chinese women planning to get pregnant within six months. This population-based, cross-sectional, sero-survey of Rubella virus infection was a part of the National Free Preconception Health Examination Project covering all 31 provinces in Mainland China. Women intending to get pregnant within six months was enrolled between 2010 and 12. Information on demographic characteristics (age, residence status, race, education and occupation) and vaccination history was obtained by interviews. Rubella virus IgG sero-positivity was determined using venous blood samples. Of 2,120,131 women recruited to the study, Rubella virus IgG serology was available in 1,974,188 (99.3%). Participating women were of young age (median=28years), mostly engaged in agricultural activities (78%), and the majority (90%) had high school education or lower. The overall prevalence of Rubella virus IgG sero-positivity was 58.4% (1,161,129); geographical variation ranged from 92.5% in Jilin to 20.1% in Qinghai and 0.0% in Tibet. Only 4.6% (n=91,604) women reported to have had Rubella virus vaccination, and it varied from 18.6% (Guangdong) to 0.2% (Qinghai). Self-reported vaccination status did not correlate with Rubella virus IgG seropositivity. Prevalence of Rubella sero-positivity is low among Chinese women of reproductive age and there are significant regional differences. Over 40% of women being susceptible to Rubella in preconception period calls for a targeted screening and vaccination strategy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Rubella epidemic in Vietnam: characteristic of rubella virus genes from pregnant women and their fetuses/newborns with congenital rubella syndrome.

    PubMed

    Pham, Van Hung; Nguyen, Thong Van; Nguyen, Truc Thanh Thi; Dang, Linh Duy; Hoang, Ngoc Hieu; Nguyen, Truong Van; Abe, Kenji

    2013-06-01

    Rubella remains poorly controlled in Southeast Asia, including Vietnam. The aim of this study was to characterize rubella virus spread in Vietnam during 2011-2012. Amniotic fluid, throat swab and placenta samples were collected from 130 patients (110 cases from pregnant women with suspected rubella and 20 cases from fetuses/newborns). Viral RNA was obtained directly from clinical specimens, amplified by PCR, and then the E1 gene containing 739 nucleotides recommended by the WHO to identify the viral genotypes was sequenced. By screening with real-time PCR, viral RNA was detectable in amniotic fluids from 103 out of 110 (93.6%) pregnant women with suspected rubella and in the throat swabs from all of 20 (100%) fetuses/newborns. In addition, viral RNA was also detected in the placenta from all cases of fetuses/newborns. All of 20 fetuses/newborns presented with congenital cataract. Twenty-four strains with the E1 gene were obtained by PCR. Using phylogenetic analysis with rubella reference sequences, all of the strains were found to be genotype 2B. Interestingly, 94% (30/32) of Vietnamese strains, including 9 strains from the database, formed an independent cluster within the genotype 2B suggesting that indigenous viruses are prevalent in this region. Rubella virus identified in Vietnam belonged to the genotype 2B. Importantly, the infection rate of rubella virus in fetuses/newborns was 100% and all of them had congenital cataract. Our results indicate an establishment of rubella prevention in this area is an urgent task in order to improve maternal and child health. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Analysis of whole genome sequences of 16 strains of rubella virus from the United States, 1961-2009.

    PubMed

    Abernathy, Emily; Chen, Min-hsin; Bera, Jayati; Shrivastava, Susmita; Kirkness, Ewen; Zheng, Qi; Bellini, William; Icenogle, Joseph

    2013-01-25

    Rubella virus is the causative agent of rubella, a mild rash illness, and a potent teratogenic agent when contracted by a pregnant woman. Global rubella control programs target the reduction and elimination of congenital rubella syndrome. Phylogenetic analysis of partial sequences of rubella viruses has contributed to virus surveillance efforts and played an important role in demonstrating that indigenous rubella viruses have been eliminated in the United States. Sixteen wild-type rubella viruses were chosen for whole genome sequencing. All 16 viruses were collected in the United States from 1961 to 2009 and are from 8 of the 13 known rubella genotypes. Phylogenetic analysis of 30 whole genome sequences produced a maximum likelihood tree giving high bootstrap values for all genotypes except provisional genotype 1a. Comparison of the 16 new complete sequences and 14 previously sequenced wild-type viruses found regions with clusters of variable amino acids. The 5' 250 nucleotides of the genome are more conserved than any other part of the genome. Genotype specific deletions in the untranslated region between the non-structural and structural open reading frames were observed for genotypes 2B and genotype 1G. No evidence was seen for recombination events among the 30 viruses. The analysis presented here is consistent with previous reports on the genetic characterization of rubella virus genomes. Conserved and variable regions were identified and additional evidence for genotype specific nucleotide deletions in the intergenic region was found. Phylogenetic analysis confirmed genotype groupings originally based on structural protein coding region sequences, which provides support for the WHO nomenclature for genetic characterization of wild-type rubella viruses.

  9. Elucidation of the full genetic information of Japanese rubella vaccines and the genetic changes associated with in vitro and in vivo vaccine virus phenotypes.

    PubMed

    Otsuki, Noriyuki; Abo, Hitoshi; Kubota, Toru; Mori, Yoshio; Umino, Yukiko; Okamoto, Kiyoko; Takeda, Makoto; Komase, Katsuhiro

    2011-02-24

    Rubella is a mild disease characterized by low-grade fever, and a morbilliform rash, but causes congenital defects in neonates born from mothers who suffered from rubella during the pregnancy. After many passages of wild-type rubella virus strains in various types of cultured cells, five live attenuated rubella vaccines were developed in Japan. An inability to elicit anti-rubella virus antibodies in experimentally infected animals was used as an in vivo marker phenotype of Japanese rubella vaccines. All Japanese rubella vaccine viruses exhibit a temperature-sensitive (ts) phenotype, and replicate very poorly at a high temperature. We determined the entire genome sequences of three Japanese rubella vaccines (Matsuba, TCRB19, and Matsuura), thereby completing the sequencing of all five Japanese rubella vaccines. In addition, the entire genome sequences of three vaccine progenitors were determined. Comparative nucleotide sequence analyses revealed mutations that were introduced into the genomes of the TO-336 and Matsuura vaccines during their production by laboratory passaging. Analyses involving cellular expression of viral P150 nonstructural protein-derived peptides revealed that the N1159S mutation conferred the ts phenotype on the TO-336 vaccine, and that reduced thermal stability of the P150 protease domain was a cause of the ts phenotype of some rubella vaccine viruses. The ts phenotype of vaccine viruses was not necessarily correlated with their inability to elicit humoral immune responses in animals. Therefore, the molecular mechanisms underlying the inability of these vaccines to elicit humoral responses in animals are more complicated than the previously considered mechanism involving the ts phenotype as the major cause. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Informing rubella vaccination strategies in East Java, Indonesia through transmission modelling.

    PubMed

    Wu, Yue; Wood, James; Khandaker, Gulam; Waddington, Claire; Snelling, Thomas

    2016-11-04

    An estimated 110,000 babies are born with congenital rubella syndrome (CRS) worldwide annually; a significant proportion of cases occur in Southeast Asia. Rubella vaccine programs have led to successful control of rubella and CRS, and even the elimination of disease in many countries. However, if vaccination is poorly implemented it might increase the number of women reaching childbearing age who remain susceptible to rubella and thereby paradoxically increase CRS. We used an age-structured transmission model to compare seven alternative vaccine strategies for their impact on reducing CRS disease burden in East Java, a setting which is yet to implement a rubella vaccine program. We also investigated the robustness of model predictions to variation in vaccine coverage and other key epidemiological factors. Without rubella vaccination, approximately 700 babies are estimated to be born with CRS in East Java every year at an incidence of 0.77 per 1000live births. This incidence could be reduced to 0.0045 per 1000 live births associated with 99.9% annual reduction in rubella infections after 20 years if the existing two doses of measles vaccine are substituted with two doses of measles plus rubella combination vaccine with the same coverage (87.8% of 9-month-old infants and 80% of 6-year-old children). By comparison a single dose of rubella vaccine will take longer to reduce the burden of rubella and CRS and will be less robust to lower vaccine coverage. While the findings of this study should be informative for settings similar to East Java, the conclusions are dependent on vaccine coverage which would need consideration before applying to all of Indonesia and elsewhere in Asia. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Serological evidence of acute rubella infection among under-fives in Mwanza: a threat to increasing rates of congenital rubella syndrome in Tanzania.

    PubMed

    Mirambo, Mariam M; Aboud, Said; Mushi, Martha F; Seugendo, Mwanaisha; Majigo, Mtebe; Groß, Uwe; Mshana, Stephen E

    2016-05-25

    Control of rubella infection is essential for preventing congenital rubella syndrome (CRS) and one of the important steps is to define a target population for vaccination. Therefore this study was done to determine serological evidence of acute rubella infection among under-fives in order to anticipate the magnitude of rubella virus transmission in Tanzania. A cross-sectional study involving children aged between 1 and 59 months was conducted between September and October 2014 before national rubella vaccination campaigns commenced. Rubella IgM antibodies were detected using commercial indirect enzyme-linked immunosorbent assay (ELISA). Data were analyzed using STATA version 11. A total of230 under-fives were enrolled, their median age was 14 (Interquartile range (IQR) 7-26) months. The overall seroprevalence of rubella IgM antibodies was 10.9 % (25/230) with two confirmed cases of CRS. Two-sample Wilcoxon rank-sum test showed that the median age of rubella IgM seropositive children was significantly higher than that of IgM seronegative children (39 IQR: 18-51months vs. 14 IQR: 7-24 months, P < 0.001). On multivariate logistic regression analysis increase in age (OR: 1.07, 95 % CI; 1.03-1.1, P < 0.001) and residing in rural areas (OR: 8.07, 95 % CI; 1.43-45.6, P = 0.018) were independently found to predict acute rubella infection among under-fives. Our findings indicate that rubella virus is prevalent in our setting posing a risk of transmitting to childbearing aged women hence increasing the risk of CRS. Increasing prevalence of acute infection with age in under-fives indicates the protective role of maternal antibodies among infants. The sustained vaccination programme of under-fives as effective measure to control CRS should be emphasized in developing countries.

  12. Serosurvey of rubella in five blocks of Tamil Nadu.

    PubMed

    Ramamurty, Nalini; Murugan, S; Raja, D; Elango, Varalaksmi; Mohana; Dhanagaran, D

    2006-01-01

    Rubella, normally a mild, self-limiting disease characterized by rash, fever and lymphadenopathy, is a vaccine preventable disease. It carries little morbidity and apparently only minor complications in children. Infection during early pregnancy may lead to congenital rubella infection. Presence of rubella specific IgG in an unvaccinated population is a long term marker of previous rubella infection, which helps to assess the immune status of that population. Though many seroprevalence studies on rebella have been reported earlier from India, no study has been conducted in recent years. We undertook this study in 2003 in five blocks identified by the Integrated Child Development Scheme (ICDS), in the five districts of Tamil Nadu to assess the immune status to rubella in two age groups (1-5 yr boys and girls and 10-16 yr adolescent girls) before vaccination and draw strategies for future vaccination programme. A total of 300 blood samples were collected by vein puncture from girls and boys of 1-5 yr age and adolescent girls of 10-16 yr age. Samples were tested for the presence of rubella specific IgG antibody by ELISA. Of the 300 samples tested, 145 (48.3%) were negative for rubella IgG antibodies. The seronegativity was 82.2 per cent in 1-5 yr and 13.5 per cent in the 10-16 yr age groups, the difference was statistically significant (P<0.001). Large percentage of children, 82.2 per cent in the 1-5 yr age group and 13.5 per cent in 10-16 yr population were susceptible to rubella infection highlighting the fact that there was a risk of congenital rubella syndrome. There is a need to implement routine measles, mumps, rubella (MMR) immunization programme for under five children and mass scale one time immunization with monovalent rubella vaccine for adolescent girls.

  13. Hospital-based surveillance of congenital rubella syndrome in Indonesia.

    PubMed

    Herini, Elisabeth Siti; Gunadi; Triono, Agung; Mulyadi, Asal Wahyuni Erlin; Mardin, Niprida; Rusipah; Soenarto, Yati; Reef, Susan E

    2017-03-01

    Congenital rubella syndrome (CRS) has serious consequences, such as miscarriage, stillbirth, and severe birth defects in infants, resulting from rubella virus infection during pregnancy. However, rubella vaccine has not yet been implemented in Indonesia. This study aimed (1) to estimate the incidence of CRS in Indonesia, (2) describe the clinical features of CRS at our referral hospital, and (3) pilot a CRS surveillance system to be extended to other hospitals. We conducted a 4-month prospective surveillance study of infants aged <1 year with suspected CRS in 2013 at an Indonesian hospital. Infants with suspected CRS were examined for rubella-specific IgM antibody or rubella IgG antibody levels. Of 47 suspected cases of CRS, 11/47 (23.4%), 9/47 (19.1%), and 27/47 (57.5%) were diagnosed as laboratory-confirmed, clinically compatible, and discarded CRS, respectively. The most common defects among laboratory-confirmed CRS cases were hearing impairment (100%), congenital cataracts (72.7%), microcephaly (72.7%), and congenital heart defects (45.5%). The number of laboratory-confirmed CRS cases among Indonesian infants is high. Furthermore, hearing impairment is the most common clinical feature of CRS in infants. Our findings indicate the importance of implementation of rubella vaccine in Indonesia. Conducting hospital-based surveillance of CRS in other hospitals in Indonesia may be appropriate. What is Known: •Congenital rubella syndrome (CRS) has serious consequences in infants resulting from rubella virus infection during pregnancy. •The incidence of CRS in most developed countries has greatly decreased since implementation of rubella vaccination. •Rubella vaccine has not yet been implemented in many developing countries. What is New: •The number of laboratory-confirmed CRS cases among Indonesian infants was high. •Implementation of rubella vaccine into immunization programs in Indonesia is important because of the high number of CRS cases. •Our study highlights the need for ongoing prospective surveillance of CRS in Indonesia.

  14. Epidemiology of rubella infection in Cameroon: a 7-year experience of measles and rubella case-based surveillance, 2008–2014

    PubMed Central

    Nimpa Mengouo, Marcellin; Ndze, Valantine Ngum; Baonga, Frangy; Kobela, Marie; Wiysonge, Charles Shey

    2017-01-01

    Objective The aim of this study was to estimate the proportion of rubella disease in a measles case-based surveillance in Cameroon prior to rubella vaccine introduction into the national immunisation programme. Design This was a cross-sectional study for rubella infection in Cameroon for the period 2008 to 2014. Setting Patients suspected with measles from the 10 regions of Cameroon were recruited according to the WHO measles case definition and were tested for rubella IgM antibodies accompanied with the case report/investigation forms. Participants All persons with rash and fever within 14 days of onset of rash according to the standard WHO African Regional Office (WHO/AFRO) case definition for a suspected measles case. Outcome measures Descriptive analyses and simple logistic regressions were performed. OR were estimated. Results A total of 9907 serum samples from people with fever and rash were received in the laboratory from 2008 to 2014. A total of 7489 (75.59%) measles-negative samples were tested for rubella; 699 (9.3%) were positive for rubella IgM antibodies. Logistic regression analysis was done using IgM antibodies detection as the outcome variable. Age, sex and setting were explanatory variables. Logistic regression analysis revealed that, comparing the proportion of rubella IgM seropositivity status by age, the association to a positive rubella IgM increased with age from 1 to 4 years (OR 7.11; 95% CI 4.35 to 12.41; p<0.0001), through 5 to 9 years (OR 13.07; 95% CI 7.93 to 22.93; p<0.001), to 10 to 14 years of age (OR 13.86; 95% CI 8.06 to 25.12; p<0.001). Persons aged ≥15 years were also more likely to have rubella infection than children under one (OR 3.69; 95% CI 1.85 to 7.48; p=0.0001). There were also significant associations with sex, with males being less associated to a positive rubella serology than females (OR 1.33; 95% CI 1.14 to 1.56; p=0.0001). No statistically significant difference in proportion of rubella cases was observed between urban and rural populations (OR 1.11; 95% CI 0.94 to 1.31; p=0.208). Conclusions This study reveals that rubella virus circulates in Cameroon, with important number of cases in children under 15 years. This finding supports the planned introduction of rubella-containing vaccines into the Expanded Program on Immunization. PMID:28389483

  15. Global and national laboratory networks support high quality surveillance for measles and rubella.

    PubMed

    Xu, Wenbo; Zhang, Yan; Wang, Huiling; Zhu, Zhen; Mao, Naiying; Mulders, Mick N; Rota, Paul A

    2017-05-01

    Laboratory networks are an essential component of disease surveillance systems because they provide accurate and timely confirmation of infection. WHO coordinates global laboratory surveillance of vaccine preventable diseases, including measles and rubella. The more than 700 laboratories within the WHO Global Measles and Rubella Laboratory Network (GMRLN) supports surveillance for measles, rubella and congenial rubella syndrome in 191 counties. This paper describes the overall structure and function of the GMRLN and highlights the largest of the national laboratory networks, the China Measles and Rubella Laboratory Network. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  16. Stability of the Rabbit Immunogenic Marker of RA 27/3 Rubella Vaccine Virus After Human Passage

    PubMed Central

    Linnemann, Calvin C.; Hutchinson, Leslie; Rotte, Thomas C.; Hegg, Marion E.; Schiff, Gilbert M.

    1974-01-01

    Rabbits were inoculated intravenously with “wild” rubella virus, RA 27/3 rubella vaccine virus, or rubella virus isolated from recipients of RA 27/3 vaccine. Rabbits receiving “wild” virus developed rubella hemagglutination inhibition antibody, and those receiving vaccine virus did not. One of the five reisolates tested produced a low transient antibody response in two of the five rabbits inoculated with this strain. The study indicates that the rabbit immunogenic marker after intravenous injection can be used to determine if a rubella virus isolated from a patient is of “wild” or vaccine origin. There was no significant change in the reduced immunogenicity characteristics of the RA 27/3 vaccine virus after human passage. PMID:4206028

  17. [Entification of the Rubella virus genotype 1H in Western Siberia].

    PubMed

    Seregin, S V; Babkin, I V; Petrova, I D; Iashina, L N; Malkova, E M; Petrov, V S

    2011-01-01

    Molecular epidemiological study of novel strain of Rubella virus isolated during the outbreak in Western Siberia in 2004 was described. Detailed phylogenetic analysis performed based upon entire SP-region, which encodes all three Rubella structural proteins (C, E2, and E1), was implemented. This analysis provides characterization of this strain and classifies it as 1H genotype, thereby correcting previous classification of this strain based upon shorter nucleotide sequence, only encoding E1 protein. Therefore, this study identified the genotype of the Rubella virus not previously detected in Western Siberia (and even entire Russian Federation), which highlights the importance of more extensive characterization of genetic variability of the Rubella virus, especially with regard to potential influence of vaccination on the Rubella virus mutagenesis.

  18. Measles, mumps, rubella, and human parvovirus B19 infections and neurologic disease.

    PubMed

    Bale, James F

    2014-01-01

    While the systemic disorders associated with measles, mumps, and rubella viruses and human parvovirus B19 tend to be mild, each virus can produce potentially life-threatening neurologic disease in human hosts, especially when these viruses infect young children. Two of the viruses, rubella and parvovirus B19, can be vertically transmitted to fetuses during maternal infection and cause congenital infection. Neurologic complications are common after intrauterine infection with the rubella virus, a condition known as the congenital rubella syndrome. Two, measles and rubella viruses, can induce "slow viral" infections, serious, disorders that can occur several years after the initial exposure to the virus and typically have fatal outcomes. © 2014 Elsevier B.V. All rights reserved.

  19. Seroprevalences of Specific IgG Antibodies to Measles, Mumps, and Rubella in Korean Infants.

    PubMed

    Cho, Hye Kyung; Lee, Hyunju; Kim, Han Wool; Kim, Sung Soon; Kang, Hae Ji; Kim, In Tae; Kim, Kyung Hyo

    2016-12-01

    In this study, the seroprevalences of measles, mumps, and rubella antibodies in infants were determined to assess the immunization strategy and control measures for these infectious diseases. Serum samples from infants < 1 year of age and their mothers were collected to measure the concentrations of specific IgG antibodies to measles, mumps, and rubella by enzyme-linked immunosorbent assay. For selected infant serum samples, measles-specific neutralizing antibody levels were determined by using the plaque reduction neutralization test. The sera from 295 of infants and 80 of their mothers were analyzed. No infants had past measles, mumps, or rubella infections. Almost all infants < 2 months of age were positive for measles and rubella IgG antibodies. However, seroprevalence of measles and rubella antibodies decreased with age, and measles IgG and rubella IgG were barely detectable after 4 months of age. The seroprevalence of mumps antibodies was lower than that of measles and rubella antibodies in infants ≤ 4 months old, and mumps IgG was barely detectable after 2 months of age. The seropositivity of measles-specific neutralizing antibody was 63.6% in infants aged 2 months and undetectable in infants ≥ 6 months old. Because the seropositivity rates of measles, mumps, and rubella antibodies were low after the first few months of age in Korean infants, active immunization with vaccines is strongly recommended for infants aged 6-11 months when measles is epidemic. Timely administration of the first dose of measles-mumps-rubella vaccine at 12 months of age should be encouraged in non-epidemic situations.

  20. Rubella Immunity in Pregnant Native Taiwanese and Immigrants from Asian Countries

    PubMed Central

    Zen, Yeong-Hwa; Shih, Ching-Tang; Kung, Wan-Ju; Lee, Chien-Hung; Lin, Ching-Chiang

    2017-01-01

    Vaccination is considered the most effective method to prevent rubella spread and congenital rubella syndrome (CRS). The aim of the present study was to investigate the rubella immunity among native and immigrant pregnant women in Taiwan. From 2000 to 2014, a total of 16,879 pregnant women who received routine prenatal examinations were recruited in this study. The rubella IgG antibodies were assayed using a microparticle enzyme immunoassay or chemiluminescent microparticle immunoassay. Subjects were categorized by nationality and subcategorized by specific periods of time for comparison. The rubella susceptibility was 12.7% in total, 11.1% in Taiwanese and 20.3% in immigrant population from 2000 to 2014. Among the immigrant women, those from Vietnam had the highest susceptibility (22.3%) and those from Thailand had the lowest susceptibility (3.8%). The immigrant women from Vietnam and China showed a significantly higher susceptibility compared with the native Taiwanese women in which the odds ratio was 2.30 (95% confidence interval [CI]: 2.04–2.60), 1.96 (95% CI: 1.59–2.41), respectively (P < 0.001). It meant that immigrants from Vietnam and China had a higher likelihood of rubella susceptibility and related CRS sequela than native women. From 2000–2004 to 2010–2014 cohort, there was no obvious change in rubella susceptibility in native women, which varied between 10.0% and 11.9%. However, there was a decreasing trend of rubella susceptibility in the immigrant women overall, from 24.5% to 11.5% (P < 0.001). To eliminate congenital rubella in Taiwan, additional catch-up immunization strategies are needed. PMID:27895276

  1. Seroprevalences of Specific IgG Antibodies to Measles, Mumps, and Rubella in Korean Infants

    PubMed Central

    2016-01-01

    In this study, the seroprevalences of measles, mumps, and rubella antibodies in infants were determined to assess the immunization strategy and control measures for these infectious diseases. Serum samples from infants < 1 year of age and their mothers were collected to measure the concentrations of specific IgG antibodies to measles, mumps, and rubella by enzyme-linked immunosorbent assay. For selected infant serum samples, measles-specific neutralizing antibody levels were determined by using the plaque reduction neutralization test. The sera from 295 of infants and 80 of their mothers were analyzed. No infants had past measles, mumps, or rubella infections. Almost all infants < 2 months of age were positive for measles and rubella IgG antibodies. However, seroprevalence of measles and rubella antibodies decreased with age, and measles IgG and rubella IgG were barely detectable after 4 months of age. The seroprevalence of mumps antibodies was lower than that of measles and rubella antibodies in infants ≤ 4 months old, and mumps IgG was barely detectable after 2 months of age. The seropositivity of measles-specific neutralizing antibody was 63.6% in infants aged 2 months and undetectable in infants ≥ 6 months old. Because the seropositivity rates of measles, mumps, and rubella antibodies were low after the first few months of age in Korean infants, active immunization with vaccines is strongly recommended for infants aged 6–11 months when measles is epidemic. Timely administration of the first dose of measles-mumps-rubella vaccine at 12 months of age should be encouraged in non-epidemic situations. PMID:27822935

  2. Acute Rubella Virus Infection among Women with Spontaneous Abortion in Mwanza City, Tanzania

    PubMed Central

    Lulandala, Lukombodzo; Matovelo, Dismas; Gumodoka, Balthazar; Mshana, Stephen E

    2017-01-01

    Introduction Acute rubella virus infection in early pregnancy has been associated with poor pregnancy outcome ranging from spontaneous abortion, stillbirth and multiple birth defects known as Congenital Rubella Syndrome (CRS). Despite its importance the prevalence of acute rubella virus infections is not known among women with spontaneous abortion in most centres in developing countries. Aim The present study was aimed to determine the seroprevalence of acute rubella infection among women with spontaneous abortion in Mwanza city. Materials and Methods A total of 268 women with spontaneous abortion were enrolled from four different hospitals in Mwanza city between November 2015 and April 2016. Blood samples were collected; sera were extracted and stored at -80°C until processing. Acute rubella virus infection was diagnosed by the detection of rubella specific IgM antibodies using indirect Enzyme Linked Immunosorbent Assay (ELISA) as per manufacturer’s instructions. Data were analysed by using STATA version 11. Results The mean age of enrolled women was 26.3±5.6 years. The prevalence of acute rubella virus infection was found to be 9/268 (3.7%, 95% CI: 1-5). Only women residing in urban areas (AOR: 5.65, 95% CI: 1.15-27.77, p=0.035) were found to predict acute rubella virus infection among cases with spontaneous abortion in Mwanza city. Conclusion About four out of hundred women residing in urban areas with spontaneous abortion in Mwanza are acutely infected with rubella virus highlighting the potential of this virus in contributing to poor pregnancy outcome in this setting. PMID:28511456

  3. Prevalence of Rubella Antibodies Among Children in the Democratic Republic of the Congo.

    PubMed

    Alfonso, Vivian H; Doshi, Reena H; Mukadi, Patrick; Higgins, Stephen G; Hoff, Nicole A; Bwaka, Ado; Mwamba, Guillaume Ngoie; Okitolonda, Emile; Muyembe, Jean-Jacques; Gerber, Sue; Rimoin, Anne W

    2018-01-01

    While generally mild in children, rubella infection in early pregnancy can lead to miscarriage, fetal death or congenital rubella syndrome. Rubella vaccination is not yet available as a part of routine immunization in the Democratic Republic of the Congo (DRC), and the burden of infection is unknown. In collaboration with the 2013-2014 DRC Demographic and Health Survey, a serosurvey was carried out to assess population immunity to vaccine-preventable diseases. Dry blood spot samples collected from children 6-59 months of age were processed using the Dynex Technologies Multiplier FLEX chemiluminescent immunoassay platform (Dynex Technologies, Chantilly, VA). Among the 7195 6- to 59-month-old children, 33% were positive and <1% indeterminate for rubella antibodies in weighted analyses. Seroprevalence was positively associated with age of the child and province, with seropositivity highest in Bandundu (53%) and lowest in Kasai-Oriental (20%). In multivariate analyses, serologic evidence of infection was associated with age of the mother and child, socioeconomic status and geographic location. Rubella infection is prevalent among children in the DRC, and while most seroconversion occurs in young children, a significant proportion of children remain at risk and may enter reproductive age susceptible to rubella infection. While not currently in place, implementation of a surveillance program will provide improved estimates of both rubella virus circulation and the burden of congenital rubella syndrome. Such information will play an important role in future policy decisions, vaccine delivery strategies and may provide a basis upon which the effectiveness of rubella antigen introduction may be assessed.

  4. Seroepidemiology of Rubella in Mozambique, 2006-2014: Implications for Rubella Immunization in Settings With High Fertility Rates.

    PubMed

    Amade, Nádia Alves; Sultane, Thebora; Augusto, Orvalho; Ali, Sádia; Jani, Ilesh V; Gudo, Eduardo Samo

    2016-10-01

    Rubella and congenital rubella syndrome are highly underreported and neglected in most sub-Saharan countries and vaccination has not yet been incorporated into their national immunization schedules. In this study, we investigated the frequency of immunoglobulin M antibodies against rubella and examined correlations with fertility rates during the period from 2006 to 2014 in Mozambique. We conducted a retrospective analysis of data collected through the routine case-based surveillance system for measles in Mozambique. A total of 7312 serum samples from suspected cases of measles were tested between 2006 and 2014. The median age was 4 years (interquartile range: 1-8 years). Of these, 1331 (18.2%) were positive for immunoglobulin M anti-rubella. The highest frequency of rubella was observed within the 5-9-year-old age group (32.6%). The frequency in the age groups <1 years old, 1-4, 10-14, 15-19, 20-29 and ≥30 were 4.5%, 13.1%, 28.7%,18.7%, 5.2% and 5.1%, respectively. Our data show that rubella is frequent among women of childbearing age in Mozambique. Considering that early pregnancy is common in Mozambique, this suggests that, in settings such as ours, the introduction of routine rubella vaccination in children should be accompanied by repeated vaccination campaigns targeting older children and adolescents.

  5. Evaluation of the World Health Organization global measles and rubella quality assurance program, 2001-2008.

    PubMed

    Stambos, Vicki; Leydon, Jennie; Riddell, Michaela; Clothier, Hazel; Catton, Mike; Featherstone, David; Kelly, Heath

    2011-07-01

    During 2001-2008, the Victorian Infectious Diseases Reference Laboratory (VIDRL) prepared and provided a measles and rubella proficiency test panel for distribution to the World Health Organization (WHO) measles and rubella network laboratories as part of their annual laboratory accreditation assessment. Panel test results were forwarded to VIDRL, and results from 8 consecutive years were analyzed. We assessed the type of assays used and results achieved on the basis of the positive and negative interpretation of submitted results, by year and WHO region, for measles and rubella. Over time, there has been a noticeable increase in laboratory and WHO regional participation. For all panels, the proportion of laboratories in all WHO regions using the WHO-validated Dade Behring assay for measles and rubella-specific IgM antibodies ranged from 35% to 100% and 59% to 100%, respectively. For all regions and years, the proportion of laboratories obtaining a pass score ranged from 87% to 100% for measles and 93% to 100% for rubella. During 2001-2008, a large proportion of laboratories worldwide achieved and maintained a pass score for both measles and rubella. Measles and rubella proficiency testing is regarded as a major achievement for the WHO measles and rubella laboratory program. © The Author 2011. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved.

  6. Seroprevalence of rubella among Jordanian women of childbearing age.

    PubMed

    Jarour, Najwa; Hayajneh, Wail A; Balbeesi, Adel; Otoom, Haidar; Al-Shurman, Abdullah; Kharabsheh, Sa'ad

    2007-05-04

    This study was conducted to assess immunity (seroprevalence) to rubella among Jordanian women of childbearing age. A multistage cluster sampling was used to recruit 1125 women of childbearing age (15-49 year) from the 12 Governorates of Jordan. Anti-rubella antibody titers were measured using enzyme-linked immunoassays. The overall immunity rate to rubella among women in childbearing age was 90.9% (CI: 88.8-92.9). However, the immunity rate was significantly lower in younger women aged 15-19 years (83%) compared to the whole cohort (P

  7. Global Measles and Rubella Laboratory Network Support for Elimination Goals, 2010-2015.

    PubMed

    Mulders, Mick N; Rota, Paul A; Icenogle, Joseph P; Brown, Kevin E; Takeda, Makoto; Rey, Gloria J; Ben Mamou, Myriam C; Dosseh, Annick R G A; Byabamazima, Charles R; Ahmed, Hinda J; Pattamadilok, Sirima; Zhang, Yan; Gacic-Dobo, Marta; Strebel, Peter M; Goodson, James L

    2016-05-06

    In 2012, the World Health Assembly endorsed the Global Vaccine Action Plan (GVAP)* with the objective to eliminate measles and rubella in five World Health Organization (WHO) regions by 2020. In September 2013, countries in all six WHO regions had established measles elimination goals, and additional goals for elimination of rubella and congenital rubella syndrome were established in three regions (1). Capacity for surveillance, including laboratory confirmation, is fundamental to monitoring and verifying elimination. The 2012-2020 Global Measles and Rubella Strategic Plan of the Measles and Rubella Initiative(†) calls for effective case-based surveillance with laboratory testing for case confirmation (2). In 2000, the WHO Global Measles and Rubella Laboratory Network (GMRLN) was established to provide high quality laboratory support for surveillance (3). The GMRLN is the largest globally coordinated laboratory network, with 703 laboratories supporting surveillance in 191 countries. During 2010-2015, 742,187 serum specimens were tested, and 27,832 viral sequences were reported globally. Expansion of the capacity of the GMRLN will support measles and rubella elimination efforts as well as surveillance for other vaccine-preventable diseases (VPDs), including rotavirus, and for emerging pathogens of public health concern.

  8. Standardization of Assays That Detect Anti-Rubella Virus IgG Antibodies

    PubMed Central

    Grangeot-Keros, Liliane; Vauloup-Fellous, Christelle

    2015-01-01

    SUMMARY Rubella virus usually causes a mild infection in humans but can cause congenital rubella syndrome (CRS). Vaccination programs have significantly decreased primary rubella virus infection and CRS; however, vaccinated individuals usually have lower levels of rubella virus IgG than those with natural infections. Rubella virus IgG is quantified with enzyme immunoassays that have been calibrated against the World Health Organization (WHO) international standard and report results in international units per milliliter. It is recognized that the results reported by these assays are not standardized. This investigation into the reasons for the lack of standardization found that the current WHO international standard (RUB-1-94) fails by three key metrological principles. The standard is not a pure analyte but is composed of pooled human immunoglobulin. It was not calibrated by certified reference methods; rather, superseded tests were used. Finally, no measurement uncertainty estimations have been provided. There is an analytical and clinical consequence to the lack of standardization of rubella virus IgG assays, which leads to misinterpretation of results. The current approach to standardization of rubella virus IgG assays has not achieved the desired results. A new approach is required. PMID:26607813

  9. Reactogenicity and immunogenicity of measles-rubella combined vaccine in school-entry-aged subjects with naturally acquired measles immunity.

    PubMed

    Kumagai, Takuji; Ihara, Toshiaki; Nakayama, Tetsuo; Nagata, Nobuo; Kamiya, Hitoshi

    2015-08-01

    The reintroduction of measles-rubella combined (MR) vaccination to Japan raised concerns about adverse events as well as immunogenicity related to booster immunization in subjects with naturally acquired immunity to measles or rubella. The time course of reactogenicity and antibody responses in recipients with pre-existing immunity to measles through natural infection was observed. Eighteen children aged 80-104 months received MR booster vaccination; 16 of them had had previous rubella vaccination. There were virtually no clinical reactions related to booster vaccination, and a highly significant antibody response to rubella antigen, whereas the antibody rise to measles was statistically significant but poor. Vaccination of individuals already immune is not harmful. Booster immunization to rubella for Japanese children is vitally important. © 2015 Japan Pediatric Society.

  10. Molecular epidemiology of rubella viruses involved in congenital rubella infections in São Paulo, Brazil, between 1996 and 2009.

    PubMed

    Curti, Suely Pires; Figueiredo, Cristina Adelaide; de Oliveira, Maria Isabel; Andrade, Joelma Queiroz; Zugaib, Marcelo; Frugis Yu, Ana Lucia; Oliveira, Danielle Bruna; Durigon, Edison Luiz

    2013-11-01

    Rubella virus (RV) infection during the early stages of pregnancy can lead to serious birth defects, known as congenital rubella syndrome (CRS). This retrospective study was conducted between 1996 and 2009 with surveillance specimens collected from patients suspected of congenital rubella infection (CRI) and CRS. The clinical samples (nine amminiotic fluid, eight urine, eight blood, one conception product, and one placenta) were sent for viral isolation and genotyping. Twenty-seven sequences were analysed and four genotypes (1a, 1B, 1G, and 2B) were identified in São Paulo that were involved in congenital infection. To our knowledge, this study is the first report that describes genetic diversity of the circulating rubella strains involved in CRI. Copyright © 2013 Wiley Periodicals, Inc.

  11. Epidemiology of rubella infection in Cameroon: a 7-year experience of measles and rubella case-based surveillance, 2008-2014.

    PubMed

    Nimpa Mengouo, Marcellin; Ndze, Valantine Ngum; Baonga, Frangy; Kobela, Marie; Wiysonge, Charles Shey

    2017-04-07

    The aim of this study was to estimate the proportion of rubella disease in a measles case-based surveillance in Cameroon prior to rubella vaccine introduction into the national immunisation programme. This was a cross-sectional study for rubella infection in Cameroon for the period 2008 to 2014. Patients suspected with measles from the 10 regions of Cameroon were recruited according to the WHO measles case definition and were tested for rubella IgM antibodies accompanied with the case report/investigation forms. All persons with rash and fever within 14 days of onset of rash according to the standard WHO African Regional Office (WHO/AFRO) case definition for a suspected measles case. Descriptive analyses and simple logistic regressions were performed. OR were estimated. A total of 9907 serum samples from people with fever and rash were received in the laboratory from 2008 to 2014. A total of 7489 (75.59%) measles-negative samples were tested for rubella; 699 (9.3%) were positive for rubella IgM antibodies. Logistic regression analysis was done using IgM antibodies detection as the outcome variable. Age, sex and setting were explanatory variables. Logistic regression analysis revealed that, comparing the proportion of rubella IgM seropositivity status by age, the association to a positive rubella IgM increased with age from 1 to 4 years (OR 7.11; 95% CI 4.35 to 12.41; p<0.0001), through 5 to 9 years (OR 13.07; 95% CI 7.93 to 22.93; p<0.001), to 10 to 14 years of age (OR 13.86; 95% CI 8.06 to 25.12; p<0.001). Persons aged ≥15 years were also more likely to have rubella infection than children under one (OR 3.69; 95% CI 1.85 to 7.48; p=0.0001). There were also significant associations with sex, with males being less associated to a positive rubella serology than females (OR 1.33; 95% CI 1.14 to 1.56; p=0.0001). No statistically significant difference in proportion of rubella cases was observed between urban and rural populations (OR 1.11; 95% CI 0.94 to 1.31; p=0.208). This study reveals that rubella virus circulates in Cameroon, with important number of cases in children under 15 years. This finding supports the planned introduction of rubella-containing vaccines into the Expanded Program on Immunization. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  12. [The active offering of measles, rubella and mumps vaccine in new mothers: the experience of health facilities in one of the Local Health Unit of Rome, Lazio, Italy].

    PubMed

    Santoro, Viviana; Pettinicchio, Valentina; Lancia, Andreina; Vazzoler, Cristiana; De Luca, Francesca; Franco, Elisabetta

    2016-01-01

    Rubella is a contagious disease that can be very serious, especially in unvaccinated pregnant women. The best way to be protected is getting vaccinated: MMR vaccine is very effective at protecting people against measles, mumps, and rubella, and preventing the complications caused by these diseases. According to PASSI 2012-2015 (the Italian behavioral risk factor surveillance system) in the territory of ex ASL Roma C only 56% of women between 18 and 49 years were immunized against rubella, thanks to vaccination (34%) or past infection detected by rubeotest (22%); 2% was susceptible and 42% of respondents did not know their immune status against rubella. The Italian National Plan for the Elimination of Measles and Congenital Rubella (PNEMoRc) 2010-15 had the aim to reduce the prevalence of rubella susceptibility in young women (<5%), to reduce the prevalence of congenital rubella and to increase MMR vaccination coverage. This plan suggested to promote actions to spread correct information about MMR vaccine in the general population and healthcare workers and to offer this vaccine to susceptible women during every appropriate contact with the Family planning clinics. In order to ensure and monitor these recommendations, a recovery procedure for MMR vaccine was activated in 2015 for women who contacted the health facilities for their first child vaccination. A form was developed in order to collect information about women's immune status against rubella and measles. According to this tool all women who stated they had never been vaccinated for rubella or MMR and/or did not remember vaccination and/or had never had a rubeotest were considered susceptible to rubella. Women susceptible to rubella were invited to undergo vaccination. Data collected during one year activity were recorded and analyzed with Epinfo 7.0 software. We collected 1801 correctly filled forms; 88.6% (1595) of women were evaluated immune to rubella and 11.4% susceptible. The prevalence of susceptibility seems to be influenced by age, from 16% in the youngest age group to 9% in the >35 years. Among 206 women susceptible to rubella: 38% were vaccinated, 31% preferred to wait, 11% refused vaccination and for 20% data is missing. The protocol of MMR vaccine recovery was effective, and allowed to reach a good number of women who had a contact with the health facilities and we hope this number to be bigger, adding a part of those women who preferred to wait. However, data of a year activity indicate that vaccine recovery initiatives should be proposed and implemented, in consideration of the proportion of rubella susceptibility in women who were recently pregnant.

  13. Congenital Rubella: Clinical and Related Studies

    ERIC Educational Resources Information Center

    Menser, Margaret A.

    1977-01-01

    Briefly described are four studies currently being undertaken in Australia to determine the effectiveness of vaccination in the prevention of rubella and to examine the relationship between rubella and diabetes. (CL)

  14. MMR Vaccine (Measles, Mumps, and Rubella)

    MedlinePlus

    Attenuvax® Measles Vaccine ... R-Vax® II (as a combination product containing Measles Vaccine, Rubella Vaccine) ... M-R® II (as a combination product containing Measles Vaccine, Mumps Vaccine, Rubella Vaccine)

  15. Modeling the Transmission of Measles and Rubella to Support Global Management Policy Analyses and Eradication Investment Cases.

    PubMed

    Thompson, Kimberly M; Badizadegan, Nima D

    2017-06-01

    Policy makers responsible for managing measles and rubella immunization programs currently use a wide range of different vaccines formulations and immunization schedules. With endemic measles and rubella transmission interrupted in the region of the Americas, all five other regions of the World Health Organization (WHO) targeting the elimination of measles transmission by 2020, and increasing adoption of rubella vaccine globally, integrated dynamic disease, risk, decision, and economic models can help national, regional, and global health leaders manage measles and rubella population immunity. Despite hundreds of publications describing models for measles or rubella and decades of use of vaccines that contain both antigens (e.g., measles, mumps, and rubella vaccine or MMR), no transmission models for measles and rubella exist to support global policy analyses. We describe the development of a dynamic disease model for measles and rubella transmission, which we apply to 180 WHO member states and three other areas (Puerto Rico, Hong Kong, and Macao) representing >99.5% of the global population in 2013. The model accounts for seasonality, age-heterogeneous mixing, and the potential existence of preferentially mixing undervaccinated subpopulations, which create heterogeneity in immunization coverage that impacts transmission. Using our transmission model with the best available information about routine, supplemental, and outbreak response immunization, we characterize the complex transmission dynamics for measles and rubella historically to compare the results with available incidence and serological data. We show the results from several countries that represent diverse epidemiological situations to demonstrate the performance of the model. The model suggests relatively high measles and rubella control costs of approximately $3 billion annually for vaccination based on 2013 estimates, but still leads to approximately 17 million disability-adjusted life years lost with associated costs for treatment, home care, and productivity loss costs of approximately $4, $3, and $47 billion annually, respectively. Combined with vaccination and other financial cost estimates, our estimates imply that the eradication of measles and rubella could save at least $10 billion per year, even without considering the benefits of preventing lost productivity and potential savings from reductions in vaccination. The model should provide a useful tool for exploring the health and economic outcomes of prospective opportunities to manage measles and rubella. Improving the quality of data available to support decision making and modeling should represent a priority as countries work toward measles and rubella goals. © 2017 Society for Risk Analysis.

  16. Estimating the burden of rubella virus infection and congenital rubella syndrome through a rubella immunity assessment among pregnant women in the Democratic Republic of the Congo: Potential impact on vaccination policy.

    PubMed

    Alleman, Mary M; Wannemuehler, Kathleen A; Hao, Lijuan; Perelygina, Ludmila; Icenogle, Joseph P; Vynnycky, Emilia; Fwamba, Franck; Edidi, Samuel; Mulumba, Audry; Sidibe, Kassim; Reef, Susan E

    2016-12-12

    Rubella-containing vaccines (RCV) are not yet part of the Democratic Republic of the Congo's (DRC) vaccination program; however RCV introduction is planned before 2020. Because documentation of DRC's historical burden of rubella virus infection and congenital rubella syndrome (CRS) has been minimal, estimates of the burden of rubella virus infection and of CRS would help inform the country's strategy for RCV introduction. A rubella antibody seroprevalence assessment was conducted using serum collected during 2008-2009 from 1605 pregnant women aged 15-46years attending 7 antenatal care sites in 3 of DRC's provinces. Estimates of age- and site-specific rubella antibody seroprevalence, population, and fertility rates were used in catalytic models to estimate the incidence of CRS per 100,000 live births and the number of CRS cases born in 2013 in DRC. Overall 84% (95% CI 82, 86) of the women tested were estimated to be rubella antibody seropositive. The association between age and estimated antibody seroprevalence, adjusting for study site, was not significant (p=0.10). Differences in overall estimated seroprevalence by study site were observed indicating variation by geographical area (p⩽0.03 for all). Estimated seroprevalence was similar for women declaring residence in urban (84%) versus rural (83%) settings (p=0.67). In 2013 for DRC nationally, the estimated incidence of CRS was 69/100,000 live births (95% CI 0, 186), corresponding to 2886 infants (95% CI 342, 6395) born with CRS. In the 3 provinces, rubella virus transmission is endemic, and most viral exposure and seroconversion occurs before age 15years. However, approximately 10-20% of the women were susceptible to rubella virus infection and thus at risk for having an infant with CRS. This analysis can guide plans for introduction of RCV in DRC. Per World Health Organization recommendations, introduction of RCV should be accompanied by a campaign targeting all children 9months to 14years of age as well as vaccination of women of child bearing age through routine services. Published by Elsevier Ltd.

  17. Balancing Evidence and Uncertainty when Considering Rubella Vaccine Introduction

    PubMed Central

    Lessler, Justin; Metcalf, C. Jessica E.

    2013-01-01

    Background Despite a safe and effective vaccine, rubella vaccination programs with inadequate coverage can raise the average age of rubella infection; thereby increasing rubella cases among pregnant women and the resulting congenital rubella syndrome (CRS) in their newborns. The vaccination coverage necessary to reduce CRS depends on the birthrate in a country and the reproductive number, R0, a measure of how efficiently a disease transmits. While the birthrate within a country can be known with some accuracy, R0 varies between settings and can be difficult to measure. Here we aim to provide guidance on the safe introduction of rubella vaccine into countries in the face of substantial uncertainty in R0. Methods We estimated the distribution of R0 in African countries based on the age distribution of rubella infection using Bayesian hierarchical models. We developed an age specific model of rubella transmission to predict the level of R0 that would result in an increase in CRS burden for specific birth rates and coverage levels. Combining these results, we summarize the safety of introducing rubella vaccine across demographic and coverage contexts. Findings The median R0 of rubella in the African region is 5.2, with 90% of countries expected to have an R0 between 4.0 and 6.7. Overall, we predict that countries maintaining routine vaccination coverage of 80% or higher are can be confident in seeing a reduction in CRS over a 30 year time horizon. Conclusions Under realistic assumptions about human contact, our results suggest that even in low birth rate settings high vaccine coverage must be maintained to avoid an increase in CRS. These results lend further support to the WHO recommendation that countries reach 80% coverage for measles vaccine before introducing rubella vaccination, and highlight the importance of maintaining high levels of vaccination coverage once the vaccine is introduced. PMID:23861777

  18. Underreporting of congenital rubella in Italy, 2010-2014.

    PubMed

    Giambi, Cristina; Bella, Antonino; Filia, Antonietta; Del Manso, Martina; Nacca, Gloria; Declich, Silvia; Rota, Maria Cristina

    2017-07-01

    In accordance with the goals of the World Health Organization Regional Committee for Europe, the Italian national Measles and Rubella Elimination Plan 2010-2015 aimed to reduce the incidence of congenital rubella cases to <1 case/100,000 live births by 2015. In Italy, a passive national surveillance system for congenital rubella and rubella in pregnancy is active since 2005. We estimated the degree of underreporting of congenital rubella, performing a capture-recapture analysis of cases detected through two independent sources: the national surveillance system and the national hospital discharge database, in the years 2010-2014. We found that 6 out of 11 cases tracked in the retrospective case-finding from hospital registries had not been notified to the surveillance system, and we estimated a degree of underreporting of 53% for the period 2010-2014. This approach showed to be simple to perform, repeatable, and effective. In order to reduce underreporting, some actions aimed at strengthening surveillance procedures are needed. The adoption on a routine basis of the review of hospital discharge registries for case-finding, monthly zero-reporting, and actions to train and sensitize all the specialists involved in the care of pregnant women and the newborns to notification procedures are recommended. What is Known • In Italy, the incidence of congenital rubella was below the WHO target of 1/100,000 live births in 2005-2015, except for two peaks in 2008 and 2012 (5 and 4/100,000, respectively). • Further efforts are required to improve congenital rubella surveillance so that it is more sensitive and specific. The WHO proposes retrospective case-finding from hospital records as an alternative approach to detect infants with congenital rubella. What is New • Underreporting of congenital rubella in Italy was 53% in 2010-2014. • Hospital discharge registries resulted to be an appropriate source to detect congenital rubella cases.

  19. Balancing evidence and uncertainty when considering rubella vaccine introduction.

    PubMed

    Lessler, Justin; Metcalf, C Jessica E

    2013-01-01

    Despite a safe and effective vaccine, rubella vaccination programs with inadequate coverage can raise the average age of rubella infection; thereby increasing rubella cases among pregnant women and the resulting congenital rubella syndrome (CRS) in their newborns. The vaccination coverage necessary to reduce CRS depends on the birthrate in a country and the reproductive number, R0, a measure of how efficiently a disease transmits. While the birthrate within a country can be known with some accuracy, R0 varies between settings and can be difficult to measure. Here we aim to provide guidance on the safe introduction of rubella vaccine into countries in the face of substantial uncertainty in R0. We estimated the distribution of R0 in African countries based on the age distribution of rubella infection using Bayesian hierarchical models. We developed an age specific model of rubella transmission to predict the level of R0 that would result in an increase in CRS burden for specific birth rates and coverage levels. Combining these results, we summarize the safety of introducing rubella vaccine across demographic and coverage contexts. The median R0 of rubella in the African region is 5.2, with 90% of countries expected to have an R0 between 4.0 and 6.7. Overall, we predict that countries maintaining routine vaccination coverage of 80% or higher are can be confident in seeing a reduction in CRS over a 30 year time horizon. Under realistic assumptions about human contact, our results suggest that even in low birth rate settings high vaccine coverage must be maintained to avoid an increase in CRS. These results lend further support to the WHO recommendation that countries reach 80% coverage for measles vaccine before introducing rubella vaccination, and highlight the importance of maintaining high levels of vaccination coverage once the vaccine is introduced.

  20. Functional and evolutionary insight from the crystal structure of rubella virus protein E1.

    PubMed

    DuBois, Rebecca M; Vaney, Marie-Christine; Tortorici, M Alejandra; Kurdi, Rana Al; Barba-Spaeth, Giovanna; Krey, Thomas; Rey, Félix A

    2013-01-24

    Little is known about the three-dimensional organization of rubella virus, which causes a relatively mild measles-like disease in children but leads to serious congenital health problems when contracted in utero. Although rubella virus belongs to the same family as the mosquito-borne alphaviruses, in many respects it is more similar to other aerosol-transmitted human viruses such as the agents of measles and mumps. Although the use of the triple MMR (measles, mumps and rubella) live vaccine has limited its incidence in western countries, congenital rubella syndrome remains an important health problem in the developing world. Here we report the 1.8 Å resolution crystal structure of envelope glycoprotein E1, the main antigen and sole target of neutralizing antibodies against rubella virus. E1 is the main player during entry into target cells owing to its receptor-binding and membrane-fusion functions. The structure reveals the epitope and the neutralization mechanism of an important category of protecting antibodies against rubella infection. It also shows that rubella virus E1 is a class II fusion protein, which had hitherto only been structurally characterized for the arthropod-borne alphaviruses and flaviviruses. In addition, rubella virus E1 has an extensive membrane-fusion surface that includes a metal site, reminiscent of the T-cell immunoglobulin and mucin family of cellular proteins that bind phosphatidylserine lipids at the plasma membrane of cells undergoing apoptosis. Such features have not been seen in any fusion protein crystallized so far. Structural comparisons show that the class II fusion proteins from alphaviruses and flaviviruses, despite belonging to different virus families, are closer to each other than they are to rubella virus E1. This suggests that the constraints on arboviruses imposed by alternating cycles between vertebrates and arthropods resulted in more conservative evolution. By contrast, in the absence of this constraint, the strictly human rubella virus seems to have drifted considerably into a unique niche as sole member of the Rubivirus genus.

  1. Rubella - Fact Sheet for Parents

    MedlinePlus

    ... A Hepatitis B Hib Measles Mumps Polio Pneumococcal Rotavirus Rubella Tetanus Whooping Cough (Pertussis) For Parents of ... A Hepatitis B Hib Measles Mumps Polio Pneumococcal Rotavirus Rubella Tetanus Whooping Cough (Pertussis) Top of Page ...

  2. Rubella Immunity in Pregnant Native Taiwanese and Immigrants from Asian Countries.

    PubMed

    Zen, Yeong-Hwa; Shih, Ching-Tang; Kung, Wan-Ju; Lee, Chien-Hung; Lin, Ching-Chiang

    2017-02-08

    Vaccination is considered the most effective method to prevent rubella spread and congenital rubella syndrome (CRS). The aim of the present study was to investigate the rubella immunity among native and immigrant pregnant women in Taiwan. From 2000 to 2014, a total of 16,879 pregnant women who received routine prenatal examinations were recruited in this study. The rubella IgG antibodies were assayed using a microparticle enzyme immunoassay or chemiluminescent microparticle immunoassay. Subjects were categorized by nationality and subcategorized by specific periods of time for comparison. The rubella susceptibility was 12.7% in total, 11.1% in Taiwanese and 20.3% in immigrant population from 2000 to 2014. Among the immigrant women, those from Vietnam had the highest susceptibility (22.3%) and those from Thailand had the lowest susceptibility (3.8%). The immigrant women from Vietnam and China showed a significantly higher susceptibility compared with the native Taiwanese women in which the odds ratio was 2.30 (95% confidence interval [CI]: 2.04-2.60), 1.96 (95% CI: 1.59-2.41), respectively ( P < 0.001). It meant that immigrants from Vietnam and China had a higher likelihood of rubella susceptibility and related CRS sequela than native women. From 2000-2004 to 2010-2014 cohort, there was no obvious change in rubella susceptibility in native women, which varied between 10.0% and 11.9%. However, there was a decreasing trend of rubella susceptibility in the immigrant women overall, from 24.5% to 11.5% ( P < 0.001). To eliminate congenital rubella in Taiwan, additional catch-up immunization strategies are needed. © The American Society of Tropical Medicine and Hygiene.

  3. Does Rubella Cause Autism: A 2015 Reappraisal?

    PubMed

    Hutton, Jill

    2016-01-01

    In the 1970s, Stella Chess found a high prevalence of autism in children with congenital rubella syndrome (CRS), 200 times that of the general population at the time. Many researchers quote this fact to add proof to the current theory that maternal infection with immune system activation in pregnancy leads to autism in the offspring. This rubella and autism association is presented with the notion that rubella has been eliminated in today's world. CRS cases are no longer typically seen; yet, autistic children often share findings of CRS including deafness, congenital heart defects, and to a lesser extent visual changes. Autistic children commonly have hyperactivity and spasticity, as do CRS children. Both autistic and CRS individuals may develop type 1 diabetes as young adults. Neuropathology of CRS infants may reveal cerebral vasculitis with narrowed lumens and cerebral necrosis. Neuroradiological findings of children with CRS show calcifications, periventricular leukomalacia, and dilated perivascular spaces. Neuroradiology of autism has also demonstrated hyperintensities, leukomalacia, and prominent perivascular spaces. PET studies of autistic individuals exhibit decreased perfusion to areas of the brain similarly affected by rubella. In both autism and CRS, certain changes in the brain have implicated the immune system. Several children with autism lack antibodies to rubella, as do children with CRS. These numerous similarities increase the probability of an association between rubella virus and autism. Rubella and autism cross many ethnicities in many countries. Contrary to current belief, rubella has not been eradicated and globally affects up to 5% of pregnant women. Susceptibility continues as vaccines are not given worldwide and are not fully protective. Rubella might still cause autism, even in vaccinated populations.

  4. Does Rubella Cause Autism: A 2015 Reappraisal?

    PubMed Central

    Hutton, Jill

    2016-01-01

    In the 1970s, Stella Chess found a high prevalence of autism in children with congenital rubella syndrome (CRS), 200 times that of the general population at the time. Many researchers quote this fact to add proof to the current theory that maternal infection with immune system activation in pregnancy leads to autism in the offspring. This rubella and autism association is presented with the notion that rubella has been eliminated in today’s world. CRS cases are no longer typically seen; yet, autistic children often share findings of CRS including deafness, congenital heart defects, and to a lesser extent visual changes. Autistic children commonly have hyperactivity and spasticity, as do CRS children. Both autistic and CRS individuals may develop type 1 diabetes as young adults. Neuropathology of CRS infants may reveal cerebral vasculitis with narrowed lumens and cerebral necrosis. Neuroradiological findings of children with CRS show calcifications, periventricular leukomalacia, and dilated perivascular spaces. Neuroradiology of autism has also demonstrated hyperintensities, leukomalacia, and prominent perivascular spaces. PET studies of autistic individuals exhibit decreased perfusion to areas of the brain similarly affected by rubella. In both autism and CRS, certain changes in the brain have implicated the immune system. Several children with autism lack antibodies to rubella, as do children with CRS. These numerous similarities increase the probability of an association between rubella virus and autism. Rubella and autism cross many ethnicities in many countries. Contrary to current belief, rubella has not been eradicated and globally affects up to 5% of pregnant women. Susceptibility continues as vaccines are not given worldwide and are not fully protective. Rubella might still cause autism, even in vaccinated populations. PMID:26869906

  5. Rubella seronegativity in antenatal screening - Is it influenced by the introduction of universal childhood rubella immunization?

    PubMed

    Lao, Terence T; Sahota, Daljit S; Law, Lai-Wa; Leung, Tak-Yeung

    2015-09-11

    This study examined the impact of rubella immunization, implemented in Hong Kong in phases since 1978, on antenatal rubella serological status in Chinese women. In a retrospective cohort study, the incidence of antenatal rubella seronegative status in our parturients managed from 1998 to 2013 was analyzed by their year-of-birth as follows: <1965 (no childhood immunization), 1965-1982 (single dose at Primary 6), and ≥1983 (two doses at age 12 months and 12 years), adjusting for other factors including age, parity, body mass index, place-of-birth status and hepatitis B surface antigen (HBsAg) status. Rubella seronegativity decreased from 12.9%, 10.5%, to 9.8% respectively, and correlated inversely (P<0.001) with year-of-birth cohorts. Despite similar demographic profiles, this correlation was found only in Hong-Kong-born women (from 12.6%, 7.5% to 6.5% respectively), who also had significant lower incidences of rubella seronegativity (OR 0.73, 0.31 and 0.29 respectively) and HBsAg seropositivity (OR 1.09, 0.63 and 0.48 respectively) than China-born women. On regression analysis, rubella seronegativity was actually significantly increased following the implementation of immunization (aOR 1.20) while it was the reverse for non-residents (aOR 0.61). Although rubella seronegativity decreased with immunization, the effect was less than expected when adjusted for other risk factors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Measles, Mumps, and Rubella Titers in Air Force Recruits: Below Herd Immunity Thresholds?

    PubMed

    Lewis, Paul E; Burnett, Daniel G; Costello, Amy A; Olsen, Cara H; Tchandja, Juste N; Webber, Bryant J

    2015-11-01

    Preventable diseases like measles and mumps are occurring with increasing frequency in the U.S. despite the availability of an effective vaccine. Given concern that an outbreak may occur among military recruits, we compared serologic evidence of immunity to measles, mumps, and rubella among military recruits with known herd immunity thresholds and determined whether the current Department of Defense policy of presuming mumps immunity based on measles and rubella titers is reliable. Serum antibody levels for measles, mumps, and rubella were obtained from all new recruits upon arrival at Joint Base San Antonio-Lackland, Texas, from 25 April 2013 through 24 April 2014. Seroprevalence of each disease was assessed by age and sex, and concordance between mumps titers and measles and rubella titers was calculated. Data analysis was performed in 2014-2015. Among 32,502 recruits, seroprevalences for measles, mumps, and rubella antibodies were 81.6%, 80.3%, and 82.1%, respectively. Of the 22,878 recruits seropositive for both measles and rubella antibodies, 87.7% were also seropositive for mumps. Seroprevalences for measles, mumps, and rubella antibodies among a large cohort of recruits entering U.S. Air Force basic training were generally lower than levels required to maintain herd immunity. In order to reduce the incidence of mumps infections, the Department of Defense should consider obtaining antibody titers for measles, mumps, and rubella and vaccinating all individuals susceptible to one or more of the viruses. Published by Elsevier Inc.

  7. When, and how, should we introduce a combination measles-mumps-rubella (MMR) vaccine into the national childhood expanded immunization programme in South Africa?

    PubMed

    Cameron, Neil A

    2012-09-07

    This article briefly reviews the history and epidemiology of measles, mumps and rubella disease and the case for introducing combination measles-mumps-rubella (MMR) vaccine into the national childhood immunization schedule in South Africa. Despite adopting the World Health Organization's Measles Elimination strategy in 1996 and achieving a significant decrease the incidence of measles, added effort is needed in South and southern Africa to reach the goal to eliminate endogenous spread measles. Mumps is still common disease of childhood and while there are few sequelae, even the rare complications are important in large populations. Congenital rubella syndrome is seldom reported, but it is estimated that of the million or so children born every year in South Africa over 600 infants are affected to some degree by rubella infection. The naturally acquired immunity to rubella in women of childbearing age in South Africa has been estimated at over 90%, so that introducing a rubella containing vaccine in childhood may paradoxically increase the proportion of girls reaching puberty still susceptible to rubella. The elimination of endogenous measles and rubella is being achieved in many countries in South America, and despite the recent measles epidemic, must still be seriously considered for South and southern Africa. Current constraints and potential steps needed to reach the goal in South Africa are discussed. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Genomic analysis of the Chinese genotype 1F rubella virus that disappeared after 2002 in China.

    PubMed

    Zhu, Zhen; Chen, Min-Hsin; Abernathy, Emily; Zhou, Shujie; Wang, Changyin; Icenogle, Joseph; Xu, Wenbo

    2014-12-01

    Genotype 1F was likely localized geographically to China as it has not been reported elsewhere. In this study, whole genome sequences of two rubella 1F virus isolates were completed. Both viruses contained 9,761 nt with a single nucleotide deletion in the intergenic region, compared to the NCBI rubella reference sequence (NC 001545). No evidence of recombination was found between 1F and other rubella viruses. The genetic distance between 1F viruses and 10 other rubella virus genotypes (1a, 1B, 1C, 1D, 1E, 1G, 1J 2A, 2B, and 2C) ranged from 3.9% to 8.6% by pairwise comparison. A region known to be hypervariable in other rubella genotypes was also the most variable region in the 1F genomes. Comparisons to all available rubella virus sequences from GenBank identified 22 nucleotide variations exclusively in 1F viruses. Among these unique variations, C9306U is located within the recommended molecular window for rubella virus genotyping assignment, could be useful to confirm 1F viruses. Using the Bayesian Markov Chain Monte Carlo (MCMC) method, the time of the most recent common ancestor for the genotype 1F was estimated between 1976 and 1995. Recent rubella molecular surveillance suggests that this indigenous strain may have circulated for less than three decades, as it has not been detected since 2002. © 2014 Wiley Periodicals, Inc.

  9. Polymorphisms in the Vitamin A Receptor and Innate Immunity Genes Influence the Antibody Response to Rubella Vaccination

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Dhiman, Neelam; O’Byrne, Megan M.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2009-01-01

    Background Genetic polymorphisms play an important role in rubella vaccine-induced immunity. Methods We genotyped 714 healthy children after two age-appropriate doses of rubella-containing vaccine for 142 potential SNPs. Results Specific polymorphisms in the vitamin A receptor, RIG-I, TRIM5 and TRIM22 genes were significantly associated with rubella vaccine humoral immunity. The minor allele of the rs4416353 in the vitamin A receptor gene was associated with an allele dose-related decrease (P=.019) in rubella antibody response. The minor allele of rs6793694, in the vitamin A receptor gene, was associated with an allele dose-related antibody decrease (P=.039). The minor variant of nonsynonymous SNP rs10813831 (Arg7Cys) in the RIG-I gene was associated with an allele dose-related decrease in rubella antibody level from 37.4 IU/mL to 28.0 IU/mL (P=.035), while increased representation of the minor allele of the 5’UTR SNP (rs3824949, P=.015), in the antiretroviral TRIM5 gene, was associated with an allele dose-related increase in rubella antibody. It is of particular interest that the nonsynonymous SNP rs3740996 (His43Tyr) in the TRIM5 gene was associated with variations in rubella antibody response (P=.016) after having been previously found to have a significant functional role. Conclusions These findings further expand our immunogenetic understanding of mechanisms of rubella vaccine-induced immunity. PMID:20001730

  10. Outbreak of measles in medical students and determination of immune status to measles-mumps-rubella viruses.

    PubMed

    Yalçin, Songül S; Kanra, Güler; Pehlivan, Tamer

    2006-01-01

    We conducted an investigation after a measles outbreak in medical students to determine the immunity of the medical students, the correlation between history and seropositivity, and measles-mumps-rubella vaccine effectiveness. After a preliminary study done during measles outbreak, a cross-sectional study was planned. Serum samples from 322 medical students were tested by enzyme-linked immunosorbent assay, vaccinated volunteers, then re-tested vaccinees. Histories of measles, mumps and rubella were taken. Of 322 students, seven students (2.2%) were seronegative to measles, 13 (4.0%) to mumps, and 13 (4.0%) to rubella. Historical information revealed 30.4% of sensitivity in measles and 34.3% in mumps, whereas 5.2% in rubella. Among those seronegative on admission and vaccinated, seroconversion rates were 100% (5/5), 90.9% (10/11), 100% (8/8) in measles, mumps and rubella vaccine, respectively. Of 265 vaccinated students parotitis was detected in one female student, arthralgia was observed in three students (1.1%) and myalgia in two (0.7%), and 240 students reported no side effects. We detected the unreliable historical screening and high seroprevalence of measles, mumps and rubella in prevaccine era for mumps and rubella and, safety of MMR vaccination in medical students in Turkey.

  11. [Molecular epidemiological analysis of rubella virus isolates from 2001 to 2011 in Shanghai, China].

    PubMed

    Li, Chong-Shan; Yang, Yu-Ying; Wang, Jian-Guo; Zhu, Zhen; Tang, Wei; Li, Zhi; Sun, Xiao-Dong; Xu, Wen-Bo

    2012-03-01

    Throat swabs collected from patients whose serum was measles IgM negative and rubella IgM positive during 2001-2011 were used to conduct cell culture for rubella virus. After identification of cell culture with RT-PCR, nucleotide of gene E1 of rubella virus was amplified and sequenced, followed by molecular epidemiological analysis. A total of 31 rubella viruses were isolated from 60 throat swabs. Compared 27 isolates with the WHO reference strains of all genotypes, phylogenetic tree was constructed based on the amplified 739 nucleotide fragment. These isolates belonged to two different genotypes respectively. Isolates 11009, 11052 and 11106 in 2011 belonged to genotype 2B, and others belonged to genotype 1E. Most of mutations were nonsense mutation, and sequence of amino acid was highly conserved. Amino acid sequence of most isolates of genotype 1E was identical, which suggested rubella viruses from same transmission chain might be transmitted continually since 2001. Rubella virus genotype 2B was found to be popular for the first time in Shanghai in 2011. The nucleotide sequences of these genotype 2B isolates showed 99% identity compared with that of isolates recently from Vietnam, Japan and Argentina. The resources of these strains were not confirmed due to the absence of rubella virus surveillance before.

  12. [The life cycle of Rubella Virus].

    PubMed

    Sakata, Masafumi; Mori, Yoshio

    2014-01-01

    Rubella virus (RV), an infectious agent of rubella, is the sole member of the genus Rubivirus in the family of Togaviridae. RV has a positive-stranded sense RNA as a genome. A natural host of RV is limited to human, and rubella is considered to be a childhood disease in general. When woman is infected with RV during early pregnancy, her fetus may develop severe birth defects known as congenital rubella syndrome. In this review, the RV life cycle from the virus entry to budding is illustrated in comparison with those of member viruses of the genus alphavirus in the same family. The multiple functions of the RV capsid protein are also introduced.

  13. Multiphasic acute disseminated encephalomyelitis associated with atypical rubella virus infection.

    PubMed

    Shinoda, Koji; Asahara, Hideaki; Uehara, Taira; Miyoshi, Katsue; Suzuki, Satoshi O; Iwaki, Toru; Kira, Jun-ichi

    2015-02-01

    We report the first case of an occurrence of multiphasic acute disseminated encephalomyelitis (ADEM) associated with atypical rubella virus infection with no rash and long-term increased titers of serum anti-rubella IgM in a 17-year-old male who had no history of rubella vaccination. He suffered from at least six clinical exacerbations with disseminated hyperintense lesions on FLAIR MR images during the course of 18 months. Repeated methylprednisolone pulse therapy and intravenous immunoglobulin therapy resolved the exacerbations. In patients with multiphasic ADEM of unknown etiology, clinicians should also consider the possibility of preceding infection with rubella virus. © The Author(s), 2015.

  14. Measles, Mumps, and Rubella (MMR) Vaccination: What Everyone Should Know

    MedlinePlus

    ... rubella combination vaccine Measles=Rubeola Measles=”10-day”, “hard” and “red” measles MMRV=measles, mumps, rubella, and varicella combination vaccine File Formats Help: How do I view different file formats ( ...

  15. Trend of measles, mumps, and rubella incidence following the measles-rubella catch up vaccination in the Republic of Korea, 2001.

    PubMed

    Choe, Young June; Eom, Hye-Eun; Cho, Sung-Il

    2017-09-01

    Following the introduction of measles-rubella (MR) catch-up vaccination in 2001 and two dose measles-mumps-rubella (MMR2) keep-up program in 2002, the incidence of measles, mumps, and rubella was not evaluated systematically. To describe the recent changes in epidemiology, a population-based incidence study from 2001 to 2015 using national notifiable disease surveillance data was conducted. Between 2001 and 2015, there was decrease in the incidence of measles and rubella, whereas a steady increase in mump incidence was noted. The age distribution of mumps cases has shifted to the older age group, whereas rubella became more frequent in younger age group. The incidence of mumps showed an increase in every birth cohorts, except for the decrease in incidence for catch-up vaccination cohort from 131 cases in 2007-2011 to 64 cases per 100 000 in 2012-2015. Continuing in monitoring of mumps and strengthening of the high two-dose MMR vaccination coverage should be taken place in Korea. © 2017 Wiley Periodicals, Inc.

  16. Pathogenesis of Congenital Rubella Virus Infection in Human Fetuses: Viral Infection in the Ciliary Body Could Play an Important Role in Cataractogenesis.

    PubMed

    Nguyen, Thong Van; Pham, Van Hung; Abe, Kenji

    2015-01-01

    Development of congenital rubella syndrome associated with rubella virus infection during pregnancy is clinically important, but the pathogenicity of the virus remains unclear. Pathological examination was conducted on 3 aborted fetuses with congenital rubella infection. At autopsy, all 3 aborted fetuses showed congenital cataract confirmed by gross observation. Rubella virus infection occurred via systemic organs including circulating hematopoietic stem cells confirmed by immunohistochemical and molecular investigations, and major histopathogical changes were found in the liver. It is noteworthy that the virus infected the ciliary body of the eye, suggesting a possible cause of cataracts. Our study based on the pathological examination demonstrated that the rubella virus infection occurred via systemic organs of human fetuses. This fact was confirmed by immunohistochemistry and direct detection of viral RNA in multiple organs. To the best of our knowledge, this study is the first report demonstrating that the rubella virus infection occurred via systemic organs of the human body. Importantly, virus infection of the ciliary body could play an important role in cataractogenesis.

  17. Effectiveness of Rubella vaccine in a rubella outbreak in Guangzhou city, China, 2014.

    PubMed

    Chang, Caiyun; Mo, Xianghuan; Hu, Pei; Liang, Wenjia; Ma, Huilai; An, Zhijie; Liu, Jun; Zheng, Huizhen

    2015-06-22

    WHO recommends the use of rubella-containing vaccine (RCVs) to prevent rubella and congenital rubella syndrome (CRS). Most licensed rubella vaccines in use globally are based on RA27/3 strains and have estimated vaccine effectiveness (VE) rates of 95-100%. In contrast, China uses a BRD-II strain-based rubella vaccine. Few field studies have been conducted that estimate VE of China's RCV. On March 17, 2014, a rubella outbreak was reported in a middle school in Guangzhou city, China. We conducted an investigation to understand reasons for the outbreak, and we used that investigation to estimate vaccine effectiveness of China's rubella vaccine. To identify cases, investigators reviewed records kept by the school doctor and absentee records kept by teachers. Self-administered questionnaires were sent to parents of all students to collect information about the students' symptoms, the results of any physician consultation, and disease history. We obtained demographic information and illness information for all students in the school; vaccination status was determined by inspection of official, parent-held vaccination records. A retrospective cohort study was conducted in 13 classes that had secondary cases of rubella. Using the secondary attack rates, we evaluated VE by the number of RCV doses received and age at vaccination. During the period February 17-May 23, 2014, 162 students (50 suspected cases, 88 probable cases, 24 confirmed cases) were diagnosed with rubella, yielding an overall attack rate of 10% (162/1621). Cases occurred in 27 classes (73%) of 37 classrooms. Secondary cases occurred in 13 classes (35%) of 37 classrooms. A total of 1130 students (69.7%) have vaccination certificates; 419 (37%) students were record-confirmed to have received RCV. For those vaccinated using BRD-II strain vaccine, vaccine effectiveness (VE) was 94% (95%CI: 75-98). VE for measles, mumps, and rubella (MMR) vaccine which is based on either BRD-II or RA27/3 strain was 89% (95%CI: 56-97). VE of a single dose of domestic monovalent rubella vaccine that used BRD-II strain vaccine was 93% (95%CI: 73-98). VE for those who received the vaccine between 1 and 2 years of age was 95% (95% CI: 67-99) while the VE was 100% for those vaccinated after 2 years of age. VE among those who received RCV <12 years ago was 100% while VE among those who received RCV ≥12 years ago was 92% (95%CI: 70-98). The rubella vaccines used in China that are based on the BRD-II rubella vaccine strain have VE of 94%, which is similar to the more commonly used RA27/3-based RCVs. Low vaccination coverage contributed to this outbreak; early reporting of an outbreak is necessary for effective outbreak response immunization. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Rubella

    MedlinePlus

    ... dangerous for a pregnant woman's baby. It can cause miscarriage or birth defects. Rubella spreads when an infected person coughs or sneezes. People without symptoms can still spread it. There is no treatment, but the measles-mumps-rubella (MMR) vaccine can prevent it. Centers ...

  19. [The very severe sensorineural deafness patients caused by rubella virus infection: two cases report].

    PubMed

    Ma, Jing; Wan, Lang; Xu, Fen

    2015-09-01

    To explore the audiological features in children who were sever sensorineural hearing loss infected with rubella virus. There were two cases of rubella virus infection in children who were deaf, they conducted the distortion product otoacoustic emission, ABR and auditory steady-state evoked response (ASSR) examination, then analyzed the results comprehensively. Two patients' mothers were prompted to have infected rubella virus during the early three months pregnant period by history and laboratory tests. The two patients were not detected deafness gene mutation. Audiology results implied the two patients were very severe binaural sensorineural deafness, so they were recommended to equipped with hearing aids and cochlear implant surgery. Early pregnancy women infected with rubella virus can cause very severe offspring sensorineural deafness. The crowd whose mother were suspected to infect with rubella virus in early pregnancy, that should be tracked and detected hearing in order to achieve early detection, early intervention and early treatment.

  20. Modelling rubella in Europe.

    PubMed Central

    Edmunds, W. J.; van de Heijden, O. G.; Eerola, M.; Gay, N. J.

    2000-01-01

    The prevention of congenital rubella syndrome (CRS), as a complication of rubella infection during pregnancy, is the main aim of rubella vaccination programmes. However, as vaccination of infants leads to an increase in the average age at which those who were not immunized become infected, certain rubella vaccination programmes can lead to an increase in the incidence of CRS. In this paper we use a mathematical model of the transmission dynamics of rubella virus to investigate the likely impact of different vaccination policies in Europe. The model was able to capture pre- and post-vaccination patterns of infection and prevalence of serological markers under a wide variety of scenarios, suggesting that the model structure and parameter estimates were appropriate. Analytical and numerical results suggest that endemic circulation of rubella is unlikely in Finland, the United Kingdom, The Netherlands, and perhaps Denmark, provided vaccine coverage is uniform across geographical and social groups. In Italy and Germany vaccine coverage in infancy has not been sufficient to interrupt rubella transmission, and continued epidemics of CRS seem probable. It seems unlikely that the immunization programmes in these countries are doing more harm than good, but this may be partly as a result of selective immunization of schoolgirls. Indeed, in both these countries, selective vaccination of schoolgirls with inadequate vaccination histories is likely to be an important mechanism by which CRS incidence is suppressed (unlike the other countries, which have had sufficiently high infant coverage rates to withdraw this option). Reducing inequalities in the uptake of rubella vaccine may bring greater health benefits than increasing the mean level of coverage. PMID:11218213

  1. Emergence and Continuous Evolution of Genotype 1E Rubella Viruses in China

    PubMed Central

    Zhu, Zhen; Cui, Aili; Wang, Huanhuan; Zhang, Yan; Liu, Chunyu; Wang, Changyin; Zhou, Shujie; Chen, Xia; Zhang, Zhenying; Feng, Daxin; Wang, Yan; Chen, Haiyun; Pan, Zhengfan; Zeng, Xiangjie; Zhou, Jianhui; Wang, Shuang; Chang, Xin; Lei, Yue; Tian, Hong; Liu, Yang; Zhou, Shunde; Zhan, Jun; Chen, Hui; Gu, Suyi; Tian, Xiaoling; Liu, Jianfeng; Chen, Ying; Fu, Hong; Yang, Xiuhui; Zheng, Huanying; Liu, Leng; Zheng, Lei; Gao, Hui; He, Jilan; Sun, Li

    2012-01-01

    In China, rubella vaccination was introduced into the national immunization program in 2008, and a rubella epidemic occurred in the same year. In order to know whether changes in the genotypic distribution of rubella viruses have occurred in the postvaccination era, we investigate in detail the epidemiological profile of rubella in China and estimate the evolutionary rate, molecular clock phylogeny, and demographic history of the predominant rubella virus genotypes circulating in China using Bayesian Markov chain Monte Carlo phylodynamic analyses. 1E was found to be the predominant rubella virus genotype since its initial isolation in China in 2001, and no genotypic shift has occurred since then. The results suggest that the global 1E genotype may have diverged in 1995 and that it has evolved at a mutation rate of 1.65 × 10−3 per site per year. The Chinese 1E rubella virus isolates were grouped into either cluster 1 or cluster 2, which likely originated in 1997 and 2006, respectively. Cluster 1 viruses were found in all provinces examined in this study and had a mutation rate of 1.90 × 10−3 per site per year. The effective number of infections remained constant until 2007, and along with the introduction of rubella vaccine into the national immunization program, although the circulation of cluster 1 viruses has not been interrupted, some viral lineages have disappeared, and the epidemic started a decline that led to a decrease in the effective population size. Cluster 2 viruses were found only in Hainan Province, likely because of importation. PMID:22162559

  2. Emergence and continuous evolution of genotype 1E rubella viruses in China.

    PubMed

    Zhu, Zhen; Cui, Aili; Wang, Huanhuan; Zhang, Yan; Liu, Chunyu; Wang, Changyin; Zhou, Shujie; Chen, Xia; Zhang, Zhenying; Feng, Daxin; Wang, Yan; Chen, Haiyun; Pan, Zhengfan; Zeng, Xiangjie; Zhou, Jianhui; Wang, Shuang; Chang, Xin; Lei, Yue; Tian, Hong; Liu, Yang; Zhou, Shunde; Zhan, Jun; Chen, Hui; Gu, Suyi; Tian, Xiaoling; Liu, Jianfeng; Chen, Ying; Fu, Hong; Yang, Xiuhui; Zheng, Huanying; Liu, Leng; Zheng, Lei; Gao, Hui; He, Jilan; Sun, Li; Xu, Wenbo

    2012-02-01

    In China, rubella vaccination was introduced into the national immunization program in 2008, and a rubella epidemic occurred in the same year. In order to know whether changes in the genotypic distribution of rubella viruses have occurred in the postvaccination era, we investigate in detail the epidemiological profile of rubella in China and estimate the evolutionary rate, molecular clock phylogeny, and demographic history of the predominant rubella virus genotypes circulating in China using Bayesian Markov chain Monte Carlo phylodynamic analyses. 1E was found to be the predominant rubella virus genotype since its initial isolation in China in 2001, and no genotypic shift has occurred since then. The results suggest that the global 1E genotype may have diverged in 1995 and that it has evolved at a mutation rate of 1.65 × 10(-3) per site per year. The Chinese 1E rubella virus isolates were grouped into either cluster 1 or cluster 2, which likely originated in 1997 and 2006, respectively. Cluster 1 viruses were found in all provinces examined in this study and had a mutation rate of 1.90 × 10(-3) per site per year. The effective number of infections remained constant until 2007, and along with the introduction of rubella vaccine into the national immunization program, although the circulation of cluster 1 viruses has not been interrupted, some viral lineages have disappeared, and the epidemic started a decline that led to a decrease in the effective population size. Cluster 2 viruses were found only in Hainan Province, likely because of importation.

  3. [Effectiveness, population-level effects, and heath economics of measles and rubella vaccination].

    PubMed

    Wichmann, O; Ultsch, B

    2013-09-01

    Vaccination against measles and rubella has been included in national immunization programs worldwide for several decades. In this article, we present the evidence related to the effectiveness of measles and rubella vaccination based on published systematic reviews, and we describe the epidemiological and health economic effects of vaccination at a population level. Several observational studies demonstrate the high effectiveness (> 90 %) of both measles and rubella vaccination. The global measles mortality reduction and the dramatic decrease in rubella and measles incidences after introduction of routine immunization contribute to the very high quality of evidence. The countries of the Americas have proved that it is feasible to eliminate measles and rubella by strengthening infant immunization through routine vaccination services and by conducting supplemental immunization activities in other childhood age groups so as to close immunity gaps. An economic evaluation of measles and rubella vaccination specifically for the healthcare system in Germany does not exist. However, we conducted a systematic review and identified 11 health-economic studies from other industrialized countries and one for a hypothetical industrialized country. Results indicate that vaccination against measles and rubella had either a cost-effective or even a cost-saving potential, which could be assumed with some limitations also for the German setting. In conclusion, there is compelling evidence that the available vaccines are very effective and that measles and rubella elimination is feasible if adequate vaccination strategies are implemented. In Germany, catch-up vaccination programs are urgently needed for children, adolescents, and young adults specifically in the western federal states.

  4. German Measles (Rubella)

    MedlinePlus

    ... the world. German measles is caused by the rubella virus, which is not the same virus that causes ... days after a child is infected with the virus. What You Can Do Make ... tired. Children with rubella should not attend school or child care for ...

  5. Rubella maculopathy.

    PubMed Central

    Orth, D H; Fishman, G A; Segall, M; Bhatt, A; Yassur, Y

    1980-01-01

    Three patients with known history of congenital rubella and sudden decrease of vision are presented. Two of the 3 patients had previous eye examinations which showed typical rubella (salt and pepper) retinopathy. All 3 showed macular lesions associated with presumed subretinal neovascularisation. Images PMID:6155934

  6. Establishment of a Rubella Screening and Immunization Program at the US Army Community Hospital, Fort Carson, Colorado

    DTIC Science & Technology

    1981-04-01

    highlighted the October 31, 1980 Morbidity and Mortality Weekly Report. 1 2 Nosocomial Rubella Infection in North Dakota, Alabama, and Ohio (January 9, 1981...studies of pregnancies complicated by maternal rubella during the first trisemester iave estimated the risk of congenital infection to be as high as 50...Education, and Welfare, Center for Disease Control, " Nosocomial Rubella Infection - North Dakota, Alabama, Ohio," Morbidity and Mortality Weekly

  7. Global seroprevalence of rubella among pregnant and childbearing age women: a meta-analysis.

    PubMed

    Pandolfi, E; Gesualdo, F; Rizzo, C; Bella, A; Agricola, E; Mastroiacovo, P; Tozzi, A E

    2017-06-01

    We conducted a meta-analysis of articles published between January 2000 and July 2016 with the aim of defining the proportion of rubella seronegative women of childbearing age (WCBA), providing the best information available on the seroprevalence of rubella in this population. We selected articles published in the time period between 2000 and 2016. The pooled prevalence of rubella seronegative women was calculated by a fixed effect model and a random effect model, according to the heterogeneity among studies. Studies were sub-grouped by population type (pregnant women and WCBA with no mention of ongoing pregnancy) and by geographic area [World Health Organization (WHO) region]. Sensitivity analysis was performed to assess the stability of results. We found important differences in rubella seronegativity prevalence estimates by WHO Region. About 88% of the studies conducted on pregnant women reported a seronegativity rate >5%. The pooled rubella seronegativity prevalence was 9.3%. When considering population groups, we obtained a seronegativity pooled estimate of 9.4% for pregnant women and of 9.5% for WCBA with no mention of ongoing pregnancy. This meta-analysis shows that the proportion of WCBA who are susceptible to rubella is still high. The figures are worrisome, taking into account that the WHO set at 5% the rubella susceptibility threshold for WCBA. © The Author 2017. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

  8. [Molecular epidemiological study on rubella virus strains isolated in Zhejiang province, China, 2005-2010].

    PubMed

    Feng, Yan; Zhong, Shu-ling; Xu, Chang-ping; Shi, Wen; Lu, Yi-yu

    2011-09-01

    To analyze the molecular epidemiological characteristic of rubella virus strains isolated in Zhejiang province from 2005 to 2010, to provide basic data for rubella prevention and control. Rubella virus strains were isolated on Vero cells from the suspected patients' specimens collected in Zhejiang province during 2005 to 2010. Partial fragments of the structural gene of Zhejiang rubella strains were amplified, using nested reverse transcription-polymerase chain reaction (RT-PCR). The amplified products were sequences and analyzed. In total, 7 rubella strains were isolated from 52 clinical specimens, of which six were classified as genotype 1E and only one was characterized as genotype 2B. In the phylogenetic tree, the Zhejiang 1E genotype rubella strains were located in the same branches with Hongkong or Hainan isolates respectively, but the Zhejiang 2B genotype strain were located in the same branch with oversea strain BuenosAires. ARG/46.08. Through p-distance analysis, results also showed that the Zhejiang 2B genotype strain was closer to the 2B strains isolated from overseas (0.011) than those strains from other provinces of China (0.023). Compared with Chinese vaccine strain BRD II, the homology on three structural genes was C > E2 > E1, but the homology of deduced amino acid sequence was E1 > C > E2, with corresponding 3, 11 and 23 amino acid mutations. There was only one amino acid on E1 gene with entropy value higher than 0.600, but seven sites on E2 gene with entropy value appeared higher than 0.600 and one with entropy value higher than 1.000. Two genotypes of rubella virus had circulated in Zhejiang province during 2005 to 2010. Genotype 1E appeared to be the predominant genotype and 2B being an imported one. Amino acid sequence of E1 gene from Zhejiang rubella strains was comparatively conserved, but E2 gene was hypervariable. Study on rubella virus E2 and C gene should be conducted in the epidemiological surveillance program of rubella.

  9. Introduction of rubella-containing-vaccine to Madagascar: implications for roll-out and local elimination

    PubMed Central

    Wesolowski, Amy; Mensah, Keitly; Brook, Cara E.; Andrianjafimasy, Miora; Winter, Amy; Buckee, Caroline O.; Razafindratsimandresy, Richter; Tatem, Andrew J.; Heraud, Jean-Michel; Metcalf, C. Jessica E.

    2016-01-01

    Few countries in Africa currently include rubella-containing vaccination (RCV) in their immunization schedule. The Global Alliance for Vaccines Initiative (GAVI) recently opened a funding window that has motivated more widespread roll-out of RCV. As countries plan RCV introductions, an understanding of the existing burden, spatial patterns of vaccine coverage, and the impact of patterns of local extinction and reintroduction for rubella will be critical to developing effective programmes. As one of the first countries proposing RCV introduction in part with GAVI funding, Madagascar provides a powerful and timely case study. We analyse serological data from measles surveillance systems to characterize the epidemiology of rubella in Madagascar. Combining these results with data on measles vaccination delivery, we develop an age-structured model to simulate rubella vaccination scenarios and evaluate the dynamics of rubella and the burden of congenital rubella syndrome (CRS) across Madagascar. We additionally evaluate the drivers of spatial heterogeneity in age of infection to identify focal locations where vaccine surveillance should be strengthened and where challenges to successful vaccination introduction are expected. Our analyses indicate that characteristics of rubella in Madagascar are in line with global observations, with an average age of infection near 7 years, and an impact of frequent local extinction with reintroductions causing localized epidemics. Modelling results indicate that introduction of RCV into the routine programme alone may initially decrease rubella incidence but then result in cumulative increases in the burden of CRS in some regions (and transient increases in this burden in many regions). Deployment of RCV with regular supplementary campaigns will mitigate these outcomes. Results suggest that introduction of RCV offers a potential for elimination of rubella in Madagascar, but also emphasize both that targeted vaccination is likely to be a lynchpin of this success, and the public health vigilance that this introduction will require. PMID:27122178

  10. Surveillance of congenital rubella and rubella infections in pregnancy in EU/EEA countries, 2012: Current status and future perspective to monitor elimination.

    PubMed

    Giambi, C; Montaño-Remacha, C; Celentano, L Pastore; Derrough, T

    2015-09-11

    Rubella elimination and congenital rubella syndrome (CRS) prevention are targets for achievement by 2015 in the WHO-EURO Region. This paper describes the existing surveillance systems for CRS and rubella in pregnancy in order to critically interpret the findings in relation to the 2012 WHO-EURO surveillance guidelines. In 2012 we conducted a survey to collect information on surveillance of CRS and rubella in pregnancy in 29 EU/EEA countries. Questionnaires explored the characteristics of the surveillance systems, case definition, epidemiological investigation and follow-up of cases, reference laboratories and types of tests performed. Twenty-eight countries had surveillance systems for CRS, mostly nationwide, mandatory, passive and case-based; 23 collected information on the origin of the infection; 11 reported asymptomatic infections; 6 required zero-reporting. Case definitions varied among countries, although 24 used the EU definition. Laboratories reported cases in 18 countries. Twenty countries collected information on pregnancy within the rubella surveillance system and 5 had specific surveillance for rubella in pregnancy. Two countries did not monitor outcomes of suspected infections in pregnancy; infants with CRS were monitored in all the remaining countries; asymptomatic infected infants in 15; stillbirths and fetal deaths in 13; therapeutic and spontaneous abortions in 8 and 7. Twenty-seven countries had a national reference laboratory for CRS and rubella in pregnancy; genotyping was performed in 15. The current surveillance systems allow adequate CRS monitoring in EU. Further efforts are needed to improve their quality, including uniform case definitions, collection of information on the origin of infection, and promotion of reporting from laboratories. Follow-up of pregnant women with suspected infection should be strengthened because it is an entry point for CRS, including detection of fetal deaths, stillbirths and abortions. Laboratory capacity for confirming congenital rubella infections and infections in pregnancy is good in EU, however the use of genotyping should be encouraged. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. [Monitoring of implementation of international programs of poliomyelitis eradication and measles and rubella elimination in the Republic of Belarus].

    PubMed

    2012-01-01

    Monitoring of implementation of international programs of poliomyelitis eradication, and measles and rubella elimination in the Republic of Belarus based on results of molecular-epidemiologic studies of 2009 - 2010. 271 viral agents isolated from children with acute flaccid paralysis syndrome, other diseases, healthy children and from sewage water within the framework of poliomyelitis control implementation were identified by serological and molecular methods. Blood sera of 528 patients with fever and rash were examined for the presence of IgM to measles and rubella virus, 418 - for the presence of IgM to parvovirus B19 and parvovirus DNA. Blood sera of 33 pregnant women and 64 children with signs of intrauterine infection were studied for IgM and IgG antibodies to rubella virus. Measles virus was isolated, N-gene sequence and phylogenetic analysis carried out. The studies performed confirmed that indigenous wild polioviruses in the country do not circulate, imported wild or vaccine-related polioviruses were also not detected. Measles and rubella morbidity in the Republic of Belarus was less than 1 in 1 000 000. 2 cases of rubella (2009) and 1 case of measles (2010) was detected during adequate control level: the rate of detection of patients with fever and rash, in whom measles and rubella diagnosis was excluded by the results of laboratory examination, was more than 2 in 100 000 of the population. The etiologic agent in more than 20% of diseases with fever and rash was parvovirus B19. A single case of measles was caused by genotype D8 virus imported from India. The data obtained give evidence to conformance of the poliomyelitis, measles, rubella, innate rubella syndrome control implemented in the Republic of Belarus to WHO recommendations; maintenance of status of country as free from poliomyelitis and achievement of main criteria of elimination of both measles and rubella by 2010.

  12. Rubella epidemics and genotypic distribution of the rubella virus in Shandong Province, China, in 1999-2010.

    PubMed

    Wang, Changyin; Zhu, Zhen; Xu, Qing; Xu, Aiqiang; Fang, Xueqiang; Song, Lizhi; Li, Weixiu; Xiong, Ping; Xu, Wenbo

    2012-01-01

    The rubella vaccine was introduced into the immunization program in 1995 in the Shandong province, China. A series of different rubella vaccination strategies were implemented at different stages of measles control in Shandong province. The average reported incidence rate of rubella cases remained at a low level in Shandong province after 1999. However, rubella epidemics occurred repeatedly in 2001/2002, 2006, and 2008/2009. The age of the onset of rubella cases gradually increased during 1999-2010, which showed that most cases were found among the 10 years old in 1999 and among the 17 years old in 2010. Phylogenetic analysis was performed and a phylogenetic tree was constructed based on the World Health Organization standard sequence window for rubella virus isolates. All rubella viruses isolated in Shandong province were divided into 4 genotypes: 1E, 1F, 2A, and 2B. Genotype 1E viruses accounted for the majority (79%) of all these viruses. The similarity of nucleotide and amino acid sequences among genotype 1E viruses was 98.2-100% and 99.1-100%, respectively. All Shandong genotype 1E strains, differed from international genotype 1E strains, belonged to cluster 1 and interdigitated with the viruses from other provinces in mainland China. The effective number of infections indicated by a bayesian skyline plot remained constant from 2001 to 2009. The gradual shift of disease burden to an older age group occurred after a rubella-containing vaccine was introduced into the childhood immunization schedule in 1995 in Shandong province. Four genotypes, including 1E, 1F, 2A, and 2B, were found in Shandong province during 2000-2009. Genotype 1E, rather than genotype 1F, became the predominant genotype circulating in Shandong province from 2001. All Shandong genotype 1E viruses belong to the genotype 1E/cluster 1; they have constantly circulated, and co-evolved and co-circulated, with those from other provinces.

  13. Seroprevalence of rubella antibodies and determinants of susceptibility to rubella in a cohort of pregnant women in Canada, 2008-2011.

    PubMed

    Gilbert, Nicolas L; Rotondo, Jenny; Shapiro, Janna; Sherrard, Lindsey; Fraser, William D; Ward, Brian J

    2017-05-25

    Long term control of rubella and congenital rubella syndrome relies on high population-level immunity against rubella, particularly among women of childbearing age. In Canada, all pregnant women should be screened so that susceptible new mothers can be offered vaccination for rubella before discharge. This study was undertaken to estimate rubella susceptibility in a cohort of pregnant women in Canada and to identify associated socio-economic and demographic factors. Biobanked plasma samples were obtained from the Maternal-Infant Research on Environmental Chemicals (MIREC) study, in which pregnant women were recruited between 2008 and 2011. Socio-demographic characteristics and obstetric histories were collected. Second trimester plasma samples (n=1,752) were tested for rubella-specific IgG using an in-house enzyme-linked immunosorbent assay. The percentage of women with IgG titers <5IU/mL, 5-10IU/mL, and ≥10IU/mL were 2.3%, 10.1%, and 87.6%, respectively. Rates of seronegativity, defined as <5IU/mL, were 3.1% in women who had no previous live birth and 1.6% in women who had given birth previously. Among the latter group, seronegativity was higher in women with high school education or less (adjusted OR (aOR) 5.93, 95% CI 2.08-16.96) or with a college or trade school diploma (aOR 3.82, 95% CI 1.45-10.12), compared to university graduates, and those born outside Canada (aOR 2.60, 95% CI 1.07-6.31). In conclusion, a large majority of pregnant women were found to be immune to rubella. Further research is needed to understand inequalities in vaccine uptake or access, and more effort is needed to promote catch-up measles-mumps-rubella vaccination among socioeconomically disadvantaged and immigrant women of childbearing age. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  14. [Rubella seroprevalence in 234 military young women aged between 19 and 31 years].

    PubMed

    Senèze, Catherine; Haus-Cheymol, Rachel; Hanslik, Thomas

    2008-12-01

    The main objectives of this study were to estimate, among young French women joining the french army, 1) their protective immunity against rubella, 2) the origin of this immunity (immunization or infection), 3) the rubella vaccine coverage and 4) the knowledge of these subjects on the disease and its methods of prevention. The study was conducted between December 1(st) 2006 and April 30(th) 2007 among 234 military women born 1976 to 1987. The results of rubella serology were obtained either in the medical files or after prescription of a serology. The dates of vaccination were collected on the military medical files and on the personal health records. A questionnaire was used to estimate the knowledge of these women on rubella. 234 women were included in our study. Results of serology were available for 224 of them. The serologic susceptibility to rubella virus was 6.7%. The mean age at the time of the serological investigation was 21.9 years. The vaccinal history was able to be collected for 45% of the immune women and 7 of the 15 non-immune women. Among the immune women, 74% had an antecedent of vaccination against rubella. The rate of rubella vaccine coverage was estimated at 70.5%. The proportion of the non-vaccinated immune women decreased during time, for the benefit of the vaccinated immune women. The knowledge on rubella disease did not differ according to the maternal status of the women. Near a quarter of them ignored the disastrous consequences for he foetus. This study shows a high seroprevalence of about 93% while the rubella vaccine coverage is estimated at 70.5%, letting suppose the persistence of the wild virus. The prevention campaigns and the efforts begun to vaccine all the non-immune women of childbearing age must be pursued.

  15. Phylogenetic analysis of rubella virus strains during an outbreak in São Paulo, 2007-2008.

    PubMed

    Figueiredo, C A; Oliveira, M I; Curti, S P; Afonso, A M S; Frugi Yu, A L; Gualberto, F; Durigon, E L

    2012-10-01

    Rubella virus (RV) is an important human pathogen that causes rubella, an acute contagious disease. It also causes severe birth defects collectively known as congenital rubella syndrome when infection occurs during the first trimester of pregnancy. Here, we present the phylogenetic analysis of RV that circulated in São Paulo during the 2007-2008 outbreak. Samples collected from patients diagnosed with rubella were isolated in cell culture and sequenced. RV RNA was obtained from samples or RV-infected cell cultures and amplified by reverse transcriptase-polymerase chain reaction. Sequences were assigned to genotypes by phylogenetic analysis using RV reference sequences. Seventeen sequences were analyzed, and three genotypes were identified: 1a, 1G, and 2B. Genotypes 1a and 1G, which were isolated in 2007, were responsible for sporadic rubella cases in São Paulo. Thereafter, in late 2007, the epidemiological conditions changed, resulting in a large RV outbreak with the clear dominance of genotype 2B. The results of this study provide new approaches for monitoring the progress of elimination of rubella from São Paulo, Brazil. Copyright © 2012 Wiley Periodicals, Inc.

  16. Rubella seroprevalence among pregnant women in Beijing, China.

    PubMed

    Meng, Qinghong; Luo, Jie; Li, Lijun; Shi, Wei; Yu, Jinqian; Shen, Yingjie; Li, Li; Wang, Yajuan; Yao, Kaihu

    2018-03-15

    Rubella infection in pregnant women can result in serious effects, such as miscarriages, stillbirths, and congenital rubella syndrome (CRS). However, very little is known about the rubella seroprevalence among pregnant women in China. This is a cross-sectional and hospital-based study. From June 2016 through March 2017, a total of 324 serum samples from healthy pregnant women were collected in the Shunyi Women and Children's Hospital of Beijing Children's Hospital. Rubella-specific IgG antibody was determined by ELISA (Euroimmun, Lübeck, Germany) kits. International assigned cut-off values of ≥10 IU/ml were used to assess the percentage of pregnant women with protective IgG concentrations. The total rate of protected individuals was 83.3% (95% CI: 78.9%-87.0%). The protective rates of pregnant women in 17-26 years group, 27-36 years group and 37-46 years group were 84.0% (95% CI: 75.3%-90.1%), 81.9% (95% CI: 74.9%-87.4%) and 84.9% (95% CI: 75.8%-90.9%) respectively. No significant difference in protective rates among the three age groups was found (P = 0.83). There were also no statistically significant correlations between protective rates and gravidity (P = 0.84), parity (P = 0.84), birth place (P = 0.16), residence area (P = 0.58), education (P = 0.40) or occupation (P = 0.65). Despite the generally low vaccination coverage for rubella, most of Chinese pregnant women had potent rubella immunity. However, at least 16.7% of pregnant women were susceptible to rubella, which suggested rubella immunization in Chinese women at or before child-bearing age.

  17. Rubella natural immunity among adolescent girls in Tanzania: the need to vaccinate child bearing aged women.

    PubMed

    Mirambo, Mariam M; Majigo, Mtebe; Scana, Seth D; Mushi, Martha F; Aboud, Said; Groß, Uwe; Kidenya, Benson R; Mshana, Stephen E

    2018-01-03

    Rubella primary infection during early stages of pregnancy is associated with high risk of congenital Rubella syndrome (CRS). Prevention of CRS in the resource-limited countries requires multiple strategies. Here, we document the data on the magnitude of Rubella natural immunity among adolescent girls which is a crucial group in devising effective control strategies to prevent CRS. A cross sectional study involving 397 adolescent girls was conducted in the city of Mwanza involving five secondary schools. Socio-demographic and other relevant information were collected using pre-tested data collection tool. Rubella IgG antibodies were determined using enzyme immunoassay. The presence of Rubella IgG titers of >10 IU/ml indicated natural immunity. The mean age of the study participants was 15.18 ± 1.48 years. Of 397 girls, 340 (85.6%) and 57 (14.4%) were from secondary schools representing peri-urban and rural areas, respectively. Out of 397 girls, 90.4% (95% CI: 87-93) were found to be naturally immune with median Rubella IgG antibodies titers of 56.7 IU/ml interquartile range (IQR): 40.8-137. The median Rubella IgG antibodies titers were significantly high in adolescent girls from families with high socio-economic status (63.96 vs. 47.13 IU/ml, P < 0.001) and in adolescent girls from peri-urban areas of the city (63.33 vs. 39.9 IU/ml, P < 0.001). The majority of adolescent girls in the city of Mwanza are naturally immune to Rubella virus. There is a need to compare the effectiveness of screening and vaccinating susceptible adolescent girls with the effectiveness of vaccinating all women of childbearing in controlling CRS in low-income countries.

  18. Interaction between human blood platelets, viruses and antibodies. IV. Post-Rubella thrombocytopenic purpura and platelet aggregation by Rubella antigen–antibody interaction

    PubMed Central

    Myllylä, G.; Vaheri, A.; Vesikari, T.; Penttinen, K.

    1969-01-01

    A new method of measuring antibodies by observing sedimentation patterns of platelets has been compared with the complement fixation and haemagglutination inhibition techniques in ten cases of Rubella and seven cases of post-Rubella thrombocytopenic purpura. The method is based on the aggregation of platelets by the joint action of antibody and small size antigens. The platelet aggregation method gave exceptionally high titres in cases of post-Rubella thrombocytopenic purpura. Other serologic methods did not give these high titres. The hypothesis that small size virus antigen and antibody against it are both needed to induce thrombocytopenia during the recovery period is discussed. Large amounts of both may result in clinical symptoms. PMID:5814719

  19. Congenital rubella syndrome in Haiti (Short communication).

    PubMed

    Golden, Nancy; Kempker, Russell; Khator, Parul; Summerlee, Robert; Fournier, Arthur

    2002-10-01

    To determine if there is an unrecognized problem of congenital rubella syndrome (CRS) in Haiti, a country without a national rubella immunization program. During March 2001 and June 2001, screening physicals were conducted on approximately 80 orphans at three orphanages in Haiti that accept disabled children. Children were classified as probable CRS cases based on established clinical criteria. Photo documentation of findings was obtained whenever possible. Six children met the criteria for probable CRS. Using data from surrounding Caribbean countries and from the United States of America prior to rubella immunization, we estimated that there are between 163 and 440 new cases of CRS per year in Haiti. CRS exists in Haiti, but its presence is generally unrecognized. A national rubella immunization policy should be considered.

  20. High-Throughput Assay Optimization and Statistical Interpolation of Rubella-Specific Neutralizing Antibody Titers

    PubMed Central

    Lambert, Nathaniel D.; Pankratz, V. Shane; Larrabee, Beth R.; Ogee-Nwankwo, Adaeze; Chen, Min-hsin; Icenogle, Joseph P.

    2014-01-01

    Rubella remains a social and economic burden due to the high incidence of congenital rubella syndrome (CRS) in some countries. For this reason, an accurate and efficient high-throughput measure of antibody response to vaccination is an important tool. In order to measure rubella-specific neutralizing antibodies in a large cohort of vaccinated individuals, a high-throughput immunocolorimetric system was developed. Statistical interpolation models were applied to the resulting titers to refine quantitative estimates of neutralizing antibody titers relative to the assayed neutralizing antibody dilutions. This assay, including the statistical methods developed, can be used to assess the neutralizing humoral immune response to rubella virus and may be adaptable for assessing the response to other viral vaccines and infectious agents. PMID:24391140

  1. The significance of specific IgM antibody in the diagnosis of rubella employing the immunofluorescence technique

    PubMed Central

    Iwakata, S.; Rhodes, A. J.; Labzoffsky, N. A.

    1972-01-01

    The applicability of the immunofluorescence (IF) test to the diagnosis of primary rubella infection was investigated. The test is based on the detection of rubella-specific antibodies in the IgM fraction of immunoglobulins. The results indicate the usefulness of the IF test for the diagnosis of primary rubella infection on a single serum specimen collected at a proper time. The test is also of value in the differentiation of primary infection from reinfection, since in reinfection no rubella-specific antibodies are found in the IgM fraction. The test is also valuable for the detection of fetal infection in utero since the persistence of IgM antibodies in pregnant women is indicative of fetal infection. PMID:4551395

  2. High seroprevalence of varicella, measles, mumps, rubella and pertussis antibodies in first-grade medical students.

    PubMed

    Socan, Maja; Berginc, Natasa

    2008-01-01

    The aim of the study was to investigate seropositivity for five vaccine-preventable communicable diseases - varicella, measles, mumps, rubella and pertussis - in a sample of first-grade medical students. A total of 256 students were tested for varicella IgG antibodies. In addition, 138 of the students were serologically screened for measles, mumps, rubella and pertussis antibodies. Data on vaccination and history of measles, mumps, rubella and pertussis were collected. Immunity to varicella, measles, mumps and rubella was established in 97.6%, 96.4%, 97.8% and 99.3% participants, respectively. Anti-pertussis toxin antibodies were detected in 81.2% of the students. The rates of varicella, measles, mumps and rubella immunity in first-grade medical students are very high. To identify those students who need vaccination before commencing practical work in healthcare facilities, a meticulous disease and vaccination history should be taken and medical records should be reviewed. Medical students providing no written evidence of adequate vaccination status should be serologically tested and vaccinated if necessary.

  3. Evaluation of sensitivity of TaqMan RT-PCR for rubella virus detection in clinical specimens.

    PubMed

    Okamoto, Kiyoko; Mori, Yoshio; Komagome, Rika; Nagano, Hideki; Miyoshi, Masahiro; Okano, Motohiko; Aoki, Yoko; Ogura, Atsushi; Hotta, Chiemi; Ogawa, Tomoko; Saikusa, Miwako; Kodama, Hiroe; Yasui, Yoshihiro; Minagawa, Hiroko; Kurata, Takako; Kanbayashi, Daiki; Kase, Tetsuo; Murata, Sachiko; Shirabe, Komei; Hamasaki, Mitsuhiro; Kato, Takashi; Otsuki, Noriyuki; Sakata, Masafumi; Komase, Katsuhiro; Takeda, Makoto

    2016-07-01

    An easy and reliable assay for detection of the rubella virus is required to strengthen rubella surveillance. Although a TaqMan RT-PCR assay for detection of the rubella virus has been established in Japan, its utility for diagnostic purposes has not been tested. To allow introduction of the TaqMan RT-PCR into the rubella surveillance system in Japan, the sensitivity of the assay was determined using representative strains for all genotypes and clinical specimens. The detection limits of the method for individual genotypes were examined using viral RNA extracted from 13 representative strains. The assay was also tested at 10 prefectural laboratories in Japan, designated as local reference laboratories for measles and rubella, to allow nationwide application of the assay. The detection limits and amplification efficiencies of the assay were similar among all the representative strains of the 13 genotypes. The TaqMan RT-PCR could detect approximately 90% of throat swab and urine samples taken up to 5days of illness. These samples were determined positive by a highly sensitive nested RT-PCR. The TaqMan RT-PCR could detect at least 10 pfu of rubella virus. Although the sensitivity was somewhat lower than that of the conventional nested RT-PCR, the TaqMan RT-PCR could be more practical to routine tests for rubella laboratory diagnosis and detection in view of the rapid response and reducing risks of contamination. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. The end of measles and congenital rubella: an achievable dream?

    PubMed

    Adamo, G; Sturabotti, G; D'Andrea, E; Baccolini, V; Romano, F; Iannazzo, S; Marzuillo, C; Villari, P

    2017-01-01

    Despite substantial progress towards measles and rubella control, outbreaks continue to threaten elimination goals worldwide. This paper aims to document progress towards the global eradication of measles and rubella. In particular, it investigates the major challenges faced by Italy in reaching the elimination goals. A review of the most important literature was carried out. Furthermore, a systematic review of the scientific literature on measles and rubella in the Italian setting was performed for the period 2000-2016. In the National Plan 2010-2015, Italy renewed its commitment to eliminate measles and rubella by 2015. However, Italy recently experienced a high measles burden (2,205 cases in 2013, 1,694 in 2014). Between June 2015 and May 2016, 515 cases were reported, accounting for 28% all cases in Europe. Immunization coverage decreased in recent years, with no Region reaching the 95% target. The systematic review included a total of 175 papers, with an upward trend in the number of published articles, which demonstrates an increasing interest in the field of measles and rubella. The review highlights the need to improve the commitment of the Italian Regions to the elimination goals; to promote Supplementary Immunization Activities (SIAs); to improve the communication skills of health care workers; to improve the health literacy of citizens; and to enhance integrated measles and rubella surveillance. Elimination of measles and rubella in Italy will require a substantial improvement in both commitment of the 21 Regions and activity of the whole country towards the WHO goals.

  5. The impact of maternal measles-rubella immunization on the 12-month-old infant's immune response to measles-mumps-rubella vaccine immunogenicity.

    PubMed

    Saffar, M-J; Ajami, A; Khalilian, A-R; Saffar, H

    2009-07-01

    This study was conducted to assess the roles of maternal measles-rubella (MR) vaccination before pregnancy on the persistence of passive immunity against MR in their infant before measles-mumps-rubella (MMR) immunization and the effects on the immunogenicity of MMR vaccine. Before and 4-8 weeks after MMR immunization of all healthy 12-month-old infants, sera samples were prepared. According to their mother's history of MR vaccination, infants were divided into two groups. Anti-MR antibodies were measured by the quantitative enzyme-linked immunosorbent assay (ELISA) method. The difference in seroconversion rates and the mean concentration of antibodies (MCA) between the two groups of infants were analyzed by descriptive statistical methods. In total, 7 and 12 sera, all from infants born from MR-vaccinated mothers, were positive against measles and rubella, respectively. The seroconversion rates were 90.5 and 53% in seronegative infants against measles and rubella, respectively, without statistically significant differences between the two groups of infants. However, the MCA differences were significant; measles P = 0.000, rubella P = 0.019. The MR vaccination of mothers may cause the prolongation of passive immunity in their infants, and may influence the immunogenicity of MMR vaccination. This finding should be considered for the optimal scheduling of the first dose of MMR vaccine. Also, the results showed that the immunogenicity of the rubella component of the MMR vaccine was lower than that reported.

  6. OAS single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine

    PubMed Central

    Haralambieva, Iana H.; Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2010-01-01

    Interferon (IFN)-induced antiviral genes are crucial players in innate antiviral defense and potential determinants of immune response heterogeneity. We selected 114 candidate SNPs from 12 antiviral genes using an LD tagSNP selection approach and genotyped them in a cohort of 738 schoolchildren immunized with two doses of rubella vaccine. Associations between SNPs/haplotypes and rubella virus-specific immune measures were assessed using linear regression methodologies. We identified 23 significant associations (p<0.05) between polymorphisms within the 2′-5′-oligoadenylate synthetase (OAS) gene cluster, and rubella virus-specific IL-2, IL-10, IL-6 secretion and antibody levels. The minor allele variants of three OAS1 SNPs (rs3741981/Ser162Gly, rs1051042/Thr361Arg, rs2660), located in a linkage disequilibrium block of functional importance, were significantly associated with an increase in rubella virus-specific IL-2/Th1 response (p≤0.024). Seven OAS1 and OAS3 promoter/regulatory SNPs were similarly associated with IL-2 secretion. Importantly, two SNPs (rs3741981 and rs10774670), independently cross-regulated rubella virus-specific IL-10 secretion levels (p≤0.031). Furthermore, both global tests and individual haplotype analyses revealed significant associations between OAS1 haplotypes and rubella virus-specific cytokine secretion. Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine. PMID:20079393

  7. Measles, mumps, and rubella--vaccine use and strategies for elimination of measles, rubella, and congenital rubella syndrome and control of mumps: recommendations of the Advisory Committee on Immunization Practices (ACIP).

    PubMed

    Watson, J C; Hadler, S C; Dykewicz, C A; Reef, S; Phillips, L

    1998-05-22

    These revised recommendations of the Advisory Committee on Immunization Practices (ACIP) on measles, mumps, and rubella prevention supersede recommendations published in 1989 and 1990. This statement summarizes the goals and current strategies for measles, rubella, and congenital rubella syndrome (CRS) elimination and for mumps reduction in the United States. Changes from previous recommendations include: Emphasis on the use of combined MMR vaccine for most indications; A change in the recommended age for routine vaccination to 12-15 months for the first dose of MMR, and to 4-6 years for the second dose of MMR; A recommendation that all states take immediate steps to implement a two dose MMR requirement for school entry and any additional measures needed to ensure that all school-aged children are vaccinated with two doses of MMR by 2001; A clarification of the role of serologic screening to determine immunity; A change in the criteria for determining acceptable evidence of rubella immunity; A recommendation that all persons who work in health-care facilities have acceptable evidence of measles and rubella immunity; Changes in the recommended interval between administration of immune globulin and measles vaccination; and Updated information on adverse events and contraindications, particularly for persons with severe HIV infection, persons with a history of egg allergy or gelatin allergy, persons with a history of thrombocytopenia, and persons receiving steroid therapy.

  8. Sociodemographic and economic characteristics of susceptibility to rubella among women preparing for pregnancy in rural China.

    PubMed

    Liu, Fangchao; Zhang, Shikun; Liu, Jue; Wang, Qiaomei; Shen, Haiping; Zhang, Yiping; Liu, Min

    2017-09-01

    Infection with rubella virus during pregnancy can result in congenital defects and adverse pregnancy outcomes. The risk of rubella infection is greatly determined by the level of rubella antibodies in the serum. A survey of rubella antibody seronegativity rates was conducted in 780 000 women in rural China who were planning a pregnancy, in order to evaluate the herd susceptibility in different age groups and by high, middle, and low GDP per capita regions. In order to evaluate the herd susceptibility to rubella, a nationwide population-based study of rural Chinese women who were planning to have a baby and who were aged 21-49 years was instigated. As a part of the National Free Pre-conception Health Examination Project covering 29 provinces in 2012, a physical check-up program was provided to women who planned to become pregnant within the next 6 months. All medical data were from serological samples tested by ELISA, and the participants' immunity status was categorized based on levels of rubella antibodies. Economic data were also collected to explore the association between herd susceptibility and socioeconomic characteristics in the women of childbearing age. A total 264 306 of 782 293 recruited women preparing for pregnancy tested susceptible to rubella (33.79%). The seronegativity rate in women with a history of vaccination was significantly lower than that in women who had not received the vaccination or did not know their vaccination history (23.76%, 33.70%, and 35.68%, respectively). The seronegativity rates were 26.89%, 37.86%, and 32.61% in high, middle, and low GDP per capita areas, respectively. After stratified analysis and adjusting for other factors by multiple logistic regression, the lower seronegativity rates in women in high GDP per capita regions compared to women in middle and low GDP per capita regions remained in the different age groups and subgroups of immunization history. There is a clear difference in rubella-specific susceptibility among rural women preparing for pregnancy of different sociodemographic and economic backgrounds. The number of rubella-susceptible rural women preparing for pregnancy, especially in relatively low GDP per capita regions in China, was high. Offering rubella vaccination to women who are rubella-susceptible and who plan to become pregnant should become one of the priorities in the field of public health work in China. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  9. Report on Rubella and Handicapped Children.

    ERIC Educational Resources Information Center

    Calvert, Donald R.

    Symptoms and characteristics of rubella (German measles) are listed, including a brief history of the disease. Emphasized are the effects of maternal rubella, particularly if contracted during the first three months of pregnancy. Likelihood of abnormalities of the child are detailed, and resulting educational as well as medical problems are…

  10. 21 CFR 866.3510 - Rubella virus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Rubella virus serological reagents. 866.3510 Section 866.3510 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3510 Rubella virus...

  11. 21 CFR 866.3510 - Rubella virus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Rubella virus serological reagents. 866.3510 Section 866.3510 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3510 Rubella virus...

  12. 21 CFR 866.3510 - Rubella virus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Rubella virus serological reagents. 866.3510 Section 866.3510 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3510 Rubella virus...

  13. 21 CFR 866.3510 - Rubella virus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Rubella virus serological reagents. 866.3510 Section 866.3510 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3510 Rubella virus...

  14. 21 CFR 866.3510 - Rubella virus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Rubella virus serological reagents. 866.3510 Section 866.3510 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3510 Rubella virus...

  15. [Vaccination against rubella, measles, chickenpox, and mumps in nursing students].

    PubMed

    Tashiro, Takayoshi; Urata, Hideko; Okada, Junya; Iwanaga, Kikuko; Tokunaga, Mizuko; Matsumoto, Tadashi

    2004-05-01

    The past history of infection and vaccination, and serum antibodies against rubella, measles, chickenpox, and mumps were investigated, before vaccine was inoculated in the susceptible nursing students. The subjects were 221 nursing students (208 women, 13 men, the average age 18.4 +/- 1.8 years old) who entered Nagasaki University from 2001 to 2003. The positive rates of the past history of rubella, measles, chickenpox, and mumps were 49.8%, 28.1%, 86.4%, 50.7%, and that of previous vaccination were 31.7%, 69.2%, 10.9%, 5.3%, respectively. The serum antibody was measured with HI assay for rubella, or with EIA assay for measles, chickenpox, and mumps. The positive rates for the antibodies against rubella, measles, chickenpox, and mumps were 92.8%, 90.0%, 82.3%, and 85.0%, respectively. The rates for vaccine inoculation to the students without antibody were 92.8% in rubella, 100.0% in measles, 66.7% in chickenpox, 85.0% in mumps, and that to the low titer antibody (2.0 < or = EIA-IgG < 4.0) students were 70.6% in measles, 48.0% in chickenpox, 93.8% in mumps, respectively. Susceptible nursing students, as well as the medical stuff, should be vaccinated in order to prevent hospital infection of rubella, measles, chickenpox, and mumps.

  16. Role of congenital rubella reference laboratory: 21-months-surveillance in Liguria, Italy.

    PubMed

    Canepa, P; Valle, L; Cristina, E; De Florentiis, D; Parodi, V; Banfi, F; Zancolli, M; Durando, P; Icardi, G; Ansaldi, F

    2009-12-01

    Rubella is generally a mild rush fever disease when acquired in childhood, but when infection occurs during the first months of pregnancy, high risk of trans-placental transmission to the foetus and of congenital anomalies exists. In November 2003, a National Plan for measles and congenital rubella elimination was approved in Italy. The aim was to reduce and maintain Congenital Rubella Syndrome incidence lower than 1 case per 100,000 live births/year by 2007. Since June 2006, Liguria Administrative Region recognized U.O. Hygiene, "San Martino" University Hospital, Genoa, as regional reference laboratory for diagnosis of rubella infection during pregnancy and post-partum. Twenty-one-month virological-surveillance results between April 2007 and December 2008 were reported in terms of demographic data, risk factors, access reasons, clinical picture, vaccination, previous rubella disease, laboratory results of pregnant women and newborns. Since the beginning of surveillance, 65 pregnant women with suspected virus infection and 18 newborns with suspected congenital rubella were followed up. The results of laboratory surveillance highlighted (i) the importance of an early screening, (ii) the suboptimal specificity of chemiluminescent assays, that often yield false positive IgM results and (iii) the fundamental role of second-level laboratory to confirm the serological diagnosis and to detect the virus by molecular techniques.

  17. Incidence of rubella in a state in North-western Nigeria: a call for action.

    PubMed

    Omoleke, Semeeh Akinwale; Udenenwu, Henry Chukwuebuka

    2016-01-01

    Rubella cases are often under-reported, especially in many developing countries, owing to inadequate attention and weak funding of elimination strategies, despite being an epidemic-prone disease. Based on available data, this paper, therefore, seeks to bring the attention of public health practitioners, researchers and policy makers to threats of rubella in our environment, and also recommend measures to mitigate the threats. The authors conducted a retrospective cross-sectional study in which the laboratory results of febrile-rash-illness cases in Kebbi State, Northwest Nigeria, from January 1, 2014 to December 31, 2015 were analysed, using descriptive statistics and chi-square test. We obtained the data set through the routine Integrated Disease Surveillance System and Response being conducted in Nigeria. A total of 413 febrile-rash-illness cases were reported and investigated in Kebbi State from 2014 to 2015, 5 (3.5%) tested positive for rubella IgM in 2014 while 7(2.6%) tested positive in 2015. There was no statistically significant difference in the incidence of rubella between 2014 and 2015 (p> 0.05). Rubella infection was mainly found in children less than 5 years of age with peak incidence period during the hot season (between February and April). There was no significant sex bias in this study. However, our practice experiences in this environment suggest a systematic under-reporting and under-diagnosis of febrile- rash-illnesses. There was no statistically significant difference in the incidence of rubella in children in our setting for the 2-years studied. However, there is a potential for increase in the transmission of the disease due to non-availability of routine childhood vaccination against rubella and the systematic under-reporting of suspected cases and weak laboratory support. In order to better appreciate the burden of rubella infection, there may be a need to undertake a prevalence survey, and simultaneously, strengthening case-based surveillance in Northwestern Nigeria. Further, WHO should support national government in accelerating the introduction of rubella-containing vaccine to stem the potential spread of this infectious disease.

  18. Incidence of rubella in a state in North-western Nigeria: a call for action

    PubMed Central

    Omoleke, Semeeh Akinwale; Udenenwu, Henry Chukwuebuka

    2016-01-01

    Introduction Rubella cases are often under-reported, especially in many developing countries, owing to inadequate attention and weak funding of elimination strategies, despite being an epidemic-prone disease. Based on available data, this paper, therefore, seeks to bring the attention of public health practitioners, researchers and policy makers to threats of rubella in our environment, and also recommend measures to mitigate the threats. Methods The authors conducted a retrospective cross-sectional study in which the laboratory results of febrile-rash-illness cases in Kebbi State, Northwest Nigeria, from January 1, 2014 to December 31, 2015 were analysed, using descriptive statistics and chi-square test. We obtained the data set through the routine Integrated Disease Surveillance System and Response being conducted in Nigeria. Results A total of 413 febrile-rash-illness cases were reported and investigated in Kebbi State from 2014 to 2015, 5 (3.5%) tested positive for rubella IgM in 2014 while 7(2.6%) tested positive in 2015. There was no statistically significant difference in the incidence of rubella between 2014 and 2015 (p> 0.05). Rubella infection was mainly found in children less than 5 years of age with peak incidence period during the hot season (between February and April). There was no significant sex bias in this study. However, our practice experiences in this environment suggest a systematic under-reporting and under-diagnosis of febrile- rash-illnesses. Conclusion There was no statistically significant difference in the incidence of rubella in children in our setting for the 2-years studied. However, there is a potential for increase in the transmission of the disease due to non-availability of routine childhood vaccination against rubella and the systematic under-reporting of suspected cases and weak laboratory support. In order to better appreciate the burden of rubella infection, there may be a need to undertake a prevalence survey, and simultaneously, strengthening case-based surveillance in Northwestern Nigeria. Further, WHO should support national government in accelerating the introduction of rubella-containing vaccine to stem the potential spread of this infectious disease. PMID:28250873

  19. Rubella Epidemics and Genotypic Distribution of the Rubella Virus in Shandong Province, China, in 1999–2010

    PubMed Central

    Xu, Qing; Xu, Aiqiang; Fang, Xueqiang; Song, Lizhi; Li, Weixiu; Xiong, Ping; Xu, Wenbo

    2012-01-01

    Background The rubella vaccine was introduced into the immunization program in 1995 in the Shandong province, China. A series of different rubella vaccination strategies were implemented at different stages of measles control in Shandong province. Methodology/Principal Findings The average reported incidence rate of rubella cases remained at a low level in Shandong province after 1999. However, rubella epidemics occurred repeatedly in 2001/2002, 2006, and 2008/2009. The age of the onset of rubella cases gradually increased during 1999–2010, which showed that most cases were found among the 10 years old in 1999 and among the 17 years old in 2010. Phylogenetic analysis was performed and a phylogenetic tree was constructed based on the World Health Organization standard sequence window for rubella virus isolates. All rubella viruses isolated in Shandong province were divided into 4 genotypes: 1E, 1F, 2A, and 2B. Genotype 1E viruses accounted for the majority (79%) of all these viruses. The similarity of nucleotide and amino acid sequences among genotype 1E viruses was 98.2–100% and 99.1–100%, respectively. All Shandong genotype 1E strains, differed from international genotype 1E strains, belonged to cluster 1 and interdigitated with the viruses from other provinces in mainland China. The effective number of infections indicated by a Bayesian skyline plot remained constant from 2001 to 2009. Conclusions/Significance The gradual shift of disease burden to an older age group occurred after a rubella-containing vaccine was introduced into the childhood immunization schedule in 1995 in Shandong province. Four genotypes, including 1E, 1F, 2A, and 2B, were found in Shandong province during 2000–2009. Genotype 1E, rather than genotype 1F, became the predominant genotype circulating in Shandong province from 2001. All Shandong genotype 1E viruses belong to the genotype 1E/cluster 1; they have constantly circulated, and co-evolved and co-circulated, with those from other provinces. PMID:22911874

  20. Anti-rubella, Mumps and Measles IgG Antibodies in Medical Students of Tehran University.

    PubMed

    Keshavarz, Maryam; Nicknam, Mohammad Hossein; Tebyanian, Majid; Shahkarami, Mohammad Kazem; Izad, Maryam

    2016-06-01

    Measles, mumps and rubella are viral infectious diseases that may result in serious complications. Since the production of vaccines, the number of cases of these diseases has been dropped. Nevertheless, these infectious diseases are still one of the major health problems in developing countries. In this study, in order to evaluate the protective responses against measles, mumps and rubella, the level and avidity of virus-specific IgG antibodies were measured in 53 medical students of Tehran University, aged between 20-30 years. Except for mumps vaccine, all the students had been vaccinated against measles and rubella according to Iran's nationwide mass vaccination protocol for all persons aged 5-25 in 2003. Our results showed that 96.2% of the volunteers had a protective level (>15 IU/ml) of IgG against rubella, 79.2% had a protective level (>11 IU/ml) of IgG against measles and 64.16% had a protective level (>11 IU/ml) of IgG against mumps. Over ten years after nationwide measles-rubella vaccination campaign, most young adults aged 20-30 had protective levels of humoral immunity against measles and rubella. However, Iranian young population is still unvaccinated against mumps, and therefore relatively large number of young adults had no protective level of IgG against it. This finding may be due to reduction in circulating of wild strain. We recommend screening of medical students for immunity against infectious agents such as measles, mumps, rubella, because they are at a high risk of these infectious agents.

  1. Poor recall of prior exposure to varicella zoster, rubella, measles, or mumps in patients with IBD.

    PubMed

    Naganuma, Makoto; Nagahori, Masakazu; Fujii, Toshimitsu; Morio, Junko; Saito, Eiko; Watanabe, Mamoru

    2013-02-01

    Few studies have measured the levels of antibodies specific for measles, mumps, rubella, and varicella zoster/chickenpox viruses in inflammatory bowel disease (IBD) patients undergoing treatment with immunomodulators/biologics. We prospectively recruited 139 IBD outpatients. Enzyme-linked immunosorbent assays were used as the serological tests for measles, mumps, rubella, and varicella zoster. We defined anti-rubella IgG < 10 IU/mL, anti-measles IgG < 16 IU/mL, and anti-mumps/varicella zoster IgG <4 IU/mL as seronegative for viruses. We also asked participants about past immunizations against or infections with measles, mumps, rubella, and varicella zoster viruses. The proportion of patients with seronegative levels of antibodies specific for varicella zoster, rubella, measles, and mumps viruses was 5%, 30%, 34%, and 37%, respectively. Approximately 40% of the IBD patients did not remember whether they had previously been infected with any of the viruses, and almost one-third of the patients could not remember whether they had previously been vaccinated. Almost 30% of the patients with a past history of rubella or measles did not have seropositive antibody levels. A total of 54% of the patients being treated with immunosuppressant displayed seronegative levels of antibodies specific for at least one of the viruses. Many IBD patients were unaware of whether they had previously been vaccinated against or infected with the viruses causing varicella zoster, rubella, measles, or mumps. Therefore, measuring the current levels of antibodies specific for such viruses is useful for determining whether patients have seropositive antibody levels before immunomodulators/biologics are used for therapy.

  2. [Surveillance Plan on Recent Outbreak of Measles and Rubella in Catalonia, Spain].

    PubMed

    Jané, Mireia; Torner, Nuria; Vidal, Ma José

    2015-01-01

    Measles and rubella are two immuno-preventive illnesses. In Catalonia, since 1988 all children are given two doses of measles and rubella vaccine with high levels of vaccination coverage. The measles elimination programme has been carried out since 1990 in Catalonia. This programme includes achieving and keeping high immunization levels among population with high vaccination coverage, intense epidemiological surveillance and an immediate response to the appearance of a case or outbreak. In 2014, the measles incidence rate was 1.9 cases/ 100,000 inhabitants. There were 4 recent outbreaks in 2006, 2011, 2013 and 2014 that affected 381, 289, 31 and 124 people respectively. All outbreaks were triggered by an imported case. In 2011 and 2014 measles outbreaks, 6% and 5.5% of affected people were health care workers. All outbreaks presented a great variety of measles genotypes. Concerning rubella elimination programme, since 2002, 68 cases of postnatal rubella and 5 cases of congenital rubella were confirmed. Regarding measles and rubella surveillance and control, in addition to strengthen vaccination coverage, it is essential immediate notification, within the first 24 hours since suspicion and laboratory confirmation. In addition there is a need to enforce vaccination among health care workers as well as in other susceptible and unvaccinated people. It is recommended to vaccinate all people who were born after 1966 and who have not been vaccinated with two doses of trivalent measles-mumps-rubella vaccine. Furthermore, we have to emphasize that the progress concerning genotypes study allows identifying various imported cases from other European countries with active outbreaks, aspect that makes easier the surveillance of these illnesses.

  3. [Detection of rubella virus RNA in clinical material by real time polymerase chain reaction method].

    PubMed

    Domonova, É A; Shipulina, O Iu; Kuevda, D A; Larichev, V F; Safonova, A P; Burchik, M A; Butenko, A M; Shipulin, G A

    2012-01-01

    Development of a reagent kit for detection of rubella virus RNA in clinical material by PCR-RT. During development and determination of analytical specificity and sensitivity DNA and RNA of 33 different microorganisms including 4 rubella strains were used. Comparison of analytical sensitivity of virological and molecular-biological methods was performed by using rubella virus strains Wistar RA 27/3, M-33, "Orlov", Judith. Evaluation of diagnostic informativity of rubella virus RNAisolation in various clinical material by PCR-RT method was performed in comparison with determination of virus specific serum antibodies by enzyme immunoassay. A reagent kit for the detection of rubella virus RNA in clinical material by PCR-RT was developed. Analytical specificity was 100%, analytical sensitivity - 400 virus RNA copies per ml. Analytical sensitivity of the developed technique exceeds analytical sensitivity of the Vero E6 cell culture infection method in studies of rubella virus strains Wistar RA 27/3 and "Orlov" by 11g and 31g, and for M-33 and Judith strains is analogous. Diagnostic specificity is 100%. Diagnostic specificity for testing samples obtained within 5 days of rash onset: for peripheral blood sera - 20.9%, saliva - 92.5%, nasopharyngeal swabs - 70.1%, saliva and nasopharyngeal swabs - 97%. Positive and negative predictive values of the results were shown depending on the type of clinical material tested. Application of reagent kit will allow to increase rubella diagnostics effectiveness at the early stages of infectious process development, timely and qualitatively perform differential diagnostics of exanthema diseases, support tactics of anti-epidemic regime.

  4. Clinical epidemiological and molecular aspects of rubella outbreak with high number of neurological cases, Tunisia 2011-2012.

    PubMed

    Messedi, Emna; Fki-Berrajah, Lamia; Gargouri, Saba; Chouikha, Anissa; Chaari, Anis; Bouaziz, Mounir; Jallouli, Hajer; Yahia, Ahlem Ben; Hammami, Adnene; Triki, Henda; Karray-Hakim, Héla

    2014-10-01

    A large and unusually prolonged rubella outbreak occurred in Tunisia from April 2011 to July 2012 and was characterized by a high number of neurological cases. To describe the outbreak and to perform virus genotyping of isolated virus strains. From January 2011 to December 2012, 5000 sera for serological diagnosis of acute rubella and 31 cerebrospinal fluid from patients with neurological symptoms were tested for the presence of rubella immunoglobulins G and M. Real-time PCR was performed on 49 throat swabs, 21 cerebrospinal fluid and 27 serum samples. Positive samples were assessed for virus genotyping by sequencing and the obtained sequences were compared to those previously isolated in the country. Acute rubella was confirmed in 280 patients including 15 neonates, 217 children and adults with mild rash and 48 patients with severe rubella (mainly encephalitis, n = 39). Most of acquired rubella cases (60.7%) were aged over 12 years with a male predominance observed in the age group 12-25 years (79%). Females belonged essentially to the unvaccinated age groups under 12 and over 25 years. Among the 23 samples tested positive by real-time PCR, six could be genotyped and clustered with either the 1E genotype, previously detected in Tunisia, or the 2B genotype which has never been isolated in Tunisia before. Gender and age distributions of the patients reflect the impact of the selective rubella vaccination program adopted in Tunisia since 2005. Genotype 1E continues to circulate and genotype 2B was probably recently introduced in Tunisia. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Students Hearing Impaired from the 1963-1965 Rubella Epidemic Begin to Enter College.

    ERIC Educational Resources Information Center

    Stuckless, E. Ross; Walter, Gerard G.

    1983-01-01

    Analysis of the postsecondary qualifications among 8,000 or more children born hearing impaired as a result of the 1963-65 rubella epidemic revealed a favorable prognosis for postsecondary education for many rubella students graduating from secondary programs in 1983, l984, and l985. (Author/CL)

  6. Premorbid Anomalies and Risk of Schizophrenia and Depressive Disorders in a Birth Cohort Exposed to Prenatal Rubella

    ERIC Educational Resources Information Center

    Penner, Justin D.; Brown, Alan S.

    2007-01-01

    In a birth cohort prenatally exposed to rubella, we assessed whether prospectively documented premorbid neuromotor dysfunction, mannerisms, deviant behaviors, and temperament during childhood and adolescence were impaired in cases who developed depressive disorder (DD) relative to rubella-exposed controls and cases who developed schizophrenia…

  7. [Seroepidemiologic study of rubella in childbearing women in Aragon, Spain (2003-2007)].

    PubMed

    Hernández Díaz, Rogelio; Rodrigo Val, María Pilar; Misiego Peral, Antonio; Roc Alfaro, María Lourdes; Adiego Sancho, María Begoña

    2011-01-01

    To quantify and identify the rubella-susceptible population in Aragon according to sociodemographic variables, with the aim of assessing compliance with the 5% limit set by the World Health Organization (WHO). Rubella serology tests performed in women of childbearing age in the Miguel Servet Hospital from 2003 to 2007 were studied. A descriptive analysis of seronegativity was performed by age, years of study, and WHO region (for 2007). A logistic regression was performed with the independent variables of age and geographical origin. We studied 13,136 women. The mean age was 31.2 years. During the study period, 5% were susceptible to rubella (95%CI: 4.63-5.37). In 2003, 8.8% were seronegative and the highest percentage (12.3%) was found in women aged 15 to 19 years. The percentage of seronegativity was higher in foreign-born women (7.7%), especially those from Asia, than in Spanish women (3.3%; p<0.05). Postpartum preventive strategies should be established to prevent possible rubella outbreaks and cases of congenital rubella syndrome. Copyright © 2010 SESPAS. Published by Elsevier Espana. All rights reserved.

  8. Pregnancy outcomes of women with failure to retain rubella immunity.

    PubMed

    Schwartzenburg, Christopher J; Gilmandyar, Dzhamala; Thornburg, Loralei L; Hackney, David N

    2014-12-01

    We sought to explore the clinical variables associated with the loss of rubella immunity during pregnancy and to determine if these changes are linked to obstetrical complications. This is a case-control study in which women were identified whose rubella antibody titers were equivocal or non-immune and compared to those who had retained immunity. Two hundred and eighty-five cases were identified and compared to the same number of controls using Student's t test, Mann-Whitney U-test or Fisher's exact test. Univariate and multivariate logistic regressions were employed. Subjects with diminished immunity were more likely to have public insurance and higher gravidity with a trend toward increased tobacco use. Diminished rubella immunity was not associated with adverse obstetrical outcomes, including preterm birth and pre-eclampsia and is likely not a risk factor for these pregnancy outcomes. While no adverse pregnancy outcomes were associated with a loss of rubella immunity, women with greater number of pregnancies appear to lose their immunity to rubella. This relationship needs to be explored further and if proven, revaccination prior to pregnancy may need to be addressed.

  9. Characterizing the dynamics of rubella relative to measles: the role of stochasticity

    PubMed Central

    Rozhnova, Ganna; Metcalf, C. Jessica E.; Grenfell, Bryan T.

    2013-01-01

    Rubella is a completely immunizing and mild infection in children. Understanding its behaviour is of considerable public health importance because of congenital rubella syndrome, which results from infection with rubella during early pregnancy and may entail a variety of birth defects. The recurrent dynamics of rubella are relatively poorly resolved, and appear to show considerable diversity globally. Here, we investigate the behaviour of a stochastic seasonally forced susceptible–infected–recovered model to characterize the determinants of these dynamics and illustrate patterns by comparison with measles. We perform a systematic analysis of spectra of stochastic fluctuations around stable attractors of the corresponding deterministic model and compare them with spectra from full stochastic simulations in large populations. This approach allows us to quantify the effects of demographic stochasticity and to give a coherent picture of measles and rubella dynamics, explaining essential differences in the recurrent patterns exhibited by these diseases. We discuss the implications of our findings in the context of vaccination and changing birth rates as well as the persistence of these two childhood infections. PMID:24026472

  10. Maternal rubella immunity status and pre-eclampsia.

    PubMed

    Lao, Terence T; Sahota, Daljit S; Law, Lai-Wa; Leung, Tak-Yeung

    2017-07-01

    To determine if maternal immune maladaptation associated with pre-eclampsia is reflected in the rubella immunity status. Incidence of pre-eclampsia was compared between rubella non-immune and immune gravidae carrying a singleton pregnancy beyond 24 weeks, taking into account maternal characteristics and reported risk factors for pre-eclampsia. The 9870 (10.4%) rubella non-immune gravidae among the 95 024 in the cohort exhibited no difference in incidence of underlying medical disorders, but they were slightly but significantly older, shorter, heavier, and had more pre-eclampsia (OR 1.24, 95% CI 1.05-1.47) despite having fewer nulliparas. Regression analysis confirmed an overall association between rubella non-immunity with pre-eclampsia (aOR 1.27, 95% CI 1.06-1.54), which was related to multiparas (aOR 1.42, 95% CI 1.05-1.91) and carrying a male fetus (aOR 1.37, 95% CI 1.06-1.78). The association between rubella non-immunity and pre-eclampsia reflects immune maladaptation in multiparas and toward a male fetus. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Acetaminophen (paracetamol) use, measles-mumps-rubella vaccination, and autistic disorder: the results of a parent survey.

    PubMed

    Schultz, Stephen T; Klonoff-Cohen, Hillary S; Wingard, Deborah L; Akshoomoff, Natacha A; Macera, Caroline A; Ji, Ming

    2008-05-01

    The present study was performed to determine whether acetaminophen (paracetamol) use after the measles-mumps-rubella vaccination could be associated with autistic disorder. This case-control study used the results of an online parental survey conducted from 16 July 2005 to 30 January 2006, consisting of 83 children with autistic disorder and 80 control children. Acetaminophen use after measles-mumps-rubella vaccination was significantly associated with autistic disorder when considering children 5 years of age or less (OR 6.11, 95% CI 1.42-26.3), after limiting cases to children with regression in development (OR 3.97, 95% CI 1.11-14.3), and when considering only children who had post-vaccination sequelae (OR 8.23, 95% CI 1.56-43.3), adjusting for age, gender, mother's ethnicity, and the presence of illness concurrent with measles-mumps-rubella vaccination. Ibuprofen use after measles-mumps-rubella vaccination was not associated with autistic disorder. This preliminary study found that acetaminophen use after measles-mumps-rubella vaccination was associated with autistic disorder.

  12. Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

    PubMed Central

    Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

    2015-01-01

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

  13. Infectious agents in congenital cataract in a tertiary care referral center in North India.

    PubMed

    Singh, Mini P; Ram, Jagat; Kumar, Archit; Khurana, Jasmine; Marbaniang, Merinda; Ratho, Radha Kanta

    2016-08-01

    Congenital cataract has the potential for inhibiting early visual development. Intrauterine infections with Rubella virus, Herpes simplex virus (HSV) and Toxoplasma gondii plays an important role in the development of congenital cataract. The study included 120 children under the age of 6 years presenting with congenital cataract and diagnosed using serology and polymerase chain reaction (PCR). The IgM positivity for rubella, HSV, T. gondii was found to be 5.8%, 1.6% and 8.3% respectively. The overall PCR positivity was found to be 40(33.3%), 25 (20.8%) and 39 (32.5%) for rubella, HSV and T. gondii with mean copy number of 1599 copies/μL; 1716 copies/μL and 1503 copies/μL respectively. Infective etiology significantly contributes to the causation of congenital cataract particularly for rubella virus which is a potentially eradicable disease. This study provides an epidemiological data for rubella, HSV and T. gondii in children with congenital cataract and highlights the need to introduce rubella vaccine in the National Immunization Programme of India. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. [Childhood diseases with exanthema].

    PubMed

    Opstelten, Wim; Eekhof, Just A H; Knuistingh Neven, Arie

    2011-01-01

    - Due to high vaccination coverage, measles and rubella (German measles) are now rarely seen in the Netherlands, which makes recognition of these diseases difficult. - Measles can also occur in people who have been immunized, as a result of vaccination failure. - Swift recognition of measles and rubella is necessary in order to manage them adequately and to prevent spreading of the disease. - Measles, rubella, and erythema infectiosum ('fifth disease') may result in complications during pregnancy. - Measles, rubella, scarlet fever, erythema infectiosum, and roseola ('sixth disease') can be difficult to differentiate. - In the Netherlands, diagnosis of a patient with measles or rubella, or of more than 1 patient with erythema infectiosum within one institution, must be reported to the local health authority within 1 working day. - Exclusion from school or a day-care facility is not required for any if the diseases discussed.

  15. MEMS reagent and sample handling procedure: Feasibility of viral antibody detection by passive immune agglutination

    NASA Technical Reports Server (NTRS)

    Bailey, G. D.; Tenoso, H. J.

    1975-01-01

    An attempt was made to develop a test requiring no preadsorption steps for the assessment of antibodies to rubella and mumps viruses using the passive immune agglutination (PIA) method. Both rubella and mumps antigens and antibodies were prepared. Direct PIA tests, using rubella antigen-coated beads, and indirect PIA tests, using rubella antibody-coated beads, were investigated. Attempts, using either method, were unsuccessful. Serum interference along with nonspecific agglutination of beads by the rubella antigen resulted in no specific response under the test conditions investigated. A new, highly sensitive approach, the enzyme immunoassay (EIA) test system, is recommended to overcome the nonspecificity. This system is a logical outgrowth of some of the solid phase work done on MEMS and represents the next generation tests system that can be directly applied to early disease detection and monitoring.

  16. Difficulties in eliminating measles and controlling rubella and mumps: a cross-sectional study of a first measles and rubella vaccination and a second measles, mumps, and rubella vaccination.

    PubMed

    Wang, Zhifang; Yan, Rui; He, Hanqing; Li, Qian; Chen, Guohua; Yang, Shengxu; Chen, Enfu

    2014-01-01

    The reported coverage of the measles-rubella (MR) or measles-mumps-rubella (MMR) vaccine is greater than 99.0% in Zhejiang province. However, the incidence of measles, mumps, and rubella remains high. In this study, we assessed MMR seropositivity and disease distribution by age on the basis of the current vaccination program, wherein the first dose of MR is administered at 8 months and the second dose of MMR is administered at 18-24 months. Cross-sectional serological surveys of MMR antibodies were conducted by collecting epidemiological data in Zhejiang province, China in 2011. In total, 1015 participants were randomly selected from two surveillance sites. Serum MMR-specific immunoglobulin G levels were tested by enzyme-linked immunosorbent assay. The geometric mean titers and seroprevalence with 95% confidence intervals (CIs) were calculated by age and gender. Proportions of different dose of vaccine by age by vaccine were also identified. Statistically significant differences between categories were assessed by the Chi-square test. Over 95% seroprevalence rates of measles were seen in all age groups except <7 months infants. Children aged 5-9 years were shown lower seropositivity rates of mumps while elder adolescences and young adults were presented lower rubella seroprevalence. Especially, rubella seropositivity was significantly lower in female adults than in male. Nine measles cases were unvaccinated or unknown vaccination history. Among them, 66.67% (6/9) patients were aged 20-29 years while 33.33% (3/9) were infants aged 8-12 months. In addition, 57.75% (648/1122) patients with mumps were children aged 5-9 years, and 50.54% (94/186) rubella cases were aged 15-39 years. A timely two-dose MMR vaccination schedule is recommended, with the first dose at 8 months and the second dose at 18-24 months. An MR vaccination speed-up campaign may be necessary for elder adolescents and young adults, particularly young females.

  17. Rubella Seromarkers and Determinants of Infection among Tanzanian Children and Adolescents in Prevaccination Era: Are We in the Right Track?

    PubMed

    Mirambo, Mariam M; Aboud, Said; Groß, Uwe; Majigo, Mtebe; Mushi, Martha F; Mshana, Stephen E

    2017-01-01

    The World health organization advocates assessment of the burden of rubella and congenital rubella syndrome (CRS) by seroepidemiological surveys and surveillance programs in all countries without vaccination programs. Due to scarcity of data in developing countries, this study was conducted to assess the seromakers for natural rubella infection in Tanzania during prevaccination era so as to ascertain the gaps for future research and prevention strategies. A cross-sectional study was conducted between September and October 2014. Indirect enzyme-linked immunosorbent assay was used to detect rubella IgG and IgM antibodies. STATA version 11 was used to perform data analysis. Of 723 enrolled participants, 368 (50.8%) and 94 (13%) were positive for specific IgG and IgM rubella antibodies, respectively. On multivariable logistic regression analysis, significant determinants of rubella IgG seropositivity were increase in age (odds ratios [OR]: 1.24, 95% confidence interval [CI]: 1.18-1.29, P < 0.001), low socioeconomic status (SES) (OR: 2.38, 95% CI: 1.1.23-4.50, P = 0.010), and absence of rash (OR: 4.34, 95% CI: 1.1.17-15.3, P = 0.027), while only the presence of rashes was significant determinant of rubella IgM seropositivity (OR: 2.5, 95%; 1.07-5.98, P = 0.034). Significantly higher mean IgG titers were observed in population ≥10 years ( P < 0.001), those residing in urban and peri-urban areas ( P < 0.001), those from employed mothers ( P = 0.018), and those with no current history of fever ( P = 0.018). The prevalence of specific rubella IgG antibodies in Tanzania is high and is associated with increase in age, absence of rash, and low SES. Results suggest a need to reconsider upper age limit for vaccination campaigns in developing countries. Screening and vaccinating women may be cost-effective campaign to prevent CRS in developing countries.

  18. Laboratory confirmation of rubella infection in suspected measles cases.

    PubMed

    Vaidya, Sunil R; Raut, Chandrashekhar G; Jadhav, Santoshkumar M

    2016-10-01

    As a part of measles outbreak based surveillance undertaken by the World Health Organization India, suspected measles cases were referred for the laboratory diagnosis at National Institute of Virology (NIV) Pune and NIV Unit Bengaluru. Altogether, 4,592 serum samples were referred during 2010-2015 from the States of Karnataka (n = 1,173), Kerala (n = 559), and Maharashtra (n = 2,860). Initially, serum samples were tested in measles IgM antibody EIA and samples with measles negative and equivocal results (n = 1,954) were subjected to rubella IgM antibody detection. Overall, 62.9% (2,889/4,592) samples were laboratory confirmed measles, 27.7% (542/1,954) were laboratory confirmed rubella and remaining 25.2% (1,161/4,592) were negative for measles and rubella. The measles vaccination status was available for 1,206 cases. Among the vaccinated individuals, 50.7% (612/1,206) were laboratory confirmed measles. The contribution of laboratory confirmed measles was 493 (40.8%) from Maharashtra, 90 (7.5%) from Karnataka, and 29 (2.4%) from Kerala. Since, 1/3rd of suspected measles cases were laboratory confirmed rubella, an urgent attention needed to build rubella surveillance in India. Additional efforts are required to rule out other exanthematous disease including Dengue and Chikungunya in measles and rubella negatives. J. Med. Virol. 88:1685-1689, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Antibody class capture assay (ACCA) for rubella-specific IgM antibody.

    PubMed

    Isaac, M; Payne, R A

    1982-01-01

    Enzyme-linked immunosorbent assays for IgM antirubella were carried out on 1,546 sera, using an IgM capture method with a F (ab')2 conjugate (ACCA). Under the conditions described, sera containing IgM antirubella bound up to 15 times as much enzyme activity as negative specimens. Paired serum specimens from 27 patients, serial serum specimens from 6 patients, and single serum specimens from 15 patients who had had recent rubella were examined by the haemagglutination inhibition test (HAI) in the presence and absence of 2-mercaptoethanol following sucrose density gradient centrifugation (SDGC). ACCA confirmed all the results found with HAI following SDGC. Specimens were examined from ten patients with congenital rubella; ACCA confirmed the results found with both immunofluorescence following SDGC and radioimmunoassay. Pre- and post-vaccination specimens from 123 patients who had been vaccinated against rubella were examined. An IgM response could only be demonstrated in the 57 cases when IgG was absent in the first specimen. The specificity of the assay was confirmed by testing 31 serum specimens from rubella immune patients that also contained rheumatoid factor, 163 serum specimens from patients with acute infections other than rubella, and 12 serum specimens from infants with miscellaneous neonatal abnormalities other than congenital rubella. The ACCA proved a simple, sensitive, and specific test for IgM antirubella and the results compared favourably with those obtained by the SDGC technique.

  20. Lack of immunity against rubella among Italian young adults.

    PubMed

    Gallone, Maria Serena; Gallone, Maria Filomena; Larocca, Angela Maria Vittoria; Germinario, Cinzia; Tafuri, Silvio

    2017-03-07

    To support the evaluation of the 2010-15 National Plan for Measles and Congenital Rubella Elimination, the authors designed and performed a serosurveillance survey to verify the immunity/susceptibility rate against rubella among Apulian young adults. The study was carried out from May 2011 to June 2012 in the Department of Transfusion Medicine/Blood Bank of Policlinico General Hospital in Bari. Subjects were enrolled by a convenience sampling. For each enrolled patient a 5 ml serum sample was collected and tested for anti-rubella IgG. The geometrical means (GMT) of anti-rubella IgG was calculated. T student test or ANOVA test, when appropriate, was used to compare the means of age per gender and GMT of anti-rubella IgG titres per age classes. Chi-square test was used to compare the proportion of anti-rubella IgG positive subjects per gender and per age classes. For all tests, a p value <0.05 was considered as significant. At the end of the study 1764 subjects were enrolled, 1362 (77.2%) of which were male. The mean age was 38.4 ± 11.7 years (range: 17-65). 86.7% (95% CI = 85.0-88.2) had a positive titre of anti-rubella IgG. GMT of anti-rubella IgG titre was 4.3. The proportion of positive subjects was of 76.8% (n = 279/363; 95% CI = 72.2-81.1) in persons aged 18-26 years; 88.1% (n = 310/352; 95% CI = 84.2-91.3) in 27-35 year-old people; 88.5% (n = 464/524; 95% CI = 85.5-91.1) in 36-45 year-old people; 90.7% (n = 350/386; 95% CI = 87.3-93.4) among people aged 46-55 years and 90.6% (n = 126/139; 95% CI = 84.5-94.9) in 55-65 year-old people (Chi-square = 39.7; p < 0.0001). GMT of anti-rubella IgG titre was 4.3 (4.3 in male and 4.2 in female, t = 2.2; p = 0.03) and seems to differ dividing the enrolled subjects by age group (F = 14.3; p < 0.0001). According to our data, too many women of child-bearing age are still unprotected from rubella in the elimination era and in this scenario the public health efforts should be oriented to catch-up activities.

  1. [Serologic survey of rubella in the pre-vaccine era in child-care centers, schools and maternity units of Fortaleza

    PubMed

    Rey, L C; Barbosa, L M; Osterno, C L; Ramalho, I L; Vilar, D C; Memória, A M; Vieira, L C; Gonçalves, V F

    1998-01-01

    OBJECTIVES: To identify rubella prevalence in different ages and population groups and rubella susceptibility of pregnant and postpartum women according to age, number of children and spontaneous abortion. METHODS: Cross-sectional study of sero-survey type. Children and students were selected in day-care centers and schools distributed by health districts of Fortaleza. Pregnant and postpartum healthy women were recruited in two large maternity units and three antenatal clinics; individuals previously vaccinated and presenting chronic or acute diseases where excluded. Written consent was obtained from participants or their caretakers. Anti-rubella IgG qualitative detection was performed with an Elisa-sandwich assay. RESULTS: Mean age-specific sero-prevalence rates of 999 samples were: 2 to 5 years= 59% (136/231); 6 to 9 years= 47% (95/204); 10 to 19 years= 56% (243/432) and 20 to 39 years= 80% (106/132). The mean age of 187 pregnant and postpartum women was 23 years (10-39) with a sero-prevalence of 76% (142/187), where 62% sero-positives aged 15 to 19 and 83% aged 26 to 39 years. A higher sero-prevalence was related to womeńs age (p<0.001), history of spontaneous abortion (p= 0.03), and two or more children (p=0.01). CONCLUSIONS: The high sero-prevalence of rubella in preschool age children reflects the intense viral transmission in child-care centers. The high susceptibility in adolescents (45%), among whom pregnancy is common, emphasizes the need to introduce rubella vaccine early and keep high immunization coverages in youngsters in order to eradicate congenital rubella syndrome. Also, postpartum routine immunization against rubella in this age group is of particular benefit.

  2. Measles and Rubella Seroprevalence Among HIV- Infected And Uninfected Zambian Youth

    PubMed Central

    Sutcliffe, Catherine G.; Searle, Kelly; Matakala, Hellen K.; Greenman, Michelle; Rainwater-Lovett, Kaitlin; Thuma, Philip E.; Moss, William J.

    2016-01-01

    Background Measles and congenital rubella syndrome remain significant causes of morbidity and mortality despite available vaccines. HIV-infected youth may be at increased risk of measles because of greater waning immunity following vaccination. At a population level, they constitute a potentially large pool of susceptibles to measles and rubella. More data among HIV-infected youth in sub-Saharan Africa are needed to guide vaccination policy and control strategies. Methods This cross-sectional study was nested within two ongoing studies of malaria and HIV in Zambia. Dried blood spot cards from youth (5–15 years) in these studies from 2009–2013 were tested for IgG antibodies to measles and rubella viruses. HIV-uninfected youth, HIV-infected treatment-naïve youth, and HIV-infected youth receiving antiretroviral therapy (ART) were compared. Results 617 HIV-uninfected, 144 HIV-infected treatment-naïve, and 128 HIV-infected youth receiving ART were included in the study. The proportion seropositive for measles virus was significantly higher among HIV-uninfected youth (92.5%) compared to HIV-infected treatment-naïve youth (74.1%) and HIV-infected youth receiving ART (71.9%). No differences by age were observed. The proportion seropositive for rubella virus was significantly higher among HIV-uninfected youth (54.7%) compared with HIV-infected treatment-naïve youth (41.7%) and HIV-infected youth receiving ART (49.6%), with increases observed by age for all groups. Conclusions Measles seroprevalence was lower among HIV-infected than uninfected youth, consistent with waning immunity following measles vaccination. HIV-infected youth would likely benefit from revaccination. Half of all youth in rural Zambia were susceptible to rubella and may need targeting for catch-up rubella campaigns when measles-rubella vaccine is introduced. PMID:27879554

  3. Measles and Rubella Seroprevalence Among HIV-infected and Uninfected Zambian Youth.

    PubMed

    Sutcliffe, Catherine G; Searle, Kelly; Matakala, Hellen K; Greenman, Michelle P; Rainwater-Lovett, Kaitlin; Thuma, Philip E; Moss, William J

    2017-03-01

    Measles and congenital rubella syndrome remain significant causes of morbidity and mortality despite available vaccines. HIV-infected youth may be at increased risk of measles because of greater waning immunity after vaccination. At a population level, they constitute a potentially large pool of susceptibles to measles and rubella. More data among HIV-infected youth in sub-Saharan Africa are needed to guide vaccination policy and control strategies. This cross-sectional study was nested within 2 ongoing studies of malaria and HIV in Zambia. Dried blood spot cards from youth (5-15 years) in these studies from 2009 to 2013 were tested for IgG antibodies to measles and rubella viruses. HIV-uninfected youth, HIV-infected treatment-naive youth and HIV-infected youth receiving antiretroviral therapy (ART) were compared. A total of 617 HIV-uninfected, 144 HIV-infected treatment-naive and 128 HIV-infected youth receiving ART were included in this study. The proportion seropositive for measles virus was significantly higher among HIV-uninfected youth (92.5%) compared with HIV-infected treatment-naive youth (74.1%) and HIV-infected youth receiving ART (71.9%). No differences by age were observed. The proportion seropositive for rubella virus was significantly higher among HIV-uninfected youth (54.7%) compared with HIV-infected treatment-naive youth (41.7%) and HIV-infected youth receiving ART (49.6%), with increases observed by age for all groups. Measles seroprevalence was lower among HIV-infected than uninfected youth, consistent with waning immunity after measles vaccination. HIV-infected youth would benefit from revaccination. Half of all youth in rural Zambia were susceptible to rubella and may need targeting for catch-up rubella campaigns when measles-rubella vaccine is introduced.

  4. Seroepidemiology Study of Cytomegalovirus and Rubella among Pregnant Women at St. Paul's Hospital Millennium Medical College, Addis Ababa, Ethiopia.

    PubMed

    Yeshwondm, Mamuye; Balkachew, Nigatu; Delayehu, Bekele; Mekonen, Getahun

    2016-09-01

    Maternal cytomegalovirus (CMV) and rubella infections have adverse neonatal outcomes. Both CMV and rubella are more widespread in developing countries and in communities with lower socioeconomic status. The aim of this study was to investigate sero-prevalence of CMV and rubella infection and associated possible risk factors. Using cross sectional study design a total of 200 pregnant women were consecutively recruited starting from June and July 2014. Blood samples were collected, and structured questions were used to gather socio-demographic and risk factor related data. ELISA was used to detect CMV (IgG, IgM) and rubella IgM. SPSS version 20 was used to analyze the data, and regression was also performed. Out of 200 pregnant women, 88.5%, 30(15.5%) and 4(2.0%) were CMV-IgG, CMV-IgM, and rubella-IgM positive, respectively. Women who were immune/positive only for IgG were 73.5%. The second group was those with primary infection [IgG (+) plus IgM (+)] and this consisted of 15.0% participants. Eleven percent of the participants were at high risk for primary infection during their pregnancy. One pregnant woman was identified as having a recent primary infection. In this study, no statistically significant association was detected between CMV infection with idependent factors (p-value>0.05). In addition to detection of high prevalence of CMV, detecting recent infection of rubella worsens the outcome of the disease. Rubella vaccine should be taken into consideration after large scale surveillance. However, screening of all pregnant women for CMV infection may not be cost-effective as in the countries with high seropositivity.

  5. A 16-year review of seroprevalence studies on measles and rubella.

    PubMed

    Dimech, Wayne; Mulders, Mick N

    2016-07-29

    The determination of the seroprevalence of vaccine-preventable diseases is critical in monitoring the efficacy of vaccination programmes and to assess the gaps in population immunity but requires extensive organisation and is time and resource intensive. The results of the studies are frequently reported in peer-reviewed scientific, government and non-government publications. A review of scientific literature was undertaken to advise the development of WHO guidelines for the assessment of measles and rubella seroprevalence. A search of the National Library of Medicine's PubMed online publications using key words of 'measles', 'rubella', combined with 'serosurvey', 'seroprevalence', 'immunity' and 'population immunity' was conducted. A total of 97 articles published between January 1998 and June 2014 were retrieved, 68 describing serosurveys for measles and 58 serosurveys for rubella, conducted in 37 and 36 different countries respectively. Only 13 (19%) and 8 (14%) respectively were UN classified "least developed countries". The study sample varied markedly and included combinations of male and female infants, children, adolescents and adults. The study sizes also varied with 28% and 33% of measles and rubella studies respectively, having greater than 2000 participants. Microtitre plate enzyme immunoassays were used in 52 (76%) measles studies and 40 (69%) rubella studies. A total of 39 (57%) measles and 44 (76%) rubella studies reported quantitative test results. Seroprevalence ranged from 60.8% to 95.9% for measles and 53.0% to 99.3% for rubella studies. The review highlighted that infants lost maternally-acquired immunity within 9months of birth and were unprotected until vaccination. Two groups at higher risk of infection were identified: young adults between the ages of 15 and 30years and immigrants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Measles and rubella elimination in the WHO Region for Europe: progress and challenges.

    PubMed

    O'Connor, P; Jankovic, D; Muscat, M; Ben-Mamou, M; Reef, S; Papania, M; Singh, S; Kaloumenos, T; Butler, R; Datta, S

    2017-08-01

    Globally measles remains one of the leading causes of death among young children even though a safe and cost-effective vaccine is available. The World Health Organization (WHO) European Region has seen a decline in measles and rubella cases in recent years. The recent outbreaks have primarily affected adolescents and young adults with no vaccination or an incomplete vaccination history. Eliminating measles and rubella is one of the top immunization priorities of the European Region as outlined in the European Vaccine Action Plan 2015-2020. Following the 2010 decision by the Member States in the Region to initiate the process of verifying elimination, the European Regional Verification Commission for Measles and Rubella Elimination (RVC) was established in 2011. The RVC meets every year to evaluate the status of measles and rubella elimination in the Region based on documentation submitted by each country's National Verification Committees. The verification process was however modified in late 2014 to assess the elimination status at the individual country level instead of at regional level. The WHO European Region has made substantial progress towards measles and rubella elimination over the past 5 years. The RVC's conclusion in 2016 that 70% and 66% of the 53 Member States in the Region had interrupted the endemic transmission of measles and rubella, respectively, by 2015 is a testament to this progress. Nevertheless, where measles and rubella remain endemic, challenges in vaccination service delivery and disease surveillance will need to be addressed through focused technical assistance from WHO and development partners. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  7. Detection of serum antibodies against measles, mumps and rubella after primary measles, mumps and rubella (MMR) vaccination in children.

    PubMed

    Rafiei Tabatabaei, Sedigheh; Esteghamati, Abdoul-Reza; Shiva, Farideh; Fallah, Fatemeh; Radmanesh, Raheleh; Abdinia, Babak; Shamshiri, Ahmad Reza; Khairkhah, Masoumeh; Shekari Ebrahimabad, Hamideh; Karimi, Abdollah

    2013-01-01

    In Iran, the measles, mumps and rubella vaccine (MMR) is administered in a two-dose protocol where the first dose is scheduled at 12 months of age. This study aims to determine the efficacy of the MMR vaccine by testing IgM and IgG antibody levels 4 - 7 weeks after primary vaccination. A single group cohort study was performed on healthy children, 12 - 15 months of age, who were vaccinated at health centers affiliated with Shahid Beheshti University of Medical Sciences in Tehran, from January to April 2009. Children with negative vaccination and/or clinical history for measles, mumps or rubella were administered the first dose of the MMR live attenuated vaccine. IgG and IgM antibodies were checked by enzyme linked immunoassay (ELISA) in serum samples 4 - 7 weeks after vaccination. A child was considered seropositive if antibody levels were higher than the assay cut-off level set by the ELISA kit. Samples from 240 children were checked for antibodies against measles and rubella. Measles serum IgM level was positive in 71.7% of samples and IgG in 75.8%. The rubella serum IgM level was positive in 71.7% of children and IgG in 73.8%. From 190 blood samples that were checked for mumps antibodies, serum IgM was positive in 68.9% and IgG in 95.3%. No significant relationship was found between seropositivity and age or gender. IgG and IgM antibody levels were below the assay cut-off levels against measles and rubella in approximately one-fourth of the children following primary MMR vaccination. A second dose was necessary to raise the level of protection against measles and rubella.

  8. Molecular surveillance of rubella viruses in Taiwan from 2005 to 2011.

    PubMed

    Cheng, Wen-Yueh; Wang, Hsiao-Chi; Liu, Ming-Tsan; Wu, Ho-Sheng

    2013-04-01

    Rubella has been listed as a mandatory notifiable disease in Taiwan since 1988. Because of high coverage rates with an effective vaccine, rubella cases have decreased dramatically in Taiwan since 1994. However, rubella outbreaks still occur due to imported transmission. Five large clusters were detected in Taiwan from 2007 to 2011. In 2007, one cluster was caused by rubella genotype 1E viruses that were imported from Vietnam, whereas another cluster was caused by genotype 2B viruses and was untraceable. In 2008, two clusters were caused by different lineages of genotype 1E viruses that were imported from Malaysia. In 2009, a cluster that was caused by genotype 2B viruses was associated with imported cases from Vietnam. The rubella viruses from 124 confirmed cases from 2005 to 2011 were characterized, and the data revealed that these viruses were distributed in the following four genotypes: 1E (n = 56), 1h (n = 1), 1j (n = 4), and 2B (n = 63). Of these viruses, 93 (75%) were associated with imported cases, and 43 of 56 genotype 1E viruses were associated with imported cases from China, Vietnam, Malaysia, and Indonesia. One genotype 1h virus was imported from Belarus, and three of four genotype 1j viruses were imported from the Philippines. Of 63 rubella genotype 2B viruses, 46 were imported from Vietnam, Thailand, Malaysia, China, Germany, and South Africa. Molecular surveillance allows for the differentiation of circulating rubella viruses and can be used to investigate transmission pathways, which are important to identify the interruption of endemic virus transmission. Copyright © 2013 Wiley Periodicals, Inc.

  9. Replication of Rubella Vaccine Population Genetic Studies: Validation of HLA Genotype and Humoral Response Associations

    PubMed Central

    Ovsyannikova, Inna G.; Jacobson, Robert M.; Vierkant, Robert A.; O’Byrne, Megan M.; Poland, Gregory A.

    2009-01-01

    Purported genetic associations found in population studies require validation for confirmation. We previously reported rubella vaccine-induced immune responses and HLA associations in 346 adolescents, age 12–18 years (1st cohort), following two doses of a rubella-containing vaccine. We sought to replicate the associations discovered in that work by verifying these associations in a new cohort of 396 subjects, age 11–19 years (2nd cohort), all having had two doses of a rubella-containing vaccine. We found that B*2705 (median 1st cohort 20.9 IU/ml, p=0.028; 2nd cohort 20.5 IU/ml, p=0.001) and DPA1*0201 (median 1st cohort 32.5 IU/ml, p=0.048; 2nd cohort 25.8 IU/ml, p=0.025) alleles were consistently associated with lower rubella-induced antibodies. Further, DPB1*0401 (median 1st cohort 43.5 IU/ml, p=0.021; 2nd cohort 36.2 IU/ml, p=0.002) alleles were associated with higher antibody levels in both populations. The association of DRB1*04-DQB1*03-DPB1*03 (mean 1st cohort 25.2 IU/ml, p=0.011; 2nd cohort 21.4 IU/ml, p=0.032) and DRB1*15/16-DQB1*06-DPB1*03 (1st cohort 16.3 IU/ml, p=0.043; 2nd cohort 19.1 IU/ml, p=0.023) haplotypes with lower rubella-specific antibodies were observed in both studies. This study provides confirmatory evidence for an association between specific class I and II HLA markers and haplotypes with rubella vaccine-induced humoral responses and lends further weight to their influence on rubella immune responses. PMID:19761839

  10. The Costs and Valuation of Health Impacts of Measles and Rubella Risk Management Policies.

    PubMed

    Thompson, Kimberly M; Odahowski, Cassie L

    2016-07-01

    National and global health policymakers require good information about the costs and benefits of their investments in measles and rubella immunization programs. Building on our review of the existing measles and rubella health economics literature, we develop inputs for use in regional and global models of the expected future benefits and costs of vaccination, treatment, surveillance, and other global coordination activities. Given diversity in the world and limited data, we characterize the costs for countries according to the 2013 World Bank income levels using 2013 U.S. dollars (2013$US). We estimate that routine immunization and supplemental immunization activities will cost governments and donors over 2013$US 2.3 billion per year for the foreseeable future, with high-income countries accounting for 55% of the costs, to vaccinate global birth cohorts of approximately 134 million surviving infants and to protect the global population of over 7 billion people. We find significantly higher costs and health consequences of measles or rubella disease than with vaccine use, with the expected disability-adjusted life year (DALY) loss for case of disease generally at least 100 times the loss per vaccine dose. To support estimates of the economic benefits of investments in measles and/or rubella elimination or control, we characterize the probabilities of various sequelae of measles and rubella infections and vaccine adverse events, the DALY inputs for health outcomes, and the associated treatment costs. Managing measles and rubella to achieve the existing and future regional measles and rubella goals and the objectives of the Global Vaccine Action Plan will require an ongoing commitment of financial resources that will prevent adverse health outcomes and save the associated treatment costs. © 2015 Society for Risk Analysis.

  11. Fetal and neonatal abnormalities due to congenital rubella syndrome: a review of literature.

    PubMed

    Yazigi, Alexandre; De Pecoulas, Aurelia Eldin; Vauloup-Fellous, Christelle; Grangeot-Keros, Liliane; Ayoubi, Jean-Marc; Picone, Olivier

    2017-02-01

    Rubella virus infection during the first trimester of pregnancy can cause congenital rubella syndrome (CRS). We aimed to describe the abnormalities in order to define the ultrasound features to look for when performing prenatal scans. The goal of this review is to focus specifically on the signs of CRS accessible to prenatal diagnosis. We analyzed every case of CRS described before and/or after birth that we identified in the Pubmed database and classified them as accessible or not to prenatal diagnosis. The most frequently reported malformations accessible to prenatal diagnosis were: cardiac septal defects, pulmonary artery stenosis, microcephaly, cataract, microphtalmia, and hepatosplenomegaly. This extensive literature review shows that the ultrasound features of CRS are not well known, even though rubella was the first teratogenic virus described. This review will help clinicians in the management of rubella during pregnancy by clarifying the findings to be sought.

  12. Cell-Mediated Immunity in Humans During Viral Infection I. Effect of Rubella on Dermal Hypersensitivity, Phytohemagglutinin Response, and T Lymphocyte Numbers

    PubMed Central

    Kauffman, Carol A.; Phair, John P.; Linnemann, Calvin C.; Schiff, Gilbert M.

    1974-01-01

    Phytohemagglutinin-induced lymphocyte deoxyribonucleic acid synthesis, dermal hypersensitivity, and peripheral blood thymus-derived lymphocyte numbers were assessed in nine men with experimentally induced rubella infection. Five of these men and two additional volunteers received treatment with tilorone dihydrochloride, an antiviral drug. Response to phytohemagglutinin was not changed during rubella; T lymphocyte numbers in peripheral blood were not influenced by the viral illness. However, dermal hypersensitivity was markedly impaired in all volunteers during the height of the illness. Tilorone alone, or with rubella, had no effect on any of the parameters studied. PMID:4546284

  13. [Rubella virus genetic determinant of attenuation].

    PubMed

    Dmitriev, G V; Borisova, T K; Faizuloev, E B; Desiatskova, R G; Zverev, V V

    2014-01-01

    Vaccination is the most effective and available way to prevent Rubella. Presently, 9 vaccine strains were registered. Nevertheless, the molecular mechanisms of the attenuation were poorly elucidated for the rubella virus. However, the study of these mechanisms identifying genotypic and phenotypic markers of attenuation, which together with sequence analysis could be used for the genetic stability control of vaccine strains, is still of current interest. Common trends of genetic changes in the process of adaptation to cold were found due to comparison of nucleic acid and amino acid sequences of the Russian strain C-77 with corresponding positions of the known rubella virus strains and its wild type progenitors, if available.

  14. Modeling and Managing the Risks of Measles and Rubella: A Global Perspective, Part I.

    PubMed

    Thompson, Kimberly M; Cochi, Stephen L

    2016-07-01

    Over the past 50 years, the use of vaccines led to significant decreases in the global burdens of measles and rubella, motivated at least in part by the successive development of global control and elimination targets. The Global Vaccine Action Plan (GVAP) includes specific targets for regional elimination of measles and rubella in five of six regions of the World Health Organization by 2020. Achieving the GVAP measles and rubella goals will require significant immunization efforts and associated financial investments and political commitments. Planning and budgeting for these efforts can benefit from learning some important lessons from the Global Polio Eradication Initiative (GPEI). Following an overview of the global context of measles and rubella risks and discussion of lessons learned from the GPEI, we introduce the contents of the special issue on modeling and managing the risks of measles and rubella. This introduction describes the synthesis of the literature available to support evidence-based model inputs to support the development of an integrated economic and dynamic disease transmission model to support global efforts to optimally manage these diseases globally using vaccines. © 2016 Society for Risk Analysis.

  15. Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

    PubMed

    Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

    2015-03-15

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Early detection and response for measles and rubella cases through the (Nursery) School Absenteeism Surveillance System in Ibaraki Prefecture.

    PubMed

    Watanabe, Miki; Kurita, Junko; Takagi, Takeshi; Nagata, Noriko; Nagasu, Natsuki; Sugawara, Tamie; Ohkusa, Yasushi

    2016-01-01

    Objectives In Ibaraki Prefecture, all (nursery) schools have joined the (Nursery) School Absenteeism Surveillance System (hereafter denoted as (N)SASSy), which is operated by the Japan School Health Association to monitor the prevalence of infectious diseases, the early detection and response for outbreaks, and prevention of large outbreaks. Prefectural government officers also utilize it as a control measure for infectious diseases. In particular, when cases of measles or rubella are registered, (N)SASSy sends e-mails automatically to prefectural government officers to activate control measures. This paper summarizes administrative responses by prefectural government officers for measles or rubella cases using (N)SASSy and discusses the future challenges.Methods We summarized registration, detection, and first response data for measles or rubella cases in (N)SASSy and compared the number of detected and reported cases enforced by the Infectious Diseases Control Law from January 1, 2013 to December 31, 2014.Results The public health center questioned hospitals/clinics and (nursery) schools about all registered measles or rubella cases in (N)SASSy on the same day to check the entered information. In the past 2 years, there were 5 measles and 56 rubella cases in 2013 and 1 measles and 19 rubella cases in 2014 registered with (N)SASSy. All cases were checked and investigated by the public health center. Of all cases detected by (N)SASSy, 7 rubella cases in 2013 and 1 rubella case in 2014 were reported based on the law. No measles cases were reported in the 2 years. The results of investigations and laboratory tests were given as feedback to the (nursery) schools. If the case did not case definition determined by the law, we changed the status in (N)SASSy to suspected or discarded cases.Conclusion Since (N)SASSy assists prefectural government officers with earlier detection of and response for infectious diseases, it definitely contributes to infection control. Immediate feedback of the laboratory test results to the (nursery) schools was also useful to confirm cases of measles or rubella. As data entry in (nursery) schools is needed for stable operation and utilization of (N)SASSy, it is important that workshops for (N)SASSy are held for (nursery) school teachers every year to maintain accuracy. Our future challenges include the coordination among (nursery) schools, hospitals/clinics, and prefectural government and their applications for infection control.

  17. A large rubella outbreak with spread from the workplace to the community.

    PubMed

    Danovaro-Holliday, M C; LeBaron, C W; Allensworth, C; Raymond, R; Borden, T G; Murray, A B; Icenogle, J P; Reef, S E

    2000-12-06

    Childhood vaccination has reduced rubella disease to low levels in the United States, but outbreaks continue to occur. The largest outbreak in the past 5 years occurred in Nebraska in 1999. To examine risk factors for disease, susceptibility of the risk population, role of vaccine failure, and the need for new vaccination strategies in response to the Nebraska rubella outbreak. Investigation of 83 confirmed rubella cases occurring in Douglas County, Nebraska, between March 23 and August 24, 1999; serosurvey of 413 pregnant women in the outbreak locale between October 1998 and March 1999 (prior to outbreak) and April and November 1999 (during and after outbreak). Case characteristics, compared with that of the general county population; area childhood rubella vaccination rates; and susceptibility among pregnant women before vs during and after the outbreak. All 83 rubella cases were unvaccinated or had unknown vaccination status and fell into 3 groups: (1) 52 (63%) were young adults (median age, 26 years), 83% of whom were born in Latin American countries where rubella vaccination was not routine. They were either employed in meatpacking plants or were their household contacts. Attack rates in the plants were high (14.4 per 1000 vs 0. 19 per 1000 for general county population); (2) 16 (19%), including 14 children (9 of whom were aged <12 months) and 2 parents, were US-born and non-Hispanic, who acquired the disease through contacts at 2 day care facilities (attack rate, 88.1 per 1000); and (3) 15 (18%) were young adults (median age, 22 years) whose major disease risk was residence in population-dense census tracts where meatpacking-related cases resided (R(2) = 0.343; P<.001); 87% of these persons were born in Latin America. Among pregnant women, susceptibility rates were 13% before the outbreak and 11% during and after the outbreak. Six (25%) of 24 susceptible women tested were seropositive for rubella IgM. Rubella vaccination rates were 90.2% for preschool children and 99.8% for school-aged children. A large rubella outbreak occurred among unvaccinated persons in a community with high immunity levels. Crowded working and living conditions facilitated transmission, but vaccine failure did not. Workplace vaccination could be considered to prevent similar outbreaks. JAMA. 2000;284:2733-2739.

  18. Evaluation of nationwide supplementary immunization in Lao People's Democratic Republic: Population-based seroprevalence survey of anti-measles and anti-rubella IgG in children and adults, mathematical modelling and a stability testing of the vaccine

    PubMed Central

    Miyano, Shinsuke; Mori, Yoshio; Vynnycky, Emilia; Keungsaneth, Phath; Vongphrachanh, Phengta; Xeuatvongsa, Anonh; Sisouk, Thongchanh; Som-Oulay, Vilasak; Khamphaphongphane, Bouaphan; Sengkeopaseuth, Bounthanom; Pathammavong, Chansay; Phounphenghak, Kongxay; Kitamura, Tomomi; Takeda, Makoto; Komase, Katsuhiro

    2018-01-01

    Background Measles outbreaks have occurred in some countries despite supplementary immunization activities (SIA) using measles-containing vaccine with high vaccination coverage. We conducted a cross-sectional seroprevalence survey to estimate population immunity in Lao People's Democratic Republic where repeated mass immunization has failed to eliminate measles. Methods and findings In this nationwide multistage cluster sampling survey conducted in 2014 based on probability proportionate to size sampling, blood samples were collected from 2,135 children and adults living in 52 randomly selected villages. Anti-measles and anti-rubella IgG were measured, and IgG prevalence was calculated. We applied mathematical modelling to estimate the number of cases of congenital rubella syndrome (CRS) in 2013 that were averted by the 2011 SIA. A stability testing was applied to the MR vaccine at 4°C, 25°C, and 35°C to examine stability differences between measles and rubella vaccine components. Measles IgG prevalence was significantly lower in the target age groups (5–21 years) of the 2011 SIA using a combination vaccine for measles and rubella vaccine (MR vaccine) than in young adults (22–39 years) (86.8% [95% CI: 83.0–90.6] vs. 99.0% [98.3–99.8]; p<0.001), whereas rubella IgG prevalence was significantly higher (88.2% [84.5–91.8] vs. 74.6% [70.7–78.5]; p<0.001). In the SIA target age groups, prevalence of measles IgG, but not rubella IgG, increased with age. CRS cases prevented in 2013 ranged from 16 [0–50] to 92 [32–180] if the force of infection had remained unchanged or had been reduced by 75%, respectively. In freeze-dried conditions, the measles vaccine component was more heat sensitive than the rubella component. Conclusions Inconsistent IgG prevalence between measles and rubella in Lao PDR can be partly explained by different stability of the measles and rubella vaccine components under heat exposure. Suboptimal vaccine handling may cause insufficient immunogenicity for measles, which subsequently leads to an outbreak despite high SIA coverage, while direct evidence is lacking. Temperature monitoring of the vaccine should be conducted. PMID:29596472

  19. Evaluation of nationwide supplementary immunization in Lao People's Democratic Republic: Population-based seroprevalence survey of anti-measles and anti-rubella IgG in children and adults, mathematical modelling and a stability testing of the vaccine.

    PubMed

    Hachiya, Masahiko; Miyano, Shinsuke; Mori, Yoshio; Vynnycky, Emilia; Keungsaneth, Phath; Vongphrachanh, Phengta; Xeuatvongsa, Anonh; Sisouk, Thongchanh; Som-Oulay, Vilasak; Khamphaphongphane, Bouaphan; Sengkeopaseuth, Bounthanom; Pathammavong, Chansay; Phounphenghak, Kongxay; Kitamura, Tomomi; Takeda, Makoto; Komase, Katsuhiro

    2018-01-01

    Measles outbreaks have occurred in some countries despite supplementary immunization activities (SIA) using measles-containing vaccine with high vaccination coverage. We conducted a cross-sectional seroprevalence survey to estimate population immunity in Lao People's Democratic Republic where repeated mass immunization has failed to eliminate measles. In this nationwide multistage cluster sampling survey conducted in 2014 based on probability proportionate to size sampling, blood samples were collected from 2,135 children and adults living in 52 randomly selected villages. Anti-measles and anti-rubella IgG were measured, and IgG prevalence was calculated. We applied mathematical modelling to estimate the number of cases of congenital rubella syndrome (CRS) in 2013 that were averted by the 2011 SIA. A stability testing was applied to the MR vaccine at 4°C, 25°C, and 35°C to examine stability differences between measles and rubella vaccine components. Measles IgG prevalence was significantly lower in the target age groups (5-21 years) of the 2011 SIA using a combination vaccine for measles and rubella vaccine (MR vaccine) than in young adults (22-39 years) (86.8% [95% CI: 83.0-90.6] vs. 99.0% [98.3-99.8]; p<0.001), whereas rubella IgG prevalence was significantly higher (88.2% [84.5-91.8] vs. 74.6% [70.7-78.5]; p<0.001). In the SIA target age groups, prevalence of measles IgG, but not rubella IgG, increased with age. CRS cases prevented in 2013 ranged from 16 [0-50] to 92 [32-180] if the force of infection had remained unchanged or had been reduced by 75%, respectively. In freeze-dried conditions, the measles vaccine component was more heat sensitive than the rubella component. Inconsistent IgG prevalence between measles and rubella in Lao PDR can be partly explained by different stability of the measles and rubella vaccine components under heat exposure. Suboptimal vaccine handling may cause insufficient immunogenicity for measles, which subsequently leads to an outbreak despite high SIA coverage, while direct evidence is lacking. Temperature monitoring of the vaccine should be conducted.

  20. Rubella vaccination in India: identifying broad consequences of vaccine introduction and key knowledge gaps.

    PubMed

    Winter, A K; Pramanik, S; Lessler, J; Ferrari, M; Grenfell, B T; Metcalf, C J E

    2018-01-01

    Rubella virus infection typically presents as a mild illness in children; however, infection during pregnancy may cause the birth of an infant with congenital rubella syndrome (CRS). As of February 2017, India began introducing rubella-containing vaccine (RCV) into the public-sector childhood vaccination programme. Low-level RCV coverage among children over several years can result in an increase in CRS incidence by increasing the average age of infection without sufficiently reducing rubella incidence. We evaluated the impact of RCV introduction on CRS incidence across India's heterogeneous demographic and epidemiological contexts. We used a deterministic age-structured model that reflects Indian states' rural and urban area-specific demography and vaccination coverage levels to simulate rubella dynamics and estimate CRS incidence with and without RCV introduction to the public sector. Our analysis suggests that current low-level private-sector vaccination has already slightly increased the burden of CRS in India. We additionally found that the effect of public-sector RCV introduction depends on the basic reproductive number, R 0, of rubella. If R 0 is five, a value empirically estimated from an array of settings, CRS incidence post-RCV introduction will likely decrease. However, if R 0 is seven or nine, some states may experience short-term or annual increases in CRS, even if a long-term total reduction in cases (30 years) is expected. Investment in population-based serological surveys and India's fever/rash surveillance system will be key to monitoring the success of the vaccination programme.

  1. Economic impact of switching rubella IgG methodologies to the prenatal public health program in Alberta.

    PubMed

    Lai, Florence Y; Dover, Douglas C; Charlton, Carmen L

    2016-10-01

    Despite widespread use of a universal rubella standard, variability in rubella antibody titre can be observed between assays, particularly at the low end of the linear range. Here, we investigate the impact of a methodology change for rubella IgG from the Abbott AXSYM to the Abbott Architect in a comprehensive prenatal screening program in the Canadian province of Alberta. 51,815 specimens (21,399 tested by AxSYM and 30,416 tested by Architect) submitted for routine prenatal screening between January 2006 and December 2012 from women who lived in Alberta after the universal childhood immunization programme for rubella was implemented, and whose immunization records were available, were included in the study. Prenatal samples tested by AxSYM for rubella IgG were approximately 30% higher than those reported by Architect. Among individuals who had tests across multiple pregnancies, the change in test platform led to an additional 7% of women who initially tested positive, becoming non-positive (i.e. negative or indeterminate) in their subsequent tests. The tendency of the Architect IgG assay to report lower quantitative values was demonstrated across all birth cohorts and vaccination status, and resulted in an additional 2800 women requiring vaccination between 2010 and 2012 with an estimated cost of $38,500. The change in rubella IgG screening assay resulted in a significant increase in the number of women who required post partum vaccination and Public Health follow-up. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Congenital rubella syndrome: a review of laboratory data from 2002 to 2011.

    PubMed

    Saraswathy, T S; Rozainanee, M Z; Asshikin, R Nurul; Zainah, S

    2013-05-01

    Rubella infection in pregnant women during the first trimester of pregnancy can lead to fetal anomalies, commonly known as congenital rubella syndrome (CRS). The objective of our study was to analyze the serological test results among infants suspected of having CRS aged < or = 12 months compared with their clinical status. Between January 2002 and December 2011, 3,279 serum samples from infants aged < or = 12 months from government hospitals in Malaysia were examined for rubella specific IgM and IgG antibodies using a Axsym, automated analyzer (Abbott Laboratories). Forty-eight samples were positive for rubella specific IgM antibodies and 494 samples were positive for rubella specific IgG antibodies. These were then age stratified and their clinical history reviewed for any CRS symptoms. Fifteen of 38 rubella IgM positive infants (39.5%) aged < 3 months, had a clinical appearance compatible with CRS. However, only 1 IgM positive infant aged 3 to 6 months and one infant aged 7 to 11 months had clinical appearance compatible with CRS. The most common abnormal findings in these cases were congenital heart defects and cataracts. Forty-eight point eight percent of IgM positive cases and 53.1% of IgG positive cases, had inadequate information in the chart to determine the presence of CRS. Clinical findings and timely laboratory diagnosis to determine the presence of CRS are important in infants born with congenital defects. Physicians should also be aware of the appropriate interpretation of these findings.

  3. Genetic Polymorphisms Associated with Rubella Virus-Specific Cellular Immunity Following MMR Vaccination

    PubMed Central

    Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Lambert, Nathaniel D.; Pankratz, V. Shane; Poland, Gregory A.

    2014-01-01

    Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. PMID:25098560

  4. Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

    2014-11-01

    Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

  5. Systematic Review of Health Economic Analyses of Measles and Rubella Immunization Interventions.

    PubMed

    Thompson, Kimberly M; Odahowski, Cassie L

    2016-07-01

    Economic analyses for vaccine-preventable diseases provide important insights about the value of prevention. We reviewed the literature to identify all of the peer-reviewed, published economic analyses of interventions related to measles and rubella immunization options to assess the different types of analyses performed and characterize key insights. We searched PubMed, the Science Citation Index, and references from relevant articles for studies in English and found 67 analyses that reported primary data and quantitative estimates of benefit-cost or cost-effectiveness analyses for measles and/or rubella immunization interventions. We removed studies that we characterized as cost-minimization analyses from this sample because they generally provide insights that focused on more optimal strategies to achieve the same health outcome. The 67 analyses we included demonstrate the large economic benefits associated with preventing measles and rubella infections using vaccines and the benefit of combining measles and rubella antigens into a formulation that saves the costs associated with injecting the vaccines separately. Despite the importance of population immunity and dynamic viral transmission, most of the analyses used static models to estimate cases prevented and characterize benefits, although the use of dynamic models continues to increase. Many of the analyses focused on characterizing the most significant adverse outcomes (e.g., mortality for measles, congenital rubella syndrome for rubella) and/or only direct costs, and the most complete analyses present data from high-income countries. © 2014 Society for Risk Analysis.

  6. Assessing herd immunity against rubella in Japan: a retrospective seroepidemiological analysis of age-dependent transmission dynamics

    PubMed Central

    Kinoshita, Ryo; Nishiura, Hiroshi

    2016-01-01

    Objective We aimed to epidemiologically assess rubella herd immunity as a function of time, age and gender in Japan, with reference to the recent 2012–2014 rubella epidemic. Design This study is a retrospective seroepidemiological analysis. Main outcome measures The susceptible fraction of the population was examined as a function of age and time. The age at infection was assessed using reported case data. Results Whereas 30 years ago rubella cases were seen only among children, the median (25–75th centiles) age of cases in 2014 was elevated to 32.0 (17.0–42.0) years among males and 27.0 (7.0–37.0) years among females. Susceptible pockets among male birth cohorts 1989–1993 and 1974–1978 were identified, with seropositive proportions of 70.0% and 68.0%, respectively. The majority of female age groups had greater seropositive proportions than the herd immunity threshold, with a minor susceptible pocket for those born from 1989 to 1993 (78.3% seropositive). The age-standardised seronegative proportion decreased to 18.3% (95% CI 16.8% to 19.8%) among males and 15.6% (95% CI 10.0% to 21.2%) among females in 2013, and the immune fraction was not sufficiently below the herd immunity threshold. While the number of live births born to susceptible mothers in 1983 was estimated at 171 876 across Japan, in 2013 it was reduced to 23 698. Conclusions An elevated age at rubella virus infection and the presence of susceptible pockets among adults were observed in Japan. Although, overall, the absolute number of rubella cases has steadily declined in Japan, the elevated age of rubella cases, along with increased numbers of susceptible adults, contributed to the observation of as many as 45 congenital rubella syndrome (CRS) cases, which calls for supplementary vaccination among susceptible adults. Assessing herd immunity is considered essential for routinely monitoring the risk of future rubella epidemics and CRS cases. PMID:26817640

  7. Assessing herd immunity against rubella in Japan: a retrospective seroepidemiological analysis of age-dependent transmission dynamics.

    PubMed

    Kinoshita, Ryo; Nishiura, Hiroshi

    2016-01-27

    We aimed to epidemiologically assess rubella herd immunity as a function of time, age and gender in Japan, with reference to the recent 2012-2014 rubella epidemic. This study is a retrospective seroepidemiological analysis. The susceptible fraction of the population was examined as a function of age and time. The age at infection was assessed using reported case data. Whereas 30 years ago rubella cases were seen only among children, the median (25-75th centiles) age of cases in 2014 was elevated to 32.0 (17.0-42.0) years among males and 27.0 (7.0-37.0) years among females. Susceptible pockets among male birth cohorts 1989-1993 and 1974-1978 were identified, with seropositive proportions of 70.0% and 68.0%, respectively. The majority of female age groups had greater seropositive proportions than the herd immunity threshold, with a minor susceptible pocket for those born from 1989 to 1993 (78.3% seropositive). The age-standardised seronegative proportion decreased to 18.3% (95% CI 16.8% to 19.8%) among males and 15.6% (95% CI 10.0% to 21.2%) among females in 2013, and the immune fraction was not sufficiently below the herd immunity threshold. While the number of live births born to susceptible mothers in 1983 was estimated at 171,876 across Japan, in 2013 it was reduced to 23,698. An elevated age at rubella virus infection and the presence of susceptible pockets among adults were observed in Japan. Although, overall, the absolute number of rubella cases has steadily declined in Japan, the elevated age of rubella cases, along with increased numbers of susceptible adults, contributed to the observation of as many as 45 congenital rubella syndrome (CRS) cases, which calls for supplementary vaccination among susceptible adults. Assessing herd immunity is considered essential for routinely monitoring the risk of future rubella epidemics and CRS cases. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  8. [Antibody titers against measles, rubella, mumps and varicella-zoster viruses in medical students].

    PubMed

    Yoshida, Noriko; Tsumura, Naoki; Toyomasu, Koji; Sagawa, Kimitaka

    2007-01-01

    It is important to identify and immunize susceptible students who have clinical practice to prevent and control hospital infections. The antibody titers to measles, rubella, mumps and varicella viruses were measured in 1,139 students(417 men, 722 women, average age 21.3+/-2.7 yr old)including 510 medical students, 442 nursing students and 187 students of the School of Medical Technology in Kurume University. Antibodies against measles virus were detected by particle agglutination assay(PA), those against rubella virus by hemagglutination inhibition assay(HI), and those against mumps and varicella viruses by enzyme-linked immunosorbent assay(EIA). The serological susceptibilities to measles, rubella, mumps and varicella viruses were 112(9.8%), 112(9.8%), 163(14.3%)and 73(6.4%), respectively. The serological susceptibilities to measles, rubella and mumps viruses in male students were not different from those in female students. The susceptibility to varicella virus in female students was significantly higher than that in male students. After susceptible students were recommended to have vaccinations against each virus, the vaccination rate of the students without antibody was 99.1%. The history of infection and vaccination against the viruses were examined by self-recorded questionnaires in 406 students from all disciplines. The serological susceptibility of students with positive vaccination history was 11.1% for measles, 6.8% for rubella, 18.3% for mumps, and 4.9% for varicella. The serological susceptibility of students with a positive infection history was 5.7% for measles, 3.4% for rubella, 2.9% for mumps, and 4.9% for varicella. In the self-recorded questionnaire, the rate of unknown infection and vaccination histories were 57.5% and 71.6% for measles, 52.5% and 68.4% for rubella, 34.3% and 75.6% for mumps, and 27.1% and 80.5% for varicella, respectively. In conclusion, these data confirm that it is essential to assess immune status against measles, rubella, mumps and varicella in students who have clinical practice in hospital regardless of infection or vaccination history. Accordingly, susceptible students should be vaccinated to prevent those viral infections in hospital.

  9. Difficulties in Eliminating Measles and Controlling Rubella and Mumps: A Cross-Sectional Study of a First Measles and Rubella Vaccination and a Second Measles, Mumps, and Rubella Vaccination

    PubMed Central

    Wang, Zhifang; Yan, Rui; He, Hanqing; Li, Qian; Chen, Guohua; Yang, Shengxu; Chen, Enfu

    2014-01-01

    Background The reported coverage of the measles–rubella (MR) or measles–mumps–rubella (MMR) vaccine is greater than 99.0% in Zhejiang province. However, the incidence of measles, mumps, and rubella remains high. In this study, we assessed MMR seropositivity and disease distribution by age on the basis of the current vaccination program, wherein the first dose of MR is administered at 8 months and the second dose of MMR is administered at 18–24 months. Methods Cross-sectional serological surveys of MMR antibodies were conducted by collecting epidemiological data in Zhejiang province, China in 2011. In total, 1015 participants were randomly selected from two surveillance sites. Serum MMR-specific immunoglobulin G levels were tested by enzyme-linked immunosorbent assay. The geometric mean titers and seroprevalence with 95% confidence intervals (CIs) were calculated by age and gender. Proportions of different dose of vaccine by age by vaccine were also identified. Statistically significant differences between categories were assessed by the Chi-square test. Results Over 95% seroprevalence rates of measles were seen in all age groups except <7 months infants. Children aged 5–9 years were shown lower seropositivity rates of mumps while elder adolescences and young adults were presented lower rubella seroprevalence. Especially, rubella seropositivity was significantly lower in female adults than in male. Nine measles cases were unvaccinated or unknown vaccination history. Among them, 66.67% (6/9) patients were aged 20–29 years while 33.33% (3/9) were infants aged 8–12 months. In addition, 57.75% (648/1122) patients with mumps were children aged 5–9 years, and 50.54% (94/186) rubella cases were aged 15–39 years. Conclusions A timely two-dose MMR vaccination schedule is recommended, with the first dose at 8 months and the second dose at 18–24 months. An MR vaccination speed-up campaign may be necessary for elder adolescents and young adults, particularly young females. PMID:24586717

  10. Modified measles versus rubella versus atypical measles: One and same thing

    PubMed Central

    Gupta, Surender Nikhil; Gupta, Naveen; Gupta, Shivani

    2015-01-01

    Introduction: In outbreak settings, more than one virus may be infecting the given population. In twin or triple outbreak of measles, German measles (rubella), and varicella in highly immunized hilly areas, maximal number of the case patients in all the hilly villages belonged to the older age group. It suggested an obvious shift to the higher age group, warranting second dose opportunity in such case scenario. The clinical presentations of viral diseases are too similar to differentiate. The aim is to clearly categorize the case patients of modified measles, rubella, and atypical measles in outbreak settings. Results: Four outbreaks are listed. In the first one, sixty case patients were identified from 1026 people in 5 villages. Of these, 41 were diagnosed by clinically, 8 were laboratory confirmed as measles and 11 were epidemiologically linked German measles case patients. Seventy percent of the cases were vaccinated for measles. In second case, we identified 29/35 measles and 6/35 were confirmed as epidemiologically linked unvaccinated chickenpox case patients. In third one, we identified 116 cases in eight villages (112/116 clinically and 04/116 laboratory confirmed). Majority of cases were immunized against measles, but only minor cases for rubella. In fourth case, we identified 505 case patients from mixed outbreaks of varicella, measles and rubella (30/505 clinically, 467/505 epidemiologically linked and 8/505 laboratory confirmed case patients from a study population of 3280). In all the four outbreaks, prima facie, the clinical presentations of both rubella and modified measles were difficult to differentiate. Discussion: On the basis of outbreak investigation and analytical inference, it has been observed that the symtomatology of modified measles and laboratory confirmed rubella case patients/epidemiologically linked cases are so similar placed that many a time, it becomes much difficult to line list the cases in one section of modified measles or rubella or atypical cases. Conclusion: Similarities of morphological symptoms between modified measles and rubella is the point of challenge and it causes debate between pediatrician and field epidemiologist to differentiate and classify them. PMID:26985417

  11. Modified measles versus rubella versus atypical measles: One and same thing.

    PubMed

    Gupta, Surender Nikhil; Gupta, Naveen; Gupta, Shivani

    2015-01-01

    In outbreak settings, more than one virus may be infecting the given population. In twin or triple outbreak of measles, German measles (rubella), and varicella in highly immunized hilly areas, maximal number of the case patients in all the hilly villages belonged to the older age group. It suggested an obvious shift to the higher age group, warranting second dose opportunity in such case scenario. The clinical presentations of viral diseases are too similar to differentiate. The aim is to clearly categorize the case patients of modified measles, rubella, and atypical measles in outbreak settings. Four outbreaks are listed. In the first one, sixty case patients were identified from 1026 people in 5 villages. Of these, 41 were diagnosed by clinically, 8 were laboratory confirmed as measles and 11 were epidemiologically linked German measles case patients. Seventy percent of the cases were vaccinated for measles. In second case, we identified 29/35 measles and 6/35 were confirmed as epidemiologically linked unvaccinated chickenpox case patients. In third one, we identified 116 cases in eight villages (112/116 clinically and 04/116 laboratory confirmed). Majority of cases were immunized against measles, but only minor cases for rubella. In fourth case, we identified 505 case patients from mixed outbreaks of varicella, measles and rubella (30/505 clinically, 467/505 epidemiologically linked and 8/505 laboratory confirmed case patients from a study population of 3280). In all the four outbreaks, prima facie, the clinical presentations of both rubella and modified measles were difficult to differentiate. On the basis of outbreak investigation and analytical inference, it has been observed that the symtomatology of modified measles and laboratory confirmed rubella case patients/epidemiologically linked cases are so similar placed that many a time, it becomes much difficult to line list the cases in one section of modified measles or rubella or atypical cases. Similarities of morphological symptoms between modified measles and rubella is the point of challenge and it causes debate between pediatrician and field epidemiologist to differentiate and classify them.

  12. Rubella in Israel after the MMR vaccine: elimination or containment?

    PubMed

    Anis, Emilia; Grotto, Itamar; Moerman, Larisa; Kaliner, Ehud; Warshavsky, Bruce; Slater, Paul E; Lev, Boaz

    2013-05-01

    Since 1996, after the full institution of the two-dose measles, mumps, and rubella vaccine (MMR) regimen in Israel, rubella incidence has declined dramatically and has remained extremely low. Cyclical outbreaks ended; the two brief outbreaks that did occur were quickly contained; and epidemiological data indicate that the disease is practically absent from the country. But similar steep declines in the incidence of measles and mumps, the two other MMR-preventable diseases, were followed by major outbreaks in 2007 and 2010. Epidemiological analyses show that undervaccination of subgroups within the Jewish ultra-orthodox population, both in Israel and abroad, and virus importation into Israel, continue to be risk factors for all three MMR-preventable diseases. Israel's public health system, therefore, should focus on a policy of containment: improve MMR coverage among undervaccinated subgroups and assure that virus importation is no longer a risk. Then the goal of rubella elimination will become feasible. We discuss how the Israeli experience may contribute to the World Health Organization Initiative to eliminate simultaneously measles and rubella.

  13. Associations between race, sex and immune response variations to rubella vaccination in two independent cohorts

    PubMed Central

    Haralambieva, Iana H.; Salk, Hannah M.; Lambert, Nathaniel D.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Warner, Nathaniel D.; Pankratz, V.Shane; Poland, Gregory A.

    2014-01-01

    Introduction Immune response variations after vaccination are influenced by host genetic factors and demographic variables, such as race, ethnicity and sex. The latter have not been systematically studied in regard to live rubella vaccine, but are of interest for developing next generation vaccines for diverse populations, for predicting immune responses after vaccination, and for better understanding the variables that impact immune response. Methods We assessed associations between demographic variables, including race, ethnicity and sex, and rubella-specific neutralizing antibody levels and secreted cytokines (IFN! , IL-6) in two independent cohorts (1,994 subjects), using linear and linear mixed models approaches, and genetically defined racial and ethnic categorizations. Results Our replicated findings in two independent, large, racially diverse cohorts indicate that individuals of African descent have significantly higher rubella-specific neutralizing antibody levels compared to individuals of European descent and/or Hispanic ethnicity (p! 0.001). Conclusion Our study provides consistent evidence for racial/ethnic differences in humoral immune response following rubella vaccination. PMID:24530932

  14. Genetic diversity of currently circulating rubella viruses: a need to define more precise viral groups.

    PubMed

    Rivailler, P; Abernathy, E; Icenogle, J

    2017-03-01

    Recent studies have shown that the currently circulating rubella viruses are mostly members of two genotypes, 1E and 2B. Also, genetically distinct viruses of genotype 1G have been found in East and West Africa. This study used a Mantel test to objectively include both genetic diversity and geographic location in the definition of lineages, and identified statistically justified lineages (n=13) and sub-lineages (n=9) of viruses within genotypes 1G, 1E and 2B. Genotype 2B viruses were widely distributed, while viruses of genotype 1E as well as 1G and 1J were much more geographically restricted. This analysis showed that more precise groupings for rubella viruses are possible, which should improve the ability to track rubella viruses worldwide. A year-by-year analysis revealed gaps in surveillance that need to be resolved in order to support the surveillance needed for enhanced control and elimination goals for rubella.

  15. Genetic diversity of currently circulating rubella viruses: a need to define more precise viral groups

    PubMed Central

    Rivailler, P

    2017-01-01

    Recent studies have shown that the currently circulating rubella viruses are mostly members of two genotypes, 1E and 2B. Also, genetically distinct viruses of genotype 1G have been found in East and West Africa. This study used a Mantel test to objectively include both genetic diversity and geographic location in the definition of lineages, and identified statistically justified lineages (n=13) and sub-lineages (n=9) of viruses within genotypes 1G, 1E and 2B. Genotype 2B viruses were widely distributed, while viruses of genotype 1E as well as 1G and 1J were much more geographically restricted. This analysis showed that more precise groupings for rubella viruses are possible, which should improve the ability to track rubella viruses worldwide. A year-by-year analysis revealed gaps in surveillance that need to be resolved in order to support the surveillance needed for enhanced control and elimination goals for rubella. PMID:27959771

  16. Prior pregnancy and antenatal rubella sero-negativity-evidence of persistent maternal immunologic alteration?

    PubMed

    Lao, Terence T; Hui, Annie S Y; Sahota, Daljit S

    2017-09-01

    It is unclear if the immunologic alterations induced by pregnancy could persist. Antenatal rubella sero-negativity was correlated with gravidity, abortions and parity in 112 083 gravidae managed during 1997-2015, with further analysis stratified for factors known to influence rubella serology. The 10.2% sero-negative gravidae had different characteristics, and the incidence showed significant difference and positive trend (P<.001 for both) with gravidity, abortions and parity. The pattern remained consistent when analysis was stratified for advanced age, high body mass index and medical history, but was negated by hepatitis B virus infection except for abortions, and by high body mass index for parity. For gravidity 2-4, no difference in rubella sero-negativity was found between gravidae with all previous pregnancies ended in abortion vs delivery. Prior pregnancies diminished rubella immunity in a dose-dependent manner, which may be a reflection of the cumulative effect of pregnancy-associated maternal immunologic alteration. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. The prevalence of ureaplasma urealyticum, mycoplasma hominis, chlamydia trachomatis and neisseria gonorrhoeae infections, and the rubella status of patients undergoing an initial infertility evaluation

    PubMed Central

    Imudia, Anthony N.; Detti, Laura; Puscheck, Elizabeth E.; Yelian, Frank D.

    2008-01-01

    Purpose To determine the prevalence of positive test for Ureaplasma urealyticum (UU), Mycoplasma hominis (MH), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) infections, and their corresponding Rubella status when undergoing workup for infertility. Methods Retrospective chart review to determine infection status for UU, MH, CT, and NG as determined by cervical swab, as well as the serum Rubella antibody titer. Results A total of 46 patients of the patients reviewed were positive for UU (20.1%), three patients were positive for MH (1.3%), five patients were positive for CT (2.2%) and one patient was positive for NG (0.4%). Rubella immunity was confirmed in 90.3% of patients. Conclusion Approximately one quarter of women presenting to an infertility clinic seeking to conceive were found to have a positive test for UU, MH, CT or NG infection. Additionally, almost 10% of the patients were Rubella non-immune at the time of presentation for infertility evaluation. PMID:18202910

  18. Postpartum live virus vaccination: lessons from veterinary medicine.

    PubMed

    Yazbak, F Edward; Diodati, Catherine J M

    2002-09-01

    Pregnant rubella-susceptible women are often revaccinated during the postpartum period with the Measles, Mumps, and Rubella vaccine (MMR). It is known that the rubella virus from vaccine is secreted in breast milk and persists in the nose and throat for up to 28 days but it is not known whether the measles and mumps viruses are similarly secreted. It is probable the measles virus from vaccine is.

  19. Cost effectiveness of prevaccination screening of health care workers for immunity to measles, rubella and mumps.

    PubMed

    Ferson, M J; Robertson, P W; Whybin, L R

    1994-04-18

    To determine the value of infection and vaccination histories as predictors of immunity to measles, rubella and mumps, and to compare the costs of various screening strategies with the cost of universal vaccination of health care workers. Staff employed by a Sydney children's hospital. Histories of measles, rubella and mumps infection or vaccination were compared with the results of serological testing to determine which historical statements had high positive predictive values (PPV) for immunity. Using this, we devised three prevaccination screening strategies and compared their costs with the cost of universal staff vaccination. Of 235 participants, 98.3% were serologically immune to measles, 96.6% to rubella and 83.0% to mumps. Historical statements indicating immunity with a PPV of more than 95% were histories of measles or of rubella vaccination, and personal recollection of mumps infection. Strategies using historical screening were cheaper than universal vaccination, which in turn was cheaper than using serological screening alone. Among health care workers at occupational risk of measles, rubella and mumps, the need for vaccination can be reduced by combining historical and serological screening. Where screening is felt to impose an administrative burden, a universal vaccination strategy costs 30%-50% more than strategies which use historical screening.

  20. Rubella, herpes simplex virus type 2 and preeclampsia.

    PubMed

    Alshareef, Shimos A; Eltom, Ahmed M; Nasr, Abubakr M; Hamdan, Hamdan Z; Adam, Ishag

    2017-07-26

    Preeclampsia is a major health problem. Although, the pathophysiology of preeclampsia is not fully understood, there are recent studies on association between infections and preeclampsia. The aim of the present study was to investigate the association between maternal seropositivity of rubella, Herpes simplex virus type 2 (HSV-2) and preeclampsia. A case -controls study (90 women in each arm) was conducted at Saad Abualila Maternity Hospital, Khartoum, Sudan. The cases were women with preeclampsia and the controls were healthy pregnant women. Rubella and HSV-2 IgG antibodies were analysed in the maternal sera of all of the participants using ELISA. There was no significant difference in the age, parity and gestational age between the two groups. Maternal serum IgG seropositivity for rubella (92.2% vs. 34.4%, P < 0.001) and HSV-2 (87.8% vs. 57.8%, P < 0.001) were significantly higher in preeclampsia than in the controls. There was no significant difference in the maternal serum IgM seropositivity for rubella (3.3% vs. 2.2%, P = 0.650) and HSV-2 (2.2% vs. 1.1%, P = 0.560). All the IgM seropositive cases were IgG seropositive too. In binary logistic regression women with rubella (OR = 4.93; 95% CI = 2.082-11.692, P < 0.001) and HSV-2 (OR = 5.54; 95% CI = 2.48-12.38, P < 0.001) IgG seropositivity were at higher risk for preeclampsia. In the current study rubella and HSV-2 IgG seropositivity is associated with preeclampsia. Preventive measure should be implemented.

  1. Results of the rubella elimination program in Catalonia (Spain), 2002–2011

    PubMed Central

    Barrabeig, Irene; Torner, Nuria; Martínez, Ana; Carmona, Gloria; Ciruela, Pilar; Batalla, Joan; Costa, Josep; Hernández, Sergi; Salleras, Luis; Domínguez, Angela; Group of Catalonia, the Rubella Surveillance

    2013-01-01

    Rubella is usually a mild disease with nonspecific symptoms, but can cause congenital rubella syndrome (CRS) when infection occurs during pregnancy. The objective of this study was to evaluate the sensitivity and positive predictive value of different data sources used for surveillance purposes in the Rubella Elimination Program of Catalonia between 2002 and 2011. The Urgent Notification to the Statutory Disease Reporting System, the Individualized Disease Reporting System, screening for other viruses included in the Measles Elimination Program, the Microbiological Reporting System and the Minimum Hospital Discharge Data were evaluated. 100 suspected cases of postnatal rubella and 6 suspected cases of CRS were detected. For postnatal rubella, Urgent Notification had the highest sensitivity (32.5%; 95%CI 18.6–49.1), followed by the Virus screening in Measles Elimination Program (25%; 95%CI 12.7-41.2). Virus screening in the Measles Elimination Program had the highest PPV (76.9%; 95%CI 46.1–94.9), followed by the Individualized Disease Reporting System (57.1%; 95%CI 28.9–82.3). For CRS cases, the Individualized Disease Reporting System had the highest sensitivity (100%, 95%CI 29.2–100) and the highest PPV (60%; 95%CI 14.7–100). Most confirmed postnatal cases (25 cases, 48.1%) were in the 25–44 y age group followed by the 15–24 y age group (11 cases, 21.2%). The highest values of sensitivity and PPV for the detection of confirmed cases corresponded to activities that were specifically introduced in the measles and rubella elimination programs. PMID:23299566

  2. [Analysis on molecular epidemiology of rubella virus in Shandong province during 2000-2007].

    PubMed

    Wang, Chang-Yin; Zhu, Zhen; Xu, Ai-Qiang; Xiong, Ping; Song, Li-Zhi; Xu, Qing; Feng, Lei; Xu, Wen-Bo

    2010-11-01

    Analyze the genetic characteristics of sixteen strains of wild-type rubella viruses derived from Vero cells, Rk13 cells or Vero/slam cells, and isolated from throat samples in Shandong province during 2000-2007. The 1107 nucleotide sequence of nucleoprotein (E1) gene of these isolates were amplified by RT-PCR, and the PCR products were directly sequenced. Comparing with the gene tree that was constructed based on the 739 gene sequences of the WHO reference strains, twelve isolated strains belonged to 1E genotype, one strain belonged to 1F genotype, three strains belonged to 2A genotype. The first strain belonged to 1E genotype was isolated in Shandong province in 2001, then genotype 1E became dominant genotype of wild rubella viruses circulated. The 1E genotype circulated from 2006-2007 was different compared with that circulated from 2001 to 2002, but no significant deviation in temporal and geographic distribution was found. The strain belonged to Genotype 1F was only isolated during 2000 to 2001. The three strains of 2A genotype of rubella viruses were similar to rubella viruses vaccine strain (BRDII). The most nucleotide mutation of rubella viruses among the sixteen strains were nonsense mutation, and the amino acid sequences were highly conservative with no change in important antigen sites. Alike the previous reports, there was the same amino acid mutation in protein E1 at the site of 338 in all of the 1E genotype rubella viruses isolated during 2001- 2007 in Shandong (Leu338 --> Phe338).

  3. A Socio-Demographic Examination of Adults Responding to Governmental Vaccination Recommendations during the Japanese Rubella Outbreak of 2013.

    PubMed

    Hori, Ai; Wada, Koji; Smith, Derek R

    2015-01-01

    In 2013 a rubella outbreak occurred among Japanese people of working-age which resulted in 14,357 reported cases. The Japanese government subsequently recommended voluntary vaccination or rubella antibody testing for young women (15-49 years of age) who were planning to conceive and for adult men, children, and other persons in potential contact with pregnant women at home. However, the expense and time involved for vaccination, antibody testing and visiting a clinic may represent a major barrier to voluntary compliance among this busy demographic. The aim of the current study was, therefore, to examine potential relationships between the social background of Japanese working-age individuals affected by the 2013 voluntary vaccination campaign. A web-based survey of 1,889 Japanese men and women aged 20-49 years was conducted in early 2014. Statistical analyses were used to explore the associations between social background and testing for rubella antibody and / or vaccination uptake during the previous year. Twenty-four percent of respondents who were planning a pregnancy had been tested for rubella antibody or vaccinated in 2013. However, among those without a current desire for pregnancy, 3% of men and 7% of women, respectively, were tested or vaccinated. Regardless of whether they were planning to conceive, testing for rubella antibodies or vaccination was statistically associated with having acquaintances who had been vaccinated, understanding the government recommendations, and being able to confirm their lack of rubella vaccination history using Maternal and Child Health Handbook records in both men and women. To help eliminate rubella in Japan, additional initiatives need to target Japanese individuals who cannot envisage a direct benefit from vaccination. The results of this study suggest that disseminating the government recommendation to all potentially affected subpopulations, along with maintaining life-time vaccination records might offer a solution to encourage vaccination uptake among working-age adults in Japan, as elsewhere.

  4. Rubella Seroprevalence and real-time PCR detection of RUBV among Congolese pregnant women.

    PubMed

    Zanga, Josue; Mbanzulu, Makola Kennedy; Kabasele, Arnold-Freddy; Ngatu, Nlandu Roger; Wumba, Dimosi Roger

    2017-04-05

    Rubella is an acute infectious disease caused by Rubella virus (RUBV). RUBV remains an important pathogen worldwide, causing approximately 100 000 cases of congenital rubella syndrome (CRS) every year; and the most severe consequence of rubella is teratogenicity. The aim of this study was to estimate the prevalence of RUBV IgG antibodies and determine RUBV genotypes in Congolese pregnant women in Kongo central province, Democratic Republic of Congo (DRC). This was a prospective cross-sectional study that consisted of a laboratory analysis of blood samples from 78 pregnant women to check for the presence of RUBV IgG antibodies, and also determine RUBV genotypes in seropositive samples (using primers targeting RUBV nucleoprotein), with the use of serological and molecular methods, respectively. Participants were pregnant women attending antenatal care clinics (ANC) at two health zones of Kisantu town in DRC. They were followed-up from the first to third trimester. Those who were negative for RUBV antibodies at the initial assay (first trimester) were tested in the second and, eventually, the third trimester. An overall rubella seroprevalence of 58.97% was observed, whereas RUBV nucleoprotein was detected in 60% of randomly selected 30 blood samples among the 46 RUBV seropositive pregnant women. Five (27.77%) of positive samples were positive for both RUBV genotypes (RV8633/9112 and RV8945/9577), whereas 11 (61.11%) of them were positive for RV8633/9112 and two (11.11%) were positive for RV8945/9577 only. Regarding rubella clinical signs and complications, two subjects (2.56%) presented with fever, whereas five pregnant women (6.41%) had experienced abortion. None (0%) of the participants has been vaccinated against RUBV. Findings from this study suggest that RUBV is prevalent in Congolese pregnant women. Further research is required to elucidate the molecular epidemiology of RUBV in order to design a rational rubella surveillance and control program in DRC.

  5. A Socio-Demographic Examination of Adults Responding to Governmental Vaccination Recommendations during the Japanese Rubella Outbreak of 2013

    PubMed Central

    Hori, Ai; Wada, Koji; Smith, Derek R.

    2015-01-01

    Background In 2013 a rubella outbreak occurred among Japanese people of working-age which resulted in 14,357 reported cases. The Japanese government subsequently recommended voluntary vaccination or rubella antibody testing for young women (15–49 years of age) who were planning to conceive and for adult men, children, and other persons in potential contact with pregnant women at home. However, the expense and time involved for vaccination, antibody testing and visiting a clinic may represent a major barrier to voluntary compliance among this busy demographic. The aim of the current study was, therefore, to examine potential relationships between the social background of Japanese working-age individuals affected by the 2013 voluntary vaccination campaign. Methods A web-based survey of 1,889 Japanese men and women aged 20–49 years was conducted in early 2014. Statistical analyses were used to explore the associations between social background and testing for rubella antibody and / or vaccination uptake during the previous year. Results Twenty-four percent of respondents who were planning a pregnancy had been tested for rubella antibody or vaccinated in 2013. However, among those without a current desire for pregnancy, 3% of men and 7% of women, respectively, were tested or vaccinated. Regardless of whether they were planning to conceive, testing for rubella antibodies or vaccination was statistically associated with having acquaintances who had been vaccinated, understanding the government recommendations, and being able to confirm their lack of rubella vaccination history using Maternal and Child Health Handbook records in both men and women. Conclusion To help eliminate rubella in Japan, additional initiatives need to target Japanese individuals who cannot envisage a direct benefit from vaccination. The results of this study suggest that disseminating the government recommendation to all potentially affected subpopulations, along with maintaining life-time vaccination records might offer a solution to encourage vaccination uptake among working-age adults in Japan, as elsewhere. PMID:26057740

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Edlich, R.F.; Spyker, D.A.

    This book contains over 50 selections. Some of the titles are: Ethanol; Hydrocarbons; Lead; Rubella and Congenital Rubella; Tachycardias; Intracerebral Hemorrhage; Acute Otitis Media; and Diabetic Ketoacidosis and Coma in Adults.

  7. Live attenuated rubella vectors expressing SIV and HIV vaccine antigens replicate and elicit durable immune responses in rhesus macaques

    PubMed Central

    2013-01-01

    Background Live attenuated viruses are among our most potent and effective vaccines. For human immunodeficiency virus, however, a live attenuated strain could present substantial safety concerns. We have used the live attenuated rubella vaccine strain RA27/3 as a vector to express SIV and HIV vaccine antigens because its safety and immunogenicity have been demonstrated in millions of children. One dose protects for life against rubella infection. In previous studies, rubella vectors replicated to high titers in cell culture while stably expressing SIV and HIV antigens. Their viability in vivo, however, as well as immunogenicity and antibody persistence, were unknown. Results This paper reports the first successful trial of rubella vectors in rhesus macaques, in combination with DNA vaccines in a prime and boost strategy. The vectors grew robustly in vivo, and the protein inserts were highly immunogenic. Antibody titers elicited by the SIV Gag vector were greater than or equal to those elicited by natural SIV infection. The antibodies were long lasting, and they were boosted by a second dose of replication-competent rubella vectors given six months later, indicating the induction of memory B cells. Conclusions Rubella vectors can serve as a vaccine platform for safe delivery and expression of SIV and HIV antigens. By presenting these antigens in the context of an acute infection, at a high level and for a prolonged duration, these vectors can stimulate a strong and persistent immune response, including maturation of memory B cells. Rhesus macaques will provide an ideal animal model for demonstrating immunogenicity of novel vectors and protection against SIV or SHIV challenge. PMID:24041113

  8. Seroprevalence of Measles-, Mumps- and Rubella-Specific IgG Antibodies in German Children and Adolescents and Predictors for Seronegativity

    PubMed Central

    Poethko-Müller, Christina; Mankertz, Annette

    2012-01-01

    We have undertaken a seroprevalence study with more than 13,000 children, who had been included in the German KIGGS survey, a representative sample of children and adolescents 0–17 years of age. The IgG titres against measles, mumps and rubella were determined in 1 to 17 year olds While 88.8% of the children were MMR-vaccinated at least once, 76.8% of children aged 1 to 17 years showed prevalence of antibodies to MMR. The highest seronegativity was seen with respect to mumps. Gender differences were most pronounced with regard to rubella IgG titres: girls aged 14 to 17 years were best protected, although seronegativity in 6.8% of this vulnerable group still shows the need of improvement. Search for predictors of missing seroprevalence identified young age to be the most important predictor. Children living in the former West and children born outside of Germany had a higher risk of lacking protection against measles and rubella, while children with a migration background but born in Germany were less often seronegative to measles antibodies than their German contemporaries. An association of seronegativity and early vaccination was seen for measles but not for mumps and rubella. A high maternal educational level was associated with seronegativity to measles and rubella. In vaccinated children, seronegativity was highest for mumps and lowest for rubella. For mumps, high differences were observed for seronegativity after one-dose and two-dose vaccination, respectively. Seronegativity increases as time since last vaccination passes thus indicating significant waning effects for all three components of MMR. PMID:22880124

  9. Are healthcare workers immune to rubella?

    PubMed

    Borràs, Eva; Campins, Magda; Esteve, María; Urbiztondo, Luis; Broner, Sonia; Bayas, José María; Costa, Josep; Domínguez, Angela

    2014-01-01

    Healthcare workers (HCW) have high exposure to infectious diseases, some of which, such as rubella, are vaccine-preventable. The aim of this study was to determine the immunity of HCW against rubella. We performed a seroprevalence study using a self-administered survey and obtained blood samples to determine rubella Immunoglobulin G (IgG) antibody levels in HCW during preventive examinations by five Primary Care Basic Prevention Units and six tertiary hospitals in Catalonia. Informed consent was obtained. IgG was determined using an antibody capture microparticle direct chemiluminometric technique. The odss ratio (OR) and 95% confidence intervals (CI) were calculated. Logistic regression was made to calculate adjusted OR. Of 642 HCW who participated (29.9% physician, 38.8% nurses, 13.3% other health workers and 18% non-health workers), 46.6% were primary care workers and 53.4% hospital workers. Of total, 97.2% had rubella antibodies. HCW aged 30-44 years had a higher prevalence of antibodies (98.4%) compared with HCW aged<30 years (adjusted OR 3.92; 95% CI 1.04-14.85). The prevalence was higher in nurses than in other HCW (adjusted OR: 5.57, 95% CI 1.21-25.59). Antibody prevalence did not differ between females and males (97.4% vs. 97.1%, P 0.89), type of center (97.7% vs. 96.8%, P 0.51) or according to history of vaccination (97.3% vs. 96.8%, P 0.82). Seroprevalence of rubella antibodies is high in HCW, but workers aged<30 years have a higher susceptibility (5.5%). Vaccination should be reinforced in HCW in this age group, due to the risk of nosocomial transmission and congenital rubella.

  10. Are healthcare workers immune to rubella?

    PubMed Central

    Borràs, Eva; Campins, Magda; Esteve, María; Urbiztondo, Luis; Broner, Sonia; Bayas, José María; Costa, Josep; Domínguez, Angela; in Healthcare Workers, Working Group for the Study of the Immune Status

    2014-01-01

    Healthcare workers (HCW) have high exposure to infectious diseases, some of which, such as rubella, are vaccine-preventable. The aim of this study was to determine the immunity of HCW against rubella. We performed a seroprevalence study using a self-administered survey and obtained blood samples to determine rubella Immunoglobulin G (IgG) antibody levels in HCW during preventive examinations by five Primary Care Basic Prevention Units and six tertiary hospitals in Catalonia. Informed consent was obtained. IgG was determined using an antibody capture microparticle direct chemiluminometric technique. The odss ratio (OR) and 95% confidence intervals (CI) were calculated. Logistic regression was made to calculate adjusted OR. Of 642 HCW who participated (29.9% physician, 38.8% nurses, 13.3% other health workers and 18% non-health workers), 46.6% were primary care workers and 53.4% hospital workers. Of total, 97.2% had rubella antibodies. HCW aged 30–44 years had a higher prevalence of antibodies (98.4%) compared with HCW aged <30 years (adjusted OR 3.92; 95% CI 1.04–14.85). The prevalence was higher in nurses than in other HCW (adjusted OR: 5.57, 95% CI 1.21–25.59). Antibody prevalence did not differ between females and males (97.4% vs. 97.1%, P 0.89), type of center (97.7% vs. 96.8%, P 0.51) or according to history of vaccination (97.3% vs. 96.8%, P 0.82). Seroprevalence of rubella antibodies is high in HCW, but workers aged <30 years have a higher susceptibility (5.5%). Vaccination should be reinforced in HCW in this age group, due to the risk of nosocomial transmission and congenital rubella. PMID:24356729

  11. Measles, rubella, and varicella among the crew of a cruise ship sailing from Florida, United States, 2006.

    PubMed

    Mitruka, Kiren; Felsen, Christina B; Tomianovic, Danitza; Inman, Barry; Street, Karen; Yambor, Phyllis; Reef, Susan E

    2012-07-01

    Cruise ship outbreaks of vaccine-preventable diseases (VPD) such as rubella and varicella have been previously associated with introduction and spread among susceptible crew members originating from countries with endemic transmission of these diseases. During February to April 2006, we investigated a cluster of rash illnesses due to measles, rubella, or varicella on a cruise ship sailing from Florida to the Caribbean. Case-finding measures included review of medical logs, active surveillance for rash illness among crew members, and passive surveillance for rash illness in the ship's infirmary lasting two incubation periods from the last case of measles. Passengers with potential exposure to these VPD were notified by letters. All susceptible crew members with potential exposure were administered the measles, mumps, and rubella vaccine after informed consent. A total of 16 cases were identified only among crew members: 1 rubella, 3 measles (two-generation spread), 11 varicella (three-generation spread), and 1 unknown diagnosis. Of 1,197 crew members evaluated, 4 had proof of immunity to measles and rubella. Based on passive surveillance, no cases were identified among passengers, the majority of whom resided in the United States. The international makeup of the population aboard cruise ships combined with their semi-enclosed environment has the potential to facilitate introduction and spread of VPD such as measles, rubella, and varicella onboard and into communities. Cruise lines should ensure crew members have evidence of immunity to these diseases. Passengers should be up to date with all vaccinations, including those that are travel-specific, prior to embarking on cruise travel. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  12. [Seroprevalence of rubella virus, varicella zoster virus, cytomegalovirus and parvovirus B19 among pregnant women in the Sousse region, Tunisia].

    PubMed

    Hannachi, N; Marzouk, M; Harrabi, I; Ferjani, A; Ksouri, Z; Ghannem, H; Khairi, H; Hidar, S; Boukadida, J

    2011-02-01

    The aim of the study is to evaluate seroprevalence of rubella virus (RV), cytomegalovirus (CMV), varicella zoster virus (VZV), and parvovirus B19 (PB19) in 404 Tunisian pregnant women, and to determine reliability of maternal past history of eruption. Sociodemographic characteristics, risk factors, and past history of eruption were collected through a questionnaire. Serologic tests were performed using enzyme immunoassays. Risk factors were analyzed using univariate and multivariate logistic regression models. Seroprevalences were 79.7% for rubella, 96.3% for CMV, 80.9% for VZV, and 76.2% for PB19. In multivariate analysis, the number of persons per room (> 2) in the house during childhood was associated with CMV infection (P = 0.004), irregular professional husband's activity was correlated with VZV infection (P = 0.04), and an age of more than 30 years was associated with PB19 infection (P = 0.02). History of rubella, varicella, and PB19 infection was unknown for, respectively, 55.8%, 20%, and 100% of women. False history of rubella and varicella were found for 7.4% and 15% of women, respectively. The positive and negative predictive values (PPV and NPV) of rubella history were, respectively, 92.6% and 17.2%, and were, respectively, 84.9% and 20.9% for varicella history. Susceptibility to RV, VZV, and PB19 infection remains high in pregnancy in our population. Preventive strategies against congenital rubella must be reinforced. Vaccination against VZV should be considered in seronegative women. Systemic CMV screening is not warranted in our country where high immunity is acquired probably in childhood. Since maternal history of eruption is not reliable, we recommend serologic testing to determine immune status of women.

  13. Antenatal screening for Toxoplasma gondii, Cytomegalovirus, rubella and Treponema pallidum infections in northern Benin.

    PubMed

    De Paschale, Massimo; Ceriani, Cristina; Cerulli, Teresa; Cagnin, Debora; Cavallari, Serena; Cianflone, Annalisa; Diombo, Kouma; Ndayaké, Joseph; Aouanou, Guy; Zaongo, Dieudonné; Priuli, Gianbattista; Viganò, Paolo; Clerici, Pierangelo

    2014-06-01

    Toxoplasma gondii, cytomegalovirus (HCMV) and rubella virus infections are among the most serious of those contracted during pregnancy in terms of foetal consequences. Toxoplasma, HCMV and rubella antibody screening is unusual in Africa, and there are few published data. The aim of this study was to evaluate the prevalence of these markers among pregnant women in northern Benin on the occasion of routine syphilis screening. Toxoplasma, HCMV and rubella IgG and IgM antibodies were determined in the serum of 283 women attending Saint Jean de Dieu de Tanguiéta hospital, using an enzyme immunoassay, and IgM were confirmed using an enzyme-linked fluorescent assay (ELFA). In the case of IgM positivity, the avidity of anti-HCMV and anti-Toxoplasma IgG was measured. Total anti-Treponema pallidum antibodies were determined using an enzyme immunoassay and confirmed by immunoblotting. In the case of positivity, the Venereal Disease Research Laboratory (VDRL) test was used. The prevalence of anti-Toxoplasma, anti-HCMV, anti-rubella IgG and total anti-Treponema antibodies was, respectively, 30.0%, 100%, 94% and 2.5%. The VDRL test was positive in 62.5% of the anti-Treponema-positive samples. The prevalence of anti-Toxoplasma, anti-HCMV and anti-rubella IgM was, respectively, 0.4%, 1.4% and 0%. There were no statistically significant differences in terms of age class or trimester of pregnancy. Anti-Toxoplasma and anti-HCMV IgG avidity was always high. The prevalence of HCMV and rubella antibodies is high in northern Benin, whereas that of Toxoplasma antibodies is lower. As nearly two-thirds of the pregnant women were anti-Toxoplasma seronegative, antibody screening should be introduced. © 2014 John Wiley & Sons Ltd.

  14. Evidence of pestivirus RNA in human virus vaccines.

    PubMed Central

    Harasawa, R; Tomiyama, T

    1994-01-01

    We examined live virus vaccines against measles, mumps, and rubella for the presence of pestivirus RNA or of pestiviruses by reverse transcription PCR. Pestivirus RNA was detected in two measles-mumps-rubella combined vaccines and in two monovalent vaccines against mumps and rubella. Nucleotide sequence analysis of the PCR products indicated that a modified live vaccine strain used for immunization of cattle against bovine viral diarrhea is not responsible for the contamination of the vaccines. Images PMID:8077414

  15. [Simulating measles and rubella elimination levels according to social stratification and interaction].

    PubMed

    Hincapié-Palacio, Doracelly; Ospina-Giraldo, Juan; Gómez-Arias, Rubén D; Uyi-Afuwape, Anthony; Chowell-Puente, Gerardo

    2010-02-01

    The study was aimed at comparing measles and rubella disease elimination levels in a homogeneous and heterogeneous population according to socioeconomic status with interactions amongst low- and high-income individuals and diversity in the average number of contacts amongst them. Effective reproductive rate simulations were deduced from a susceptibleinfected- recovered (SIR) mathematical model according to different immunisation rates using measles (1980 and 2005) and rubella (1998 and 2005) incidence data from Latin-America and the Caribbean. Low- and high-income individuals' social interaction and their average number of contacts were analysed by bipartite random network analysis. MAPLE 12 (Maplesoft Inc, Ontario Canada) software was used for making the simulations. The progress made in eliminating both diseases between both periods of time was reproduced in the socially-homogeneous population. Measles (2005) would be eliminated in high- and low-income groups; however, it would only be achieved in rubella (2005) if there were a high immunity rate amongst the low-income group. If the average number of contacts were varied, then rubella would not be eliminated, even with a 95 % immunity rate. Monitoring the elimination level in diseases like measles and rubella requires that socio-economic status be considered as well as the population's interaction pattern. Special attention should be paid to communities having diversity in their average number of contacts occurring in confined spaces such as displaced communities, prisons, educational establishments, or hospitals.

  16. 77 FR 58843 - Advisory Committee on Immunization Practices (ACIP)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-24

    ..., hepatitis B vaccine, meningococcal vaccines, influenza, measles-mumps-rubella vaccine, pertussis and vaccine...-rubella vaccine, hepatitis B vaccine, child/adolescent immunization schedule, and the adult immunization...

  17. [Studying of molecular mechanisms of rubella virus attenuation evidence from Russian strain C-77].

    PubMed

    Dmitriev, G V; Borisova, T K; Faĭzuloev, E B; Zabiiaka, Iu I; Desiatskova, R G; Zverev, V V

    2012-01-01

    Live attenuated rubella vaccine is used for vaccination. Temperature-sensitive (ts) phenotype was proved for almost all rubella vaccine strains, and the acquisition of the ts phenotype during cold adaptation was strongly correlated with the attenuation of the wild-type viruses. Nevertheless, the molecular mechanisms of the attenuation have been insufficiently understood for rubella virus. Study ofthese mechanisms, identifying genotypic markers of attenuation, which together with the sequence analyses could be used for genetic stability control of vaccine strains, is still of current interest. In this work, we determined nearly complete genome sequences of attenuated (ca) and the wildtype progenitor (wt) of the rubella virus strain C-77 isolated in Russia. Possible genetic determinants of attenuation were detected. Thus, 13 nucleotide differences leading to 6 amino acid substitutions were found. Four amino acid substitutions were found to be almost unique. Special consideration should be given to Tyr1042Cys substitution in the protease domain of C-77 strain, because it most probably plays the crucial role in acquisition of ts-phenotype.

  18. Virologic surveillance for wild-type rubella viruses in the Americas.

    PubMed

    Icenogle, Joseph P; Siqueira, Marilda M; Abernathy, Emily S; Lemos, Xenia R; Fasce, Rodrigo A; Torres, Graciela; Reef, Susan E

    2011-09-01

    The goal of eliminating rubella from the Americas by 2010 was established in 2003. Subsequently, a systematic nomenclature for wild-type rubella viruses (wtRVs) was established, wtRVs circulating in the region were catalogued, and importations of wtRVs into a number of countries were documented. The geographic distribution of wtRVs of various genotypes in the Americas, interpreted in the context of the global distribution of these viruses, contributed to the documentation of rubella elimination from some countries. Data from virologic surveillance also contributed to the conclusion that viruses of genotype 2B began circulating endemically in the Americas during 2006-2007. Viruses of one genotype (1C), which are restricted to the Americas, will likely disappear completely from the world as they are eliminated from the Americas. Efforts to expand virologic surveillance for wtRVs in the Americas will also provide additional data aiding the elimination of rubella from the region. For example, identification of vaccine virus in specimens from rash and fever cases found during elimination can identify such cases as vaccine associated.

  19. Measles, mumps, and rubella vaccines.

    PubMed

    Wharton, M; Cochi, S L; Williams, W W

    1990-03-01

    With widespread use of the live virus vaccines for measles, mumps, and rubella, there has been a dramatic decrease in the incidence of all three diseases. At the same time, an increasing proportion of the remaining cases are occurring in adolescents and adults. Thus, vaccinations for these three diseases of childhood must be included in a comprehensive program for adult immunization. The vaccines have a proven history of safety and efficacy and are usually administered together as combined measles-mumps-rubella (MMR) vaccine. Vaccination for measles, mumps, and rubella is particularly important for susceptible adults likely to come in contact with infected children. Adults at particularly high risk for exposure may include daycare center workers, teachers and other school employees, college students, medical personnel, and those planning to travel outside the United States.

  20. Measles and Rubella Immunity: A New Requirement.

    ERIC Educational Resources Information Center

    Dorman, John M.; And Others

    1984-01-01

    Stanford University (California) has developed a list of medical immunization requirements for incoming students to help stop incidence of rubella and measles. A discussion of these requirements is offered. (DF)

  1. Congenital rubella

    MedlinePlus

    ... mother is infected with the virus that causes German measles. Congenital means the condition is present at ... Gershon AA. Rubella virus (German measles). In: Bennett JE, Dolin R, ... Principles and Practice of Infectious Diseases, Updated ...

  2. Measles, mumps, and rubella.

    PubMed

    White, Sarah J; Boldt, Kristi L; Holditch, Sara J; Poland, Gregory A; Jacobson, Robert M

    2012-06-01

    Measles, mumps, and rubella are viral diseases that may adversely affect nonimmune pregnant women and their fetuses/neonates. Prevention of these diseases and their complications can be achieved through measles-mumps-rubella (MMR) vaccination before pregnancy. The vaccine is contraindicated during pregnancy, because it contains live, attenuated viruses that pose a theoretical risk to the fetus. However, accidental receipt of MMR vaccination is not known to cause maternal/fetal complications. MMR immunization is recommended to nonimmune obstetric patients upon completion or termination of pregnancy.

  3. Rubella

    MedlinePlus

    ... now. Almost everyone who receives the vaccine has immunity to rubella. Immunity means that your body has built a defense ... a mild infection. After an infection, people have immunity to the disease for the rest of their ...

  4. Measles and Rubella Global Strategic Plan 2012-2020 midterm review report: Background and summary.

    PubMed

    Orenstein, Walter A; Cairns, Lisa; Hinman, Alan; Nkowane, Benjamin; Olivé, Jean-Marc; Reingold, Arthur L

    2018-01-11

    Measles, a vaccine-preventable illness, is one of the most infectious diseases known to man. In 2015, an estimated 134,200 measles deaths occurred globally. Rubella, also vaccine-preventable, is a concern because infection during pregnancy can result in congenital defects in the baby. More than 100,000 babies with congenital rubella syndrome were estimated to have been born globally in 2010. Eradication of both measles and rubella is considered to be feasible, beneficial, and more cost-effective than high-level control. All six World Health Organization (WHO) regions have measles elimination goals by 2020 and two have rubella elimination goals by that year. However, the World Health Assembly has not endorsed a global eradication goal for either disease. In 2012, the Measles and Rubella Initiative published a Global Measles and Rubella Strategic Plan, 2012-2020, referred to hereafter as the Plan, which aimed to achieve measles and rubella elimination in at least five WHO regions by end-2020 through the implementation of five core strategies, with progress evaluated against 2015 milestones. When, by end-2015, none of these milestones had been met, WHO's Strategic Advisory Group of Experts on Immunization (SAGE) recommended a mid-term review of the Plan to evaluate progress toward goals, assess the quality of strategy implementation, and formulate lessons learned. A five-member team reviewed documents and conducted interviews with stakeholders as the basis for the review's conclusions and recommendations. This team concluded that, although significant progress in measles elimination had been made, progress had slowed. It recommended that countries continue to work toward elimination goals with a focus on strengthening ongoing immunization systems. In addition, it concluded that the strategies articulated in the Plan were sound, however full implementation had been impeded by inadequate country ownership and global political will, reflected in inadequate resources. Detailed recommendations for each of the Plan's five strategies as well as the areas of polio transition, governance and resource mobilization are outlined. Copyright © 2017 World Health Organization. Published by Elsevier Ltd.. All rights reserved.

  5. Whooping Cough (Pertussis) - Fact Sheet for Parents

    MedlinePlus

    ... A Hepatitis B Hib Measles Mumps Polio Pneumococcal Rotavirus Rubella Tetanus Whooping Cough (Pertussis) For Parents of ... A Hepatitis B Hib Measles Mumps Polio Pneumococcal Rotavirus Rubella Tetanus Whooping Cough (Pertussis) Top of Page ...

  6. Deaf-Blind Children with Maternal Rubella: Implications for Adult Services.

    ERIC Educational Resources Information Center

    Lockett, Theodore; Rudolph, James

    1980-01-01

    The paper provides data on the numbers and developmental functioning levels of deaf blind children with maternal rubella. Ramifications of their future needs in the vocational rehabilitation process are considered. (Author)

  7. Healthy Family 2009: Protecting Toddlers and Teens

    MedlinePlus

    ... 15 Months Hib, PCV Measles, mumps and rubella (German measles) vaccine— MMR A "3 in 1" vaccine ... death in some cases Rubella, also known as German measles. A generally mild disease, it can cause ...

  8. Possible alternative to European Pharmacopoeia's method of analysis Test for Fc Function of Immunoglobulin (2.7.9) by using tetanus toxoid as antigen.

    PubMed

    Perez-del-Pulgar, S; Lopez, M; Gensana, M; Jorquera, J I

    2006-08-01

    Preparations of intravenous immunoglobulins must keep functional integrity throughout the purification process. In order to assess Fc fragment functionality, the European Pharmacopoeia proposes the Test for Fc function of immunoglobulin (2.7.9), which is based on a rubella antigen of high titre. Sometimes, such antigen is difficult to obtain. In the present study, we develop the same assay using tetanus toxoid instead of rubella antigen, adapting the procedure for the use of tetanus toxoid. The comparison between rubella-based and tetanus-based assays showed that the slopes of the haemolysis curves were higher if red blood cells had been sensitised with the rubella antigen than with tetanus toxoid. Nonetheless, the tetanus-based assay gave satisfactory results and it could be a good alternative antigen target.

  9. Vaccine-Preventable Diseases In Pediatric Patients: A Review Of Measles, Mumps, Rubella, And Varicella.

    PubMed

    Levine, Deborah A

    2016-12-01

    Vaccine-preventable diseases such as measles, mumps, rubella, and varicella continue to plague children and adults worldwide. Although public health programs have helped decrease the prevalence and sequelae of these diseases, outbreaks still occur. To limit the spread of these diseases, emergency clinicians must be able to readily identify the characteristic presentations of the rashes associated with measles, rubella, and varicella, as well as the common presenting features associated with mumps. Diagnostic laboratory studies are not usually necessary, as a complete history and physical examination usually lead to an accurate diagnosis. Treatment for these vaccine-preventable diseases usually consists of supportive care, but, in some cases, severe complications and death may occur. This issue provides a review of the clinical features, differential diagnoses, potential complications, and treatment options for measles, mumps, rubella, and varicella.

  10. Some factors affecting rubella seronegative prevalence among pregnant women in a North West England region between April 2011 and March 2013.

    PubMed

    Ogundele, Michael; Ghebrehewet, Sam; Chawla, Anu

    2016-06-01

    Rubella is usually a mild viral illness, but during pregnancy, it can have potentially devastating effects causing fetal losses and severe congenital malformations (congenital rubella syndrome). Rubella is now rare in most developed countries following a successful vaccination programme. We aimed to investigate differences in epidemiological profile of pregnant women screened antenatally in Liverpool to identify risk factors for rubella immunity. All samples were tested with the Elecsys Rubella IgG immunoassay kit. A result <10 IU/ml was considered to be seronegative. The seronegativity prevalence among pregnant women in Liverpool (6.3%) is higher than average value for the North West region (3.7%). The seronegative rates varied with age (15.4% for <15 years, 18.7% for 15-20 years, compared with 2% for 30-35 years). The areas with the highest seronegative rates correspond with areas of Liverpool with high pockets of socioeconomic deprivation. The highest proportion of seronegative women were among the youngest age groups. Local areas with highest level of deprivation should be given priority and additional resources to develop targeted programmes and pathways to implement appropriate interventions such as MMR catch-up programmes and put in place arrangements for offering MMR vaccination in maternity units. © The Author 2015. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  12. Evaluation of the immune status against measles, mumps, and rubella in adult allogeneic hematopoietic stem cell transplantation recipients.

    PubMed

    Kawamura, Koji; Yamazaki, Rie; Akahoshi, Yu; Nakano, Hirofumi; Ugai, Tomotaka; Wada, Hidenori; Yamasaki, Ryoko; Ishihara, Yuko; Sakamoto, Kana; Ashizawa, Masahiro; Sato, Miki; Terasako-Saito, Kiriko; Kimura, Shun-ichi; Kikuchi, Misato; Nakasone, Hideki; Kanda, Junya; Kako, Shinichi; Tanihara, Aki; Nishida, Junji; Kanda, Yoshinobu

    2015-03-01

    Previous studies have shown that most patients lose immunity to measles, mumps, and rubella (MMR) during long-term follow-up after allogeneic hematopoietic stem cell transplantation (HSCT), and immunizations against them have been investigated. However, these previous studies mainly targeted pediatric patients and information in adult patients is still insufficient. We evaluated the immunity to MMR in 45 adult allogeneic HSCT patients. None of these patients received vaccination after HSCT. The seropositive rates at six years after allogeneic HSCT were estimated to be less than 44% for measles, less than 10% for mumps, and less than 36% for rubella. Thirteen of the 16 female patients who were 16-39 years old were negative or equivocal for rubella. Patients who developed grade II-IV acute graft-versus-host disease tended to become seronegative for measles and rubella at two years after HSCT, although the difference was not statistically significant. This study showed that most adult patients lost immunity to MMR after allogeneic HSCT. Although we did not evaluate the safety and efficacy of vaccination in this study, most HSCT guidelines recommend vaccination for HSCT recipients without active chronic graft-versus-host disease or ongoing immunosuppressive therapy at 24 months after HSCT. Immunization against rubella is especially important for female patients of reproductive age. Further studies will be necessary to evaluate the effect of vaccination on the antibody response in adult allogeneic HSCT recipients.

  13. Seroprevalence of measles, mumps, rubella and varicella among staff of a hospital in Riyadh, Saudi Arabia.

    PubMed

    Abbas, Moustafa; Atwa, Mona; Emara, Amany

    2007-01-01

    This study aimed at screening immune status of Health Care Workers (HCWs) against measles, mumps, rubella, and varicella, and assessing the reliability of the history of previous illness due to these infections or vaccination against them as an indicator of the immune status, as checked by laboratory tests. Demographic data, history of previous illnesses and previous vaccinations were collected using a self-administered questionnaire. Also, serologic screening was done for these infections. Antibodies tested using ELISA. Among tested hospital staff, 71.8%, 60.3%, 47.9% and 68.4% reported history of infection or vaccination against measles, mumps, rubella and varicella respectively, while laboratory results proved that 4.5%, 10.8%, 12.9% and 11.3% were susceptible respectively. Susceptibility was most frequent among housekeeping staff against measles and varicella, while administrative staff were the most susceptibles to mumps, and nurses were the most susceptibles to rubella. Sensitivity of past history of illness as an indicator of the immune status, was found to be (85%, 83%, 66%, 86%); Specificity was (81%, 81%, 89%, 87%); Positive Predictive value (PV) was (99%, 98%, 98%, 98%) and Negative PV was (16%, 29%, 22%, 39%) for measles, mumps, rubella and varicella respectively. Screening for measles, mumps, rubella and varicella among hospital staff is mandatory to detect those who are susceptible for infections and should be vaccinated, and so preventing transmission of these infections to their colleagues or patients.

  14. [Measles, mumps and rubella virus infection in pregnancy. Possible adverse effects on pregnant women, pregnancy outcome and the fetus].

    PubMed

    Enders, M; Biber, M; Exler, S

    2007-11-01

    Measles, mumps and rubella are common childhood diseases. Therefore, frequent and intense contact with children of preschool age may be associated with a higher infection risk for childcare providers. This overview summarizes current knowledge on possible adverse effects of these infections on pregnant women, pregnancy outcome and the fetus. Acute rubella or mumps virus infections are apparently not more severe in pregnant than non-pregnant women. In contrast, measles virus infection in pregnancy is linked to a higher incidence of pneumonitis and hospitalization. Evidence of congenital defects due to fetal infection is only provided in case of rubella virus infection in early pregnancy. Following rubella virus infection in the first trimester an increased fetal loss rate was reported. In 1966, a prospective study showed also a significant association between maternal mumps in the first trimester and an increased risk of abortion. But other investigators could not confirm this association. Measles and rubella but not mumps virus infections are linked to an increased premature birth rate. Occurring in late pregnancy, all three infections can result in birth of an infected infant. But severe disease occurs rarely and is mostly reported for premature infants with early neonatal measles. Preventive measures, aimed to reduce the risk of infection or severe complications for pregnant childcare providers, should consider the individual history of the employee (e.g. previous immunizations or antibody test results), the current epidemiological situation and possible interventions like passive immunization in case of exposure to measles.

  15. Analysis of complete genomes of the rubella virus genotypes 1E and 2B which circulated in China, 2000–2013

    PubMed Central

    Zhu, Zhen; Chen, Min-hsin; Abernathy, Emily; Icenogle, Joseph; Zhou, Shujie; Wang, Changyin; Zhao, Chunfang; Wang, Yan; Chen, Haiyun; Si, Yuan; Xu, Wenbo

    2016-01-01

    Rubella viruses of genotypes 1E and 2B are currently the most frequently detected wild-type viruses in the world. Genotype 1E viruses from China have been genetically distinct from genotype 1E viruses found elsewhere, while genotype 2B viruses found in China are not distinguishable from genotype 2B viruses from other areas. Genetic clusters of viruses of both genotypes were defined previously using sequences of the 739-nt genotyping window. Here we report phylogenic analysis using whole genomic sequences from seven genotype 1E and three genotype 2B viruses which were isolated in China between 2000 and 2013 and confirm the subgrouping of current circulating genotypes 1E and 2B viruses. In addition, the whole genomic characterization of Chinese rubella viruses was clarified. The results indicated that the Chinese rubella viruses were highly conserved at the genomic level, and no predicted amino acid variations were found at positions where functional domains of the proteins were identified. Therefore, it gives us the idea that the rubella control and elimination goal should be achieved if vaccine immunization coverage continues maintaining at the high level. PMID:27959338

  16. Experience with live rubella virus vaccine combined with live vaccines against measles and mumps*

    PubMed Central

    Smorodintsev, A. A.; Nasibov, M. N.; Jakovleva, N. V.

    1970-01-01

    Vaccination of pre-school children in the 1-7-years age-group for the specific prophylaxis of mumps and rubella is often difficult to arrange because of the already large number of inoculations given to these children. Combined vaccines to protect against measles, mumps and rubella should therefore be a valuable development. The existence of effective live vaccines for each of these 3 diseases makes possible the production of a single preparation suitable for subcutaneous inoculation. Tests on vaccine strains of measles (Leningrad-16), mumps (Leningrad-3) and rubella (Leningrad-8) viruses in various combinations have established that divalent or trivalent vaccines remain clinically harmless, highly immunogenic and epidemiologically effective. Single subcutaneous administrations of live measles vaccine combined with mumps or rubella vaccines or both, when given to children aged 1-8 years, brough about a high percentage of serological conversions and an increase in antibodies to a level comparable with that achieved with the corresponding monovalent vaccines. Morbidity from the 3 diseases was reduced among those vaccinated with the trivalent vaccine by 10 or more times, i.e., by about the same factor as when monovalent or divalent vaccines were used. PMID:5310140

  17. Analysis of the association opportunistic infections with c-reactive protein focus toxoplasma, cytomegalovirus, rubella,and hepatitis in human immunodeficiency virus

    NASA Astrophysics Data System (ADS)

    Khadijah, K. H.; Ferica, K.; Katu, S.; Halim, R.; Mubin, A. H.

    2018-03-01

    Opportunistic infections occur more often severe in people with HIV. C-reactive protein is known to have a prognostic value in HIV and those with HIV-related opportunistic infections. High level of CRP will increase therisk of infection toxoplasma, CMV, rubella,and hepatitis in HIV.Analyzing association of opportunistic infections toxoplasma, CMV, rubella,and hepatitis with the level of CRP in HIV, a cross-sectional analytic study wasduring January-July 2017 on both outpatientand inpatient HIV subjects at Wahidin Sudirohusodo Hospital, Makassar. Each HIV patient is categorized into agroup of opportunistic infections: toxoplasma, CMV, rubella, hepatitis. CRP levels will be assessed in each group, defined by normal values <5 mg/L and increased when ≥5 mg/L.From 49 patients, 34 people with toxoplasma, 48 CMV, 41 rubella, 3 HBV and 1HCV with amean of age 34.55±8.434 years and CRP 59.74±74.787 mg/L. The only toxoplasma had a significant association with high CRP levels (p <0.05). There was no meaningful relationship between the number of opportunistic infections with high levels of CRP (p>0.05).

  18. Seroprevalence of antibodies to measles and rubella eight months after a vaccination campaign in the southeast of Iran.

    PubMed

    Izadi, Shahrokh; Zahraei, Seyed Mohsen; Mokhtari-Azad, Talat

    2018-02-08

    Eight months after the mass immunization campaign of November 2015 against measles and rubella in the southeast of Iran, in order to evaluate the sero-immunity level of the people living in the mentioned region, a serosurvey study was performed. Using a multi-stage probability proportional to size cluster sampling, the sera of 1,056 participants, ranging from 15 months to 20 years old, were tested for measles and rubella IgG antibodies in the National Reference Laboratory at Tehran University of Medical Sciences, Tehran, Iran. The seroprevalence rates of antibodies against measles and rubella in the age groups below 16 years were respectively 98.4 and 93.2%. In the age group of 16 to 20 years, who was not the target of the mass immunization campaign, the said rates were respectively 91.7% and 87.4%. The herd immunity of the age groups below 16 years, who were the target of the campaign, is favourably high and reassuring both for measles and for rubella. Campaigns of supplementary vaccination play a substantial role for filling the gaps in the herd immunity.

  19. Handicapping Conditions Associated with the Congenital Rubella Syndrome.

    ERIC Educational Resources Information Center

    Vernon, McCay; And Others

    1980-01-01

    The authors discuss the incidence of impairments diagnosed among children with congenital rubella syndrome. Approximately 73 percent are hearing impaired, at least 35 percent have congenital heart disorders, and 33 percent have visual defects. (Author)

  20. The "Rubella Bulge" and Vocational Planning.

    ERIC Educational Resources Information Center

    Wyks, Hollis W.

    1980-01-01

    The increased numbers and additional handicaps of deaf students born in the 1963-65 rubella epidemic require not more postsecondary programs, but rather strengthened programs and rehabilitation approaches to vocational and independent living skill training. (Author/CL)

  1. MMR (measles, mumps, and rubella) vaccine - what you need to know

    MedlinePlus

    Centers for Disease Control and Prevention website. MMR (measles, mumps, and rubella) vaccine. www.cdc.gov/vaccines/hcp/vis/vis-statements/mmr.html . Updated February 12, 2018. Accessed February 14, 2018.

  2. Measles, Mumps, and Rubella - Vaccine Use and Strategies for Elimination of Measles, Rubella, and Congenital Rubella Syndrome and Control of Mumps: Recommendations of the Advisory Committee on Immunization Practices (ACIP). Vol. 47/No. RR-8.

    DTIC Science & Technology

    1998-05-22

    America William P. Glezen, M.D. Houston, Texas Mexico’s Health Secretariat Roberto Tapia Conyer, M.D. MEXICO National Medical Association Walter...were similar in two groups, one of which was administered MMR and varicella vaccines simultaneously at separate sites and the other of which received... Varicella prophylaxis (VZIG) Measles prophylaxis (IG) - Standard (i.e., nonimmuno- compromised) contact - Immunocompromised contact Blood

  3. Measles and rubella eradication.

    PubMed

    Hinman, Alan R

    2018-01-02

    This article discusses concepts of eradication, some issues relating to vertical and horizontal public health programs, some current issues relating to measles and rubella, and what we need to do about them. It concludes that measles and rubella/CRS can and should be eradicated. A target date should be established in 2020 (or before). Eradication can only be accomplished in the context of strengthening ongoing immunization services and strengthening surveillance so it can guide activities. Additional resources will be required to achieve the goal. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Maternal and Congenital cytomegalovirus infection and zero rubella IgM prevalence in newborns in St.Paul's Hospital Millennium Medical College.

    PubMed

    Mamuye, Yeshwondm; Nigatu, Balkachew; Bekele, Delayehu; Getahun, Mekonen

    2016-10-21

    Maternal cytomegalovirus (CMV) and Rubella infections result in adverse neonatal outcomes. Both CMV and Rubella are more widespread in developing countries and in communities with lower socioeconomic status. Thus, the aim of this study was to determine IgM specific to CMV and Rubella among newborns and Maternal CMV-seroprevalence and to identify risk factors. Using cross sectional study design a total of 312 (156 newborns and 156 mothers) study participants were recruited by simple random sampling technique from gynecology outpatient department (OPD) and ward, starting from April 1, 2015 to June 30, 2015. Cord and venous blood samples were collected from all participants and structured questionnaire was introduced to gather risk factor related data. ELISA was used to detect CMV and Rubella-IgM. SPSS version 20 was used to analyze the data, and regression analysis was also performed. Out of 156 newborns, 2 [1.3 %; 95 % CI: 0.0-3.8] were positive for CMV-IgM and no single rubella was detected. Association was not computed between risk related variables and cytomegalovirus infected newborns due to the low positivity rate. Multiple independent predictors were found between maternal CMV-IgM and Obstetrical characteristics. Cytomegalovirus-IgM was significantly isolated from mothers with history of transfusion (25.0 %, OR 0.09, 95 % CI 0.0-0.3, P = 0.006), history of abortion (OR 0.02, 95 % CI 0.0-0.6, P = 0.023), HIV sero-status (OR 5.0, 95 % CI 1.5-15.8, P = 0.034), and multi parity (OR 0.08, 95 % CI 0.01-0.7, P = 0.022). Although low congenital CMV and no Rubella are reported among newborns, more effort is needed to screen for congenital infectious viral disease as well as usage of advanced techniques should be taken into consideration.

  5. Evaluation of measles-rubella vaccination for mothers in early puerperal phase.

    PubMed

    Hisano, Michi; Kato, Tatsuo; Inoue, Eisuke; Sago, Haruhiko; Yamaguchi, Koushi

    2016-02-24

    The postpartum period is an ideal opportunity to vaccinate mothers with inadequate immunity to vaccine-preventable diseases including measles and rubella. A prospective study of measles-rubella (MR) vaccination in the early puerperal phase was conducted in 171 mothers, who had insufficient antibody titers when screened for immunity to measles (≤ 1:4 on the neutralization test [NT]) or rubella (≤ 1:16 on the hemagglutination inhibition [HI] test) during pregnancy. To evaluate the efficacy of MR vaccination in the postpartum period, we determined their post-vaccination antibody titers and immune responses to vaccination, and investigated the association between these and their prolactin (PRL) levels and Th1/Th2 ratios at the time of vaccination. We also examined the passage of viral RNA and antigen into breast milk. Of the 169 participants who completed the study schedule, 117 and 101 had low antibody titers against measles and rubella, respectively. In the measles-seronegative group, the antibody-positive rate was 87% on the NT assay, and the NT geometric mean antibody titer was 11.4 (95% confidence interval [CI], 10.0-13.0). In the rubella-seronegative group, the antibody-positive rate was 88% on the HI test assay, and the HI geometric mean antibody titer was 64.0 (95% CI, 53.9-76.0). There was no association between the post-vaccination antibody titers and the PRL levels or Th1/Th2 ratios at the time of vaccination. In the rubella-seronegative group, subjects with higher Th1/Th2 ratios showed higher rates of responsiveness than those with lower ratios (P=0.045). Although measles virus RNA was isolated from the breast milk of two vaccinated mothers, breastfeeding was not associated with clinical disease in any infants. MR vaccination in the early puerperal phase is considered an effective way to prevent the diseases, regardless of the mother's immunological status and hormonal milieu. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Using Seroprevalence and Immunisation Coverage Data to Estimate the Global Burden of Congenital Rubella Syndrome, 1996-2010: A Systematic Review

    PubMed Central

    Vynnycky, Emilia; Adams, Elisabeth J.; Cutts, Felicity T.; Reef, Susan E.; Navar, Ann Marie; Simons, Emily; Yoshida, Lay-Myint; Brown, David W. J.; Jackson, Charlotte; Strebel, Peter M.; Dabbagh, Alya J.

    2016-01-01

    Background The burden of Congenital Rubella Syndrome (CRS) is typically underestimated in routine surveillance. Updated estimates are needed following the recent WHO position paper on rubella and recent GAVI initiatives, funding rubella vaccination in eligible countries. Previous estimates considered the year 1996 and only 78 (developing) countries. Methods We reviewed the literature to identify rubella seroprevalence studies conducted before countries introduced rubella-containing vaccination (RCV). These data and the estimated vaccination coverage in the routine schedule and mass campaigns were incorporated in mathematical models to estimate the CRS incidence in 1996 and 2000–2010 for each country, region and globally. Results The estimated CRS decreased in the three regions (Americas, Europe and Eastern Mediterranean) which had introduced widespread RCV by 2010, reaching <2 per 100,000 live births (the Americas and Europe) and 25 (95% CI 4–61) per 100,000 live births (the Eastern Mediterranean). The estimated incidence in 2010 ranged from 90 (95% CI: 46–195) in the Western Pacific, excluding China, to 116 (95% CI: 56–235) and 121 (95% CI: 31–238) per 100,000 live births in Africa and SE Asia respectively. Highest numbers of cases were predicted in Africa (39,000, 95% CI: 18,000–80,000) and SE Asia (49,000, 95% CI: 11,000–97,000). In 2010, 105,000 (95% CI: 54,000–158,000) CRS cases were estimated globally, compared to 119,000 (95% CI: 72,000–169,000) in 1996. Conclusions Whilst falling dramatically in the Americas, Europe and the Eastern Mediterranean after vaccination, the estimated CRS incidence remains high elsewhere. Well-conducted seroprevalence studies can help to improve the reliability of these estimates and monitor the impact of rubella vaccination. PMID:26962867

  7. Seroconversion rates to combined measles-mumps-rubella-varicella vaccine of children with upper respiratory tract infection.

    PubMed

    Dennehy, P H; Saracen, C L; Peter, G

    1994-10-01

    To determine if upper respiratory tract infection (URI) affects the seroconversion rate or quantitative response to each component of a combined measles-mumps-rubella-varicella vaccine. One hundred forty-nine children between 15 and 18 months of age were prospectively divided into two groups according to the presence of URI or recent history of URI symptoms within the 4 weeks before vaccination. Once stratified, 74 children in the healthy group and 75 children in the URI group were randomly assigned to receive one of three lots of measles-mumps-rubella varicella vaccine by subcutaneous injection into the deltoid area. Serum was obtained from each child just before vaccination and 4 to 6 weeks later for measuring antibody levels against each virus. Prevaccination antibody levels against each virus in the URI and healthy groups did not differ. Nine children had pre-existing antibodies to varicella and six to mumps; no child had positive serologies for measles or rubella before vaccination. Children with pre-existing antibody were excluded from analysis of seroconversion for that virus. Seroconversion to measles, mumps, and rubella occurred in 100% of children in both groups. Mean antibody levels did not differ between the healthy and URI groups for measles (111 vs 122), mumps (97 vs 108), or rubella (96 vs 102). Three (4%) of 70 children with URIs in whom varicella serologies were available failed to seroconvert to varicella vaccine although none of the 69 healthy children had vaccine failure (P = .24). The mean varicella antibody level was 11.3 +/- 1.4 in the healthy children, which did not differ significantly from the level of 9.5 +/- 0.9 in the URI group. Seroconversion to measles, mumps, rubella, and varicella was not significantly affected by the presence of a concurrent or recent URI in 15- to 18-month-old children.

  8. Measles and Rubella Global Strategic Plan 2012-2020 midterm review.

    PubMed

    Orenstein, W A; Hinman, A; Nkowane, B; Olive, J M; Reingold, A

    2018-01-11

    1. Measles eradication is the ultimate goal but it is premature to set a date for its accomplishment. Existing regional elimination goals should be vigorously pursued to enable setting a global target by 2020. 2. The basic strategic approaches articulated in the Global Measles and Rubella Strategic Plan 2012-2020 are valid to achieve the goals but have not been fully implemented (or not appropriately adapted to local situations). 3. The report recommends a shift from primary reliance on supplementary immunization activities (SIAs) to assure two doses of measles-containing vaccine (MCV) are delivered to the target population to primary reliance on ongoing services to assure administration of two doses of MCV. Regular high quality SIAs will still be necessary while ongoing services are being strengthened. 4. The report recommends a shift from primary reliance on coverage to measure progress to incorporating disease incidence as a major indicator. 5. The report recommends that the measles/rubella vaccination program be considered an indicator for the quality of the overall immunization program and that measles/rubella incidence and measles and rubella vaccination coverage be considered as primary indicators of immunization program performance. 6. Polio transition presents both risks and opportunities: risks should be minimized and opportunities maximized. 7. A school entry immunization check could contribute significantly to strengthening overall immunization services with assurance that recommended doses of measles and rubella vaccines as well as other vaccines have been delivered and providing those vaccines at that time if the child is un- or under-vaccinated. 8. Program decisions should increasingly be based on good quality data and appropriate analysis. 9. The incorporation of rubella vaccination into the immunization program needs to be accelerated - it should be accorded equivalent emphasis as measles. 10. Outbreak investigation and response are critical but the most important thing is to prevent outbreaks. Copyright © 2017 World Health Organization. Published by Elsevier Ltd.. All rights reserved.

  9. The Influence of Defect on Development in Children with Congenital Rubella

    ERIC Educational Resources Information Center

    Chess, Stella

    1974-01-01

    Reports findings of an investigation of the development of 54 children at 8 years of age with congenital rubella. Examines the relation between specific patterns of physical disability and cognitive and adaptive behavior. (ED)

  10. Measles, Mumps, Rubella (MMR)

    MedlinePlus

    ... due largely to international travel. According to the Centers for Disease Control and Prevention (CDC) , in 2014, there were 23 ... effects, and who should get vaccinated About Measles Centers for Disease Control and Prevention (CDC) About Rubella (German Measles) Centers ...

  11. Assembly, maturation and three-dimensional helical structure of the teratogenic rubella virus

    PubMed Central

    Mangala Prasad, Vidya

    2017-01-01

    Viral infections during pregnancy are a significant cause of infant morbidity and mortality. Of these, rubella virus infection is a well-substantiated example that leads to miscarriages or severe fetal defects. However, structural information about the rubella virus has been lacking due to the pleomorphic nature of the virions. Here we report a helical structure of rubella virions using cryo-electron tomography. Sub-tomogram averaging of the surface spikes established the relative positions of the viral glycoproteins, which differed from the earlier icosahedral models of the virus. Tomographic analyses of in vitro assembled nucleocapsids and virions provide a template for viral assembly. Comparisons of immature and mature virions show large rearrangements in the glycoproteins that may be essential for forming the infectious virions. These results present the first known example of a helical membrane-enveloped virus, while also providing a structural basis for its assembly and maturation pathway. PMID:28575072

  12. Assembly, maturation and three-dimensional helical structure of the teratogenic rubella virus.

    PubMed

    Mangala Prasad, Vidya; Klose, Thomas; Rossmann, Michael G

    2017-06-01

    Viral infections during pregnancy are a significant cause of infant morbidity and mortality. Of these, rubella virus infection is a well-substantiated example that leads to miscarriages or severe fetal defects. However, structural information about the rubella virus has been lacking due to the pleomorphic nature of the virions. Here we report a helical structure of rubella virions using cryo-electron tomography. Sub-tomogram averaging of the surface spikes established the relative positions of the viral glycoproteins, which differed from the earlier icosahedral models of the virus. Tomographic analyses of in vitro assembled nucleocapsids and virions provide a template for viral assembly. Comparisons of immature and mature virions show large rearrangements in the glycoproteins that may be essential for forming the infectious virions. These results present the first known example of a helical membrane-enveloped virus, while also providing a structural basis for its assembly and maturation pathway.

  13. Vaccine-preventable diseases in pediatric patients: a review of measles, mumps, rubella, and varicella [digest].

    PubMed

    Levine, Deborah A; Pade, Kathryn H

    2016-12-22

    Vaccine-preventable diseases such as measles, mumps, rubella, and varicella continue to plague children and adults worldwide. Although public health programs have helped decrease the prevalence and sequelae of these diseases, outbreaks still occur. To limit the spread of these diseases, emergency clinicians must be able to readily identify the characteristic presentations of the rashes associated with measles, rubella, and varicella, as well as the common presenting features associated with mumps. Diagnostic laboratory studies are not usually necessary, as a complete history and physical examination usually lead to an accurate diagnosis. Treatment for these vaccine-preventable diseases usually consists of supportive care, but, in some cases, severe complications and death may occur. This issue provides a review of the clinical features, differential diagnoses, potential complications, and treatment options for measles, mumps, rubella, and varicella. [Points & Pearls is a digest of Pediatric Emergency Medicine Practice].

  14. Mutual interference on the immune response to yellow fever vaccine and a combined vaccine against measles, mumps and rubella.

    PubMed

    Nascimento Silva, Juliana Romualdo; Camacho, Luiz Antonio B; Siqueira, Marilda M; Freire, Marcos de Silva; Castro, Yvone P; Maia, Maria de Lourdes S; Yamamura, Anna Maya Y; Martins, Reinaldo M; Leal, Maria de Luz F

    2011-08-26

    A randomized trial was conducted to assess the immunogenicity and reactogenicity of yellow fever vaccines (YFV) given either simultaneously in separate injections, or 30 days or more after a combined measles-mumps-rubella (MMR) vaccine. Volunteers were also randomized to YFV produced from 17DD and WHO-17D-213 substrains. The study group comprised 1769 healthy 12-month-old children brought to health care centers in Brasilia for routine vaccination. The reactogenicity was of the type and frequency expected for the vaccines and no severe adverse event was associated to either vaccine. Seroconversion and seropositivity 30 days or more after vaccination against yellow fever was similar across groups defined by YFV substrain. Subjects injected YFV and MMR simultaneously had lower seroconversion rates--90% for rubella, 70% for yellow fever and 61% for mumps--compared with those vaccinated 30 days apart--97% for rubella, 87% for yellow fever and 71% for mumps. Seroconversion rates for measles were higher than 98% in both comparison groups. Geometric mean titers for rubella and for yellow fever were approximately three times higher among those who got the vaccines 30 days apart. For measles and mumps antibodies GMTs were similar across groups. MMR's interference in immune response of YFV and YFV's interference in immune response of rubella and mumps components of MMR had never been reported before but are consistent with previous observations from other live vaccines. These results may affect the recommendations regarding primary vaccination with yellow fever vaccine and MMR. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Screening for Susceptibility to Rubella among On-Campus Female Residents.

    ERIC Educational Resources Information Center

    Gorski, June; And Others

    1979-01-01

    This article reports on the efforts at the University of Tennessee/Knoxville to screen college women for susceptibility to rubella and to educate them to the possibilities of birth defects associated with the disease during pregnancy. (JMF)

  16. Rubella-Caused Deafness: Maintaining Objectivity and a Positive Frame of Reference.

    ERIC Educational Resources Information Center

    Pimentel, Albert T.

    1980-01-01

    Scientific inquiry too often focuses on "what's wrong" and not "what's right" with deaf children, including those with maternal rubella. Failure to succeed should not ignore factors other than etiology, including educational and communicative factors. (Author)

  17. Cellular Immune Mechanisms in Malaria.

    DTIC Science & Technology

    1981-12-31

    with infectious mononucleosis , rubella, and measles (14). Of particular interest was that these antibodies were optimally detected at 150 C. Shortly...Terasaki. 1970. Lymphocytotoxins in Disease 1. Infectious mononucleosis , rubella and measles. Lymphocytotoxins in Disease (ed. by P.I. Terasakl), p

  18. Cellular Immune Mechanisms in Malaria.

    DTIC Science & Technology

    1980-08-31

    The initial studies in this area demonstrated the presence of lymphocytotoxins in patients with infectious mononucleosis , rubella, and measles (14...and P.I. Terasaki. 1970. Lymphocytotoxins in Disease I. Infectious mononucleosis , rubella and measles. Lymphocytotoxins in Disease (ed. by P.I

  19. Cellular Immune Mechanisms in Malaria.

    DTIC Science & Technology

    1979-08-31

    this area demonstrated the presence of anti-lymphocytotoxins in patients with infectious mononucleosis , rubella, and measles (14). i ii |......tm,,l...Blood 32:402. 14. Mottironi, V.D. and P.I. Terasaki. 1970. Lymphocytotoxins in Disease I. Infectious mononucleosis , rubella and measles

  20. National Imperative to Establish a Domestic Medical Intelligence Center

    DTIC Science & Technology

    2007-09-01

    in children ɝ years • Syphilis • Syphilis , congenital • Tetanus • Toxic-shock syndrome (other than Streptococcal) • Trichinellosis...Rabies • Rocky Mountain spotted fever • Rubella • Rubella, congenital syndrome • Salmonellosis • Severe Acute Respiratory Syndrome

  1. The First Ten Months of the Rubella Living-Unit

    ERIC Educational Resources Information Center

    Dolan, William S.

    1972-01-01

    The first 10 months of a residential school's educational program for preschool rubella children are described, followed by the case studies of the original six children in the program who are all multiply handicapped (deaf blind and mentally handicapped). (CB)

  2. Clinical evaluation of a new measles-mumps-rubella combined live virus vaccine in the Dominican Republic*

    PubMed Central

    Ehrenkranz, N. Joel; Ventura, Arnoldo K.; Medler, Edward M.; Jackson, Joseph E.; Kenny, Michael T.

    1975-01-01

    Over 900 children were enrolled in a double-blind placebo-controlled clinical study of measles (Schwarz strain), mumps (Jeryl Lynn strain), and rubella (Cendehill strain) trivalent vaccine. The trivalent vaccine caused about the same degree of reactivity as is generally associated with the Schwarz strain measles vaccine. Paired sera from triplesusceptible vaccinees had seroconversion rates of 99% for measles, 94% for mumps, and 93% for rubella. The results of this study show that this trivalent vaccine is as well tolerated and as effective as its component vaccines. PMID:764997

  3. Persistence of rubella and mumps antibodies, following changes in the recommended age for the second dose of MMR vaccine in Portugal.

    PubMed

    Gonçalves, G; Frade, J; Nascimento, M S J; Mesquita, J R; Nunes, C

    2016-11-01

    In Portugal, the recommended age for the second dose of MMR (MMR2) was changed from 10-13 years to 5-6 years for those born in 1994 and afterwards. This study aimed to assess if MMR schedule and time elapsed from the last dose are associated with the concentration of rubella and mumps IgG antibodies. Three Portuguese birth cohorts (convenience samples) were selected for this study (66, 59 and 41 participants born respectively in 1990-1993, 1994-1995 and 2001-2003). Geometric mean concentrations (GMC) for mumps IgG were respectively 36, 30 and 38 RU/ml (P = 0·236) and for rubella IgG were 18, 20 and 17 IU/ml (P = 0·641). For both specific antibodies, no differences were observed with time since MMR2. Receiving MMR2 at 5-6 or 10-13 years was not associated with concentration of both antibodies. The GMC of rubella IgG was lower in males (P = 0·029). Taking into account previous evidence and the logistics needed to change vaccination schedules, it seems reasonable that sustaining very high coverage with two doses of MMR is currently the most pragmatic way to control mumps and rubella rather than any changes to the schedule.

  4. [Serological survey of measles, rubella and mumps immunity among pediatric and resident physicians, Valencia, Spain].

    PubMed

    Andani Cervera, Joaquín; Castañeda Gordillo, Patricia; Fuente Goig, M Teresa; Giménez Martí, M José; Alcaraz Soriano, M Jesús; Gómez Pajares, Fernando; Diez Domingo, Javier; Boitos, Cristina

    2014-10-01

    Health workers are exposed to vaccine-preventable diseases. Therefore, vaccination programs are essential for preventing sanitary environment-acquired infections and avoiding additional damage to patients. The objectives were to estimate the prevalence of antibodies against measles, rubella and mumps among physicians of the Clinical Area of Children Diseases of the La Fe University Hospital (Valencia) and to study its relationship with history of disease, vaccination and professional status. Observational, cross-sectional and analytical study. All subjects underwent a serological test for detection of specific antibodies against measles, rubella and mumps. Some of them also completed a questionnaire about the history of disease and vaccination. A descriptive and relation analysis was performed to each disease. 97 physicians participated in the study. 75 participants (77,3%) had positive serology to measles, 85 (87,6%) to rubella and 68 (70,1%) to mumps. The logistic regression model showed a significant effect of age (OR 1,22) in the prevalence of antibodies against measles and a significant effect of sex (OR 5,16) in the prevalence of antibodies against rubella. Given the high prevalence of seronegative young physicians and taking into account their professional activity, vaccination in this group would be recommended. Therefore it would be desirable to design strategies to achieve the accession of physicians to the vaccination program.

  5. Assessing the Effectiveness and Cost-Benefit of Test-and-Vaccinate Policy for Supplementary Vaccination against Rubella with Limited Doses

    PubMed Central

    Saito, Masaya M.; Kinoshita, Ryo

    2018-01-01

    Elevating herd immunity level against rubella is essential to prevent congenital rubella syndrome (CRS). Insufficient vaccination coverage left susceptible pockets among adults in Japan, and the outbreak of rubella from 2012 to 2013 resulted in 45 observed CRS cases. Given a limited stock of rubella-containing vaccine (RCV) available, the Japanese government recommended healthcare providers to prioritize vaccination to those confirmed with low level of immunity, or to those likely to transmit to pregnant women. Although a test-and-vaccinate policy could potentially help reduce the use of the limited stockpile of vaccines, by selectively elevating herd immunity, the cost of serological testing is generally high and comparable to the vaccine itself. Here, we aimed to examine whether random vaccination would be more cost-beneficial than the test-and-vaccinate strategy. A mathematical model was employed to evaluate the vaccination policy implemented in 2012–2013, quantifying the benefit-to-cost ratio to achieve herd immunity. The modelling exercise demonstrated that, while the test-and-vaccinate strategy can efficiently achieve herd immunity when stockpiles of RCV are limited, random vaccination would be a more cost-beneficial strategy. As long as the herd immunity acts as the goal of vaccination, our findings apply to future supplementary immunization strategy. PMID:29565821

  6. Molecular analysis of rubella virus in travelers suspected of measles infection in São Paulo, Brazil.

    PubMed

    Figueiredo, Cristina A; Yu, Ana Lucia Frugis; Afonso, Ana Maria S; Curti, Suely P; Oliveira, Maria I

    2012-01-01

    To identify measles virus genotypes in three cases of travelers suspected of measles infection. Samples (blood and urine) were collected for serology, virus isolation, and genotyping. Sera were analyzed for IgM antibodies against measles virus and rubella virus by enzyme-linked immunosorbent assay (ELISA) (Siemens - Marburg, Germany). Clinical samples (lymphocytes and urine) were inoculated into Statens Serum Institute rabbit corneal epithelial cell line- ATCC CL 60 (SIRC) and Vero Slam cells. RNA was extracted from clinical samples and cell culture was inoculated and processed by polymerase chain reaction (PCR) with oligonucleotides specific for measles virus (MV) and rubella virus (RV). All patients showed IgM negative serology for MV and positive IgM for RV. RV belonging to genotypes 1B, 1C, and 1E were isolated from patients who came from Finland, Peru, and Germany, respectively. Genotype 1B has been found in Europe and on the East Coast of South America; 1C has been found in Peru and the West Coast of South America, and 1E, first identified in 1997, now appears to have worldwide distribution. Information about RV and MV genotypes circulating in São Paulo is essential for the control of measles, rubella, and congenital rubella syndrome (CRS) in Brazil.

  7. Rubella metapopulation dynamics and importance of spatial coupling to the risk of congenital rubella syndrome in Peru

    PubMed Central

    Metcalf, C. J. E.; Munayco, C. V.; Chowell, G.; Grenfell, B. T.; Bjørnstad, O. N.

    2011-01-01

    Rubella is generally a mild childhood disease, but infection during early pregnancy may cause spontaneous abortion or congenital rubella syndrome (CRS), which may entail a variety of birth defects. Consequently, understanding the age-structured dynamics of this infection has considerable public health value. Vaccination short of the threshold for local elimination of transmission will increase the average age of infection. Accordingly, the classic concern for this infection is the potential for vaccination to increase incidence in individuals of childbearing age. A neglected aspect of rubella dynamics is how age incidence patterns may be moulded by the spatial dynamics inherent to epidemic metapopulations. Here, we use a uniquely detailed dataset from Peru to explore the implications of this for the burden of CRS. Our results show that the risk of CRS may be particularly severe in small remote regions, a prediction at odds with expectations in the endemic situation, and with implications for the outcome of vaccination. This outcome results directly from the metapopulation context: specifically, extinction–re-colonization dynamics are crucial because they allow for significant leakage of susceptible individuals into the older age classes during inter-epidemic periods with the potential to increase CRS risk by as much as fivefold. PMID:20659931

  8. [Seroprevalence of antibodies to measles, rubella, mumps, hepatitis B viruses and all three poliovirus serotypes among children in Quindío, Colombia].

    PubMed

    González, María M; Sarmiento, Luis; Giraldo, Alejandra M; Padilla, Leonardo; Rey-Benito, Gloria; Castaño, Jhon C

    2016-02-01

    Objective The main goal of this research was to assess the seroprevalence of antibodies against measles, rubella, mumps, hepatitis B and all three poliovirus serotypes among children in the Quindío Department, Colombia. Methods Blood samples were obtained from 170 healthy children aged 5-9 years from nine municipalities in Quindío. The presence of serum IgG antibodies against measles, rubella, mumps and Hepatitis B were determined using commercial indirect ELISA kits. Immunity to poliomyelitis was assessed through the presence of neutralizing antibodies following the method recommended by the World Health Organization. Results Among the 170 children enrolled, 169 (99.41%), 170 (100 %), and 167 (98.2 %) were seropositive to poliovirus 1, poliovirus 2, and poliovirus 3, respectively. The average reciprocal antibody titers were 178 for poliovirus type 1, 120 for type 2 and 56 for type 3. Of the 170 children, 96.47 % were protected against mumps and rubella, and 86.47 % against measles. Only 106 (62.35 %) of the studied subjects were proved to be seropositive to hepatitis B. Conclusion The immunization program in Quindío has provided seroprotection against all three poliomyelitis serotypes, rubella and mumps. However, the child population is not fully protected against measles and hepatitis B virus infections.

  9. Childhood Diseases - What Parents Need to Know

    MedlinePlus

    ... is covered in the vaccine. Similarly, the MMR vaccine protects against measles, mumps, and rubella, viral infections that cause serious symptoms. Measles and mumps often can lead to chronic conditions, such as deafness, brain damage, and reproductive problems. Rubella is also known as ...

  10. Deafness and Rubella: A Challenge and a Charge to Rehabilitation.

    ERIC Educational Resources Information Center

    Mills, Craig

    1980-01-01

    Summarizing salient information from the preceding papers (EC 132 316-326), the author cites nine major issues and recommendations, including the fact that considerable underutilized legislation should be brought to bear on the needs of children and adults with rubella. (Author)

  11. Neurologic Damage and Behavior Disorder in Rubella Children.

    ERIC Educational Resources Information Center

    Chess, Stella; Fernandez, Paulina

    1980-01-01

    A longitudinal study of 214 rubella deaf children (13 to 14 years old) revealed a low incidence (10%) of neurologica damage among those with normal intelligence, but a high incidence (51% to 70%) among those who were mentally retarded or blind. (Author)

  12. Measles & rubella outbreaks in Maharashtra State, India.

    PubMed

    Vaidya, Sunil R; Kamble, Madhukar B; Chowdhury, Deepika T; Kumbhar, Neelakshi S

    2016-02-01

    Under the outbreak-based measles surveillance in Maharashtra State the National Institute of Virology at Pune receives 3-5 serum samples from each outbreak and samples from the local hospitals in Pune for laboratory diagnosis. This report describes one year data on the measles and rubella serology, virus isolation and genotyping. Maharashtra State Health Agencies investigated 98 suspected outbreaks between January-December 2013 in the 20 districts. Altogether, 491 serum samples were received from 20 districts and 126 suspected cases from local hospitals. Samples were tested for the measles and rubella IgM antibodies by commercial enzyme immunoassay (EIA). To understand the diagnostic utility, a subset of serum samples (n=53) was tested by measles focus reduction neutralization test (FRNT). Further, 37 throat swabs and 32 urine specimens were tested by measles reverse transcription (RT)-PCR and positive products were sequenced. Virus isolation was performed in Vero hSLAM cells. Of the 98 suspected measles outbreaks, 61 were confirmed as measles, 12 as rubella and 21 confirmed as the mixed outbreaks. Four outbreaks remained unconfirmed. Of the 126 cases from the local hospitals, 91 were confirmed for measles and three for rubella. Overall, 93.6 per cent (383/409) confirmed measles cases were in the age group of 0-15 yr. Measles virus was detected in 18 of 38 specimens obtained from the suspected cases. Sequencing of PCR products revealed circulation of D4 (n=9) and D8 (n=9) strains. Four measles viruses (three D4 & one D8) were isolated. Altogether, 94 measles and rubella outbreaks were confirmed in 2013 in the State of Maharasthra indicating the necessity to increase measles vaccine coverage in the State.

  13. Seroprevalence of Measles, Mumps, and Rubella Antibodies in College Students in Mumbai, India.

    PubMed

    Gohil, Devanshi J; Kothari, Sweta T; Chaudhari, Amol B; Gunale, Bhagwat K; Kulkarni, Prasad S; Deshmukh, Ranjana A; Chowdhary, Abhay S

    2016-04-01

    Measles, Mumps, and Rubella (MMR) are vaccine preventable viral infections, which cause significant mortality and morbidity globally. Increased incidence rates of these infectious diseases are observed in young adults. Information on seroprevalence data on MMR in India is limited. The objective of this study was to determine the prevalence of IgG antibodies against MMR among young adults. This was a descriptive cross-sectional study involving 192 healthy college students from Maharshi Dayanand College, Mumbai. The project was approved by the Institutional Ethics Committee of Haffkine Institute. Between December 2012 and September 2013, blood samples were collected from individuals of age 18-23 years after obtaining written informed consent from them. The quantitative determination of IgG antibodies in serum specimens against MMR was determined using enzyme linked immunosorbent assay. Data on history of vaccination were also collected from participants. Among 192 healthy college students (age 18-23 years), MMR seroprevalence was 91%, 97%, and 88%, respectively. The overall seropositivity of MMR was 79%. The highest level of seronegativity was seen with regards to rubella-specific antibodies in 12% of cases. About 96% of the participants did not know about their vaccination history while none of the participants knew about their history of MMR infections. Despite unknown vaccination status, a majority of college students in our study were found seropositive for all three infections, which indicate natural boosting. However, the proportion of seronegativity for measles and rubella was relatively higher. Especially since the study population belonged to reproductive age group, there is a concern of congenital rubella syndrome in the offspring. Although a larger multicentric study is required to confirm the findings, the results indicate that a dose of measles-rubella (MR) vaccine should be offered to these college students.

  14. Measles & rubella outbreaks in Maharashtra State, India

    PubMed Central

    Vaidya, Sunil R.; Kamble, Madhukar B.; Chowdhury, Deepika T.; Kumbhar, Neelakshi S.

    2016-01-01

    Background & objectives: Under the outbreak-based measles surveillance in Maharashtra State the National Institute of Virology at Pune receives 3-5 serum samples from each outbreak and samples from the local hospitals in Pune for laboratory diagnosis. This report describes one year data on the measles and rubella serology, virus isolation and genotyping. Methods: Maharashtra State Health Agencies investigated 98 suspected outbreaks between January-December 2013 in the 20 districts. Altogether, 491 serum samples were received from 20 districts and 126 suspected cases from local hospitals. Samples were tested for the measles and rubella IgM antibodies by commercial enzyme immunoassay (EIA). To understand the diagnostic utility, a subset of serum samples (n=53) was tested by measles focus reduction neutralization test (FRNT). Further, 37 throat swabs and 32 urine specimens were tested by measles reverse transcription (RT)-PCR and positive products were sequenced. Virus isolation was performed in Vero hSLAM cells. Results: Of the 98 suspected measles outbreaks, 61 were confirmed as measles, 12 as rubella and 21 confirmed as the mixed outbreaks. Four outbreaks remained unconfirmed. Of the 126 cases from the local hospitals, 91 were confirmed for measles and three for rubella. Overall, 93.6 per cent (383/409) confirmed measles cases were in the age group of 0-15 yr. Measles virus was detected in 18 of 38 specimens obtained from the suspected cases. Sequencing of PCR products revealed circulation of D4 (n=9) and D8 (n=9) strains. Four measles viruses (three D4 & one D8) were isolated. Interpretation & conclusions: Altogether, 94 measles and rubella outbreaks were confirmed in 2013 in the State of Maharasthra indicating the necessity to increase measles vaccine coverage in the State. PMID:27121521

  15. Measles, mumps, and rubella antibody status and response to immunization in children after therapy for acute lymphoblastic leukemia.

    PubMed

    Aytac, Selin; Yalcin, S Songul; Cetin, Mualla; Yetgin, Sevgi; Gumruk, Fatma; Tuncer, Murat; Yurdakok, Kadriye; Gurgey, Aytemiz

    2010-08-01

    Seventy-seven patients with acute lymphoblastic leukemia (ALL) who were in complete remission and whose therapies had been stopped for at least 6 months before enrollment in this study were retrospectively analyzed regarding their antibody status for measles, mumps, and rubella, with the aim to demonstrate the seropositivity rate after treatment in the authors' group. Each patient's serum samples were analyzed by enzyme-linked immunosorbent assay (ELISA) method to determine the antibody titers before and after immunization. Measles serology was available in 77 children; 45 (58%) were seronegative. Initial ages of measle-seronegative patients were statistically lower than those of seropositive cases (median 3.29 versus 4.91 years, respectively). Mumps serology was available in 76 children; 36 (47%) were seronegative. Mumps-seropositive cases tended to have more frequent previous history of infection than seronegative cases (55.0% versus 28.6%, respectively, P = .05). Rubella serology was available in 76 children, and 20 (26.3%) were seronegative. It was determined that initial ages of rubella-seronegative patients were statistically lower than those of seropositive cases (median 3.03 versus 4.32 years, respectively). The authors concluded based on the results of their study that at a median of 3.31 years after completion of chemotherapy for ALL, the majority of cases had antibody levels lower than protective values for measles (58.4%); however, these values were 47.3% for mumps and 26.3% for rubella. Seroconversion rates after measles (55%) and mumps vaccination (57.1%) were still low. However, in the available cases, relatively adequate response to rubella vaccination (92.3%) was observed.

  16. Childhood febrile illness and the risk of myopia in UK Biobank participants.

    PubMed

    Guggenheim, J A; Williams, C

    2016-04-01

    Historical reports suggest febrile illness during childhood is a risk factor for myopia. The establishment of the UK Biobank provided a unique opportunity to investigate this relationship. We studied a sample of UK Biobank participants of White ethnicity aged 40-69 years old who underwent autorefraction (N=91 592) and were classified as myopic (≤-0.75 Dioptres (D)), highly myopic (≤-6.00 D), or non-myopic (>-0.75 D). Self-reported age at diagnosis of past medical conditions was ascertained during an interview with a nurse at a Biobank assessment centre. Logistic regression analysis was used to calculate the odds ratio (OR) for myopia or high myopia associated with a diagnosis before age 17 years of each of nine febrile illnesses, after adjusting for potential confounders (age, sex, highest educational qualification, and birth order). Rubella, mumps, and pertussis were associated with myopia: rubella, OR=1.38, 95% CI: 1.03-1.85, P=0.030; mumps, OR=1.32, 95% CI: 1.07-1.64, P=0.010; and pertussis, OR=1.39, 95% CI 1.03-1.87, P=0.029. Measles, rubella, and pertussis were associated with high myopia: measles, OR=1.48, 95% CI: 1.07-2.07, P=0.019; rubella, OR=1.94, 95% CI: 1.12-3.35, P=0.017; and pertussis, OR=2.15, 95% CI: 1.24-3.71, P=0.006. The evidence did not support an interaction between education and febrile illness in explaining the above risks. A history of childhood measles, rubella, or pertussis was associated with high myopia, whereas a history of childhood rubella, mumps, or pertussis was associated with any myopia. The reasons for these associations are unclear.

  17. Global Distribution of Rubella Virus Genotypes

    PubMed Central

    Zheng, Du-Ping; Icenogle, Joseph; Katow, Shigetaka; Abernathy, Emily S.; Song, Ki-Joon; Xu, Wen-Bo; Yarulin, Vitaly; Desjatskova, R.G.; Aboudy, Yair; Enders, Gisela; Croxson, Margaret

    2003-01-01

    Phylogenetic analysis of a collection of 103 E1 gene sequences from rubella viruses isolated from 17 countries from 1961 to 2000 confirmed the existence of at least two genotypes. Rubella genotype I (RGI) isolates, predominant in Europe, Japan, and the Western Hemisphere, segregated into discrete subgenotypes; intercontinental subgenotypes present in the 1960s and 1970s were replaced by geographically restricted subgenotypes after ~1980. Recently, active subgenotypes include one in the United States and Latin America, one in China, and a third that apparently originated in Asia and spread to Europe and North America, starting in 1997, indicating the recent emergence of an intercontinental subgenotype. A virus that potentially arose as a recombinant between two RGI subgenotypes was discovered. Rubella genotype II (RGII) showed greater genetic diversity than did RGI and may actually consist of multiple genotypes. RGII viruses were limited to Asia and Europe; RGI viruses were also present in most of the countries where RGII viruses were isolated. PMID:14720390

  18. [Molecular and biologic characteristics of attenuated rubella viruses].

    PubMed

    Lavrent'eva, I N

    2008-01-01

    To study stability/variability of rubella virus vaccine strain "Orlov-B" during its adaptation to other tissue substrate. Vaccine strains of rubella virus Wistar 27/3 and "Orlov-B" as well as wild type strains "Orlov-D" and "Lebedev" were used. Rhesus monkeys were used as laboratory animals. Standard virological, molecular and statistical methods were applied. Obtained as a result of adaptation to other tissue substrate - diploid human cell line M-22 - strain "Orlov-D" demonstrated stability on RCT40 sign in in vitro experiments. Comparative genotyping of "Orlov-B" and "Orlov-D" strains on gene E1 showed identity of nucleotide sequences of both variants. Genetic stability of virus on the gene coding the most immunogenic protein E1 was confirmed in vivo: the stable high immunogenic and protective activity of both "Orlov-B" and "Orlov- D" strains was demonstrated in experiments on rhesus macaques. New data on stability of attenuated rubella virus vaccine strains have practical significance for the development of new vaccines.

  19. Seroprevalence of antibodies to measles, mumps, and rubella among Thai population: evaluation of measles/MMR immunization programme.

    PubMed

    Tharmaphornpilas, Piyanit; Yoocharean, Pornsak; Rasdjarmrearnsook, Aim-Orn; Theamboonlers, Apiradee; Poovorawan, Yong

    2009-02-01

    Stored serum specimens, from four regions of Thailand, of healthy children attending well baby clinics and of healthy people with acute illnesses visiting outpatient clinics were randomly sampled and tested for IgG antibody to measles, mumps, and rubella (MMR). The immunity patterns of rubella and mumps fitted well with the history of rubella and MMR vaccination, seroprotective rates being over 85% among those aged over seven years. A high proportion of younger children acquired the infection before the age of vaccination. MMR vaccination should preferably be given to children at an earlier age. For measles, 73% seroprotective rates among children, aged 8-14 years, who should have received two doses of measles/MMR vaccine, were lower than expected. This finding was consistent with the age-group reported in outbreaks of measles in Thailand. The apparent ineffectiveness (in relation to measles) of MMR immunization of 1st grade students warrants further studies.

  20. Divergent sorting of a balanced ancestral polymorphism underlies the establishment of gene-flow barriers in Capsella

    PubMed Central

    Sicard, Adrien; Kappel, Christian; Josephs, Emily B.; Lee, Young Wha; Marona, Cindy; Stinchcombe, John R.; Wright, Stephen I.; Lenhard, Michael

    2015-01-01

    In the Bateson–Dobzhansky–Muller model of genetic incompatibilities post-zygotic gene-flow barriers arise by fixation of novel alleles at interacting loci in separated populations. Many such incompatibilities are polymorphic in plants, implying an important role for genetic drift or balancing selection in their origin and evolution. Here we show that NPR1 and RPP5 loci cause a genetic incompatibility between the incipient species Capsella grandiflora and C. rubella, and the more distantly related C. rubella and C. orientalis. The incompatible RPP5 allele results from a mutation in C. rubella, while the incompatible NPR1 allele is frequent in the ancestral C. grandiflora. Compatible and incompatible NPR1 haplotypes are maintained by balancing selection in C. grandiflora, and were divergently sorted into the derived C. rubella and C. orientalis. Thus, by maintaining differentiated alleles at high frequencies, balancing selection on ancestral polymorphisms can facilitate establishing gene-flow barriers between derived populations through lineage sorting of the alternative alleles. PMID:26268845

  1. Nanoporous Membrane Immunosensor

    DTIC Science & Technology

    2000-01-01

    but not intended to be limited to blood, saliva, ocular lens fluid, cerebral spinal fluid, sweat, urine, milk, ascites fluid, mucous, synovial fluid...such as rubella-IgG and rubella-IgM; antibodies to toxoplasmosis , such as toxoplasmosis IgG(Toxo-IgG) and toxoplasmosis IgM (Toxo-IgM); testosterone

  2. FUNDUS AUTOFLUORESCENCE IN RUBELLA RETINOPATHY: Correlation With Photoreceptor Structure and Function.

    PubMed

    Bukowska, Danuta M; Wan, Sue Ling; Chew, Avenell L; Chelva, Enid; Tang, Ivy; Mackey, David A; Chen, Fred K

    2017-01-01

    To illustrate altered fundus autofluorescence in rubella retinopathy and to investigate their relationships with photoreceptor structure and function using multimodal imaging. The authors report four cases of rubella retinopathy aged 8, 33, 42, and 50 years. All patients had dilated clinical fundus examination; wide-field color photography; blue, green, and near-infrared autofluorescence imaging and spectral domain optical coherence tomography. Two patients also underwent microperimetry and adaptive optics imaging. En face optical coherence tomography, cone mosaic, and microperimetry were coregistered with autofluorescence images. The authors explored the structure-function correlation. All four patients had a "salt-and-pepper" appearance on dilated fundus examination and wide-field color photography. There were variable-sized patches of hypoautofluorescence on both blue and near-infrared excitation in all four patients. Wave-guiding cones were visible and retinal sensitivity was intact over these regions. There was no correlation between hypoautofluorescence and regions of attenuated ellipsoid and interdigitation zones. Hyperautofluorescent lesions were also noted and some of these were pseudo-vitelliform lesions. Patchy hypoautofluorescence on near-infrared excitation can be a feature of rubella retinopathy. This may be due to abnormal melanin production or loss of melanin within retinal pigment epithelium cells harboring persistent rubella virus infection. Preservation of the ellipsoid zone, wave-guiding cones, and retinal sensitivity within hypoautofluorescent lesions suggest that these retinal pigment epithelium changes have only mild impact on photoreceptor cell function.

  3. Systematic Review of Measles and Rubella Serology Studies.

    PubMed

    Thompson, Kimberly M; Odahowski, Cassie L

    2016-07-01

    Serological tests provide information about individual immunity from historical infection or immunization. Cross-sectional serological studies provide data about the age- and sex-specific immunity levels for individuals in the studied population, and these data can provide a point of comparison for the results of transmission models. In the context of developing an integrated model for measles and rubella transmission, we reviewed the existing measles and rubella literature to identify the results of national serological studies that provided cross-sectional estimates of population immunity at the time of data collection. We systematically searched PubMed, the Science Citation Index, and references we identified from relevant articles published in English. We extracted serological data for comparison to transmission model outputs. For rubella, serological studies of women of child-bearing age provide information about the potential risks of infants born with congenital rubella syndrome. Serological studies also document the loss of maternal antibodies, which occurs at different rates for the different viruses and according to the nature of the induced immunity (i.e., infection or vaccine). The serological evidence remains limited for some areas, with studies from developed countries representing a disproportionate part of the evidence. The collection and review of serological evidence can help program managers identify immunity gaps in the population, which may help them better understand the characteristics of individuals within their populations who may participate in transmission and manage risks. © 2015 Society for Risk Analysis.

  4. Seroprevalence of mumps, varicella and rubella antibodies in children 1-16 years of age in eastern Turkey.

    PubMed

    Gürgöze, Metin Kaya; Yilmaz, Erdal; Gödekmerdan, Ahmet; Akça, Zehra; Doğan, Yaşar; Akarsu, Saadet; Aygün, A Denizmen

    2006-01-01

    In this study, seroprevalence of mumps, varicella and rubella was investigated in 803 unvaccinated children in eastern Turkey whose ages ranged between 1 and 16 years. Mumps IgG, varicella IgG and rubella IgG antibody levels in all children were studied by enzyme-linked immunosorbent assay (ELISA) method. Information regarding socioeconomic characteristics, number of siblings and disease history was gathered for each participant. No significant difference in seropositivity was detected between girls and boys. Seroprevalence of mumps increased with age, with a seropositivity rate of 29.9% in children aged 1-4 years and of 88.8% in those aged 13-16 years. Seroprevalence of varicella increased with age, with a seropositivity rate of 26.8% in children aged 1-4 years and of 90.3% in those aged 13-16 years. Seroprevalence of rubella also increased with age, with a seropositivity rate of 47.3% in the children aged 1-4 years and of 89.2% in those aged 13-16 years. There was a statistically significant increase in the rate of seropositivity with advancing age through the group of 13-16 years old (p < 0.05). In conclusion, in order to avoid mumps, varicella and rubella diseases and their possible complications, children should be vaccinated against these three diseases before the age of two, since seroprevalence increases with age.

  5. Phylogenetic analysis of rubella viruses in Vietnam during 2009-2010.

    PubMed

    Tran, Dinh Nguyen; Pham, Ngan Thi Kim; Tran, Thi Thuy Trinh; Khamrin, Pattara; Thongprachum, Aksara; Komase, Katsuhiro; Hayakawa, Satoshi; Mizuguchi, Masashi; Ushijima, Hiroshi

    2012-04-01

    Rubella virus (RV) usually causes a mild disease. However, infection during the first trimester of pregnancy often leads to severe birth defects known as congenital rubella syndrome (CRS). Although wild-type RVs exist and circulate worldwide, their genotypes remain unknown in many countries. The aim of this study was to identify the molecular characteristics of RVs found in Vietnam during the years 2009-2010 and to provide the first data concerning RV genotypes in this country. Throat swab samples were collected between 2009 and 2010 from four CRS cases and nine rubella infection cases visiting one Children's Hospital and one outpatient clinic in Ho Chi Minh City. The 739-nucleotide coding region of the RV E1 gene recommended by the World Health Organization was amplified by reverse transcriptase PCR, and the resulting DNA fragments were then sequenced. Sequences were assigned to genotypes by phylogenetic analysis with RV reference strains. RV RNA was detected in 11 clinical specimens. Phylogenetic analysis of the sequences showed that all 11 strains belonged to 2B genotype. Several variations in amino acids were found, among which five changes were involved in the B and T cell epitopes. These data indicate that viruses of genotype 2B were circulating in Vietnam. The increasing information about RV genotype in Vietnam should aid in the control of rubella infection and CRS in this country. Copyright © 2012 Wiley Periodicals, Inc.

  6. Measles, mumps, rubella and VZV: importance of serological testing of vaccine-preventable diseases in young adults living with HIV in Germany.

    PubMed

    Schwarze-Zander, C; Draenert, R; Lehmann, C; Stecher, M; Boesecke, C; Sammet, S; Wasmuth, J C; Seybold, U; Gillor, D; Wieland, U; Kümmerle, T; Strassburg, C P; Mankertz, A; Eis-Hübinger, A M; Jäger, G; Fätkenheuer, G; Bogner, J R; Rockstroh, J K; Vehreschild, J J

    2017-01-01

    Measles, mumps, rubella (MMR) and varicella zoster virus (VZV) infection can cause serious diseases and complications in the HIV-positive population. Due to successful vaccination programmes measles, mumps and congenital rubella syndrome has become neglected in Germany. However, recent outbreaks of measles have occurred from import-associated cases. In this cross-sectional study the serostatus for MMR and VZV in 2013 HIV-positive adults from three different university outpatient clinics in Bonn (n = 544), Cologne (n = 995) and Munich (n = 474) was analysed. Sera were tested for MMR- and VZV-specific immunglobulin G antibodies using commercial immunoassays. Seronegativity was found in 3% for measles, 26% for mumps, 11% for rubella and 2% for VZV. Regarding MMR, 35% of patients lacked seropositivity against at least one infectious agent. In multivariable analysis younger age was strongly associated with seronegativity against all four viruses, measles, mumps, rubella (P < 0·001, P < 0·001 and P = 0·001, respectively) and VZV (P = 0·001). In conclusion, there is high need for MMR and VZV vaccination in people living with HIV in Germany born in 1970 or later. Thus, systematic MMR and VZV antibody screening and vaccination should be implemented in the HIV-positive population to prevent serious disease and complications of vaccine-preventable diseases.

  7. Medical Surveillance Monthly Report (MSMR). Volume 6, Number 8, September/October 2000

    DTIC Science & Technology

    2000-10-01

    Rocky mountain spotted fever - - - - Ehrlichiosis - - 2 1 Rubella 1 - - - Encephalitis 1 - 1 - Salmonellosis 38 27 52 76 Filariasis...valley fever - - - - E. coli O157:H7 1 9 9 11 Rocky mountain spotted fever - 3 - - Ehrlichiosis - 1 1 2 Rubella 1 4 - 1 Encephalitis - - 1 1

  8. Medical Surveillance Monthly Report (MSMR). Volume 6, Number 1, January 2000

    DTIC Science & Technology

    2000-01-01

    Rocky mountain spotted fever - 2 2 - Ehrlichiosis - 1 1 - Rubella 3 - - - Encephalitis - - - - Salmonellosis 24 51 63 27 Filariasis - 1...1 1 - - Diphtheria - - - - Rift valley fever - - - - E. Coli 0157:H7 2 1 2 10 Rocky mountain spotted fever - 5 - 4 Ehrlichiosis 2 - 1 1 Rubella - - 1

  9. Mainstreaming and Postsecondary Educational and Employment Status of a Rubella Cohort.

    ERIC Educational Resources Information Center

    Kasen, Stephanie; And Others

    1990-01-01

    The postsecondary education and work status of 46 rubella deaf young adults was described and evaluated as an outcome of ethnicity, socioeconomic status, preschool attendance, early parent involvement, and degree of prior mainstreaming. Prior mainstreaming was a determinant of postsecondary education attendance over and above the effects of…

  10. Potentials of Rubella Deaf-Blind Children.

    ERIC Educational Resources Information Center

    Smith, Benjamin F.

    Potentials of three classifications of rubella deaf blind children are discussed. Potentials for children at the middle trainable level and below are discussed for the areas of communication skills, daily living skills, mobility and orientation, vocational effort, and self-control and social interaction. For children in the upper trainable through…

  11. Postsecondary Programs for Deaf Students at the Peak of the Rubella Bulge.

    ERIC Educational Resources Information Center

    DeCaro, James J.; And Others

    1987-01-01

    The paper describes the status, as of 1985, of postsecondary education for the deaf in the United States. Noted are the appearance of 37 new programs for deaf students reflecting the increased number of deaf college age students stemming from the rubella epidemic of 1963-65. (DB)

  12. Stereotyped Behaviors in Blind Children: Relationships to Motility Behaviors of Autism.

    ERIC Educational Resources Information Center

    Iverson, Landa J.

    Three groups of visually impaired children--10 with rubella, 7 with retrolental fibroplasia (RLF), and 9 with blindness other than rubella or RLF--were observed for stereotypic behaviors. Ss were observed in four different environmental settings: classroom/instruction; mealtime activity/breakfast, lunch, or supper; physical education/movement…

  13. The Demographics of Deafness Resulting from Maternal Rubella.

    ERIC Educational Resources Information Center

    Trybus, Raymond J.; And Others

    1980-01-01

    The paper reviews data on the size and major characteristics of the population of rubella deafened children, with emphasis on those born during 1963-65. The focus is on the impact that this large group of deaf youngsters will have on postsecondary educational institutions and rehabilitation agencies during the decade of the 1980s. (Author)

  14. [Seroprevalence of measles, rubella, mumps and varicella in health workers in the Community of Madrid].

    PubMed

    Rodríguez, Ma Luisa; Martínez, David; Santos-Sancho, Juana Maria; Borda, Jenry Ricardo; Orero, Ana

    2014-06-01

    The vaccination of health workers has a large repercussion on the health of the workers, the patients and the population in general. Due to this, we proposed to discover the serological status for varicella, rubella, mumps and measles in the workers of a tertiary hospital in Madrid. We have conducted a retrospective epidemiological study of 1060 health workers, obtaining information such as age, sex, service area, employment status, pre-exposure vaccination and post-vaccination serology and vaccination status. In the population studied, 90.1% were protected against varicella, 65.6% against mumps, 95.6% against rubella and 92.9% against measles. There is no better protection against these illnesses for workers who treat patients directly, workers who treat immunosuppressed patients or for workers in services or units with a higher risk of infection. There is no better protection against varicella, rubella, mumps and measles for the workers who have higher risk of infection at work; and the workers who treat patients, that if they suffer these diseases, this could put their health at risk.

  15. Seroprevalence of measles and rubella virus antibodies in the population of the Community of Madrid, 2008-2009.

    PubMed

    García-Comas, Luis; Sanz Moreno, J C; Ordobás Gavín, M; Barranco Ordóñez, D; García Gutiérrez, J; Ramos Blázquez, B; Rodero Garduño, I

    2015-01-01

    The seroprevalence (SP) of measles and rubella virus antibodies is presented by age groups obtained in the IV Serosurvey of the Region of Madrid (2008-2009). The target population is composed of residents with ages ranging between 2 and 60 years in the Region of Madrid. A two-stage cluster sample is used. The SP of measles virus antibodies is 97.8% (CI 95%: 97.3-98.2). The highest SP is observed in the 2-5 year and 41-60 year age groups. The point estimate does not reach 95% in the 16-20 and 21-30 year age groups. The SP of rubella virus antibodies is 97.2% (CI 95%: 96.5-97.7). The SP is over 95% in all of the age groups. In immigrant women between the ages of 16 and 49, the SP is 95.9% (CI 95%: 93.7-97.4). The identification of groups susceptible to the measles virus in young adults could lead to outbreaks as a result of importing the virus. The circulation of the rubella virus is possible among immigrant women aged between 16 and 49 years, which could lead to the appearance of SRC cases. Epidemiological surveillance will allow the impact on the measles and rubella elimination plan to be determined in the future. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  16. Prevaccination screening of health-care workers for immunity to measles, rubella, mumps, and varicella in a developing country: What do we save?

    PubMed

    Alp, Emine; Cevahir, Fatma; Gökahmetoglu, Selma; Demiraslan, Hayati; Doganay, Mehmet

    2012-04-01

    A structured questionnaire was administered to health-care workers (HCWs). The HCWs were also screened for measles, rubella, mumps, and varicella (MMRV) using serological methods. One thousand two hundred and fifty-five HCWs were tested. Of the HCWs examined, 94% were immune to measles, 97% to rubella, 90% to mumps and 98% to varicella. The positive predictive values of histories of measles, mumps, rubella and varicella were 96%, 93%, 100% and 98%, respectively. The negative predictive values of histories of measles, mumps, rubella and varicella were 13%, 17%, 5% and 2%, respectively. The cost of vaccination without screening was significantly more expensive (cost difference: €24,385) for varicella, although vaccination without screening was cheap (cost difference: €5693) for MMR. Although the use of cheaper vaccines supports the implementation of vaccination programs without screening, the cost of vaccination should not be calculated based only on the direct costs. The indirect costs associated with lost work time due to vaccination and its side effects and the direct costs of potential side effects should be considered. However, if prescreening is not conducted, some HCWs (2-7%) would be unprotected against these contagious illnesses because of the unreliability of their MMRV history. In conclusion, the screening of HCWs before vaccination continues to be advisable. Copyright © 2011 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  17. Rubella outbreak and outbreak management in a school setting, China, 2014.

    PubMed

    Chang, Caiyun; Ma, Huilai; Liang, Wenjia; Hu, Pei; Mo, Xianghuan; An, Zhijie; Zheng, Huizhen

    2017-04-03

    An active response to a rubella outbreak may interrupt disease transmission, and outbreak response immunization (ORI) can increase immunity among persons who might otherwise not be protected. On March 17, 2014, a rubella outbreak was reported in a middle school in Guangzhou city, China. We conducted an investigation to assess impact of a policy of exclusion of cases from school and of ORI. Active surveillance was used to find cases of rubella. Investigators interviewed teachers and reviewed the absentee records to determine implementation details of school exclusion. ORI was recommended on 2 occasions during the outbreak, one small-scale and one large-scale. Laboratory confirmation tests included serum IgM and IgG measurements to distinguish between acute infection and immunity. A serological survey in 4 classes was used to determine immunity status and identify symptomatic and asymptomatic cases. From February 17 to May 23, 2014, 162 rubella cases (24 laboratory-confirmed and 138 epidemiologically linked) were detected among 1,621 students. Cases ultimately occurred in 27 classes (72.97%) across 37 classes. In 11 classes in which exclusion from school was delayed by 1 or more days, the secondary attack rate was 12.30%, compared with 2.35% in 15 classes with immediate exclusion. ORI increased vaccine coverage from 25.83 % to 86.92%, and the final case of the epidemic was reported one month later. A serological survey of 91 students in 4 classes identified 15 cases, 6 of which were asymptomatic. The outbreak happened in school with low rubella-containing vaccination coverage. Exclusion from school upon rash/fever onset was associated with lowering the secondary attack rate, but school exclusion alone was not able to stop this outbreak - a large ORI was needed. Assuring complete vaccination upon entry to school is likely to be necessary to ensure coverage is above the herd immunity threshold and prevent outbreaks from happening.

  18. Investigation into low-level anti-rubella virus IgG results reported by commercial immunoassays.

    PubMed

    Dimech, Wayne; Arachchi, Nilukshi; Cai, Jingjing; Sahin, Terri; Wilson, Kim

    2013-02-01

    Since the 1980s, commercial anti-rubella virus IgG assays have been calibrated against a WHO International Standard and results have been reported in international units per milliliter (IU/ml). Laboratories testing routine patients' samples collected 100 samples that gave anti-rubella virus IgG results of 40 IU/ml or less from each of five different commercial immunoassays (CIA). The total of 500 quantitative results obtained from 100 samples from each CIA were compared with results obtained from an in-house enzyme immunoassay (IH-EIA) calibrated using the WHO standard. All 500 samples were screened using a hemagglutination inhibition assay (HAI). Any sample having an HAI titer of 1:8 or less was assigned a negative anti-rubella virus antibody status. If the HAI titer was greater than 1:8, the sample was tested in an immunoblot (IB) assay. If the IB result was negative, the sample was assigned a negative anti-rubella virus IgG status; otherwise, the sample was assigned a positive status. Concordance between the CIA qualitative results and the assigned negative status ranged from 50.0 to 93.8% and 74.5 to 97.8% for the assigned positive status. Using a receiver operating characteristic analysis with the cutoff set at 10 IU/ml, the estimated sensitivity and specificity ranged from 70.2 to 91.2% and 65.9 to 100%, respectively. There was poor correlation between the quantitative CIA results and those obtained by the IH-EIA, with the coefficient of determination (R(2)) ranging from 0.002 to 0.413. Although CIAs have been calibrated with the same international standard for more than 2 decades, the level of standardization continues to be poor. It may be time for the scientific community to reevaluate the relevance of quantification of anti-rubella virus IgG.

  19. Investigation into Low-Level Anti-Rubella Virus IgG Results Reported by Commercial Immunoassays

    PubMed Central

    Arachchi, Nilukshi; Cai, Jingjing; Sahin, Terri; Wilson, Kim

    2013-01-01

    Since the 1980s, commercial anti-rubella virus IgG assays have been calibrated against a WHO International Standard and results have been reported in international units per milliliter (IU/ml). Laboratories testing routine patients' samples collected 100 samples that gave anti-rubella virus IgG results of 40 IU/ml or less from each of five different commercial immunoassays (CIA). The total of 500 quantitative results obtained from 100 samples from each CIA were compared with results obtained from an in-house enzyme immunoassay (IH-EIA) calibrated using the WHO standard. All 500 samples were screened using a hemagglutination inhibition assay (HAI). Any sample having an HAI titer of 1:8 or less was assigned a negative anti-rubella virus antibody status. If the HAI titer was greater than 1:8, the sample was tested in an immunoblot (IB) assay. If the IB result was negative, the sample was assigned a negative anti-rubella virus IgG status; otherwise, the sample was assigned a positive status. Concordance between the CIA qualitative results and the assigned negative status ranged from 50.0 to 93.8% and 74.5 to 97.8% for the assigned positive status. Using a receiver operating characteristic analysis with the cutoff set at 10 IU/ml, the estimated sensitivity and specificity ranged from 70.2 to 91.2% and 65.9 to 100%, respectively. There was poor correlation between the quantitative CIA results and those obtained by the IH-EIA, with the coefficient of determination (R2) ranging from 0.002 to 0.413. Although CIAs have been calibrated with the same international standard for more than 2 decades, the level of standardization continues to be poor. It may be time for the scientific community to reevaluate the relevance of quantification of anti-rubella virus IgG. PMID:23254301

  20. Childhood febrile illness and the risk of myopia in UK Biobank participants

    PubMed Central

    Guggenheim, J A; Williams, C

    2016-01-01

    Purpose Historical reports suggest febrile illness during childhood is a risk factor for myopia. The establishment of the UK Biobank provided a unique opportunity to investigate this relationship. Patients and methods We studied a sample of UK Biobank participants of White ethnicity aged 40–69 years old who underwent autorefraction (N=91 592) and were classified as myopic (≤−0.75 Dioptres (D)), highly myopic (≤−6.00 D), or non-myopic (>−0.75 D). Self-reported age at diagnosis of past medical conditions was ascertained during an interview with a nurse at a Biobank assessment centre. Logistic regression analysis was used to calculate the odds ratio (OR) for myopia or high myopia associated with a diagnosis before age 17 years of each of nine febrile illnesses, after adjusting for potential confounders (age, sex, highest educational qualification, and birth order). Results Rubella, mumps, and pertussis were associated with myopia: rubella, OR=1.38, 95% CI: 1.03–1.85, P=0.030; mumps, OR=1.32, 95% CI: 1.07–1.64, P=0.010; and pertussis, OR=1.39, 95% CI 1.03–1.87, P=0.029. Measles, rubella, and pertussis were associated with high myopia: measles, OR=1.48, 95% CI: 1.07–2.07, P=0.019; rubella, OR=1.94, 95% CI: 1.12–3.35, P=0.017; and pertussis, OR=2.15, 95% CI: 1.24–3.71, P=0.006. The evidence did not support an interaction between education and febrile illness in explaining the above risks. Conclusion A history of childhood measles, rubella, or pertussis was associated with high myopia, whereas a history of childhood rubella, mumps, or pertussis was associated with any myopia. The reasons for these associations are unclear. PMID:26846593

  1. Prevalence and genotypic characterization of Human Parvovirus B19 in children with measles- and rubella-like illness in Iran.

    PubMed

    Rezaei, Farhad; Sarshari, Behrang; Ghavami, Nastaran; Meysami, Parisa; Shadab, Azadeh; Salimi, Hamid; Mokhtari-Azad, Talat

    2016-06-01

    Human Parvovirus B19 (B19V) is a prototype of the Erythroparvovirus genus in Parvoviridae family. B19V infections are often associated with fever and rash, and can be mistakenly reported as measles or rubella. Differential diagnosis of B19V illness is necessary for case management and also for public health control activities, particularly in outbreak situations in which measles or rubella is suspected. To investigate the causative role of B19V infection in children with measles- and rubella-like illness, a total of 583 sera from children with exanthema were tested for presence of B19V by determining anti-B19V IgG and IgM antibodies by ELISA as well as B19V DNA detection by nested PCR. DNA positive samples were assessed further for determination of viral load and sequence analysis by Real-Time PCR and Sanger sequencing method, respectively. Out of 583 patients, 112 (19.21%) patients were positive for B19V-IgM antibody, 110 (18.87%) were positive for B19V-IgG antibody, and 63 (10.81%) were positive for B19V viral DNA. The frequency of B19V-IgG antibodies were increased with age; that is children under 6 year old showed 7.11% seroprevalence for B19V-IgG as compared to 18.39% and 28.91% for age groups 6 to >11 and 11-14 years old, respectively. Phylogenetic analysis of the NS1-VPu1 overlapping region revealed that all sequenced B19V-DNA belonged to genotype 1. The results of this study may aid the surveillance programs aiming at eradicating measles/rubella virus in Iran, as infections with B19V can be mistakenly reported as measles or rubella if laboratory testing is not conducted. © 2015 Wiley Periodicals, Inc.

  2. Antibody persistence for 3 years following two doses of tetravalent measles-mumps-rubella-varicella vaccine in healthy children.

    PubMed

    Knuf, Markus; Zepp, Fred; Helm, Klaus; Maurer, Hartwig; Prieler, Albrecht; Kieninger-Baum, Dorothee; Douha, Martine; Willems, Paul

    2012-03-01

    Two doses of a varicella-containing vaccine in healthy children <12 years are suggested to induce better protection than a single dose. Persistence of immunity against measles, mumps, rubella, and varicella as well as varicella breakthrough cases were assessed 3 years after two-dose measles, mumps, rubella, and varicella (MMRV) vaccination or concomitant MMR (Priorix™) and varicella (Varilrix™) vaccination. Four hundred ninety-four healthy children, 12-18 months old at the time of the first dose, received either two doses of MMRV vaccine (GlaxoSmithKline Biologicals) 42-56 days apart (MMRV, N = 371) or one dose of MMR and varicella vaccines administered simultaneously at separate sites, followed by another MMR vaccination 42-56 days later (MMR + V, N = 123). Three hundred-four subjects participated in 3-year follow-up for persistence of immunity and occurrence of breakthrough varicella (MMRV, N = 225; MMR + V, N = 79). Antibodies were measured by ELISA (measles, mumps, rubella) and immunofluorescence (varicella). Contacts with individuals with varicella or zoster and cases of breakthrough varicella disease were recorded. Three years post-vaccination seropositivity rates in subjects seronegative before vaccination were: MMRV-measles, 98.5% (geometric mean titer [GMT] = 3,599.6); mumps, 97.4% (GMT = 1,754.5); rubella, 100% (GMT = 51.9); varicella, 99.4% (GMT = 225.5); MMR + V-measles, 97.0% (GMT = 1,818.8); mumps, 93.8% (GMT = 1,454.6); rubella, 100% (GMT = 53.8); and varicella, 96.8% (GMT = 105.8). Of the subjects, 15-20% reported contact with individuals with varicella/zoster each year. After 3 years, the cumulative varicella breakthrough disease rate was 0.7% (two cases) in the MMRV group and 5.4% (five cases) in the MMR + V group. Immunogenicity of the combined MMRV vaccine was sustained 3 years post-vaccination. (208136/041/NCT00406211).

  3. [Seroprevalence rates of Toxoplasma gondii, rubella, cytomegalovirus, syphilis, and hepatitis B, seroprevalences rate in the pregnant population in İstanbul].

    PubMed

    Doğan, Keziban; Güraslan, Hakan; Özel, Gül; Aydan, Zerrin; Yaşar, Levent

    2014-12-01

    We retrospectively evaluated the rate of Toxoplasma gondii, rubella, syphilis, cytomegalovirus, and hepatitis B in Istanbul to compare these results with those of other literature and to contribute to the national screening program. The study was conducted in 2011 with women in the first trimester of pregnancy, with ages ranging between 16 and 48 years, in Bakırköy Training and Research Hospital's outpatient pregnancy clinic between January 2008 and January 2013. The mean age of pregnant women was 28.12±5.53, and the mean gravidity was 1.76+0.84.The seropositivities of T. gondii IgM and IgG, cytomegalovirus IgM and IgG, rubella IgM and IgG, VDRL (syphilis), HbsAg, anti-HBsAg were evaluated by ELISA method and evaluated in relation with age and parity. The seropositivity rates were as follows: T. gondii IgM: 0.8%, T. gondii IgG: 31.4%, cytomegalovirus IgM: 0.8%, cytomegalovirus IgG: 99.3%, rubella IgM: 0.2%, rubella IgG: 95.7%, VDRL: 0%, HbsAg: 1.2%, and anti-HbsAg: 26.3%. Also, pregnant women with T. gondii IgG(+) were older than pregnant women with T. gondii IgG(-), and this was statistically significant (p<0.005). Pregnant women with anti-HbsAg(+) were older than pregnant women with anti-HbsAg IgG(-), and this was statistically significant (p<0.005). Also, pregnant women with anti-HbsAg(+) had higher gravidity rates than pregnant women with anti-HbsAg(-), and this was statistically significant (p<0.005). To protect from perinatally transmitted diseases, vaccination programs against rubella and hepatitis B should be extended, and educational programs including the whole country should be arranged. Screening of high-risk pregnant women will be more appropriate when considering the financial charges of screening programs performed for early detection of perinatal infections and for protecting the fetus.

  4. Guidelines on the management of, and exposure to, rash illness in pregnancy (including consideration of relevant antibody screening programmes in pregnancy).

    PubMed

    Morgan-Capner, P; Crowcroft, N S

    2002-03-01

    These guidelines, produced by the Public Health Laboratory Service (PHLS) aim to help decision making in the investigation and management of pregnant women who have 'a rash compatible with a systemic viral illness', or who have contact with a person with such an illness. They address particularly rubella, parvovirus B19, and varicella-zoster virus infection, but consider other infective causes of rash illness in the United Kingdom. The guidelines give the magnitude and degrees of risk to the fetus in terms of outcomes for the gestation at which maternal infection occurs. Recent changes in epidemiology and management lead to the following specific advice, which both updates and re-affirms established guidelines. All pregnant women with a non-vesicular rash illness should be investigated simultaneously for rubella and parvovirus B19 infection. All pregnant women who have had significant contact with a person suffering from a non-vesicular illness should be investigated for asymptomatic parvovirus B19 infection, and for asymptomatic rubella infection unless there is satisfactory evidence of past rubella infection (vaccine or natural infection). A significant contact is defined as being in the same room for over 15 minutes, or face-to-face contact. Specific investigation to detect asymptomatic rubella reinfection is not advised. It is essential to confirm by adequate laboratory investigation all cases of possible rubella and parvovirus B19 infection in pregnancy. Management of proven rubella in pregnancy should be based on established risks of adverse outcome. Women with proven parvovirus B19 infection in the first 20 weeks of pregnancy should be followed by regular, ultrasound scanning, and referred to Regional Units of Fetal Medicine if hydrops fetalis is detected. Parvovirus B19 antibody screening in pregnancy is not advised, and consensus has been reached on the procedures to be followed for rubella antibody screening, including the concentration of antibody that reflects past infection. Oral antiviral treatment (aciclovir) is advised with informed consent for pregnant women who present within 24 hours of onset of varicella. Referral to hospital and intravenous antiviral treatment is indicated for pregnant women with complications and/or risk factors, or whose illness continues for six days or more. Pregnant women exposed to varicella or herpes zoster can be reassured as to their protection if they themselves have a history of varicella or herpes zoster. If this history is uncertain or not known, susceptibility should be tested, and varicellazoster immunoglobulin (VZIG) offered to those found susceptible if within 10 days of first exposure. Infants whose mothers develop varicella 7 days before to 7 days after delivery should be given VZIG, and aciclovir if onset was 4 days before to 2 days after delivery.

  5. The Causes for Stresses to Families with Deaf-Blind Children.

    ERIC Educational Resources Information Center

    Yu, Muriel

    Described in 13 case studies of deaf blind (as a result of rubella) children are medical, economical, emotional, and professional factors that add to stresses of parents. Medical factors are examined in relation to frequent hospitalization of the rubella children before 18 months of age. One of the case studies shows how young adult parents were…

  6. Effect of Maternal Rubella on Hearing and Vision: A Twenty Year Post-Epidemic Study.

    ERIC Educational Resources Information Center

    Johnson, Donald D.; Whitehead, Robert L.

    1989-01-01

    Two groups of deaf college students, including 104 deaf from congenital rubella syndrome (CRS) and 138 deaf from other reasons, received complete audiometric assessments and ophthalmological examinations. Degree of hearing loss did not differ between groups. However, 7 visual problems were found to be more prevalent with the CRS population.…

  7. Serving the Deaf-Blind Population: Planning for 1980.

    ERIC Educational Resources Information Center

    Brewer, Garry D.; Kakalik, James S.

    Discussed in the report on planning for services to deaf-blind persons are the impact of the 1963-65 rubella epidemic on service delivery, the need for service system information and control, prevention of rubella as a cost-effective alternative to after care, estimates of the size of the 1980 deaf-blind population, and the projected (1980)cost of…

  8. Relationship of Rubella, Herpes Simplex, Cytomegalovirus, and Certain Other Viral Disabilities.

    ERIC Educational Resources Information Center

    Vernon, McCay; Hicks, Doin

    1980-01-01

    The article reviews the literature on the relationship of certain viral diseases to hearing loss with emphasis on its implications for professionals who work with hearing impaired children and adults. The data describe both the serious pathology recently discovered to be present in some rubella deafened youth and the potential dangers of several…

  9. Reports of sensorineural deafness after measles, mumps, and rubella immunisation.

    PubMed Central

    Stewart, B J; Prabhu, P U

    1993-01-01

    There have been nine reports of sensorineural hearing loss after measles, mumps, and rubella (MMR) immunisation. In three cases the deafness was unrelated to MMR immunisation. In six cases the cause was unknown and MMR remained a possible aetiology. Any risk associated with attenuated viruses must be weighed against the risks of the natural diseases. PMID:8024302

  10. Perils of childhood. Immunization against measles, mumps, and rubella.

    PubMed

    Levine, B E; Lavi, S

    1991-01-01

    Some children with a positive history and skin test for egg allergy require a unique desensitization protocol for the measles, mumps and rubella (MMR) vaccine. The pathophysiology of food allergies, skin testing and the MMR desensitization protocol are described. Strategies appropriate to the children's developmental stage are suggested to enhance the nurse's supportive role throughout the desensitization process.

  11. Defense Health Care. Comprehensive Oversight Framework Needed to Help Ensure Effective Implementation of a Deployment Health Quality Assurance Program

    DTIC Science & Technology

    2007-06-01

    Virus IPV Inactivated Poliovirus MMR Measles, Mumps, and Rubella This is a work of the U.S. government and is not subject to copyright protection...rubella), inactivated poliovirus (IPV), hepatitis B, and influenza (once per season). • Pass: all immunizations current • Fail: overdue for one or more

  12. 75 FR 48715 - Proposed Vaccine Information Materials for Measles, Mumps, Rubella, and Varicella Vaccines

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-11

    ... United States who intends to administer one of these covered vaccines is required to provide copies of..., mumps, and rubella (MMR) vaccine can prevent these diseases. Most children who get their MMR shots will... one dose of MMR vaccine, unless they can show that they have had either the vaccines or the diseases...

  13. A digital microfluidic system for serological immunoassays in remote settings.

    PubMed

    Ng, Alphonsus H C; Fobel, Ryan; Fobel, Christian; Lamanna, Julian; Rackus, Darius G; Summers, Aimee; Dixon, Christopher; Dryden, Michael D M; Lam, Charis; Ho, Man; Mufti, Nooman S; Lee, Victor; Asri, Mohd Afiq Mohd; Sykes, Edward A; Chamberlain, M Dean; Joseph, Rachael; Ope, Maurice; Scobie, Heather M; Knipes, Alaine; Rota, Paul A; Marano, Nina; Chege, Paul M; Njuguna, Mary; Nzunza, Rosemary; Kisangau, Ngina; Kiogora, John; Karuingi, Michael; Burton, John Wagacha; Borus, Peter; Lam, Eugene; Wheeler, Aaron R

    2018-04-25

    Serosurveys are useful for assessing population susceptibility to vaccine-preventable disease outbreaks. Although at-risk populations in remote areas could benefit from this type of information, they face several logistical barriers to implementation, such as lack of access to centralized laboratories, cold storage, and transport of samples. We describe a potential solution: a compact and portable, field-deployable, point-of-care system relying on digital microfluidics that can rapidly test a small volume of capillary blood for disease-specific antibodies. This system uses inexpensive, inkjet-printed digital microfluidic cartridges together with an integrated instrument to perform enzyme-linked immunosorbent assays (ELISAs). We performed a field validation of the system's analytical performance at Kakuma refugee camp, a remote setting in northwestern Kenya, where we tested children aged 9 to 59 months and caregivers for measles and rubella immunoglobulin G (IgG). The IgG assays were determined to have sensitivities of 86% [95% confidence interval (CI), 79 to 91% (measles)] and 81% [95% CI, 73 to 88% (rubella)] and specificities of 80% [95% CI, 49 to 94% (measles)] and 91% [95% CI, 76 to 97% (rubella)] (measles, n = 140; rubella, n = 135) compared with reference tests (measles IgG and rubella IgG ELISAs from Siemens Enzygnost) conducted in a centralized laboratory. These results demonstrate a potential role for this point-of-care system in global serological surveillance, particularly in remote areas with limited access to centralized laboratories. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  14. Two-Year Study of Northwest Regional Center's Summer Sessions for Preschool, Rubella, Deaf-Blind Children. Final Report.

    ERIC Educational Resources Information Center

    Starkovich, Paul

    The report describes the Summer Sessions for Preschool, Rubella, Deaf-Blind Children conducted in 1970 and 1971 by the Northwest Regional Center for Deaf-Blind Children in Vancouver, Washington. The summer programs were primarily designed to evaluate preschool deaf-blind children in a learning and living situation. The report is intended not only…

  15. Project Word-Back: Exploratory Follow-Up Study on Deaf-Blind (Rubella) Children in California.

    ERIC Educational Resources Information Center

    Scheffelin, Edward J.

    Project Word-Back, an exploratory followup study of 21 young deaf-blind (Rubella) children (6 to 9 years old), was conducted to establish a tentative reference source of information, obtain teacher estimates on selected aspects of the current functioning level of a sample of children, and provide basic data from which hypotheses may be formulated…

  16. Acetaminophen (Paracetamol) Use, Measles-Mumps-Rubella Vaccination, and Autistic Disorder: The Results of a Parent Survey

    ERIC Educational Resources Information Center

    Schultz, Stephen T.; Klonoff-Cohen, Hillary S.; Wingard, Deborah L.; Akshoomoff, Natacha A.; Macera, Caroline A.; Ji, Ming

    2008-01-01

    The present study was performed to determine whether acetaminophen (paracetamol) use after the measles-mumps-rubella vaccination could be associated with autistic disorder. This case-control study used the results of an online parental survey conducted from 16 July 2005 to 30 January 2006, consisting of 83 children with autistic disorder and 80…

  17. Susceptibility to measles, rubella, mumps, and varicella-zoster viruses among healthcare workers.

    PubMed

    Aypak, Cenk; Bayram, Yasemin; Eren, Hayriye; Altunsoy, Adalet; Berktaş, Mustafa

    2012-01-01

    It is important to identify and immunize susceptible healthcare workers to prevent and control hospital infections. Our aim was to evaluate the specific antibodies against the measles, mumps, and rubella viruses and the varicella zoster virus among healthcare workers in a tertiary-care hospital. A total of 284 healthcare workers (89 men and 195 women; mean age, 33.5 ± 11 years), including 111 nurses, 87 physicians, 34 laboratory technicians, and 52 members of the housekeeping staff, of Van Training and Research Hospital were enrolled in this study. Antibodies were detected with an enzyme-linked immunosorbent assay. The numbers of workers with serological susceptibility to mumps, measles, rubella, or chicken pox were 26 (9.2%), 18 (6.3%), 7 (2.5%), and 5 (1.8%), respectively. Although the difference was not statistical significant, the rate of seroprevalence of antibodies was lowest for measles (90.8%; p>0.05). Susceptibility to measles, mumps, and rubella, and chicken pox was more prevalent among young healthcare workers (p<0.001). Not all healthcare workers born before 1957 were immune to these vaccine-preventable diseases. These data confirm that screening and vaccination of susceptible healthcare workers is essential regardless of age.

  18. Modeling the impact of rubella vaccination in Vietnam.

    PubMed

    Vynnycky, Emilia; Yoshida, Lay Myint; Huyen, Dang Thi Thanh; Trung, Nguyen Dac; Toda, Kohei; Cuong, Nguyen Van; Thi Hong, Duong; Ariyoshi, Koya; Miyakawa, Masami; Moriuchi, Hiroyuki; Tho, Le Huu; Nguyen, Hien Anh; Duc Anh, Dang; Jit, Mark; Hien, Nguyen Tran

    2016-01-01

    Supported by GAVI Alliance, measles-rubella vaccination was introduced in Vietnam in 2014, involving a mass campaign among 1-14 year olds and routine immunization of children aged 9 months. We explore the impact on the incidence of Congenital Rubella Syndrome (CRS) during 2013-2050 of this strategy and variants involving women aged 15-35 years. We use an age and sex-structured dynamic transmission model, set up using recently-collected seroprevalence data from Central Vietnam, and also consider different levels of transmission and contact patterns. If the serological profile resembles that in Central Vietnam, the planned vaccination strategy could potentially prevent 125,000 CRS cases by 2050 in Vietnam, despite outbreaks predicted in the meantime. Targeting the initial campaign at 15-35 year old women with or without children aged 9 months-14 years led to sustained reductions in incidence, unless levels of ongoing transmission were medium-high before vaccination started. Assumptions about contact greatly influenced predictions if the initial campaign just targeted 15-35 year old women and/or levels of ongoing transmission were medium-high. Given increased interest in rubella vaccination, resulting from GAVI Alliance funding, the findings are relevant for many countries.

  19. Characterization of rubella virus genotypes among pregnant women in northern Vietnam, 2011-2013.

    PubMed

    Van Le, Son; Le, Duc Hoang; Hoang, Huong Thi; Hoang, Ha; Nguyen, Nam Trung; Chu, Ha Hoang

    2015-02-01

    Rubella virus (RV) infection is an unresolved clinical complication that affects children in developing countries including Vietnam. RV infection during the first trimester of pregnancy causes severe birth defects known as congenital rubella syndrome. This study reports on the genomic characterization of RV strains circulating in northern Vietnam during 2011-2013. RV-IgM positive amniotic fluid specimens were collected from 38 women from northern Vietnam who presented with clinical rubella at the National Hospital of Obstetrics and Gynecology in Hanoi, Vietnam. The RV genes were determined by nested PCR with primers amplifying the 739-nucleotide coding region of the E1 gene. The sequences from the amplified DNA fragments were phylogenetically analyzed and compared to reference RV strains. Seventeen out of 38 samples are positive for RV detecting. All new RV isolates are clustered to genotype 2B. Eighteen amino acid mutations were found in the T and B cell epitopes. These results suggest that genotype 2B RV strains frequently circulate in northern Vietnam. These data describe the RV genotype in Vietnam with the aim of improving maternal and child health in this country. © 2014 Wiley Periodicals, Inc.

  20. A Microneedle Patch for Measles and Rubella Vaccination Is Immunogenic and Protective in Infant Rhesus Macaques.

    PubMed

    Joyce, Jessica C; Carroll, Timothy D; Collins, Marcus L; Chen, Min-Hsin; Fritts, Linda; Dutra, Joseph C; Rourke, Tracy L; Goodson, James L; McChesney, Michael B; Prausnitz, Mark R; Rota, Paul A

    2018-04-26

    New methods to increase measles and rubella (MR) vaccination coverage are needed to achieve global and regional MR elimination goals. Here, we developed microneedle (MN) patches designed to administer MR vaccine by minimally trained personnel, leave no biohazardous sharps waste, remove the need for vaccine reconstitution, and provide thermostability outside the cold chain. This study evaluated the immunogenicity of MN patches delivering MR vaccine to infant rhesus macaques. Protective titers of measles neutralizing antibodies (>120 mIU/mL) were detected in 100% of macaques in the MN group and 75% of macaques in the subcutaneous (SC) injection group. Rubella neutralizing antibody titers were >10 IU/mL for all groups. All macaques in the MN group were protected from challenge with wild-type measles virus, whereas 75% were protected in the SC group. However, vaccination by the MN or SC route was unable to generate protective immune responses to measles in infant macaques pretreated with measles immunoglobulin to simulate maternal antibody. These results show, for the first time, that MR vaccine delivered by MN patch generated protective titers of neutralizing antibodies to both measles and rubella in infant rhesus macaques and afforded complete protection from measles virus challenge.

  1. The fourth disease, 1900-2000.

    PubMed

    Weisse, M E

    2001-01-27

    Measles and scarlet fever were differentiated from one another in the 17th century. Rubella was accepted as the third distinct paediatric exanthem in 1881. Nil Filatow in 1885 and Clement Dukes in 1894 described two distinct forms of rubella, and in 1900 Dukes proposed that one of these forms of rubella was a separate entity which he called the fourth disease. For the past five decades, fourth disease has been considered a non-entity, perhaps a mild form of scarlet fever, but certainly not a distinct disease. In 1979 Keith Powell resurrected the idea of the fourth disease and argued that it was caused by exotoxin-producing Staphylococcus aureus. We present additional arguments for the existence of fourth disease, as well as information to link the disease to S. aureus.

  2. [Antibody persistence following on different vaccination strategies of domestic measles, mumps and rubella combined attenuated live vaccine: a 3-year follow-up study].

    PubMed

    He, H Q; Li, Q; Yan, R; Zhou, Y; Tang, X W; Deng, X; Xie, S Y; Chen, Z P

    2017-04-06

    Objective: To assess the 3-year antibody persistence after vaccination of domestic measles, mumps and rubella combined attenuated live vaccine (MMR) with different program. Methods: Children from three different vaccination strategies (Group 8 m MR: 8 months and 18 months vaccinated with measles-rubella combined attenuated live vaccine and domestic MMR,respectively; Group 8 m MMR: 8 months and 18 months both vaccinated with domestic MMR; Group 12 m MMR: 12 months and 22 months both vaccinated with domestic MMR ) were followed up in Zhejiang province in July 2015. There were 170 participants in Group 8 m MR, 171 participants in Group 8 m MMR and 173 participants in Group 12 m MMR selected by simple random sampling method .Blood samples (venous blood 2-3 ml) were collected 1 month after the first dose vaccination of MMR (only in Group 8 m MMR and Group 12 m MMR) and 3 years (36-38 months) after the last dose vaccination of MMR and tested for antibody IgG against Measles, Mumps and Rubella using ELISA. Seropostive rate and Geometric mean concentration (GMC) were calculated and compared among different groups by Chi-square test or Fisher exact test and Kruskal-Wallis H test. Results: A total of 514 participants (8 m MR: 170; 8 m MMR:171; 12 m MMR:173) were enrolled. The overall seropositivity rate of measles, mumps and rubella was 98.1% (504), 93.4% (480) and 88.1% (453), respectively, with corresponding GMC was 1 012.33 mU/ml, 502.87 U/ml and 50.53 U/ml respectively. There was no significant difference of seropositivity rate for measles among three groups (all groups were>97%). The highest seropositivity rate for mumps was found in the Group 12 m MMR with the rate of 98.8% (171/173), followed by Group 8 m MMR and Group 8 m MR with 93.0% (159/171) and 88.2%(150/170) respectively (Fisher exact test, P< 0.001). The highest seropositivity rate for rubella was also found in the Group 12 m MMR with the rate of 94.8% (164/173), followed by Group 8 m MMR and Group 8 m MR with 86.6%(148/171) and 82.9%(141/170) respectively (Fisher exact test, P= 0.002). The highest GMC of antibody against measles, mumps and rubella were all found in Group 12 m MMR, with 1 217.30 (1 119.35-1 323.82) mU/ml, 717.07 (643.83-798.65) U/ml and 62.54(56.21-69.58) U/ml respectively. The lowest GMC of antibody against measles and mumps were both in Group 12 m MR with 812.01 (734.52-897.67) mU/ml and 363.28 (305.42-432.11) U/ml respectively. The lowest GMC of antibody against rubella was in Group 8 m MMR with 44.10 (39.08-49.76) U/ml. These differences of GMCs among three groups were all reach significant means ( P< 0.05). Conclusion: High level seropostive rates and GMCs were exist against measles and rubella after 3-year vaccination of domestic MMR among different program. Higher antibody level against mumps were found in those children with two doses vaccination of MMR.

  3. An outbreak of rubella in a hilly district of Kangra-Chamba, Himachal Pradesh, India, 2006.

    PubMed

    Gupta, Surender Nikhil; Gupta, Naveen Nikhil

    2009-07-01

    Rubella is a minor disease that often goes unnoticed and seldom results in significant morbidity and mortality. However, the infection among pregnant women is associated with serious consequences for the fetus. On 5th November, 2006, a local community leader reported cases of fever with rash in three villages of Chamba district to Shahpur hospital. No death was reported. We investigated the outbreak as a suspected outbreak of measles with the objectives of confirming diagnosis, estimating the magnitude of outbreak and formulating recommendations for control and prevention. We defined a case of the rubella as occurrence of fever with rash in any resident of these three villages between 20th October to 9th December, 2006. We line listed the cases and collected information on age, sex, residence, date of onset, symptoms, signs, treatment history, traveling history, vaccination status and pregnancy status. We described the outbreak by time, place and person characteristics. Sera of a sample of case patients were tested for IgM antibodies to measles and later rubella viruses. We identified 61 cases in three villages - 39 cases in Hattli, 17 in Thulel and 5 in Dramman. The overall attack rate (AR) was 8.7%. Sex specific AR for males was 10% and females 7.4%. All case patients were less than 20 years of age and the attack rate was highest in the age group 11-20 years (median age 12 years). The index case was traced in Hattli Bengali slum and occurred on 20th October 2006 where majorities (41%) of the cases were reported. No pregnant woman was found to be affected. The number of cases peaked on 19th November and the last case was reported on 9th December 2006. Of 61 case-patients, 50 (82%) were immunized against measles while proportions of children vaccinated for measles were 96% (672/700) and none of them were immunized against rubella (including two (3%) who had MMR immunization privately). Out of six blood samples tested, all tested negative for measles IgM antibodies but four were positive for IgM antibodies to rubella. Only 36% (22/61) of the cases took the treatment from modern system of medicine. An outbreak of rubella was confirmed and was possibly due to the frequent traveling of Bengali colony patients to other areas for selling the food items. We advised the local health authorities to provide MMR vaccination to the unexposed and energetic IEC in three affected and neighboring villages.

  4. Seroprevalence survey of varicella, measles, rubella, and hepatitis A and B viruses in a multinational healthcare workforce in Saudi Arabia.

    PubMed

    Almuneef, M A; Memish, Z A; Balkhy, H H; Otaibi, B; Helmi, M

    2006-11-01

    To determine the prevalence of the vaccine-preventable diseases caused by varicella, measles, rubella, and hepatitis A and B viruses in a multinational healthcare workforce. Prospective cohort study. A 750-bed tertiary care center located in Riyadh, Saudi Arabia. In compliance with hospital policy, newly recruited healthcare workers (HCWs) were enrolled in the study from September 2001 to March 2005. Serum samples were collected from all HCWs during the initial hiring process and tested for IgG antibodies against each of the 5 viral agents. Nonimmune HCWs were subsequently vaccinated at the earliest opportunity. A total of 4,006 newly hired (international and local) employees were included in the study. All underwent serologic testing for IgG antibodies against varicella, measles, rubella, hepatitis A, and hepatitis B viruses. Of the total, 63% were female and 37% were male. Middle Eastern employees comprised 47% of the total, followed by employees from the Far East (35%), the West (10%), and Africa (8%). Forty-two percent were nurses, 27% were in administration, 18% were medical technicians, and 13% were physicians. Among the 4,006 newly hired HCWs, 14% had negative IgG antibody test results for varicella virus, 13% for measles virus, 10% for rubella virus, 33% for hepatitis A virus, and 43% for hepatitis B virus. More women than men were susceptible to hepatitis A (40% vs. 24%; P<.001), whereas more men were susceptible to hepatitis B (55% vs. 35%; P<.001). Varicella susceptibility was more common among HCWs from the Far East (19%), whereas susceptibility to measles, rubella, hepatitis A, and hepatitis B was highest among HCWs from the Middle East. Both relative youth and male sex were associated with lack of antibodies against hepatitis B virus and rubella virus. In contrast, female sex and younger age were associated with lack of antibodies against hepatitis A virus (P<.001). Seroprevalence surveys of vaccine-preventable diseases among HCWs, although labor intensive, are invaluable in caring for a multinational workforce.

  5. Measles, mumps, and rubella antibody patterns of persistence and rate of decline following the second dose of the MMR vaccine.

    PubMed

    Seagle, Emma E; Bednarczyk, Robert A; Hill, Tenisha; Fiebelkorn, Amy Parker; Hickman, Carole J; Icenogle, Joseph P; Belongia, Edward A; McLean, Huong Q

    2018-02-01

    Antibodies to measles, mumps, and rubella decline 3% per year on average, and have a high degree of individual variation. Yet, individual variations and differences across antigens are not well understood. To better understand potential implications on individual and population susceptibility, we reanalyzed longitudinal data to identify patterns of seropositivity and persistence. Children vaccinated with the second dose of measles, mumps, rubella vaccine (MMR2) at 4-6 years of age were followed up to 12 years post-vaccination. The rates of antibody decline were assessed using regression models, accounting for differences between and within subjects. Most of the 302 participants were seropositive throughout follow-up (96% measles, 88% mumps, 79% rubella). The rate of antibody decline was associated with MMR2 response and baseline titer for measles and age at first dose of MMR (MMR1) for rubella. No demographic or clinical factors were associated with mumps rate of decline. One month post-MMR2, geometric mean titer (GMT) to measles was high (3892 mIU/mL), but declined on average 9.7% per year among those with the same baseline titer and <2-fold increase post-MMR2. Subjects with ≥2-fold experienced a slower decline (≤7.4%). GMT to rubella was 149 one month post-MMR2, declining 2.6% and 5.9% per year among those who received MMR1 at 12-15 months and >15 months, respectively. GMT to mumps one month post-MMR2 was 151, declining 9.2% per year. Only 14% of subjects had the same persistence trends for all antigens. The rate of antibody decay varied substantially among individuals and the 3 antigen groups. A fast rate of decline coupled with high variation was observed for mumps, yet no predictors were identified. Future research should focus on better understanding waning titers to mumps and its impacts on community protection and individual susceptibility, in light of recent outbreaks in vaccinated populations. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. [What EIA assay levels correspond to rubella antibody HI assay titer?].

    PubMed

    Terada, Kihei; Inoue, Mika; Wakabayashi, Tokio; Ogita, Satoko; Ouchi, Kazunobu

    2009-01-01

    In 2004, a Japanese-government-supported research group recommended that women without rubella antibody or with low titers < or = 1:16 of HI antibody should be vaccinated to decrease the risk of congenital rubella syndrome. We compared HI antibody titer with EIA-IgG levels in 520 college students with < or = 1:64, HI antibody measuring rubella antibodies in the same specimen using HI and EIA assay kits from Denka Seiken Co. (Japan) and Dade Behring Co. (Germany). The positive predictive value of the EIA assay using the kit from Denka Seiken Co. was 99.8% and the negative predictive value 91.3%, respectively, compared to 97.9% (positive > or = 15 IU/mL), 98.1% (positive > or = 10 IU/mL), and 93.4%, using the kit from Dade Behring Co. Between HI titers and EIA-IgG measured with the Denka kit, the coefficient index was 0.715 (p < 0.0001). Between those measured with the Dade kit, the coefficient index was 0.610 (p < 0.0001). Between EIA-IgG levels measured using the two kits, the coefficient index was 0.753 (p < 0.0001). The HI value of 1:16 corresponds approximately to 9.0 with the kit (positive > or = 4.0) from Denka, and to 30 IU/mL with the kit from Dade. EIA-IgG levels > or = 10 IU/mL are considered globally as protective antibody titers, meaning that the Japanese recommendation of < or = 1:16 for vaccination is too loose. Japanese EIA kit values for the rubella antibody should also be expressed in IU/mL using the global standard.

  7. Quantitative investigations of different vaccination policies for the control of congenital rubella syndrome (CRS) in the United Kingdom.

    PubMed Central

    Anderson, R. M.; Grenfell, B. T.

    1986-01-01

    The paper examines predictions of the impact of various one-, two- and three-stage vaccination policies on the incidence of congenital rubella syndrome (CRS) in the United Kingdom with the aid of a mathematical model of the transmission dynamics of rubella virus. Parameter estimates for the model are derived from either serological data or case notifications, and special attention is given to the significance of age-related changes in the rate of exposure to rubella infection and heterogeneous mixing between age groups. Where possible, model predictions are compared with observed epidemiological trends. The principal conclusion of the analyses is that benefit is to be gained in the UK, both in the short and long term, by the introduction of a multiple-stage vaccination policy involving high levels of vaccination coverage of young male and female children (at around two years of age) and teenage girls (between the ages of 10-15 years), plus continued surveillance and vaccination of adult women in the child-bearing age classes. Model predictions suggest that to reduce the incidence of CRS in future years, below the level generated by a continuation of the current UK policy (the vaccination of teenage girls), would require high rates of vaccination (greater than 60%) of both boys and girls at around two years of age. Numerical studies also suggest that uniform vaccination coverage levels of greater than 80-85% of young male and female children could, in the long term (40 years or more), eradicate rubella virus from the population. The robustness of these conclusions with respect to the accuracy of parameter estimates and various assumptions concerning the pattern of age-related change in exposure to infections and 'who acquires infection from whom' is discussed. PMID:3701044

  8. Combination Measles-Mumps-Rubella-Varicella Vaccine in Healthy Children

    PubMed Central

    Ma, Shu-Juan; Li, Xing; Xiong, Yi-Quan; Yao, A.-.ling; Chen, Qing

    2015-01-01

    Abstract A combined measles-mumps-rubella-varicella (MMRV) vaccine is expected to facilitate universal immunization against these 4 diseases. This study was undertaken to synthesize current research findings of the immunogenicity and safety of MMRV in healthy children. We searched PubMed, Embase, BIOSIS Previews, Web of Science, Cochrane Library, and other databases through September 9, 2014. Eligible randomized controlled trials (RCTs) were selected and collected independently by 2 reviewers. Meta-analysis was conducted using Stata 12.0 and RevMan 5.3. Twenty-four RCTs were included in qualitative synthesis. Nineteen RCTs compared single MMRV dose with measles-mumps-rubella vaccine with or without varicella vaccine (MMR + V/MMR). Similar seroconversion rates of these 4 viruses were found between comparison groups. There were comparable geometric mean titers (GMTs) against mumps and varicella viruses between MMRV group and MMR + V/MMR group. MMRV group achieved enhanced immune response to measles component, with GMT ratio of 1.66 (95% confidence interval [CI] 1.48, 1.86; P < 0.001) for MMRV versus MMR and 1.62 (95% CI 1.51, 1.70; P < 0.001) for MMRV versus MMR + V. Meanwhile, immune response to rubella component in MMRV group was slightly reduced, GMT ratios were 0.81 (95% CI 0.78, 0.85; P < 0.001) and 0.79 (95% CI 0.76, 0.83; P < 0.001), respectively. Well tolerated safety profiles were demonstrated except higher incidence of fever (relative risks 1.12–1.60) and measles/rubella-like rash (relative risks 1.44–1.45) in MMRV groups. MMRV had comparable immunogenicity and overall safety profiles to MMR + V/MMR in healthy children based on current evidence. PMID:26554769

  9. Evaluation of rubella screening in pregnant women

    PubMed Central

    Gyorkos, T W; Tannenbaum, T N; Abrahamowicz, M; Delage, G; Carsley, J; Marchand, S

    1998-01-01

    BACKGROUND: The rationale for rubella vaccination in the general population and for screening for rubella in pregnant women is the prevention of congenital rubella syndrome. The objective of this study was to evaluate the effectiveness of the prenatal rubella screening program in Quebec. METHODS: A historical cross-sectional study was designed. Sixteen hospitals with obstetric services were randomly selected, 8 from among the 35 "large" hospitals in the province (500 or more live births/year) and 8 from among the 50 "small" hospitals (fewer than 500 live births/year). A total of 2551 women were randomly selected from all mothers of infants born between Apr. 1, 1993, and Mar. 31, 1994, by means of stratified 2-stage sampling. The proportions of women screened and vaccinated were ascertained from information obtained from the hospital chart, the physician's office and the patient. RESULTS: The overall (adjusted) screening rate was 94.0%. The rates were significantly different between large and small hospitals (94.4% v. 89.6%). Five large hospitals and one small hospital had rates above 95.0%. The likelihood of not having been screened was statistically significantly higher for women who had been pregnant previously than for women pregnant for the first time (4.8% v. 1.4%; p < 0.001). Of the 200 women who were seronegative at the time of screening (8.4%), 79 had been vaccinated postpartum, had a positive serological result on subsequent testing or did not require vaccination, and 59 had not been vaccinated postpartum; for 62, subsequent vaccination status was unknown. INTERPRETATION: Continued improvement in screening practices is needed, especially in small hospitals. Because vaccination rates are unacceptably low, it is crucial that steps be taken to address this issue. PMID:9835876

  10. Immunity to Measles, Mumps, and Rubella in US Children With Perinatal HIV Infection or Perinatal HIV Exposure Without Infection

    PubMed Central

    Siberry, George K.; Patel, Kunjal; Bellini, William J.; Karalius, Brad; Purswani, Murli U.; Burchett, Sandra K.; Meyer, William A.; Sowers, Sun Bae; Ellis, Angela; Van Dyke, Russell B.

    2015-01-01

    Background. Children with perinatal human immunodeficiency virus (HIV) infection (PHIV) may not be protected against measles, mumps, and rubella (MMR) because of impaired initial vaccine response or waning immunity. Our objectives were to estimate seroimmunity in PHIV-infected and perinatally HIV-exposed but uninfected (HEU) children and identify predictors of immunity in the PHIV cohort. Methods. PHIV and HEU children were enrolled in the Pediatric HIV/AIDS Cohort Study (PHACS) at ages 7–15 years from 2007 to 2009. At annual visits, demographic, laboratory, immunization, and clinical data were abstracted and serologic specimens collected. Most recent serologic specimen was used to determine measles seroprotection by plaque reduction neutralization assay and rubella seroprotection and mumps seropositivity by enzyme immunoassay. Sustained combination antiretroviral therapy (cART) was defined as taking cART for at least 3 months. Results. Among 428 PHIV and 221 HEU PHACS participants, the prevalence was significantly lower in PHIV children for measles seroprotection (57% [95% confidence interval {CI}, 52%–62%] vs 99% [95% CI, 96%–100%]), rubella seroprotection (65% [95% CI, 60%–70%] vs 98% [95% CI, 95%–100%]), and mumps seropositivity (59% [95% CI, 55%–64%] vs 97% [95% CI, 94%–99%]). On multivariable analysis, greater number of vaccine doses while receiving sustained cART and higher nadir CD4 percentage between last vaccine dose and serologic testing independently improved the cumulative prediction of measles seroprotection in PHIV. Predictors of rubella seroprotection and mumps seropositivity were similar. Conclusions. High proportions of PHIV-infected children, but not HEU children, lack serologic evidence of immunity to MMR, despite documented immunization and current cART. Effective cART before immunization is a strong predictor of current seroimmunity. PMID:26060291

  11. Self-reported histories of disease and vaccination against measles, mumps, rubella and varicella in health care personnel in Japan.

    PubMed

    Kumakura, Shunichi; Onoda, Keiichi; Hirose, Masahiro

    2014-03-01

    Health care personnel are required to be immune against vaccine-preventable diseases, such as measles, mumps, rubella, and varicella. The aim of this study is to evaluate the accuracy of self-reported histories of disease and vaccination against measles, mumps, rubella, and varicella in order to determine the immune status of health care personnel. A self-reported questionnaire of history of previous disease and vaccination against these diseases was administered to a total of 910 health care personnel in Shimane university hospital in Japan, whose results were compared with serological evidences. There were numerous subjects who did not remember a history of disease (greater than 33% each) and of vaccination (greater than 58% each). Self-reported history of disease and vaccination had high positive predictive value against either disease for testing positive for antiviral antibodies. However, a considerable number of false-negative subjects could be found; 88.9% of subjects for measles, 89.3% for mumps, 62.2% for rubella and 96.3% for varicella in the population who had neither a self-reported history of disease nor a vaccination against each disease. In addition, regardless of the disease in question, a negative predictive value in self-reported history of disease and vaccination was remarkably low. These results suggest that self-reported history of disease and vaccination was not predictive to determine the accurate immune status of health care personnel against measles, mumps, rubella, and varicella. A seroprevalence survey, followed by an adequate immunization program for susceptible subjects, is crucial to prevent and control infection in hospital settings. Copyright © 2013 Japanese Society of Chemotherapy and the Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. Preliminary multiplex microarray IgG immunoassay for the diagnosis of toxoplasmosis and rubella.

    PubMed

    Baschirotto, Priscila T; Krieger, Marco A; Foti, Leonardo

    2017-06-01

    During pregnancy, toxoplasmosis and rubella can cause serious damage to the mother and the foetus through vertical transmission. Early diagnosis enables implementation of health measures aimed at preventing vertical transmission and minimising damage caused by these diseases. Here, we report the development of a multiplex assay for simultaneous detection of IgG antibodies produced during toxoplasmosis and rubella infection. This assay is based on xMap technology. Initially, by singleplex assays, we evaluated the following antigens: one Toxoplasma gondii lysate; two antigenic extracts of T. gondii (TOX8131 and TOX8122); fragments of T. gondii antigens [SAG-1 (amino acids 45-198), GRA-7 (24-100), GRA-1 (57-149), ROP-4, and MIC-3 (234-306)]; two chimeric antigens composed of fragments of SAG-1, GRA-7, and P35 (CTOX and CTOXH); and fragments of Rubella virus antigens [E-1 (157-176, 213-239, 374-390), E-2 (31-105), and C (1-123)]. A multiplex assay to simultaneously diagnose toxoplasmosis and rubella was designed with the best-performing antigens in singleplex and multiplex assays, which included CTOXH, T. gondii lysate, TOX8131, E-1, and E-2. The multiplex assay showed 100% sensitivity and specificity for anti-T. gondii IgG detection and 95.6% sensitivity and 100% specificity for anti-R. virus IgG detection. We found that, despite the difficulties related to developing multiplex systems, different types of antigens (extracts and recombinant proteins) can be used to develop high-performance diagnostic tests. The assay developed is suitable to screen for prior T. gondii and R. virus infections, because it is a rapid, high-throughput, low-cost alternative to the current standard diagnostic tools, which require multiple individual tests.

  13. Molecular surveillance of measles and rubella in the WHO European Region: new challenges in the elimination phase.

    PubMed

    Santibanez, S; Hübschen, J M; Ben Mamou, M C; Muscat, M; Brown, K E; Myers, R; Donoso Mantke, O; Zeichhardt, H; Brockmann, D; Shulga, S V; Muller, C P; O'Connor, P M; Mulders, M N; Mankertz, A

    2017-08-01

    The WHO European Region (EUR) has adopted the goal of eliminating measles and rubella but individual countries perform differently in achieving this goal. Measles virus spread across the EUR by mobile groups has recently led to large outbreaks in the insufficiently vaccinated resident population. As an instrument for monitoring the elimination process and verifying the interruption of endemic virus transmission, molecular surveillance has to provide valid and representative data. Irrespective of the country's specific situation, it is required to ensure the functionality of the laboratory surveillance that is supported by the WHO Global Measles and Rubella Laboratory Network. To investigate whether the molecular surveillance in the EUR is adequate for the challenges in the elimination phase, we addressed the quality assurance of molecular data, the continuity and intensity of molecular monitoring, and the analysis of transmission chains. Published articles, the molecular External Quality Assessment Programme of the WHO, the Centralized Information System for Infectious Diseases of the WHO EUR and the WHO Measles and Rubella Nucleotide Surveillance databases served as information sources. Molecular proficiency testing conducted by the WHO in 2016 has shown that the expertise for measles and rubella virus genotyping exists in all parts of the EUR. The analysis of surveillance data reported nationally to the WHO in 2013-2016 has revealed some countries with outbreaks but not sufficiently representative molecular data. Long-lasting supranational MV transmission chains were identified. A more systematic molecular monitoring and recording of the transmission pattern for the whole EUR could help to create a meaningful picture of the elimination process. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. All rights reserved.

  14. The impact of socioeconomic factors on the efficiency of voluntary toxoplasmosis screening during pregnancy: a population-based study.

    PubMed

    Lange, A E; Thyrian, J R; Wetzka, S; Flessa, S; Hoffmann, W; Zygmunt, M; Fusch, C; Lode, H N; Heckmann, M

    2016-07-29

    Congenital toxoplasmosis is associated with severe complications. German state health insurance covers rubella, but not toxoplasmosis, immunity screening. We analysed the effect of socioeconomic factors on the efficiency of private toxoplasmosis screening during pregnancy. Toxoplasmosis and rubella screening data (n = 5402 mothers) were collected within the population-based Survey of Neonates in Pomerania (SNiP). At the first-trimester screening, 34.4 % (88.1 %) of expecting mothers were immune to toxoplasmosis (rubella). Susceptibility for toxoplasmosis (rubella) was observed in 39.6 % (8.9 %) and 25.8 % (2.95 %) were not tested. Data on a 2(nd) screening were available in a subgroup of women with negative immunity showing less than 45 % participation rate. Active toxoplasmosis (no rubella) infection was observed in 0.3 % (n = 17) of pregnant women. A multiple logistic regression model (AIC = 719.67; AUC = 0.725) revealed that the likelihood of participating in a second toxoplasmosis screening increased among women with a good level of education and a steady partnership and decreased with paternal unemployment and the absence of breastfeeding. The highest probability of non-participation in toxoplasmosis screening was found among women with temporal burden and family responsibilities. A cost-benefit analysis showed that covering general screening for toxoplasmosis with health insurance saved costs. Toxoplasmosis carried a substantial risk of infection during pregnancy. Although increased socioeconomic status was positively associated with the participation in toxoplasmosis screening, this was not the case when pregnant women had strong temporal burden and family responsibilities. This data supports the need for toxoplasmosis screening among pregnant women as a general healthcare benefit covered by insurance.

  15. [Seroprevalence of antibodies against Treponema pallidum, Toxoplasma gondii, rubella virus, hepatitis B and C virus, and HIV in pregnant women].

    PubMed

    Gutiérrez-Zufiaurre, Nieves; Sánchez-Hernández, Javier; Muñoz, Santiago; Marín, Raquel; Delgado, Nuria; Sáenz, María Carmen; Muñoz-Bellido, Juan Luis; García-Rodríguez, José Angel

    2004-11-01

    The prevalence of antibodies against Treponema pallidum, Toxoplasma gondii, rubella virus, hepatitis B virus (HBV), hepatitis C virus (HCV) and human immunodeficiency virus (HIV) was investigated in pregnant women. With the use of several serological methods in samples from women who had their first obstetric visit in 2001, we studied the prevalence of serum antibodies against T. pallidum, T. gondii, rubella virus, HBV and HCV in 2,929 pregnant women, and anti-HIV antibodies in the 1,349 women agreeing to this test. Antibodies against T. pallidum were not detected in any case. HBsAg was found in 11 patients (0.4%), six of whom (54.5%) were not aware of their condition. The presence of anti-rubella antibodies was almost universal (99.95%). In the total population, 18.8% of patients had anti-T. gondii antibodies; only one had a serological profile suggesting acute toxoplasmosis. Among the 1,349 women studied, anti-HIV antibodies were detected in two intravenous drug abusers who were aware of their condition. Anti-HCV antibodies were found in 0.4% of the series, and 36.4% of the HCV-positive patients had no knowledge of their condition. Active infection by T. pallidum in pregnant women in Spain is currently exceptional. The level of immunization against rubella virus is excellent. Seropositivity to T. gondii is lower than rates reported in earlier studies. The prevalence of HBsAg and anti-HCV antibodies is around 0.4%, and seropositive status is often discovered in routine serological studies performed during pregnancy. HIV seropositivity is low, and the pregnant women included in this study were aware of their condition.

  16. [The Quality Analysis of National Supervising Sampling for Rubella Virus IgM Diagnostic Kits in 2014].

    PubMed

    Yu, Tina; Qu, Shoufang; Zhang, Xiaoyan; Sun, Nan; Gao, Shangxian; Li, Haining; Huang, Jie

    2015-07-01

    To evaluate the quality status of rubella virus IgM diagnostic kits by national supervising sampling. Using legal inspection combining with exploratory study, the positive and negative coincidence rate, detection limit and repeatability of kits were verified. The results showed that 15 of 16 batches of kits were qualified using legal inspection, and the passing rate was 93.8%. The unqualified item was negative coincidence rate. In exploratory study, only 11 batches (68.8%) complied with industry standard. The unqualified items were negative coincidence rate, detection limit and repeatability. At present, rubella virus IgM diagnostic Kits have some quality problems in the market. It is recommended that we adopt industry standard and national reference panel in the registration inspection for the future, which will prompt enterprises to improve quality.

  17. Retinopathy following measles, mumps, and rubella vaccination in an immuno-incompetent girl.

    PubMed

    Schuil, J; van de Putte, E M; Zwaan, C M; Koole, F D; Meire, F M

    1998-01-01

    We describe a 4-year-old girl with subnormal visual acuity due to a bilateral retinopathy. The child had a history of encephalitis following MMR vaccination. Temporary retinopathy associated with measles, mumps, and rubella (MMR) vaccination has been described. Recently an idiopathic CD4+ T lymphocytopenia in the child was diagnosed. This cellular immunodeficiency supports our hypothesis of measles retinopathy after vaccination of an immuno-deficient child.

  18. [Drug clinics. Drug of the month. A new measles-rubella-mumps vaccine (Priorix)].

    PubMed

    Senterre, J

    1999-02-01

    A novel measles-mumps-rubella vaccine (Priorix) has been marketed by SmithKline Beecham. It contains live attenuated virus with measles and mumps strains slightly different from those present in MMR VAX (Pasteur Merieux MSD). The indications and contraindications are similar for both vaccines. Immunogenicity is also equivalent as well as general reactogenicity. By contrast local symptoms were reported significantly less frequently after Priorix.

  19. Seroprevalence of measles, mumps, rubella, and varicella amongphysicians and nurses in Jordan.

    PubMed

    Bakri, Faris Ghalib; Abdelrahim, Zakaria Mohammad; Alkalbani, Alaqahira Samih; Khrais, Ghada Mohammad; Shamroukh, Deena Shamroukh; Hayajneh, Ferial Ahmad; Mahafza, Azmi

    2016-04-19

    Measles, mumps, rubella, and varicella can affect susceptible healthcare workers who might subsequently spread the infection to susceptible patients and workers. Here, we aim to determine the seroprevalence of these infections among physicians and nurses and to compare the history of varicella with the results of varicella antibodies among study participants. Two randomly selected groups, one group of physicians and one of nurses, from a university hospital in Jordan were interviewed and their serum IgG antibodies were measured. The physicians and nurses group had 252 and 241 participants, respectively. The physicians group had significantly more males and younger participants. The percentage of individuals in the physician and nurse groups with positive antibodies to measles was 75.4% and 75.1%, respectively; mumps, 88.5% and 94.2%; rubella, 89.3% and 87.1%; and varicella, 92.1% and 92.5%. Immunity was similar between the 2 groups except for mumps, where significantly more nurses were immune. The positive and negative predictive values for the history of varicella to predict immunity in all participants were 95% and 13.5%, respectively. A small but important proportion of our healthcare workers are still susceptible to measles, mumps, rubella, and varicella. In addition, the recall history to varicella showed suboptimal ability to predict immunity.

  20. The "fourth disease" of childhood: reevaluation of a nonexistent disease.

    PubMed

    Morens, D M; Katz, A R

    1991-09-15

    Observed and described between 1884 and 1900, "fourth disease" (Dukes disease) followed measles, scarlet fever, and rubella as the fourth clinically characterized childhood exanthem. Like rubella ("third disease") and erythema infectiosum ("fifth disease"), accepted by the medical community at about the same time, the existence of fourth disease was initially controversial. Over the following decades descriptions of hundreds of cases, outbreaks, and laboratory studies were published in the indexed medical literature. Unlike rubella and fifth disease, however, fourth disease was not subsequently proven to exist by either epidemiologic criteria or isolation of an etiologic agent. By the 1930s, it was infrequently recognized and by the 1960s had been dropped from textbooks. In this study, the authors use epidemiologic methods to reevaluate published data on English schoolchildren from 1892 to 1900 upon which the original fourth disease claim of Dukes was based. The authors conclude that fourth disease never existed. Reinterpretation of the original data suggests that cases can be completely explained as misdiagnosed rubella and scarlet fever. Misidentification of fourth disease is attributed to failures in the critical abilities of the medical and scientific communities at the time. The implications of erroneously identifying a nonexistent disease suggest that modern scientific approaches to disease identification are sound.

  1. Impact of State Public Health Spending on Disease Incidence in the United States from 1980 to 2009.

    PubMed

    Verma, Reetu; Clark, Samantha; Leider, Jonathon; Bishai, David

    2017-02-01

    To understand the relationship between state-level spending by public health departments and the incidence of three vaccine preventable diseases (VPDs): mumps, pertussis, and rubella in the United States from 1980 to 2009. This study uses state-level public health spending data from The Census Bureau and annual mumps, pertussis, and rubella incidence counts from the University of Pittsburgh's project Tycho. Ordinary least squares (OLS), fixed effects, and random effects regression models were tested, with results indicating that a fixed effects model would be most appropriate model for this analysis. Model output suggests a statistically significant, negative relationship between public health spending and mumps and rubella incidence. Lagging outcome variables indicate that public health spending actually has the greatest impact on VPD incidence in subsequent years, rather than the year in which the spending occurred. Results were robust to models with lagged spending variables, national time trends, and state time trends, as well as models with and without Medicaid and hospital spending. Our analysis indicates that there is evidence of a significant, negative relationship between a state's public health spending and the incidence of two VPDs, mumps and rubella, in the United States. © Health Research and Educational Trust.

  2. Isolation of infectious Zika virus from a urine sample cultured in SIRC cells from a patient suspected of having rubella virus.

    PubMed

    Oliveira, Maria Isabel de; Namiyama, Gislene Mitsue; Cabral, Gabriela Bastos; Ferreira, João Leandro; Taniwaki, Noemi; Afonso, Ana Maria Sardinha; Lima, Isabella Rillo; Brigido, Luís Fernando Macedo de

    2018-01-01

    A great variety of viruses which cause exanthema share other clinical manifestations, making the etiologic identification a very difficult task, relying exclusively on the clinical examination. Rubella virus (RV) infection during the early stages of pregnancy can lead to serious birth defects, known as congenital rubella syndrome (CRS). In the present report, we described the presence of Zika virus (ZIKV) particles in urine samples and also ZIKV isolation in SIRC cells from the urine of a patient in acute phase of suspected rubella disease. The 50-year-old unvaccinated woman living in Sao Paulo, Brazil, was admitted to the emergency room with fever, headache, rash, arthralgia and prostration. Urine samples were collected for virus isolation and RT-qPCR. SIRC and Vero cells were inoculated with urine samples during 7 days. RT-qPCR was performed using measles virus (MV) and RV primers and both were found to be negative. After this result, RT-qPCR was performed for parvovirus B19, herpes virus 6 and ZIKV. The urine sample and the isolate were positive by Real Time PCR for ZIKV and negative for all other viruses tested. The sequences isolated are from the Asiatic lineage.

  3. Persistent Infection of Human Fetal Endothelial Cells with Rubella Virus

    PubMed Central

    Perelygina, Ludmila; Zheng, Qi; Metcalfe, Maureen; Icenogle, Joseph

    2013-01-01

    Cardiovascular abnormalities are the leading cause of neonatal death among patients with congenital rubella syndrome (CRS). Although persistence of rubella virus (RV) in fetal endothelium has been repeatedly suggested as a possible cause of cardiovascular birth defects, evidence of the permissiveness of fetal endothelial cells to RV is lacking. In this study we evaluated the ability of RV to infect and persist in primary fetal endothelial cells derived from human umbilical vein (HUVEC). We found that wild type (wt) low passage clinical RV productively infected HUVEC cultures without producing cytopathology or ultrastructural changes. RV did not inhibit host cell protein synthesis, cell proliferation, or interfere with the cell cycle. Persistently infected cultures were easily established at low and high multiplicities of infection (MOI) with both laboratory and wt clinical RV strains. However, synchronous infections of entire HUVEC monolayers were only observed with clinical RV strains. The release of infectious virions into media remained at consistently high levels for several subcultures of infected HUVEC. The results indicate that macrovascular fetal endothelial cells are highly permissive to RV and allow slow persistent RV replication. The findings provide more evidence for the suggestion that vascular pathologies in CRS are triggered by persistent rubella virus infection of the endothelium. PMID:23940821

  4. Fulminant encephalitis associated with a vaccine strain of rubella virus.

    PubMed

    Gualberto, Felipe Augusto Souza; de Oliveira, Maria Isabel; Alves, Venancio A F; Kanamura, Cristina T; Rosemberg, Sérgio; Sato, Helena Keico; Arantes, Benedito A F; Curti, Suely Pires; Figueiredo, Cristina Adelaide

    2013-12-01

    Involvement of the central nervous system is common in measles, but rare in rubella. However, rubella virus (RV) can cause a variety of central nervous system syndromes, including meningitis, encephalitis, Guillain-Barré syndrome and sub acute sclerosing panencephalitis. We report the occurrence of one fatal case of the encephalitis associated with measles-rubella (MR) vaccine during an immunization campaign in São Paulo, Brazil. A 31 year-old-man, previously in good health, was admitted at emergency room, with confusion, agitation, inability to stand and hold his head up. Ten days prior to admission, he was vaccinated with combined MR vaccine (Serum Institute of India) and three days later he developed 'flu-like' illness with fever, myalgia and headache. Results of clinical and laboratory exams were consistent with a pattern of viral encephalitis. During hospitalization, his condition deteriorated rapidly with tetraplegia and progression to coma. On the 3rd day of hospitalization he died. Histopathology confirmed encephalitis and immunohistochemistry was positive for RV on brain tissue. RV was also detected by qPCR and virus isolation in cerebrospinal fluid, brain and other clinical samples. The sequence obtained from the isolated virus was identical to that of the RA 27/3 vaccine strain. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Safety and immunogenicity of inactivated poliovirus vaccine when given with measles-rubella combined vaccine and yellow fever vaccine and when given via different administration routes: a phase 4, randomised, non-inferiority trial in The Gambia.

    PubMed

    Clarke, Ed; Saidu, Yauba; Adetifa, Jane U; Adigweme, Ikechukwu; Hydara, Mariama Badjie; Bashorun, Adedapo O; Moneke-Anyanwoke, Ngozi; Umesi, Ama; Roberts, Elishia; Cham, Pa Modou; Okoye, Michael E; Brown, Kevin E; Niedrig, Matthias; Chowdhury, Panchali Roy; Clemens, Ralf; Bandyopadhyay, Ananda S; Mueller, Jenny; Jeffries, David J; Kampmann, Beate

    2016-08-01

    The introduction of the inactivated poliovirus vaccine (IPV) represents a crucial step in the polio eradication endgame. This trial examined the safety and immunogenicity of IPV given alongside the measles-rubella and yellow fever vaccines at 9 months and when given as a full or fractional dose using needle and syringe or disposable-syringe jet injector. We did a phase 4, randomised, non-inferiority trial at three periurban government clinics in west Gambia. Infants aged 9-10 months who had already received oral poliovirus vaccine were randomly assigned to receive the IPV, measles-rubella, and yellow fever vaccines, singularly or in combination. Separately, IPV was given as a full intramuscular or fractional intradermal dose by needle and syringe or disposable-syringe jet injector at a second visit. The primary outcomes were seroprevalence rates for poliovirus 4-6 weeks post-vaccination and the rate of seroconversion between baseline and post-vaccination serum samples for measles, rubella, and yellow fever; and the post-vaccination antibody titres generated against each component of the vaccines. We did a per-protocol analysis with a non-inferiority margin of 10% for poliovirus seroprevalence and measles, rubella, and yellow fever seroconversion, and (1/3) log2 for log2-transformed antibody titres. This trial is registered with ClinicalTrials.gov, number NCT01847872. Between July 10, 2013, and May 8, 2014, we assessed 1662 infants for eligibility, of whom 1504 were enrolled into one of seven groups for vaccine interference and one of four groups for fractional dosing and alternative route of administration. The rubella and yellow fever antibody titres were reduced by co-administration but the seroconversion rates achieved non-inferiority in both cases (rubella, -4·5% [95% CI -9·5 to -0·1]; yellow fever, 1·2% [-2·9 to 5·5]). Measles and poliovirus responses were unaffected (measles, 6·8% [95% CI -1·4 to 14·9]; poliovirus serotype 1, 1·6% [-6·7 to 4·7]; serotype 2, 0·0% [-2·1 to 2·1]; serotype 3, 0·0% [-3·8 to 3·9]). Poliovirus seroprevalence was universally high (>97%) after vaccination, but the antibody titres generated by fractional intradermal doses of IPV did not achieve non-inferiority compared with full dose. The number of infants who seroconverted or had a four-fold rise in titres was also lower by the intradermal route. There were no safety concerns. The data support the future co-administration of IPV, measles-rubella, and yellow fever vaccines within the Expanded Programme on Immunization schedule at 9 months. The administration of single fractional intradermal doses of IPV by needle and syringe or disposable-syringe jet injector compromises the immunity generated, although it results in a high post-vaccination poliovirus seroprevalence. Bill & Melinda Gates Foundation. Copyright © 2016 Clarke et al. Open Access article distributed under the terms of CC BY. Published by Elsevier Ltd.. All rights reserved.

  6. Slow Progress In Finalizing Measles And Rubella Elimination In The European Region.

    PubMed

    Biellik, Robin; Davidkin, Iria; Esposito, Susanna; Lobanov, Andrey; Kojouharova, Mira; Pfaff, Günter; Santos, José Ignacio; Simpson, John; Mamou, Myriam Ben; Butler, Robb; Deshevoi, Sergei; Huseynov, Shahin; Jankovic, Dragan; Shefer, Abigail

    2016-02-01

    All countries in the World Health Organization European Region committed to eliminating endemic transmission of measles and rubella by 2015, and disease incidence has decreased dramatically. However, there was little progress between 2012 and 2013, and the goal will likely not be achieved on time. Genuine political commitment, increased technical capacity, and greater public awareness are urgently needed, especially in Western Europe. Project HOPE—The People-to-People Health Foundation, Inc.

  7. Immunogenicity and safety of early vaccination with two doses of a combined measles-mumps-rubella-varicella vaccine in healthy Indian children from 9 months of age: a phase III, randomised, non-inferiority trial.

    PubMed

    Lalwani, Sanjay; Chatterjee, Sukanta; Balasubramanian, Sundaram; Bavdekar, Ashish; Mehta, Shailesh; Datta, Sanjoy; Povey, Michael; Henry, Ouzama

    2015-09-11

    This study (NCT00969436) compared the immunogenicity and safety of measles-mumps-rubella (MMR) followed by MMR+varicella (V) vaccines to (1) 2 doses of combined MMRV and (2) MMR followed by MMRV, in Indian children. Phase III, open, randomised, non-inferiority study. 6 tertiary care hospitals located in India. Healthy participants aged 9-10 months not previously vaccinated against/exposed to measles, mumps, rubella and varicella or without a history of these diseases. Participants were randomised (2:2:1) to receive 2 doses of either MMRV (MMRV/MMRV group) or MMR followed by MMRV (MMR/MMRV group) or MMR followed by MMR+V (MMR/MMR+V, control group) at 9 and 15 months of age. Antibody titres against measles, mumps and rubella were measured using ELISA and against varicella using an immunofluorescence assay. To demonstrate non-inferiority of the 2 vaccination regimens versus the control in terms of seroconversion rates, defined as a group difference with a lower bound of the 95% CI >-10% for each antigen, 43 days postdose 2. Parents/guardians recorded solicited local and general symptoms for a 4-day and 43-day period after each vaccine dose, respectively. Seroconversion rates postdose 1 ranged from 87.5% to 93.2% for measles, 83.3% to 86.1% for mumps and 98.7% to 100% for rubella across the 3 vaccine groups. The seroconversion rates postdose 2 were 100% for measles, mumps and rubella and at least 95.8% for varicella across the 3 vaccine groups. Non-inferiority of MMRV/MMRV and MMR/MMRV to MMR/MMR+V was achieved for all antigens, 43 days postdose 2. The 3 vaccination regimens were generally well tolerated in terms of solicited local and general symptoms. The immune responses elicited by the MMRV/MMRV and MMR/MMRV vaccination regimens were non-inferior to those elicited by the MMR/MMR+V regimen for all antigens. The 3 vaccination schedules also exhibited an acceptable safety profile in Indian children. NCT00969436. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  8. An outbreak investigation of congenital rubella syndrome in Solomon Islands, 2013

    PubMed Central

    Durski, Kara N; Tituli, Carol; Ogaoga, Divi; Joshua, Cynthia; Dofai, Alfred; Leydon, Jennie; Nilles, Eric

    2016-01-01

    Introduction During May 2012, a rubella outbreak was declared in Solomon Islands. A suspected case of congenital rubella syndrome (CRS) was reported from one hospital 11 months later in 2013. This report describes the subsequent CRS investigation, findings and measures implemented. Methods Prospective CRS surveillance was conducted at the newborn nursery, paediatric and post-natal wards, and the paediatric cardiology and ophthalmology clinics of the study hospital from April to July 2013. Retrospective case finding by reviewing medical records was also undertaken to identify additional cases born between January and March 2013 for the same wards and clinics. Cases were identified using established World Health Organization case definitions for CRS. Results A total of 13 CRS cases were identified, including two laboratory-confirmed, four clinically confirmed and seven suspected cases. Five CRS cases were retrospectively identified, including four suspected and one clinically confirmed case. There was no geospatial clustering of residences. The mothers of the cases were aged between 20 and 36 years. Three of the six mothers available for interview recalled an acute illness with rash during the first trimester of pregnancy. Discussion Additional CRS cases not captured in this investigation are likely. Caring for CRS cases is a challenge in resource-poor settings. Rubella vaccination is safe and effective and can prevent the serious consequences of CRS. Well planned and funded vaccination activities can prevent future CRS cases. PMID:27757248

  9. Echocardiography findings in clinically confirmed congenital rubella syndrome cases seen at the University of Port Harcourt Teaching Hospital, Nigeria.

    PubMed

    Otaigbe, B E; Tabansi, P N; Agbedey, G O

    2012-01-01

    Congenital rubella syndrome (CRS) is known to affect thousands of children in the developing world because rubella vaccination is not available routinely in most of these countries. Among its many manifestations only congenital heart disease is life threatening. This study was undertaken to ascertain the cases of echocardiographic determined congenital heart disease in clinically confirmed CRS cases. Data of patients with clinically confirmed CRS seen over a period of 5 years in the Paediatric cardiology clinic of the University of Port Harcourt Teaching Hospital was retrieved and analysed. Seven cases (2.8 % of total cardiac cases) were seen. 6 (85.7%) cases had at least one murmur on auscultation. Patent ductus arteriosus was the commonest cardiac defect seen either in isolation or incombination with a VSD or ASD. Only one child had no cardiac defect. 4 (57.1%) of them had been admitted for heart failure at least once and 2 (28.6 %) were on anti-failure regimen, one of whom had cardiac surgery one month ago. In view of the fact that 6 (85.7%) of the patients with CRS had at least one congenital heart defect, we advocate routine echocardiography on patients with CRS to ensure early treatment and reduce mortality and morbidity.We also advocate that rubella vaccination be given routinely in developing countries.

  10. Vaccination against rubella: Analysis of the temporal evolution of the age-dependent force of infection and the effects of different contact patterns

    NASA Astrophysics Data System (ADS)

    Amaku, M.; Coutinho, F. A.; Azevedo, R. S.; Burattini, M. N.; Lopez, L. F.; Massad, E.

    2003-05-01

    In this paper, we analyze the temporal evolution of the age-dependent force of infection and incidence of rubella, after the introduction of a very specific vaccination program in a previously nonvaccinated population where rubella was in endemic steady state. We deduce an integral equation for the age-dependent force of infection, which depends on a number of parameters that can be estimated from the force of infection in a steady state prior to the vaccination program. We present the results of our simulations, which are compared with observed data. We also examine the influence of contact patterns among members of a community on the age-dependent intensity of transmission of rubella and on the results of vaccination strategies. As an example of the theory proposed, we calculate the effects of vaccination strategies for four communities from Caieiras (Brazil), Huixquilucan (Mexico), Finland, and the United Kingdom. The results for each community differ considerably according to the distinct intensity and pattern of transmission in the absence of vaccination. We conclude that this simple vaccination program is not very efficient (very slow) in the goal of eradicating the disease. This gives support to a mixed strategy, proposed by Massad et al., accepted and implemented by the government of the State of São Paulo, Brazil.

  11. Immunolocalization and Distribution of Rubella Antigen in Fatal Congenital Rubella Syndrome

    PubMed Central

    Lazar, Mihaela; Perelygina, Ludmila; Martines, Roosecelis; Greer, Patricia; Paddock, Christopher D.; Peltecu, Gheorghe; Lupulescu, Emilia; Icenogle, Joseph; Zaki, Sherif R.

    2015-01-01

    Background An estimated 100,000 cases of congenital rubella syndrome (CRS) occur worldwide each year. The reported mortality rate for infants with CRS is up to 33%. The cellular mechanisms responsible for the multiple congenital defects in CRS are presently unknown. Here we identify cell types positive for rubella virus (RV) in CRS infants. Methods Cells and organs involved in RV replication were identified in paraffin-embedded autopsy tissues from three fatal case-patients by histopathologic examination and immunohistochemical (IHC) staining using a rabbit polyclonal RV antibody. Normal rabbit antisera and RV antisera preabsorbed with highly purified RV served as negative controls. Results RV antigen was found in interstitial fibroblasts in the heart, adventitial fibroblasts of large blood vessels, alveolar macrophages, progenitor cells of the outer granular layer of the brain, and in capillary endothelium and basal plate in the placenta. The antibody specificity was verified by IHC staining of multiple tissue sections from other infectious disease cases. RV infection of each cell type is consistent with abnormalities which have been identified in patients with CRS, in the heart, large blood vessels, and brain. Antigen distribution was consistent with inflammatory response to vascular injury and systemic spread of RV. Conclusions The identification of RV positive cell types in CRS is important to better understand the pathology and pathogenesis of CRS. PMID:26870820

  12. An outbreak investigation of congenital rubella syndrome in Solomon Islands, 2013.

    PubMed

    Durski, Kara N; Tituli, Carol; Ogaoga, Divi; Musto, Jennie; Joshua, Cynthia; Dofai, Alfred; Leydon, Jennie; Nilles, Eric

    2016-01-01

    During May 2012, a rubella outbreak was declared in Solomon Islands. A suspected case of congenital rubella syndrome (CRS) was reported from one hospital 11 months later in 2013. This report describes the subsequent CRS investigation, findings and measures implemented. Prospective CRS surveillance was conducted at the newborn nursery, paediatric and post-natal wards, and the paediatric cardiology and ophthalmology clinics of the study hospital from April to July 2013. Retrospective case finding by reviewing medical records was also undertaken to identify additional cases born between January and March 2013 for the same wards and clinics. Cases were identified using established World Health Organization case definitions for CRS. A total of 13 CRS cases were identified, including two laboratory-confirmed, four clinically confirmed and seven suspected cases. Five CRS cases were retrospectively identified, including four suspected and one clinically confirmed case. There was no geospatial clustering of residences. The mothers of the cases were aged between 20 and 36 years. Three of the six mothers available for interview recalled an acute illness with rash during the first trimester of pregnancy. Additional CRS cases not captured in this investigation are likely. Caring for CRS cases is a challenge in resource-poor settings. Rubella vaccination is safe and effective and can prevent the serious consequences of CRS. Well planned and funded vaccination activities can prevent future CRS cases.

  13. Phylogenetic Analysis of Rubella Virus Strains from an Outbreak in Madrid, Spain, from 2004 to 2005 ▿ †

    PubMed Central

    Martínez-Torres, A. O.; Mosquera, M. M.; Sanz, J. C.; Ramos, B.; Echevarría, J. E.

    2009-01-01

    An outbreak of rubella affected 460 individuals in 2004 and 2005 in the community of Madrid, Spain. Most of the patients were nonvaccinated Latin American immigrants or Spanish males. This study presents the first data on rubella virus genotypes in Spain. Forty selected clinical samples (2 urine, 5 serum, 3 blood, 2 saliva, and 28 pharyngeal exudate samples) from 40 cases were collected. The 739-nucleotide sequence recommended by the World Health Organization obtained from viral RNA in these samples was analyzed by using the MEGA v4.0 software. Seventeen isolates were obtained from 40 clinical samples from the outbreak, including two isolated from congenital rubella syndrome cases. Only viral RNA of genotype 1j was detected in both isolates and clinical specimens. Two variations in amino acids, G253C and T394S, which are involved in neutralization epitopes arose during the outbreak, but apparently there was no positive selection of either of them. The origin of the outbreak remains unknown because of poor virologic surveillance in Latin America and the African countries neighboring Spain. On the other hand, this is the first report of this genotype in Europe. The few published sequences of genotype 1j indicate that it comes from Japan and the Philippines, but there are no epidemiological data supporting this as the origin of the Madrid outbreak. PMID:19020066

  14. Do HIV-positive adult immigrants need to be screened for measles-mumps-rubella and varicella zoster virus immunization?

    PubMed

    Llenas-García, Jara; Rubio, Rafael; Hernando, Asunción; Arrazola, Pilar; Pulido, Federico

    2013-08-01

    A systematic screening for measles, mumps, rubella (MMR) and varicella zoster virus (VZV) in HIV-positive adult immigrants in Spain was evaluated, and factors associated with MMR and VZV vaccines' indication were studied. Every HIV-positive immigrant was tested for VZV and MMR-IgG. MMR vaccine was indicated to patients with lymphocytes CD4+ >200 cells/mm³ and a negative measles-IgG, a negative mumps-IgG and/or a negative rubella-IgG. VZV vaccine was indicated to every VZV-IgG negative patient with CD4+ >400 cells/mm³. In total, 289 patients were screened; seroprevalence was 95.2%, 92.2%, 70.3% and 89.3% for VZV, measles, mumps and rubella IgG, respectively. Having a negative VZV-IgG was statistically associated with coming from sub-Saharan Africa (prevalence ratio [PR]: 6.52; 95% CI: 1.71-24.84; p=0.006), while having secondary education was a protective factor (PR: 0.25; 95% CI: 0.07-0.97; p=0.045). Fourteen patients (4.8%) had indication of VZV vaccine; vaccination was feasible in 21.4% of them at first visit. Eighty-one patients (29.7%) had indication of MMR vaccine, most of them due to mumps-IgG negative (53.1%) or rubella-IgG negative (24.7%). Age < 30 years at first visit was the only factor statistically associated with MMR vaccine indication (PR: 1.47; 95% CI: 1.02-2.11; p=0.04). According to CD4+ cell counts, vaccination was feasible in 71.6% of patients at first visit. In conclusion, more than a third of HIV-infected immigrant patients are susceptible to at least one easily preventable infectious disease. Especial attention should be given to immigrant women of childbearing age.

  15. Two-year antibody persistence in children vaccinated at 12-15 months with a measles-mumps-rubella virus vaccine without human serum albumin.

    PubMed

    Berry, Andrea A; Abu-Elyazeed, Remon; Diaz-Perez, Clemente; Mufson, Maurice A; Harrison, Christopher J; Leonardi, Michael; Twiggs, Jerry D; Peltier, Christopher; Grogg, Stanley; Carbayo, Antonio; Shapiro, Steven; Povey, Michael; Baccarini, Carmen; Innis, Bruce L; Henry, Ouzama

    2017-07-03

    One combined measles-mumps-rubella (MMR) vaccine without Human Serum Albumin (HSA) is currently licensed in the USA (M-M-R II; Merck, USA) and another has been developed (Priorix™ [MMR-RIT, GSK, Belgium]). In this follow-up study, children from USA or Puerto Rico, who had received one dose of M-M-R II or MMR-RIT at 12-15 months of age in the primary study (NCT00861744), were followed-up for 2 y post-vaccination. Anti-measles and anti-rubella antibodies were measured using Enzyme-Linked Immunosorbent Assay (ELISA), and anti-mumps antibodies using ELISA and plaque reduction neutralization (PRN) assays. Serious adverse events (SAEs) were recorded during the entire follow-up. The according-to-protocol (ATP) persistence cohort included 752 children (M-M-R II = 186, MMR-RIT = 566), who received primary vaccination at a mean age of 12.3 ( ± 0.67) months. 104 children were revaccinated with MMR-containing vaccines; therefore, serology results for timepoints after revaccination were excluded from the analysis. Seropositivity for measles (Year 1≥ 98.3%; Year 2≥ 99.4%) and rubella (Year 1≥ 98.9%; Year 2 = 100%) remained as high at Year 2 as at Day 42. Similarly, seropositivity for mumps determined by ELISA (Year 1≥ 90.1%; Year 2≥ 94.1%) and PRN assays (Year 1≥ 87.5%; Year 2≥ 91.7%) persisted. Thirty-three SAEs were recorded in 23 children; 2 SAEs (inguinal adenitis and idiopathic thrombocytopenic purpura) and one SAE (febrile convulsion) were considered as potentially related to MMR-RIT and M-M-R II, respectively. This study showed that antibodies against measles, mumps and rubella persisted for up to 2 y post-vaccination with either MMR vaccine in children aged 12-15 months, and that both vaccines were well-tolerated during the follow-up period.

  16. Immunity to Measles, Mumps, and Rubella in US Children With Perinatal HIV Infection or Perinatal HIV Exposure Without Infection.

    PubMed

    Siberry, George K; Patel, Kunjal; Bellini, William J; Karalius, Brad; Purswani, Murli U; Burchett, Sandra K; Meyer, William A; Sowers, Sun Bae; Ellis, Angela; Van Dyke, Russell B

    2015-09-15

    Children with perinatal human immunodeficiency virus (HIV) infection (PHIV) may not be protected against measles, mumps, and rubella (MMR) because of impaired initial vaccine response or waning immunity. Our objectives were to estimate seroimmunity in PHIV-infected and perinatally HIV-exposed but uninfected (HEU) children and identify predictors of immunity in the PHIV cohort. PHIV and HEU children were enrolled in the Pediatric HIV/AIDS Cohort Study (PHACS) at ages 7-15 years from 2007 to 2009. At annual visits, demographic, laboratory, immunization, and clinical data were abstracted and serologic specimens collected. Most recent serologic specimen was used to determine measles seroprotection by plaque reduction neutralization assay and rubella seroprotection and mumps seropositivity by enzyme immunoassay. Sustained combination antiretroviral therapy (cART) was defined as taking cART for at least 3 months. Among 428 PHIV and 221 HEU PHACS participants, the prevalence was significantly lower in PHIV children for measles seroprotection (57% [95% confidence interval {CI}, 52%-62%] vs 99% [95% CI, 96%-100%]), rubella seroprotection (65% [95% CI, 60%-70%] vs 98% [95% CI, 95%-100%]), and mumps seropositivity (59% [95% CI, 55%-64%] vs 97% [95% CI, 94%-99%]). On multivariable analysis, greater number of vaccine doses while receiving sustained cART and higher nadir CD4 percentage between last vaccine dose and serologic testing independently improved the cumulative prediction of measles seroprotection in PHIV. Predictors of rubella seroprotection and mumps seropositivity were similar. High proportions of PHIV-infected children, but not HEU children, lack serologic evidence of immunity to MMR, despite documented immunization and current cART. Effective cART before immunization is a strong predictor of current seroimmunity. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  17. History repeats itself in Japan: Failure to learn from rubella epidemic leads to failure to provide the HPV vaccine.

    PubMed

    Tanaka, Yusuke; Ueda, Yutaka; Yoshino, Kiyoshi; Kimura, Tadashi

    2017-08-03

    Eradication of vaccine-preventable diseases is one of the most important goals of public health interventions. Herd immunity can be established by national vaccination programs. However, once the national vaccination program stops for any reason, unprotected group will be generated depending on an unfortunate year of birth. Currently, there are 2 major concerns regarding vaccine cohort gaps in Japan: one is for the rubella vaccine, the other for the human papillomavirus (HPV) vaccine.

  18. A modified haemagglutination inhibition test for rubella antibodies, using standardized, freeze-dried reagents. Report of a comparative multi-centre trial.

    PubMed Central

    van Weemen, B.; Kacaki, J.

    1976-01-01

    A modified haemagglutination inhibition test for rubella antibodies, using standardized freeze-dried reagents, was developed and compared with haemagglutination inhibition tests using fresh erythrocytes. This comparison was made in collaboration with six European laboratories. A total of 4205 serum samples were tested. The results show that: (1) Sensitivity and reliability of the modified test are good; (2) the modified test can be performed in polystyrene microtitration plates. PMID:789763

  19. [Adult-onset opsoclonus-myoclonus-ataxia syndrome revealing rubella meningoencephalitis].

    PubMed

    Nasri, A; Mansour, M; Messelmani, M; Riahi, A; Derbali, H; Bedoui, I; Zaouali, J; Mrissa, R

    2016-12-01

    Opsoclonus-myoclonus-ataxia (OMS) is a rare clinical syndrome, of paraneoplastic infectious, post-infectious, post-vaccinal or idiopathic origin. We report a 24-year-old young man who presented with gait disorder preceded by a febrile rash and retroauricular lymph nodes. Three days before admission, he had headache, vertigo, nausea and vomiting followed by gait unsteadiness and movement disorders of limbs and eyes. On examination, he had OMS syndrome. Brain MRI, total body scan, MIBG scintigraphy, tumor markers and onconeural antibodies were normal. Cerebro-spinal fluid (CSF) analysis showed lymphocytic meningitis. Positive serum and CSF immunoglobulin M antibody against rubella virus was demonstrated. He received acyclovir with full recovery within two weeks. We discuss the peculiarities of this association with a literature review. This observation enlarges the spectrum of neurological manifestations of rubella as well as that of OMS etiologies. Copyright © 2016 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  20. Influences on immunization rates: Vaccination coverage of mumps, measles, rubella and varicella before and after the STIKO intervention 2011 - A retrospective study.

    PubMed

    Sanftenberg, Linda; Schrörs, Hans-Jürgen; Schelling, Jörg

    2016-07-25

    In September 2011, the German Standing Committee on Vaccinations (STIKO) changed their recommendation regarding the mumps-measles-rubella-varicella vaccination (MMRV). We compared the immunization rates against MMRV in Germany before and after the STIKO intervention. We recorded the immunization status of children born between 09/2008 and 08/2012 in 35 selected doctor's surgeries in Germany. After the STIKO intervention, the ratio of the combined MMRV vaccine as the first dose immunization was reduced to approximately 25% of the initial value. A slight increase in the number of children not sufficiently vaccinated against varicella (1.2%) was observed, but the immunization rates against measles, mumps, rubella and varicella did not significantly decrease. The STIKO intervention led to a significant change in physicians' vaccination procedures. The separate administration MMR+V vaccination may be a helpful option to improve the immunization rates in general. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Mandatory vaccinations in European countries, undocumented information, false news and the impact on vaccination uptake: the position of the Italian pediatric society.

    PubMed

    Bozzola, Elena; Spina, Giulia; Russo, Rocco; Bozzola, Mauro; Corsello, Giovanni; Villani, Alberto

    2018-06-14

    High rates of vaccination coverage are important in preventing infectious diseases. Enforcing mandatory vaccinations is one of the strategies that some Countries adopted to protect the community when vaccination coverage is not satisfactory. In Italy, in 2017 vaccination against diphtheria, tetanus, pertussis, hepatitis B, poliovirus, Haemophilus influenzae type b, measles, mumps, rubella and varicella became compulsory in childhood. In order to contrast vaccination policies, anti-vaccination campaigns contribute to the spread of fake news. Among them, there is the false information that Italy is the only one country with mandatory vaccination policy. Aim of our study is confronting vaccination policies in children under 18 months against among different European countries for the following vaccines: diphtheria, tetanus, pertussis, hepatitis B, poliovirus, Haemophilus influenzae type b, measles, mumps, rubella and varicella. Information on policies of mandatory or recommended vaccinations of the European Countries were gathered by ECDC and compared to the Italian one. European Countries recommend or contemplate compulsory vaccines. Among them, eleven Countries (35.4%) have mandatory vaccinations for at least one out of diphtheria, tetanus, pertussis, hepatitis B, poliovirus, Haemophilus influenzae type b, measles, mumps, rubella and varicella vaccine. Not only in Italy, vaccination against diphtheria, tetanus, pertussis, hepatitis B, poliovirus, Haemophilus influenzae type b, measles, mumps, rubella and varicella is mandatory in children under 18 months. Other European countries adopted compulsory policies in order to prevent the spread of infectious diseases and to protect the community.

  2. Detection of measles, mumps and rubella viruses by immuno-colorimetric assay and its application in focus reduction neutralization tests.

    PubMed

    Vaidya, Sunil R; Kumbhar, Neelakshi S; Bhide, Vandana S

    2014-12-01

    Measles, mumps and rubella are vaccine-preventable diseases; however limited epidemiological data are available from low-income or developing countries. Thus, it is important to investigate the transmission of these viruses in different geographical regions. In this context, a cell culture-based rapid and reliable immuno-colorimetric assay (ICA) was established and its utility studied. Twenty-three measles, six mumps and six rubella virus isolates and three vaccine strains were studied. Detection by ICA was compared with plaque and RT-PCR assays. In addition, ICA was used to detect viruses in throat swabs (n = 24) collected from patients with suspected measles or mumps. Similarly, ICA was used in a focus reduction neutralization test (FRNT) and the results compared with those obtained by a commercial IgG enzyme immuno assay. Measles and mumps virus were detected 2 days post-infection in Vero or Vero-human signaling lymphocytic activation molecule cells, whereas rubella virus was detected 3 days post-infection in Vero cells. The blue stained viral foci were visible by the naked eye or through a magnifying glass. In conclusion, ICA was successfully used on 35 virus isolates, three vaccine strains and clinical specimens collected from suspected cases of measles and mumps. Furthermore, an application of ICA in a neutralization test (i.e., FRNT) was documented; this may be useful for sero-epidemiological, cross-neutralization and pre/post-vaccine studies. © 2014 The Societies and Wiley Publishing Asia Pty Ltd.

  3. TORCH seroprevalence among patients attending Obstetric Care Clinic of Haydarpasa Training and Research Hospital affiliated to Association of Istanbul Northern Anatolia Public Hospitals.

    PubMed

    Numan, Onur; Vural, Fisun; Aka, Nurettin; Alpay, Murat; Coskun, Ayse Deniz Erturk

    2015-01-01

    Toxoplasma gondii, Rubella, Cytomegalovirus and Herpes simplex viruses are microorganisms that cause congenital infections and they are called briefly as TORCH. There is an ongoing argument for the screening of reproductive age women due to the high cost of tests. For a test to be used in screening, prevalence of disease in this population should be known. The aim of this study was to investigate TORCH seroprevalence among women attending a teaching hospital in Istanbul. A total of 1101 patients attending outpatient clinic of Obstetric Care Clinic of Haydarpasa Training and Research Hospital affiliated to Association of Istanbul Northern Anatolia Public Hospitals between September 2013 to January 2015 and their laboratory data were evaluated retrospectively. We investigated Ig G and M seropositivity rates against TORCH. The age of the patients ranged between 17-47 years with a mean age of 30.3±5.8 years. Pregnant population had 99.5% anti-CMV Ig G (+), 94.2% anti-Rubella Ig G (+), 31% anti-Toxoplasma Ig G (+). Seroprevalence for Anti IgM was 0.5% for CMV, 0.2% for rubella. The screening for Toxoplasma gondii may be suggested since the prevalence is not high in our population. The screening of CMV is not meaningful, due to high seroprevalence. Although seroprevalence of rubella is also high, it may be suggested for preconception vaccination especially in women above 20 years of age born prior to National Vaccination Programme.

  4. Evaluation of measles and rubella integrated surveillance system in Apulia region, Italy, 3 years after its introduction.

    PubMed

    Turiac, I A; Fortunato, F; Cappelli, M G; Morea, A; Chironna, M; Prato, Rosa; Martinelli, D

    2018-04-01

    This study aimed at evaluating the integrated measles and rubella surveillance system (IMRSS) in Apulia region, Italy, from its introduction in 2013 to 30 June 2016. Measles and rubella case reports were extracted from IMRSS. We estimated system sensitivity at the level of case reporting, using the capture-recapture method for three data sources. Data quality was described as the completeness of variables and timeliness of notification as the median-time interval from symptoms onset to initial alert. The proportion of suspected cases with laboratory investigation, the rate of discarded cases and the origin of infection were also computed. A total of 127 measles and four rubella suspected cases were reported to IMRSS and 82 were laboratory confirmed. Focusing our analysis on measles, IMRSS sensitivity was 82% (95% CI: 75-87). Completeness was >98% for mandatory variables and 57% for 'genotyping'. The median-time interval from symptoms onset to initial alert was 4.5 days, with a timeliness of notification of 33% (41 cases reported ⩽48 h). The proportion of laboratory investigation was 87%. The rate of discarded cases was 0.1 per 100 000 inhabitants per year. The origin of infection was identified for 85% of cases. It is concluded that IMRSS provides good quality data and has good sensitivity; still efforts should be made to improve the completeness of laboratory-related variables, timeliness and to increase the rate of discarded cases.

  5. Association of infectious mononucleosis with multiple sclerosis. A population-based study.

    PubMed

    Ramagopalan, Sreeram V; Valdar, William; Dyment, David A; DeLuca, Gabriele C; Yee, Irene M; Giovannoni, Gavin; Ebers, George C; Sadovnick, A Dessa

    2009-01-01

    Genetic and environmental factors have important roles in multiple sclerosis (MS) susceptibility. Several studies have attempted to correlate exposure to viral illness with the subsequent development of MS. Here in a population-based Canadian cohort, we investigate the relationship between prior clinical infection or vaccination and the risk of MS. Using the longitudinal Canadian database, 14,362 MS index cases and 7,671 spouse controls were asked about history of measles, mumps, rubella, varicella and infectious mononucleosis as well as details about vaccination with measles, mumps, rubella, hepatitis B and influenza vaccines. Comparisons were made between cases and spouse controls. Spouse controls and stratification by sex appear to correct for ascertainment bias because with a single exception we found no significant differences between cases and controls for all viral exposures and vaccinations. However, 699 cases and 165 controls reported a history of infectious mononucleosis (p < 0.001, corrected odds ratio 2.06, 95% confidence interval 1.71-2.48). Females were more aware of disease history than males (p < 0.001). The data further confirms a reporting distortion between males and females. Historically reported measles, mumps, rubella, varicella and vaccination for hepatitis B, influenza, measles, mumps and rubella are not associated with increased risk of MS later in life. A clinical history of infectious mononucleosis is conspicuously associated with increased MS susceptibility. These findings support studies implicating Epstein-Barr virus in MS disease susceptibility, but a co-association between MS susceptibility and clinically apparent infectious mononucleosis cannot be excluded.

  6. Seroprevalence of HIV, HTLV, CMV, HBV and rubella virus infections in pregnant adolescents who received care in the city of Belém, Pará, Northern Brazil.

    PubMed

    Guerra, Aubaneide Batista; Siravenha, Leonardo Quintão; Laurentino, Rogério Valois; Feitosa, Rosimar Neris Martins; Azevedo, Vânia Nakauth; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Machado, Luiz Fernando Almeida

    2018-05-16

    Prenatal tests are important for prevention of vertical transmission of various infectious agents. The objective of this study was to describe the prevalence of human immunodeficiency virus (HIV), human T-lymphotropic virus (HTLV), hepatitis B virus (HBV), cytomegalovirus (CMV), rubella virus and vaccination coverage against HBV in pregnant adolescents who received care in the city of Belém, Pará, Brazil. A cross-sectional study was performed with 324 pregnant adolescents from 2009 to 2010. After the interview and blood collection, the patients were screened for antibodies and/or antigens against HIV-1/2, HTLV-1/2, CMV, rubella virus and HBV. The epidemiological variables were demonstrated using descriptive statistics with the G, χ 2 and Fisher exact tests. The mean age of the participants was 15.8 years, and the majority (65.4%) had less than 6 years of education. The mean age at first intercourse was 14.4 years, and 60.8% reported having a partner aged between 12 and 14 years. The prevalence of HIV infection was 0.3%, and of HTLV infection was 0.6%. Regarding HBV, 0.6% of the participants had acute infection, 9.9% had a previous infection, 16.7% had vaccine immunity and 72.8% were susceptible to infection. The presence of anti-HBs was greater in adolescent between 12 and 14 years old (28.8%) while the anti-HBc was greater in adolescent between 15 and 18 years old (10.3%). Most of the adolescents presented the IgG antibody to CMV (96.3%) and rubella (92.3%). None of the participants had acute rubella infection, and 2.2% had anti-CMV IgM. This study is the first report of the seroepidemiology of infectious agents in a population of pregnant adolescents in the Northern region of Brazil. Most of the adolescents had low levels of education, were susceptible to HBV infection and had IgG antibodies to CMV and rubella virus. The prevalence of HBV, HIV and HTLV was similar to that reported in other regions of Brazil. However, the presence of these agents in this younger population reinforces the need for good prenatal follow-up and more comprehensive vaccination campaigns against HBV due to the large number of women susceptible to the virus.

  7. Autism and vaccination-the current evidence.

    PubMed

    Miller, Lisa; Reynolds, Joni

    2009-07-01

    The purpose of this article is to review relevant background literature regarding the evidence linking thimerosal-containing vaccine and the measles, mumps, and rubella vaccine to autism. Rigorous scientific studies have not identified links between autism and either thimerosal-containing vaccine or the measles, mumps, and rubella vaccine. Nurses are often in the position of providing advice regarding vaccines in their formal practice areas as well as in their daily lives. Families need current and credible evidence to make decisions for their children. Excellent vaccine information resources are available online.

  8. The elimination of indigenous measles, mumps, and rubella from Finland by a 12-year, two-dose vaccination program.

    PubMed

    Peltola, H; Heinonen, O P; Valle, M; Paunio, M; Virtanen, M; Karanko, V; Cantell, K

    1994-11-24

    In the 1970s measles, mumps, and rubella were rampant in Finland, and rates of immunization were inadequate. In 1982 a comprehensive national vaccination program began in which two doses of a combined live-virus vaccine were used. Public health nurses at 1036 child health centers administered the vaccine to children at 14 to 18 months of age and again at 6 years, and also to selected groups of older children and young adults. Vaccination was voluntary and free of charge. In follow-up studies, we focused on rates of vaccination, reasons for noncompliance, adverse reactions, immunogenicity, persistence of antibody, and incidence of the three diseases. Since 1987, paired serum samples have been collected from all patients with suspected cases of measles, mumps, or rubella. Over a period of 12 years, 1.5 million of the 5 million people in Finland were vaccinated. Coverage now exceeds 95 percent. The vaccine was efficient and safe, even in those with a history of severe allergy. No deaths or persistent sequelae were attributable to vaccination. The most frequent complication requiring hospitalization was acute thrombocytopenic purpura, which occurred at a rate of 3.3 per 100,000 vaccinated persons. The 99 percent decrease in the incidence of the three diseases was accompanied by an increasing rate of false positive clinical diagnoses. In 655 vaccinated patients with clinically diagnosed disease, serologic studies confirmed the presence of measles in only 0.8 percent, mumps in 2.0 percent, and rubella in 1.2 percent. The few localized outbreaks were confined to patients in the partially vaccinated age groups. There are now fewer than 30 sporadic cases of each of the three diseases per year, and those are probably imported. Over a 12-year period, an immunization program using two doses of combined live-virus vaccine has eliminated indigenous measles, mumps, and rubella from Finland. Serologic studies show that most reported sporadic cases are now due to other causes, but a continued high rate of vaccination coverage is essential to prevent outbreaks resulting from exposure to imported disease.

  9. Case based measles surveillance in Pune: evidence to guide current and future measles control and elimination efforts in India.

    PubMed

    Bose, Anindya Sekhar; Jafari, Hamid; Sosler, Stephen; Narula, Arvinder Pal Singh; Kulkarni, V M; Ramamurty, Nalini; Oommen, John; Jadi, Ramesh S; Banpel, R V; Henao-Restrepo, Ana Maria

    2014-01-01

    According to WHO estimates, 35% of global measles deaths in 2011 occurred in India. In 2013, India committed to a goal of measles elimination by 2020. Laboratory supported case based measles surveillance is an essential component of measles elimination strategies. Results from a case-based measles surveillance system in Pune district (November 2009 through December 2011) are reported here with wider implications for measles elimination efforts in India. Standard protocols were followed for case identification, investigation and classification. Suspected measles cases were confirmed through serology (IgM) or epidemiological linkage or clinical presentation. Data regarding age, sex, vaccination status were collected and annualized incidence rates for measles and rubella cases calculated. Of the 1011 suspected measles cases reported to the surveillance system, 76% were confirmed measles, 6% were confirmed rubella, and 17% were non-measles, non-rubella cases. Of the confirmed measles cases, 95% were less than 15 years of age. Annual measles incidence rate was more than 250 per million persons and nearly half were associated with outbreaks. Thirty-nine per cent of the confirmed measles cases were vaccinated with one dose of measles vaccine (MCV1). Surveillance demonstrated high measles incidence and frequent outbreaks in Pune where MCV1 coverage in infants was above 90%. Results indicate that even high coverage with a single dose of measles vaccine was insufficient to provide population protection and prevent measles outbreaks. An effective measles and rubella surveillance system provides essential information to plan, implement and evaluate measles immunization strategies and monitor progress towards measles elimination.

  10. Challenges of measles and rubella laboratory diagnostic in the era of elimination.

    PubMed

    Hübschen, J M; Bork, S M; Brown, K E; Mankertz, A; Santibanez, S; Ben Mamou, M; Mulders, M N; Muller, C P

    2017-08-01

    The Member States of the WHO European Region adopted the goal of measles and rubella elimination more than 10 years ago, but so far only 21 of 53 countries have reached this target. Laboratory investigation of suspected cases is essential to support disease elimination efforts. Therefore, WHO maintains a network of accredited laboratories providing high-quality testing. Laboratory investigation heavily relies on specific IgM serology and increasingly on virus detection by reverse transcription (RT)-PCR, but other methods such as IgG avidity testing and genetic characterization of virus strains have gained in importance. In elimination settings, often few samples from suspected cases are available for testing, but testing proficiency must be maintained. The predictive value of an IgM-positive result decreases and other rash-fever disease aetiologies become more important. In addition, cases with a rash after measles/rubella vaccination or with mild disease after waning of vaccine-induced antibodies are seen more often. Thus, it is necessary to perform comprehensive and potentially time-consuming and costly investigations of every suspected case using quality-controlled laboratory methods. At the same time rapid feedback to public health officers is required for timely interventions. The introduction of new laboratory methods for comprehensive case investigations requires training of staff under the supervision of WHO-accredited reference laboratories and the definition of appropriate test algorithms. Clinical, laboratory, and epidemiological data are essential for final case classification and investigation of chains of transmission in the endgame of measles and rubella elimination. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. All rights reserved.

  11. Social regulations predispose people to complete vaccination for vaccine-preventable diseases.

    PubMed

    Takeuchi, Jiro; Goto, Masashi; Kawamura, Takashi; Hiraide, Atsushi

    2014-11-01

    Japan experienced measles outbreaks in both 2006 and 2007 mainly among university students. Improvement of vaccine coverage against vaccine-preventable viral infections is the prime task for preventing outbreaks of viral infections. To elucidate the promoting factors for complete vaccination against measles, rubella, mumps, and varicella-zoster viruses, we conducted a case-control study among single university students in Japan. Information on vaccinations and clinico-demographical factors were collected using a self-administered questionnaire and a photocopy of the Maternal and Child Health Handbook. Logistic regression analysis was performed to estimate odds ratios (ORs) and their 95% confidence intervals (CIs) for two-time vaccination against measles and rubella viruses as mandatory vaccinations and at least one-time vaccination against mumps and varicella-zoster viruses as optional vaccinations. A total of 1,370 (744 medical, 508 paramedical, and 118 pharmaceutical) students were invited to participate, 960 (70.1%) of whom were enrolled in the study. Students aged < 20 years had a greater propensity for measles and rubella vaccinations (OR 7.8 [95% CI, 5.1-11.8] and OR 6.1 [95% CI, 3.7-10.0], respectively) compared with those aged ≥ 20 years. Students with a history of living over-seas for 1 month or longer were more likely to complete vaccination for measles (OR 4.4 [95% CI, 1.4-13.5] compared with those without such history. This significantly high vaccination coverage was attributed to the measles-rubella catch-up campaign by the Japanese government and the immunization regulations by foreign countries. These findings suggest that social regulations would predispose people to complete vaccination.

  12. Expression of interleukin-2 receptor alpha and CD45RO antigen on T lymphocytes cultured with rubella virus antigen, compared with humoral immunity in rubella vaccinees.

    PubMed

    Toyoda, M; Ihara, T; Nakano, T; Ito, M; Kamiya, H

    1999-04-09

    We studied the expression of interleukin-2 receptor alpha (CD25)+ CD45RO+ CD4+ T lymphocytes (T-cell activation) in response to the rubella virus (RV) antigen (Matsuura strain, Biken, Osaka, Japan) using three-color-staining flow cytometry. The subjects were 48 healthy children (3-14 years old, 31 boys and 17 girls), who had received either monovalent vaccine (n = 5; mean age, 13.2 years) or measles-mumps-rubella (MMR) vaccine (n = 21; mean age, 10.5 years), had been naturally infected (n = 5; mean age, 11.4 years), or had been neither vaccinated nor naturally infected (n = 17; mean age, 10.0 years) and 62 healthy adolescents and adults (15-37 years old; 19 males and 43 females), who had received monovalent vaccine (n = 26, mean age, 27.4 years), had been naturally infected (n = 8; mean age, 24.0 years), or had been neither vaccinated nor naturally infected (n = 8; mean age, 16.5 years). Ninety-four of 110 subjects had HI titers > or = 1:16. T-cell activation in these subjects was significantly higher than that in 6 seronegative (HI titers < 1:8) subjects (p < 0.05). T-cell activation did not differ significantly with the history of exposure to RV. HI antibody titers > or = 1:16 and T-cell activation persisted in vaccinated subjects for > or = 20 years and was similar to those in naturally infected subjects. Our results suggest that cell-mediated immunity and humoral immunity persist for at least 20 years after vaccination.

  13. Case Based Measles Surveillance in Pune: Evidence to Guide Current and Future Measles Control and Elimination Efforts in India

    PubMed Central

    Bose, Anindya Sekhar; Jafari, Hamid; Sosler, Stephen; Narula, Arvinder Pal Singh; Kulkarni, V. M.; Ramamurty, Nalini; Oommen, John; Jadi, Ramesh S.; Banpel, R. V.; Henao-Restrepo, Ana Maria

    2014-01-01

    Background According to WHO estimates, 35% of global measles deaths in 2011 occurred in India. In 2013, India committed to a goal of measles elimination by 2020. Laboratory supported case based measles surveillance is an essential component of measles elimination strategies. Results from a case-based measles surveillance system in Pune district (November 2009 through December 2011) are reported here with wider implications for measles elimination efforts in India. Methods Standard protocols were followed for case identification, investigation and classification. Suspected measles cases were confirmed through serology (IgM) or epidemiological linkage or clinical presentation. Data regarding age, sex, vaccination status were collected and annualized incidence rates for measles and rubella cases calculated. Results Of the 1011 suspected measles cases reported to the surveillance system, 76% were confirmed measles, 6% were confirmed rubella, and 17% were non-measles, non-rubella cases. Of the confirmed measles cases, 95% were less than 15 years of age. Annual measles incidence rate was more than 250 per million persons and nearly half were associated with outbreaks. Thirty-nine per cent of the confirmed measles cases were vaccinated with one dose of measles vaccine (MCV1). Conclusion Surveillance demonstrated high measles incidence and frequent outbreaks in Pune where MCV1 coverage in infants was above 90%. Results indicate that even high coverage with a single dose of measles vaccine was insufficient to provide population protection and prevent measles outbreaks. An effective measles and rubella surveillance system provides essential information to plan, implement and evaluate measles immunization strategies and monitor progress towards measles elimination. PMID:25290339

  14. TORCH seroprevalence among patients attending Obstetric Care Clinic of Haydarpasa Training and Research Hospital affiliated to Association of Istanbul Northern Anatolia Public Hospitals

    PubMed Central

    Numan, Onur; Vural, Fisun; Aka, Nurettin; Alpay, Murat; Coskun, Ayse Deniz Erturk

    2015-01-01

    OBJECTIVE: Toxoplasma gondii, Rubella, Cytomegalovirus and Herpes simplex viruses are microorganisms that cause congenital infections and they are called briefly as TORCH. There is an ongoing argument for the screening of reproductive age women due to the high cost of tests. For a test to be used in screening, prevalence of disease in this population should be known. The aim of this study was to investigate TORCH seroprevalence among women attending a teaching hospital in Istanbul. METHODS: A total of 1101 patients attending outpatient clinic of Obstetric Care Clinic of Haydarpasa Training and Research Hospital affiliated to Association of Istanbul Northern Anatolia Public Hospitals between September 2013 to January 2015 and their laboratory data were evaluated retrospectively. We investigated Ig G and M seropositivity rates against TORCH. RESULTS: The age of the patients ranged between 17–47 years with a mean age of 30.3±5.8 years. Pregnant population had 99.5% anti-CMV Ig G (+), 94.2% anti-Rubella Ig G (+), 31% anti-Toxoplasma Ig G (+). Seroprevalence for Anti IgM was 0.5% for CMV, 0.2% for rubella. CONCLUSION: The screening for Toxoplasma gondii may be suggested since the prevalence is not high in our population. The screening of CMV is not meaningful, due to high seroprevalence. Although seroprevalence of rubella is also high, it may be suggested for preconception vaccination especially in women above 20 years of age born prior to National Vaccination Programme. PMID:28058368

  15. The effectiveness of measles-mumps-rubella (MMR) vaccination in the prevention of pediatric hospitalizations for targeted and untargeted infections: A retrospective cohort study.

    PubMed

    La Torre, Giuseppe; Saulle, Rosella; Unim, Brigid; Meggiolaro, Angela; Barbato, Angelo; Mannocci, Alice; Spadea, Antonietta

    2017-08-03

    To evaluate the effectiveness of the measles-mumps-rubella (MMR) vaccine in reducing hospitalizations for infectious disease, targeted and not targeted, as well as from respiratory diseases in children in Rome. The cohort was recomposed through record linkage of 2 archives (vaccination register and hospital discharge records. The analysis included 11,004 children. 20.9% did not receive the MMR vaccination, 49% and 30.1% received one and 2 doses. There were no hospitalizations for rubella, 2 for mumps, and 12 for measles. The vaccine was highly protective against measles and mumps hospitalizations (HR = 0.10; 95% CI: 0.03.0.34). Regarding all infectious diseases there were 414 hospitalizations, and the vaccine was protective (HR = 0.29; 95% CI: 0.25 to 0.34). Concerning respiratory diseases, there were 809 admissions (7.4%), and the vaccine was highly protective (HR: 0.18; 95% CI: 0.07 to 0.48). MMR vaccination is effective for the primary prevention of target and not targeted infectious diseases and may also limit hospitalizations for respiratory diseases.

  16. Investigation of measles and rubella outbreaks in Tamil Nadu, India-2003.

    PubMed

    Ramamurty, Nalini; Raja, Duraisamy; Gunasekaran, Palani; Varalakshmi, Elango; Mohana, Sambasivam; Jin, Li

    2006-04-01

    The aims of the present study were to confirm measles outbreaks by detection of measles-specific IgM antibodies, isolation of measles virus, and genetic characterization to document the circulating genotypes in Tamil Nadu. Eight outbreaks were reported from six districts of Tamil Nadu, India during the period Jan-Dec 2003. Blood samples were collected for serology, urine, and throat swabs for virus isolation. Genotypic characterization of measles isolates was based on the sequence of the N gene. All the clinically suspected outbreaks (n = 8) were confirmed by serology; six out of the eight as measles and two as combination of measles and rubella highlighting the need to carry out rubella serology on measles-negative samples. Genetic characterization of three isolates obtained revealed one as genotype D4 and two as D8. Measles genotypes D4 and D8 were found to circulate in three districts of Tamil Nadu. It is necessary to be aware of the circulating genotypes within the geographical area. The information would be valuable to evaluate control measures and identify viral transmission and importation. Copyright 2006 Wiley-Liss, Inc.

  17. Detection and genotyping of rubella virus from exanthematous patients suspected of having measles using reverse transcription-PCR.

    PubMed

    Yasui, Yoshihiro; Mori, Yoshio; Adachi, Hirokazu; Kobayashi, Shinichi; Yamashita, Teruo; Minagawa, Hiroko

    2014-01-01

    Between July 2012 and March 2013, a total of 133 clinical specimens from 47 patients suspected of having measles were collected for virological surveillance in Aichi Prefecture, Japan. Facing the rubella epidemic, the reverse transcription (RT)-PCR protocol for measles virus (MeV) was modified to simultaneously detect rubella virus (RUBV) in these clinical specimens. As a result, 30 specimens from 15 patients were positive for RUBV and 8 specimens from 3 patients were positive for MeV. The RUBV genotype analysis for the samples from 13 patients revealed 12 samples as 2B and 1 sample as 1E. The results provided additional evidence for the difficulty in the diagnosis of exanthematous diseases based on clinical manifestations alone and the necessity of virological diagnosis to maintain the accuracy of case-based surveillance. Furthermore, the results indicated that the modified RT-PCR protocol could be useful as a routine procedure to simultaneously detect MeV and RUBV in clinical specimens of patients suspected of having exanthematous disease caused by these viruses.

  18. [Prevalence of American trypanosomiasis, syphilis, toxoplasmosis, rubella, hepatitis B, hepatitis C, human immunodeficiency virus infection, assayed through serological tests among pregnant patients, from 1996 to 1998, at the Regional University Hospital Norte do Paraná].

    PubMed

    Reiche, E M; Morimoto, H K; Farias, G N; Hisatsugu, K R; Geller, L; Gomes, A C; Inoue, H Y; Rodrigues, G; Matsuo, T

    2000-01-01

    In order to evaluate the seroprevalence of the american trypanosomiasis, syphilis, toxoplasmosis, rubella, hepatitis B infection, hepatitis C infection and human immunodeficiency virus infection among pregnant women attended at the Hospital Universitário Regional Norte do Paraná, Londrina State University, Paraná, a retrospective study of the serologic results performed in the prenatal routine during the period of June 1996 to June 1998 was carried out. The rates of seropositivity were as follows: american trypanosomiasis = 0.9%, syphilis = 1.6%, toxoplasmosis = 67% (IgG) and 1.8% (IgM), rubella = 89% (IgG) and 1.2% (IgM), hepatitis B surface antigen = 0.8%, hepatitis C virus = 0.8% and human immunodeficiency virus infection = 0.6%. An association between the increase in the seroprevalence of Chagas' disease and patient age was detected (p=0.006). The results underscore the importance of the serological tests in perinatal care, to prevent both the congenital and perinatally transmitted forms of theses infectious diseases.

  19. [Progress on mechanism of cell apoptosis induced by rubella virus].

    PubMed

    Li, Zhen-mei; Chu, Fu-lu; Liu, Ying; Wang, Zhi-yu

    2013-09-01

    Rubella virus (RV), a member of the family Togaviridae, can induce apoptosis of host cells in vitro. Protein kinases of the Ras-Raf-MEK-ERK pathway and PI3K-Akt pathway play essential roles in virus multiplication, cell survival and apoptosis. Proteins p53 and TAp63 that bind to specific DNA sequences stimulate Bax in a manner to produce functional pores that facilitate release of mitochondrial cytochrome c and downstream caspase activation. In this review, the molecular mechanisms of RV-induced cell apoptosis, including RV-infected cell lines, pathological changes in cell components and apoptosis signaling pathways are summarized.

  20. Genome-Wide Characterization of Transcriptional Patterns in High and Low Antibody Responders to Rubella Vaccination

    PubMed Central

    Haralambieva, Iana H.; Oberg, Ann L.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Grill, Diane E.; Middha, Sumit; Bot, Brian M.; Wang, Vivian W.; Smith, David I.; Jacobson, Robert M.; Poland, Gregory A.

    2013-01-01

    Immune responses to current rubella vaccines demonstrate significant inter-individual variability. We performed mRNA-Seq profiling on PBMCs from high and low antibody responders to rubella vaccination to delineate transcriptional differences upon viral stimulation. Generalized linear models were used to assess the per gene fold change (FC) for stimulated versus unstimulated samples or the interaction between outcome and stimulation. Model results were evaluated by both FC and p-value. Pathway analysis and self-contained gene set tests were performed for assessment of gene group effects. Of 17,566 detected genes, we identified 1,080 highly significant differentially expressed genes upon viral stimulation (p<1.00E−15, FDR<1.00E−14), including various immune function and inflammation-related genes, genes involved in cell signaling, cell regulation and transcription, and genes with unknown function. Analysis by immune outcome and stimulation status identified 27 genes (p≤0.0006 and FDR≤0.30) that responded differently to viral stimulation in high vs. low antibody responders, including major histocompatibility complex (MHC) class I genes (HLA-A, HLA-B and B2M with p = 0.0001, p = 0.0005 and p = 0.0002, respectively), and two genes related to innate immunity and inflammation (EMR3 and MEFV with p = 1.46E−08 and p = 0.0004, respectively). Pathway and gene set analysis also revealed transcriptional differences in antigen presentation and innate/inflammatory gene sets and pathways between high and low responders. Using mRNA-Seq genome-wide transcriptional profiling, we identified antigen presentation and innate/inflammatory genes that may assist in explaining rubella vaccine-induced immune response variations. Such information may provide new scientific insights into vaccine-induced immunity useful in rational vaccine development and immune response monitoring. PMID:23658707

  1. Immunogenicity and safety of a novel MMR vaccine (live, freeze-dried) containing the Edmonston-Zagreb measles strain, the Hoshino mumps strain, and the RA 27/3 rubella strain: Results of a randomized, comparative, active controlled phase III clinical trial.

    PubMed

    Sood, Ashwani; Mitra, Monjori; Joshi, Himanshu Arvind; Nayak, Uma Siddhartha; Siddaiah, Prashanth; Babu, T Ramesh; Mahapatro, Samarendra; Sanmukhani, Jayesh; Gupta, Gaurav; Mittal, Ravindra; Glueck, Reinhard

    2017-07-03

    This phase III clinical trial was conducted to evaluate the immunogenicity and safety of the single-dose and multi-dose formulations of a novel MMR vaccine (live, freeze-dried) developed by M/s Cadila Healthcare Limited, India (Cadila MMR vaccine), containing the Hoshino mumps strain, compared to that of an existing MMR vaccine (live, freeze-dried) developed by M/s Serum Institute of India Limited, India (Serum MMR vaccine). These two vaccines have similar measles and rubella strains, but different mumps strains (Hoshino in Cadila MMR vaccine, and L-Zagreb in Serum MMR vaccine). Three hundred and twenty-eight subjects of either sex, aged 15-18 months, were randomized in a 2:1 ratio to receive either the Cadila or Serum MMR vaccine. Immunogenicity assessments (IgG antibodies against measles, mumps, and rubella viruses) were done at baseline and 42 d after vaccination. Solicited (local and systemic) and unsolicited adverse events were recorded for up to 42 d following vaccination. The Cadila MMR vaccine was found to be non-inferior to the Serum MMR vaccine in terms of end-of-study proportion of subjects seropositive for anti-measles antibodies (100.0% in both groups), anti-mumps antibodies (94.5% vs. 94.0%), and anti-rubella antibodies (95.5% vs. 91.0%). Both vaccines were well tolerated by all study participants; the most common adverse event reported in both groups was fever, followed by rash. The results of this phase III clinical trial show that the novel Cadila MMR vaccine is non-inferior to the Serum MMR vaccine.

  2. Immunogenicity and safety of measles-mumps-rubella vaccine delivered by disposable-syringe jet injector in healthy Brazilian infants: a randomized non-inferiority study.

    PubMed

    de Menezes Martins, Reinaldo; Curran, Birute; Maia, Maria de Lourdes Sousa; Ribeiro, Maria das Graças Tavares; Camacho, Luiz Antonio Bastos; da Silva Freire, Marcos; Yamamura, Anna Maya Yoshida; Siqueira, Marilda Mendonça; Lemos, Maria Cristina F; de Albuquerque, Elizabeth Maciel; von Doellinger, Vanessa dos Reis; Homma, Akira; Saganic, Laura; Jarrahian, Courtney; Royals, Michael; Zehrung, Darin

    2015-03-01

    This study aimed to determine if immunogenicity to measles-mumps-rubella vaccine delivered to infants via a disposable-syringe jet injector (DSJI) was non-inferior to that administered by needle and syringe (NS). Vaccination safety was evaluated, as were the use, performance, and acceptability of each delivery method. The DSJI was the PharmaJet 2009 generation-1 device (G1) and the vaccine was measles-mumps-rubella vaccine from Bio-Manguinhos. Five hundred eighty-two healthy Brazilian infants were randomized to receive vaccine via G1 or NS. Seroconversion rates against measles and mumps viruses in the G1 treatment group did not meet non-inferiority criteria when compared with the NS group; however, responses in the G1 group to rubella virus were non-inferior to those of NS vaccinees. Most adverse events were mild or moderate. Crying after injection was more frequent in the NS group, and local skin reactions were more common in the G1 group. Five serious adverse events were judged causally unrelated to treatment and all resolved. Parents/guardians expressed a strong preference for G1 over NS for their children. Vaccinators found the G1 easy to use but noted incomplete vaccine delivery in some cases. Although the G1 has been superseded by an updated device, our results are important for the continued improvement and evaluation of DSJIs, which have the potential to overcome many of the challenges and risks associated with needle-based injections worldwide. Recommendations for future DSJI clinical studies include rigorous training of vaccinators, quantitative measurement of wetness on the skin following injection, and regular monitoring of device and vaccinator performance. Copyright © 2014. Published by Elsevier Inc.

  3. Long-term safety and serologic response to measles, mumps, and rubella vaccination in HIV-1 infected adults.

    PubMed

    Stermole, Benjamin M; Grandits, Greg A; Roediger, Mollie P; Clark, Brychan M; Ganesan, Anuradha; Weintrob, Amy C; Crum-Cianflone, Nancy F; Ferguson, Tomas M; Macalino, Grace E; Landrum, Michael L

    2011-04-05

    We analyzed HIV viral load (VL) and CD4 count changes, and antibody responses following MMR vaccination of individuals in the U.S. Military HIV Natural History Study cohort. Cases receiving at least one dose of MMR vaccine after HIV diagnosis were matched 1:2 to HIV-positive controls not receiving the vaccine. Baseline was defined as time of vaccination for cases and indexed and matched to the time post-HIV diagnosis for controls. Changes in CD4 count and VL at 6, 12, 18 and 24 months were compared between cases and controls using a general linear model. Available sera from cases were tested for MMR seropositivity at baseline and post-vaccination at 6, 12, 18, and 24 months. Overall mean CD4 count change from baseline through 24 months was 20 (±23) cells/μL greater for cases than controls (p=0.39). Similar non-significant changes in CD4 cell count were seen in the subset of those not on HAART at baseline. VL changes were small and similar between groups (mean differential change -0.04 (±0.18) log(10) copies/mL; p=0.84). Of 21 vaccinated participants with baseline serologic testing, 14 (67%) were reactive to measles, 19 (91%) to mumps, and 20 (95%) to rubella. Three (43%) of 7 participants nonreactive to measles developed measles IgG; for mumps, 1 (50%) of 2 developed mumps IgG; for rubella, 1 (100%) developed rubella IgG. MMR vaccination did not result in detrimental immunologic or virologic changes through 24 months post-vaccination. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Seroprevalence of measles, mumps and rubella among young adults, after 20 years of universal 2-dose MMR vaccination in Israel

    PubMed Central

    Levine, Hagai; Zarka, Salman; Ankol, Omer E; Rozhavski, Vladi; Davidovitch, Nadav; Aboudy, Yair; Balicer, Ran D

    2015-01-01

    Evidence-based vaccination policy is important for the global and local efforts of achieving control over measles. In 2007, the first Israeli birth cohort to be twice vaccinated during childhood with Measles-Mumps-Rubella vaccine reached adulthood. In parallel, Israel experienced its largest measles outbreak since 1994. We aimed to assess the seroprevalence of measles IgG antibodies and concordance with rubella and mumps seroprevalence among young Israeli adults born 1988–9 in comparison to previous birth cohorts, in order to inform evidence based prevention policy. We conducted a seroprevalence study of IgG antibodies among 439 Israeli adults born in 1988–9, based on a representative sample of sera collected at age 18–19 upon recruitment to mandatory military service in 2007. In total, 85.7% were seropositive for measles as compared with 95.6% in the 1996 recruitment (P < 0.001). The absolute decline was significant both for males (8.8%, P = 0.001) and females (12.1%, P < 0.001). There were no significant differences in seropositivity by gender, years of education, country of birth or smoking status. Rubella seropositivity among measles seropositives was 90.4%, significantly (P < 0.001) higher than 72.1% among measles seronegatives. Mumps seropositivity among measles seropositives was 87.0%, significantly (P < 0.001) higher than 62.3% among measles seronegatives. Results were similar for Israeli-born only. Our findings indicate that measles seroprevalence decreased after the last change in vaccination policy and reach sub-optimal level. Until global eradication is reached, a proactive vaccination program to supplement routine childhood vaccination program should be considered in Israel and in other countries. PMID:25891446

  5. Clinical profile of congenital rubella syndrome in Yogyakarta, Indonesia.

    PubMed

    Herini, Elisabeth S; Gunadi; Triono, Agung; Wirastuti, Fita; Iskandar, Kristy; Mardin, Niprida; Soenarto, Yati

    2018-02-01

    Congenital rubella syndrome (CRS) has many severe neurological manifestations and other systemic consequences. Although various studies have been done in Indonesia, there are no conclusive results on CRS incidence. The aim of this study was therefore to investigate the incidence, clinical manifestations and outcomes of CRS in Yogyakarta, Indonesia. A descriptive study involving a review of congenital anomalies associated with CRS was carried out at Dr Sardjito Hospital, Yogyakarta, Indonesia, from July 2008 to June 2013. CRS was categorized according to the World Health Organization (WHO) classification. This study involved children aged <1 year old, and was conducted at the outpatient clinic, pediatric and neonatology wards. A total of 201 children met the criteria for suspected CRS during the 5 year study. Of those patients, 6% were classified as having laboratory-confirmed CRS, 21.4% as having clinically compatible CRS, and 72.6% as having discarded CRS (i.e. a suspected case that does not meet the criteria for CRS). The estimated incidence of laboratory-confirmed CRS and laboratory-confirmed and clinically compatible CRS in Yogyakarta, Indonesia during the study period was 0.05:1,000 and 0.25:1,000 live births, respectively. Of the laboratory-confirmed CRS patients, 83.3% of children had congenital heart disease (CHD), 75% had hearing impairment, 66.7% had congenital cataract and 50% had microcephaly. Furthermore, none of the mothers was vaccinated against rubella. The incidence of CRS in infants in Yogyakarta Indonesia is considered high, with most clinical manifestations being CHD, hearing impairment and congenital cataract. This emphasizes the necessity for epidemiological study of CRS in other hospitals and the importance of establishing a national rubella vaccination program in Indonesia. © 2017 Japan Pediatric Society.

  6. Updated data on effective and safe immunizations with live-attenuated vaccines for children after living donor liver transplantation.

    PubMed

    Shinjoh, Masayoshi; Hoshino, Ken; Takahashi, Takao; Nakayama, Tetsuo

    2015-01-29

    Although immunizations using live-attenuated vaccines are not recommended for children post-liver transplant due to their theoretical risks, they will inevitably encounter vaccine-preventable viral diseases upon returning to real-life situations. The window of opportunity for vaccination is usually limited prior to transplantation because these children often have unstable disease courses. Also, vaccine immunity does not always persist after transplantation. Beginning in 2002, subcutaneous immunizations with four individual live-attenuated vaccines (measles, rubella, varicella, and mumps) to pediatric patients following living donor liver transplantation (LDLT) were performed for those who fulfilled the clinical criteria, including humoral and cell-mediated immunity. Written informed consent was collected. We included the study on 70 immunizations for 18 cases that we reported in 2008 (Shinjoh et al., 2008). A total of 196 immunizations were administered to 48 pediatric post-LDLT recipients. Of these, 144 were first immunizations and 52 were repeated immunizations following LDLT. The seroconversion rates at the first dose for measles (AIK-C), rubella (TO-336), varicella (Oka), and mumps (Hoshino) were 100% (36/36), 100% (35/35), 70% (23/33), and 75% (24/32), respectively. Antibody levels did not fall over time in patients immunized with rubella vaccine. Three mild cases of breakthrough varicella were observed. Two cases with transient parotid gland swelling were observed after mumps immunization. Two admissions because of fever at 2-3 weeks after the measles vaccine were reported but the patients had no symptoms of measles. Immunizations using selected live-attenuated vaccines were safe and effective for post-LDLT children who were not severely immunosuppressed. However, with the exception of rubella, repeated immunization may be necessary. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Immunity to rubella before and after vaccination against measles, mumps and rubella (MMR) at 12 years of age of the first generation offered MMR vaccination in Sweden at 18 months.

    PubMed

    Böttiger, M

    1995-12-01

    In 1982, a two-dose programme of vaccination against measles, mumps and rubella (MMR) at the ages of 18 months and 12 years was introduced in Sweden. In 1992-3, the first group of children vaccinated at 18 months reached the age of 12, i.e. the time for a second dose. In connection with this 12-year vaccination, 376 children were recruited, investigated concerning earlier MMR vaccination and bled prior to and 2 months after the immunization. Two hundred and twenty of them had a documented, earlier MMR vaccination and 156 had not. The latter were classified as unvaccinated. The antibody status against rubella was measured by the haemolysis-in-gel method. Prior to the present vaccination, 3% of the earlier vaccinated group totally lacked any sign of antibodies. In the presumably unvaccinated group, this figure was 76%. After the vaccination all children showed signs of antibody activity and reached the antibody level of > or = 15 international units, i.e. in our tests a zone dia. of approx 8 mm. However, the secondly vaccinated children ended up with a mean antibody level of 10.7 mm which was slightly lower than the level, i.e. 11.0 mm of those lacking earlier vaccination history and prevaccination seronegative. The earlier unvaccinated but pre-immune children reached a mean level of 11.2 mm. In general, those with relatively high, pre-vaccination, antibody levels reacted less to the booster than those with low or no pre-vaccination immunity. The booster thus appeared to restore the antibody levels of the low-titre children.

  8. Seroprotection against Vaccine-Preventable Diseases amongst Health Care Workers in a Community Hospital, Qatar.

    PubMed

    Guanche Garcell, H; Villanueva Arias, A; Guilarte García, E; Alfonso Serrano, R N

    2016-10-01

    Health care workers (HCW) are at high risk of contracting various infectious diseases and play a dual role in the transmission of infections in health care facilities. To determine the seroprotection against hepatitis B, measles, rubella, and varicella among HCWs in a community hospital in Qatar. This is a cross-sectional survey conducted in a 75-bed community hospital in Dukhan, Qatar. From August 2012 to December 2015, 705 HCWs were tested for the presence of IgG antibodies for measles, rubella, and varicella, and also for hepatitis B surface antigen (HBsAg). They were also asked about previous history of hepatitis B vaccination. 595 (84.4%) HCWs received a full hepatitis B vaccination schedule; 110 (15.6%) received a single dose. The full schedule was reported with higher frequency by nurses (90.2%) compared to physicians (74.1%) or technicians (79.7%). Those aged ≥30 years (90.4%) and <20 years of work experience had received a full vaccination schedule more frequently than younger and less experienced HCWs. Female HCWs (87.8%) received full schedule more frequently than males (78.8%). 73.4% of the staff had seroprotection against heaptitis B, with the lowest anti-HBsAg titers observed in physicians (58.8%) compared with other categories; males (64.9%) were less protected than females. The seropositivity was 85.6%(95% CI 82.4% to 88.4%) for measles, 94.7% (95% CI 92.2% to 97.3%) for rubella, and 92.2% (95% CI 89.7% to 94.7%) for varicella. HCWs, particularly physicians, are not enough protected against hepatitis B. The seroprotection against measles, rubella, and varicella.

  9. Associations between Cytokine/Cytokine Receptor SNPs and Humoral Immunity to Measles, Mumps and Rubella in a Somali Population

    PubMed Central

    Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2008-01-01

    We genotyped a Somali population (n=85; age ≤ 30 years) for 617 cytokine and cytokine receptor SNPs using Illumina GoldenGate genotyping to determine associations with measles, mumps and rubella immunity. Overall, sixty-one significant associations (p≤0.01) were found between SNPs belonging to cytokine receptor genes regulating Th1 (IL12RB2, IL2RA and B) and Th2 (IL4R, IL10RB) immunity, and cytokine (IL1B, TNFA, IL6 and IFNB1) and cytokine receptor (IL1RA, IFNAR2, IL18R1, TNFRSF1A and B) genes regulating innate immunity, and variations in antibody levels to measles, mumps or rubella. SNPs within two major inflammatory cytokine genes, TNFA and IL6, demonstrated associations with measles-specific antibodies. Specifically, the minor allele variant of rs1799964 (TNFA -1211 C>T) was associated with primarily seronegative values (median EIA index values ≤0.87; p=0.002; q=0.23) in response to measles disease and/or vaccination. A heterozygous variant CT for rs2069849 (IL6 +4272C>T; Phe201Phe) was also associated with seronegative values and a lower median level of antibody response to measles disease and/or vaccination (p=0.004; q=0.36) or measles vaccination alone (p=0.008). Several SNPs within the coding and regulatory regions of cytokine and cytokine receptor genes demonstrated associations with mumps and rubella antibody levels, but were less informative as strong LD patterns and lower frequencies for minor alleles were observed among these SNPs. Our study identifies specific SNPs in innate immune response genes that may play a role in modulating antibody responses to measles vaccination and/or infection in Somali subjects. PMID:18715339

  10. Seroprevalence of measles, mumps and rubella among young adults, after 20 years of universal 2-dose MMR vaccination in Israel.

    PubMed

    Levine, Hagai; Zarka, Salman; Ankol, Omer E; Rozhavski, Vladi; Davidovitch, Nadav; Aboudy, Yair; Balicer, Ran D

    2015-01-01

    Evidence-based vaccination policy is important for the global and local efforts of achieving control over measles. In 2007, the first Israeli birth cohort to be twice vaccinated during childhood with Measles-Mumps-Rubella vaccine reached adulthood. In parallel, Israel experienced its largest measles outbreak since 1994. We aimed to assess the seroprevalence of measles IgG antibodies and concordance with rubella and mumps seroprevalence among young Israeli adults born 1988-9 in comparison to previous birth cohorts, in order to inform evidence based prevention policy. We conducted a seroprevalence study of IgG antibodies among 439 Israeli adults born in 1988-9, based on a representative sample of sera collected at age 18-19 upon recruitment to mandatory military service in 2007. In total, 85.7% were seropositive for measles as compared with 95.6% in the 1996 recruitment (P < 0.001). The absolute decline was significant both for males (8.8%, P = 0.001) and females (12.1%, P < 0.001). There were no significant differences in seropositivity by gender, years of education, country of birth or smoking status. Rubella seropositivity among measles seropositives was 90.4%, significantly (P < 0.001) higher than 72.1% among measles seronegatives. Mumps seropositivity among measles seropositives was 87.0%, significantly (P < 0.001) higher than 62.3% among measles seronegatives. Results were similar for Israeli-born only. Our findings indicate that measles seroprevalence decreased after the last change in vaccination policy and reach sub-optimal level. Until global eradication is reached, a proactive vaccination program to supplement routine childhood vaccination program should be considered in Israel and in other countries.

  11. The key role of rubella virus glycoproteins in the formation of immune response, and perspectives on their use in the development of new recombinant vaccines.

    PubMed

    Petrova, Ekaterina K; Dmitrieva, Anastasia A; Trifonova, Ekaterina A; Nikitin, Nikolai A; Karpova, Olga V

    2016-02-17

    Rubella is a highly contagious viral disease which is mostly threatens to women of reproductive age. Existent live attenuated vaccines are effective enough, but have some drawbacks and are unusable for a certain group of people, including pregnant women and people with AIDS and other immunodeficiency. Thereby the development of alternative non-replicating, recombinant vaccines undoubtedly is needed. This review discusses the protein E1 and E2 role in formation of immune response and perspectives in development of new generation recombinant vaccines using them. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Unusual Dermatoglyphic Findings Associated with Cytomegalic Inclusion Disease of Infancy—First Report and Practical Review

    PubMed Central

    Wright, Harry T.; Parker, Charles E.; Mavalwala, Jamshed

    1972-01-01

    Infection with the human cytomegalovirus has a teratogenic effect on the fetus during the first trimester of gestation as does rubella. Since unusual dermatoglyphic findings have been observed in infants with congenital rubella infection, the present study was designed to determine whether or not unusual dermatoglyphics occur in patients with cytomegalic inclusion disease of infancy. Analysis of dermatoglyphics in 15 infants with cytomegalic inclusion disease revealed unusual features in all infants. These features are reported here for the first time and are compared with dermatoglyphic findings in a normal population as well as with those of available parents of the infants. PMID:4335498

  13. Measles, mumps, and rubella virus vaccine (M-M-R™II): a review of 32 years of clinical and postmarketing experience.

    PubMed

    Lievano, Fabio; Galea, Susan A; Thornton, Michele; Wiedmann, Richard T; Manoff, Susan B; Tran, Trung N; Amin, Manisha A; Seminack, Margaret M; Vagie, Kristen A; Dana, Adrian; Plotkin, Stanley A

    2012-11-06

    M-M-R™II (measles, mumps, and rubella virus vaccine live; Merck, Sharp, & Dohme Corp.) is indicated for simultaneous vaccination against measles, mumps, and rubella in individuals ≥ 12 months of age. Before the vaccine era, these viruses infected most exposed individuals, with subsequent morbidity and mortality. One of the greatest achievements of public health has been to eliminate these 3 diseases in large geographic areas. The safety profile of M-M-R™II is described using data from routine global postmarketing surveillance. Postmarketing surveillance has limitations (including incomplete reporting of case data), but allows collection of real-world information on large numbers of individuals, who may have concurrent medical problems excluding them from clinical trials. It can also identify rare adverse experiences (AEs). Over its 32-year history, ≈ 575 million doses of M-M-R™II have been distributed worldwide, with 17,536 AEs voluntarily reported for an overall rate of 30.5 AEs/1,000,000 doses distributed. This review provides evidence that the vaccine is safe and well-tolerated. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Role of N-linked oligosaccharides in processing and intracellular transport of E2 glycoprotein of rubella virus.

    PubMed Central

    Qiu, Z; Hobman, T C; McDonald, H L; Seto, N O; Gillam, S

    1992-01-01

    The role of N-linked glycosylation in processing and intracellular transport of rubella virus glycoprotein E2 has been studied by expressing glycosylation mutants of E2 in COS cells. A panel of E2 glycosylation mutants were generated by oligonucleotide-directed mutagenesis. Each of the three potential N-linked glycosylation sites was eliminated separately as well as in combination with the other two sites. Expression of the E2 mutant proteins in COS cells indicated that in rubella virus M33 strain, all three sites are used for the addition of N-linked oligosaccharides. Removal of any of the glycosylation sites resulted in slower glycan processing, lower stability, and aberrant disulfide bonding of the mutant proteins, with the severity of defect depending on the number of deleted carbohydrate sites. The mutant proteins were transported to the endoplasmic reticulum and Golgi complex but were not detected on the cell surface. However, the secretion of the anchor-free form of E2 into the medium was not completely blocked by the removal of any one of its glycosylation sites. This effect was dependent on the position of the deleted glycosylation site. Images PMID:1583721

  15. Decreased measles antibody response after measles-mumps-rubella vaccine in infants with colds.

    PubMed

    Krober, M S; Stracener, C E; Bass, J W

    1991-04-24

    We examined the possibility that the common cold or afebrile upper respiratory tract infection might interfere with successful immunization in children who receive standard measles-mumps-rubella vaccine. Infants 15 to 18 months of age presenting at our well-child clinics for routine examination and immunizations were divided into two groups. Those infants with a history and physical findings of upper respiratory tract infection were compared with healthy control group infants who did not have upper respiratory tract infections, and who did not have a history of upper respiratory tract infection symptoms within the previous month. Both groups were studied for their serologic response to measles-mumps-rubella vaccination. Prevaccination serum samples were obtained prior to vaccine administration and postvaccination serum samples were obtained 6 to 8 weeks later. Measles antibody was measured in these serum samples by an indirect fluorescein-tagged antibody test. Ten (21%) of 47 infants with colds failed to develop measles antibody, while only one (2%) of 51 well infants failed to develop antibody. We conclude that infants with colds have a significant seroconversion failure rate associated with measles vaccine administration and that this may be the cause of some primary measles vaccine failures.

  16. A review of testing used in seroprevalence studies on measles and rubella.

    PubMed

    Dimech, Wayne; Mulders, Mick N

    2016-07-29

    Seroprevalence studies are an essential tool to monitor the efficacy of vaccination programmes, to understand population immunity and to identify populations at higher risk of infection. An overarching review of all aspects of seroprevalence studies for measles and rubella published between 1998 and June 2014 was undertaken and the findings reported elsewhere. This paper details the considerable variation in the testing formats identified in the review. Apart from serum/plasma samples, testing of oral fluid, breast milk, dry blood spots and capillary whole blood were reported. Numerous different commercial assays were employed, including microtitre plate assays, automated immunoassays and classical haemagglutination inhibition and neutralisation assays. A total of 29 of the 68 (43%) measles and 14 of the 58 (24%) rubella studies reported qualitative test results. Very little information on the testing environment, including quality assurance mechanisms used, was provided. Due to the large numbers of testing systems, the diversity of sample types used and the difficulties in accurate quantification of antibody levels, the results reported in individual studies were not necessarily comparable. Further efforts to standardise seroprevalence studies may overcome this deficiency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Seroprevalence of antibodies to measles, mumps, and rubella, and serologic responses after vaccination among human immunodeficiency virus (HIV)-1 infected adults in Northern Thailand.

    PubMed

    Chaiwarith, Romanee; Praparattanapan, Jutarat; Nuket, Khanuengnit; Kotarathitithum, Wilai; Supparatpinyo, Khuanchai

    2016-04-30

    After the global implementation of national immunization programs for prevention of measles, mumps, and rubella (MMR), the prevalences of protective antibodies to these viruses are high in general population. However, there are limited data among human immunodeficiency virus (HIV)-1 infected individuals. This study aimed to determine the seroprevalence of antibodies to these viruses, and the serologic responses after vaccination among HIV-infected adults in Northern Thailand. A cross-sectional study was conducted in 500 HIV-infected adults, aged 20-59 years, receiving combination antiretroviral therapy, CD4 cell count ≥200 cells/mm(3), and plasma HIV-1 RNA <50 copies/mL, and 132 HIV-uninfected controls, aged 20-59 years, at Chiang Mai University Hospital during July and August 2011. Prevalences of protective antibodies to these viruses as well as serologic responses after MMR vaccination in those without protective antibody to at least one of the three viruses were compared between groups. The prevalences of protective antibodies to measles, mumps, and rubella were 94.2, 55.0, and 84.6 % among HIV-infected adults, and 97.7, 67.5, and 89.4 % among HIV-uninfected controls, respectively. The prevalence of protective antibody to mumps was significantly lower in HIV-infected adults (p-value = 0.010). MMR vaccination was done in 249 HIV-infected and 46 HIV-uninfected controls; at week 8 to 12 after vaccination, the seroprotective rates against measles, mumps, and rubella in HIV-infected adults were 96.4, 70.7, and 98.0 %, respectively, whereas those in HIV-uninfected controls were 100, 87, and 100 %, respectively. No serious adverse effects were observed. In contrast to measles and rubella, the prevalence of protective antibody to mumps was low in both HIV-infected adults and HIV-uninfected controls in northern Thailand. The seroprotective rates after MMR vaccination in both groups were considerably high, except only for mumps. Therefore, MMR vaccination should be considered in all HIV-infected adults receiving antiretroviral therapy with undetectable plasma HIV-1 RNA and CD4 cell count ≥200 cells/mm(3). ClinicalTrials.gov: NCT02724852 , registered on March 31, 2016.

  18. Seroprevalence of rubella in Colombia: a birth-year cohort analysis

    PubMed Central

    Hincapie-Palacio, Doracelly; Lenis Ballesteros, Viviana; Ospina, Martha Ospina; Toro, Olga Lucía Pérez; Díaz, Francisco J

    2013-01-01

    OBJECTIVE To estimate the seroprevalence of rubella and associated factors. METHODS Population-based seroprevalence study in a random sample of 2,124 individuals, aged six to 64 years, representative by age, sex and area in Medellín, Colombia, 2009. Biological and socioeconomic variables were analyzed for their association with serum protection against rubella, according to birth-year cohort; those born before (1954-1990) and after (1991-2003) the introduction of universal immunization. Titer of IgG antibodies against the rubella virus was detected using a high sensitivity (AxSYM®Rubella IgG – Abbott Laboratories) and a high specificity test (VIDAS RUB IgG II®– BioMerieux Laboratories). Proportions and weighted averages derived from a complex sample, including a correction factor for differences in gender participation, were estimated. Association with protection for groups of biological and social variables according to birth cohort was analyzed using a logistic regression model. RESULTS Titers of IgG antibodies were higher in those born before (mean 110 UI/ml, 95%CI 100.5;120.2) compared to those born after (mean 64 UI/ml; 95%CI 54.4;72.8; p = 0.000) the introduction of mass immunization. The proportion of protection increased from 88.9% in those born 1990-1994, to 89.2% in those born 1995-1999 and to 92.1% in those born between 2000 and 2003, possibly due to boosters being administered from 1998 onwards. In those born before the introduction of the immunization, seroprotection was associated with previous contact with cases (OR 2.6; 95%CI 1.1;5.9), self- perceived health status (OR 2.5; 95%CI 1.05;6.0), educational level (OR 0.2; 95%CI 0.08;0.8) and years of residence in the neighborhood (RD 0,96; 95%CI 0.98;1.0) after adjusting for all variables. In those born after, serum protection was associated with effective sleep time (OR 1,4; 95%CI 1.09;1.8) and self-perceived health status (OR 5.5; 95%CI 1.2;23.8). CONCLUSIONS The seroprevalence profile changed with the mass immunization plan, with higher titers of IgG antibodies in those born before the start of the immunization. It is recommended that the level of long-term protection be monitored and concerted action taken to improve potentially associated socioeconomic conditions. PMID:24626546

  19. The ocular manifestations of congenital infection: a study of the early effect and long-term outcome of maternally transmitted rubella and toxoplasmosis.

    PubMed Central

    O'Neill, J F

    1998-01-01

    PURPOSE: To study the spectrum of adverse ocular effects which result from maternally transmitted rubella and toxoplasma infection; further, to record the long-term visual and neurodevelopmental outcomes of these 2 major causes of fetal infection. STUDY DESIGN AND PATIENTS: A series of 55 patients with congenital infection have been studied prospectively on a long-term basis. The study group included a cohort of 34 cases with congenital rubella syndrome demonstrated by virus isolation, and 21 cases with a clinical diagnosis of congenital toxoplasmosis and serologic confirmation. All patients had specific disease-related ocular defects. Rubella patients were first identified during or following the last major rubella epidemic in 1963-1964, and some have been followed serially since that time. A separate study group of representative toxoplasmosis patients presented for examination and diagnosis at varying time periods between 1967 and 1991. OBSERVATIONS AND RESULTS: This study confirms that a broad spectrum of fetal injury may result from intrauterine infection and that both persistent and delayed-onset effects may continue or occur as late as 30 years after original infection. Many factors contribute to the varied outcome of prenatal infection, the 2 most important being the presence of maternal immunity during early gestation and the stage of gestation during which fetal exposure occurs in a nonimmune mother. RUBELLA: As a criteria of inclusion, all 34 rubella patients in this study exhibited one or more ocular defects at the time of birth or in the immediate neonatal period. Cataracts were present in 29 (85%) of the 34, of which 21 (63%) were bilateral. Microphthalmia, the next most frequent defect, was present in 28 (82%) of the 34 infants and was bilateral in 22 (65%). Glaucoma was recorded in 11 cases (29%) and presented either as a transient occurrence with early cloudy cornea in microphthalmic eyes (4 patients), as the infantile type with progressive buphthalmos (1 patient), or as a later-onset, aphakic glaucoma many months or years following cataract aspiration in 11 eyes of 6 patients. Rubella retinopathy was present in the majority of patients, although an accurate estimate of its incidence or laterality was not possible because of the frequency of cataracts and nystagmus and the difficulty in obtaining adequate fundus examination. TOXOPLASMOSIS: Twenty-one patients with congenital toxoplasmosis have been examined and followed for varying time periods, 7 for 20 years or more. The major reason for initial examination was parental awareness of an ocular deviation. Twelve children (57%) presented between the ages of 3 months and 4 years with an initial diagnosis of strabismus, 9 of whom had minor complaints or were diagnosed as part of routine examinations. All cases in this study have had evidence of retinochoroiditis, the primary ocular pathology of congenital toxoplasmosis. Two patients had chronic and recurrent inflammation with progressive vitreal traction bands, retinal detachments, and bilateral blindness. Macular lesions were always associated with central vision loss; however, over a period of years visual acuity gradually improved in several patients. Individuals with more severe ocular involvement were also afflicted with the most extensive central nervous system deficits, which occurred following exposure during the earliest weeks of gestation. CONCLUSIONS: Although congenital infection due to rubella virus has been almost completely eradicated in the United States, the long-term survivors from the prevaccination period continue to experience major complications from their early ocular and cerebral defects. They may be afflicted by the persistence of virus in their affected organs and the development of late manifestations of their congenital infection. Congenital toxoplasmosis continues to be the source of major defects for 3,000 to 4,100 infants in the United States each year; the spectrum of defects is wide and may vary from blindness and severe mental retardation to minor retinochoroidal lesions of little consequence. Effective solutions for either the prevention or treatment of congenital toxoplasmosis have not been developed in this country but are under intensive and continuing investigation. Images FIGURE 4 FIGURE 5A FIGURE 5B FIGURE 5C FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15A FIGURE 15B FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20A FIGURE 20B FIGURE 20C FIGURE 20D FIGURE 20E FIGURE 20F FIGURE 20G FIGURE 20H FIGURE 20J FIGURE 20K FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 A FIGURE 24B FIGURE 25 FIGURE 26 FIGURE 27 FIGURE 28 FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 PMID:10360309

  20. Meningitis Myths and Facts

    MedlinePlus

    ... Pertussis (Whooping Cough) Pneumococcal Disease Polio Respiratory Syncytial Virus (RSV) Rotavirus Rubella (German Measles) Shingles (Herpes Zoster) Tetanus (Lockjaw) Advanced Search » Professional ...

  1. Encephalitis

    MedlinePlus

    ... due to some viruses, including: Measles Mumps Polio Rabies Rubella Varicella (chickenpox) Other viruses that cause encephalitis ... Vaccinate animals to prevent encephalitis caused by the rabies virus.

  2. Fontanelles - excessively large

    MedlinePlus

    ... Hydrocephalus Intrauterine growth retardation (IUGR) Premature birth Rarer causes: Achondroplasia Apert syndrome Cleidocranial dysostosis Congenital rubella Neonatal hypothyroidism Osteogenesis imperfecta Rickets When to Contact a Medical ...

  3. Evolutionary analysis of rubella viruses in mainland China during 2010–2012: endemic circulation of genotype 1E and introductions of genotype 2B

    PubMed Central

    Zhu, Zhen; Rivailler, Pierre; Abernathy, Emily; Cui, Aili; Zhang, Yan; Mao, Naiyin; Xu, Songtao; Zhou, Shujie; Lei, Yue; Wang, Yan; Zheng, Huanying; He, Jilan; Chen, Ying; Li, Chongshan; Bo, Fang; Zhao, Chunfang; Chen, Meng; Lu, Peishan; Li, Fangcai; Gu, Suyi; Gao, Hui; Guo, Yu; Chen, Hui; Feng, Daxing; Wang, Shuang; Tang, Xiaomin; Lei, Yake; Feng, Yan; Deng, Lili; Gong, Tian; Fan, Lixia; Xu, Wenbo; Icenogle, Joseph; Chen, Xia; Tian, Hong; Ma, Yan; Liu, Leng; Liu, Li; Liu, Jianfeng; Fu, Hong; Yang, Yuying; Ma, Yujie; Zhao, Hua; Huang, Fang; Hu, Ying; Zhang, Hong; Tian, Xiaoling; Du, Hui; Ma, Xuemin; Zhang, Zhenying; Xu, Jin; Zhou, Jianhui; Ye, Xufang; Li, Jing; Lu, Yiyu; Liu, Wei; Zhang, Yanni; Zhao, Shengcang; Ba, Zhuoma

    2015-01-01

    Rubella remains a significant burden in mainland China. In this report, 667 viruses collected in 24 of 31 provinces of mainland China during 2010–2012 were sequenced and analyzed, significantly extending previous reports on limited numbers of viruses collected before 2010. Only viruses of genotypes 1E and 2B were found. Genotype 1E viruses were found in all 24 provinces. Genotype 1E viruses were likely introduced into mainland China around 1997 and endemic transmission of primarily one lineage became established. Viruses reported here from 2010–2012 are largely in a single cluster within this lineage. Genotype 2B viruses were rarely detected in China prior to 2010. This report documents a previously undetected 2B lineage, which likely became endemic in eastern provinces of China between 2010 and 2012. Bayesian analyses were performed to estimate the evolutionary rates and dates of appearance of the genotype 1E and 2B viral linages in China. A skyline plot of viral population diversity did not provide evidence of reduction of diversity as a result of vaccination, but should be useful as a baseline for such reductions as vaccination programs for rubella become widespread in mainland China. PMID:25613734

  4. [Microbiological Surveillance of Measles and Rubella in Spain. Laboratory Network].

    PubMed

    Echevarría, Juan Emilio; Fernández García, Aurora; de Ory, Fernando

    2015-01-01

    The Laboratory is a fundamental component on the surveillance of measles and rubella. Cases need to be properly confirmed to ensure an accurate estimation of the incidence. Strains should be genetically characterized to know the transmission pattern of these viruses and frequently, outbreaks and transmission chains can be totally discriminated only after that. Finally, the susceptibility of the population is estimated on the basis of sero-prevalence surveys. Detection of specific IgM response is the base of the laboratory diagnosis of these diseases. It should be completed with genomic detection by RT-PCR to reach an optimal efficiency, especially when sampling is performed early in the course of the disease. Genotyping is performed by genomic sequencing according to reference protocols of the WHO. Laboratory surveillance of measles and rubella in Spain is organized as a net of regional laboratories with different capabilities. The National Center of Microbiology as National Reference Laboratory (NRL), supports regional laboratories ensuring the availability of all required techniques in the whole country and watching for the quality of the results. The NRL is currently working in the implementation of new molecular techniques based on the analysis of genomic hypervariable regions for the strain characterization at sub-genotypic levels and use them in the surveillance.

  5. Detection of measles, mumps, and rubella viruses.

    PubMed

    Tipples, Graham; Hiebert, Joanne

    2011-01-01

    Measles, mumps, and rubella are infections caused by RNA viruses of the same name and are vaccine preventable. The vaccines are frequently administered in a trivalent form. Laboratory diagnostic methods can include indirect detection via antibody (IgM and IgG) detection methods and direct detection by viral culture or viral genome detection. There are challenges for the laboratory in areas with low prevalence due to high vaccine uptake. In those areas, routine serological methods such as IgM detection may have a reduced positive predictive value and thus require confirmation by other methods. Direct detection of viral genomic material using reverse transcription polymerase chain reaction (RT-PCR) methodologies can play an important role for laboratory confirmation of acute infections. Furthermore, genotyping of these three viruses provides useful molecular epidemiological data for differentiating vaccine from wild-type strains, linking cases and outbreaks, and tracking geographic spread and elimination. The purpose of this chapter is to provide guidance for the laboratory diagnosis of measles, mumps, and rubella virus infections. Where assays are commercially available or previously published, the appropriate references are provided as well as brief comments on the interpretation of results. Detailed protocols are provided for the molecular assays which have been developed and more commonly applied in recent years.

  6. Evolutionary analysis of rubella viruses in mainland China during 2010-2012: endemic circulation of genotype 1E and introductions of genotype 2B.

    PubMed

    Zhu, Zhen; Rivailler, Pierre; Abernathy, Emily; Cui, Aili; Zhang, Yan; Mao, Naiyin; Xu, Songtao; Zhou, Shujie; Lei, Yue; Wang, Yan; Zheng, Huanying; He, Jilan; Chen, Ying; Li, Chongshan; Bo, Fang; Zhao, Chunfang; Chen, Meng; Lu, Peishan; Li, Fangcai; Gu, Suyi; Gao, Hui; Guo, Yu; Chen, Hui; Feng, Daxing; Wang, Shuang; Tang, Xiaomin; Lei, Yake; Feng, Yan; Deng, Lili; Gong, Tian; Fan, Lixia; Xu, Wenbo; Icenogle, Joseph

    2015-01-23

    Rubella remains a significant burden in mainland China. In this report, 667 viruses collected in 24 of 31 provinces of mainland China during 2010-2012 were sequenced and analyzed, significantly extending previous reports on limited numbers of viruses collected before 2010. Only viruses of genotypes 1E and 2B were found. Genotype 1E viruses were found in all 24 provinces. Genotype 1E viruses were likely introduced into mainland China around 1997 and endemic transmission of primarily one lineage became established. Viruses reported here from 2010-2012 are largely in a single cluster within this lineage. Genotype 2B viruses were rarely detected in China prior to 2010. This report documents a previously undetected 2B lineage, which likely became endemic in eastern provinces of China between 2010 and 2012. Bayesian analyses were performed to estimate the evolutionary rates and dates of appearance of the genotype 1E and 2B viral linages in China. A skyline plot of viral population diversity did not provide evidence of reduction of diversity as a result of vaccination, but should be useful as a baseline for such reductions as vaccination programs for rubella become widespread in mainland China.

  7. Measles, Rubella and Varicella IgG Seroprevalence in a Large Refugee Cohort in Germany in 2015: A Cross-Sectional Study.

    PubMed

    Jablonka, Alexandra; Happle, Christine; Wetzke, Martin; Dopfer, Christian; Merkesdal, Sonja; Schmidt, Reinhold E; Behrens, Georg M N; Solbach, Philipp

    2017-12-01

    The current extent of migration to the European continent is associated with exceptional humanitarian challenges. In 2015, Western Europe faced an enormous immigration of refugees with largely unknown protection status against communicable diseases. To adapt vaccination strategies, we aimed at assessing seroprevalences against three of the most relevant vaccine preventable diseases (VPD) in a large representative cohort. IgG seroprevalences for rubella, varicella (n = 554) and measles (n = 552) were analyzed in inhabitants of a Northern German refugee camp in the summer of 2015. Of the refugees, 77.9% were male (mean age 27.4 years for male and 26.8 years for female migrants). Most refugees came from the Eastern Mediterranean region (83.4%), followed by immigrants from Eastern Europe (7.4%), Africa (4.6%), or other regions (4.5%). The vast majority of migrants were protected against the three VPD: overall IgG seropositivity was 88.5% for measles, 77.9% for rubella and 95.9% for varicella. However, seroprevalences showed age- and origin-dependent differences. Varicella immunity, for example, was lowest in the youngest age group of both genders (10.1% of male/4.5% of female seronegative refugees <18 years vs. 100% seropositivity in men and women >49 years of age), and Sudanese migrants displayed particularly low rates of protection against varicella. In accordance with previous studies, our analyses show an overall satisfactory seropositivity against measles, rubella, and varicella in refugees entering Europe during the current exodus. However, this rate is not sufficient for preventing transmission. For example, the rate of 12.9-17.9% female refugees at reproductive age unprotected against measles and the low protection levels against varicella in minors observed in our cohort emphasizes the need for stringent vaccination strategies in refugees coming to Europe during the current crisis.

  8. Results of continuous monitoring of the performance of rubella virus IgG and hepatitis B virus surface antibody assays using trueness controls in a multicenter trial.

    PubMed

    Kruk, Tamara; Ratnam, Sam; Preiksaitis, Jutta; Lau, Allan; Hatchette, Todd; Horsman, Greg; Van Caeseele, Paul; Timmons, Brian; Tipples, Graham

    2012-10-01

    We conducted a multicenter trial in Canada to assess the value of using trueness controls (TC) for rubella virus IgG and hepatitis B virus surface antibody (anti-HBs) serology to determine test performance across laboratories over time. TC were obtained from a single source with known international units. Seven laboratories using different test systems and kit lots included the TC in routine assay runs of the analytes. TC measurements of 1,095 rubella virus IgG and 1,195 anti-HBs runs were plotted on Levey-Jennings control charts for individual laboratories and analyzed using a multirule quality control (MQC) scheme as well as a single three-standard-deviation (3-SD) rule. All rubella virus IgG TC results were "in control" in only one of the seven laboratories. Among the rest, "out-of-control" results ranged from 5.6% to 10% with an outlier at 20.3% by MQC and from 1.1% to 5.6% with an outlier at 13.4% by the 3-SD rule. All anti-HBs TC results were "in control" in only two laboratories. Among the rest, "out-of-control" results ranged from 3.3% to 7.9% with an outlier at 19.8% by MQC and from 0% to 3.3% with an outlier at 10.5% by the 3-SD rule. In conclusion, through the continuous monitoring of assay performance using TC and quality control rules, our trial detected significant intra- and interlaboratory, test system, and kit lot variations for both analytes. In most cases the assay rejections could be attributable to the laboratories rather than to kit lots. This has implications for routine diagnostic screening and clinical practice guidelines and underscores the value of using an approach as described above for continuous quality improvement in result reporting and harmonization for these analytes.

  9. Enabling implementation of the Global Vaccine Action Plan: developing investment cases to achieve targets for measles and rubella prevention.

    PubMed

    Thompson, Kimberly M; Strebel, Peter M; Dabbagh, Alya; Cherian, Thomas; Cochi, Stephen L

    2013-04-18

    Global prevention and control of infectious diseases requires significant investment of financial and human resources and well-functioning leadership and management structures. The reality of competing demands for limited resources leads to trade-offs and questions about the relative value of specific investments. Developing investment cases can help to provide stakeholders with information about the benefits, costs, and risks associated with available options, including examination of social, political, governance, and ethical issues. We describe the process of developing investment cases for globally coordinated management of action plans for measles and rubella as tools for enabling the implementation of the Global Vaccine Action Plan (GVAP). We focus on considerations related to the timing of efforts to achieve measles and rubella goals independently and within the context of ongoing polio eradication efforts, other immunization priorities, and other efforts to control communicable diseases or child survival initiatives. Our analysis suggests that the interactions between the availability and sustainability of financial support, sufficient supplies of vaccines, capacity of vaccine delivery systems, and commitments at all levels will impact the feasibility and timing of achieving national, regional, and global goals. The timing of investments and achievements will determine the net financial and health benefits obtained. The methodology, framing, and assumptions used to characterize net benefits and uncertainties in the investment cases will impact estimates and perceptions about the value of prevention achieved overall by the GVAP. We suggest that appropriately valuing the benefits of investments of measles and rubella prevention will require the use of integrated dynamic disease, economic, risk, and decision analytic models in combination with consideration of qualitative factors, and that synthesizing information in the form of investment cases may help stakeholders manage expectations as they chart the course ahead and navigate the decade of vaccines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Analysis of rubella virus capsid protein-mediated enhancement of replicon replication and mutant rescue.

    PubMed

    Tzeng, Wen-Pin; Matthews, Jason D; Frey, Teryl K

    2006-04-01

    The rubella virus capsid protein (C) has been shown to complement a lethal deletion (termed deltaNotI) in P150 replicase protein. To investigate this phenomenon, we generated two lines of Vero cells that stably expressed either C (C-Vero cells) or C lacking the eight N-terminal residues (Cdelta8-Vero cells), a construct previously shown to be unable to complement DeltaNotI. In C-Vero cells but not Vero or Cdelta8-Vero cells, replication of a wild-type (wt) replicon expressing the green fluorescent protein (GFP) reporter gene (RUBrep/GFP) was enhanced, and replication of a replicon with deltaNotI (RUBrep/GFP-deltaNotI) was rescued. Surprisingly, replicons with deleterious mutations in the 5' and 3' cis-acting elements were also rescued in C-Vero cells. Interestingly, the Cdelta8 construct localized to the nucleus while the C construct localized in the cytoplasm, explaining the lack of enhancement and rescue in Cdelta8-Vero cells since rubella virus replication occurs in the cytoplasm. Enhancement and rescue in C-Vero cells were at a basic step in the replication cycle, resulting in a substantial increase in the accumulation of replicon-specific RNAs. There was no difference in translation of the nonstructural proteins in C-Vero and Vero cells transfected with the wt and mutant replicons, demonstrating that enhancement and rescue were not due to an increase in the efficiency of translation of the transfected replicon transcripts. In replicon-transfected C-Vero cells, C and the P150 replicase protein associated by coimmunoprecipitation, suggesting that C might play a role in RNA replication, which could explain the enhancement and rescue phenomena. A unifying model that accounts for enhancement of wt replicon replication and rescue of diverse mutations by the rubella virus C protein is proposed.

  11. Immunogenicity and safety of measles-mumps-rubella and varicella vaccines coadministered with a fourth dose of Haemophilus influenzae type b and Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine in toddlers: a pooled analysis of randomized trials.

    PubMed

    Bryant, Kristina; McVernon, Jodie; Marchant, Colin; Nolan, Terry; Marshall, Gary; Richmond, Peter; Marshall, Helen; Nissen, Michael; Lambert, Stephen; Aris, Emmanuel; Mesaros, Narcisa; Miller, Jacqueline

    2012-08-01

    A pooled analysis was conducted of 1257 toddlers who received a fourth dose of Haemophilus influenzae type b-Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine (HibMenCY-TT) or Hib conjugate vaccine (Hib polysaccharide conjugated to N. meningitidis outer membrane protein) coadministered with measles-mumps-rubella (MMR) and varicella (VAR) vaccines (NCT00134719/NCT00289783). Noninferiority of immunological responses to MMR and VAR was demonstrated between groups and incidences of MMR- and VAR-specific solicited symptoms were similar, indicating that HibMenCY-TT can be coadministered with MMR and VAR.

  12. Rubella virus genotype 1G and echovirus 9 as etiologic agents of exanthematous diseases in Brazil: insights from phylogenetic analysis.

    PubMed

    Figueiredo, Cristina Adelaide; Luchs, Adriana; Russo, Denise Hage; de Cassia Compagnoli Carmona, Rita; Afonso, Ana Maria Sardinha; de Oliveira, Maria Isabel; Curti, Suely Pires; de Moraes, José Cassio; Toscano, Cristiana M; Ciccone, Flavia Helena; Timenetsky, Maria do Carmo Sampaio Tavares

    2014-06-01

    The aim of the present study was to identify the rubella virus (RV) and enterovirus (EV) genotypes detected during the Epidemiological Surveillance on Exanthematic Febrile Diseases (VIGIFEX) study and to perform phylogenetic analysis. Ten RV- and four EV-positive oropharyngeal samples isolated from cell culture were subjected to RT-PCR and sequencing. Genotype 1G and echovirus 9 (E-9) was identified in RV- and EV-positive samples, respectively. The RV 1G genotype has been persisting in Brazil since 2000-2001. No evidence of E-9 being involved in exanthematic illness in Brazil has been reported previously. Differential laboratory diagnosis is essential for management of rash and fever disease.

  13. Toxic epidermal necrolysis following morbilli-parotitis-rubella vaccination.

    PubMed

    Dobrosavljevic, D; Milinkovic, M V; Nikolic, M M

    1999-07-01

    We present the first reported case of toxic epidermal necrolysis (TEN) caused by morbilli-parotitis-rubella (MPR) vaccine. A 13-year-old girl developed TEN 7 days after she received live, attenuated, triple MPR vaccine. The history of drug intake and any illness was negative. At admission the patient was acutely ill with high fever. The whole body was erythematous. The epidermis was wrinkled and the Nikolsky sign was positive. Numerous erosions were present on the lips and genital region. On the seventh day of illness, the eruption involved 80% of the skin. Systemic corticosteroid therapy was not employed. The skin and mucosal defects completely epithelized by the end of the third week of illness. Mild keratoconjunctivitis sicca remained because of permanent cup cell damage.

  14. Measles, mumps, rubella vaccine induced subacute sclerosing panencephalitis.

    PubMed

    Belgamwar, R B; Prasad, S; Appaya, P

    1997-11-01

    The incidence of subacute sclerosing panencephalitis (SSPE), a progressive and fatal neurodegenerative disease caused by the measles virus, has declined with widespread use of measles vaccine. The risk of SSPE after measles vaccination has been estimated at 0.7/million doses. This paper reports the case of a 15-year-old girl from India who developed SSPE presumably as a result of a delayed effect of measles, mumps, and rubella (MMR) vaccine. She presented with a 2-month history of behavioral disturbances, a deterioration in school performance, forgetfulness, silly smiling, handwriting changes, social withdrawal, and ataxia. The girl had received MMR vaccine at 9 months of age and had no past history of measles. Her measles antibody titre was 1:625 in both serum and cerebrospinal fluid.

  15. Immunogenicity and reactogenicity of tetravalent vaccine for measles, mumps, rubella and varicella (MMRV) in healthy children: a meta-analysis of randomized controlled trials.

    PubMed

    Leung, Julia Hy; Hirai, Hoyee W; Tsoi, Kelvin Kf

    2015-01-01

    Varicella is a highly infectious childhood disease. Tetravalent measles-mumps-rubella-varicella (MMRV) vaccine was introduced as one-syringe dose. To evaluate the immunogenicity and reactogenicity of MMRV vaccine versus trivalent MMR with varicella (V) vaccines in healthy children and to assess the respective safety issue. Randomized controlled trials (RCTs) were searched from the OVID databases. Trials were eligible if healthy children were randomized to receive MMRV or MMR+V vaccine. Seroconversions in serum antibody titers were the primary outcomes; adverse events were the secondary outcomes. Ten RCTs with 8961 healthy children were identified. MMRV and MMR+V vaccines showed comparable immunogenicity against measles (relative risk [RR] = 0.99, 95% CI = 0.98-1.00), mumps (RR = 0.99, 95% CI = 0.97-1.00), rubella (RR = 1.00, 95% CI = 1.00-1.01) and varicella (RR = 0.98, 95% CI = 0.95-1.01). At least 93% of children in both groups had seroconverted within 6 weeks. MMRV group showed significantly higher incidences of fever (RR = 1.19, 95% CI = 1.09-1.31) and rash (RR = 1.23, 95% CI = 1.06-1.43). The immunogenicities of MMRV and MMR+V vaccines were comparable in healthy children; however, MMRV vaccination showed higher incidences of fever and rash.

  16. Measles, rubella, mumps, and varicella seroprevalence among health care workers in Turkey: is prevaccination screening cost-effective?

    PubMed

    Celikbas, Aysel; Ergonul, Onder; Aksaray, Sabahat; Tuygun, Nilden; Esener, Harika; Tanir, Gonul; Eren, Sebnem; Baykam, Nurcan; Guvener, Engin; Dokuzoguz, Basak

    2006-11-01

    To investigate the immune status of health care workers (HCWs) against measles, rubella, mumps, and varicella zoster (MMRV) in Turkey and to define an appropriate vaccination program among HCWs. Voluntary HCWs from a children's hospital and a general hospital were included in the study between March and May 2005. The specific IgG antibodies against MMRV viruses were screened by ELISA. Three hundred sixty-three HCWs participated in the study; 186 (51%) were physicians, 118 (33%) were nurses, 36 (10%) were housekeeping staff, and 23 (6%) were medical technicians. The proportion of HCWs who had antibodies against measles was 98.6%; rubella, 98.3%; mumps, 92.2%; and varicella, 98%. No association was found between the susceptibility to at least 1 of MMRV virus infections and gender, age, duration of work, profession, and department of work in analysis either among the whole study group, or each hospital. The positive predictive value for the history of varicella was 100%, whereas it was 92% for MMR. The cost of vaccination for varicella was significantly expensive without screening before vaccination. However, there was not much difference for MMR infections. A policy based on obtaining the history of varicella infection from the staff and then screening the ones with negative history and vaccination of only seronegative HCWs was found to be appropriate.

  17. Perfluoroalkyl and Polyfluoroalkyl Substances and Indicators of Immune Function in Children Aged 12 – 19 years: NHANES

    PubMed Central

    Stein, Cheryl R.; McGovern, Kathleen J.; Pajak, Ashley M.; Maglione, Paul J.; Wolff, Mary S.

    2016-01-01

    Background Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are immunotoxic in laboratory studies. Humans studies of immune effects are inconsistent. Using the U.S. National Health and Nutrition Examination Survey (NHANES) we examined PFAS serum concentration and indicators of prevalent immune function among 12 to 19 year old children. Methods In this cross-sectional study we examined PFAS serum concentration in relation to measles, mumps, and rubella antibody concentrations in NHANES 1999 – 2000 and 2003 – 2004 (n=1,191) and to allergic conditions and allergic sensitization in NHANES 2005 – 2006 (n=640). Results In adjusted, survey-weighted models, a doubling of perfluorooctane sulfonate (PFOS) concentration among seropositive children was associated with a 13.3% (95% CI −19.9, −6.2) decrease in rubella antibody concentration and a 5.9% decrease in mumps antibody concentration (95% CI −9.9, −1.6). We observed no adverse association between exposure and current allergic conditions, including asthma. Children with higher PFOS concentration were less likely to be sensitized to any allergen (OR 0.74, 95% CI 0.58, 0.95). Conclusion Increased exposure to several PFAS was associated with lower levels to mumps and rubella antibody concentrations, especially among seropositive individuals. These lower antibody concentrations may indicate a less robust response to vaccination or greater waning of vaccine-derived immunity over time. PMID:26492286

  18. Decay of Passively Acquired Maternal Antibodies against Measles, Mumps, and Rubella Viruses

    PubMed Central

    Nicoara, Corina; Zäch, Kristina; Trachsel, Daniel; Germann, Daniel; Matter, Lukas

    1999-01-01

    The decay of maternally derived antibodies to measles, mumps, and rubella viruses in Swiss infants was studied in order to determine the optimal time for vaccination. A total of 500 serum or plasma samples from infants up to 2 years of age were tested by enzyme-linked immunosorbent assay and fluorescent-antibody testing. The decline of antibody prevalence was slowest against the measles virus. By 9 to 12 months of age, only 5 of 58 (8.6%; 95% CI, 2.9 to 19.0) infants were antibody positive for the measles virus, and only 2 had levels above 200 mIU/ml. Mumps and rubella virus antibody seropositivity was lowest at 9 to 12 months of age with 3 of 58 (5.2%; 95% CI, 1.1 to 14.4) infants and at 12 to 15 months with 1 of 48 (2.1%; 95% CI, 0.1 to 11.1) infants, respectively. Concentrations of passively acquired antibodies decreased rapidly within the first 6 months of life. We observed no significant differences in antibody prevalence or concentration according to gender in any age group. In conclusion, MMR vaccination at 12 instead of 15 months of age could reduce the pool of susceptible subjects in infancy and support the efforts to eliminate these infections, particularly in combination with a second vaccine dose before school entry. PMID:10548578

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoneda, T.; Urade, M.; Sakuda, M.

    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growthmore » of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of /sup 125/I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound /sup 125/I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients.« less

  20. Progress Toward Measles Elimination - South-East Asia Region, 2003-2013.

    PubMed

    Thapa, Arun; Khanal, Sudhir; Sharapov, Umid; Swezy, Virginia; Sedai, Tika; Dabbagh, Alya; Rota, Paul; Goodson, James L; McFarland, Jeffrey

    2015-06-12

    In 2013, the 66th session of the Regional Committee of the World Health Organization (WHO) South-East Asia Region adopted the goal of measles elimination and rubella and congenital rubella syndrome control by 2020 after rigorous prior consultations. The recommended strategies include 1) achieving and maintaining ≥95% coverage with 2 doses of measles- and rubella-containing vaccine in every district through routine or supplementary immunization activities (SIAs); 2) developing and sustaining a sensitive and timely case-based measles surveillance system that meets recommended performance indicators; 3) developing and maintaining an accredited measles laboratory network; and 4) achieving timely identification, investigation, and response to measles outbreaks. This report updates previous reports and summarizes progress toward measles elimination in the South-East Asia Region during 2003-2013. Within the region, coverage with the first dose of a measles-containing vaccine (MCV1) increased from 67% to 78%; an estimated 286 million children (95% of the target population) were vaccinated in SIAs; measles incidence decreased 73%, from 59 to 16 cases per million population; and estimated measles deaths decreased 63%. To achieve measles elimination in the region, additional efforts are needed in countries with <95% 2-dose routine MCV coverage, particularly in India and Indonesia, to strengthen routine immunization services, conduct periodic high-quality SIAs, and strengthen measles case-based surveillance and laboratory diagnosis of measles.

  1. Measles

    MedlinePlus

    ... protects against measles, mumps, and rubella, can cause autism. Parents and caregivers should know that: Large studies ... no connection between this or any vaccine and autism. Reviews by all major health organizations in the ...

  2. Rubella: Make Sure Your Child Gets Vaccinated

    MedlinePlus

    ... Emergency Preparedness & Response Environmental Health Healthy Living Injury, Violence & Safety Life Stages & Populations Travelers’ Health Workplace Safety & Health Features Media Sign up for Features Get Email Updates To ...

  3. Travelers' Health: Rubella

    MedlinePlus

    ... Climates Humanitarian Aid Workers Humanitarian Aid Workers in Ecuador Insurance International Adoption Jet Lag Last-Minute Travel Long-Term Travel Mass Gatherings Medical Tourism Mental Health Motion Sickness Natural Disasters Pregnant Travelers ...

  4. 77 FR 30015 - Advisory Committee on Immunization Practices (ACIP)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-21

    ..., influenza, pneumococcal vaccines, measles-mumps-rubella vaccine, pertussis, development of evidence- based recommendations, Institute of Medicine vaccine committee report, and anthrax vaccine adsorbed and vaccine supply...

  5. Rubella Test

    MedlinePlus

    ... and Mumps Tests Mercury Metanephrines Methotrexate Methylmalonic Acid Mononucleosis (Mono) Test MRSA Screening MTHFR Mutation Mycophenolic Acid ... 23 days after coming in contact with an infectious person. A person is usually infectious about a ...

  6. Varicella (Chickenpox) Vaccine

    MedlinePlus

    ProQuad® (as a combination product containing Measles Vaccine, Mumps Vaccine, Rubella Vaccine, Varicella Vaccine) ... Has a parent, brother, or sister with a history of immune system problems. Is taking salicylates (such ...

  7. Rubella (German Measles)

    MedlinePlus

    ... in such cases has been associated with the development of Reye syndrome . When to Call the Doctor Call your doctor if your ... Getting Immunizations Affect My Unborn Baby? A Kid's Guide to Shots ...

  8. Fifth Disease

    MedlinePlus

    ... past. The others included measles, rubella (German measles), chicken pox, scarlet fever, and roseola. Fifth disease is ... The first signs of fifth disease are mild flu- or cold-like symptoms, including: low-grade fever ...

  9. Teratology: from science to birth defects prevention.

    PubMed

    Rasmussen, Sonja A; Erickson, J David; Reef, Susan E; Ross, Danielle S

    2009-01-01

    One of the goals of birth defects research is to better understand risk or preventive factors for birth defects so that strategies for prevention can be developed. In this article, we have selected four areas of birth defects research that have led to the development of prevention strategies. These areas include rubella virus as a cause of congenital rubella syndrome, folic acid as a preventive factor for neural tube defects, cytomegalovirus infection as a cause of birth defects and developmental disabilities, and alcohol as a cause of fetal alcohol spectrum disorders. For each of these areas, we review key clinical and research findings that led to the identification of the risk or preventive factor, milestones in the development of prevention strategies, and the progress made thus far toward prevention.

  10. Is there a 'regressive phenotype' of Autism Spectrum Disorder associated with the measles-mumps-rubella vaccine? A CPEA Study.

    PubMed

    Richler, Jennifer; Luyster, Rhiannon; Risi, Susan; Hsu, Wan-Ling; Dawson, Geraldine; Bernier, Raphael; Dunn, Michelle; Hepburn, Susan; Hyman, Susan L; McMahon, William M; Goudie-Nice, Julie; Minshew, Nancy; Rogers, Sally; Sigman, Marian; Spence, M Anne; Goldberg, Wendy A; Tager-Flusberg, Helen; Volkmar, Fred R; Lord, Catherine

    2006-04-01

    A multi-site study of 351 children with Autism Spectrum Disorders (ASD) and 31 typically developing children used caregiver interviews to describe the children's early acquisition and loss of social-communication milestones. For the majority of children with ASD who had experienced a regression, pre-loss development was clearly atypical. Children who had lost skills also showed slightly poorer outcomes in verbal IQ and social reciprocity, a later mean age of onset of autistic symptoms, and more gastrointestinal symptoms than children with ASD and no regression. There was no evidence that onset of autistic symptoms or of regression was related to measles-mumps-rubella vaccination. The implications of these findings for the existence of a 'regressive phenotype' of ASD are discussed.

  11. Rubella: Questions and Answers

    MedlinePlus

    ... of special precautions. Does the MMR vaccine cause autism? There is no scientific evidence that measles, MMR, ... other vaccine causes or increases the risk of autism. The question about a possible link between MMR ...

  12. About Infectious Mononucleosis

    MedlinePlus

    ... fever sore throat head and body aches swollen lymph nodes in the neck and armpits swollen liver or ... infections that can cause infectious mononucleosis: Cytomegalovirus (CMV) Toxoplasmosis HIV Rubella Hepatitis A, B, or C Adenovirus ...

  13. Laboratory diagnosis of viral infections

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lennette, E.H.

    1985-01-01

    This book contains 30 chapters. Some of the chapter titles are: Radioimmunoassay Systems; Enzyme Immunoassay Systems; Concepts of Clinical Diagnostic Virology; Role of Tissue Culture Systems, Adenoviruses; Influenza Viruses; Rabies Virus; and Rubella.

  14. Vaccine-Preventable Disease Photos

    MedlinePlus

    ... Typhoid fever HPV Polio Whooping cough Influenza (flu) Rabies Yellow fever Photo Library Photographs accompanied by text ... images Pneumococcus Three images Polio Twenty-six images Rabies Ten images Rotavirus Two images Rubella Fifteen images ...

  15. Concurrent Multiple Outbreaks of Varicella, Rubeola, German Measles in Unvaccinated Children of Co-Educational Mount Carmel Senior Secondary School, Thakurdwara Palampur of Northern Himachal, India

    PubMed Central

    Gupta, Surender Nikhil; Gupta, Naveen; Gupta, Shivani

    2015-01-01

    Background: In April, 2009, in a co-education school, we investigated suspected triple outbreak; varicella first and then with chance detection of rubeola and rubella. The aim was to confirm diagnosis and recommend remedial measures to prevent further outbreaks. Materials and Methods: We defined a case of varicella with maculopapulovesicular rash without other apparent cause in students or staff of the school and residents of neighboring villages of Khalet and Roady since 23rd March to 14th October, 2009. We line listed case patients and collected information on age, sex, residence, date of onset, symptoms, signs, traveling, treatment history, and vaccination status. The outbreak was described by time, place, and person characteristics. Diagnosis was confirmed epidemiologically and serologically; first to chickenpox, measles, and german measles viruses. Results: We identified 505 case patients from mixed outbreaks of varicella, measles, and german measles (30/505 clinically, 467/505 epidemiologically linked and 8/505 laboratory confirmed case patients from a study population of 3280. We investigated the suspected outbreak with case definition of varicella but measles 20/3280 (0.60%) and rubella 34/3280 (1.03%) cases were also observed. The overall attack rate (AR) was 15% while in school; it was 22% but highest (56%) in Nursery up to 4th standard with index case in first standard. Sex-specific AR was (23%) more in boys. Triple concurrent infection caused 05% complications but no death was reported. Severity of the symptoms was more in 5th standard onwards with 49–249 lesions and severer in poor villages Roady and Khalet (P < 0.05). Only 4% were immunized against varicella/german measles privately. Seventeen percent of the cases went for traditional treatment vs modern medicine (P < 0.001). 5/10 samples for IgM antibodies for chickenpox and 2/10 samples were positive for rubella. Conclusions: Triple infection of varicella, measles, and rubella was confirmed epidemiologically and serologically. We recommended local authorities for MMRV in the school and near villages with aggressive IEC activities in affected areas. PMID:25811001

  16. Concurrent multiple outbreaks of varicella, rubeola, german measles in unvaccinated children of co-educational mount carmel senior secondary school, thakurdwara palampur of northern himachal, India.

    PubMed

    Gupta, Surender Nikhil; Gupta, Naveen; Gupta, Shivani

    2015-01-01

    In April, 2009, in a co-education school, we investigated suspected triple outbreak; varicella first and then with chance detection of rubeola and rubella. The aim was to confirm diagnosis and recommend remedial measures to prevent further outbreaks. We defined a case of varicella with maculopapulovesicular rash without other apparent cause in students or staff of the school and residents of neighboring villages of Khalet and Roady since 23(rd) March to 14(th) October, 2009. We line listed case patients and collected information on age, sex, residence, date of onset, symptoms, signs, traveling, treatment history, and vaccination status. The outbreak was described by time, place, and person characteristics. Diagnosis was confirmed epidemiologically and serologically; first to chickenpox, measles, and german measles viruses. We identified 505 case patients from mixed outbreaks of varicella, measles, and german measles (30/505 clinically, 467/505 epidemiologically linked and 8/505 laboratory confirmed case patients from a study population of 3280. We investigated the suspected outbreak with case definition of varicella but measles 20/3280 (0.60%) and rubella 34/3280 (1.03%) cases were also observed. The overall attack rate (AR) was 15% while in school; it was 22% but highest (56%) in Nursery up to 4(th) standard with index case in first standard. Sex-specific AR was (23%) more in boys. Triple concurrent infection caused 05% complications but no death was reported. Severity of the symptoms was more in 5(th) standard onwards with 49-249 lesions and severer in poor villages Roady and Khalet (P < 0.05). Only 4% were immunized against varicella/german measles privately. Seventeen percent of the cases went for traditional treatment vs modern medicine (P < 0.001). 5/10 samples for IgM antibodies for chickenpox and 2/10 samples were positive for rubella. Triple infection of varicella, measles, and rubella was confirmed epidemiologically and serologically. We recommended local authorities for MMRV in the school and near villages with aggressive IEC activities in affected areas.

  17. FastStats: Measles

    MedlinePlus

    ... Women’s Health State and Territorial Data Reproductive Health Contraceptive Use Infertility Reproductive Health Notice Regarding FastStats Mobile ... measles, mumps, rubella: 91.9% (2015) Percent of adolescents aged 13-17 years vaccinated against measles, mumps, ...

  18. Warning: Your Classroom May Be Dangerous to Your Health

    ERIC Educational Resources Information Center

    Califano, Joseph A., Jr.

    1978-01-01

    The United States Secretary of Health, Education and Welfare discusses the national need to ensure that all children are immunized against childhood diseases--polio, measles, rubella, mumps, diphtheria, pertussis and tetanus. (RK)

  19. Comparative Sensitivity of Tissue Cultures to Rubella Virus: Use of Guinea Pig Cells for Virus Titration

    PubMed Central

    Horta-Barbosa, L.; Warren, Joel

    1969-01-01

    A series of 19 different primary and serial tissue cultures were investigated for their sensitivity to virulent or attenuated rubella virus (RV). Primary guinea pig tissues, a serial passage of baby hamster kidney, and primary human amnion were comparable to African green monkey kidney tissue cultures in their sensitivity. In general, primary human tissues were relatively insusceptible to the Gilchrist strain of RV. RV interfered with the growth of vesicular stomatitis virus. Based on this finding, it was possible to develop an assay method in guinea pig tissue cultures by using VSV as the challenge virus. This system appeared to be comparable in sensitivity to the use of primary monkey kidney tissue cultures for the detection of small amounts of RV and offers the advantages of economy, rapidity, and safety. PMID:4979943

  20. Long-term Seroprotection Rates Following Second Dose of Measles as MMR Vaccine at 15 months in Indian Children.

    PubMed

    Hansashree, P; Verma, Sanjay; Rawat, Amit; Sankhyan, Naveen; Bharti, Bhavneet

    2018-05-15

    To find out seropositivity rates at 4-6 and 9-12 years of age; among those who received one-dose measles at 9 months and one-dose MMR at 15 months of age. 80 healthy children (53 males) at 4-6 or 9-12 years of age, attending outpatient department for vaccination were enrolled. Antibody titers were estimated using commercially available quantitative-IgG ELISA kits. The seropositivity rates against measles, mumps, rubella were 80% (40/50), 86% (43/50), and 96% (48/50), respectively at 4-6 years, and 83.3% (25/30), 96.7% (29/30) and 96.7% (29/30), respectively at 9-12 years of age. Single dose of rubella vaccine seems to provide adequate long-term protection; however, measles vaccine requires more doses for similar protection.

  1. Measles, mumps, rubella, and varicella seroprevalence in refugees in Germany in 2015.

    PubMed

    Jablonka, Alexandra; Happle, Christine; Grote, Ulrike; Schleenvoigt, Benjamin Thomas; Hampel, Annika; Dopfer, Christian; Hansen, Gesine; Schmidt, Reinhold Ernst; Behrens, Georg M N

    2016-12-01

    The current extent of migration poses emerging socio-economic and humanitarian challenges. Little is known on vaccination rates in migrants entering Europe, and the implementation of guidelines for serological testing and vaccination of refugees are pending. We conducted seroprevalence analyses for measles, mumps, rubella and varicella (MMRV) in 678 refugees coming to Germany during the current crisis. The mean age of refugees was 28.8±11.4 years, and 76.1 % of subjects were male. Overall, IgG seronegativity was 7.4 % (95 % CI 5.5-9.6) for measles, 10.2 % (95 % CI 8.0-12.5) for mumps, 2.2 % (95 % CI 1.2-3.4) for rubella, and 3.3 % (95 % CI 1.9-4.9) for varicella. Seropositivity rates were age-dependent with considerably low values in children. For example, overall MMR immunity was 90.9 % (95 % CI 88.8-93.1), but only 73.1 % of minor aged refugees displayed complete seroprevalence against all three diseases, and only 68.9 % of children and adolescents were completely MMRV immune. Our initial data set suggests overall satisfactory MMRV immunity in adult migrants coming to Europe, but the observed low MMRV seroprevalences in refugee children support thorough and prompt vaccination of young migrants entering Europe. Taken together, our data set underlines the urgent need to implement and validate vaccination guidelines for refugee care in the current crisis.

  2. Assessment of humoral and cell-mediated immune response to measles-mumps-rubella vaccine viruses among patients with asthma.

    PubMed

    Yoo, Kwang Ha; Agarwal, Kanishtha; Butterfield, Michael; Jacobson, Robert M; Poland, Gregory A; Juhn, Young J

    2010-01-01

    Little is known about the influence of asthma status on humoral and cell-mediated immune responses to measles-mumps-rubella (MMR) vaccine viruses. We compared the virus-specific IgG levels and lymphoproliferative response of peripheral blood mononuclear cells to MMR vaccine viruses between asthmatic and nonasthmatic patients. The study subjects included 342 healthy children aged 12-18 years who had received two doses of the MMR vaccine. We ascertained asthma status by applying predetermined criteria. Of the 342 subjects, 230 were available for this study of whom 25 were definite asthmatic patients (10.9%) and the rest of subjects were nonasthmatic patients. The mean of the log-transformed lymphoproliferative responses between definite asthma and nonasthma who had a family history of asthma were for measles, 0.92 ± 0.31 versus 1.54 ± 0.17 (p = 0.125); for mumps, 0.98 ± 0.64 versus 2.20 ± 0.21 (p = 0.035); and for rubella, 0.12 ± 0.37 versus 0.97 ± 0.16 (p = 0.008), respectively, adjusting for the duration between the first MMR vaccination and determination of the immune responses. There were no such differences among children without a family history of asthma. MMR virus-specific IgG levels were not different between study subjects with or without asthma. The study findings suggest asthmatic patients may have a suboptimal cell-mediated immune response to MMR vaccine viruses and a family history of asthma modifies this effect.

  3. Application of Oral Fluid Assays in Support of Mumps, Rubella and Varicella Control Programs.

    PubMed

    Maple, Peter A C

    2015-12-09

    Detection of specific viral antibody or nucleic acid produced by infection or immunization, using oral fluid samples, offers increased potential for wider population uptake compared to blood sampling. This methodology is well established for the control of HIV and measles infections, but can also be applied to the control of other vaccine preventable infections, and this review describes the application of oral fluid assays in support of mumps, rubella and varicella national immunization programs. In England and Wales individuals with suspected mumps or rubella, based on clinical presentation, can have an oral fluid swab sample taken for case confirmation. Universal varicella immunization of children has led to a drastic reduction of chickenpox in those countries where it is used; however, in England and Wales such a policy has not been instigated. Consequently, in England and Wales most children have had chickenpox by age 10 years; however, small, but significant, numbers of adults remain susceptible. Targeted varicella zoster virus (VZV) immunization of susceptible adolescents offers the potential to reduce the pool of susceptible adults and oral fluid determination of VZV immunity in adolescents is a potential means of identifying susceptible individuals in need of VZV vaccination. The main application of oral fluid testing is in those circumstances where blood sampling is deemed not necessary, or is undesirable, and when the documented sensitivity and specificity of the oral fluid assay methodology to be used is considered sufficient for the purpose intended.

  4. Tdap Booster Requirements for Secondary Schools

    MedlinePlus

    ... HPV Rubella Influenza Smallpox Measles Tetanus MenACWY Varicella (chickenpox) MenB Zoster (shingles) Mumps View All Pertussis Talking ... TRANSLATE FOR IAC TRAVEL (INTERNATIONAL) UNPROTECTED PEOPLE REPORTS Chickenpox Diphtheria Hepatitis A Hepatitis B >> view all VACCINATING ...

  5. What Would Happen If We Stopped Vaccinations?

    MedlinePlus

    ... of the last century, diseases like whooping cough, polio, measles, Haemophilus influenzae , and rubella struck hundreds of ... smallpox — has been totally erased from the planet. Polio is close to being eliminated, but still exists ...

  6. Analysis of the temperature sensitivity of Japanese rubella vaccine strain TO-336.vac and its effect on immunogenicity in the guinea pig.

    PubMed

    Okamoto, Kiyoko; Ami, Yasushi; Suzaki, Yuriko; Otsuki, Noriyuki; Sakata, Masafumi; Takeda, Makoto; Mori, Yoshio

    2016-04-01

    The marker of Japanese domestic rubella vaccines is their lack of immunogenicity in guinea pigs. This has long been thought to be related to the temperature sensitivity of the viruses, but supporting evidence has not been described. In this study, we generated infectious clones of TO-336.vac, a Japanese domestic vaccine, TO-336.GMK5, the parental virus of TO-336.vac, and their mutants, and determined the molecular bases of their temperature sensitivity and immunogenicity in guinea pigs. The results revealed that Ser(1159) in the non-structural protein-coding region was responsible for the temperature sensitivity of TO-336.vac dominantly, while the structural protein-coding region affected the temperature sensitivity subordinately. The findings further suggested that the temperature sensitivity of TO-336.vac affected the antibody induction in guinea pigs after subcutaneous inoculation. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Universal measles-mumps-rubella vaccination to new recruits and the incidence of mumps in the military.

    PubMed

    Moon, Jong Youn; Jung, Jaehun; Huh, Kyungmin

    2017-07-13

    In response to the resurgence of mumps, the Korean Armed Forces started the measles-mumps-rubella (MMR) vaccination to all new recruits regardless of prior vaccination history. We evaluated the effectiveness of the vaccination by comparing the incidence between the military and civilian populations before and after implementation of the new policy. The standardized incidence ratio of mumps in the military was 7.06 in the prevaccine period, which declined to 0.96 in the postvaccine period. Vaccine effectiveness was estimated at 86.4%. Incidence rate ratio was lower in the 1996-1998 birth cohort (BC) compared with 1989-1995 BC (0.10 vs. 0.55), suggesting higher effectiveness of vaccination in the 1996-1998 BC. Our data provide evidence for the use of the MMR vaccination in the prevention of mumps in high-risk adults. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Updated Dosing Instructions for Immune Globulin (Human) GamaSTAN S/D for Hepatitis A Virus Prophylaxis.

    PubMed

    Nelson, Noele P

    2017-09-15

    GamaSTAN S/D (Grifols Therapeutics, Inc., Research Triangle Park, North Carolina) is a sterile, preservative-free solution of immune globulin (IG) for intramuscular administration and is used for prophylaxis against disease caused by infection with hepatitis A, measles, varicella, and rubella viruses (1). GamaSTAN S/D is the only IG product approved by the Food and Drug Administration for hepatitis A virus (HAV) prophylaxis. In July 2017, GamaSTAN S/D prescribing information was updated with changes to the dosing instructions for hepatitis A preexposure and postexposure prophylaxis indications. These changes were made because of concerns about decreased HAV immunoglobulin G antibody (anti-HAV IgG) potency, likely resulting from decreasing prevalence of previous HAV infection among plasma donors, leading to declining anti-HAV antibody levels in donor plasma (2). No changes in dosing instructions were made for measles, varicella, or rubella preexposure or postexposure prophylaxis.

  9. Expansion of Surveillance for Vaccine-preventable Diseases: Building on the Global Polio Laboratory Network and the Global Measles and Rubella Laboratory Network Platforms.

    PubMed

    Mulders, Mick N; Serhan, Fatima; Goodson, James L; Icenogle, Joseph; Johnson, Barbara W; Rota, Paul A

    2017-07-01

    Laboratory networks were established to provide accurate and timely laboratory confirmation of infections, an essential component of disease surveillance systems. The World Health Organization (WHO) coordinates global laboratory surveillance of vaccine-preventable diseases (VPDs), including polio, measles and rubella, yellow fever, Japanese encephalitis, rotavirus, and invasive bacterial diseases. In addition to providing high-quality laboratory surveillance data to help guide disease control, elimination, and eradication programs, these global networks provide capacity-building and an infrastructure for public health laboratories. There are major challenges with sustaining and expanding the global laboratory surveillance capacity: limited resources and the need for expansion to meet programmatic goals. Here, we describe the WHO-coordinated laboratory networks supporting VPD surveillance and present a plan for the further development of these networks. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  10. Is it Right Time to Introduce Mumps Vaccine in Indias Universal Immunization Program?

    PubMed

    Vaidya, S R; Hamde, V S

    2016-06-08

    Measles, mumps and rubella are vaccine preventable diseases. However, morbidity and mortality due to these diseases remain largely unnoticed in India. Measles has received much attention; mumps and rubella still need to garner attention. According to the World Health Organization, near-elimination of mumps could be achieved by maintaining high vaccine coverage using a two-dose strategy. However, Government of India has not yet decided on mumps vaccine. In this review, we have reviewed sero-prevalence studies, vaccine studies, outbreak investigations, virus isolation and virus genotyping studies on mumps. Overall, mumps seems to be a significant public health problem in India, but does not garner attention due to the absence of a surveillance and documentation system. Thus, inclusion of mumps antigen in the Universal immunization program would have added advantages, the economic burden imposed by the cost of the vaccine offset by a reduction in disease burden.

  11. [Parasitic and viral marker detection in pregnant adolescents and their newborn infants at risk].

    PubMed

    Contreras, M C; Escaff, V; Salinas, P; Saavedra, T; Suárez, M

    1995-01-01

    We have investigated the prevalence of antibodies against Toxoplasma gondii, Trypanosoma cruzzi, Hepatitis B virus, cytomegalovirus, rubella virus, and human immunodeficiency virus in 139 adolescent pregnant women and in their high risk newborn children. The methods employed were the Sabin and Feldman reaction, complement fixation reaction, ELISA, and xenodiagnostic 30.9% of the pregnant group were seropositive for T. gondii, both mothers and newborns were IgM-negative. Two mothers (1.4%) presented anti T. cruzii antibodies, and one newborn child had circulating parasites. Related to the virological studies, 93.5% of the population were anti CMV antibodies positive and all their newborns were IgM (-) 90.6% of the adolescents were rubella positive and one was seropositive to VIH. We conclude that the prevalence found in this group of adolescent pregnant women are not significantly different to the one reported for the general pregnant women population.

  12. Immunizations and autism: a review of the literature.

    PubMed

    Doja, Asif; Roberts, Wendy

    2006-11-01

    Because of a temporal correlation between the first notable signs and symptoms of autism and the routine childhood vaccination schedule, many parents have become increasingly concerned regarding the possible etiologic role vaccines may play in the development of autism. In particular, some have suggested an association between the Measles-Mumps-Rubella vaccine and autism. Our literature review found very few studies supporting this theory, with the overwhelming majority showing no causal association between the Measles-Mumps-Rubella vaccine and autism. The vaccine preservative thimerosal has alternatively been hypothesized to have a possible causal role in autism. Again, no convincing evidence was found to support this claim, nor for the use of chelation therapy in autism. With decreasing uptake of immunizations in children and the inevitable occurrence of measles outbreaks, it is important that clinicians be aware of the literature concerning vaccinations and autism so that they may have informed discussions with parents and caregivers.

  13. Effect of jet injection on infectivity of measles, mumps, and rubella vaccine in a bench model.

    PubMed

    Coughlin, Melissa M; Collins, Marcus; Saxon, Gene; Jarrahian, Courtney; Zehrung, Darin; Cappello, Chris; Dhere, Rajeev; Royals, Michael; Papania, Mark; Rota, Paul A

    2015-08-26

    Disposable-syringe jet injectors (DSJIs) with single-use, auto disable, needle-free syringes offer the opportunity to avoid hazards associated with injection using a needle and syringe. Clinical studies have evaluated DSJIs for vaccine delivery, but most studies have focused on inactivated, subunit, or DNA vaccines. Questions have been raised about possible damage to live attenuated viral vaccines by forces generated during the jet injection process. This study examines the effect of jet injection on the integrity of measles, mumps, and rubella vaccine (MMR), measured by viral RNA content and infectivity. Three models of DSJIs were evaluated, each generating a different ejection force. Following jet injection, the RNA content for each of the vaccine components was measured using RT-qPCR immediately after injection and following passage in Vero cells. Jet injection was performed with and without pig skin as a simulation of human skin. There was little to no reduction of RNA content immediately following jet injection with any of the three DSJIs. Samples passaged in Vero cells showed no loss in infectivity of the measles vaccine following jet injection. Mumps vaccine consistently showed increased replication following jet injection. Rubella vaccine showed no loss after jet injection alone but some infectivity loss following injection through pig skin with two of the devices. Overall, these data demonstrated that forces exerted on a live attenuated MMR vaccine did not compromise vaccine infectivity. The bench model and protocol used in this study can be applied to evaluate the impact of jet injection on other live virus vaccines. Published by Elsevier Ltd.

  14. Similar Antibody Levels in 3-Year-Old Children Vaccinated Against Measles, Mumps, and Rubella at the Age of 12 Months or 18 Months.

    PubMed

    Kontio, Mia; Palmu, Arto A; Syrjänen, Ritva K; Lahdenkari, Mika; Ruokokoski, Esa; Davidkin, Irja; Vaarala, Outi; Melin, Merit

    2016-06-15

    Measles-mumps-rubella (MMR) vaccinations have been offered to Finnish children at 14-18 months and 6 years of age. In May 2011, the recommended age for the first vaccine dose was lowered to 12 months because of the European measles epidemic. Fingertip capillary blood samples were collected from 3-year-old Finnish children vaccinated once with MMR vaccine at 11-19 months of age. The immunoglobulin G (IgG) antibodies to all 3 MMR antigens were measured with enzyme-linked immunosorbent assay. Neutralizing antibodies and the avidity of antibodies were measured for measles virus. From April through October 2013, 187 children were enrolled. Equally high proportions of the samples were seropositive for measles virus, mumps virus, or rubella virus antibodies, and there were no significant differences in the IgG antibody concentrations in children vaccinated at 11-13 months of age, compared with those vaccinated at 17-19 months of age. However, among children vaccinated at 11-13 months of age, boys had lower antibody concentrations than girls. Neutralizing measles virus antibody titers were above the threshold for protective immunity in all 78 samples analyzed. The measles virus antibody avidity indexes were high for all children. MMR induces similar antibody responses in 12-month-old children as compared to 18-month-old children, but in boys increasing age appears to improve the antibody responses. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  15. Incorporating immunizations into routine obstetric care to facilitate Health Care Practitioners in implementing maternal immunization recommendations

    PubMed Central

    Webb, Heather; Street, Jackie; Marshall, Helen

    2014-01-01

    Immunization against pertussis, influenza, and rubella reduces morbidity and mortality in pregnant women and their offspring. Health care professionals (HCPs) caring for women perinatally are uniquely placed to reduce maternal vaccine preventable diseases (VPDs). Despite guidelines recommending immunization during the perinatal period, maternal vaccine uptake remains low. This qualitative study explored the role of obstetricians, general practitioners, and midwives in maternal vaccine uptake. Semi-structured interviews (n = 15) were conducted with perinatal HCPs at a tertiary maternity hospital in South Australia. HCPs were asked to reflect on their knowledge, beliefs, and practice relating to immunization advice and vaccine provision. Interviews were transcribed and coded using thematic analysis. Data collection and analysis was an iterative process, with collection ceasing with theoretical saturation. Participants unanimously supported maternal vaccination as an effective way of reducing risk of disease in this vulnerable population, however only rubella immunity detection and immunization is embedded in routine care. Among these professionals, delegation of responsibility for maternal immunization was unclear and knowledge about maternal immunization was variable. Influenza and pertussis vaccine prevention measures were not included in standard pregnancy record documentation, information provision to patients was “ad hoc” and vaccinations not offered on-site. The key finding was that the incorporation of maternal vaccinations into standard care through a structured process is an important facilitator for immunization uptake. Incorporating vaccine preventable disease management measures into routine obstetric care including incorporation into the Pregnancy Record would facilitate HCPs in implementing recommendations. Rubella prevention provides a useful “template” for other vaccines. PMID:24509790

  16. Prevaccination antibody screening and immunization program for healthcare personnel against measles, mumps, rubella, and varicella in a Japanese tertiary care hospital.

    PubMed

    Kanamori, Hajime; Tokuda, Koichi; Ikeda, Shinobu; Endo, Shiro; Ishizawa, Chiyuki; Hirai, Yukari; Takahashi, Masami; Aoyagi, Tetsuji; Hatta, Masumitsu; Gu, Yoshiaki; Yano, Hisakazu; Weber, David J; Kaku, Mitsuo

    2014-10-01

    Susceptible healthcare personnel (HCP) are at high risk for acquiring and transmitting measles, mumps, rubella, and varicella (MMRV). Presumptive evidence of immunity to MMRV is recommended for HCP. The aim of this investigation was to examine the seroprevalence of MMRV in Japanese HCP and the association with history or vaccination in terms of occupational safety. To improve infection control at our hospital, we also assessed their immune status by implementing prevaccination antibody screening and an immunization program with postvaccination serological testing. We implemented seroprevalence surveys on MMRV antibodies among 243 newly and 2,664 previously hired HCP in a Japanese tertiary care hospital. Self-administered questionnaires about history of MMRV and vaccination with or without written documentation were completed for newly hired HCP. Prevaccination and postvaccination serological tests were performed using virus-specific IgG enzyme-linked immunosorbent assays. Indeed, only a few HCP accurately remembered or had written records of their disease or vaccination history. After our immunization program was implemented, the seropositivity rate reached levels as high as ~98% for measles, rubella, and varicella, and increased to ~80% for mumps. Our program was cost-effective, and no severe adverse reactions were reported. The prevaccination antibody screening for HCP would be helpful, given the lack of written vaccination records or documented disease history, and is also useful for the prevention of adverse reactions associated with unnecessary vaccination. It is important for infection control practitioners to comprehend the immune status of HCP against MMRV, and then provide an appropriate immunization program for susceptible HCP.

  17. SEROLOGICAL RESPONSE TO VACCINES IN CHILDREN WITH DIABETES.

    PubMed

    Dashti, Anahita Sanaei; Alaei, Mohammad Reza; Musavi, Zahra; Faramarzi, Raheleh; Mansouri, Farhad; Nasimfar, Amir

    2015-01-01

    Patients with diabetes mellitus (DM) are more susceptible to infections. Deficiency in some domains of immune system could be one of the main reasons, which increases the risk of infections. The aim of this study was to assess antibody responses to vaccines in a group of children with diabetes and in the controls. A cross-sectional study was performed among 90 children under 15 years of age with a history of type 1 DM, referred to endocrinology clinics of university hospitals; Mofid Children Hospital and Loghman Hospital. Also, we enrolled ninety healthy children as the control group. Antibody levels against diphtheria, tetanus, pertussis, measles, mumps, rubella and hepatitis B (HB) were measured by enzyme-linked immunosorbent assay (ELISA). Among 90 patients with diabetes, 48% were male and 52% were female and in the control group 49% were male and 51% were female. Regarding IgG antibody levels against measles, there was not any significant difference between the two groups, but according to the applied kit, IgG levels against measles vaccine were positive in 62% of the diabetic and 84% of the controls. Also, there was a significant difference between the two groups in terms of IgG antibody level against rubella, but consistent with the applied kit, there was not any significant difference between the two the groups. Given the results of the study, no difference was found between patients with diabetes and controls who were vaccinated with pertussis, diphtheria, tetanus, mumps and HB vaccines. But there are some concerns about measles and rubella vaccinations that need further investigation.

  18. Incorporating immunizations into routine obstetric care to facilitate Health Care Practitioners in implementing maternal immunization recommendations.

    PubMed

    Webb, Heather; Street, Jackie; Marshall, Helen

    2014-01-01

    Immunization against pertussis, influenza, and rubella reduces morbidity and mortality in pregnant women and their offspring. Health care professionals (HCPs) caring for women perinatally are uniquely placed to reduce maternal vaccine preventable diseases (VPDs). Despite guidelines recommending immunization during the perinatal period, maternal vaccine uptake remains low. This qualitative study explored the role of obstetricians, general practitioners, and midwives in maternal vaccine uptake. Semi-structured interviews (n = 15) were conducted with perinatal HCPs at a tertiary maternity hospital in South Australia. HCPs were asked to reflect on their knowledge, beliefs, and practice relating to immunization advice and vaccine provision. Interviews were transcribed and coded using thematic analysis. Data collection and analysis was an iterative process, with collection ceasing with theoretical saturation. Participants unanimously supported maternal vaccination as an effective way of reducing risk of disease in this vulnerable population, however only rubella immunity detection and immunization is embedded in routine care. Among these professionals, delegation of responsibility for maternal immunization was unclear and knowledge about maternal immunization was variable. Influenza and pertussis vaccine prevention measures were not included in standard pregnancy record documentation, information provision to patients was "ad hoc" and vaccinations not offered on-site. The key finding was that the incorporation of maternal vaccinations into standard care through a structured process is an important facilitator for immunization uptake. Incorporating vaccine preventable disease management measures into routine obstetric care including incorporation into the Pregnancy Record would facilitate HCPs in implementing recommendations. Rubella prevention provides a useful 'template' for other vaccines.

  19. Genetic Characterization of Rubella Virus Strains Detected in Spain, 1998-2014.

    PubMed

    Martínez-Torres, Alex O; Mosquera, María M; De Ory, Fernando; González-Praetorius, Alejandro; Echevarría, Juan E

    2016-01-01

    The National Plan for the Elimination of Rubella was implemented in Spain in 2008 using the logistics of the National Plan for the Elimination of Measles that have been employed since year 2000. Molecular characterization of rubella virus (RUBV) is important for disease surveillance and for monitoring elimination of the disease throughout the world. We describe the first complete series of data regarding the circulation of RUBV genotypes in Spain. The 739-nucleotide fragment designated by the WHO for RUBV genotyping was sequenced in 88 selected cases collected from 1998 to 2014. Five genotypes were identified: 1E, 2B, 1J, 1I, and 1a. Genotype 1E was predominant between 1998 and 2003 but was replaced by genotype 2B, which was detected in sporadic cases in 2004, 2006, 2008, 2012, 2013 and 2014. There was an outbreak of genotype 2B in Algeciras (Andalusia) in 2008. Genotype 1J caused an outbreak in Madrid in 2004/2005 and sporadic cases in 2005 and 2007. Genotype 1I was found to have infected an immune-suppressed patient with neurological symptoms in 2008. Finally, vaccine strain RA 27/3 was detected in three sporadic cases, two of them immune-suppressed and without a recent history of vaccination. This suggests that during these years there were a series of imported sporadic cases and outbreaks, confirming the findings of epidemiological data analysis. The importation sources were generally consistent with our geographic and cultural ties, mainly with Europe (genotypes 1E, 2B, 1I) and Latin America (1J).

  20. Gene expression profiling of rubella virus infected primary endothelial cells of fetal and adult origin.

    PubMed

    Geyer, Henriette; Bauer, Michael; Neumann, Jennifer; Lüdde, Amy; Rennert, Paul; Friedrich, Nicole; Claus, Claudia; Perelygina, Ludmilla; Mankertz, Annette

    2016-02-02

    Rubella virus (RV) infection is usually a mild illness in children and adults. However, maternal infection during the first trimester of pregnancy can lead to congenital rubella syndrome (CRS) in the infant. Fetuses with CRS show damage to the endothelium of the heart and blood vessels; thus, it has been speculated that the clinical manifestations associated with CRS may be a result of endothelial cells persistently infected with RV. Here, we compared the effects of RV infection on gene expression in primary endothelial cells of fetal (HUVEC) and of adult (HSaVEC) origin by transcriptional profiling. More than 75 % of the genes differentially regulated following RV infection were identical in both cell types. Gene Ontology (GO) analysis of these commonly regulated genes showed an enrichment of terms involved in cytokine production and cytokine regulation. Increased accumulation of inflammatory cytokines following RV infection was verified by protein microarray. Interestingly, the chemokine CCL14, which is implicated in supporting embryo implantation at the fetal-maternal interface, was down-regulated following RV infection only in HUVEC. Most noticeably, when analyzing the uniquely regulated transcripts for each cell type, GO term-based cluster analysis of the down-regulated genes of HUVEC revealed an enrichment of the GO terms "sensory organ development", "ear development" and "eye development". Since impairment in vision and hearing are the most prominent clinical manifestations observed in CRS patients, the here detected down-regulated genes involved in the development of sensory organs sheds light on the molecular mechanisms that may contribute to the teratogenic effect of RV.

Top