Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.
2007-01-01
The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets
The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs
Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.
2018-01-01
Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches
Hypermethylation of 28S ribosomal RNA in β-thalassemia trait carriers.
Sornjai, Wannapa; Lithanatudom, Pathrapol; Erales, Jenny; Joly, Philippe; Francina, Alain; Hacot, Sabine; Fucharoen, Suthat; Svasti, Saovaros; Diaz, Jean Jacques; Mertani, Hichem C; Smith, Duncan R
2017-01-01
Ribosome biogenesis is the process of synthesis of the cellular ribosomes which mediate protein translation. Integral with the ribosomes are four cytoplasmic ribosomal RNAs (rRNAs) which show extensive post-transcriptional modifications including 2'-O-methylation and pseudouridylation. Several hereditary hematologic diseases including Diamond-Blackfan anemia have been shown to be associated with defects in ribosome biogenesis. Thalassemia is the most important hematologic inherited genetic disease worldwide, and this study examined the post-transcriptional ribose methylation status of three specific active sites of the 28S rRNA molecule at positions 1858, 4197 and 4506 of β-thalassemia trait carriers and normal controls. Samples from whole blood and cultured erythroid cells were examined. Results showed that site 4506 was hypermethylated in β-thalassemia trait carriers in both cohorts. Expression of fibrillarin, the ribosomal RNA methyltransferase as well as snoRNAs were additionally quantified by RT-qPCR and evidence of dysregulation was seen. Hemoglobin E trait carriers also showed evidence of dysregulation. These results provide the first evidence that ribosome biogenesis is dysregulated in β-thalassemia trait carriers. Copyright © 2016 Elsevier B.V. All rights reserved.
Ribosome protection by antibiotic resistance ATP-binding cassette protein.
Su, Weixin; Kumar, Veerendra; Ding, Yichen; Ero, Rya; Serra, Aida; Lee, Benjamin Sian Teck; Wong, Andrew See Weng; Shi, Jian; Sze, Siu Kwan; Yang, Liang; Gao, Yong-Gui
2018-05-15
The ribosome is one of the richest targets for antibiotics. Unfortunately, antibiotic resistance is an urgent issue in clinical practice. Several ATP-binding cassette family proteins confer resistance to ribosome-targeting antibiotics through a yet unknown mechanism. Among them, MsrE has been implicated in macrolide resistance. Here, we report the cryo-EM structure of ATP form MsrE bound to the ribosome. Unlike previously characterized ribosomal protection proteins, MsrE is shown to bind to ribosomal exit site. Our structure reveals that the domain linker forms a unique needle-like arrangement with two crossed helices connected by an extended loop projecting into the peptidyl-transferase center and the nascent peptide exit tunnel, where numerous antibiotics bind. In combination with biochemical assays, our structure provides insight into how MsrE binding leads to conformational changes, which results in the release of the drug. This mechanism appears to be universal for the ABC-F type ribosome protection proteins. Copyright © 2018 the Author(s). Published by PNAS.
Chang, F. N.; Flaks, Joel G.
1972-01-01
The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and
Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M
2014-08-01
5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.
Lindström, Mikael S.
2012-01-01
Biogenesis of eukaryotic ribosomes occurs mainly in a specific subnuclear compartment, the nucleolus, and involves the coordinated assembly of ribosomal RNA and ribosomal proteins. Identification of amino acid sequences mediating nucleolar localization of ribosomal proteins may provide important clues to understand the early steps in ribosome biogenesis. Human ribosomal protein S9 (RPS9), known in prokaryotes as RPS4, plays a critical role in ribosome biogenesis and directly binds to ribosomal RNA. RPS9 is targeted to the nucleolus but the regions in the protein that determine its localization remains unknown. Cellular expression of RPS9 deletion mutants revealed that it has three regions capable of driving nuclear localization of a fused enhanced green fluorescent protein (EGFP). The first region was mapped to the RPS9 N-terminus while the second one was located in the proteins C-terminus. The central and third region in RPS9 also behaved as a strong nucleolar localization signal and was hence sufficient to cause accumulation of EGFP in the nucleolus. RPS9 was previously shown to interact with the abundant nucleolar chaperone NPM1 (nucleophosmin). Evaluating different RPS9 fragments for their ability to bind NPM1 indicated that there are two binding sites for NPM1 on RPS9. Enforced expression of NPM1 resulted in nucleolar accumulation of a predominantly nucleoplasmic RPS9 mutant. Moreover, it was found that expression of a subset of RPS9 deletion mutants resulted in altered nucleolar morphology as evidenced by changes in the localization patterns of NPM1, fibrillarin and the silver stained nucleolar organizer regions. In conclusion, RPS9 has three regions that each are competent for nuclear localization, but only the central region acted as a potent nucleolar localization signal. Interestingly, the RPS9 nucleolar localization signal is residing in a highly conserved domain corresponding to a ribosomal RNA binding site. PMID:23285058
Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze
2013-01-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775
Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun
2013-10-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.
Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul
2009-06-01
Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultantmore » fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.« less
Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site
Harada, Yoichiro; Li, Hua; Li, Huilin; Lennarz, William J.
2009-01-01
Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of ≈1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings, we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes. PMID:19365066
Protein-protein interactions within late pre-40S ribosomes.
Campbell, Melody G; Karbstein, Katrin
2011-01-20
Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.
Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu
2007-01-01
Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838
Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harada, Y.; Li, H.; Li, Hua
2009-04-28
Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of {approx}1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings,more » we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes.« less
Structural Characterization of an Alternative Mode of Tigecycline Binding to the Bacterial Ribosome
Schedlbauer, Andreas; Kaminishi, Tatsuya; Ochoa-Lizarralde, Borja; Dhimole, Neha; Zhou, Shu; López-Alonso, Jorge P.
2015-01-01
Although both tetracycline and tigecycline inhibit protein synthesis by sterically hindering the binding of tRNA to the ribosomal A site, tigecycline shows increased efficacy in both in vitro and in vivo activity assays and escapes the most common resistance mechanisms associated with the tetracycline class of antibiotics. These differences in activities are attributed to the tert-butyl-glycylamido side chain found in tigecycline. Our structural analysis by X-ray crystallography shows that tigecycline binds the bacterial 30S ribosomal subunit with its tail in an extended conformation and makes extensive interactions with the 16S rRNA nucleotide C1054. These interactions restrict the mobility of C1054 and contribute to the antimicrobial activity of tigecycline, including its resistance to the ribosomal protection proteins. PMID:25753625
Protein-Protein Interactions within Late Pre-40S Ribosomes
Campbell, Melody G.; Karbstein, Katrin
2011-01-01
Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps. PMID:21283762
Duval, Mélodie; Korepanov, Alexey; Fuchsbauer, Olivier; Fechter, Pierre; Haller, Andrea; Fabbretti, Attilio; Choulier, Laurence; Micura, Ronald; Klaholz, Bruno P.; Romby, Pascale; Springer, Mathias; Marzi, Stefano
2013-01-01
Regulation of translation initiation is well appropriate to adapt cell growth in response to stress and environmental changes. Many bacterial mRNAs adopt structures in their 5′ untranslated regions that modulate the accessibility of the 30S ribosomal subunit. Structured mRNAs interact with the 30S in a two-step process where the docking of a folded mRNA precedes an accommodation step. Here, we used a combination of experimental approaches in vitro (kinetic of mRNA unfolding and binding experiments to analyze mRNA–protein or mRNA–ribosome complexes, toeprinting assays to follow the formation of ribosomal initiation complexes) and in vivo (genetic) to monitor the action of ribosomal protein S1 on the initiation of structured and regulated mRNAs. We demonstrate that r-protein S1 endows the 30S with an RNA chaperone activity that is essential for the docking and the unfolding of structured mRNAs, and for the correct positioning of the initiation codon inside the decoding channel. The first three OB-fold domains of S1 retain all its activities (mRNA and 30S binding, RNA melting activity) on the 30S subunit. S1 is not required for all mRNAs and acts differently on mRNAs according to the signals present at their 5′ ends. This work shows that S1 confers to the ribosome dynamic properties to initiate translation of a large set of mRNAs with diverse structural features. PMID:24339747
The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity.
Andrade, José M; Dos Santos, Ricardo F; Chelysheva, Irina; Ignatova, Zoya; Arraiano, Cecília M
2018-06-01
Ribosome biogenesis is a complex process involving multiple factors. Here, we show that the widely conserved RNA chaperone Hfq, which can regulate sRNA-mRNA basepairing, plays a critical role in rRNA processing and ribosome assembly in Escherichia coli Hfq binds the 17S rRNA precursor and facilitates its correct processing and folding to mature 16S rRNA Hfq assists ribosome assembly and associates with pre-30S particles but not with mature 30S subunits. Inactivation of Hfq strikingly decreases the pool of mature 70S ribosomes. The reduction in ribosome levels depends on residues located in the distal face of Hfq but not on residues found in the proximal and rim surfaces which govern interactions with the sRNAs. Our results indicate that Hfq-mediated regulation of ribosomes is independent of its function as sRNA-regulator. Furthermore, we observed that inactivation of Hfq compromises translation efficiency and fidelity, both features of aberrantly assembled ribosomes. Our work expands the functions of the Sm-like protein Hfq beyond its function in small RNA-mediated regulation and unveils a novel role of Hfq as crucial in ribosome biogenesis and translation. © 2018 The Authors.
Pseudoknot and translational control in the expression of the S15 ribosomal protein.
Bénard, L; Philippe, C; Ehresmann, B; Ehresmann, C; Portier, C
1996-01-01
Translational autocontrol of the expression of the ribosomal protein S15 proceeds through the transitory formation of a pseudoknot. A synopsis of the known data is used to propose a molecular model of the mechanism involved and for the role of the pseudoknot. This latter structure is able to recruit 30S ribosomal subunits to initiate translation, but also to bind S15 and to stop translation by trapping the ribosome on its loading site. Information on the S15 protein recognition of the messenger RNA site was deduced from mutational analyses and chemical probing. A comparison of this messenger site with the S15 ribosomal binding site was conducted by analysing hydroxyl radical footprintings of these two sites. The existence of two subsites in 16S RNA suggests that the ribosomal protein S15 might present either two different binding sites or at least one common subsite. Clues for the presence of a common site between the messenger and 16S RNA are given which cannot rule out that recognition specificity is linked to a few other determinants. Whether these determinants are different or not remains an open question.
Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D
2015-01-13
Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.
A model for the study of ligand binding to the ribosomal RNA helix h44
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dibrov, Sergey M.; Parsons, Jerod; Hermann, Thomas
2010-09-02
Oligonucleotide models of ribosomal RNA domains are powerful tools to study the binding and molecular recognition of antibiotics that interfere with bacterial translation. Techniques such as selective chemical modification, fluorescence labeling and mutations are cumbersome for the whole ribosome but readily applicable to model RNAs, which are readily crystallized and often give rise to higher resolution crystal structures suitable for detailed analysis of ligand-RNA interactions. Here, we have investigated the HX RNA construct which contains two adjacent ligand binding regions of helix h44 in 16S ribosomal RNA. High-resolution crystal structure analysis confirmed that the HX RNA is a faithful structuralmore » model of the ribosomal target. Solution studies showed that HX RNA carrying a fluorescent 2-aminopurine modification provides a model system that can be used to monitor ligand binding to both the ribosomal decoding site and, through an indirect effect, the hygromycin B interaction region.« less
Lill, R; Robertson, J M; Wintermeyer, W
1989-01-01
A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120
Kimura, J; Kimura, M
1987-09-05
The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.
Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C
2015-10-06
The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.
Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.
Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V
2010-10-01
The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.
Melnikov, Sergey V.; Söll, Dieter; Steitz, Thomas A.
2016-01-01
Abstract Cisplatin is a widely prescribed anticancer drug, which triggers cell death by covalent binding to a broad range of biological molecules. Among cisplatin targets, cellular RNAs remain the most poorly characterized molecules. Although cisplatin was shown to inactivate essential RNAs, including ribosomal, spliceosomal and telomeric RNAs, cisplatin binding sites in most RNA molecules are unknown, and therefore it remains challenging to study how modifications of RNA by cisplatin contributes to its toxicity. Here we report a 2.6Å-resolution X-ray structure of cisplatin-modified 70S ribosome, which describes cisplatin binding to the ribosome and provides the first nearly atomic model of cisplatin–RNA complex. We observe nine cisplatin molecules bound to the ribosome and reveal consensus structural features of the cisplatin-binding sites. Two of the cisplatin molecules modify conserved functional centers of the ribosome—the mRNA-channel and the GTPase center. In the mRNA-channel, cisplatin intercalates between the ribosome and the messenger RNA, suggesting that the observed inhibition of protein synthesis by cisplatin is caused by impaired mRNA-translocation. Our structure provides an insight into RNA targeting and inhibition by cisplatin, which can help predict cisplatin-binding sites in other cellular RNAs and design studies to elucidate a link between RNA modifications by cisplatin and cisplatin toxicity. PMID:27079977
Translational control of ribosomal protein S15.
Portier, C; Philippe, C; Dondon, L; Grunberg-Manago, M; Ebel, J P; Ehresmann, B; Ehresmann, C
1990-08-27
The expression of ribosomal protein S15 is shown to be translationally and negatively autocontrolled using a fusion within a reporter gene. Isolation and characterization of several deregulated mutants indicate that the regulatory site (the translational operator site) overlaps the ribosome loading site of the S15 messenger. In this region, three domains, each exhibiting a stem-loop structure, were determined using chemical and enzymatic probes. The most downstream hairpin carries the Shine-Dalgarno sequence and the initiation codon. Genetic and structural data derived from mutants constructed by site-directed mutagenesis show that the operator is a dynamic structure, two domains of which can form a pseudoknot. Binding of S15 to these two domains suggests that the pseudoknot could be stabilized by S15. A model is presented in which two alternative structures would explain the molecular basis of the S15 autocontrol.
Ribosomal targets for antibiotic drug discovery
Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R
2016-09-13
The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.
Differences in Ribosome Binding and Sarcin/Ricin Loop Depurination by Shiga and Ricin Holotoxins.
Li, Xiao-Ping; Tumer, Nilgun E
2017-04-11
Both ricin and Shiga holotoxins display no ribosomal activity in their native forms and need to be activated to inhibit translation in a cell-free translation inhibition assay. This is because the ribosome binding site of the ricin A chain (RTA) is blocked by the B subunit in ricin holotoxin. However, it is not clear why Shiga toxin 1 (Stx1) or Shiga toxin 2 (Stx2) holotoxin is not active in a cell-free system. Here, we compare the ribosome binding and depurination activity of Stx1 and Stx2 holotoxins with the A1 subunits of Stx1 and Stx2 using either the ribosome or a 10-mer RNA mimic of the sarcin/ricin loop as substrates. Our results demonstrate that the active sites of Stx1 and Stx2 holotoxins are blocked by the A2 chain and the B subunit, while the ribosome binding sites are exposed to the solvent. Unlike ricin, which is enzymatically active, but cannot interact with the ribosome, Stx1 and Stx2 holotoxins are enzymatically inactive but can interact with the ribosome.
Defining the bacteroides ribosomal binding site.
Wegmann, Udo; Horn, Nikki; Carding, Simon R
2013-03-01
The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.
Root-Bernstein, Robert; Root-Bernstein, Meredith
2016-05-21
We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their
Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes
DOE Office of Scientific and Technical Information (OSTI.GOV)
deLivron, M.; Robinson, V
BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess themore » GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.« less
Kasprzyk, Marta; Twardowski, Tomasz
2016-01-01
Recently, a number of ribosome-associated non-coding RNAs (rancRNAs) have been discovered in all three domains of life. In our previous studies, we have described several types of rancRNAs in Saccharomyces cerevisiae, derived from many cellular RNAs, including mRNAs, rRNAs, tRNAs and snoRNAs. Here, we present the evidence that the tRNA fragments from simple eukaryotic organism S. cerevisiae directly bind to the ribosomes. Interestingly, rancRNA-tRFs in yeast are derived from both, 5′- and 3′-part of the tRNAs and both types of tRFs associate with the ribosomes in vitro. The location of tRFs within the ribosomes is distinct from classical A- and P-tRNA binding sites. Moreover, 3′-tRFs bind to the distinct site than 5′-tRFs. These interactions are stress dependent and as a consequence, provoke regulation of protein biosynthesis. We observe strong correlation between tRF binding to the ribosomes and inhibition of protein biosynthesis in particular environmental conditions. These results implicate the existence of an ancient and conserved mechanism of translation regulation with the involvement of ribosome-associating tRNA-derived fragments. PMID:27609601
The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.
Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P
2007-01-01
The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.
Further characterization of ribosome binding to thylakoid membranes. [Pisum sativum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hurewitz, J.; Jagendorf, A.T.
1987-05-01
Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation,more » and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of (/sup 3/H)leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins.« less
Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.
1998-01-01
Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994
Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.
Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel
2007-12-07
The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.
Ridgeway, William K.; Millar, David P.; Williamson, James R.
2012-01-01
The self-assembly of bacterial 30S ribosomes involves a large number of RNA folding and RNA-protein binding steps. The sequence of steps determines the overall assembly mechanism and the structure of the mechanism has ramifications for the robustness of biogenesis and resilience against kinetic traps. Thermodynamic interdependencies of protein binding inferred from omission-reconstitution experiments are thought to preclude certain assembly pathways and thus enforce ordered assembly, but this concept is at odds with kinetic data suggesting a more parallel assembly landscape. A major challenge is deconvolution of the statistical distribution of intermediates that are populated during assembly at high concentrations approaching in vivo assembly conditions. To specifically resolve the intermediates formed by binding of three ribosomal proteins to the full length 16S rRNA, we introduce Fluorescence Triple-Correlation Spectroscopy (F3CS). F3CS identifies specific ternary complexes by detecting coincident fluctuations in three-color fluorescence data. Triple correlation integrals quantify concentrations and diffusion kinetics of triply labeled species, and F3CS data can be fit alongside auto-correlation and cross-correlation data to quantify the populations of 10 specific ribosome assembly intermediates. The distribution of intermediates generated by binding three ribosomal proteins to the entire native 16S rRNA included significant populations of species that were not previously thought to be thermodynamically accessible, questioning the current interpretation of the classic omission-reconstitution experiments. F3CS is a general approach for analyzing assembly and function of macromolecular complexes, especially those too large for traditional biophysical methods. PMID:22869699
Ochs, Kerstin; Rust, René C.; Niepmann, Michael
1999-01-01
Most eukaryotic initiation factors (eIFs) are required for internal translation initiation at the internal ribosome entry site (IRES) of picornaviruses. eIF4B is incorporated into ribosomal 48S initiation complexes with the IRES RNA of foot-and-mouth disease virus (FMDV). In contrast to the weak interaction of eIF4B with capped cellular mRNAs and its release upon entry of the ribosomal 60S subunit, eIF4B remains tightly associated with the FMDV IRES during formation of complete 80S ribosomes. Binding of eIF4B to the IRES is energy dependent, and binding of the small ribosomal subunit to the IRES requires the previous energy-dependent association of initiation factors with the IRES. The interaction of eIF4B with the IRES in 48S and 80S complexes is independent of the location of the initiator AUG and thus independent of the mechanism by which the small ribosomal subunit is placed at the actual start codon, either by direct internal ribosomal entry or by scanning. eIF4B does not greatly rearrange its binding to the IRES upon entry of the ribosomal subunits, and the interaction of eIF4B with the IRES is independent of the polypyrimidine tract-binding protein, which enhances FMDV translation. PMID:10438840
Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard
2015-01-01
During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277
Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard
2015-04-07
During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Arenz, Stefan; Graf, Michael; Nguyen, Fabian; Huter, Paul; Polikanov, Yury S.; Blanchard, Scott C.; Wilson, Daniel N.
2016-01-01
The ribosome is one of the major targets for therapeutic antibiotics; however, the rise in multidrug resistance is a growing threat to the utility of our current arsenal. The orthosomycin antibiotics evernimicin (EVN) and avilamycin (AVI) target the ribosome and do not display cross-resistance with any other classes of antibiotics, suggesting that they bind to a unique site on the ribosome and may therefore represent an avenue for development of new antimicrobial agents. Here we present cryo-EM structures of EVN and AVI in complex with the Escherichia coli ribosome at 3.6- to 3.9-Å resolution. The structures reveal that EVN and AVI bind to a single site on the large subunit that is distinct from other known antibiotic binding sites on the ribosome. Both antibiotics adopt an extended conformation spanning the minor grooves of helices 89 and 91 of the 23S rRNA and interacting with arginine residues of ribosomal protein L16. This binding site overlaps with the elbow region of A-site bound tRNA. Consistent with this finding, single-molecule FRET (smFRET) experiments show that both antibiotics interfere with late steps in the accommodation process, wherein aminoacyl-tRNA enters the peptidyltransferase center of the large ribosomal subunit. These data provide a structural and mechanistic rationale for how these antibiotics inhibit the elongation phase of protein synthesis. PMID:27330110
Long, Katherine S; Poehlsgaard, Jacob; Hansen, Lykke H; Hobbie, Sven N; Böttger, Erik C; Vester, Birte
2009-03-01
Tiamulin and valnemulin target the peptidyl transferase centre (PTC) on the bacterial ribosome. They are used in veterinary medicine to treat infections caused by a variety of bacterial pathogens, including the intestinal spirochetes Brachyspira spp. Mutations in ribosomal protein L3 and 23S rRNA have previously been associated with tiamulin resistance in Brachyspira spp. isolates, but as multiple mutations were isolated together, the roles of the individual mutations are unclear. In this work, individual 23S rRNA mutations associated with pleuromutilin resistance at positions 2055, 2447, 2504 and 2572 (Escherichia coli numbering) are introduced into a Mycobacterium smegmatis strain with a single rRNA operon. The single mutations each confer a significant and similar degree of valnemulin resistance and those at 2447 and 2504 also confer cross-resistance to other antibiotics that bind to the PTC in M. smegmatis. Antibiotic footprinting experiments on mutant ribosomes show that the introduced mutations cause structural perturbations at the PTC and reduced binding of pleuromutilin antibiotics. This work underscores the fact that mutations at nucleotides distant from the pleuromutilin binding site can confer the same level of valnemulin resistance as those at nucleotides abutting the bound drug, and suggests that the former function indirectly by altering local structure and flexibility at the drug binding pocket.
Kaempfer, Raymond; Kaufman, Jennifer
1972-01-01
The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325
Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R
2013-02-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.
Ribosome-inactivating proteins
Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M
2013-01-01
Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927
Characterization of a novel RNA-binding region of eIF4GI critical for ribosomal scanning
Prévôt, Déborah; Décimo, Didier; Herbreteau, Cécile H.; Roux, Florence; Garin, Jérôme; Darlix, Jean-Luc; Ohlmann, Théophile
2003-01-01
The eukaryotic translation initiation factor eIF4GI binds several proteins and acts as a scaffold to promote preinitiation complex formation on the mRNA molecule (48S). Following mRNA attachment this complex scans along the messenger in a 5′ to 3′ direction until it locates and recognizes the initiation start codon. By using a combination of retroviral and picornaviral proteases (HIV-2 and L respectively) in the reticulocyte lysate system, we have characterized a 40 amino acid (aa) region of eIF4GI (aa 642–681) that exhibits general RNA-binding properties. Removal of this domain by proteolytic processing followed by translational assays showed virtually no inhibition of internal ribosome entry on the encephalomyocarditis virus, but resulted in drastic impairment of ribosome scanning as demonstrated by studying poliovirus and foot-and-mouth disease virus translation. Based on these findings, we propose that this 40 aa motif of eIF4GI is critical for ribosome scanning. PMID:12682023
[Protein S3 in the human 80S ribosome adjoins mRNA from 3'-side of the A-site codon].
Molotkov, M V; Graĭfer, D M; Popugaeva, E A; Bulygin, K N; Meshchaninova, M I; Ven'iaminova, A G; Karpova, G G
2007-01-01
The protein environment of mRNA 3' of the A-site codon (the decoding site) in the human 80S ribosome was studied using a set of oligoribonucleotide derivatives bearing a UUU triplet at the 5'-end and a perfluoroarylazide group at one of the nucleotide residues at the 3'-end of this triplet. Analogues of mRNA were phased into the ribosome using binding at the tRNAPhe P-site, which recognizes the UUU codon. Mild UV irradiation of ribosome complexes with tRNAPhe and mRNA analogues resulted in the predominant crosslinking of the analogues with the 40S subunit components, mainly with proteins and, to a lesser extent, with rRNA. Among the 40S subunit ribosomal proteins, the S3 protein was the main target for modification in all cases. In addition, minor crosslinking with the S2 protein was observed. The crosslinking with the S3 and S2 proteins occurred both in triple complexes and in the absence of tRNA. Within triple complexes, crosslinking with S15 protein was also found, its efficiency considerably falling when the modified nucleotide was moved from positions +5 to +12 relative to the first codon nucleotide in the P-site. In some cases, crosslinking with the S30 protein was observed, it was most efficient for the derivative containing a photoreactive group at the +7 adenosine residue. The results indicate that the S3 protein in the human ribosome plays a key role in the formation of the mRNA binding site 3' of the codon in the decoding site.
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stanley, R.; Blaha, G; Grodzicki, R
2010-01-01
Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in themore » pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stanley, Robin E.; Blaha, Gregor; Grodzicki, Robert L.
2010-05-03
Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in themore » pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.« less
Distribution and diversity of ribosome binding sites in prokaryotic genomes.
Omotajo, Damilola; Tate, Travis; Cho, Hyuk; Choudhary, Madhusudan
2015-08-14
Prokaryotic translation initiation involves the proper docking, anchoring, and accommodation of mRNA to the 30S ribosomal subunit. Three initiation factors (IF1, IF2, and IF3) and some ribosomal proteins mediate the assembly and activation of the translation initiation complex. Although the interaction between Shine-Dalgarno (SD) sequence and its complementary sequence in the 16S rRNA is important in initiation, some genes lacking an SD ribosome binding site (RBS) are still well expressed. The objective of this study is to examine the pattern of distribution and diversity of RBS in fully sequenced bacterial genomes. The following three hypotheses were tested: SD motifs are prevalent in bacterial genomes; all previously identified SD motifs are uniformly distributed across prokaryotes; and genes with specific cluster of orthologous gene (COG) functions differ in their use of SD motifs. Data for 2,458 bacterial genomes, previously generated by Prodigal (PROkaryotic DYnamic programming Gene-finding ALgorithm) and currently available at the National Center for Biotechnology Information (NCBI), were analyzed. Of the total genes examined, ~77.0% use an SD RBS, while ~23.0% have no RBS. Majority of the genes with the most common SD motifs are distributed in a manner that is representative of their abundance for each COG functional category, while motifs 13 (5'-GGA-3'/5'-GAG-3'/5'-AGG-3') and 27 (5'-AGGAGG-3') appear to be predominantly used by genes for information storage and processing, and translation and ribosome biogenesis, respectively. These findings suggest that an SD sequence is not obligatory for translation initiation; instead, other signals, such as the RBS spacer, may have an overarching influence on translation of mRNAs. Subsequent analyses of the 5' secondary structure of these mRNAs may provide further insight into the translation initiation mechanism.
Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes
Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V
1971-01-01
Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558
Kamina, Anyango D; Williams, Noreen
2017-01-01
RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.
Kamina, Anyango D.; Williams, Noreen
2017-01-01
RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains’ interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP. PMID:28542332
In vivo tmRNA protection by SmpB and pre-ribosome binding conformation in solution
Ranaei-Siadat, Ehsan; Mérigoux, Cécile; Seijo, Bili; Ponchon, Luc; Saliou, Jean-Michel; Bernauer, Julie; Sanglier-Cianférani, Sarah; Dardel, Fréderic
2014-01-01
TmRNA is an abundant RNA in bacteria with tRNA and mRNA features. It is specialized in trans-translation, a translation rescuing system. We demonstrate that its partner protein SmpB binds the tRNA-like region (TLD) in vivo and chaperones the fold of the TLD-H2 region. We use an original approach combining the observation of tmRNA degradation pathways in a heterologous system, the analysis of the tmRNA digests by MS and NMR, and co-overproduction assays of tmRNA and SmpB. We study the conformation in solution of tmRNA alone or in complex with one SmpB before ribosome binding using SAXS. Our data show that Mg2+ drives compaction of the RNA structure and that, in the absence of Mg2+, SmpB has a similar effect albeit to a lesser extent. Our results show that tmRNA is intrinsically structured in solution with identical topology to that observed on complexes on ribosomes which should facilitate its subsequent recruitment by the 70S ribosome, free or preloaded with one SmpB molecule. PMID:25135523
Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'yaminova, A G; Frolova, L Iu; Stahl, J; Karpova, G G
2008-01-01
Protein S3 fragments were determined that crosslink to modified mRNA analogues in positions +5 to +12 relative to the first nucleotide in the P-site binding codon in model complexes mimicking states of ribosomes at the elongation and translation termination steps. The mRNA analogues contained a Phe codon UUU/UUC at the 5'-termini that could predetermine the position of the tRNA(Phe) on the ribosome by the location of P-site binding and perfluorophenylazidobenzoyl group at a nucleotide in various positions 3' of the UUU/UUC codon. The crosslinked S3 protein was isolated from 80S ribosomal complexes irradiated with mild UV light and subjected to cyanogen bromide-induced cleavage at methionine residues with subsequent identification of the crosslinked oligopeptides. An analysis of the positions of modified oligopeptides resulting from the cleavage showed that, in dependence on the positions of modified nucleotides in the mRNA analogue, the crosslinking sites were found in the N-terminal half of the protein (fragment 2-127) and/or in the C-terminal fragment 190-236; the latter reflects a new peculiarity in the structure of the mRNA binding center in the ribosome, unknown to date. The results of crosslinking did not depend on the type of A-site codon or on the presence of translation termination factor eRF1.
Role of conserved nucleotides in building the 16S rRNA binding site of E. coli ribosomal protein S8.
Allmang, C; Mougel, M; Westhof, E; Ehresmann, B; Ehresmann, C
1994-01-01
Ribosomal protein S8 specifically recognizes a helical and irregular region of 16S rRNA that is highly evolutionary constrained. Despite its restricted size, the precise conformation of this region remains a question of debate. Here, we used chemical probing to analyze the structural consequences of mutations in this RNA region. These data, combined with computer modelling and previously published data on protein binding were used to investigate the conformation of the RNA binding site. The experimental data confirm the model in which adenines A595, A640 and A642 bulge out in the deep groove. In addition to the already proposed non canonical U598-U641 interaction, the structure is stabilized by stacking interactions (between A595 and A640) and an array of hydrogen bonds involving bases and the sugar phosphate backbone. Mutations that alter the ability to form these interdependent interactions result in a local destabilization or reorganization. The specificity of recognition by protein S8 is provided by the irregular and distorted backbone and the two bulged adenines 640 and 642 in the deep groove. The third adenine (A595) is not a direct recognition site but must adopt a bulged position. The U598-U641 pair should not be directly in contact with the protein. Images PMID:7937081
Walker, Sarah E.; Zhou, Fujun; Mitchell, Sarah F.; Larson, Victoria S.; Valasek, Leos; Hinnebusch, Alan G.; Lorsch, Jon R.
2013-01-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B’s domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome’s mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment. PMID:23236192
The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.
MacConnell, W P; Kaplan, N O
1982-05-25
The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-05-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-01-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033
Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O
1995-01-01
Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.
The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.
Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J
2016-08-15
Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).
Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Phalee, Anawat; Noikong-Phalee, Waraporn; Chai, Jong Yil
2016-03-01
Trematode cercariae are commonly found in many freshwater gastropods. These cercariae can serve to identify the occurrence of such trematodes as Centrocestus formosanus, Haplorchis taichui, Haplorchoides sp, and Stellantchasmus falcatus, which are important parasites in Chiang Mai Province, Thailand. As the species of these cercariae cannot be identified accurately based on morphology, this study employed sequencing of a fragment of 28S ribosomal DNA and phylogenetic analysis to identify the trematode cercariae found in freshwater gastropods in Chiang Mai Province. Eight types of trematode cercariae were identified, namely, distome cercaria (grouped with Philophthalmus spp clade), echinostome cercaria (grouped with Echinostoma spp clade), furcocercous cercaria (grouped with Posthodiplostomum sp/Alaria taxideae/Hysteromorpha triloba clade), monostome cercaria (grouped with Catatropis indicus clade), parapleurolophocercous cercaria (grouped with Haplorchoides sp clade), pleurolophocercous cercaria (grouped with Centrocestusformosanus clade), transversotrema cercaria (grouped with Transversotrema spp clade), and xiphidiocercaria (grouped with Prosthodendrium spp clade). These results provide important information that can be used for identifying these parasites in epidemiological surveys.
Kaminishi, Tatsuya; Schedlbauer, Andreas; Fabbretti, Attilio; Brandi, Letizia; Ochoa-Lizarralde, Borja; He, Cheng-Guang; Milón, Pohl; Connell, Sean R.; Gualerzi, Claudio O.; Fucini, Paola
2015-01-01
Hygromycin A (HygA) binds to the large ribosomal subunit and inhibits its peptidyl transferase (PT) activity. The presented structural and biochemical data indicate that HygA does not interfere with the initial binding of aminoacyl-tRNA to the A site, but prevents its subsequent adjustment such that it fails to act as a substrate in the PT reaction. Structurally we demonstrate that HygA binds within the peptidyl transferase center (PTC) and induces a unique conformation. Specifically in its ribosomal binding site HygA would overlap and clash with aminoacyl-A76 ribose moiety and, therefore, its primary mode of action involves sterically restricting access of the incoming aminoacyl-tRNA to the PTC. PMID:26464437
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly,more » cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.« less
In vivo tmRNA protection by SmpB and pre-ribosome binding conformation in solution.
Ranaei-Siadat, Ehsan; Mérigoux, Cécile; Seijo, Bili; Ponchon, Luc; Saliou, Jean-Michel; Bernauer, Julie; Sanglier-Cianférani, Sarah; Dardel, Fréderic; Vachette, Patrice; Nonin-Lecomte, Sylvie
2014-10-01
TmRNA is an abundant RNA in bacteria with tRNA and mRNA features. It is specialized in trans-translation, a translation rescuing system. We demonstrate that its partner protein SmpB binds the tRNA-like region (TLD) in vivo and chaperones the fold of the TLD-H2 region. We use an original approach combining the observation of tmRNA degradation pathways in a heterologous system, the analysis of the tmRNA digests by MS and NMR, and co-overproduction assays of tmRNA and SmpB. We study the conformation in solution of tmRNA alone or in complex with one SmpB before ribosome binding using SAXS. Our data show that Mg(2+) drives compaction of the RNA structure and that, in the absence of Mg(2+), SmpB has a similar effect albeit to a lesser extent. Our results show that tmRNA is intrinsically structured in solution with identical topology to that observed on complexes on ribosomes which should facilitate its subsequent recruitment by the 70S ribosome, free or preloaded with one SmpB molecule. © 2014 Ranaei-Siadat et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen
2010-04-26
Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less
Ribosome binding induces repositioning of the signal recognition particle receptor on the translocon
Kuhn, Patrick; Draycheva, Albena; Vogt, Andreas; Petriman, Narcis-Adrian; Sturm, Lukas; Drepper, Friedel; Warscheid, Bettina; Wintermeyer, Wolfgang
2015-01-01
Cotranslational protein targeting delivers proteins to the bacterial cytoplasmic membrane or to the eukaryotic endoplasmic reticulum membrane. The signal recognition particle (SRP) binds to signal sequences emerging from the ribosomal tunnel and targets the ribosome-nascent-chain complex (RNC) to the SRP receptor, termed FtsY in bacteria. FtsY interacts with the fifth cytosolic loop of SecY in the SecYEG translocon, but the functional role of the interaction is unclear. By using photo-cross-linking and fluorescence resonance energy transfer measurements, we show that FtsY–SecY complex formation is guanosine triphosphate independent but requires a phospholipid environment. Binding of an SRP–RNC complex exposing a hydrophobic transmembrane segment induces a rearrangement of the SecY–FtsY complex, which allows the subsequent contact between SecY and ribosomal protein uL23. These results suggest that direct RNC transfer to the translocon is guided by the interaction between SRP and translocon-bound FtsY in a quaternary targeting complex. PMID:26459600
Hepatitis-C-virus-like internal ribosome entry sites displace eIF3 to gain access to the 40S subunit
NASA Astrophysics Data System (ADS)
Hashem, Yaser; Des Georges, Amedee; Dhote, Vidya; Langlois, Robert; Liao, Hstau Y.; Grassucci, Robert A.; Pestova, Tatyana V.; Hellen, Christopher U. T.; Frank, Joachim
2013-11-01
Hepatitis C virus (HCV) and classical swine fever virus (CSFV) messenger RNAs contain related (HCV-like) internal ribosome entry sites (IRESs) that promote 5'-end independent initiation of translation, requiring only a subset of the eukaryotic initiation factors (eIFs) needed for canonical initiation on cellular mRNAs. Initiation on HCV-like IRESs relies on their specific interaction with the 40S subunit, which places the initiation codon into the P site, where it directly base-pairs with eIF2-bound initiator methionyl transfer RNA to form a 48S initiation complex. However, all HCV-like IRESs also specifically interact with eIF3 (refs 2, 5, 6, 7, 9, 10, 11, 12), but the role of this interaction in IRES-mediated initiation has remained unknown. During canonical initiation, eIF3 binds to the 40S subunit as a component of the 43S pre-initiation complex, and comparison of the ribosomal positions of eIF3 and the HCV IRES revealed that they overlap, so that their rearrangement would be required for formation of ribosomal complexes containing both components. Here we present a cryo-electron microscopy reconstruction of a 40S ribosomal complex containing eIF3 and the CSFV IRES. Remarkably, although the position and interactions of the CSFV IRES with the 40S subunit in this complex are similar to those of the HCV IRES in the 40S-IRES binary complex, eIF3 is completely displaced from its ribosomal position in the 43S complex, and instead interacts through its ribosome-binding surface exclusively with the apical region of domain III of the IRES. Our results suggest a role for the specific interaction of HCV-like IRESs with eIF3 in preventing ribosomal association of eIF3, which could serve two purposes: relieving the competition between the IRES and eIF3 for a common binding site on the 40S subunit, and reducing formation of 43S complexes, thereby favouring translation of viral mRNAs.
Has1 regulates consecutive maturation and processing steps for assembly of 60S ribosomal subunits
Dembowski, Jill A.; Kuo, Benjamin; Woolford, John L.
2013-01-01
Ribosome biogenesis requires ∼200 assembly factors in Saccharomyces cerevisiae. The pre-ribosomal RNA (rRNA) processing defects associated with depletion of most of these factors have been characterized. However, how assembly factors drive the construction of ribonucleoprotein neighborhoods and how structural rearrangements are coupled to pre-rRNA processing are not understood. Here, we reveal ATP-independent and ATP-dependent roles of the Has1 DEAD-box RNA helicase in consecutive pre-rRNA processing and maturation steps for construction of 60S ribosomal subunits. Has1 associates with pre-60S ribosomes in an ATP-independent manner. Has1 binding triggers exonucleolytic trimming of 27SA3 pre-rRNA to generate the 5′ end of 5.8S rRNA and drives incorporation of ribosomal protein L17 with domain I of 5.8S/25S rRNA. ATP-dependent activity of Has1 promotes stable association of additional domain I ribosomal proteins that surround the polypeptide exit tunnel, which are required for downstream processing of 27SB pre-rRNA. Furthermore, in the absence of Has1, aberrant 27S pre-rRNAs are targeted for irreversible turnover. Thus, our data support a model in which Has1 helps to establish domain I architecture to prevent pre-rRNA turnover and couples domain I folding with consecutive pre-rRNA processing steps. PMID:23788678
Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors
Umaer, Khan; Ciganda, Martin
2014-01-01
Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018
Shi, Wei-Wei; Tang, Yun-Sang; Sze, See-Yuen; Zhu, Zhen-Ning; Wong, Kam-Bo; Shaw, Pang-Chui
2016-10-13
Ricin is a type 2 ribosome-inactivating protein (RIP), containing a catalytic A chain and a lectin-like B chain. It inhibits protein synthesis by depurinating the N-glycosidic bond at α-sarcin/ricin loop (SRL) of the 28S rRNA, which thereby prevents the binding of elongation factors to the GTPase activation center of the ribosome. Here, we present the 1.6 Å crystal structure of Ricin A chain (RTA) complexed to the C-terminal peptide of the ribosomal stalk protein P2, which plays a crucial role in specific recognition of elongation factors and recruitment of eukaryote-specific RIPs to the ribosomes. Our structure reveals that the C-terminal GFGLFD motif of P2 peptide is inserted into a hydrophobic pocket of RTA, while the interaction assays demonstrate the structurally untraced SDDDM motif of P2 peptide contributes to the interaction with RTA. This interaction mode of RTA and P protein is in contrast to that with trichosanthin (TCS), Shiga-toxin (Stx) and the active form of maize RIP (MOD), implying the flexibility of the P2 peptide-RIP interaction, for the latter to gain access to ribosome.
A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs
Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.
2009-01-01
Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483
Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R
2009-05-01
Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.
Kinetic analysis of pre-ribosome structure in vivo
Swiatkowska, Agata; Wlotzka, Wiebke; Tuck, Alex; Barrass, J. David; Beggs, Jean D.; Tollervey, David
2012-01-01
Pre-ribosomal particles undergo numerous structural changes during maturation, but their high complexity and short lifetimes make these changes very difficult to follow in vivo. In consequence, pre-ribosome structure and composition have largely been inferred from purified particles and analyzed in vitro. Here we describe techniques for kinetic analyses of the changes in pre-ribosome structure in living cells of Saccharomyces cerevisiae. To allow this, in vivo structure probing by DMS modification was combined with affinity purification of newly synthesized 20S pre-rRNA over a time course of metabolic labeling with 4-thiouracil. To demonstrate that this approach is generally applicable, we initially analyzed the accessibility of the region surrounding cleavage site D site at the 3′ end of the mature 18S rRNA region of the pre-rRNA. This revealed a remarkably flexible structure throughout 40S subunit biogenesis, with little stable RNA–protein interaction apparent. Analysis of folding in the region of the 18S central pseudoknot was consistent with previous data showing U3 snoRNA–18S rRNA interactions. Dynamic changes in the structure of the hinge between helix 28 (H28) and H44 of pre-18S rRNA were consistent with recently reported interactions with the 3′ guide region of U3 snoRNA. Finally, analysis of the H18 region indicates that the RNA structure matures early, but additional protection appears subsequently, presumably reflecting protein binding. The structural analyses described here were performed on total, affinity-purified, newly synthesized RNA, so many classes of RNA and RNA–protein complex are potentially amenable to this approach. PMID:23093724
Mpp10 represents a platform for the interaction of multiple factors within the 90S pre-ribosome
Kharde, Satyavati; Ahmed, Yasar Luqman; Stier, Gunter; Kunze, Ruth; Sinning, Irmgard
2017-01-01
In eukaryotes, ribosome assembly is a highly complex process that involves more than 200 assembly factors that ensure the folding, modification and processing of the different rRNA species as well as the timely association of ribosomal proteins. One of these factors, Mpp10 associates with Imp3 and Imp4 to form a complex that is essential for the normal production of the 18S rRNA. Here we report the crystal structure of a complex between Imp4 and a short helical element of Mpp10 to a resolution of 1.88 Å. Furthermore, we extend the interaction network of Mpp10 and characterize two novel interactions. Mpp10 is able to bind the ribosome biogenesis factor Utp3/Sas10 through two conserved motifs in its N-terminal region. In addition, Mpp10 interacts with the ribosomal protein S5/uS7 using a short stretch within an acidic loop region. Thus, our findings reveal that Mpp10 provides a platform for the simultaneous interaction with multiple proteins in the 90S pre-ribosome. PMID:28813493
GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies
Amanatiadou, Elsa P.; Papadopoulos, Giorgio L.; Strouboulis, John; Vizirianakis, Ioannis S.
2015-01-01
The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946
The path from nucleolar 90S to cytoplasmic 40S pre-ribosomes.
Schäfer, Thorsten; Strauss, Daniela; Petfalski, Elisabeth; Tollervey, David; Hurt, Ed
2003-03-17
Recent reports have increased our knowledge of the consecutive steps during 60S ribosome biogenesis substantially, but 40S subunit formation is less well understood. Here, we investigate the maturation of nucleolar 90S pre-ribosomes into cytoplasmic 40S pre-ribosomes. During the transition from 90S to 40S particles, the majority of non-ribosomal proteins (approximately 30 species) dissociate, and significantly fewer factors associate with 40S pre-ribosomes. Notably, some of these components are part of both early 90S and intermediate 40S pre-particles in the nucleolus (e.g. Enp1p, Dim1p and Rrp12p), whereas others (e.g. Rio2p and Nob1p) are found mainly on late cytoplasmic pre-40S subunits. Finally, temperature-sensitive mutants mapping either in earlier (enp1-1) or later (rio2-1) components exhibit defects in the formation and nuclear export of pre-40S subunits. Our data provide an initial biochemical map of the pre-40S ribosomal subunit on its path from the nucleolus to the cytoplasm. This pathway involves fewer changes in composition than seen during 60S biogenesis.
Jakovljevic, Jelena; Ohmayer, Uli; Gamalinda, Michael; Talkish, Jason; Alexander, Lisa; Linnemann, Jan; Milkereit, Philipp; Woolford, John L.
2012-01-01
Ribosome biogenesis is a complex multistep process that involves alternating steps of folding and processing of pre-rRNAs in concert with assembly of ribosomal proteins. Recently, there has been increased interest in the roles of ribosomal proteins in eukaryotic ribosome biogenesis in vivo, focusing primarily on their function in pre-rRNA processing. However, much less is known about participation of ribosomal proteins in the formation and rearrangement of preribosomal particles as they mature to functional subunits. We have studied ribosomal proteins L7 and L8, which are required for the same early steps in pre-rRNA processing during assembly of 60S subunits but are located in different domains within ribosomes. Depletion of either leads to defects in processing of 27SA3 to 27SB pre-rRNA and turnover of pre-rRNAs destined for large ribosomal subunits. A specific subset of proteins is diminished from these residual assembly intermediates: six assembly factors required for processing of 27SA3 pre-rRNA and four ribosomal proteins bound to domain I of 25S and 5.8S rRNAs surrounding the polypeptide exit tunnel. In addition, specific sets of ribosomal proteins are affected in each mutant: In the absence of L7, proteins bound to domain II, L6, L14, L20, and L33 are greatly diminished, while proteins L13, L15, and L36 that bind to domain I are affected in the absence of L8. Thus, L7 and L8 might establish RNP structures within assembling ribosomes necessary for the stable association and function of the A3 assembly factors and for proper assembly of the neighborhoods containing domains I and II. PMID:22893726
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George
2013-01-01
SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Principles of 60S ribosomal subunit assembly emerging from recent studies in yeast
Konikkat, Salini; Woolford, John L.
2017-01-01
Ribosome biogenesis requires the intertwined processes of folding, modification, and processing of ribosomal RNA, together with binding of ribosomal proteins. In eukaryotic cells, ribosome assembly begins in the nucleolus, continues in the nucleoplasm, and is not completed until after nascent particles are exported to the cytoplasm. The efficiency and fidelity of ribosome biogenesis are facilitated by >200 assembly factors and ~76 different small nucleolar RNAs. The pathway is driven forward by numerous remodeling events to rearrange the ribonucleoprotein architecture of pre-ribosomes. Here, we describe principles of ribosome assembly that have emerged from recent studies of biogenesis of the large ribosomal subunit in the yeast Saccharomyces cerevisiae. We describe tools that have empowered investigations of ribosome biogenesis, and then summarize recent discoveries about each of the consecutive steps of subunit assembly. PMID:28062837
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Barendt, Pamela A.; Shah, Najaf A.; Barendt, Gregory A.; Kothari, Parth A.; Sarkar, Casim A.
2013-01-01
While the ribosome has evolved to function in complex intracellular environments, these contexts do not easily allow for the study of its inherent capabilities. We have used a synthetic, well-defined, Escherichia coli (E. coli)-based translation system in conjunction with ribosome display, a powerful in vitro selection method, to identify ribosome binding sites (RBSs) that can promote the efficient translation of messenger RNAs (mRNAs) with a leader length representative of natural E. coli mRNAs. In previous work, we used a longer leader sequence and unexpectedly recovered highly efficient cytosine-rich sequences with complementarity to the 16S ribosomal RNA (rRNA) and similarity to eukaryotic RBSs. In the current study, Shine-Dalgarno (SD) sequences were prevalent but non-SD sequences were also heavily enriched and were dominated by novel guanine- and uracil-rich motifs which showed statistically significant complementarity to the 16S rRNA. Additionally, only SD motifs exhibited position-dependent decreases in sequence entropy, indicating that non-SD motifs likely operate by increasing the local concentration of ribosomes in the vicinity of the start codon, rather than by a position-dependent mechanism. These results further support the putative generality of mRNA-rRNA complementarity in facilitating mRNA translation, but also suggest that context (e.g., leader length and composition) dictates the specific subset of possible RBSs that are used for efficient translation of a given transcript. PMID:23427812
Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae
Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine
2016-01-01
ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single
Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae.
Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine; Belyi, Yury
2016-01-01
The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5' untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62-K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62-K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62-K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62-K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62-K70 segment of Rps26 and the 5' untranslated region of mRNA. The data suggested a specific role of the Y62-K70 motif during translation initiation. Here, we report that single-site substitutions
Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome
NASA Astrophysics Data System (ADS)
Poirot, Olivier; Timsit, Youri
2016-05-01
From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.
Kiosze-Becker, Kristin; Ori, Alessandro; Gerovac, Milan; Heuer, André; Nürenberg-Goloub, Elina; Rashid, Umar Jan; Becker, Thomas; Beckmann, Roland; Beck, Martin; Tampé, Robert
2016-01-01
Ribosome recycling orchestrated by the ATP binding cassette (ABC) protein ABCE1 can be considered as the final—or the first—step within the cyclic process of protein synthesis, connecting translation termination and mRNA surveillance with re-initiation. An ATP-dependent tweezer-like motion of the nucleotide-binding domains in ABCE1 transfers mechanical energy to the ribosome and tears the ribosome subunits apart. The post-recycling complex (PRC) then re-initiates mRNA translation. Here, we probed the so far unknown architecture of the 1-MDa PRC (40S/30S·ABCE1) by chemical cross-linking and mass spectrometry (XL-MS). Our study reveals ABCE1 bound to the translational factor-binding (GTPase) site with multiple cross-link contacts of the helix–loop–helix motif to the S24e ribosomal protein. Cross-linking of the FeS cluster domain to the ribosomal protein S12 substantiates an extreme lever-arm movement of the FeS cluster domain during ribosome recycling. We were thus able to reconstitute and structurally analyse a key complex in the translational cycle, resembling the link between translation initiation and ribosome recycling. PMID:27824037
Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S
1989-01-01
A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.
Ribosome-inactivating proteins: potent poisons and molecular tools.
Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M
2013-11-15
Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms.
Cukras, Anthony R; Green, Rachel
2005-05-27
The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.
[Family of ribosomal proteins S1 contains unique conservative domain].
Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N
2010-01-01
Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.
Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry
Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering withmore » translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.« less
Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'iaminova, A G; Karpova, G G
2008-01-01
Protein S15 is a characteristic component of the mammalian 80S ribosome that neighbors mRNA codon at the decoding site and the downstream triplets. In this study we determined S15 protein fragments located close to mRNA positions +4 to +12 with respect to the first nucleotide of the P site codon on the human ribosome. For cross-linking to ribosomal protein S15, a set of mRNA was used that contained triplet UUU/UUC at the 5'-termini and a perfluorophenyl azide-modified uridine in position 3' of this triplet. The locations of mRNA analogues on the ribosome were governed by tRNAPhe cognate to the UUU/UUC triplet targeted to the P site. Cross-linked S15 protein was isolated from the irradiated with mild UV light complexes of 80S ribosomes with tRNAPhe and mRNA analogues with subsequent cleavage with CNBr that splits polypeptide chain after methionines. Analysis of modified oligopeptides resulted from the cleavage revealed that in all cases cross-linking site was located in C-terminal fragment 111-145 of protein S15 indicating that this fragment is involved in formation of decoding site of the eukaryotic ribosome.
Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack
de Virgilio, Maddalena; Lombardi, Alessio; Caliandro, Rocco; Fabbrini, Maria Serena
2010-01-01
Ribosome-inactivating proteins (RIPs) are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat) and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential. PMID:22069572
Kimura, M; Kimura, J; Hatakeyama, T
1988-11-21
The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).
Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R
2014-01-01
Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3′ domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3′-domain is unanchored and the 5′-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells. DOI: http://dx.doi.org/10.7554/eLife.04491.001 PMID:25313868
Molecular cloning of low-temperature-inducible ribosomal proteins from soybean.
Kim, Kee-Young; Park, Seong-Whan; Chung, Young-Soo; Chung, Chung-Han; Kim, Jung-In; Lee, Jai-Heon
2004-05-01
Three ribosomal protein genes induced by low-temperature treatment were isolated from soybean. GmRPS13 (742 bp) encodes a 17.1 kDa protein which has 95% identity with the 40S ribosomal protein S13 of Panax ginseng (AB043974). GmRPS6 (925 bp) encodes a 28.1 kDa protein which has 94% identity with the 40S ribosomal protein S6 of Asparagus officinalis (AJ277533). GmRPL37 (494 bp) encodes a 10.7 kDa protein which has 85% identity with the 60S ribosomal protein L37 of Arabidopsis thaliana (AF370216). The expression of these ribosomal protein genes started to increase 3 d after low-temperature treatment, whereas the cold-stress protein src1 was highly induced from the first day. Such late response of these ribosomal protein genes may be due to secondary signals during cold adaptation. The induction of ribosomal protein genes might enhance the translation process or help proper ribosome functioning under low-temperature conditions.
Odilorhabdins, Antibacterial Agents that Cause Miscoding by Binding at a New Ribosomal Site.
Pantel, Lucile; Florin, Tanja; Dobosz-Bartoszek, Malgorzata; Racine, Emilie; Sarciaux, Matthieu; Serri, Marine; Houard, Jessica; Campagne, Jean-Marc; de Figueiredo, Renata Marcia; Midrier, Camille; Gaudriault, Sophie; Givaudan, Alain; Lanois, Anne; Forst, Steve; Aumelas, André; Cotteaux-Lautard, Christelle; Bolla, Jean-Michel; Vingsbo Lundberg, Carina; Huseby, Douglas L; Hughes, Diarmaid; Villain-Guillot, Philippe; Mankin, Alexander S; Polikanov, Yury S; Gualtieri, Maxime
2018-04-05
Growing resistance of pathogenic bacteria and shortage of antibiotic discovery platforms challenge the use of antibiotics in the clinic. This threat calls for exploration of unconventional sources of antibiotics and identification of inhibitors able to eradicate resistant bacteria. Here we describe a different class of antibiotics, odilorhabdins (ODLs), produced by the enzymes of the non-ribosomal peptide synthetase gene cluster of the nematode-symbiotic bacterium Xenorhabdus nematophila. ODLs show activity against Gram-positive and Gram-negative pathogens, including carbapenem-resistant Enterobacteriaceae, and can eradicate infections in animal models. We demonstrate that the bactericidal ODLs interfere with protein synthesis. Genetic and structural analyses reveal that ODLs bind to the small ribosomal subunit at a site not exploited by current antibiotics. ODLs induce miscoding and promote hungry codon readthrough, amino acid misincorporation, and premature stop codon bypass. We propose that ODLs' miscoding activity reflects their ability to increase the affinity of non-cognate aminoacyl-tRNAs to the ribosome. Copyright © 2018 Elsevier Inc. All rights reserved.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús
2018-05-18
The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits.
Macrolide antibiotic interaction and resistance on the bacterial ribosome.
Poehlsgaard, Jacob; Douthwaite, Stephen
2003-02-01
Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.
Lamichhane, Tek N; Abeydeera, N Dinuka; Duc, Anne-Cécile E; Cunningham, Philip R; Chow, Christine S
2011-01-28
Ribosomal RNA is the catalytic portion of ribosomes, and undergoes a variety of conformational changes during translation. Structural changes in ribosomal RNA can be facilitated by the presence of modified nucleotides. Helix 31 of bacterial 16S ribosomal RNA harbors two modified nucleotides, m²G966 and m⁵C967, that are highly conserved among bacteria, though the degree and nature of the modifications in this region are different in eukaryotes. Contacts between helix 31 and the P-site tRNA, initiation factors, and ribosomal proteins highlight the importance of this region in translation. In this work, a heptapeptide M13 phage-display library was screened for ligands that target the wild-type, naturally modified bacterial helix 31. Several peptides, including TYLPWPA, CVRPFAL, TLWDLIP, FVRPFPL, ATPLWLK, and DIRTQRE, were found to be prevalent after several rounds of screening. Several of the peptides exhibited moderate affinity (in the high nM to low µM range) to modified helix 31 in biophysical assays, including surface plasmon resonance (SPR), and were also shown to bind 30S ribosomal subunits. These peptides also inhibited protein synthesis in cell-free translation assays.
Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús
2018-01-01
Abstract The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits. PMID:29788267
Heilek, G M; Noller, H F
1996-01-01
Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688
Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli
2017-05-27
Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.
Interaction of tetracycline with RNA: photoincorporation into ribosomal RNA of Escherichia coli.
Oehler, R; Polacek, N; Steiner, G; Barta, A
1997-01-01
Photolysis of [3H]tetracycline in the presence of Escherichia coli ribosomes results in an approximately 1:1 ratio of labelling ribosomal proteins and RNAs. In this work we characterize crosslinks to both 16S and 23S RNAs. Previously, the main target of photoincorporation of [3H]tetracycline into ribosomal proteins was shown to be S7, which is also part of the one strong binding site of tetracycline on the 30S subunit. The crosslinks on 23S RNA map exclusively to the central loop of domain V (G2505, G2576 and G2608) which is part of the peptidyl transferase region. However, experiments performed with chimeric ribosomal subunits demonstrate that peptidyltransferase activity is not affected by tetracycline crosslinked solely to the 50S subunits. Three different positions are labelled on the 16S RNA, G693, G1300 and G1338. The positions of these crosslinked nucleotides correlate well with footprints on the 16S RNA produced either by tRNA or the protein S7. This suggests that the nucleotides are labelled by tetracycline bound to the strong binding site on the 30S subunit. In addition, our results demonstrate that the well known inhibition of tRNA binding to the A-site is solely due to tetracycline crosslinked to 30S subunits and furthermore suggest that interactions of the antibiotic with 16S RNA might be involved in its mode of action. PMID:9092632
Yoshikawa, Harunori; Komatsu, Wataru; Hayano, Toshiya; Miura, Yutaka; Homma, Keiichi; Izumikawa, Keiichi; Ishikawa, Hideaki; Miyazawa, Naoki; Tachikawa, Hiroyuki; Yamauchi, Yoshio; Isobe, Toshiaki; Takahashi, Nobuhiro
2011-01-01
Ribosome biogenesis starts with transcription of the large ribosomal RNA precursor (47S pre-rRNA), which soon combines with numerous factors to form the 90S pre-ribosome in the nucleolus. Although the subsequent separation of the pre-90S particle into pre-40S and pre-60S particles is critical for the production process of mature small and large ribosomal subunits, its molecular mechanisms remain undetermined. Here, we present evidence that p32, fibrillarin (FBL), and Nop52 play key roles in this separation step. Mass-based analyses combined with immunoblotting showed that p32 associated with 155 proteins including 31 rRNA-processing factors (of which nine were components of small subunit processome, and six were those of RIX1 complex), 13 chromatin remodeling components, and six general transcription factors required for RNA polymerase III-mediated transcription. Of these, a late rRNA-processing factor Nop52 interacted directly with p32. Immunocytochemical analyses demonstrated that p32 colocalized with an early rRNA-processing factor FBL or Nop52 in the nucleolus and Cajal bodies, but was excluded from the nucleolus after actinomycin D treatment. p32 was present in the pre-ribosomal fractions prepared by cell fractionation or separated by ultracentrifugation of the nuclear extract. p32 also associated with pre-rRNAs including 47S/45S and 32S pre-rRNAs. Furthermore, knockdown of p32 with a small interfering RNA slowed the early processing from 47S/45S pre-rRNAs to 18S rRNA and 32S pre-rRNA. Finally, Nop52 was found to compete with FBL for binding to p32 probably in the nucleolus. Given the fact that FBL and Nop52 are associated with pre-ribosome particles distinctly different from each other, we suggest that p32 is a new rRNA maturation factor involved in the remodeling from pre-90S particles to pre-40S and pre-60S particles that requires the exchange of FBL for Nop52. PMID:21536856
Mapping of ribosomal 23S ribosomal RNA modifications in Clostridium sporogenes.
Kirpekar, Finn; Hansen, Lykke H; Mundus, Julie; Tryggedsson, Stine; Teixeira Dos Santos, Patrícia; Ntokou, Eleni; Vester, Birte
2018-06-27
All organisms contain RNA modifications in their ribosomal RNA (rRNA), but the importance, positions and exact function of these are still not fully elucidated. Various functions such as stabilising structures, controlling ribosome assembly and facilitating interactions have been suggested and in some cases substantiated. Bacterial rRNA contains much fewer modifications than eukaryotic rRNA. The rRNA modification patterns in bacteria differ from each other, but too few organisms have been mapped to draw general conclusions. This study maps 23S ribosomal RNA modifications in Clostridium sporogenes that can be characterised as a non-toxin producing Clostridium botulinum. Clostridia are able to sporulate and thereby survive harsh conditions, and are in general considered to be resilient to antibiotics. Selected regions of the 23S rRNA were investigated by mass spectrometry and by primer extension analysis to pinpoint modified sites and the nature of the modifications. Apparently, C. sporogenes 23S rRNA contains few modifications compared to other investigated bacteria. No modifications were identified in domain II and III of 23S rRNA. Three modifications were identified in domain IV, all of which have also been found in other organisms. Two unusual modifications were identified in domain V, methylated dihydrouridine at position U2449 and dihydrouridine at position U2500 (Escherichia coli numbering), in addition to four previously known modified positions. The enzymes responsible for the modifications were searched for in the C. sporogenes genome using BLAST with characterised enzymes as query. The search identified genes potentially coding for RNA modifying enzymes responsible for most of the found modifications.
Transition state analogues in structures of ricin and saporin ribosome-inactivating proteins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ho, Meng-Chiao; Sturm, Matthew B.; Almo, Steven C.
2010-01-12
Ricin A-chain (RTA) and saporin-L1 (SAP) catalyze adenosine depurination of 28S rRNA to inhibit protein synthesis and cause cell death. We present the crystal structures of RTA and SAP in complex with transition state analogue inhibitors. These tight-binding inhibitors mimic the sarcin-ricin recognition loop of 28S rRNA and the dissociative ribocation transition state established for RTA catalysis. RTA and SAP share unique purine-binding geometry with quadruple {pi}-stacking interactions between adjacent adenine and guanine bases and 2 conserved tyrosines. An arginine at one end of the {pi}-stack provides cationic polarization and enhanced leaving group ability to the susceptible adenine. Common featuresmore » of these ribosome-inactivating proteins include adenine leaving group activation, a remarkable lack of ribocation stabilization, and conserved glutamates as general bases for activation of the H{sub 2}O nucleophile. Catalytic forces originate primarily from leaving group activation evident in both RTA and SAP in complex with transition state analogues.« less
Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.
Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre
2016-09-01
Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.
Targeting ricin to the ribosome.
May, Kerrie L; Yan, Qing; Tumer, Nilgun E
2013-07-01
The plant toxin ricin is highly toxic for mammalian cells and is of concern for bioterrorism. Ricin belongs to a family of functionally related toxins, collectively referred to as ribosome inactivating proteins (RIPs), which disable ribosomes and halt protein synthesis. Currently there are no specific antidotes against ricin or related RIPs. The catalytic subunit of ricin is an N-glycosidase that depurinates a universally conserved adenine residue within the sarcin/ricin loop (SRL) of the 28S rRNA. This depurination activity inhibits translation and its biochemistry has been intensively studied. Yet, recent developments paint a more complex picture of toxicity, with ribosomal proteins and cellular signaling pathways contributing to the potency of ricin. In particular, several studies have now established the importance of the ribosomal stalk structure in facilitating the depurination activity and ribosome specificity of ricin and other RIPs. This review highlights recent developments defining toxin-ribosome interactions and examines the significance of these interactions for toxicity and therapeutic intervention. Copyright © 2013 Elsevier Ltd. All rights reserved.
Sterk, Maaike; Romilly, Cédric; Wagner, E Gerhart H
2018-01-01
Abstract Initiation is the rate-limiting step in translation. It is well-known that stable structure at a ribosome binding site (RBS) impedes initiation. The ribosome standby model of de Smit and van Duin, based on studies of the MS2 phage coat cistron, proposed how high translation rates can be reconciled with stable, inhibitory structures at an RBS. Here, we revisited the coat protein system and assessed the translation efficiency from its sequestered RBS by introducing standby mutations. Further experiments with gfp reporter constructs assessed the effects of 5′-tails—as standby sites—with respect to length and sequence contributions. In particular, combining in vivo and in vitro assays, we can show that tails of CA-dinucleotide repeats—and to a lesser extent, AU-repeats—dramatically increase translation rates. Tails of increasing length reach maximal rate-enhancing effects at 16–18 nucleotides. These standby tails are single-stranded and do not exert their effect by structure changes in the neighboring RBS stem–loop. In vitro translation and toeprinting assays furthermore demonstrate that standby effects are exerted at the level of translation initiation. Finally, as expected, destabilizing mutations within the coat RBS indicate an interplay with the effects of standby tails. PMID:29420821
Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip
2018-04-21
Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.
Yamaguchi, K; von Knoblauch, K; Subramanian, A R
2000-09-15
Identification of all the protein components of a plastid (chloroplast) ribosomal 30 S subunit has been achieved, using two-dimensional gel electropholesis, high performance liquid chromatography purification, N-terminal sequencing, polymerase chain reaction-based screening of cDNA library, nucleotide sequencing, and mass spectrometry (electrospray ionization, matrix-assisted laser desorption/ionization time-of-flight, and reversed-phase HPLC coupled with electrospray ionization mass spectrometry). 25 proteins were identified, of which 21 are orthologues of all Escherichia coli 30 S ribosomal proteins (S1-S21), and 4 are plastid-specific ribosomal proteins (PSRPs) that have no homologues in the mitochondrial, archaebacterial, or cytosolic ribosomal protein sequences in data bases. 12 of the 25 plastid 30 S ribosomal proteins (PRPs) are encoded in the plastid genome, whereas the remaining 13 are encoded by the nuclear genome. Post-translational transit peptide cleavage sites for the maturation of the 13 cytosolically synthesized PRPs, and post-translational N-terminal processing in the maturation of the 12 plastid synthesized PRPs are described. Post-translational modifications in several PRPs were observed: alpha-N-acetylation of S9, N-terminal processings leading to five mature forms of S6 and two mature forms of S10, C-terminal and/or internal modifications in S1, S14, S18, and S19, leading to two distinct forms differing in mass and/or charge (the corresponding modifications are not observed in E. coli). The four PSRPs in spinach plastid 30 S ribosomal subunit (PSRP-1, 26.8 kDa, pI 6.2; PSRP-2, 21.7 kDa, pI 5.0; PSRP-3, 13.8 kDa, pI 4.9; PSRP-4, 5.2 kDa, pI 11.8) comprise 16% (67.6 kDa) of the total protein mass of the 30 S subunit (429.3 kDa). PSRP-1 and PSRP-3 show sequence similarities with hypothetical photosynthetic bacterial proteins, indicating their possible origins in photosynthetic bacteria. We propose the hypothesis that PSRPs form a "plastid
Attachment of UDP-hexosamines to the ribosomes isolated from rat liver
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kopacz-Jodczyk, T.; Paszkiewicz-Gadek, A.; Galasinski, W.
1988-06-01
The binding of UDP-N-acetylhexosamines with purified ribosomes was studied and it was found that the radioactive nucleotides can be attached to these particles. The radioactivity of the purified ribosomal pellet depends on the amounts of ribosomes and UDP-N-acetylhexosamines. Some characteristics of the binding system indicate that the attachment of UDP-sugar to ribosome does not require the participation of glycosyltransferases. The results of the competition experiment would suggest that there are specific sites on ribosomes for the binding of UDP-N-acetylglucosamine.
mRNA 3' of the A site bound codon is located close to protein S3 on the human 80S ribosome.
Molotkov, Maxim V; Graifer, Dmitri M; Popugaeva, Elena A; Bulygin, Konstantin N; Meschaninova, Maria I; Ven'yaminova, Aliya G; Karpova, Galina G
2006-07-01
Ribosomal proteins neighboring the mRNA downstream of the codon bound at the decoding site of human 80S ribosomes were identified using three sets of mRNA analogues that contained a UUU triplet at the 5' terminus and a perfluorophenylazide cross-linker at guanosine, adenosine or uridine residues placed at various locations 3' of this triplet. The positions of modified mRNA nucleotides on the ribosome were governed by tRNA(Phe) cognate to the UUU triplet targeted to the P site. Upon mild UV-irradiation, the mRNA analogues cross-linked preferentially to the 40S subunit, to the proteins and to a lesser extent to the 18S rRNA. Cross-linked nucleotides of 18S rRNA were identified previously. In the present study, it is shown that among the proteins the main target for cross-linking with all the mRNA analogues tested was protein S3 (homologous to prokaryotic S3, S3p); minor cross-linking to protein S2 (S5p) was also detected. Both proteins cross-linked to mRNA analogues in the ternary complexes as well as in the binary complexes (without tRNA). In the ternary complexes protein S15 (S19p) also cross-linked, the yield of the cross-link decreased significantly when the modified nucleotide moved from position +5 to position +12 with respect to the first nucleotide of the P site bound codon. In several ternary complexes minor cross-linking to protein S30 was likewise detected. The results of this study indicate that S3 is a key protein at the mRNA binding site neighboring mRNA downstream of the codon at the decoding site in the human ribosome.
Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D
2017-01-01
Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.
Structural characterization of ribosome recruitment and translocation by type IV IRES.
Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S
2016-05-09
Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation.
Structural characterization of ribosome recruitment and translocation by type IV IRES
Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S
2016-01-01
Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts the otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451
Factors Affecting Nuclear Export of the 60S Ribosomal Subunit In Vivo
Stage-Zimmermann, Tracy; Schmidt, Ute; Silver, Pamela A.
2000-01-01
In Saccharomyces cerevisiae, the 60S ribosomal subunit assembles in the nucleolus and then is exported to the cytoplasm, where it joins the 40S subunit for translation. Export of the 60S subunit from the nucleus is known to be an energy-dependent and factor-mediated process, but very little is known about the specifics of its transport. To begin to address this problem, an assay was developed to follow the localization of the 60S ribosomal subunit in S. cerevisiae. Ribosomal protein L11b (Rpl11b), one of the ∼45 ribosomal proteins of the 60S subunit, was tagged at its carboxyl terminus with the green fluorescent protein (GFP) to enable visualization of the 60S subunit in living cells. A panel of mutant yeast strains was screened for their accumulation of Rpl11b–GFP in the nucleus as an indicator of their involvement in ribosome synthesis and/or transport. This panel included conditional alleles of several rRNA-processing factors, nucleoporins, general transport factors, and karyopherins. As predicted, conditional alleles of rRNA-processing factors that affect 60S ribosomal subunit assembly accumulated Rpl11b–GFP in the nucleus. In addition, several of the nucleoporin mutants as well as a few of the karyopherin and transport factor mutants also mislocalized Rpl11b–GFP. In particular, deletion of the previously uncharacterized karyopherin KAP120 caused accumulation of Rpl11b–GFP in the nucleus, whereas ribosomal protein import was not impaired. Together, these data further define the requirements for ribosomal subunit export and suggest a biological function for KAP120. PMID:11071906
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression
Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.
2018-01-01
The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865
Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome
Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.
2014-01-01
SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919
Non-canonical mechanism for translational control in bacteria: synthesis of ribosomal protein S1
Boni, Irina V.; Artamonova, Valentina S.; Tzareva, Nina V.; Dreyfus, Marc
2001-01-01
Translation initiation region (TIR) of the rpsA mRNA encoding ribosomal protein S1 is one of the most efficient in Escherichia coli despite the absence of a canonical Shine–Dalgarno-element. Its high efficiency is under strong negative autogenous control, a puzzling phenomenon as S1 has no strict sequence specificity. To define sequence and structural elements responsible for translational efficiency and autoregulation of the rpsA mRNA, a series of rpsA′–′lacZ chromosomal fusions bearing various mutations in the rpsA TIR was created and tested for β-galactosidase activity in the absence and presence of excess S1. These in vivo results, as well as data obtained by in vitro techniques and phylogenetic comparison, allow us to propose a model for the structural and functional organization of the rpsA TIR specific for proteobacteria related to E.coli. According to the model, the high efficiency of translation initiation is provided by a specific fold of the rpsA leader forming a non-contiguous ribosome entry site, which is destroyed upon binding of free S1 when it acts as an autogenous repressor. PMID:11483525
sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-04
With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Efficient Cleavage of Ribosome-Associated Poly(A)-Binding Protein by Enterovirus 3C Protease
Kuyumcu-Martinez, N. Muge; Joachims, Michelle; Lloyd, Richard E.
2002-01-01
Poliovirus (PV) causes a rapid and drastic inhibition of host cell cap-dependent protein synthesis during infection while preferentially allowing cap-independent translation of its own genomic RNA via an internal ribosome entry site element. Inhibition of cap-dependent translation is partly mediated by cleavage of an essential translation initiation factor, eIF4GI, during PV infection. In addition to cleavage of eIF4GI, cleavage of eIF4GII and poly(A)-binding protein (PABP) has been recently proposed to contribute to complete host translation shutoff; however, the relative importance of eIF4GII and PABP cleavage has not been determined. At times when cap-dependent translation is first blocked during infection, only 25 to 35% of the total cellular PABP is cleaved; therefore, we hypothesized that the pool of PABP associated with polysomes may be preferentially targeted by viral proteases. We have investigated what cleavage products of PABP are produced in vivo and the substrate determinants for cleavage of PABP by 2A protease (2Apro) or 3C protease (3Cpro). Our results show that PABP in ribosome-enriched fractions is preferentially cleaved in vitro and in vivo compared to PABP in other fractions. Furthermore, we have identified four N-terminal PABP cleavage products produced during PV infection and have shown that viral 3C protease generates three of the four cleavage products. Also, 3Cpro is more efficient in cleaving PABP in ribosome-enriched fractions than 2Apro in vitro. In addition, binding of PABP to poly(A) RNA stimulates 3Cpro-mediated cleavage and inhibits 2Apro-mediated cleavage. These results suggest that 3Cpro plays a major role in processing PABP during virus infection and that the interaction of PABP with translation initiation factors, ribosomes, or poly(A) RNA may promote its cleavage by viral 2A and 3C proteases. PMID:11836384
sORFs.org: a repository of small ORFs identified by ribosome profiling
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-01
With the advent of ribosome profiling, a next generation sequencing technique providing a “snap-shot’’ of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these ‘sORFs’, indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. PMID:26527729
The attachment of UDP-hexosamines to the ribosomes isolated from rat liver.
Kopacz-Jodczyk, T; Paszkiewicz-Gadek, A; Gałasiński, W
1988-06-01
The binding of UDP-N-acetylhexosamines with purified ribosomes was studied and it was found that the radioactive nucleotides can be attached to these particles. The radioactivity of the purified ribosomal pellet depends on the amounts of ribosomes and UDP-N-acetylhexosamines. Some characteristics of the binding system indicate that the attachment of UDP-sugar to ribosome does not require the participation of glycosyltransferases. The results of the competition experiment would suggest that there are specific sites on ribosomes for the binding of UDP-N-acetylglucosamine.
Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio
2016-07-27
In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Role of Mex67-Mtr2 in the Nuclear Export of 40S Pre-Ribosomes
Occhipinti, Laura; Kemmler, Stefan; Panse, Vikram G.
2012-01-01
Nuclear export of mRNAs and pre-ribosomal subunits (pre40S and pre60S) is fundamental to all eukaryotes. While genetic approaches in budding yeast have identified bona fide export factors for mRNAs and pre60S subunits, little is known regarding nuclear export of pre40S subunits. The yeast heterodimeric transport receptor Mex67-Mtr2 (TAP-p15 in humans) binds mRNAs and pre60S subunits in the nucleus and facilitates their passage through the nuclear pore complex (NPC) into the cytoplasm by interacting with Phe-Gly (FG)-rich nucleoporins that line its transport channel. By exploiting a combination of genetic, cell-biological, and biochemical approaches, we uncovered an unanticipated role of Mex67-Mtr2 in the nuclear export of 40S pre-ribosomes. We show that recruitment of Mex67-Mtr2 to pre40S subunits requires loops emanating from its NTF2-like domains and that the C-terminal FG-rich nucleoporin interacting UBA-like domain within Mex67 contributes to the transport of pre40S subunits to the cytoplasm. Remarkably, the same loops also recruit Mex67-Mtr2 to pre60S subunits and to the Nup84 complex, the respective interactions crucial for nuclear export of pre60S subunits and mRNAs. Thus Mex67-Mtr2 is a unique transport receptor that employs a common interaction surface to participate in the nuclear export of both pre-ribosomal subunits and mRNAs. Mex67-Mtr2 could engage a regulatory crosstalk among the three major export pathways for optimal cellular growth and proliferation. PMID:22956913
Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús
2016-01-01
The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873
The Flavonoid Apigenin Downregulates CDK1 by Directly Targeting Ribosomal Protein S9
Iizumi, Yosuke; Oishi, Masakatsu; Taniguchi, Tomoyuki; Goi, Wakana; Sowa, Yoshihiro; Sakai, Toshiyuki
2013-01-01
Flavonoids have been reported to inhibit tumor growth by causing cell cycle arrest. However, little is known about the direct targets of flavonoids in tumor growth inhibition. In the present study, we developed a novel method using magnetic FG beads to purify flavonoid-binding proteins, and identified ribosomal protein S9 (RPS9) as a binding partner of the flavonoid apigenin. Similar to treatment with apigenin, knockdown of RPS9 inhibited the growth of human colon cancer cells at the G2/M phase by downregulating cyclin-dependent kinase 1 (CDK1) expression at the promoter level. Furthermore, knockdown of RPS9 suppressed G2/M arrest caused by apigenin. These results suggest that apigenin induces G2/M arrest at least partially by directly binding and inhibiting RPS9 which enhances CDK1 expression. We therefore raise the possibility that identification of the direct targets of flavonoids may contribute to the discovery of novel molecular mechanisms governing tumor growth. PMID:24009741
Ahmed, Tofayel; Shi, Jian
2017-01-01
Abstract Chloroplastic translation is mediated by a bacterial-type 70S chloroplast ribosome. During the evolution, chloroplast ribosomes have acquired five plastid-specific ribosomal proteins or PSRPs (cS22, cS23, bTHXc, cL37 and cL38) which have been suggested to play important regulatory roles in translation. However, their exact locations on the chloroplast ribosome remain elusive due to lack of a high-resolution structure, hindering our progress to understand their possible roles. Here we present a cryo-EM structure of the 70S chloroplast ribosome from spinach resolved to 3.4 Å and focus our discussion mainly on the architecture of the 30S small subunit (SSU) which is resolved to 3.7 Å. cS22 localizes at the SSU foot where it seems to compensate for the deletions in 16S rRNA. The mRNA exit site is highly remodeled due to the presence of cS23 suggesting an alternative mode of translation initiation. bTHXc is positioned at the SSU head and appears to stabilize the intersubunit bridge B1b during thermal fluctuations. The translation factor plastid pY binds to the SSU on the intersubunit side and interacts with the conserved nucleotide bases involved in decoding. Most of the intersubunit bridges are conserved compared to the bacteria, except for a new bridge involving uL2c and bS6c. PMID:28582576
Purification, characterization and crystallization of the human 80S ribosome
Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.
2014-01-01
Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798
Ribosomal RNA and ribosomal proteins in corynebacteria.
Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica
2003-09-04
Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.
Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L
2018-04-24
Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.
RNA regulators responding to ribosomal protein S15 are frequent in sequence space
Slinger, Betty L.; Meyer, Michelle M.
2016-01-01
There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716
Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones
Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter
2015-01-01
Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation. PMID:26112308
Sequential protein association with nascent 60S ribosomal particles.
Saveanu, Cosmin; Namane, Abdelkader; Gleizes, Pierre-Emmanuel; Lebreton, Alice; Rousselle, Jean-Claude; Noaillac-Depeyre, Jacqueline; Gas, Nicole; Jacquier, Alain; Fromont-Racine, Micheline
2003-07-01
Ribosome biogenesis in eukaryotes depends on the coordinated action of ribosomal and nonribosomal proteins that guide the assembly of preribosomal particles. These intermediate particles follow a maturation pathway in which important changes in their protein composition occur. The mechanisms involved in the coordinated assembly of the ribosomal particles are poorly understood. We show here that the association of preribosomal factors with pre-60S complexes depends on the presence of earlier factors, a phenomenon essential for ribosome biogenesis. The analysis of the composition of purified preribosomal complexes blocked in maturation at specific steps allowed us to propose a model of sequential protein association with, and dissociation from, early pre-60S complexes for several preribosomal factors such as Mak11, Ssf1, Rlp24, Nog1, and Nog2. The presence of either Ssf1 or Nog2 in complexes that contain the 27SB pre-rRNA defines novel, distinct pre-60S particles that contain the same pre-rRNA intermediates and that differ only by the presence or absence of specific proteins. Physical and functional interactions between Rlp24 and Nog1 revealed that the assembly steps are, at least in part, mediated by direct protein-protein interactions.
Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús
2016-09-19
The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Tereshchenkov, A G; Shishkina, A V; Karpenko, V V; Chertkov, V A; Konevega, A L; Kasatsky, P S; Bogdanov, A A; Sumbatyan, N V
2016-10-01
Novel fluorescent derivatives of macrolide antibiotics related to tylosin bearing rhodamine, fluorescein, Alexa Fluor 488, BODIPY FL, and nitrobenzoxadiazole (NBD) residues were synthesized. The formation of complexes of these compounds with 70S E. coli ribosomes was studied by measuring the fluorescence polarization depending on the ribosome amount at constant concentration of the fluorescent substance. With the synthesized fluorescent tylosin derivatives, the dissociation constants for ribosome complexes with several known antibiotics and macrolide analogs previously obtained were determined. It was found that the fluorescent tylosin derivatives containing BODIPY FL and NBD groups could be used to screen the binding of novel antibiotics to bacterial ribosomes in the macrolide-binding site.
25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications
NASA Technical Reports Server (NTRS)
Baharaeen, S.; Vishniac, H. S.
1984-01-01
Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.
The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress
Sloan, Katherine E.; Bohnsack, Markus T.; Watkins, Nicholas J.
2013-01-01
Summary Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. PMID:24120868
Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco
2014-12-18
Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Garzia, Aitor; Jafarnejad, Seyed Mehdi; Meyer, Cindy; Chapat, Clément; Gogakos, Tasos; Morozov, Pavel; Amiri, Mehdi; Shapiro, Maayan; Molina, Henrik; Tuschl, Thomas; Sonenberg, Nahum
2017-01-01
Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs and their mechanism of action remain unknown. We studied the Zinc Finger Protein 598 (ZNF598) using PAR-CLIP and revealed that it cross-links to tRNAs, mRNAs and rRNAs, thereby placing the protein on translating ribosomes. Cross-linked reads originating from AAA-decoding tRNALys(UUU) were 10-fold enriched over its cellular abundance, and poly-lysine encoded by poly(AAA) induced RQC in a ZNF598-dependent manner. Encounter with translated polyA segments by ZNF598 triggered ubiquitination of several ribosomal proteins, requiring the E2 ubiquitin ligase UBE2D3 to initiate RQC. Considering that human CDS are devoid of >4 consecutive AAA codons, sensing of prematurely placed polyA tails by a specialized RNA-binding protein is a novel nucleic-acid-based surveillance mechanism of RQC. PMID:28685749
Garzia, Aitor; Jafarnejad, Seyed Mehdi; Meyer, Cindy; Chapat, Clément; Gogakos, Tasos; Morozov, Pavel; Amiri, Mehdi; Shapiro, Maayan; Molina, Henrik; Tuschl, Thomas; Sonenberg, Nahum
2017-07-07
Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs and their mechanism of action remain unknown. We studied the Zinc Finger Protein 598 (ZNF598) using PAR-CLIP and revealed that it cross-links to tRNAs, mRNAs and rRNAs, thereby placing the protein on translating ribosomes. Cross-linked reads originating from AAA-decoding tRNA Lys (UUU) were 10-fold enriched over its cellular abundance, and poly-lysine encoded by poly(AAA) induced RQC in a ZNF598-dependent manner. Encounter with translated polyA segments by ZNF598 triggered ubiquitination of several ribosomal proteins, requiring the E2 ubiquitin ligase UBE2D3 to initiate RQC. Considering that human CDS are devoid of >4 consecutive AAA codons, sensing of prematurely placed polyA tails by a specialized RNA-binding protein is a novel nucleic-acid-based surveillance mechanism of RQC.
The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.
Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J
2013-10-17
Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Complete kinetic mechanism for recycling of the bacterial ribosome
Borg, Anneli; Pavlov, Michael
2016-01-01
How EF-G and RRF act together to split a post-termination ribosomal complex into its subunits has remained obscure. Here, using stopped-flow experiments with Rayleigh light scattering detection and quench-flow experiments with radio-detection of GTP hydrolysis, we have clarified the kinetic mechanism of ribosome recycling and obtained precise estimates of its kinetic parameters. Ribosome splitting requires that EF-G binds to an already RRF-containing ribosome. EF-G binding to RRF-free ribosomes induces futile rounds of GTP hydrolysis and inhibits ribosome splitting, implying that while RRF is purely an activator of recycling, EF-G acts as both activator and competitive inhibitor of RRF in recycling of the post-termination ribosome. The ribosome splitting rate and the number of GTPs consumed per splitting event depend strongly on the free concentrations of EF-G and RRF. The maximal recycling rate, here estimated as 25 sec−1, is approached at very high concentrations of EF-G and RRF with RRF in high excess over EF-G. The present in vitro results, suggesting an in vivo ribosome recycling rate of ∼5 sec−1, are discussed in the perspective of rapidly growing bacterial cells. PMID:26527791
Cryo-EM structure of a late pre-40S ribosomal subunit from Saccharomyces cerevisiae
Schmidt, Christian; Berninghausen, Otto; Becker, Thomas
2017-01-01
Mechanistic understanding of eukaryotic ribosome formation requires a detailed structural knowledge of the numerous assembly intermediates, generated along a complex pathway. Here, we present the structure of a late pre-40S particle at 3.6 Å resolution, revealing in molecular detail how assembly factors regulate the timely folding of pre-18S rRNA. The structure shows that, rather than sterically blocking 40S translational active sites, the associated assembly factors Tsr1, Enp1, Rio2 and Pno1 collectively preclude their final maturation, thereby preventing untimely tRNA and mRNA binding and error prone translation. Moreover, the structure explains how Pno1 coordinates the 3’end cleavage of the 18S rRNA by Nob1 and how the late factor’s removal in the cytoplasm ensures the structural integrity of the maturing 40S subunit. PMID:29155690
The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site
Pillet, Benjamin; García-Gómez, Juan J.; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter
2015-01-01
Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S
Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude
2004-05-01
The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.
The fluctuating ribosome: thermal molecular dynamics characterized by neutron scattering
NASA Astrophysics Data System (ADS)
Zaccai, Giuseppe; Natali, Francesca; Peters, Judith; Řihová, Martina; Zimmerman, Ella; Ollivier, J.; Combet, J.; Maurel, Marie-Christine; Bashan, Anat; Yonath, Ada
2016-11-01
Conformational changes associated with ribosome function have been identified by X-ray crystallography and cryo-electron microscopy. These methods, however, inform poorly on timescales. Neutron scattering is well adapted for direct measurements of thermal molecular dynamics, the ‘lubricant’ for the conformational fluctuations required for biological activity. The method was applied to compare water dynamics and conformational fluctuations in the 30 S and 50 S ribosomal subunits from Haloarcula marismortui, under high salt, stable conditions. Similar free and hydration water diffusion parameters are found for both subunits. With respect to the 50 S subunit, the 30 S is characterized by a softer force constant and larger mean square displacements (MSD), which would facilitate conformational adjustments required for messenger and transfer RNA binding. It has been shown previously that systems from mesophiles and extremophiles are adapted to have similar MSD under their respective physiological conditions. This suggests that the results presented are not specific to halophiles in high salt but a general property of ribosome dynamics under corresponding, active conditions. The current study opens new perspectives for neutron scattering characterization of component functional molecular dynamics within the ribosome.
Huang, Shijie; Zhu, Xuechen; Melançon, Charles E
2016-01-15
The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.
Use of 16S Ribosomal RNA Sequences to Infer Relationships among Archaebacteria.
1987-04-16
the rRNAs of one or both other kingdoms , and among the archaebacteria there are also substantial variations) (1), echinoderms (5, 11), major...Security Classification) Ln Use of 16S Ribosomal RNA Sequences to infer Relationships among Archaebacteria : Annual Report (U) q 12 PERSONAL AUTHOR(S...FIELD GROUP SUB-GROUP Archaebacteria ; Eubacteria; Eukaryotes; 16S Ribosomal RNA; 08 I Phylogeny; rRNA; RNA Sequencing; Molecular Clock; Urkingdoms; r
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-07-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-01-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998
Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J.; Ehresmann, Chantal; Portier, Claude
2015-01-01
Summary The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G•U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO–lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G•U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15–rpsO mRNA interactions can also be found, probably with A(−46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited. PMID:15101974
Figueiredo, Vandré C; Roberts, Llion A; Markworth, James F; Barnett, Matthew P G; Coombes, Jeff S; Raastad, Truls; Peake, Jonathan M; Cameron-Smith, David
2016-02-01
Muscle hypertrophy occurs following increased protein synthesis, which requires activation of the ribosomal complex. Additionally, increased translational capacity via elevated ribosomal RNA (rRNA) synthesis has also been implicated in resistance training-induced skeletal muscle hypertrophy. The time course of ribosome biogenesis following resistance exercise (RE) and the impact exerted by differing recovery strategies remains unknown. In the present study, the activation of transcriptional regulators, the expression levels of pre-rRNA, and mature rRNA components were measured through 48 h after a single-bout RE. In addition, the effects of either low-intensity cycling (active recovery, ACT) or a cold-water immersion (CWI) recovery strategy were compared. Nine male subjects performed two bouts of high-load RE randomized to be followed by 10 min of either ACT or CWI. Muscle biopsies were collected before RE and at 2, 24, and 48 h after RE. RE increased the phosphorylation of the p38-MNK1-eIF4E axis, an effect only evident with ACT recovery. Downstream, cyclin D1 protein, total eIF4E, upstream binding factor 1 (UBF1), and c-Myc proteins were all increased only after RE with ACT. This corresponded with elevated abundance of the pre-rRNAs (45S, ITS-28S, ITS-5.8S, and ETS-18S) from 24 h after RE with ACT. In conclusion, coordinated upstream signaling and activation of transcriptional factors stimulated pre-rRNA expression after RE. CWI, as a recovery strategy, markedly blunted these events, suggesting that suppressed ribosome biogenesis may be one factor contributing to the impaired hypertrophic response observed when CWI is used regularly after exercise. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Revisiting the structures of several antibiotics bound to the bacterial ribosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bulkley, David; Innis, C. Axel; Blaha, Gregor
2010-10-08
The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model.more » Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.« less
Revisiting the Structures of Several Antibiotics Bound to the Bacterial Ribosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
D Bulkley; C Innis; G Blaha
2011-12-31
The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model.more » Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.« less
Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F.; Martin, William F.
2013-01-01
Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force. PMID:24259312
Ribosome Biogenesis in the Yeast Saccharomyces cerevisiae
Woolford, John L.; Baserga, Susan J.
2013-01-01
Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922
Feldman, Sanford H; Ntenda, Abraham M
2011-01-01
We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574
Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel
2003-08-01
Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.
Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio
2016-01-01
In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. PMID:27016735
On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.
Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T
2009-10-09
The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its
Johnson, W
1972-06-01
The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein.
Kalusa, Andrew; Cano, Celine; Travers, Jon; Boxall, Kathy; Chow, Chiau Ling; Burns, Sam; Schmitt, Jessica; Pickard, Lisa; Barillari, Caterina; McAndrew, P. Craig; Clarke, Paul A.; Linardopoulos, Spiros; Griffin, Roger J.; Aherne, G. Wynne; Raynaud, Florence I.; Workman, Paul; Jones, Keith; van Montfort, Rob L.M.
2013-01-01
The ribosomal P70 S6 kinases play a crucial role in PI3K/mTOR regulated signalling pathways and are therefore potential targets for the treatment of a variety of diseases including diabetes and cancer. In this study we describe the identification of three series of chemically distinct S6K1 inhibitors. In addition, we report a novel PKA-S6K1 chimeric protein with five mutations in or near its ATP-binding site, which was used to determine the binding mode of two of the three inhibitor series, and provided a robust system to aid the optimisation of the oxadiazole-substituted benzimidazole inhibitor series. We show that the resulting oxadiazole-substituted aza-benzimidazole is a potent and ligand efficient S6 kinase inhibitor, which blocks the phosphorylation of RPS6 at Ser235/236 in TSC negative HCV29 human bladder cancer cells by inhibiting S6 kinase activity and thus provides a useful tool compound to investigate the function of S6 kinases. PMID:24072592
Na, Dokyun; Lee, Doheon
2010-10-15
RBSDesigner predicts the translation efficiency of existing mRNA sequences and designs synthetic ribosome binding sites (RBSs) for a given coding sequence (CDS) to yield a desired level of protein expression. The program implements the mathematical model for translation initiation described in Na et al. (Mathematical modeling of translation initiation for the estimation of its efficiency to computationally design mRNA sequences with a desired expression level in prokaryotes. BMC Syst. Biol., 4, 71). The program additionally incorporates the effect on translation efficiency of the spacer length between a Shine-Dalgarno (SD) sequence and an AUG codon, which is crucial for the incorporation of fMet-tRNA into the ribosome. RBSDesigner provides a graphical user interface (GUI) for the convenient design of synthetic RBSs. RBSDesigner is written in Python and Microsoft Visual Basic 6.0 and is publicly available as precompiled stand-alone software on the web (http://rbs.kaist.ac.kr). dhlee@kaist.ac.kr
Koloteva-Levine, Nadejda; Pinchasi, Dalia; Pereman, Idan; Zur, Amit; Brandeis, Michael; Elroy-Stein, Orna
2004-01-01
The anaphase-promoting complex/cyclosome (APC/C) is a multisubunit ubiquitin ligase that mediates the proteolysis of cell cycle proteins in mitosis and G1. We used a yeast three-hybrid screen to identify proteins that interact with the internal ribosome entry site (IRES) of platelet-derived growth factor 2 mRNA. Surprisingly, this screen identified Apc5, although it does not harbor a classical RNA binding domain. We found that Apc5 binds the poly(A) binding protein (PABP), which directly binds the IRES element. PABP was found to enhance IRES-mediated translation, whereas Apc5 overexpression counteracted this effect. In addition to its association with the APC/C complex, Apc5 binds much heavier complexes and cosediments with the ribosomal fraction. In contrast to Apc3, which is associated only with the APC/C and remains intact during differentiation, Apc5 is degraded upon megakaryocytic differentiation in correlation with IRES activation. Expression of Apc5 in differentiated cells abolished IRES activation. This is the first report implying an additional role for an APC/C subunit, apart from its being part of the APC/C complex. PMID:15082755
Integrin binding and mechanical tension induce movement of mRNA and ribosomes to focal adhesions
NASA Technical Reports Server (NTRS)
Chicurel, M. E.; Singer, R. H.; Meyer, C. J.; Ingber, D. E.
1998-01-01
The extracellular matrix (ECM) activates signalling pathways that control cell behaviour by binding to cell-surface integrin receptors and inducing the formation of focal adhesion complexes (FACs). In addition to clustered integrins, FACs contain proteins that mechanically couple the integrins to the cytoskeleton and to immobilized signal-transducing molecules. Cell adhesion to the ECM also induces a rapid increase in the translation of preexisting messenger RNAs. Gene expression can be controlled locally by targeting mRNAs to specialized cytoskeletal domains. Here we investigate whether cell binding to the ECM promotes formation of a cytoskeletal microcompartment specialized for translational control at the site of integrin binding. High-resolution in situ hybridization revealed that mRNA and ribosomes rapidly and specifically localized to FACs that form when cells bind to ECM-coated microbeads. Relocation of these protein synthesis components to the FAC depended on the ability of integrins to mechanically couple the ECM to the contractile cytoskeleton and on associated tension-moulding of the actin lattice. Our results suggest a new type of gene regulation by integrins and by mechanical stress which may involve translation of mRNAs into proteins near the sites of signal reception.
Johnson, William
1972-01-01
The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein. Images PMID:4564407
Molecular mechanics of 30S subunit head rotation.
Mohan, Srividya; Donohue, John Paul; Noller, Harry F
2014-09-16
During ribosomal translocation, a process central to the elongation phase of protein synthesis, movement of mRNA and tRNAs requires large-scale rotation of the head domain of the small (30S) subunit of the ribosome. It has generally been accepted that the head rotates by pivoting around the neck helix (h28) of 16S rRNA, its sole covalent connection to the body domain. Surprisingly, we observe that the calculated axis of rotation does not coincide with the neck. Instead, comparative structure analysis across 55 ribosome structures shows that 30S head movement results from flexing at two hinge points lying within conserved elements of 16S rRNA. Hinge 1, although located within the neck, moves by straightening of the kinked helix h28 at the point of contact with the mRNA. Hinge 2 lies within a three-way helix junction that extends to the body through a second, noncovalent connection; its movement results from flexing between helices h34 and h35 in a plane orthogonal to the movement of hinge 1. Concerted movement at these two hinges accounts for the observed magnitudes of head rotation. Our findings also explain the mode of action of spectinomycin, an antibiotic that blocks translocation by binding to hinge 2.
Molecular mechanics of 30S subunit head rotation
Mohan, Srividya; Donohue, John Paul; Noller, Harry F.
2014-01-01
During ribosomal translocation, a process central to the elongation phase of protein synthesis, movement of mRNA and tRNAs requires large-scale rotation of the head domain of the small (30S) subunit of the ribosome. It has generally been accepted that the head rotates by pivoting around the neck helix (h28) of 16S rRNA, its sole covalent connection to the body domain. Surprisingly, we observe that the calculated axis of rotation does not coincide with the neck. Instead, comparative structure analysis across 55 ribosome structures shows that 30S head movement results from flexing at two hinge points lying within conserved elements of 16S rRNA. Hinge 1, although located within the neck, moves by straightening of the kinked helix h28 at the point of contact with the mRNA. Hinge 2 lies within a three-way helix junction that extends to the body through a second, noncovalent connection; its movement results from flexing between helices h34 and h35 in a plane orthogonal to the movement of hinge 1. Concerted movement at these two hinges accounts for the observed magnitudes of head rotation. Our findings also explain the mode of action of spectinomycin, an antibiotic that blocks translocation by binding to hinge 2. PMID:25187561
Eukaryotic ribosome display with in situ DNA recovery.
He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J
2012-01-01
Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Jie; Lancaster, Laura; Trakhanov, Sergei
2012-03-26
The class II release factor RF3 is a GTPase related to elongation factor EF-G, which catalyzes release of class I release factors RF1 and RF2 from the ribosome after termination of protein synthesis. The 3.3 {angstrom} crystal structure of the RF3 {center_dot} GDPNP {center_dot} ribosome complex provides a high-resolution description of interactions and structural rearrangements that occur when binding of this translational GTPase induces large-scale rotational movements in the ribosome. RF3 induces a 7{sup o} rotation of the body and 14{sup o} rotation of the head of the 30S ribosomal subunit, and itself undergoes inter- and intradomain conformational rearrangements. Wemore » suggest that ordering of critical elements of switch loop I and the P loop, which help to form the GTPase catalytic site, are caused by interactions between the G domain of RF3 and the sarcin-ricin loop of 23S rRNA. The rotational movements in the ribosome induced by RF3, and its distinctly different binding orientation to the sarcin-ricin loop of 23S rRNA, raise interesting implications for the mechanism of action of EF-G in translocation.« less
Energetics of codon-anticodon recognition on the small ribosomal subunit.
Almlöf, Martin; Andér, Martin; Aqvist, Johan
2007-01-09
Recent crystal structures of the small ribosomal subunit have made it possible to examine the detailed energetics of codon recognition on the ribosome by computational methods. The binding of cognate and near-cognate anticodon stem loops to the ribosome decoding center, with mRNA containing the Phe UUU and UUC codons, are analyzed here using explicit solvent molecular dynamics simulations together with the linear interaction energy (LIE) method. The calculated binding free energies are in excellent agreement with experimental binding constants and reproduce the relative effects of mismatches in the first and second codon position versus a mismatch at the wobble position. The simulations further predict that the Leu2 anticodon stem loop is about 10 times more stable than the Ser stem loop in complex with the Phe UUU codon. It is also found that the ribosome significantly enhances the intrinsic stability differences of codon-anticodon complexes in aqueous solution. Structural analysis of the simulations confirms the previously suggested importance of the universally conserved nucleotides A1492, A1493, and G530 in the decoding process.
Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals
Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...
2015-04-30
In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less
Graf, Michael; Arenz, Stefan; Huter, Paul; Dönhöfer, Alexandra; Nováček, Jiří
2017-01-01
Abstract Ribosomes are the protein synthesizing machines of the cell. Recent advances in cryo-EM have led to the determination of structures from a variety of species, including bacterial 70S and eukaryotic 80S ribosomes as well as mitoribosomes from eukaryotic mitochondria, however, to date high resolution structures of plastid 70S ribosomes have been lacking. Here we present a cryo-EM structure of the spinach chloroplast 70S ribosome, with an average resolution of 5.4 Å for the small 30S subunit and 3.6 Å for the large 50S ribosomal subunit. The structure reveals the location of the plastid-specific ribosomal proteins (RPs) PSRP1, PSRP4, PSRP5 and PSRP6 as well as the numerous plastid-specific extensions of the RPs. We discover many features by which the plastid-specific extensions stabilize the ribosome via establishing additional interactions with surrounding ribosomal RNA and RPs. Moreover, we identify a large conglomerate of plastid-specific protein mass adjacent to the tunnel exit site that could facilitate interaction of the chloroplast ribosome with the thylakoid membrane and the protein-targeting machinery. Comparing the Escherichia coli 70S ribosome with that of the spinach chloroplast ribosome provides detailed insight into the co-evolution of RP and rRNA. PMID:27986857
Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.
2014-01-01
All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383
Ghosal, Anubrata; Babu, Vignesh M P; Walker, Graham C
2018-06-18
YbeY is a highly conserved, multifunctional endoribonuclease that plays a significant role in ribosome biogenesis and has several additional roles. Here, we show in Escherichia coli that overexpressing the conserved GTPase, Era, partially suppresses the growth defect of a ΔybeY strain while improving 16S rRNA processing and 70S ribosome assembly. This suppression requires both Era's ability to hydrolyze GTP and the function of three exoribonucleases, RNase II, RNase R and RNase PH, suggesting a model for Era's action. Overexpressing Vibrio cholerae Era similarly partially suppresses the defects of an E. coli ΔybeY strain indicating this property of Era is conserved in bacteria other than E. coli Importance This work provides additional insights into the critical, but still incompletely understood, mechanism of the processing of the E. coli 16S rRNA 3'-terminus. The highly conserved GTPase, Era, is known to bind to the precursor of the 16S rRNA near its 3-end. Both the endoribonuclease YbeY, which binds to Era, and four exoribonucleases have been implicated in this 3'-end processing. Results reported here offer additional insights into the role of Era in 16S rRNA 3'-maturation and into the relationship between the action of the endoribonuclease YbeY and the four exoribonucleases. This study also hints at why YbeY is only essential in some bacteria and suggests that the YbeY could be a target for a new class of antibiotic in these bacteria. Copyright © 2018 American Society for Microbiology.
Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387
Puchta, Olga; Lubas, Michal; Lipinski, Kamil A; Piatkowski, Jakub; Malecki, Michal; Golik, Pawel
2010-04-01
Pentatricopeptide repeat (PPR) proteins form the largest known RNA-binding protein family and are found in all eukaryotes, being particularly abundant in higher plants. PPR proteins localize mostly in mitochondria and chloroplasts, where they modulate organellar genome expression on the post-transcriptional level. The Saccharomyces cerevisiae DMR1 (CCM1, YGR150C) encodes a PPR protein that localizes to mitochondria. Deletion of DMR1 results in a complete and irreversible loss of respiratory capacity and loss of wild-type mtDNA by conversion to rho(-)/rho(0) petites, regardless of the presence of introns in mtDNA. The phenotype of the dmr1Delta mitochondria is characterized by fragmentation of the small subunit mitochondrial rRNA (15S rRNA), that can be reversed by wild-type Dmr1p. Other mitochondrial transcripts, including the large subunit mitochondrial rRNA (21S rRNA), are not affected by the lack of Dmr1p. The purified Dmr1 protein specifically binds to different regions of 15S rRNA in vitro, consistent with the deletion phenotype. Dmr1p is therefore the first yeast PPR protein, which has an rRNA target and is probably involved in the biogenesis of mitochondrial ribosomes and translation.
Translational autocontrol of the Escherichia coli ribosomal protein S15.
Portier, C; Dondon, L; Grunberg-Manago, M
1990-01-20
When rpsO, the gene encoding the ribosomal protein S15 in Escherichia coli, is carried by a multicopy plasmid, the mRNA synthesis rate of S15 increases with the gene dosage but the rate of synthesis of S15 does not rise. A translational fusion between S15 and beta-galactosidase was introduced on the chromosome in a delta lac strain and the expression of beta-galactosidase studied under different conditions. The presence of S15 in trans represses the beta-galactosidase level five- to sixfold, while the synthesis rate of the S15-beta-galactosidase mRNA decreases by only 30 to 50%. These data indicate that S15 is subject to autogenous translational control. Derepressed mutants were isolated and sequenced. All the point mutations map in the second codon of S15, suggesting a location for the operator site that is very near to the translation initiation codon. However, the creation of deletion mutations shows that the operator extends into the 5' non-coding part of the message, thus overlapping the ribosome loading site.
RNA binding protein Lin28B confers gastric cancer cells stemness via directly binding to NRP-1.
Wang, Xiaocong; Hu, Huihua; Liu, Hebo
2018-05-19
This work aims to explore the roles and related mechanisms of RNA binding protein Lin28B in gastric cancer cells stemness. We found that Lin28B expression was negatively correlated with the overall survival (OS) of gastric cancer patients, and significantly increased in gastric cancer cells compared with that in gastric epithelial cells. Lin28B overexpression increased spheroid formation, expression of gastric cancer stemness-related markers, and decreased cisplatin sensitivity in gastric cancer cells. Mechanistically, Lin28B could directly bind to NRP-1 3'UTR, thus increasing NRP-1 mRNA stability and expression, and activate the downstream Wnt/β-catenin signaling. Knockdown of NRP-1 or treatment with Wnt/β-catenin antagonist could rescue the promotive effects of Lin28B on gastric cancer stemness. Thus, thes results indicate that Lin28B could facilitate gastric cancer stemness via directly binding to NRP-1 3'UTR and activating the downstream Wnt/β-catenin signaling. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Research on ribosome-inactivating proteins from angiospermae to gymnospermae and cryptogamia
Liu, Wang-Yi
2017-01-01
Ribosome-inactivating Proteins (RIPs) are a group of cytotoxin proteins that usually contain a RNA N-glycosidase domain, which irreversibly inactivates ribosome, thus inhibiting protein synthesis. During the past 14 years (1990-2004), the studies conducted in our laboratory had been focusing on the structure and enzymatic mechanism of several PIPs. Herein, we briefly described a summary of the studies conducted mainly in our laboratory on RIPs from angiospermae to gymnospermae and cryptogamia as follows. (1) Cinnamomin is a novel type II RIP isolated from mature seeds of camphor tree. Like ricin, it specifically removes the adenine at A4324 in rat liver 28S rRNA. We systematically studied this low-toxic RIP in term of its enzymatic mechanism, the primary and crystal structure and the nucleotide sequence of its gene, the genetic expression, and its physiological role in the seed cell and the toxicity to human cancer cells and insect larvae. The cleavage of supercoiled double-stranded DNA was its intrinsic property of cinnamomin A-chain, its N- and C-terminal regions were found to be required for deadenylation of rRNA and also necessary for deadenylation of supercoiled double-stranded circular DNA. These results strongly excluded the possibility that cleavage of supercoiled DNA was due to nuclease contamination. (2) Trichosanthin, an abortifacient protein, was purified from the Chinese medicinal herb, Tian-hua-fen, obtained from root tubers of Chinese trichosanthes plant. We proved that trichosanthin was a RNA N-glycosidase, inactivating eukaryotic ribosome by hydrolyzing the N-C glycosidic bond of the adenose at site 4324 in rat 28S rRNA, and inhibited protein synthesis in vitro. (3) A unique Biota orientalis RNase (RNase Bo) was extracted from the mature seeds of the cypress cypress tree (Oriental arborvita), which was gymnospermae plant. It cleaved only a specific phosphodiester bond between C4453 and A4454 of 28S RNA in rat ribosomes, producing a small RNA
Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G
2011-05-01
The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.
Beati, Lorenza; Cáceres, Abraham G; Lee, Jamie A; Munstermann, Leonard E
2004-02-01
Lutzomyia spp. are New World phlebotomine sand flies, many of which are involved in the transmission of human diseases, such as leishmaniases and bartonellosis. The systematic classification of the approximately 400 species in the genus has been based on morphological characters, but the relationships within the genus are still very much in question. We have inferred phylogenies of 32 species of phlebotomine sand flies belonging to seven sub-genera and two species groups, by using fragments of the mitochondrial small subunit (12SrRNA) and of the nuclear large subunit (28SrRNA) ribosomal gene sequences. The subgenus Helcocyrtomyia and the Verrucarum species group, prominent representatives of the Peruvian sand fly fauna, were represented by 11 and 7 species, respectively. Although based on a limited number of taxa, the resulting phylogenies, based on 837 characters, provide an initial phylogenetic backbone for the progressive reconstruction of infrageneric relationships within Lutzomyia.
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Comparison of the structures of free and ribosome-bound tRNAPhe by using slow tritium exchange.
Farber, N; Cantor, C R
1980-01-01
The rate of incorporation of tritium from the solvent into the C-8 position of purines in RNA is markedly sensitive to the microenvironment. This slow tritium exchange reaction has been used to study the structure and interactions of yeast tRNAPhe bound to poly(U)-programed tight-couple 70S ribosomes of Escherichia coli. The tritium incorporation into specific sites of the tRNA was determined by enzymatic digestion and measurement of the specific activity of each of the isolated radioactive fragments. Ribosome binding leads to marked suppression in the exchange rate of a number of fragments. This delineates extensive regions of tRNA-ribosome contact. No change in exchange rates is seen for fragments from the corner of the molecule, indicating that this region of bound tRNA is readily accessible to the solvent. Ribosome binding results in an enhanced exchange rate at the T loop. This appears to be the result of a conformational change that is most likely an unfolding of the T and D loops. Additional tritium exchange reactions suggest this conformational change is induced by ribosomes and not by messenger. PMID:7001473
Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo
2015-01-01
Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442
The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis
Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert
2015-01-01
During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414
Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong
2016-12-06
Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.
Al-Hadid, Qais; White, Jonelle; Clarke, Steven
2016-02-12
A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.
Eyal, Zohar; Matzov, Donna; Krupkin, Miri; Wekselman, Itai; Paukner, Susanne; Zimmerman, Ella; Rozenberg, Haim; Bashan, Anat; Yonath, Ada
2015-01-01
The emergence of bacterial multidrug resistance to antibiotics threatens to cause regression to the preantibiotic era. Here we present the crystal structure of the large ribosomal subunit from Staphylococcus aureus, a versatile Gram-positive aggressive pathogen, and its complexes with the known antibiotics linezolid and telithromycin, as well as with a new, highly potent pleuromutilin derivative, BC-3205. These crystal structures shed light on specific structural motifs of the S. aureus ribosome and the binding modes of the aforementioned antibiotics. Moreover, by analyzing the ribosome structure and comparing it with those of nonpathogenic bacterial models, we identified some unique internal and peripheral structural motifs that may be potential candidates for improving known antibiotics and for use in the design of selective antibiotic drugs against S. aureus. PMID:26464510
Ribosomal proteins: functions beyond the ribosome.
Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua
2015-04-01
Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.
Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.
Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P
2010-08-01
Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.
RNA Mimicry by the Fap7 Adenylate Kinase in Ribosome Biogenesis
Réty, Stéphane; Lebaron, Simon; Deschamps, Patrick; Bareille, Joseph; Jombart, Julie; Robert-Paganin, Julien; Delbos, Lila; Chardon, Florian; Zhang, Elodie; Charenton, Clément; Tollervey, David; Leulliot, Nicolas
2014-01-01
During biogenesis of the 40S and 60S ribosomal subunits, the pre-40S particles are exported to the cytoplasm prior to final cleavage of the 20S pre-rRNA to mature 18S rRNA. Amongst the factors involved in this maturation step, Fap7 is unusual, as it both interacts with ribosomal protein Rps14 and harbors adenylate kinase activity, a function not usually associated with ribonucleoprotein assembly. Human hFap7 also regulates Cajal body assembly and cell cycle progression via the p53–MDM2 pathway. This work presents the functional and structural characterization of the Fap7–Rps14 complex. We report that Fap7 association blocks the RNA binding surface of Rps14 and, conversely, Rps14 binding inhibits adenylate kinase activity of Fap7. In addition, the affinity of Fap7 for Rps14 is higher with bound ADP, whereas ATP hydrolysis dissociates the complex. These results suggest that Fap7 chaperones Rps14 assembly into pre-40S particles via RNA mimicry in an ATP-dependent manner. Incorporation of Rps14 by Fap7 leads to a structural rearrangement of the platform domain necessary for the pre-rRNA to acquire a cleavage competent conformation. PMID:24823650
Hoy, Marshal S.; Rodriguez, Rusty J.
2013-01-01
Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.
Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs
NASA Technical Reports Server (NTRS)
Delihas, N.; Fox, G. E.
1987-01-01
In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.
Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution
NASA Astrophysics Data System (ADS)
Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad
2015-07-01
Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.
Abolhassani, Mohsen; Roux, Kenneth H
2009-06-01
Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.
Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.
Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B
1978-01-01
A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229
Dey, Sandip; Biswas, Chiranjit; Sengupta, Jayati
2018-06-21
The ribosome-associated GTPase HflX acts as an antiassociation factor upon binding to the 50S ribosomal subunit during heat stress in Escherichia coli Although HflX is recognized as a guanosine triphosphatase, several studies have shown that the N-terminal domain 1 of HflX is capable of hydrolyzing adenosine triphosphate (ATP), but the functional role of its adenosine triphosphatase (ATPase) activity remains unknown. We demonstrate that E. coli HflX possesses ATP-dependent RNA helicase activity and is capable of unwinding large subunit ribosomal RNA. A cryo-electron microscopy structure of the 50S-HflX complex in the presence of nonhydrolyzable analogues of ATP and guanosine triphosphate hints at a mode of action for the RNA helicase and suggests the linker helical domain may have a determinant role in RNA unwinding. Heat stress results in inactivation of the ribosome, and we show that HflX can restore heat-damaged ribosomes and improve cell survival. © 2018 Dey et al.
Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.
Prestle, J; Schönfelder, M; Adam, G; Mundry, K W
1992-01-01
Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614
Rqc2p and 60S ribosomal subunits mediate mRNA-independent elongation of nascent chains
Shen, Peter S.; Park, Joseph; Qin, Yidan; Li, Xueming; Parsawar, Krishna; Larson, Matthew H.; Cox, James; Cheng, Yifan; Lambowitz, Alan M.; Weissman, Jonathan S.; Brandman, Onn; Frost, Adam
2015-01-01
In Eukarya, stalled translation induces 40S dissociation and recruitment of the Ribosome Quality control Complex (RQC) to the 60S subunit, which mediates nascent chain degradation. Here, we report cryoEM structures revealing that the RQC components Rqc2p (YPL009C/Tae2) and Ltn1p (YMR247C/Rkr1) bind to the 60S at sites exposed after 40S dissociation, placing the Ltn1p RING domain near the exit channel and Rqc2p over the P-site tRNA. We further demonstrate that Rqc2p recruits alanine and threonine charged tRNA to the A-site and directs elongation of nascent chains independently of mRNA or 40S subunits. Our work uncovers an unexpected mechanism of protein synthesis in which a protein—not an mRNA—determines tRNA recruitment and the tagging of nascent chains with Carboxy-terminal Ala and Thr extensions (“CAT tails”). PMID:25554787
Topography of Escherichia coli ribosomal proteins. The order of reactivity of thiol groups*
Bakardjieva, Anastasia; Crichton, Robert R.
1974-01-01
1. 30S and 50S ribosomal subunits of Escherichia coli were treated with N-[2,3-14C]-ethylmaleimide and iodo[14C]acetamide. 2. The proteins in the native subunits which reacted with the reagents were S1,‡ S2, S12, S13, S18, S21, L2, L5, L6, L10, L11, L15, L17, L20, L26+28 and L27. 3. Several proteins, such as S1, S12, S14, S18, L2, L6, L10, L11 and either L26 or 28, had thiol groups in an oxidized form and reacted to a greater extent after reduction with β-mercaptoethanol or dithiothreitol. 4. The total number of thiol groups in 30S and 50S subunits was determined as 16–17 and 26–27 respectively. The total number of thiol groups in each ribosomal protein was also determined. 5. The reaction of 30S and 50S subunits with iodoacetamide under several different conditions established the order of reactivity of thiol groups. PMID:4618476
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.
Pulk, Arto; Maiväli, Ulo; Remme, Jaanus
2006-05-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association
Pulk, Arto; Maiväli, Ülo; Remme, Jaanus
2006-01-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933
A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death
McCall, Ingrid C.; Perrot, Véronique; Weiss, Howard; Ovesepian, Armen; Baquero, Fernando
2017-01-01
ABSTRACT We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn) operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE), is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures. PMID:28174311
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.
Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar
2011-11-01
Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Martínez, Fernando; Daròs, José-Antonio
2014-09-01
The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly
Spirin, Alexander S
2009-11-17
A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.
Regulation of the protein-conducting channel by a bound ribosome
Gumbart, James; Trabuco, Leonardo G.; Schreiner, Eduard; Villa, Elizabeth; Schulten, Klaus
2009-01-01
Summary During protein synthesis, it is often necessary for the ribosome to form a complex with a membrane-bound channel, the SecY/Sec61 complex, in order to translocate nascent proteins across a cellular membrane. Structural data on the ribosome-channel complex are currently limited to low-resolution cryo-electron microscopy maps, including one showing a bacterial ribosome bound to a monomeric SecY complex. Using that map along with available atomic-level models of the ribosome and SecY, we have determined, through molecular dynamics flexible fitting (MDFF), an atomic-resolution model of the ribosome-channel complex. We characterized computationally the sites of ribosome-SecY interaction within the complex and determined the effect of ribosome binding on the SecY channel. We also constructed a model of a ribosome in complex with a SecY dimer by adding a second copy of SecY to the MDFF-derived model. The study involved 2.7-million-atom simulations over altogether nearly 50 ns. PMID:19913480
Barnard, G F; Staniunas, R J; Mori, M; Puder, M; Jessup, M J; Steele, G D; Chen, L B
1993-09-01
The levels of a number of ribosomal protein mRNAs are reported to be increased in human colon cancer. We have assessed whether selected ribosomal protein mRNAs are overexpressed in other gastrointestinal malignancies, namely gastric and hepatocellular carcinomas. Subtracted complementary DNA libraries were generated from paired samples of human (a) colorectal carcinoma minus adjacent normal colonic mucosa and (b) hepatocellular carcinoma minus adjacent normal liver. Screening of approximately 3% of these library clones determined that ribosomal protein mRNAs encoding L18 and L37 (not previously reported) and P0 and S6 were overexpressed in one or the other library. Their complementary DNA inserts were then used as probes to evaluate their expression in a larger number of paired tumor/normal surgical samples of human colonic, gastric, and hepatocellular carcinomas, by Northern hybridization. The mRNA signal was greater in the colonic carcinoma than in paired adjacent normal colonic mucosa in 38 of 42 cases for P0 [tumor/normal (T/N) ratio = 3.0 +/- 0.3, mean +/- SE, P < 0.001] (G. F. Barnard, R. J. Staniunas, S. Bao, K. Mafune, J. L. Gollan, G. D. Steele, Jr., and L. B. Chen, Cancer Res., 52: 3067-3072, 1992), in 25 of 28 cases for L18 (T/N ratio = 3.7 +/- 0.5, P < 0.001), in 27 of 28 cases for L37 (T/N ratio = 5.3 +/- 0.4, P < 0.001), and in 24 of 28 cases for S6 (T/N ratio = 3.1 +/- 0.5, P < 0.01). The level of mRNA overexpression of L18 and S6 did not correlate with the Dukes' stage of disease. In hepatocellular carcinoma samples, using the same four ribosomal protein complementary DNA probes, only P0 mRNA was significantly increased (T/N ratio = 2.8 +/- 0.4, n = 6, P = 0.047). In gastric carcinoma samples, none of these mRNAs was increased (mean T/N ratios = 0.9-1.2, n = 6). Therefore, gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein mRNAs as do colonic carcinoma.
Xie, Qiang; Wang, Yanhui; Lin, Jinzhong; Qin, Yan; Wang, Ying; Bu, Wenjun
2012-01-01
In support of the hypothesis of the endosymbiotic origin of eukaryotes, much evidence has been found to support the idea that some organelles of eukaryotic cells originated from bacterial ancestors. Less attention has been paid to the identity of the host cell, although some biochemical and molecular genetic properties shared by archaea and eukaryotes have been documented. Through comparing 507 taxa of 16S-18S rDNA and 347 taxa of 23S-28S rDNA, we found that archaea and eukaryotes share twenty-six nucleotides signatures in ribosomal DNA. These signatures exist in all living eukaryotic organisms, whether protist, green plant, fungus, or animal. This evidence explicitly supports the archaeal origin of eukaryotes. In the ribosomal RNA, besides A2058 in Escherichia coli vs. G2400 in Saccharomyces cerevisiae, there still exist other twenties of sites, in which the bases are kingdom-specific. Some of these sites concentrate in the peptidyl transferase centre (PTC) of the 23S-28S rRNA. The results suggest potential key sites to explain the kingdom-specific spectra of drug resistance of ribosomes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jetzt, Amanda E.
Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarlymore » to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.« less
Zhang, Junxiang; Yuan, Hui; Yang, Yong; Fish, Tara; Lyi, Sangbom M.; Thannhauser, Theodore W; Zhang, Lugang; Li, Li
2016-01-01
Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development. Mutations in plastid ribosomal proteins lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood, and the functions of some individual plastid ribosomal proteins remain unknown. To identify genes responsible for chloroplast development, we isolated and characterized a mutant that exhibited pale yellow inner leaves with a reduced growth rate in Arabidopsis. The mutant (rps5) contained a missense mutation of plastid ribosomal protein S5 (RPS5), which caused a dramatically reduced abundance of chloroplast 16S rRNA and seriously impaired 16S rRNA processing to affect ribosome function and plastid translation. Comparative proteomic analysis revealed that the rps5 mutation suppressed the expression of a large number of core components involved in photosystems I and II as well as many plastid ribosomal proteins. Unexpectedly, a number of proteins associated with cold stress responses were greatly decreased in rps5, and overexpression of the plastid RPS5 improved plant cold stress tolerance. Our results indicate that RPS5 is an important constituent of the plastid 30S subunit and affects proteins involved in photosynthesis and cold stress responses to mediate plant growth and development. PMID:27006483
Concerted removal of the Erb1–Ytm1 complex in ribosome biogenesis relies on an elaborate interface
Thoms, Matthias; Ahmed, Yasar Luqman; Maddi, Karthik; Hurt, Ed; Sinning, Irmgard
2016-01-01
The complicated process of eukaryotic ribosome biogenesis involves about 200 assembly factors that transiently associate with the nascent pre-ribosome in a spatiotemporally ordered way. During the early steps of 60S subunit formation, several proteins, collectively called A3 cluster factors, participate in the removal of the internal transcribed spacer 1 (ITS1) from 27SA3 pre-rRNA. Among these factors is the conserved hetero-trimeric Nop7–Erb1–Ytm1 complex (or human Pes1–Bop1–Wdr12), which is removed from the evolving pre-60S particle by the AAA ATPase Rea1 to allow progression in the pathway. Here, we clarify how Ytm1 and Erb1 interact, which has implications for the release mechanism of both factors from the pre-ribosome. Biochemical studies show that Ytm1 and Erb1 bind each other via their ß-propeller domains. The crystal structure of the Erb1–Ytm1 heterodimer determined at 2.67Å resolution reveals an extended interaction surface between the propellers in a rarely observed binding mode. Structure-based mutations in the interface that impair the Erb1–Ytm1 interaction do not support growth, with specific defects in 60S subunit synthesis. Under these mutant conditions, it becomes clear that an intact Erb1–Ytm1 complex is required for 60S maturation and that loss of this stable interaction prevents ribosome production. PMID:26657628
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18
Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan
2011-01-01
5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
Guimond, A; Moss, T
1999-02-01
We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.
Thompson, R C; Dix, D B; Gerson, R B; Karim, A M
1981-01-10
The characteristics of a GTPase reaction between poly(U)-programmed ribosomes, EFTu . GTP, and the near-cognate aminoacyl (aa)-tRNA, Leu-tRNA Leu 2, have been studied to assess the role of this reaction in proofreading of the codon-anticodon interaction. The reaction resembles the GTPase reaction with cognate aa-tRNAs and EFTu . GTP in its substrate requirements, in its involving EFTu . GTP . aa-tRNA ternary complexes, and in its requiring a free ribosomal A-site. The noncognate reaction differs from the cognate one in that aa-tRNA becomes stably bound to the ribosomes only 5% of the time; it therefore seems best characterized as an abortive enzymatic binding reaction. The rate of reaction is a significant fraction (4%) of that of the cognate aa-tRNA, indicating that recognition of ternary complexes by ribosomes involves a level of error greater than that of translation as a whole. The rejection of the noncognate aa-tRNA following GTP hydrolysis is therefore a vital step in the translation process and fulfills the criteria set for a proofreading reaction. Leu-tRNA Leu 2 which escapes rejection through proofreading, forms a stable complex with the ribosomal A-site, so it appears that the Leu-tRNA2 which was rejected never reached the A-site and that proofreading precedes full A-site binding.
Zhao, Qin; Nagaswamy, Uma; Lee, Hunjoong; Xia, Youlin; Huang, Hung-Chung; Gao, Xiaolian; Fox, George E.
2005-01-01
Helix 42 of Domain II of Escherichia coli 23S ribosomal RNA underlies the L7/L12 stalk in the ribosome and may be significant in positioning this feature relative to the rest of the 50S ribosomal subunit. Unlike the Haloarcula marismortui and Deinococcus radiodurans examples, the lower portion of helix 42 in E.coli contains two consecutive G•A oppositions with both adenines on the same side of the stem. Herein, the structure of an analog of positions 1037–1043 and 1112–1118 in the helix 42 region is reported. NMR spectra and structure calculations support a cis Watson–Crick/Watson–Crick (cis W.C.) G•A conformation for the tandem (G•A)2 in the analog and a minimally perturbed helical duplex stem. Mg2+ titration studies imply that the cis W.C. geometry of the tandem (G•A)2 probably allows O6 of G20 and N1 of A4 to coordinate with a Mg2+ ion as indicated by the largest chemical shift changes associated with the imino group of G20 and the H8 of G20 and A4. A cross-strand bridging Mg2+ coordination has also been found in a different sequence context in the crystal structure of H.marismortui 23S rRNA, and therefore it may be a rare but general motif in Mg2+ coordination. PMID:15939932
Srikant, C B; Dahan, A; Craig, C
1990-02-04
The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2
Dalley, Jane A.; Selkirk, Alexander
2008-01-01
Targeting of proteins to the endoplasmic reticulum (ER) occurs cotranslationally necessitating the interaction of the signal recognition particle (SRP) and the translocon with the ribosome. Biochemical and structural studies implicate ribosomal protein Rpl25p as a major ribosome interaction site for both these factors. Here we characterize an RPL25GFP fusion, which behaves as a dominant mutant leading to defects in co- but not posttranslational translocation in vivo. In these cells, ribosomes still interact with ER membrane and the translocon, but are defective in binding SRP. Overexpression of SRP can restore ribosome binding of SRP, but only partially rescues growth and translocation defects. Our results indicate that Rpl25p plays a critical role in the recruitment of SRP to the ribosome. PMID:18448667
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu
2006-08-04
Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase,more » whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone.« less
Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).
Yonath, Ada
2010-06-14
High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics.
Modified nucleoside dependent Watson-Crick and wobble codon binding by tRNALysUUU species.
Yarian, C; Marszalek, M; Sochacka, E; Malkiewicz, A; Guenther, R; Miskiewicz, A; Agris, P F
2000-11-07
Nucleoside modifications are important to the structure of all tRNAs and are critical to the function of some tRNA species. The transcript of human tRNA(Lys3)(UUU) with a UUU anticodon, and the corresponding anticodon stem and loop domain (ASL(Lys3)(UUU)), are unable to bind to poly-A programmed ribosomes. To determine if specific anticodon domain modified nucleosides of tRNA(Lys) species would restore ribosomal binding and also affect thermal stability, we chemically synthesized ASL(Lys) heptadecamers and site-specifically incorporated the anticodon domain modified nucleosides pseudouridine (Psi(39)), 5-methylaminomethyluridine (mnm(5)U(34)) and N6-threonylcarbamoyl-adenosine (t(6)A(37)). Incorporation of t(6)A(37) and mnm(5)U(34) contributed structure to the anticodon loop, apparent by increases in DeltaS, and significantly enhanced the ability of ASL(Lys3)(UUU) to bind poly-A programmed ribosomes. Neither ASL(Lys3)(UUU)-t(6)A(37) nor ASL(Lys3)(UUU)-mnm(5)U(34) bound AAG programmed ribosomes. Only the presence of both t(6)A(37) and mnm(5)U(34) enabled ASL(Lys3)(UUU) to bind AAG programmed ribosomes, as well as increased its affinity for poly-A programmed ribosomes to the level of native Escherichia coli tRNA(Lys). The completely unmodified anticodon stem and loop of human tRNA(Lys1,2)(CUU) with a wobble position-34 C bound AAG, but did not wobble to AAA, even when the ASL was modified with t(6)A(37). The data suggest that tRNA(Lys)(UUU) species require anticodon domain modifications in the loop to impart an ordered structure to the anticodon for ribosomal binding to AAA and require a combination of modified nucleosides to bind AAG.
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Jetzt, Amanda E; Li, Xiao-Ping; Tumer, Nilgun E; Cohick, Wendie S
2016-11-01
Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. Copyright © 2016 Elsevier Inc. All rights reserved.
Kinetics and Mechanism of Mammalian Mitochondrial Ribosome Assembly.
Bogenhagen, Daniel F; Ostermeyer-Fay, Anne G; Haley, John D; Garcia-Diaz, Miguel
2018-02-13
Mammalian mtDNA encodes only 13 proteins, all essential components of respiratory complexes, synthesized by mitochondrial ribosomes. Mitoribosomes contain greatly truncated RNAs transcribed from mtDNA, including a structural tRNA in place of 5S RNA as a scaffold for binding 82 nucleus-encoded proteins, mitoribosomal proteins (MRPs). Cryoelectron microscopy (cryo-EM) studies have determined the structure of the mitoribosome, but its mechanism of assembly is unknown. Our SILAC pulse-labeling experiments determine the rates of mitochondrial import of MRPs and their assembly into intact mitoribosomes, providing a basis for distinguishing MRPs that bind at early and late stages in mitoribosome assembly to generate a working model for mitoribosome assembly. Mitoribosome assembly is a slow process initiated at the mtDNA nucleoid driven by excess synthesis of individual MRPs. MRPs that are tightly associated in the structure frequently join the complex in a coordinated manner. Clinically significant MRP mutations reported to date affect proteins that bind early on during assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Rust, Aleksander; Partridge, Lynda J.; Davletov, Bazbek
2017-01-01
Ribosome inactivating proteins (RIPs) form a class of toxins that was identified over a century ago. They continue to fascinate scientists and the public due to their very high activity and long-term stability which might find useful applications in the therapeutic killing of unwanted cells but can also be used in acts of terror. We will focus our review on the canonical plant-derived RIPs which display ribosomal RNA N-glycosidase activity and irreversibly inhibit protein synthesis by cleaving the 28S ribosomal RNA of the large 60S subunit of eukaryotic ribosomes. We will place particular emphasis on therapeutic applications and the generation of immunotoxins by coupling antibodies to RIPs in an attempt to target specific cells. Several generations of immunotoxins have been developed and we will review their optimisation as well as their use and limitations in pre-clinical and clinical trials. Finally, we endeavour to provide a perspective on potential future developments for the therapeutic use of immunotoxins. PMID:29076988
Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati
2016-01-01
In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964
Biogenesis of cytosolic ribosomes requires the essential iron–sulphur protein Rli1p and mitochondria
Kispal, Gyula; Sipos, Katalin; Lange, Heike; Fekete, Zsuzsanna; Bedekovics, Tibor; Janáky, Tamás; Bassler, Jochen; Aguilar Netz, Daili J; Balk, Janneke; Rotte, Carmen; Lill, Roland
2005-01-01
Mitochondria perform a central function in the biogenesis of cellular iron–sulphur (Fe/S) proteins. It is unknown to date why this biosynthetic pathway is indispensable for life, the more so as no essential mitochondrial Fe/S proteins are known. Here, we show that the soluble ATP-binding cassette (ABC) protein Rli1p carries N-terminal Fe/S clusters that require the mitochondrial and cytosolic Fe/S protein biogenesis machineries for assembly. Mutations in critical cysteine residues of Rli1p abolish association with Fe/S clusters and lead to loss of cell viability. Hence, the essential character of Fe/S clusters in Rli1p explains the indispensable character of mitochondria in eukaryotes. We further report that Rli1p is associated with ribosomes and with Hcr1p, a protein involved in rRNA processing and translation initiation. Depletion of Rli1p causes a nuclear export defect of the small and large ribosomal subunits and subsequently a translational arrest. Thus, ribosome biogenesis and function are intimately linked to the crucial role of mitochondria in the maturation of the essential Fe/S protein Rli1p. PMID:15660134
Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji
2015-03-03
The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Welle, Stephen; Burgess, Kerri; Mehta, Sangeeta
2009-03-01
Knocking out myostatin activity during development increases the rate of muscle protein synthesis. The present study was done to determine whether postdevelopmental loss of myostatin activity stimulates myofibrillar protein synthesis and the phosphorylation of some of the proteins involved in regulation of protein synthesis rate. Myostatin activity was inhibited for 4 days, in 4- to 5-mo-old male mice, with injections of an anti-myostatin antibody (JA16). The mean myofibrillar synthesis rate increased 19% (P < 0.01) relative to the mean rate in saline-treated mice, as determined by incorporation of deuterium-labeled phenylalanine. JA16 increased phosphorylation of p70 S6 kinase (S6K) and ribosomal protein S6 (rpS6) 1.9-fold (P < 0.05). It did not affect phosphorylation of eukaryotic initiation factor 4E-binding protein-1 or Akt. Microarrays and real-time PCR analyses indicated that JA16 administration did not selectively enrich levels of mRNAs encoding myofibrillar proteins, ribosomal proteins, or translation initiation and elongation factors. Rapamycin treatment did not affect the rate of myofibrillar protein synthesis whether or not the mice received JA16 injections, although it eliminated the phosphorylation of S6K and rpS6. We conclude that the normal level of myostatin activity in mature muscle is sufficient to inhibit myofibrillar synthesis rate and phosphorylation of S6K and rpS6. Reversal of the inhibition of myofibrillar synthesis with an anti-myostatin antibody is not dependent on mTOR activation.
Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance
NASA Astrophysics Data System (ADS)
Gregory, Steven T.
2018-03-01
Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-01
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591
Reductive alkylation of ribosomes as a probe to the topography of ribosomal proteins*
Moore, Graham; Crichton, Robert R.
1974-01-01
Escherichia coli ribosomes were treated with a number of different aldehydes of various sizes in the presence of NaBH4. After incorporation of either 3H or 14C, the ribosomal proteins were separated by two-dimensional polyacrylamide-gel electrophoresis and the extent of alkylation of the lysine residues in each protein was measured. The same pattern of alkylation was observed with the four reagents used, namely formaldehyde, acetone, benzaldehyde and 3,4,5-trimethoxybenzaldehyde. Every protein in 30S and 50S subunits was modified, although there was considerable variation in the degree of alkylation of individual proteins. A topographical classification of ribosomal proteins is presented, based on the degree of exposure of lysine residues. The data indicate that every protein of the ribosome has at least one lysine residue exposed at or near the surface of the ribonucleo-protein complex. PMID:4462744
Le, My-Tra; Kasprzak, Wojciech K; Kim, Taejin; Gao, Feng; Young, Megan YL; Yuan, Xuefeng; Shapiro, Bruce A; Seog, Joonil; Simon, Anne E
2017-01-01
Turnip crinkle virus contains a T-shaped, ribosome-binding, translation enhancer (TSS) in its 3’UTR that serves as a hub for interactions throughout the region. The viral RNA-dependent RNA polymerase (RdRp) causes the TSS/surrounding region to undergo a conformational shift postulated to inhibit translation. Using optical tweezers (OT) and steered molecular dynamic simulations (SMD), we found that the unusual stability of pseudoknotted element H4a/Ψ3 required five upstream adenylates, and H4a/Ψ3 was necessary for cooperative association of two other hairpins (H5/H4b) in Mg2+. SMD recapitulated the TSS unfolding order in the absence of Mg2+, showed dependence of the resistance to pulling on the 3D orientation and gave structural insights into the measured contour lengths of the TSS structure elements. Adenylate mutations eliminated one-site RdRp binding to the 3’UTR, suggesting that RdRp binding to the adenylates disrupts H4a/Ψ3, leading to loss of H5/H4b interaction and promoting a conformational switch interrupting translation and promoting replication. DOI: http://dx.doi.org/10.7554/eLife.22883.001 PMID:28186489
Ribonucleic Acid and Ribosomes of Bacillus stearothermophilus1
Saunders, Grady F.; Campbell, L. Leon
1966-01-01
Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332–339. 1966.—The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10−2m MgCl2–10−2m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg++ concentration to 10−3m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10−2m Mg++ to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a Tm at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a Tm of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. Images PMID:5903099
Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact
Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.
2014-01-01
The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300
High-resolution structure of the Escherichia coli ribosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.
Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less
High-resolution structure of the Escherichia coli ribosome
Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; ...
2015-03-16
Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less
Mulvey, Matthew; Poppers, Jeremy; Ladd, Alison; Mohr, Ian
1999-01-01
The herpes simplex virus type 1 γ34.5 gene product and the cellular GADD34 protein both contain similar domains that can regulate the activity of eukaryotic initiation factor 2 (eIF2), a critical translation initiation factor. Viral mutants that lack the GADD34-related function grow poorly on a variety of malignant human cells, as activation of the cellular PKR kinase leads to the accumulation of inactive, phosphorylated eIF2 at late times postinfection. Termination of translation prior to the completion of the viral reproductive cycle leads to impaired growth. Extragenic suppressors that regain the ability to synthesize proteins efficiently in the absence of the viral GADD34-related function have been isolated. These suppressor alleles are dominant in trans and affect the steady-state accumulation of several viral mRNA species. We demonstrate that deregulated expression of Us11, a virus-encoded RNA-binding, ribosome-associated protein is necessary and sufficient to confer a growth advantage upon viral mutants that lack a GADD34-related function. Ectopic expression of Us11 reduces the accumulation of the activated cellular PKR kinase and allows for sustained protein synthesis. Thus, an RNA-binding, ribosome-associated protein (Us11) and a GADD34-related protein (γ34.5) both function in a signal pathway that regulates translation by modulating eIF2 phosphorylation. PMID:10074192
Basu, Debaleena; Kahn, Jennifer N; Li, Xiao-Ping; Tumer, Nilgun E
2016-12-01
The A1 subunits of Shiga toxin 1 (Stx1A1) and Shiga toxin 2 (Stx2A1) interact with the conserved C termini of ribosomal-stalk P-proteins to remove a specific adenine from the sarcin/ricin loop. We previously showed that Stx2A1 has higher affinity for the ribosome and higher catalytic activity than Stx1A1. To determine if conserved arginines at the distal face of the active site contribute to the higher affinity of Stx2A1 for the ribosome, we mutated Arg172, Arg176, and Arg179 in both toxins. We show that Arg172 and Arg176 are more important than Arg179 for the depurination activity and toxicity of Stx1A1 and Stx2A1. Mutation of a single arginine reduced the depurination activity of Stx1A1 more than that of Stx2A1. In contrast, mutation of at least two arginines was necessary to reduce depurination by Stx2A1 to a level similar to that of Stx1A1. R176A and R172A/R176A mutations eliminated interaction of Stx1A1 and Stx2A1 with ribosomes and with the stalk, while mutation of Arg170 at the active site reduced the binding affinity of Stx1A1 and Stx2A1 for the ribosome, but not for the stalk. These results demonstrate that conserved arginines at the distal face of the active site are critical for interactions of Stx1A1 and Stx2A1 with the stalk, while a conserved arginine at the active site is critical for non-stalk-specific interactions with the ribosome. Arginine mutations at either site reduced ribosome interactions of Stx1A1 and Stx2A1 similarly, indicating that conserved arginines are critical for ribosome interactions but do not contribute to the higher affinity of Stx2A1 for the ribosome. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A.; Hanson, Johannes; Meyer, Christian
2016-01-01
Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5′ untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5′ terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase. PMID:27877176
Liberman, Joseph A.; Suddala, Krishna C.; Aytenfisu, Asaminew; ...
2015-06-23
PreQ 1-III riboswitches are newly identified RNA elements that control bacterial genes in response to preQ 1 (7-aminomethyl-7-deazaguanine), a precursor to the essential hypermodified tRNA base queuosine. Although numerous riboswitches fold as H-type or HL out-type pseudoknots that integrate ligand-binding and regulatory sequences within a single folded domain, the preQ 1-III riboswitch aptamer forms a HL out-type pseudoknot that does not appear to incorporate its ribosome-binding site (RBS). To understand how this unusual organization confers function, in this paper we determined the crystal structure of the class III preQ 1 riboswitch from Faecalibacterium prausnitzii at 2.75 Å resolution. PreQ 1more » binds tightly (K D,app 6.5 ± 0.5 nM) between helices P1 and P2 of a three-way helical junction wherein the third helix, P4, projects orthogonally from the ligand-binding pocket, exposing its stem-loop to base pair with the 3' RBS. Biochemical analysis, computational modeling, and single-molecule FRET imaging demonstrated that preQ 1 enhances P4 reorientation toward P1–P2, promoting a partially nested, H-type pseudoknot in which the RBS undergoes rapid docking (k dock ~0.6 s -1) and undocking (k undock ~1.1 s -1). Finally, discovery of such dynamic conformational switching provides insight into how a riboswitch with bipartite architecture uses dynamics to modulate expression platform accessibility, thus expanding the known repertoire of gene control strategies used by regulatory RNAs.« less
Park, Sang-Wook; Stevens, Noah M; Vivanco, Jorge M
2002-12-01
Ribosome-inactivating proteins (RIPs) are enzymes that cleave a specific adenine base from the highly conserved sarcin/ricin (S/R) loop of the large ribosomal RNA, thus arresting protein synthesis at the translocation step. In the present study, we employed three RIPs to dissect the antifungal activity of RIPs as plant defense proteins. We measured the catalytic activity of RAT (the catalytic A-chain of ricin from Ricinus communis L.), saporin-S6 (from Saponaria officinalis L.), and ME (RIP from Mirabilis expansa R&P) against intact ribosomal substrates isolated from various pathogenic fungi. We further determined the enzymatic specificity of these three RIPs against fungal ribosomes, from Rhizoctonia solani Kuhn, Alternaria solani Sorauer, Trichoderma reesei Simmons and Candida albicans Berkhout, and correlated the data with antifungal activity. RAT showed the strongest toxicity against all tested fungal ribosomes, except for the ribosomes isolated from C. albicans, which were most susceptible to saporin. RAT and saporin showed higher enzymatic activity than ME against ribosomes from all of the fungal species assayed, but did not show detectable antifungal activity. In contrast, ME showed substantial inhibitory activity against fungal growth. Using N-hydroxysuccinimide-fluorescein labeling of RIPs and fluorescence microscopy, we determined that ME was targeted to the surface of fungal cells and transferred into the cells. Thus, ME caused ribosome depurination and subsequent fungal mortality. In contrast, saporin did not interact with fungal cells, correlating with its lack of antifungal activity.
McCluskey, Andrew J.; Bolewska-Pedyczak, Eleonora; Jarvik, Nick; Chen, Gang; Sidhu, Sachdev S.; Gariépy, Jean
2012-01-01
Shiga-like toxins are ribosome-inactivating proteins (RIP) produced by pathogenic E. coli strains that are responsible for hemorrhagic colitis and hemolytic uremic syndrome. The catalytic A1 chain of Shiga-like toxin 1 (SLT-1), a representative RIP, first docks onto a conserved peptide SD[D/E]DMGFGLFD located at the C-terminus of all three eukaryotic ribosomal stalk proteins and halts protein synthesis through the depurination of an adenine base in the sarcin-ricin loop of 28S rRNA. Here, we report that the A1 chain of SLT-1 rapidly binds to and dissociates from the C-terminal peptide with a monomeric dissociation constant of 13 µM. An alanine scan performed on the conserved peptide revealed that the SLT-1 A1 chain interacts with the anionic tripeptide DDD and the hydrophobic tetrapeptide motif FGLF within its sequence. Based on these 2 peptide motifs, SLT-1 A1 variants were generated that displayed decreased affinities for the stalk protein C-terminus and also correlated with reduced ribosome-inactivating activities in relation to the wild-type A1 chain. The toxin-peptide interaction and subsequent toxicity were shown to be mediated by cationic and hydrophobic docking surfaces on the SLT-1 catalytic domain. These docking surfaces are located on the opposite face of the catalytic cleft and suggest that the docking of the A1 chain to SDDDMGFGLFD may reorient its catalytic domain to face its RNA substrate. More importantly, both the delineated A1 chain ribosomal docking surfaces and the ribosomal peptide itself represent a target and a scaffold, respectively, for the design of generic inhibitors to block the action of RIPs. PMID:22355345
Nuclear export of the small ribosomal subunit requires the Ran–GTPase cycle and certain nucleoporins
Moy, Terence I.; Silver, Pamela A.
1999-01-01
After their assembly in the nucleolus, ribosomal subunits are exported from the nucleus to the cytoplasm. After export, the 20S rRNA in the small ribosomal subunit is cleaved to yield 18S rRNA and the small 5′ ITS1 fragment. The 5′ ITS1 RNA is normally degraded by the cytoplasmic Xrn1 exonuclease, but in strains lacking XRN1, the 5′ ITS1 fragment accumulates in the cytoplasm. Using the cytoplasmic localization of the 5′ ITS1 fragment as an indicator for the export of the small ribosomal subunit, we have identified genes that are required for ribosome export. Ribosome export is dependent on the Ran–GTPase as mutations in Ran or its regulators caused 5′ ITS1 to accumulate in the nucleoplasm. Mutations in the genes encoding the nucleoporin Nup82 and in the NES exporter Xpo1/Crm1 also caused the nucleoplasmic accumulation of 5′ ITS1. Mutants in a subset of nucleoporins and in the nuclear transport factors Srp1, Kap95, Pse1, Cse1, and Mtr10 accumulate the 5′ ITS1 in the nucleolus and affect ribosome assembly. In contrast, we did not detect nuclear accumulation of 5′ ITS1 in 28 yeast strains that have mutations in other genes affecting nuclear trafficking. PMID:10465789
Brammer, Leighanne A; Bolduc, Benjamin; Kass, Jessica L; Felice, Kristin M; Noren, Christopher J; Hall, Marilena Fitzsimons
2008-02-01
Screening of the commercially available Ph.D.-7 phage-displayed heptapeptide library for peptides that bind immobilized Zn2+ resulted in the repeated selection of the peptide HAIYPRH, although binding assays indicated that HAIYPRH is not a zinc-binding peptide. HAIYPRH has also been selected in several other laboratories using completely different targets, and its ubiquity suggests that it is a target-unrelated peptide. We demonstrated that phage displaying HAIYPRH are enriched after serial amplification of the library without exposure to target. The amplification of phage displaying HAIYPRH was found to be dramatically faster than that of the library itself. DNA sequencing uncovered a mutation in the Shine-Dalgarno (SD) sequence for gIIp, a protein involved in phage replication, imparting to the SD sequence better complementarity to the 16S ribosomal RNA (rRNA). Introducing this mutation into phage lacking a displayed peptide resulted in accelerated propagation, whereas phage displaying HAIYPRH with a wild-type SD sequence were found to amplify normally. The SD mutation may alter gIIp expression and, consequently, the rate of propagation of phage. In the Ph.D.-7 library, the mutation is coincident with the displayed peptide HAIYPRH, accounting for the target-unrelated selection of this peptide in multiple reported panning experiments.
Molle, Thibaut; Moreau, Yohann; Clemancey, Martin; Forouhar, Farhad; Ravanat, Jean-Luc; Duraffourg, Nicolas; Fourmond, Vincent; Latour, Jean-Marc; Gambarelli, Serge; Mulliez, Etienne; Atta, Mohamed
2016-10-18
RimO, a radical-S-adenosylmethionine (SAM) enzyme, catalyzes the specific C 3 methylthiolation of the D89 residue in the ribosomal S 12 protein. Two intact iron-sulfur clusters and two SAM cofactors both are required for catalysis. By using electron paramagnetic resonance, Mössbauer spectroscopies, and site-directed mutagenesis, we show how two SAM molecules sequentially bind to the unique iron site of the radical-SAM cluster for two distinct chemical reactions in RimO. Our data establish that the two SAM molecules bind the radical-SAM cluster to the unique iron site, and spectroscopic evidence obtained under strongly reducing conditions supports a mechanism in which the first molecule of SAM causes the reoxidation of the reduced radical-SAM cluster, impeding reductive cleavage of SAM to occur and allowing SAM to methylate a HS - ligand bound to the additional cluster. Furthermore, by using density functional theory-based methods, we provide a description of the reaction mechanism that predicts the attack of the carbon radical substrate on the methylthio group attached to the additional [4Fe-4S] cluster.
Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth A.; Contreras, Nataly; Hertz, Marla I.; Olivares, Eduardo; Cáceres, C. Joaquín; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R.; López-Lastra, Marcelo
2016-01-01
The 5′leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work we examine the internal ribosome entry site (IRES) located in the 5′leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5′leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. PMID:27191820
Rig-I regulates NF-κB activity through binding to Nf-κb1 3′-UTR mRNA
Zhang, Hong-Xin; Liu, Zi-Xing; Sun, Yue-Ping; Lu, Shun-Yuan; Liu, Xue-Song; Huang, Qiu-Hua; Xie, Yin-Yin; Dang, Su-Ying; Zheng, Guang-Yong; Li, Yi-Xue; Kuang, Ying; Fei, Jian; Chen, Zhu; Wang, Zhu-Gang
2013-01-01
Retinoic acid inducible gene I (RIG-I) senses viral RNAs and triggers innate antiviral responses through induction of type I IFNs and inflammatory cytokines. However, whether RIG-I interacts with host cellular RNA remains undetermined. Here we report that Rig-I interacts with multiple cellular mRNAs, especially Nf-κb1. Rig-I is required for NF-κB activity via regulating Nf-κb1 expression at posttranscriptional levels. It interacts with the multiple binding sites within 3′-UTR of Nf-κb1 mRNA. Further analyses reveal that three distinct tandem motifs enriched in the 3′-UTR fragments can be recognized by Rig-I. The 3′-UTR binding with Rig-I plays a critical role in normal translation of Nf-κb1 by recruiting the ribosomal proteins [ribosomal protein L13 (Rpl13) and Rpl8] and rRNAs (18S and 28S). Down-regulation of Rig-I or Rpl13 significantly reduces Nf-κb1 and 3′-UTR–mediated luciferase expression levels. These findings indicate that Rig-I functions as a positive regulator for NF-κB signaling and is involved in multiple biological processes in addition to host antivirus immunity. PMID:23553835
Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans
Holdt, Lesca M.; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A.; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H.; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel
2016-01-01
Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542
Cloning and determination of the transcription termination site of ribosomal RNA gene of the mouse.
Kominami, R; Mishima, Y; Urano, Y; Sakai, M; Muramatsu, M
1982-01-01
A Eco RI 6.6 kb DNA fragment containing the 3'-end of 28S ribosomal RNA gene of the mouse was detected by Southern blot hybridization, and cloned in a lambda-phage vector. The site of transcription termination and the processed 3'-end of 28S RNA were determined on the cloned fragment and the surrounding nucleotide sequence determined. The 3'-terminal nucleotides of mouse 28S RNA are similar to those of yeast, Drosophila and Xenopus although the homology was lost drastically beyond the 3'-end of 28S RNA. 45S precursor RNA terminated at 30 nucleotides downstream from the 3'-end of 28S RNA gene. A structure of a dyad symmetry with a loop was found immediately prior to the termination site of 45S RNA. The rDNA termination site thus shares some common features with termination sites recognized by other RNA polymerases. Images PMID:6281727
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying
2013-11-15
Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletionmore » and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.« less
Becker, Matthias M. M.; Lapouge, Karine; Segnitz, Bernd; Wild, Klemens; Sinning, Irmgard
2017-01-01
Co-translational protein targeting and membrane protein insertion is a fundamental process and depends on the signal recognition particle (SRP). In mammals, SRP is composed of the SRP RNA crucial for SRP assembly and function and six proteins. The two largest proteins SRP68 and SRP72 form a heterodimer and bind to a regulatory site of the SRP RNA. Despite their essential roles in the SRP pathway, structural information has been available only for the SRP68 RNA-binding domain (RBD). Here we present the crystal structures of the SRP68 protein-binding domain (PBD) in complex with SRP72-PBD and of the SRP72-RBD bound to the SRP S domain (SRP RNA, SRP19 and SRP68) detailing all interactions of SRP72 within SRP. The SRP72-PBD is a tetratricopeptide repeat, which binds an extended linear motif of SRP68 with high affinity. The SRP72-RBD is a flexible peptide crawling along the 5e- and 5f-loops of SRP RNA. A conserved tryptophan inserts into the 5e-loop forming a novel type of RNA kink-turn stabilized by a potassium ion, which we define as K+-turn. In addition, SRP72-RBD remodels the 5f-loop involved in ribosome binding and visualizes SRP RNA plasticity. Docking of the S domain structure into cryo-electron microscopy density maps reveals multiple contact sites between SRP68/72 and the ribosome, and explains the role of SRP72 in the SRP pathway. PMID:27899666
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio
2016-04-15
We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.
Valdez, Benigno C; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J
2004-07-20
Treacher Collins syndrome (TCS) is an autosomal dominant disorder characterized by an abnormality of craniofacial development that arises during early embryogenesis. TCS is caused by mutations in the gene TCOF1, which encodes the nucleolar phosphoprotein treacle. Even though the genetic alterations causing TCS have been uncovered, the mechanism underlying its pathogenesis and the function of treacle remain unknown. Here, we show that treacle is involved in ribosomal DNA gene transcription by interacting with upstream binding factor (UBF). Immunofluorescence labeling shows treacle and UBF colocalize to specific nucleolar organizer regions and cosegregate within nucleolar caps of actinomycin d-treated HeLa cells. Biochemical analysis shows the association of treacle and UBF with chromatin. Immunoprecipitation and the yeast two-hybrid system both suggest physical interaction of the two nucleolar phosphoproteins. Down-regulation of treacle expression using specific short interfering RNA results in inhibition of ribosomal DNA transcription and cell growth. A similar correlation is observed in Tcof(+/-) mouse embryos that exhibit craniofacial defects and growth retardation. Thus, treacle haploinsufficiency in TCS patients might result in abnormal development caused by inadequate ribosomal RNA production in the prefusion neural folds during the early stages of embryogenesis. The elucidation of a physiological function of treacle provides important information of relevance to the molecular dissection of the biochemical pathology of TCS.
Valdez, Benigno C.; Henning, Dale; So, Rolando B.; Dixon, Jill; Dixon, Michael J.
2004-01-01
Treacher Collins syndrome (TCS) is an autosomal dominant disorder characterized by an abnormality of craniofacial development that arises during early embryogenesis. TCS is caused by mutations in the gene TCOF1, which encodes the nucleolar phosphoprotein treacle. Even though the genetic alterations causing TCS have been uncovered, the mechanism underlying its pathogenesis and the function of treacle remain unknown. Here, we show that treacle is involved in ribosomal DNA gene transcription by interacting with upstream binding factor (UBF). Immunofluorescence labeling shows treacle and UBF colocalize to specific nucleolar organizer regions and cosegregate within nucleolar caps of actinomycin d-treated HeLa cells. Biochemical analysis shows the association of treacle and UBF with chromatin. Immunoprecipitation and the yeast two-hybrid system both suggest physical interaction of the two nucleolar phosphoproteins. Down-regulation of treacle expression using specific short interfering RNA results in inhibition of ribosomal DNA transcription and cell growth. A similar correlation is observed in Tcof+/- mouse embryos that exhibit craniofacial defects and growth retardation. Thus, treacle haploinsufficiency in TCS patients might result in abnormal development caused by inadequate ribosomal RNA production in the prefusion neural folds during the early stages of embryogenesis. The elucidation of a physiological function of treacle provides important information of relevance to the molecular dissection of the biochemical pathology of TCS. PMID:15249688
Differences in the ribosomes prepared from lactating and non-lactating bovine mammary gland
Herrington, M. D.; Hawtrey, A. O.
1971-01-01
1. Ribosomes prepared from bovine lactating mammary gland are able to synthesize protein, whereas similar preparations from non-lactating glands are not. Washing the ribosome suspensions through a medium containing 0.5m-ammonium chloride enhanced their ability to incorporate phenylalanine into polyphenylalanine. 2. Ribosomes isolated from non-lactating bovine mammary gland, in contrast with those from rat liver and lactating mammary gland, contained significant amounts of extraneous nucleases. These enzymes could be removed by washing with a medium A buffer containing 0.5m-ammonium chloride. 3. Only those ribosomes from functionally active tissues were able to bind polyuridylic acid and phenylalanyl-tRNA. PMID:5165653
ERIC Educational Resources Information Center
Pirbhoy, Patricia Salgado; Farris, Shannon; Steward, Oswald
2016-01-01
Previous studies have shown that induction of long-term potentiation (LTP) induces phosphorylation of ribosomal protein S6 (rpS6) in postsynaptic neurons, but the functional significance of rpS6 phosphorylation is poorly understood. Here, we show that synaptic stimulation that induces perforant path LTP triggers phosphorylation of rpS6 (p-rpS6)…
Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth; Contreras, Nataly; Hertz, Marla I; Olivares, Eduardo; Cáceres, Carlos J; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R; López-Lastra, Marcelo
2016-07-01
The 5' leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work, we examine the internal ribosome entry site (IRES) located in the 5' leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5' leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. © 2016 Federation of European Biochemical Societies.
The pretranslocation ribosome is targeted by GTP-bound EF-G in partially activated form
Hauryliuk, Vasili; Mitkevich, Vladimir A.; Eliseeva, Natalia A.; Petrushanko, Irina Yu.; Ehrenberg, Måns; Makarov, Alexander A.
2008-01-01
Translocation of the tRNA·mRNA complex through the bacterial ribosome is driven by the multidomain guanosine triphosphatase elongation factor G (EF-G). We have used isothermal titration calorimetry to characterize the binding of GDP and GTP to free EF-G at 4°C, 20°C, and 37°C. The binding affinity of EF-G is higher to GDP than to GTP at 4°C, but lower at 37°C. The binding enthalpy and entropy change little with temperature in the case of GDP binding but change greatly in the case of GTP binding. These observations are compatible with a large decrease in the solvent-accessible hydrophobic surface area of EF-G on GTP, but not GDP, binding. The explanation we propose is the locking of the switch 1 and switch 2 peptide loops in the G domain of EF-G to the γ-phosphate of GTP. From these data, in conjunction with previously reported structural data on guanine nucleotide-bound EF-G, we suggest that EF-G enters the pretranslocation ribosome as an “activity chimera,” with the G domain activated by the presence of GTP but the overall factor conformation in the inactive form typical of a GDP-bound multidomain guanosine triphosphatase. We propose that the active overall conformation of EF-G is attained only in complex with the ribosome in its “ratcheted state,” with hybrid tRNA binding sites. PMID:18836081
Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.; ...
2016-01-24
Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.
Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less
Revealing Nature’s Synthetic Potential Through the Study of Ribosomal Natural Product Biosynthesis
Dunbar, Kyle L.; Mitchell, Douglas A.
2013-01-01
Ribosomally synthesized posttranslationally modified peptides (RiPPs) are a rapidly growing class of natural products with diverse structures and activities. In recent years, a great deal of progress has been made in elucidating the biosynthesis of various RiPP family members. As with the study of nonribosomal peptide and polyketide biosynthetic enzymes, these investigations have led to the discovery of entirely new biological chemistry. With each unique enzyme investigated, a more complex picture of Nature’s synthetic potential is revealed. This review focuses on recent reports (since 2008) that have changed the way that we think about ribosomal natural product biosynthesis and the enzymology of complex bond-forming reactions. PMID:23286465
Dual effect of chloramphenicol peptides on ribosome inhibition.
Bougas, Anthony; Vlachogiannis, Ioannis A; Gatos, Dimitrios; Arenz, Stefan; Dinos, George P
2017-05-01
Chloramphenicol peptides were recently established as useful tools for probing nascent polypeptide chain interaction with the ribosome, either biochemically, or structurally. Here, we present a new 10mer chloramphenicol peptide, which exerts a dual inhibition effect on the ribosome function affecting two distinct areas of the ribosome, namely the peptidyl transferase center and the polypeptide exit tunnel. According to our data, the chloramphenicol peptide bound on the chloramphenicol binding site inhibits the formation of both acetyl-phenylalanine-puromycin and acetyl-lysine-puromycin, showing, however, a decreased peptidyl transferase inhibition compared to chloramphenicol-mediated inhibition per se. Additionally, we found that the same compound is a strong inhibitor of green fluorescent protein synthesis in a coupled in vitro transcription-translation assay as well as a potent inhibitor of lysine polymerization in a poly(A)-programmed ribosome, showing that an additional inhibitory effect may exist. Since chemical protection data supported the interaction of the antibiotic with bases A2058 and A2059 near the entrance of the tunnel, we concluded that the extra inhibition effect on the synthesis of longer peptides is coming from interactions of the peptide moiety of the drug with residues comprising the ribosomal tunnel, and by filling up the tunnel and blocking nascent chain progression through the restricted tunnel. Therefore, the dual interaction of the chloramphenicol peptide with the ribosome increases its inhibitory effect and opens a new window for improving the antimicrobial potency of classical antibiotics or designing new ones.
Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions
Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun
2012-01-01
Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557
Effects of detergents on ribosomal precursor subunits of Bacillus megaterium.
Body, A; Brownstein, B H
1978-01-01
Cell extracts prepared by osmotic lysis of protoplasts were analyzed by sucrose gradient sedimentation. In the absence of detergents, ribosomal precursor particles were found in a gradient fraction which sedimented faster than mature 50S subunits and in two other fractions coincident with mature 50S and 30S ribosomal subunits. Phospholipid, an indicator of membrane, was shown to be associated with only the fastest-sedimenting ribosomal precursor particle fraction. After the extracts were treated with detergents, all phospholipid was found at the top of the gradients. Brij 58, Triton X-100, and Nonidet P-40 did not cause a change in the sedimentation values of precursors; however, the detergents deoxycholate or LOC (Amway Corp.) disrupted the fastest-sedimenting precursor and converted the ribosomal precursor subunits which sedimented at the 50S and 30S positions to five different classes of more slowly sedimenting particles. Earlier reports on the in vivo assembly of ribosomal subunits have shown that several stages of ribosomal precursor subunits exist, and, in the presence of the detergents deoxycholate and LOC, which had been used to prepare cell extracts, the precursors sedimented more slowly. Our data are consistent with the hypothesis that those detergents selectively modify the structure of ribosomal precursors and lend further support to the hypothesis that the in vivo ribosomal precursor subunits have 50S and 30S sedimentation values. In addition, these data support the idea that the ribosomal precursor particles found in the fast-sedimenting fraction may constitute a unique precursor fraction.
Effects of Detergents on Ribosomal Precursor Subunits of Bacillus megaterium
Body, Barbara A.; Brownstein, Bernard H.
1978-01-01
Cell extracts prepared by osmotic lysis of protoplasts were analyzed by sucrose gradient sedimentation. In the absence of detergents, ribosomal precursor particles were found in a gradient fraction which sedimented faster than mature 50S subunits and in two other fractions coincident with mature 50S and 30S ribosomal subunits. Phospholipid, an indicator of membrane, was shown to be associated with only the fastest-sedimenting ribosomal precursor particle fraction. After the extracts were treated with detergents, all phospholipid was found at the top of the gradients. Brij 58, Triton X-100, and Nonidet P-40 did not cause a change in the sedimentation values of precursors; however, the detergents deoxycholate or LOC (Amway Corp.) disrupted the fastest-sedimenting precursor and converted the ribosomal precursor subunits which sedimented at the 50S and 30S positions to five different classes of more slowly sedimenting particles. Earlier reports on the in vivo assembly of ribosomal subunits have shown that several stages of ribosomal precursor subunits exist, and, in the presence of the detergents deoxycholate and LOC, which had been used to prepare cell extracts, the precursors sedimented more slowly. Our data are consistent with the hypothesis that those detergents selectively modify the structure of ribosomal precursors and lend further support to the hypothesis that the in vivo ribosomal precursor subunits have 50S and 30S sedimentation values. In addition, these data support the idea that the ribosomal precursor particles found in the fast-sedimenting fraction may constitute a unique precursor fraction. PMID:412833
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert
2017-06-20
The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.
Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila
2012-07-13
Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.
Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen
2012-08-01
Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L
2013-02-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L.
2013-01-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2. PMID:23268442
Galián, J A; Rosato, M; Rosselló, J A
2012-06-01
In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.
Ciganda, Martin; Williams, Noreen
2012-01-01
The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
Ribosomal proteins L5 and L11 co-operatively inactivate c-Myc via RNA-induced silencing complex.
Liao, J-M; Zhou, X; Gatignol, A; Lu, H
2014-10-09
Oncogene MYC is highly expressed in many human cancers and functions as a global regulator of ribosome biogenesis. Previously, we reported that ribosomal protein (RP) L11 binds to c-Myc and inhibits its transcriptional activity in response to ribosomal stress. Here, we show that RPL5, co-operatively with RPL11, guides the RNA-induced silencing complex (RISC) to c-Myc mRNA and mediates the degradation of the mRNA, consequently leading to inhibition of c-Myc activity. Knocking down of RPL5 induced c-Myc expression at both mRNA and protein levels, whereas overexpression of RPL5 suppressed c-Myc expression and activity. Immunoprecipitation revealed that RPL5 binds to 3'UTR of c-Myc mRNA and two subunits of RISC, TRBP (HIV-1 TAR RNA-binding protein) and Ago2, mediating the targeting of c-Myc mRNA by miRNAs. Interestingly, RPL5 and RPL11 co-resided on c-Myc mRNA and suppressed c-Myc expression co-operatively. These findings uncover a mechanism by which these two RPs can co-operatively suppress c-Myc expression, allowing a tightly controlled ribosome biogenesis in cells.
RNA–protein binding kinetics in an automated microfluidic reactor
Ridgeway, William K.; Seitaridou, Effrosyni; Phillips, Rob; Williamson, James R.
2009-01-01
Microfluidic chips can automate biochemical assays on the nanoliter scale, which is of considerable utility for RNA–protein binding reactions that would otherwise require large quantities of proteins. Unfortunately, complex reactions involving multiple reactants cannot be prepared in current microfluidic mixer designs, nor is investigation of long-time scale reactions possible. Here, a microfluidic ‘Riboreactor’ has been designed and constructed to facilitate the study of kinetics of RNA–protein complex formation over long time scales. With computer automation, the reactor can prepare binding reactions from any combination of eight reagents, and is optimized to monitor long reaction times. By integrating a two-photon microscope into the microfluidic platform, 5-nl reactions can be observed for longer than 1000 s with single-molecule sensitivity and negligible photobleaching. Using the Riboreactor, RNA–protein binding reactions with a fragment of the bacterial 30S ribosome were prepared in a fully automated fashion and binding rates were consistent with rates obtained from conventional assays. The microfluidic chip successfully combines automation, low sample consumption, ultra-sensitive fluorescence detection and a high degree of reproducibility. The chip should be able to probe complex reaction networks describing the assembly of large multicomponent RNPs such as the ribosome. PMID:19759214
Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes
2014-12-01
During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.
Li, Xiao-Ping; Kahn, Peter C; Kahn, Jennifer Nielsen; Grela, Przemyslaw; Tumer, Nilgun E
2013-10-18
Ricin inhibits protein synthesis by depurinating the α-sarcin/ricin loop (SRL). Ricin holotoxin does not inhibit translation unless the disulfide bond between the A (RTA) and B (RTB) subunits is reduced. Ricin holotoxin did not bind ribosomes or depurinate them but could depurinate free RNA. When RTA is separated from RTB, arginine residues located at the interface are exposed to the solvent. Because this positively charged region, but not the active site, is blocked by RTB, we mutated arginine residues at or near the interface of RTB to determine if they are critical for ribosome binding. These variants were structurally similar to wild type RTA but could not bind ribosomes. Their K(m) values and catalytic rates (k(cat)) for an SRL mimic RNA were similar to those of wild type, indicating that their activity was not altered. However, they showed an up to 5-fold increase in K(m) and up to 38-fold decrease in kcat toward ribosomes. These results suggest that the stalk binding stimulates the catalysis of ribosome depurination by RTA. The mutated arginines have side chains behind the active site cleft, indicating that the ribosome binding surface of RTA is on the opposite side of the surface that interacts with the SRL. We propose that stalk binding stimulates the catalysis of ribosome depurination by orienting the active site of RTA toward the SRL and thereby allows docking of the target adenine into the active site. This model may apply to the translation factors that interact with the stalk.
Role of large thermal fluctuations and magnesium ions in t-RNA selectivity of the ribosome
Guo, Zuojun; Gibson, Meghan; Sitha, Sanyasi; Chu, Steven; Mohanty, Udayan
2011-01-01
The fidelity of translation selection begins with the base pairing of codon-anticodon complex between the m-RNA and tRNAs. Binding of cognate and near-cognate tRNAs induces 30S subunit of the ribosome to wrap around the ternary complex, EF-Tu(GTP)aa-tRNA. We have proposed that large thermal fluctuations play a crucial role in the selection process. To test this conjecture, we have developed a theoretical technique to determine the probability that the ternary complex, as a result of large thermal fluctuations, forms contacts leading to stabilization of the GTPase activated state. We argue that the configurational searches for such processes are in the tail end of the probability distribution and show that the probability for this event is localized around the most likely configuration. Small variations in the repositioning of cognate relative to near-cognate complexes lead to rate enhancement of the cognate complex. The binding energies of over a dozen unique site-bound magnesium structural motifs are investigated and provide insights into the nature of interaction of divalent metal ions with the ribosome. PMID:21368154
Ribosomal protein S6 kinase 1 signaling regulates mammalian lifespan
Selman, Colin; Tullet, Jennifer M.A.; Wieser, Daniela; Irvine, Elaine; Lingard, Steven J.; Choudhury, Agharul I.; Claret, Marc; Al-Qassab, Hind; Carmignac, Danielle; Ramadani, Faruk; Woods, Angela; Robinson, Iain C.A.; Schuster, Eugene; Batterham, Rachel L.; Kozma, Sara C.; Thomas, George; Carling, David; Okkenhaug, Klaus; Thornton, Janet M.; Partridge, Linda; Gems, David; Withers, Dominic J.
2016-01-01
Caloric restriction (CR) protects against aging and disease but the mechanisms by which this affects mammalian lifespan are unclear. We show in mice that deletion of the nutrient-responsive mTOR (mammalian target of rapamycin) signaling pathway component ribosomal S6 protein kinase 1 (S6K1) led to increased lifespan and resistance to age-related pathologies such as bone, immune and motor dysfunction and loss of insulin sensitivity. Deletion of S6K1 induced gene expression patterns similar to those seen in CR or with pharmacological activation of adenosine monophosphate (AMP)-activated protein kinase (AMPK), a conserved regulator of the metabolic response to CR. Our results demonstrate that S6K1 influences healthy mammalian lifespan, and suggest therapeutic manipulation of S6K1 and AMPK might mimic CR and provide broad protection against diseases of aging. PMID:19797661
Bock, Lars V.; Blau, Christian; Vaiana, Andrea C.; Grubmüller, Helmut
2015-01-01
During ribosomal translation, the two ribosomal subunits remain associated through intersubunit bridges, despite rapid large-scale intersubunit rotation. The absence of large barriers hindering rotation is a prerequisite for rapid rotation. Here, we investigate how such a flat free-energy landscape is achieved, in particular considering the large shifts the bridges undergo at the periphery. The dynamics and energetics of the intersubunit contact network are studied using molecular dynamics simulations of the prokaryotic ribosome in intermediate states of spontaneous translocation. Based on observed occupancies of intersubunit contacts, residues were grouped into clusters. In addition to the central contact clusters, peripheral clusters were found to maintain strong steady interactions by changing contacts in the course of rotation. The peripheral B1 bridges are stabilized by a changing contact pattern of charged residues that adapts to the rotational state. In contrast, steady strong interactions of the B4 bridge are ensured by the flexible helix H34 following the movement of protein S15. The tRNAs which span the subunits contribute to the intersubunit binding enthalpy to an almost constant degree, despite their different positions in the ribosome. These mechanisms keep the intersubunit interaction strong and steady during rotation, thereby preventing dissociation and enabling rapid rotation. PMID:26109353
Yrb4p, a yeast ran-GTP-binding protein involved in import of ribosomal protein L25 into the nucleus.
Schlenstedt, G; Smirnova, E; Deane, R; Solsbacher, J; Kutay, U; Görlich, D; Ponstingl, H; Bischoff, F R
1997-01-01
Gsp1p, the essential yeast Ran homologue, is a key regulator of transport across the nuclear pore complex (NPC). We report the identification of Yrb4p, a novel Gsp1p binding protein. The 123 kDa protein was isolated from Saccharomyces cerevisiae cells and found to be related to importin-beta, the mediator of nuclear localization signal (NLS)-dependent import into the nucleus, and to Pse1p. Like importin-beta, Yrb4p and Pse1p specifically bind to Gsp1p-GTP, protecting it from GTP hydrolysis and nucleotide exchange. The GTPase block of Gsp1p complexed to Yrb4p or Pse1p is released by Yrb1p, which contains a Gsp1p binding domain distinct from that of Yrb4p. This might reflect an in vivo function for Yrb1p. Cells disrupted for YRB4 are defective in nuclear import of ribosomal protein L25, but show no defect in the import of proteins containing classical NLSs. Expression of a Yrb4p mutant deficient in Gsp1p-binding is dominant-lethal and blocks bidirectional traffic across the NPC in wild-type cells. L25 binds to Yrb4p and Pse1p and is released by Gsp1p-GTP. Consistent with its putative role as an import receptor for L25-like proteins, Yrb4p localizes to the cytoplasm, the nucleoplasm and the NPC. PMID:9321403
Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria
2014-01-01
We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2’,3’-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2’- and 3’-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process. PMID:25191528
Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria
2014-01-01
We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.
Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics
NASA Astrophysics Data System (ADS)
Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.
2017-12-01
Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.
Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics
Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R; Allen, Rosalind J
2017-01-01
Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance. PMID:28714461
A computer model for the 30S ribosome subunit.
Kuntz, I D; Crippen, G M
1980-01-01
We describe a computer-generated model for the locations of the 21 proteins of the 30S subunit of the E. coli ribosome. The model uses a new method of incorporating experimental measurements based on a mathematical technique called distance geometry. In this paper, we use data from two sources: immunoelectron microscopy and neutron-scattering studies. The data are generally self-consistent and lead to a set of relatively well-defined structures in which individual protein coordinates differ by approximately 20 A from one structure to another. Two important features of this calculation are the use of extended proteins rather than just the centers of mass, and the ability to confine the protein locations within an arbitrary boundary surface so that only solutions with an approximate 30S "shape" are permitted. PMID:7020786
Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli
DOE R&D Accomplishments Database
Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.
1982-06-01
This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.
Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C
1998-03-03
The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.
Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude
1998-01-01
The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926
Defective ribosome assembly in Shwachman-Diamond syndrome.
Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J
2011-10-20
Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.
Yu, Shoukai; Lemos, Bernardo
2016-12-31
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Evolution of ribosomal proteins in Enterobacteriaceae.
Hori, H; Osawa, S
1978-01-01
The evolution of ribosomal proteins of about 70 bacterial strains belonging to the family Enterobacteriaceae has been studied by use of previously reported data (S. Osawa, T. Itoh, and E. Otaka, J. Bacteriol. 107:168-178, 1971) and those obtained in this paper. The proximity of the bacteria was quantified by co-chromatographing the differentially labeled ribosomal proteins from two strains on a column of carboxymethyl cellulose in various combinations. The were then classified into 12 groups (=species?) according to their ribosomal protein compositions and were placed in a phylogenic tree. PMID:346556
Yu, Shoukai; Lemos, Bernardo
2016-01-01
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. PMID:27797956
New Insights into Ribosome Structure and Function.
Jobe, Amy; Liu, Zheng; Gutierrez-Vargas, Cristina; Frank, Joachim
2018-06-14
In the past 4 years, because of the advent of new cameras, many ribosome structures have been solved by cryoelectron microscopy (cryo-EM) at high, often near-atomic resolution, bringing new mechanistic insights into the processes of translation initiation, peptide elongation, termination, and recycling. Thus, cryo-EM has joined X-ray crystallography as a powerful technique in structural studies of translation. The significance of this new development is that structures of ribosomes in complex with their functional binding partners can now be determined to high resolution in multiple states as they perform their work. The aim of this article is to provide an overview of these new studies and assess the contributions they have made toward an understanding of translation and translational control. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.
Characterization of Ribosomes from Neurospora crassa
Storck, R.
1963-01-01
Ribosomes isolated from growing hyphae of Neurospora crassa contain 53 per cent protein and 47 per cent RNA and have a sedimentation coefficient of 81S at 20°C and infinite dilution. These ribosomes are stable at pH 7.4 in the presence of 0.01 M and 0.002 M MgCl2 but undergo a dissociation into smaller particles if the MgCl2 concentration is lowered to 0.0001 M. Two types of RNA with sedimentation coefficients of 19S2050 and 13S2050 have been extracted from the 81S particles. PMID:13984420
NASA Technical Reports Server (NTRS)
Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.
1996-01-01
A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex
Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
[Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].
Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G
2005-01-01
Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.
NASA Astrophysics Data System (ADS)
Patel, Bhargav A.
P-glycoprotein (P-gp) is considered an important therapeutic target for reversal of multidrug resistance (MDR) in cancer. It recognizes a diverse range of chemically and mechanistically dissimilar drugs. It has been postulated that the efflux by P-gp plays a major role in failure of chemotherapy. Hence, researchers have been trying to obtain a potent inhibitor of P-gp with specificity to tumor sites. In this pursuit, we previously were able to obtain a novel (S)-valine thiazole-derived peptidomimetic compound 1 ( TTT-28), which showed potent reversal of MDR in vitro as well as in vivo compared to verapamil, a well-known MDR modulator. We have also found that compound 1 triggers ATPase stimulation when incubated with P-gp alike verapamil, which implies its mechanism of action as competitive in nature. In this study, we attempted to understand structural requirements of ligands binding to a perplexing drug-binding site of P-gp and affecting its ATPase function. Toward this goal, we prepared a novel set of 64 analogues by fine tuning lead compound 1. These synthesized analogues were tested using ATPase activity assay. During the course of the study, a potent stimulator (1) of ATPase activity was transformed into an ATPase inhibitory leads such as compounds 43 , 57 and 113. The ATPase inhibitory activity of these compounds is predominantly contributed by the presence of a cyclohexyl group in place of the 2-aminobenzophenone moiety of ATPase activity stimulatory lead compound 1. Molecular modeling studies suggested a need for specific interactions with the drug-binding site of P-gp to induce different conformational states of P-gp to produce either stimulation or inhibition of ATPase activity. Collectively, this comprehensive synthesis work will facilitate further research towards P-gp inhibitor development.
Mallik, Saurav; Kundu, Sudip
2015-01-01
Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.
Hermans, Emmanuel; Geurts, Muriel; Maloteaux, Jean-Marie
1997-01-01
The functional interaction of the cloned rat neurotensin receptor with intracellular G-proteins was investigated by studying the binding of the radiolabelled guanylyl nucleotide analogue [35S]-GTPγS induced by neurotensin to membranes prepared from transfected Chinese hamster ovary (CHO) cells. The agonist-induced binding of [35S]-GTPγS was only detected in the presence of NaCl in the incubation buffer. However, it was also demonstrated that the binding of [3H]-neurotensin to its receptor was inhibited by NaCl. In the presence of 50 mM NaCl, the binding of the labelled nucleotide was about 2 fold increased by stimulation with saturating concentrations of neurotensin (EC50 value of 2.3±0.9 nM). The stimulation of [35S]-GTPγS binding by neurotensin was mimicked by the stable analogue of neurotensin, JMV-449 (EC50 value of 1.7±0.4 nM) and the neurotensin related peptide neuromedin N (EC50 value of 21±6 nM). The NT-induced [35S]-GTPγS binding was competitively inhibited by SR48692 (pA2 value of 9.55±0.28), a non-peptide neurotensin receptor antagonist. SR48692 alone had no effect on the specific binding of [35S]-GTPγS. The response to neurotensin was found to be inhibited by the aminosteroid U-73122, a putative inhibitor of phospholipase C-dependent processes, indicating that this drug may act at the G-protein level. Taken together, these results constitute the first characterization of the exchange of guanylyl nucleotides at the G-protein level that is induced by the neuropeptide neurotensin after binding to its receptor. PMID:9283723
Galián, J A; Rosato, M; Rosselló, J A
2012-01-01
In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S–5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S–5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S–5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S–5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary. PMID:22354111
Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David
2014-08-01
In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.
Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix
2014-01-01
In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421
Drug-Sensing by the Ribosome Induces Translational Arrest via Active Site Perturbation
Arenz, Stefan; Meydan, Sezen; Starosta, Agata L.; Berninghausen, Otto; Beckmann, Roland; Vázquez-Laslop, Nora; Wilson, Daniel N.
2014-01-01
SUMMARY During protein synthesis, nascent polypeptide chains within the ribosomal tunnel can act in cis to induce ribosome stalling and regulate expression of downstream genes. The Staphylococcus aureus ErmCL leader peptide induces stalling in the presence of clinically important macrolide antibiotics, such as erythromycin, leading to the induction of the downstream macrolide resistance methyltransferase ErmC. Here, we present a cryo-electron microscopy (EM) structure of the erythromycin-dependent ErmCL-stalled ribosome at 3.9 Å resolution. The structure reveals how the ErmCL nascent chain directly senses the presence of the tunnel-bound drug and thereby induces allosteric conformational rearrangements at the peptidyltransferase center (PTC) of the ribosome. ErmCL-induced perturbations of the PTC prevent stable binding and accommodation of the aminoacyl-tRNA at the A-site leading to inhibition of peptide bond formation and translation arrest. PMID:25306253
Superresolution Imaging of Ribosomes and RNA Polymerase in Live Escherichia coli Cells
Bakshi, Somenath; Siryaporn, Albert; Goulian, Mark; Weisshaar, James C.
2012-01-01
Summary Quantitative spatial distributions of ribosomes (S2-YFP) and RNA polymerase (β′-yGFP) in live E. coli are measured by superresolution fluorescence microscopy. In moderate growth conditions, Nucleoid-ribosome segregation is strong, and RNAP localizes to the nucleoid lobes. The mean copy numbers per cell are 4600 RNAPs and 55,000 ribosomes. Only 10–15% of the ribosomes lie within the densest part of the nucleoid lobes, and at most 4% of the RNAPs lie in the two ribosome-rich endcaps. The predominant observed diffusion coefficient of ribosomes is Dribo = 0.04 μm2/s, attributed to free mRNA being translated by one or more 70S ribosomes. We find no clear evidence of sub-diffusion, as would arise from tethering of ribosomes. The degree of DNA-ribosome segregation strongly suggests that in E. coli most translation occurs on free mRNA transcripts that have diffused into the ribosome-rich regions. Both RNAP and ribosome radial distributions extend to the cytoplasmic membrane, consistent with the transertion hypothesis. However, few if any RNAP copies lie near the membrane of the endcaps. This suggests that if transertion occurs, it exerts a direct radially expanding force on the nucleoid, but not a direct axially expanding force. PMID:22624875
Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V
2015-10-01
Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.
Watson, K L; Konrad, K D; Woods, D F; Bryant, P J
1992-01-01
The tumor suppressor gene lethal(1)aberrant immune response 8 (air8) of Drosophila melanogaster encodes a homolog of the human S6 ribosomal protein. P element insertions that prevent expression of this gene cause overgrowth of the lymph glands (the hematopoietic organs), abnormal blood cell differentiation, and melanotic tumor formation. They also cause delayed development, inhibit growth of most of the larval organs, and lead to larval lethality. Mitotic recombination experiments indicate that the normal S6 gene is required for clone survival in the germ line and imaginal discs. The S6 gene produces a 1.1-kilobase transcript that is abundant throughout development in wild-type animals and in revertants derived from the insertional mutants but is barely detectable in the mutant larvae. cDNAs corresponding to this transcript show a 248-amino acid open reading frame with 75.4% identity and 94.8% similarity to both human and rat S6 ribosomal protein sequences. The results reveal a regulatory function of this ribosomal protein in the hematopoietic system of Drosophila that may be related to its developmentally regulated phosphorylation. Images PMID:1454811
Conformational dynamics of bacterial trigger factor in apo and ribosome-bound states.
Can, Mehmet Tarik; Kurkcuoglu, Zeynep; Ezeroglu, Gokce; Uyar, Arzu; Kurkcuoglu, Ozge; Doruker, Pemra
2017-01-01
The chaperone trigger factor (TF) binds to the ribosome exit tunnel and helps cotranslational folding of nascent chains (NC) in bacterial cells and chloroplasts. In this study, we aim to investigate the functional dynamics of fully-atomistic apo TF and its complex with 50S. As TF accomodates a high percentage of charged residues on its surface, the effect of ionic strength on TF dynamics is assessed here by performing five independent molecular dynamics (MD) simulations (total of 1.3 micro-second duration) at 29 mM and 150 mM ionic strengths. At both concentrations, TF exhibits high inter- and intra-domain flexibility related to its binding (BD), core (CD), and head (HD) domains. Even though large oscillations in gyration radius exist during each run, we do not detect the so-called 'fully collapsed' state with both HD and BD collapsed upon the core. In fact, the extended conformers with relatively open HD and BD are highly populated at the physiological concentration of 150 mM. More importantly, extended TF snapshots stand out in terms of favorable docking onto the 50S subunit. Elastic network modeling (ENM) indicates significant changes in TF's functional dynamics and domain decomposition depending on its conformation and positioning on the 50S. The most dominant slow motions are the lateral sweeping and vertical opening/closing of HD relative to 50S. Finally, our ENM-based efficient technique -ClustENM- is used to sample atomistic conformers starting with an extended TF-50S complex. Specifically, BD and CD motions are restricted near the tunnel exit, while HD is highly mobile. The atomistic conformers generated without an NC are in agreement with the cryo-EM maps available for TF-ribosome-NC complex.
RNA and ribosomal protein patterns during aerial spore germination in Streptomyces granaticolor.
Mikulík, K; Janda, I; Weiser, J; Stastná, J; Jiránová, A
1984-12-03
Disruption of the external sheath of Streptomyces granaticolor aerial spores and subsequent cultivation in a rich medium result in a synchronous germination. This method was used to analyze RNA and protein patterns during the germination. The germination process took place through a sequence of time-ordered events. RNA and protein synthesis started during the first 5 min and net DNA synthesis at 60-70 min of germination. Within the first 10 min of germination, synthesis of RNA was not sensitive to the inhibitory effect of rifamycin. During this period rRNA and other species including 4-5-S RNA were synthesized. Dormant spores contained populations of ribosomes or ribosomal precursors that were structurally and functionally defective. The ribosomal particles bound a sporulation pigment(s) of the melanine type. The ribosomal proteins complexed to the pigments formed insoluble aggregates which were easily removed from the ribosomes by one wash with 1 M NH4Cl. During the first 10 min of germination, pigment(s) were liberated from the complexes with the ribosomes and protein extracts of the washed ribosomes had essentially the same pattern as the extracts of ribosomes of vegetative cells. These structural alterations were accompanied by enhancement of the ribosome activities in polypeptide synthesis in vivo and in vitro. When the spores were incubated with a 14C-labelled amino acid mixture in the presence of rifamycin, only three proteins (GS1, GL1 and GS9) were identified to be radiolabelled in the extracts from the washed ribosomes. These experiments indicate that liberation of the sporulation pigment(s) from the complexes with ribosomal proteins and assembly of de novo synthesized proteins and proteins from a preexisting pool in the spore are involved in the reactivation of the ribosomes of dormant spores of S. granaticolor.
Potenza, L; Cafiero, M A; Camarda, A; La Salandra, G; Cucchiarini, L; Dachà, M
2009-10-01
In the present work mites previously identified as Dermanyssus gallinae De Geer (Acari, Mesostigmata) using morphological keys were investigated by molecular tools. The complete internal transcribed spacer 1 (ITS1), 5.8S ribosomal DNA, and ITS2 region of the ribosomal DNA from mites were amplified and sequenced to examine the level of sequence variations and to explore the feasibility of using this region in the identification of this mite. Conserved primers located at the 3'end of 18S and at the 5'start of 28S rRNA genes were used first, and amplified fragments were sequenced. Sequence analyses showed no variation in 5.8S and ITS2 region while slight intraspecific variations involving substitutions as well as deletions concentrated in the ITS1 region. Based on the sequence analyses a nested PCR of the ITS2 region followed by RFLP analyses has been set up in the attempt to provide a rapid molecular diagnostic tool of D. gallinae.
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan
2017-01-01
Abstract The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson–Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. PMID:28369621
Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.
Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel
2012-02-01
Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.
Nearly complete 28S rRNA gene sequences confirm new hypotheses of sponge evolution.
Thacker, Robert W; Hill, April L; Hill, Malcolm S; Redmond, Niamh E; Collins, Allen G; Morrow, Christine C; Spicer, Lori; Carmack, Cheryl A; Zappe, Megan E; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C; Bangalore, Purushotham V
2013-09-01
The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges.
Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo
2016-01-01
The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898
Atkins, John F; Loughran, Gary; Baranov, Pavel V
2017-01-19
In many bacteria, separate genes encode a copper binding chaperone and a copper efflux pump, but in some the chaperone encoding gene has been elusive. In this issue of Molecular Cell, Meydan et al. (2017) report that ribosomes translating the ORF that encodes the copper pump frequently frameshift and terminate to produce the copper chaperone. Copyright © 2017 Elsevier Inc. All rights reserved.
Inhibition by ricin of protein synthesis in vitro. Ribosomes as the target of the toxin
Montanaro, Lucio; Sperti, Simonetta; Stirpe, Fiorenzo
1973-01-01
1. Ricin (a toxic protein from the seeds of Ricinus communis) is a powerful inhibitor of the poly(U)-directed incorporation of phenylalanine into polypeptides catalysed by isolated rat liver ribosomes and elongation factors 1 and 2 (EF 1 and EF 2). The inhibition can be largely overcome by increasing the concentration of ribosomes. 2. The toxin does not affect the binding of phenylalanyl-tRNA to ribosomes catalysed by EF 1, nor does it inhibit the puromycin reaction used as a test for peptide-bond formation catalysed by ribosomes. 3. Ricin inhibits the ribosome-linked GTP hydrolysis catalysed by EF 2. 4. Ribosomes treated with ricin and washed through sucrose gradients containing 0.6m-NH4Cl are functionally inactive in those assay systems that are sensitive to the presence of added toxin. 5. It is suggested that ricin brings about an irreversible modification of ribosomes which impairs their ability to interact with EF 2. Since ricin inhibits at a molar concentration much lower than that of ribosomes it probably acts catalytically. No added cofactor is necessary for the inhibitory action of the toxin. PMID:4780693
Mars, Ruben A T; Mendonça, Karoline; Denham, Emma L; van Dijl, Jan Maarten
2015-10-01
One of the best-characterized general stress responses in bacteria is the σB-mediated stress response of the Gram-positive soil bacterium Bacillus subtilis. The σB regulon contains approximately 200 protein-encoding genes and 136 putative regulatory RNAs. One of these σB-dependent RNAs, named S1136-S1134, was recently mapped as being transcribed from the S1136 promoter on the opposite strand of the essential rpsD gene, which encodes the ribosomal primary-binding protein S4. Accordingly, S1136-S1134 transcription results in an rpsD-overlapping antisense RNA (asRNA). Upon exposure of B. subtilis to ethanol, the S1136 promoter was found to be induced, while rpsD transcription was downregulated. By quantitative PCR, we show that the activation of transcription from the S1136 promoter is directly responsible for the downregulation of rpsD upon ethanol exposure. We also show that this downregulation of rpsD leads to a reduced level of the small (30S) ribosomal subunit upon ethanol stress. The activation of the S1136 promoter thus represents the first example of antisense transcription-mediated regulation in the general stress response of B. subtilis and implicates the reduction of ribosomal protein abundance as a new aspect in the σB-dependent stress response. We propose that the observed reduction in the level of the small ribosomal subunit, which contains the ribosome-decoding center, may protect B. subtilis cells against misreading and spurious translation of possibly toxic aberrant peptides under conditions of ethanol stress. Copyright © 2015 Elsevier B.V. All rights reserved.
BI-D1870 is a specific inhibitor of the p90 RSK (ribosomal S6 kinase) isoforms in vitro and in vivo
Sapkota, Gopal P.; Cummings, Lorna; Newell, Felicity S.; Armstrong, Christopher; Bain, Jennifer; Frodin, Morten; Grauert, Matthias; Hoffmann, Matthias; Schnapp, Gisela; Steegmaier, Martin; Cohen, Philip; Alessi, Dario R.
2006-01-01
Hormones and growth factors induce the activation of a number of protein kinases that belong to the AGC subfamily, including isoforms of PKA, protein kinase B (also known as Akt), PKC, S6K p70 (ribosomal S6 kinase), RSK (p90 ribosomal S6 kinase) and MSK (mitogen- and stress-activated protein kinase), which then mediate many of the physiological processes that are regulated by these extracellular agonists. It can be difficult to assess the individual functions of each AGC kinase because their substrate specificities are similar. Here we describe the small molecule BI-D1870, which inhibits RSK1, RSK2, RSK3 and RSK4 in vitro with an IC50 of 10–30 nM, but does not signi-ficantly inhibit ten other AGC kinase members and over 40 other protein kinases tested at 100-fold higher concentrations. BI-D1870 is cell permeant and prevents the RSK-mediated phorbol ester- and EGF (epidermal growth factor)-induced phosphoryl-ation of glycogen synthase kinase-3β and LKB1 in human embry-onic kidney 293 cells and Rat-2 cells. In contrast, BI-D1870 does not affect the agonist-triggered phosphorylation of substrates for six other AGC kinases. Moreover, BI-D1870 does not suppress the phorbol ester- or EGF-induced phosphorylation of CREB (cAMP-response-element-binding protein), consistent with the genetic evidence indicating that MSK, and not RSK, isoforms mediate the mitogen-induced phosphorylation of this transcription factor. PMID:17040210
Owen, Gillian A; Pascoe, Ben; Kallifidas, Dimitris; Paget, Mark S B
2007-06-01
Streptomyces coelicolor contains paralogous versions of seven ribosomal proteins (S14, S18, L28, L31, L32, L33, and L36), which differ in their potential to bind structural zinc. The paralogues are termed C(+) or C(-) on the basis of the presence or absence of putative cysteine ligands. Here, mutational studies suggest that the C(-) version of L31 can functionally replace its C(+) paralogue only when expressed at an artificially elevated level. We show that the level of expression of four transcriptional units encoding C(-) proteins is elevated under conditions of zinc deprivation. Zur controls the expression of three transcriptional units (including rpmG2, rpmE2, rpmB2, rpsN2, rpmF2, and possibly rpsR2). Zur also controls the expression of the znuACB operon, which is predicted to encode a high-affinity zinc transport system. Surprisingly, the zinc-responsive control of the rpmG3-rpmJ2 operon is dictated by sigma(R), a sigma factor that was previously shown to control the response to disulfide stress in S. coelicolor. The induction of sigma(R) activity during zinc limitation establishes an important link between thiol-disulfide metabolism and zinc homeostasis.
HCV-like IRESs displace eIF3 to gain access to the 40S subunit
Hashem, Yaser; des Georges, Amedee; Dhote, Vidya; Langlois, Robert; Liao, Hstau Y.; Grassucci, Robert A.; Pestova, Tatyana V.; Hellen, Christopher U.T.; Frank, Joachim
2014-01-01
Hepatitis C virus (HCV) and Classical swine fever virus (CSFV) mRNAs contain related (HCV-like) internal ribosome entry sites (IRESs) that promote 5’-end independent initiation of translation, requiring only a subset of the eukaryotic initiation factors (eIFs) needed for canonical initiation on cellular mRNAs1. Initiation on HCV-like IRESs relies on their specific interaction with the 40S subunit2–8, which places the initiation codon into the P site, where it directly base-pairs with eIF2-bound Met-tRNAiMet to form a 48S initiation complex. However, all HCV-like IRESs also specifically interact with eIF32,5–7,9–12, but the role of this interaction in IRES-mediated initiation has remained unknown. During canonical initiation, eIF3 binds to the 40S subunit as a component of the 43S pre-initiation complex, and comparison of the ribosomal positions of eIF313 and the HCV IRES8 revealed that they overlap, so that their rearrangement would be required for formation of ribosomal complexes containing both components13. Here, we present a cryo-electron microscopy reconstruction of a 40S ribosomal complex containing eIF3 and the CSFV IRES. Strikingly, although the position and interactions of the CSFV IRES with the 40S subunit in this complex are similar to those of the HCV IRES in the 40S/IRES binary complex8, eIF3 is completely displaced from its ribosomal position in the 43S complex, and instead interacts through its ribosome-binding surface exclusively with the apical region of domain III of the IRES. Our results suggest a role for the specific interaction of HCV-like IRESs with eIF3 in preventing ribosomal association of eIF3, which could serve two purposes: relieving the competition between the IRES and eIF3 for a common binding site on the 40S subunit, and reducing formation of 43S complexes, thereby favoring translation of viral mRNAs. PMID:24185006
Kim, Sung Won; Wiers, Corinde E; Tyler, Ryan; Shokri-Kojori, Ehsan; Jang, Yeon Joo; Zehra, Amna; Freeman, Clara; Ramirez, Veronica; Lindgren, Elsa; Miller, Gregg; Cabrera, Elizabeth A; Stodden, Tyler; Guo, Min; Demiral, Şükrü B; Diazgranados, Nancy; Park, Luke; Liow, Jeih-San; Pike, Victor; Morse, Cheryl; Vendruscolo, Leandro F; Innis, Robert B; Koob, George F; Tomasi, Dardo; Wang, Gene-Jack; Volkow, Nora D
2018-05-03
Neuroinflammation appears to contribute to neurotoxicity observed with heavy alcohol consumption. To assess whether chronic alcohol results in neuroinflammation we used PET and [ 11 C]PBR28, a ligand that binds to the 18-kDa translocator protein (TSPO), to compare participants with an alcohol use disorder (AUD: n = 19) with healthy controls (HC: n = 17), and alcohol-dependent (n = 9) with -nondependent rats (n = 10). Because TSPO is implicated in cholesterol's transport for steroidogenesis, we investigated whether plasma cholesterol levels influenced [ 11 C]PBR28 binding. [ 11 C]PBR28 binding did not differ between AUD and HC. However, when separating by TSPO genotype rs6971, we showed that medium-affinity binders AUD participants showed lower [ 11 C]PBR28 binding than HC in regions of interest (whole brain, gray and white matter, hippocampus, and thalamus), but no group differences were observed in high-affinity binders. Cholesterol levels inversely correlated with brain [ 11 C]PBR28 binding in combined groups, due to a correlation in AUD participants. In rodents, we observed no differences in brain [ 11 C]PBR28 uptake between alcohol-dependent and -nondependent rats. These findings, which are consistent with two previous [ 11 C]PBR28 PET studies, may indicate lower activation of microglia in AUD, whereas failure to observe alcohol effects in the rodent model indicate that species differences do not explain the discrepancy with prior rodent autoradiographic studies reporting increases in TSPO binding with chronic alcohol. However, reduced binding in AUD participants could also reflect competition from endogenous TSPO ligands such as cholesterol; and since the rs6971 polymorphism affects the cholesterol-binding domain of TSPO this could explain why differences were observed only in medium-affinity binders.
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Astrophysics Data System (ADS)
Verdier, L.; Gharbi-Benarous, J.; Bertho, G.; Mauvais, P.; Girault, J.-P.
1999-10-01
In this study the dissociation constants of the low antibiotic-ribosomes interaction were determined by the T2 (CPMG), the Carr-Purcell-Meiboom-Gill spin-echo decay rate and the line-broadening methods. Three MLSB antibiotics were studied, a macrolide roxithromycin, a ketolide HMR 3647 and a lincosamide clindamycin for their weak interaction with three bacterial ribosomes, E. coli, Staphylococcus aureus sensitive and resistant to erythromycin. Nous avons mesuré la constante de dissociation, Kd correspondant à l'interaction faible antibiotique-ribosome bactérien pour des antibiotiques de différentes classes, un macrolide (roxithromycine), un kétolide (HMR 3647) et une lincosamide (clindamycine) avec des ribosomes de différentes souches bactériennes (E. coli, Staphylococcus aureus sensible ou résistant à l'erythromycin) par deux méthodes : l'une basée sur la variation des largeurs de raies et l'autre sur les temps de relaxation transversaux T2 en utilisant une séquence CPMG.
Mechanisms for ribotoxin-induced ribosomal RNA cleavage
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Kaiyu; Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824; Zhou, Hui-Ren
The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activatedmore » kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce r
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G
1979-01-01
The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.
Bashan, Anat; Yonath, Ada
2009-01-01
Crystallography of ribosomes, the universal cell nucleoprotein assemblies facilitating the translation of the genetic-code into proteins, met with severe problems owing to their large size, complex structure, inherent flexibility and high conformational variability. For the case of the small ribosomal subunit, which caused extreme difficulties, post crystallization treatment by minute amounts of a heteropolytungstate cluster allowed structure determination at atomic resolution. This cluster played a dual role in ribosomal crystallography: providing anomalous phasing power and dramatically increased the resolution, by stabilization of a selected functional conformation. Thus, four out of the fourteen clusters that bind to each of the crystallized small subunits are attached to a specific ribosomal protein in a fashion that may control a significant component of the subunit internal flexibility, by “gluing” symmetrical related subunits. Here we highlight basic issues in the relationship between metal ions and macromolecules and present common traits controlling in the interactions between polymetalates and various macromolecules, which may be extended towards the exploitation of polymetalates for therapeutical treatment. PMID:19915655
RISSC: a novel database for ribosomal 16S–23S RNA genes spacer regions
García-Martínez, Jesús; Bescós, Ignacio; Rodríguez-Sala, Jesús Javier; Rodríguez-Valera, Francisco
2001-01-01
A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S–23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others. PMID:11125084
Hierlmeier, Thomas; Merl, Juliane; Sauert, Martina; Perez-Fernandez, Jorge; Schultz, Patrick; Bruckmann, Astrid; Hamperl, Stephan; Ohmayer, Uli; Rachel, Reinhard; Jacob, Anja; Hergert, Kristin; Deutzmann, Rainer; Griesenbeck, Joachim; Hurt, Ed; Milkereit, Philipp; Baßler, Jochen; Tschochner, Herbert
2013-01-01
Eukaryotic ribosome biogenesis requires more than 150 auxiliary proteins, which transiently interact with pre-ribosomal particles. Previous studies suggest that several of these biogenesis factors function together as modules. Using a heterologous expression system, we show that the large ribosomal subunit (LSU) biogenesis factor Noc1p of Saccharomyces cerevisiae can simultaneously interact with the LSU biogenesis factor Noc2p and Rrp5p, a factor required for biogenesis of the large and the small ribosomal subunit. Proteome analysis of RNA polymerase-I-associated chromatin and chromatin immunopurification experiments indicated that all members of this protein module and a specific set of LSU biogenesis factors are co-transcriptionally recruited to nascent ribosomal RNA (rRNA) precursors in yeast cells. Further ex vivo analyses showed that all module members predominantly interact with early pre-LSU particles after the initial pre-rRNA processing events have occurred. In yeast strains depleted of Noc1p, Noc2p or Rrp5p, levels of the major LSU pre-rRNAs decreased and the respective other module members were associated with accumulating aberrant rRNA fragments. Therefore, we conclude that the module exhibits several binding interfaces with pre-ribosomes. Taken together, our results suggest a co- and post-transcriptional role of the yeast Rrp5p–Noc1p–Noc2p module in the structural organization of early LSU precursors protecting them from non-productive RNase activity. PMID:23209026
A Plasma Protein Indistinguishable from Ribosomal Protein S19
Semba, Umeko; Chen, Jun; Ota, Yoshihiko; Jia, Nan; Arima, Hidetoshi; Nishiura, Hiroshi; Yamamoto, Tetsuro
2010-01-01
A monocyte-chemoattracting factor is generated during blood coagulation and during clotting of platelet-rich plasma. This chemotactic factor attracts monocytes as a ligand of the C5a receptor; however, it inhibits C5a-induced neutrophil chemotaxis as an apparent receptor antagonist. The curious dual function of the serum monocyte chemotactic factor resembles that of the cross-linked homodimer of ribosomal protein S19 (RP S19). Indeed, the inactive precursor of the monocyte chemotactic factor was present in plasma, and the precursor molecule and RP S19, as well as the active form and the RP S19 dimer, were indistinguishable in terms of immunological reactivity and molecular size. Coagulation factor XIIIa, plasma transglutaminase, and membrane phosphatidylserine on the activated platelets were required for conversion of the precursor to the active form. In addition, the precursor molecule in plasma could be replaced by wild-type recombinant RP S19 but not by mutant forms of it. These results indicate that a molecule indistinguishable from RP S19 was present in plasma, and that the RP S19-like molecule was converted to the active form by a transglutaminase-catalyzed reaction on a scaffold that included the phosphatidylserine-exposed platelet membrane. PMID:20093496
Stratford, Anna L; Fry, Christopher J; Desilets, Curtis; Davies, Alastair H; Cho, Yong Y; Li, Yvonne; Dong, Zigang; Berquin, Isabelle M; Roux, Philippe P; Dunn, Sandra E
2008-01-01
Introduction Basal-like breast cancers (BLBC) frequently overexpress the epidermal growth factor receptor (EGFR) and subsequently have high levels of signaling through the MAP kinase pathway, which is thought to contribute to their aggressive behavior. While we have previously reported the expression of Y-box binding protein-1 (YB-1) in 73% of BLBC, it is unclear whether it can be regulated by a component of the MAP kinase signaling pathway. Phosphorylation of YB-1 at the serine 102 residue is required for transcriptional activation of growth-enhancing genes, such as EGFR. Using Motifscan we identified p90 ribosomal S6 kinase (RSK) as a potential candidate for activating YB-1. Methods Inhibition of RSK1 and RSK2 was achieved using siRNA and the small molecule SL0101. RSK1, RSK2, activated RSK and kinase-dead RSK were expressed in HCC1937 cells. Kinase assays were performed to illustrate direct phosphorylation of YB-1 by RSK. The impact of inhibiting RSK on YB-1 function was measured by luciferase assays and chromatin immunoprecipitation. Results Using an in vitro kinase assay, RSK1 and RSK2 were shown to directly phosphorylate YB-1. Interestingly, they were more effective activators of YB-1 than AKT or another novel YB-1 kinase, PKCα. Phosphorylation of YB-1 (serine 102 residue) is blocked by inhibition of the MAP kinase pathway or by perturbing RSK1/RSK2 with siRNA or SL0101. In immortalized breast epithelial cells where RSK is active yet AKT is not, YB-1 is phosphorylated. Supporting this observation, RSK2-/- mouse embryo fibroblasts lose the ability to phosphorylate YB-1 in response to epidermal growth factor. This subsequently interfered with the ability of YB-1 to regulate the expression of EGFR. The RSK inhibitor SL0101 decreased the ability of YB-1 to bind the promoter, transactivate and ultimately reduce EGFR expression. In concordance with these results the expression of constitutively active RSK1 increased YB-1 phosphorylation, yet the kinase-dead RSK
Oesterle, Sabine; Gerngross, Daniel; Schmitt, Steven; Roberts, Tania Michelle; Panke, Sven
2017-09-26
Multiplexed gene expression optimization via modulation of gene translation efficiency through ribosome binding site (RBS) engineering is a valuable approach for optimizing artificial properties in bacteria, ranging from genetic circuits to production pathways. Established algorithms design smart RBS-libraries based on a single partially-degenerate sequence that efficiently samples the entire space of translation initiation rates. However, the sequence space that is accessible when integrating the library by CRISPR/Cas9-based genome editing is severely restricted by DNA mismatch repair (MMR) systems. MMR efficiency depends on the type and length of the mismatch and thus effectively removes potential library members from the pool. Rather than working in MMR-deficient strains, which accumulate off-target mutations, or depending on temporary MMR inactivation, which requires additional steps, we eliminate this limitation by developing a pre-selection rule of genome-library-optimized-sequences (GLOS) that enables introducing large functional diversity into MMR-proficient strains with sequences that are no longer subject to MMR-processing. We implement several GLOS-libraries in Escherichia coli and show that GLOS-libraries indeed retain diversity during genome editing and that such libraries can be used in complex genome editing operations such as concomitant deletions. We argue that this approach allows for stable and efficient fine tuning of chromosomal functions with minimal effort.
Epstein-Barr virus-encoded EBNA-5 binds to Epstein-Barr virus-induced Fte1/S3a protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kashuba, Elena; Yurchenko, Mariya; Szirak, Krisztina
Epstein-Barr virus (EBV) transforms resting human B cells into immortalized immunoblasts. EBV-encoded nuclear antigens EBNA-5 (also called EBNA-LP) is one of the earliest viral proteins expressed in freshly infected B cells. We have recently shown that EBNA-5 binds p14ARF, a nucleolar protein that regulates the p53 pathway. Here, we report the identification of another protein with partially nucleolar localization, the v-fos transformation effector Fte-1 (Fte-1/S3a), as an EBNA-5 binding partner. In transfected cells, Fte-1/S3a and EBNA-5 proteins showed high levels of colocalization in extranucleolar inclusions. Fte-1/S3a has multiple biological functions. It enhances v-fos-mediated cellular transformation and is part of themore » small ribosomal subunit. It also interacts with the transcriptional factor CHOP and apoptosis regulator poly(ADP-ribose) polymerase (PARP). Fte-1/S3a is regularly expressed at high levels in both tumors and cancer cell lines. Its high expression favors the maintenance of malignant phenotype and undifferentiated state, whereas its down-regulation is associated with cellular differentiation and growth arrest. Here, we show that EBV-induced B cell transformation leads to the up-regulation of Fte-1/S3a. We suggest that EBNA-5 through binding may influence the growth promoting, differentiation inhibiting, or apoptosis regulating functions of Fte-1/S3a.« less
Owen, Gillian A.; Pascoe, Ben; Kallifidas, Dimitris; Paget, Mark S. B.
2007-01-01
Streptomyces coelicolor contains paralogous versions of seven ribosomal proteins (S14, S18, L28, L31, L32, L33, and L36), which differ in their potential to bind structural zinc. The paralogues are termed C+ or C− on the basis of the presence or absence of putative cysteine ligands. Here, mutational studies suggest that the C− version of L31 can functionally replace its C+ paralogue only when expressed at an artificially elevated level. We show that the level of expression of four transcriptional units encoding C− proteins is elevated under conditions of zinc deprivation. Zur controls the expression of three transcriptional units (including rpmG2, rpmE2, rpmB2, rpsN2, rpmF2, and possibly rpsR2). Zur also controls the expression of the znuACB operon, which is predicted to encode a high-affinity zinc transport system. Surprisingly, the zinc-responsive control of the rpmG3-rpmJ2 operon is dictated by σR, a sigma factor that was previously shown to control the response to disulfide stress in S. coelicolor. The induction of σR activity during zinc limitation establishes an important link between thiol-disulfide metabolism and zinc homeostasis. PMID:17400736
Romes, Erin M.; Sobhany, Mack; Stanley, Robin E.
2016-01-01
The synthesis of eukaryotic ribosomes is a complex, energetically demanding process requiring the aid of numerous non-ribosomal factors, such as the PeBoW complex. The mammalian PeBoW complex, composed of Pes1, Bop1, and WDR12, is essential for the processing of the 32S preribosomal RNA. Previous work in Saccharomyces cerevisiae has shown that release of the homologous proteins in this complex (Nop7, Erb1, and Ytm1, respectively) from preribosomal particles requires Rea1 (midasin or MDN1 in humans), a large dynein-like protein. Midasin contains a C-terminal metal ion-dependent adhesion site (MIDAS) domain that interacts with the N-terminal ubiquitin-like (UBL) domain of Ytm1/WDR12 as well as the UBL domain of Rsa4/Nle1 in a later step in the ribosome maturation pathway. Here we present the crystal structure of the UBL domain of the WDR12 homologue from S. cerevisiae at 1.7 Å resolution and demonstrate that human midasin binds to WDR12 as well as Nle1 through their respective UBL domains. Midasin contains a well conserved extension region upstream of the MIDAS domain required for binding WDR12 and Nle1, and the interaction is dependent upon metal ion coordination because removal of the metal or mutation of residues that coordinate the metal ion diminishes the interaction. Mammalian WDR12 displays prominent nucleolar localization that is dependent upon active ribosomal RNA transcription. Based upon these results, we propose that release of the PeBoW complex and subsequent release of Nle1 by midasin is a well conserved step in the ribosome maturation pathway in both yeast and mammalian cells. PMID:26601951
NASA Technical Reports Server (NTRS)
Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.
1985-01-01
The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
NASA Technical Reports Server (NTRS)
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution
Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.
2013-01-01
The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742
NASA Technical Reports Server (NTRS)
Broeze, R. J.; Pope, D. H.
1978-01-01
The inhibition of translation which is observed after shifting Escherichia coli to low temperature was investigated. 70 S ribosomes were isolated from E. coli 8 hours after a shift to 5 C synthesized protein in the absence of added mRNA (i.e., endogenous protein synthesis by 70 S monosomes) at a rate which was three times greater than the rate of endogenous protein synthesis by 70 S ribosomes which were isolated at the time of the shift to 5 C. Calculations based on the rates of endogenous protein synthesis and polyphenylalanine synthesis indicate that 70 S monosomes comprise only 0.1% of the total E. coli 70 S ribosome population after 8 hours at 5 c. Experiments designed to test initiation complex formation on ApUpG or formaldehyde treated MS-2 viral RNA demonstrated that, although the rate of formation of 30 S initiation complexes was not inhibited, the rate of formation of active 70 S initiation complexes, able to react with puromycin, was inhibited to a great extent at 5 C. A model depicting the effects of low temperature on the E. coli translation system is proposed.
Structure of ratcheted ribosomes with tRNAs in hybrid states
Julián, Patricia; Konevega, Andrey L.; Scheres, Sjors H. W.; Lázaro, Melisa; Gil, David; Wintermeyer, Wolfgang; Rodnina, Marina V.; Valle, Mikel
2008-01-01
During protein synthesis, tRNAs and mRNA move through the ribosome between aminoacyl (A), peptidyl (P), and exit (E) sites of the ribosome in a process called translocation. Translocation is accompanied by the displacement of the tRNAs on the large ribosomal subunit toward the hybrid A/P and P/E states and by a rotational movement (ratchet) of the ribosomal subunits relative to one another. So far, the structure of the ratcheted state has been observed only when translation factors were bound to the ribosome. Using cryo-electron microscopy and classification, we show here that ribosomes can spontaneously adopt a ratcheted conformation with tRNAs in their hybrid states. The peptidyl-tRNA molecule in the A/P state, which is visualized here, is not distorted compared with the A/A state except for slight adjustments of its acceptor end, suggesting that the displacement of the A-site tRNA on the 50S subunit is passive and is induced by the 30S subunit rotation. Simultaneous subunit ratchet and formation of the tRNA hybrid states precede and may promote the subsequent rapid and coordinated tRNA translocation on the 30S subunit catalyzed by elongation factor G. PMID:18971332
Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA
Ciganda, Martin; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864
Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro
2016-08-26
Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Babina, Arianne M; Parker, Darren J; Li, Gene-Wei; Meyer, Michelle M
2018-06-20
In many bacteria, ribosomal proteins autogenously repress their own expression by interacting with RNA structures typically located in the 5'-UTRs of their mRNA transcripts. This regulation is necessary to maintain a balance between ribosomal proteins and rRNA to ensure proper ribosome production. Despite advances in non-coding RNA discovery and validation of RNA-protein regulatory interactions, the selective pressures that govern the formation and maintenance of such RNA cis-regulators in the context of an organism remain largely undetermined. To examine the impact disruptions to this regulation have on bacterial fitness, we introduced point mutations that abolish ribosomal protein binding and regulation into the RNA structure that controls expression of ribosomal proteins L20 and L35 within the Bacillus subtilis genome. Our studies indicate that removing this regulation results in reduced log phase growth, improper rRNA maturation, and the accumulation of a kinetically trapped or mis-assembled ribosomal particle at low temperatures, suggesting defects in ribosome synthesis. Such work emphasizes the important role regulatory RNAs play in the stoichiometric production of ribosomal components for proper ribosome composition and overall organism viability and reinforces the potential of targeting ribosomal protein production and ribosome assembly with novel antimicrobials. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Polesskaya, Anna; Cuvellier, Sylvain; Naguibneva, Irina; Duquet, Arnaud; Moss, Eric G; Harel-Bellan, Annick
2007-05-01
Lin-28 is a highly conserved, RNA-binding, microRNA-regulated protein that is involved in regulation of developmental timing in Caenorhabditis elegans. In mammals, Lin-28 is stage-specifically expressed in embryonic muscle, neurons, and epithelia, as well as in embryonic carcinoma cells, but is suppressed in most adult tissues, with the notable exception of skeletal and cardiac muscle. The specific function and mechanism of action of Lin-28 are not well understood. Here we used loss-of-function and gain-of-function assays in cultured myoblasts to show that expression of Lin-28 is essential for skeletal muscle differentiation in mice. In order to elucidate the specific function of Lin-28, we used a combination of biochemical and functional assays, which revealed that, in differentiating myoblasts, Lin-28 binds to the polysomes and increases the efficiency of protein synthesis. An important target of Lin-28 is IGF-2, a crucial growth and differentiation factor for muscle tissue. Interaction of Lin-28 with translation initiation complexes in skeletal myoblasts and in the embryonic carcinoma cell line P19 was confirmed by localization of Lin-28 to the stress granules, temporary structures that contain stalled mRNA-protein translation complexes. Our results unravel novel mechanisms of translational regulation in skeletal muscle and suggest that Lin-28 performs the role of "translational enhancer" in embryonic and adult cells and tissues.
An update on sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Van Criekinge, Wim; Menschaert, Gerben
2018-01-04
sORFs.org (http://www.sorfs.org) is a public repository of small open reading frames (sORFs) identified by ribosome profiling (RIBO-seq). This update elaborates on the major improvements implemented since its initial release. sORFs.org now additionally supports three more species (zebrafish, rat and Caenorhabditis elegans) and currently includes 78 RIBO-seq datasets, a vast increase compared to the three that were processed in the initial release. Therefore, a novel pipeline was constructed that also enables sORF detection in RIBO-seq datasets comprising solely elongating RIBO-seq data while previously, matching initiating RIBO-seq data was necessary to delineate the sORFs. Furthermore, a novel noise filtering algorithm was designed, able to distinguish sORFs with true ribosomal activity from simulated noise, consequently reducing the false positive identification rate. The inclusion of other species also led to the development of an inner BLAST pipeline, assessing sequence similarity between sORFs in the repository. Building on the proof of concept model in the initial release of sORFs.org, a full PRIDE-ReSpin pipeline was now released, reprocessing publicly available MS-based proteomics PRIDE datasets, reporting on true translation events. Next to reporting those identified peptides, sORFs.org allows visual inspection of the annotated spectra within the Lorikeet MS/MS viewer, thus enabling detailed manual inspection and interpretation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
2009-01-01
Membrane protein integration occurs predominantly at the endoplasmic reticulum and is mediated by the translocon, which is formed by the Sec61p complex. The translocon binds to the ribosome at the polypeptide exit site such that integration occurs in a cotranslational manner. Ribosomal protein Rpl17 is positioned such that it contacts both the ribosome exit tunnel and the surface of the ribosome near the exit site, where it is intimately associated with the translocon. The presence of a trans-membrane (TM) segment inside the ribosomal exit tunnel leads to the recruitment of RAMP4 to the translocon at a site adjacent to Rpl17. This suggests a signaling function for Rpl17 such that it can recognize a TM segment inside the ribosome and triggers rearrangements of the translocon, priming it for subsequent TM segment integration. PMID:19468070
The nuclear import of ribosomal proteins is regulated by mTOR
Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.
2014-01-01
Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810
Ribosome A and P sites revealed by length analysis of ribosome profiling data
Martens, Andrew T.; Taylor, James; Hilser, Vincent J.
2015-01-01
The high-throughput sequencing of nuclease-protected mRNA fragments bound to ribosomes, a technique known as ribosome profiling, quantifies the relative frequencies with which different regions of transcripts are translated. This technique has revealed novel translation initiation sites with unprecedented scope and has furthered investigations into the connections between codon biases and translation rates. Yet the location of the codon being decoded in ribosome footprints is still unknown, and has been complicated by the recent observation of footprints with non-canonical lengths. Here we show how taking into account the variations in ribosome footprint lengths can reveal the ribosome aminoacyl (A) and peptidyl (P) site locations. These location assignments are in agreement with the proposed mechanisms for various ribosome pauses and further enhance the resolution of the profiling data. We also show that GC-rich motifs at the 5′ ends of footprints are found in yeast, calling into question the anti-Shine-Dalgarno effect's role in ribosome pausing. PMID:25805170
Lupus autoantibodies target ribosomal P proteins
1985-01-01
All nine SLE (systemic lupus erythematosus) sera with antiribosomal antibody activity targeted the same three ribosomal protein antigens, of molecular masses 38 and 17/19 kD when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting. One serum reacted with an additional protein of approximately kD. Ribosomal subunit fractionation by composite gel electrophoresis and sucrose density ultracentrifugation showed that these proteins were part of the large subunit. Isoelectric focusing in agarose, and two-dimensional polyacrylamide gel electrophoresis revealed that the antigens had pI between 4.5 and 6.5, but that the 17/19 kD antigens were more acidic than the 38 kD antigen. Similarities in the molecular masses, charges, as well as the presence of highly conserved crossreactive epitopes, failure to bind to carboxymethylcellulose at pH 4.2, and extractability of the 17/19 kD proteins by 400 mM NH4Cl-ethanol at 0 degrees C indicated that these antigens were analogous to the proteins P0 (38 kD) and P1/P2 (17/19 kD) described previously (25, 36). Co-identity was confirmed using reference antibodies and antigen. Although antibodies to these proteins were only found in 5-10% of more than 50 sera screened by radioimmunoassay or Western blotting, the selective production of antibodies to epitopes on three (out of a total of more than 80) ribosomal proteins may provide further clues to autoantibody induction of SLE. PMID:2410526
Reengineering ribosome export.
Lo, Kai-Yin; Johnson, Arlen W
2009-03-01
Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.
Lo, Kai-Yin
2009-01-01
Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820
An mRNA-Derived Noncoding RNA Targets and Regulates the Ribosome
Pircher, Andreas; Bakowska-Zywicka, Kamilla; Schneider, Lukas; Zywicki, Marek; Polacek, Norbert
2014-01-01
Summary The structural and functional repertoire of small non-protein-coding RNAs (ncRNAs) is central for establishing gene regulation networks in cells and organisms. Here, we show that an mRNA-derived 18-nucleotide-long ncRNA is capable of downregulating translation in Saccharomyces cerevisiae by targeting the ribosome. This 18-mer ncRNA binds to polysomes upon salt stress and is crucial for efficient growth under hyperosmotic conditions. Although the 18-mer RNA originates from the TRM10 locus, which encodes a tRNA methyltransferase, genetic analyses revealed the 18-mer RNA nucleotide sequence, rather than the mRNA-encoded enzyme, as the translation regulator. Our data reveal the ribosome as a target for a small regulatory ncRNA and demonstrate the existence of a yet unkown mechanism of translation regulation. Ribosome-targeted small ncRNAs are found in all domains of life and represent a prevalent but so far largely unexplored class of regulatory molecules. PMID:24685157
Gamalinda, Michael; Woolford, John L
2014-11-01
Numerous ribosomal proteins have a striking bipartite architecture: a globular body positioned on the ribosomal exterior and an internal loop buried deep into the rRNA core. In eukaryotes, a significant number of conserved r-proteins have evolved extra amino- or carboxy-terminal tail sequences, which thread across the solvent-exposed surface. The biological importance of these extended domains remains to be established. In this study, we have investigated the universally conserved internal loop and the eukaryote-specific extensions of yeast L4. We show that in contrast to findings with bacterial L4, deleting the internal loop of yeast L4 causes severely impaired growth and reduced levels of large ribosomal subunits. We further report that while depleting the entire L4 protein blocks early assembly steps in yeast, deletion of only its extended internal loop affects later steps in assembly, revealing a second role for L4 during ribosome biogenesis. Surprisingly, deletion of the entire eukaryote-specific carboxy-terminal tail of L4 has no effect on viability, production of 60S subunits, or translation. These unexpected observations provide impetus to further investigate the functions of ribosomal protein extensions, especially eukaryote-specific examples, in ribosome assembly and function. © 2014 Gamalinda and Woolford; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Panina, Ekaterina M; Mironov, Andrey A; Gelfand, Mikhail S
2003-08-19
Zinc is an important component of many proteins, but in large concentrations it is poisonous to the cell. Thus its transport is regulated by zinc repressors ZUR of proteobacteria and Gram-positive bacteria from the Bacillus group and AdcR of bacteria from the Streptococcus group. Comparative computational analysis allowed us to identify binding signals of ZUR repressors GAAATGTTATANTATAACATTTC for gamma-proteobacteria, GTAATGTAATAACATTAC for the Agrobacterium group, GATATGTTATAACATATC for the Rhododoccus group, TAAATCGTAATNATTACGATTTA for Gram-positive bacteria, and TTAACYRGTTAA of the streptococcal AdcR repressor. In addition to known transporters and their paralogs, zinc regulons were predicted to contain a candidate component of the ATP binding cassette, zinT (b1995 in Escherichia coli and yrpE in Bacillus subtilis). Candidate AdcR-binding sites were identified upstream of genes encoding pneumococcal histidine triad (PHT) proteins from a number of pathogenic streptococci. Protein functional analysis of this family suggests that PHT proteins are involved in the invasion process. Finally, repression by zinc was predicted for genes encoding a variety of paralogs of ribosomal proteins. The original copies of all these proteins contain zinc-ribbon motifs and thus likely bind zinc, whereas these motifs are destroyed in zinc-regulated paralogs. We suggest that the induction of these paralogs in conditions of zinc starvation leads to their incorporation in a fraction of ribosomes instead of the original ribosomal proteins; the latter are then degraded with subsequent release of some zinc for the utilization by other proteins. Thus we predict a mechanism for maintaining zinc availability for essential enzymes.
S28 peptidases: lessons from a seemingly 'dysfunctional' family of two.
Kozarich, John W
2010-06-28
A recent paper in BMC Structural Biology reports the crystal structure of human prolylcarboxypeptidase (PRCP), one of the two members of the S28 peptidase family. Comparison of the substrate-binding site of PRCP with that of its family partner, dipeptidyl dipeptidase 7 (DPP7), helps to explain the different enzymatic activities of these structurally similar proteins, and also reveals a novel apparent charge-relay system in PRCP involving the active-site catalytic histidine. See research article: http://www.biomedcentral.com/1472-6807/10/16/
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gurel, G.; Blaha, G; Moore, P
2009-01-01
Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In themore » ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.« less
Kinase Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer
2017-02-01
Ribosome assembly • Autophagy • CRISPR /Cas9 6 ACCOMPLISHMENTS Major goals The major goals in this reporting period were to use the CRISPR ...defects on ribosome assembly, drug sensitivity etc. Accomplishments under these goals To set up the CRISPR /Cas9 experiment, the Karbstein...recombinant Cas9, and then assayed CRISPR /Cas9 mediated cleavage of a PCR-generated DNA. This demonstrated that the guide RNAs we had designed based on
Zhao, Song; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Pu, Feifei; Ma, Dongchu
2016-10-01
Objective To investigate the regulatory effect of post-translation modification of ribosomal protein S6 kinase 1 (S6K1) on the polyploidization of megakaryocytes. Methods SP600125, a c-Jun N-terminal kinase (JNK) inhibitor, and H-89, a cAMP-dependent protein kinase (PKA) inhibitor, were used to treat CMK cells separately or in combination. With propidium iodide (PI) to dye DNA in the treated cells, the relative DNA content was detected by flow cytometry, and then the DNA polyploidy was analyzed. The change of expression and phosphorylation of ribosomal protein S6 kinase 1 (S6K1), an important mammalian target of rapamycin (mTOR) downstream target molecule, was analyzed by Western blotting. Molecular docking study and kinase activity assay were performed to analyze the combination of H-89 with S6K1 and the effect of H-89 on the activity of S6K1 kinase. Results SP600125 induced CMK cell polyploidization in a time-dependent and dose-dependent manner. At the same time, it increased the phosphorylation of S6K1 at Thr421/Ser424 and decreased the phosphorylation of S6K1 at Thr389. H-89 not only blocked polyploidization, but also decreased the phosphorylation of S6K1 at Thr421/Ser424 and increased the phosphorylation of S6K1 at Thr389. Molecular docking and kinase activity assay showed that H-89 occupied the ATP binding sites of S6K1 and inhibited its activity. Noticeably, both H-89 and SP600125 inhibited the activity of PKA. Moreover, the two drugs further inhibited the activity of PKA when used together. Therefore, these data indicated that H-89 blocked the SP600125-induced polyploidization of CMK cells mainly by changing S6K1 phosphorylation state, rather than its inhibitory effect on PKA. Conclusion H-89 can block the polyploidization of SP600125-induced CMK cells by regulating S6K1 phosphorylation state.
Comparative study between prokaryotes and eukaryotes by chemical iodination of ribosomal proteins.
Bernabeu, C; Vázquez, D; Conde, F P
1979-04-25
Escherichia coli and Saccharomyces cerevisiae ribosomal proteins were chemically iodinated with 125I by chloramine T under conditions in which the proteins were denatured. The labelled proteins were subsequently separated by two-dimensional gel electrophoresis with an excess of untreated ribosomal proteins from the same species. The iodination did not change the electrophoretic mobility of the proteins as shown by the pattern of spots in the stained gel slabs and their autoradiography. The 125I radioactivity incorporated in the proteins was estimated by cutting out the gel spots from the two-dimensional electrophoresis gel slabs. The highest content of 125I was found in the ribosomal proteins L2, L11, L13, L20/S12, S4 and S9 from E. coli, and L2/L3, L4/L6/S7, L5, L19/L20, L22/S17, L29/S27, L35/L37 and S14/S15 from S. cerevisiae. Comparisons between the electrophoretic patterns of E. coli and S. cerevisiae ribosomal proteins were carried out by coelectrophoresis of labelled and unlabelled proteins from both species. E. coli ribosomal proteins L5, L11, L20, S2, S3 and S15/S16 were found to overlap with L15, L11/L16, L36/L37, S3, S10 and S33 from S. cerevisiae, respectively. Similar coelectrophoresis of E. coli 125I-labelled proteins with unlabelled rat liver and wheat germ ribosomal proteins showed the former to overlap with proteins L1, L11, L14, L16, L19, L20 and the latter with L2, L5, L6, L15, L17 from E. coli.
Andersen, Niels Møller; Poehlsgaard, Jacob; Warrass, Ralf
2012-01-01
Tildipirosin is a 16-membered-ring macrolide developed to treat bacterial pathogens, including Mannheimia haemolytica and Pasteurella multocida, that cause respiratory tract infections in cattle and swine. Here we evaluated the efficacy of tildipirosin at inhibiting protein synthesis on the ribosome (50% inhibitory concentration [IC50], 0.23 ± 0.01 μM) and compared it with the established veterinary macrolides tylosin, tilmicosin, and tulathromycin. Mutation and methylation at key rRNA nucleotides revealed differences in the interactions of these macrolides within their common ribosomal binding site. PMID:22926570
Locke, Jeffrey B.; Hilgers, Mark; Shaw, Karen Joy
2009-01-01
Following recent reports of ribosomal protein L3 mutations in laboratory-derived linezolid-resistant (LZDr) Staphylococcus aureus, we investigated whether similar mutations were present in LZDr staphylococci of clinical origin. Sequence analysis of a variety of LZDr isolates revealed two L3 mutations, ΔSer145 (S. aureus NRS127) and Ala157Arg (Staphylococcus epidermidis 1653059), both occurring proximal to the oxazolidinone binding site in the peptidyl transferase center. The oxazolidinone torezolid maintained a ≥8-fold potency advantage over linezolid for both strains. PMID:19805557
Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus.
Jahn, O; Hartmann, R K; Boeckh, T; Erdmann, V A
1991-06-01
The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.
Functional dynamics within the human ribosome regulate the rate of active protein synthesis
Ferguson, Angelica; Wang, Leyi; Altman, Roger B.; Terry, Daniel S.; Juette, Manuel F.; Burnett, Benjamin J.; Alejo, Jose L.; Dass, Randall A.; Parks, Matthew M.; Vincent, Theresa C.; Blanchard, Scott C.
2015-01-01
SUMMARY The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule FRET methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. PMID:26593721
Fernandez-Pol, J Alberto
2016-01-01
The ribosomal protein metallopanstimulin-1 (MPS1/S27) serves critical survival purposes in cell division, in normal and cancerous cells; for this reason, selective pressures of evolution have conserved the DNA sequences encoding MPS1/S27 in Archaea and Eukariotic cells. The expression of MPS1/S27 protein in human adult cerebellum has not been established. The presence of MPS1/S27, was screened in paraffin-embedded human adult brain specimens processed for tissue inmunohistochemistry. Affinity-purified specific antibodies were directed against the N-terminus of MPS1. The antibodies to MPS1 detected Purkinje cells (PC) and their dendrites. In PC, MPS1 antigen-positive staining was found in: the nucleolus, which was strongly stained; ribosomes attached to the external nuclear membrane; cytoplasm of PC, with strong staining in a punctuate fashion; the soma-attached large dendrite trunks of PC, which were MPS1 antigen-positive; and the granular cell layer, where cellular staining in a few cells that appeared to resemble smaller PC was observed. Since MPS1 is involved in cell division, DNA repair, and ribosomal biogenesis, it may be a useful antigen for studying processes such as protein synthesis, oncogenesis, regeneration, aging, and perhaps diseases of the human cerebellum. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.
Jayawickrama, D A; Larive, C K
1999-06-01
The binding of a small molecule, (trimethylsilyl)propionic acid (TSP), to a 17-residue peptide, β(12-28), is examined using (1)H NMR spectroscopy. β(12-28) (VHHQKLVFFAEDVGSNK) is a central fragment of the 40-42-residue Alzheimer's-associated Aβ peptide. This peptide has been previously shown to form soluble aggregates in low-pH aqueous solution. The TSP resonance is broadened appreciably in solutions containing relatively high concentrations (∼2 mM) of the peptide. The changes in TSP line width measured by titration of a peptide solution with TSP indicate a 1:1 binding stoichiometry. If the concentrations of both the peptide and TSP are reduced by 1 order of magnitude, the resonances of both species are sharp, suggesting that TSP binds predominately to the aggregated peptide. Nuclear Overhauser effect experiments indicate that the TSP interacts predominately with the side chains of the aliphatic peptide residues Leu(17) and Val(18). Pulsed-field gradient NMR measurements of TSP and peptide diffusion coefficients provide a more quantitative picture of the TSP-peptide binding equilibrium. The measured diffusion coefficients were used to calculate the fractions of the free and bound TSP. These results substantiate the conclusion that the stoichiometry of the TSP-peptide binding equilibrium is essentially 1:1 and further indicate anticooperative behavior in solutions containing an excess of TSP resulting in a dissociation of the peptide aggregates.
Lin, A; McNally, J; Wool, I G
1983-09-10
The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.
Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA
Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.
2015-01-01
Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222
Mallik, Saurav; Kundu, Sudip
2013-01-01
Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU). Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA) is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs) in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins) have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli) are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder) at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend. PMID:23940533
Mazzoleni, Sofia; Rovatsos, Michail; Schillaci, Odessa; Dumas, Francesca
2018-01-01
Abstract We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH) in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876) (Scandentia), in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates. PMID:29416829
The ribosomal subunit assembly line
Dlakić, Mensur
2005-01-01
Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363
Yates, J L; Arfsten, A E; Nomura, M
1980-01-01
Escherichia coli ribosomal protein L1 (0.5 micro M) was found to inhibit the synthesis of both proteins of the L11 operon, L11 and L1, but not the synthesis of other proteins directed by lambda rifd 18 DNA. Similarly, S4 (1 micro M) selectively inhibited the synthesis of three proteins of the alpha operon, S13, S11, and S4, directed by lambda spcI DNA or a restriction enzyme fragment obtained from this DNA. S8 (3.6 micro M) also showed preferential inhibitory effects on the synthesis of some proteins encoded in the spc operon, L24 and L5 (and probably S14 and S8), directed by lambda spcl DNA or a restriction enzyme fragment carrying the genes for these proteins. The inhibitory effect of L1 was observed only with L1 and not with other proteins examined, including S4 and S8. Similarly, the effect of S4 was not observed with L1 or S8, and that of S8 was not seen with L1 or S4. Inhibition was shown to take place at the level of translation rather than transcription. Thus, at least some ribosomal proteins (L1 S4, and S8) have the ability to cause selective translational inhibition of the synthesis of certain ribosomal proteins whose genes are in the same operon as their own. These results support the hypothesis that certain free ribosomal proteins not assembled into ribosomes act as "autogenous" feedback inhibitors to regulate the synthesis of ribosomal proteins. Images PMID:6445562
[Immunochemistry of eukaryotic ribosomes].
Lopaczyński, W; Gałasiński, W
1990-01-01
Immunochemical investigations of ribosomes should correlate with basic knowledge of the function, structure and activity of organelles in the cell processes. Our paper presents data of immunochemical methods used to determine the structure, function and differences of ribosomes. We present the usefulness of immunochemical methods to test human ribosomes, diagnosis and therapy of many diseases.
Vendeix, Franck A P; Murphy, Frank V; Cantara, William A; Leszczyńska, Grażyna; Gustilo, Estella M; Sproat, Brian; Malkiewicz, Andrzej; Agris, Paul F
2012-03-02
Human tRNA(Lys3)(UUU) (htRNA(Lys3)(UUU)) decodes the lysine codons AAA and AAG during translation and also plays a crucial role as the primer for HIV-1 (human immunodeficiency virus type 1) reverse transcription. The posttranscriptional modifications 5-methoxycarbonylmethyl-2-thiouridine (mcm(5)s(2)U(34)), 2-methylthio-N(6)-threonylcarbamoyladenosine (ms(2)t(6)A(37)), and pseudouridine (Ψ(39)) in the tRNA's anticodon domain are critical for ribosomal binding and HIV-1 reverse transcription. To understand the importance of modified nucleoside contributions, we determined the structure and function of this tRNA's anticodon stem and loop (ASL) domain with these modifications at positions 34, 37, and 39, respectively (hASL(Lys3)(UUU)-mcm(5)s(2)U(34);ms(2)t(6)A(37);Ψ(39)). Ribosome binding assays in vitro revealed that the hASL(Lys3)(UUU)-mcm(5)s(2)U(34);ms(2)t(6)A(37);Ψ(39) bound AAA and AAG codons, whereas binding of the unmodified ASL(Lys3)(UUU) was barely detectable. The UV hyperchromicity, the circular dichroism, and the structural analyses indicated that Ψ(39) enhanced the thermodynamic stability of the ASL through base stacking while ms(2)t(6)A(37) restrained the anticodon to adopt an open loop conformation that is required for ribosomal binding. The NMR-restrained molecular-dynamics-derived solution structure revealed that the modifications provided an open, ordered loop for codon binding. The crystal structures of the hASL(Lys3)(UUU)-mcm(5)s(2)U(34);ms(2)t(6)A(37);Ψ(39) bound to the 30S ribosomal subunit with each codon in the A site showed that the modified nucleotides mcm(5)s(2)U(34) and ms(2)t(6)A(37) participate in the stability of the anticodon-codon interaction. Importantly, the mcm(5)s(2)U(34)·G(3) wobble base pair is in the Watson-Crick geometry, requiring unusual hydrogen bonding to G in which mcm(5)s(2)U(34) must shift from the keto to the enol form. The results unambiguously demonstrate that modifications pre-structure the anticodon as a key
Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei
Kamina, Anyango D.; Jaremko, Daniel; Christen, Linda
2017-01-01
ABSTRACT Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei, the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T. brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei. IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as
Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.
Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen
2017-01-01
Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of
Turkina, Maria V; Klang Årstrand, Hanna; Vener, Alexander V
2011-01-01
Protein synthesis in plants is characterized by increase in the translation rates for numerous proteins and central metabolic enzymes during the day phase of the photoperiod. The detailed molecular mechanisms of this diurnal regulation are unknown, while eukaryotic protein translation is mainly controlled at the level of ribosomal initiation complexes, which also involves multiple events of protein phosphorylation. We characterized the extent of protein phosphorylation in cytosolic ribosomes isolated from leaves of the model plant Arabidopsis thaliana harvested during day or night. Proteomic analyses of preparations corresponding to both phases of the photoperiod detected phosphorylation at eight serine residues in the C-termini of six ribosomal proteins: S2-3, S6-1, S6-2, P0-2, P1 and L29-1. This included previously unknown phosphorylation of the 40S ribosomal protein S6 at Ser-231. Relative quantification of the phosphorylated peptides using stable isotope labeling and mass spectrometry revealed a 2.2 times increase in the day/night phosphorylation ratio at this site. Phosphorylation of the S6-1 and S6-2 variants of the same protein at Ser-240 increased by the factors of 4.2 and 1.8, respectively. The 1.6 increase in phosphorylation during the day was also found at Ser-58 of the 60S ribosomal protein L29-1. It is suggested that differential phosphorylation of the ribosomal proteins S6-1, S6-2 and L29-1 may contribute to modulation of the diurnal protein synthesis in plants.
Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsurugi, K.; Motizuki, M.; Mitsui, K.
1988-01-01
When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were /sup 3/H-labeled in vitro and injected back into X. laevis oocytes, most /sup 3/H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, /sup 3/H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of /sup 3/H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide,more » a cysteine protease inhibitor, resulting in the accumulation of /sup 3/H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus.« less
ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.
Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J
2016-03-22
Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.
Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.
Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C
2015-11-05
The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.
Deforges, Jules; de Breyne, Sylvain; Ameur, Melissa; Ulryck, Nathalie; Chamond, Nathalie; Saaidi, Afaf; Ponty, Yann; Ohlmann, Theophile; Sargueil, Bruno
2017-07-07
In the late phase of the HIV virus cycle, the unspliced genomic RNA is exported to the cytoplasm for the necessary translation of the Gag and Gag-pol polyproteins. Three distinct translation initiation mechanisms ensuring Gag production have been described with little rationale for their multiplicity. The Gag-IRES has the singularity to be located within Gag ORF and to directly interact with ribosomal 40S. Aiming at elucidating the specificity and the relevance of this interaction, we probed HIV-1 Gag-IRES structure and developed an innovative integrative modelling strategy to take into account all the gathered information. We propose a novel Gag-IRES secondary structure strongly supported by all experimental data. We further demonstrate the presence of two regions within Gag-IRES that independently and directly interact with the ribosome. Importantly, these binding sites are functionally relevant to Gag translation both in vitro and ex vivo. This work provides insight into the Gag-IRES molecular mechanism and gives compelling evidence for its physiological importance. It allows us to propose original hypotheses about the IRES physiological role and conservation among primate lentiviruses. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.
Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G
1987-11-01
Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.
Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E
2015-03-20
Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.
Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L
2017-11-01
Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In
Cis-regulatory RNA elements that regulate specialized ribosome activity.
Xue, Shifeng; Barna, Maria
2015-01-01
Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.
Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro
2014-11-01
Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.
Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448
Li, Bin; Pacey, Marissa P.
2017-01-01
We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308
Phosphorylation of ribosomal protein S6 mediates compensatory renal hypertrophy
Xu, Jinxian; Chen, Jianchun; Dong, Zheng; Meyuhas, Oded; Chen, Jian-Kang
2014-01-01
The molecular mechanism underlying renal hypertrophy and progressive nephron damage remains poorly understood. Here we generated congenic ribosomal protein S6 (rpS6) knockin mice expressing non-phosphorylatable rpS6 and found that uninephrectomy-induced renal hypertrophy was significantly blunted in these knockin mice. Uninephrectomy-induced increases in cyclin D1 and decreases in cyclin E in the remaining kidney were attenuated in the knockin mice compared to their wild-type littermates. Uninephrectomy induced rpS6 phosphorylation in the wild type mice; however, no rpS6 phosphorylation was detected in uninephrectomized or sham-operated knockin mice. Nonetheless, uninephrectomy stimulated comparable 4E-BP1 phosphorylation in both knockin and wild type mice, indicating that mTORC1 was still activated in the knockin mice. Moreover, the mTORC1 inhibitor rapamycin prevented both rpS6 and 4E-BP1 phosphorylation, significantly blunted uninephrectomy-induced renal hypertrophy in wild type mice, but did not prevent residual renal hypertrophy despite inhibiting 4E-BP1 phosphorylation in uninephrectomized knockin mice. Thus, both genetic and pharmacological approaches unequivocally demonstrate that phosphorylated rpS6 is a downstream effector of the mTORC1-S6K1 signaling pathway mediating renal hypertrophy. Hence, rpS6 phosphorylation facilitates the increase in cyclin D1 and decrease in cyclin E1 that underlie the hypertrophic nature of uninephrectomy-induced kidney growth. PMID:25229342
Ponti, Donatella; Bellenchi, Gian Carlo; Puca, Rosa; Bastianelli, Daniela; Maroder, Marella; Ragona, Giuseppe; Roussel, Pascal; Thiry, Marc; Mercola, Dan; Calogero, Antonella
2014-01-01
EGR1 is an immediate early gene with a wide range of activities as transcription factor, spanning from regulation of cell growth to differentiation. Numerous studies show that EGR1 either promotes the proliferation of stimulated cells or suppresses the tumorigenic growth of transformed cells. Upon interaction with ARF, EGR1 is sumoylated and acquires the ability to bind to specific targets such as PTEN and in turn to regulate cell growth. ARF is mainly localized to the periphery of nucleolus where is able to negatively regulate ribosome biogenesis. Since EGR1 colocalizes with ARF under IGF-1 stimulation we asked the question of whether EGR1 also relocate to the nucleolus to interact with ARF. Here we show that EGR1 colocalizes with nucleolar markers such as fibrillarin and B23 in the presence of ARF. Western analysis of nucleolar extracts from HeLa cells was used to confirm the presence of EGR1 in the nucleolus mainly as the 100 kDa sumoylated form. We also show that the level of the ribosomal RNA precursor 47S is inversely correlated to the level of EGR1 transcripts. The EGR1 iseffective to regulate the synthesis of the 47S rRNA precursor. Then we demonstrated that EGR1 binds to the Upstream Binding Factor (UBF) leading us to hypothesize that the regulating activity of EGR1 is mediated by its interaction within the transcriptional complex of RNA polymerase I. These results confirm the presence of EGR1 in the nucleolus and point to a role for EGR1 in the control of nucleolar metabolism.
Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C
1988-01-01
We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025
Picking, W D; Hackstadt, T; Paretsky, D
1989-01-01
Guinea pig endotoxicosis induced by lipopolysaccharide from Coxiella burnetii Nine Mile phase I stimulates phosphorylation of liver ribosomal protein S6, with a 50% increase at 12 h postinoculation. The responsible protein kinase (S6PK) has been partially purified from liver; its activity is independent of cyclic AMP and of Ca2+ plus phosphatidyl serine or diacylglycerol. The preparation has an apparent optimum concentration of 20 mM Mg2+, while Ca2+ and Mn2+ are each inhibitory at 2 mM. The apparent Km for ATP is 30 microM with intact ribosomes. Because of the central role of phosphorylation in metabolic regulation and a purported role of phosphorylated S6 in protein synthesis, the lipopolysaccharide-induced stimulation of S6PK suggests a significant regulatory role of such enzymes in the pathobiochemistry of Q fever infection and endotoxicosis. Images PMID:2807543
USDA-ARS?s Scientific Manuscript database
The present molecular-systematic and phylogeographic analysis is based on sequences of cytochrome c oxidase subunit 1 (cox1) (mtDNA) and 28S ribosomal DNA, and includes 59 isolates of cestodes of the genus Anoplocephaloides Baer, 1923 s. s. (Cyclophyllidea, Anoplocephalidae) from arvicoline rodents ...
Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R
2006-01-01
As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome
Inhibition of eukaryotic translation elongation by the antitumor natural product Mycalamide B.
Dang, Yongjun; Schneider-Poetsch, Tilman; Eyler, Daniel E; Jewett, John C; Bhat, Shridhar; Rawal, Viresh H; Green, Rachel; Liu, Jun O
2011-08-01
Mycalamide B (MycB) is a marine sponge-derived natural product with potent antitumor activity. Although it has been shown to inhibit protein synthesis, the molecular mechanism of action by MycB remains incompletely understood. We verified the inhibition of translation elongation by in vitro HCV IRES dual luciferase assays, ribosome assembly, and in vivo [(35)S]methinione labeling experiments. Similar to cycloheximide (CHX), MycB inhibits translation elongation through blockade of eEF2-mediated translocation without affecting the eEF1A-mediated loading of tRNA onto the ribosome, AUG recognition, or dipeptide synthesis. Using chemical footprinting, we identified the MycB binding site proximal to the C3993 28S rRNA residue on the large ribosomal subunit. However, there are also subtle, but significant differences in the detailed mechanisms of action of MycB and CHX. First, MycB arrests the ribosome on the mRNA one codon ahead of CHX. Second, MycB specifically blocked tRNA binding to the E-site of the large ribosomal subunit. Moreover, they display different polysome profiles in vivo. Together, these observations shed new light on the mechanism of inhibition of translation elongation by MycB.
Kawanami, Toshinori; Yatera, Kazuhiro; Yamasaki, Kei; Noguchi, Shingo; Fukuda, Kazumasa; Akata, Kentarou; Naito, Keisuke; Kido, Takashi; Ishimoto, Hiroshi; Taniguchi, Hatsumi; Mukae, Hiroshi
2016-04-16
Determining whether methicillin-resistant Staphylococcus aureus (MRSA) is a true causative pathogen or reflective of colonization when MRSA is cultured from the respiratory tract remains important in treating patients with pneumonia. We evaluated the bacterial microbiota in bronchoalveolar lavage fluid (BALF) using the clone library method with a 16S ribosomal RNA (rRNA) gene analysis in 42 patients from a pneumonia registry who had MRSA cultured from their sputum or BALF samples. Patients were divided into two groups: those treated with (Group A) or without (Group B) anti-MRSA agents, and their clinical features were compared. Among 248 patients with pneumonia, 42 patients who had MRSA cultured from the respiratory tract were analyzed (Group A: 13 patients, Group B: 29 patients). No clones of S. aureus were detected in the BALF of 20 out of 42 patients. Twenty-eight of 29 patients in Group B showed favorable clinical outcomes, indicating that these patients had non-MRSA pneumonia. Using a microflora analysis of the BALF, the S. aureus phylotype was predominant in 5 of 28 (17.9%) patients among the detected bacterial phylotypes, but a minor population (the percentage of clones ≤ 10%) in 19 (67.9%) of 28 patients. A statistical analysis revealed no positive relationship between the percentage of clones of the S. aureus phylotype and risk factors of MRSA pneumonia. The molecular method using BALF specimens suggests that conventional cultivation method results may mislead true causative pathogens, especially in patients with MRSA pneumonia. Further studies are necessary to elucidate these clinically important issues.
Nowak, Jakub Stanislaw; Hobor, Fruzsina; Downie Ruiz Velasco, Angela; Choudhury, Nila Roy; Heikel, Gregory; Kerr, Alastair; Ramos, Andres; Michlewski, Gracjan
2017-03-01
Lin28a inhibits the biogenesis of let-7 miRNAs by triggering the polyuridylation and degradation of their precursors by terminal uridylyltransferases TUT4/7 and 3'-5' exoribonuclease Dis3l2, respectively. Previously, we showed that Lin28a also controls the production of neuro-specific miRNA-9 via a polyuridylation-independent mechanism. Here we reveal that the sequences and structural characteristics of pre-let-7 and pre-miRNA-9 are eliciting two distinct modes of binding to Lin28a. We present evidence that Dis3l2 controls miRNA-9 production. Finally, we show that the constitutive expression of untagged Lin28a during neuronal differentiation in vitro positively and negatively affects numerous other miRNAs. Our findings shed light on the role of Lin28a in differentiating cells and on the ways in which one RNA-binding protein can perform multiple roles in the regulation of RNA processing. © 2017 Nowak et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.
Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao
2016-04-01
RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.
The ribosome as a missing link in the evolution of life.
Root-Bernstein, Meredith; Root-Bernstein, Robert
2015-02-21
Many steps in the evolution of cellular life are still mysterious. We suggest that the ribosome may represent one important missing link between compositional (or metabolism-first), RNA-world (or genes-first) and cellular (last universal common ancestor) approaches to the evolution of cells. We present evidence that the entire set of transfer RNAs for all twenty amino acids are encoded in both the 16S and 23S rRNAs of Escherichia coli K12; that nucleotide sequences that could encode key fragments of ribosomal proteins, polymerases, ligases, synthetases, and phosphatases are to be found in each of the six possible reading frames of the 16S and 23S rRNAs; and that every sequence of bases in rRNA has information encoding more than one of these functions in addition to acting as a structural component of the ribosome. Ribosomal RNA, in short, is not just a structural scaffold for proteins, but the vestigial remnant of a primordial genome that may have encoded a self-organizing, self-replicating, auto-catalytic intermediary between macromolecules and cellular life. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Liberman, Joseph A.; Suddala, Krishna C.; Aytenfisu, Asaminew; Chan, Dalen; Belashov, Ivan A.; Salim, Mohammad; Mathews, David H.; Spitale, Robert C.; Walter, Nils G.; Wedekind, Joseph E.
2015-01-01
PreQ1-III riboswitches are newly identified RNA elements that control bacterial genes in response to preQ1 (7-aminomethyl-7-deazaguanine), a precursor to the essential hypermodified tRNA base queuosine. Although numerous riboswitches fold as H-type or HLout-type pseudoknots that integrate ligand-binding and regulatory sequences within a single folded domain, the preQ1-III riboswitch aptamer forms a HLout-type pseudoknot that does not appear to incorporate its ribosome-binding site (RBS). To understand how this unusual organization confers function, we determined the crystal structure of the class III preQ1 riboswitch from Faecalibacterium prausnitzii at 2.75 Å resolution. PreQ1 binds tightly (KD,app 6.5 ± 0.5 nM) between helices P1 and P2 of a three-way helical junction wherein the third helix, P4, projects orthogonally from the ligand-binding pocket, exposing its stem-loop to base pair with the 3′ RBS. Biochemical analysis, computational modeling, and single-molecule FRET imaging demonstrated that preQ1 enhances P4 reorientation toward P1–P2, promoting a partially nested, H-type pseudoknot in which the RBS undergoes rapid docking (kdock ∼0.6 s−1) and undocking (kundock ∼1.1 s−1). Discovery of such dynamic conformational switching provides insight into how a riboswitch with bipartite architecture uses dynamics to modulate expression platform accessibility, thus expanding the known repertoire of gene control strategies used by regulatory RNAs. PMID:26106162
In vitro degradation of ribosomes.
Mora, G; Rivas, A
1976-12-01
The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.
Trans‐acting translational regulatory RNA binding proteins
Harvey, Robert F.; Smith, Tom S.; Mulroney, Thomas; Queiroz, Rayner M. L.; Pizzinga, Mariavittoria; Dezi, Veronica; Villenueva, Eneko; Ramakrishna, Manasa
2018-01-01
The canonical molecular machinery required for global mRNA translation and its control has been well defined, with distinct sets of proteins involved in the processes of translation initiation, elongation and termination. Additionally, noncanonical, trans‐acting regulatory RNA‐binding proteins (RBPs) are necessary to provide mRNA‐specific translation, and these interact with 5′ and 3′ untranslated regions and coding regions of mRNA to regulate ribosome recruitment and transit. Recently it has also been demonstrated that trans‐acting ribosomal proteins direct the translation of specific mRNAs. Importantly, it has been shown that subsets of RBPs often work in concert, forming distinct regulatory complexes upon different cellular perturbation, creating an RBP combinatorial code, which through the translation of specific subsets of mRNAs, dictate cell fate. With the development of new methodologies, a plethora of novel RNA binding proteins have recently been identified, although the function of many of these proteins within mRNA translation is unknown. In this review we will discuss these methodologies and their shortcomings when applied to the study of translation, which need to be addressed to enable a better understanding of trans‐acting translational regulatory proteins. Moreover, we discuss the protein domains that are responsible for RNA binding as well as the RNA motifs to which they bind, and the role of trans‐acting ribosomal proteins in directing the translation of specific mRNAs. This article is categorized under: 1RNA Interactions with Proteins and Other Molecules > RNA–Protein Complexes2Translation > Translation Regulation3Translation > Translation Mechanisms PMID:29341429
HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove
Filbin, Megan E.; Kieft, Jeffrey S.
2011-01-01
Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem–loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem–loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis. PMID:21606179
HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.
Filbin, Megan E; Kieft, Jeffrey S
2011-07-01
Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis.
Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S
2008-07-01
Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.
A ribosome-dependent GTPase from yeast distinct from elongation factor 2.
Skogerson, L; Wakatama, E
1976-01-01
Three proteins required for poly(U)-directed polyphenylalanine synthesis have been separated from yeast. Two of the factors correspond to the elongation factors 1 and 2 described for other eukaryotic systems, according to the criteria of phenylalanyl-tRNA binding and diphtheria toxin-catalyzed ADP-ribosylation. The third protein, while absolutely required for polyphenylalanine synthesis, was a more active ribosome-dependent GTPase than elongation factor 2. PMID:174100
Ullers, Ronald S.; Houben, Edith N.G.; Raine, Amanda; ten Hagen-Jongman, Corinne M.; Ehrenberg, Måns; Brunner, Joseph; Oudega, Bauke; Harms, Nellie; Luirink, Joen
2003-01-01
As newly synthesized polypeptides emerge from the ribosome, they interact with chaperones and targeting factors that assist in folding and targeting to the proper location in the cell. In Escherichia coli, the chaperone trigger factor (TF) binds to nascent polypeptides early in biosynthesis facilitated by its affinity for the ribosomal proteins L23 and L29 that are situated around the nascent chain exit site on the ribosome. The targeting factor signal recognition particle (SRP) interacts specifically with the signal anchor (SA) sequence in nascent inner membrane proteins (IMPs). Here, we have used photocross-linking to map interactions of the SA sequence in a short, in vitro–synthesized, nascent IMP. Both TF and SRP were found to interact with the SA with partially overlapping binding specificity. In addition, extensive contacts with L23 and L29 were detected. Both purified TF and SRP could be cross-linked to L23 on nontranslating ribosomes with a competitive advantage for SRP. The results suggest a role for L23 in the targeting of IMPs as an attachment site for TF and SRP that is close to the emerging nascent chain. PMID:12756233
Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B
1982-01-01
1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129
Occhipinti, Laura; Chang, Yiming; Altvater, Martin; Menet, Anna M.; Kemmler, Stefan; Panse, Vikram G.
2013-01-01
Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a second surface that makes non-FG contacts with the nucleoporin Nup116. A basic patch mutant of Gle2 is able to function in mRNA export, but not pre-60S export. Thus, Gle2 provides a distinct interaction platform to transport pre-60S to the cytoplasm. Notably, Gle2’s interaction platforms become crucial for pre-60S export when FG-interacting receptors are either not recruited to pre-60S or are impaired. We propose that large complex cargos rely on non-FG as well as FG-interactions for their efficient translocation through the nuclear pore complex channel. PMID:23907389
Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia
2014-01-01
Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678
Sugihara, Yoshihiko; Honda, Hiroki; Iida, Tomoharu; Morinaga, Takuma; Hino, Shingo; Okajima, Tetsuya; Matsuda, Tsukasa; Nadano, Daita
2010-03-05
Heterogeneity of ribosome structure, due to variations in ribosomal protein composition, has been shown to be of physiological significance in plants and yeast. Mammalian genomics have demonstrated numerous genes that are paralogous to genes encoding ribosomal proteins. Although the vast majority are considered to be pseudogenes, mRNA expression of a few paralogues, such as human ribosomal protein L39-like/L39-2, has been reported. In the present study, ribosomes from the liver, mammary gland, and testis of rodents were analyzed using a combination of two-dimensional gel electrophoresis under radical-free and highly reducing conditions, and mass spectrometry. This system allowed identification of 78 ribosomal proteins and Rack1 from a single gel. The degree of heterogeneity was far less than that reported for plant and yeast ribosomes, and was in accord with published biochemical and genetic data for mammalian ribosomes. Nevertheless, an uncharacterized paralogue of ribosomal protein L22, ribosomal protein L22-like 1, was identified as a minor ribosomal component. Ribosomal proteins L10-like and L39-like, paralogues of ribosomal proteins L10 and L39, respectively, were found in ribosomes only from the testis. Reverse transcription-polymerase chain reaction yielded supportive evidence for specific expression of L10-like and L39-like in the testis. Newly synthesized L39-like is likely to be transported to the nucleolus, where ribosome biosynthesis occurs, and then incorporated into translating ribosomes in the cytoplasm. Heterogeneity of mammalian testicular ribosomes is structurally non-negligible, and may offer valuable insights into the function of the customized ribosome.
Phosphorylation of Wheat Germ Initiation Factors and Ribosomal Proteins 1
Browning, Karen S.; Yan, Tyan Fuh J.; Lauer, Stephen J.; Aquino, Lu Ann; Tao, Mariano; Ravel, Joanne M.
1985-01-01
The ability of the wheat germ initiation factors and ribosomes to serve as substrates for a wheat germ protein kinase (Yan and Tao 1982 J Biol Chem 257: 7037-7043) has been investigated. The wheat germ kinase catalyzes the phosphorylation of the 42,000 dalton subunit of eukaryotic initiation factor (eIF)-2 and the 107,000 dalton subunit of eIF-3. Other initiation factors, eIF-4B and eIF-4A, and elongation factors, EF-1 and EF-2, are not phosphorylated by the kinase. Quantitative analysis indicates that the kinase catalyzes the incorporation of about 0.5 to 0.6 mole of phosphate per mole of the 42,000 dalton subunit of eIF-2 and about 6 moles of phosphate per mole of the 107,000 dalton subunit of eIF-3. Three proteins (Mr = 38,000, 14,800, and 12,600) of the 60S ribosomal subunit are phosphorylated by the kinase, but none of the 40S ribosomal proteins are substrates of the kinase. No effects of phosphorylation on the activities of eIF-2, eIF-3, or 60S ribosomal subunits could be demonstrated in vitro. Images Fig. 1 Fig. 3 Fig. 4 PMID:16664060
Peeling the onion: ribosomes are ancient molecular fossils.
Hsiao, Chiaolong; Mohan, Srividya; Kalahar, Benson K; Williams, Loren Dean
2009-11-01
We describe a method to establish chronologies of ancient ribosomal evolution. The method uses structure-based and sequence-based comparison of the large subunits (LSUs) of Haloarcula marismortui and Thermus thermophilus. These are the highest resolution ribosome structures available and represent disparate regions of the evolutionary tree. We have sectioned the superimposed LSUs into concentric shells, like an onion, using the site of peptidyl transfer as the origin (the PT-origin). This spherical approximation combined with a shell-by-shell comparison captures significant information along the evolutionary time line revealing, for example, that sequence and conformational similarity of the 23S rRNAs are greatest near the PT-origin and diverge smoothly with distance from it. The results suggest that the conformation and interactions of both RNA and protein can be described as changing, in an observable manner, over evolutionary time. The tendency of macromolecules to assume regular secondary structural elements such as A-form helices with Watson-Crick base pairs (RNA) and alpha-helices and beta-sheets (protein) is low at early time points but increases as time progresses. The conformations of ribosomal protein components near the PT-origin suggest that they may be molecular fossils of the peptide ancestors of ribosomal proteins. Their abbreviated length may have proscribed formation of secondary structure, which is indeed nearly absent from the region of the LSU nearest the PT-origin. Formation and evolution of the early PT center may have involved Mg(2+)-mediated assembly of at least partially single-stranded RNA oligomers or polymers. As one moves from center to periphery, proteins appear to replace magnesium ions. The LSU is known to have undergone large-scale conformation changes upon assembly. The T. thermophilus LSU analyzed here is part of a fully assembled ribosome, whereas the H. marismortui LSU analyzed here is dissociated from other ribosomal components
Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.
2015-01-01
Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995
RRP1B Targets PP1 to Mammalian Cell Nucleoli and Is Associated with Pre-60S Ribosomal Subunits
Chamousset, Delphine; De Wever, Veerle; Moorhead, Greg B.; Chen, Yan; Boisvert, Francois-Michel; Lamond, Angus I.
2010-01-01
A pool of protein phosphatase 1 (PP1) accumulates within nucleoli and accounts for a large fraction of the serine/threonine protein phosphatase activity in this subnuclear structure. Using a combination of fluorescence imaging with quantitative proteomics, we mapped the subnuclear localization of the three mammalian PP1 isoforms stably expressed as GFP-fusions in live cells and identified RRP1B as a novel nucleolar targeting subunit that shows a specificity for PP1β and PP1γ. RRP1B, one of two mammalian orthologues of the yeast Rrp1p protein, shows an RNAse-dependent localization to the granular component of the nucleolus and distributes in a similar manner throughout the cell cycle to proteins involved in later steps of rRNA processing. Quantitative proteomic analysis of complexes containing both RRP1B and PP1γ revealed enrichment of an overlapping subset of large (60S) ribosomal subunit proteins and pre-60S nonribosomal proteins involved in mid-late processing. Targeting of PP1 to this complex by RRP1B in mammalian cells is likely to contribute to modulation of ribosome biogenesis by mechanisms involving reversible phosphorylation events, thus playing a role in the rapid transduction of cellular signals that call for regulation of ribosome production in response to cellular stress and/or changes in growth conditions. PMID:20926688
Lafuente, M J; Gamo, F J; Gancedo, C
1996-09-01
We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.
Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B
2012-12-01
Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.
Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B
2012-01-01
Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185
Liu, Peng; Myo, Thwin; Ma, Wei; Lan, Dingyun; Qi, Tuo; Guo, Jia; Song, Ping; Guo, Jun; Kang, Zhensheng
2016-01-01
Tyrosine phosphorylation protein A (TypA/BipA) belongs to the ribosome-binding GTPase superfamily. In many bacterial species, TypA acts as a global stress and virulence regulator and also mediates resistance to the antimicrobial peptide bactericidal permeability-increasing protein. However, the function of TypA in plants under biotic stresses is not known. In this study, we isolated and functionally characterized a stress-responsive TypA gene (TaTypA) from wheat, with three copies located on chromosomes 6A, 6B, and 6D, respectively. Transient expression assays indicated chloroplast localization of TaTypA. The transcript levels of TaTypA were up-regulated in response to treatment with methyl viologen, which induces reactive oxygen species (ROS) in chloroplasts through photoreaction, cold stress, and infection by an avirulent strain of the stripe rust pathogen. Knock down of the expression of TaTypA through virus-induced gene silencing decreased the resistance of wheat to stripe rust accompanied by weakened ROS accumulation and hypersensitive response, an increase in TaCAT and TaSOD expression, and an increase in pathogen hyphal growth and branching. Our findings suggest that TaTypA contributes to resistance in an ROS-dependent manner. PMID:27446108
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms. PMID:26872259
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.
Lalucque, Hervé; Silar, Philippe
2000-01-01
Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985
Krupkin, Miri; Wekselman, Itai; Matzov, Donna; Eyal, Zohar; Diskin Posner, Yael; Rozenberg, Haim; Zimmerman, Ella; Bashan, Anat; Yonath, Ada
2016-01-01
Two structurally unique ribosomal antibiotics belonging to the orthosomycin family, avilamycin and evernimicin, possess activity against Enterococci, Staphylococci, and Streptococci, and other Gram-positive bacteria. Here, we describe the high-resolution crystal structures of the eubacterial large ribosomal subunit in complex with them. Their extended binding sites span the A-tRNA entrance corridor, thus inhibiting protein biosynthesis by blocking the binding site of the A-tRNA elbow, a mechanism not shared with other known antibiotics. Along with using the ribosomal components that bind and discriminate the A-tRNA—namely, ribosomal RNA (rRNA) helices H89, H91, and ribosomal proteins (rProtein) uL16—these structures revealed novel interactions with domain 2 of the CTC protein, a feature typical to various Gram-positive bacteria. Furthermore, analysis of these structures explained how single nucleotide mutations and methylations in helices H89 and H91 confer resistance to orthosomycins and revealed the sequence variations in 23S rRNA nucleotides alongside the difference in the lengths of the eukaryotic and prokaryotic α1 helix of protein uL16 that play a key role in the selectivity of those drugs. The accurate interpretation of the crystal structures that could be performed beyond that recently reported in cryo-EM models provide structural insights that may be useful for the design of novel pathogen-specific antibiotics, and for improving the potency of orthosomycins. Because both drugs are extensively metabolized in vivo, their environmental toxicity is very low, thus placing them at the frontline of drugs with reduced ecological hazards. PMID:27791159
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya
2007-11-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less
A 5.8S nuclear ribosomal RNA gene sequence database: applications to ecology and evolution
NASA Technical Reports Server (NTRS)
Cullings, K. W.; Vogler, D. R.
1998-01-01
We complied a 5.8S nuclear ribosomal gene sequence database for animals, plants, and fungi using both newly generated and GenBank sequences. We demonstrate the utility of this database as an internal check to determine whether the target organism and not a contaminant has been sequenced, as a diagnostic tool for ecologists and evolutionary biologists to determine the placement of asexual fungi within larger taxonomic groups, and as a tool to help identify fungi that form ectomycorrhizae.
He, M; Taussig, M J
1997-01-01
We describe a rapid, eukaryotic, in vitro method for selection and evolution of antibody combining sites using antibody-ribosome-mRNA (ARM) complexes as selection particles. ARMs carrying single-chain (VH/K) binding fragments specific for progesterone were selected using antigen-coupled magnetic beads; selection simultaneously captured the genetic information as mRNA, making it possible to generate and amplify cDNA by single-step RT-PCR on the ribosome-bound mRNA for further manipulation. Using mutant libraries, antigen-binding ARMs were enriched by a factor of 10(4)-10(5)-fold in a single cycle, with further enrichment in repeated cycles. While demonstrated here for antibodies, the method has the potential to be applied equally for selection of receptors or peptides from libraries. PMID:9396828
He, M; Taussig, M J
1997-12-15
We describe a rapid, eukaryotic, in vitro method for selection and evolution of antibody combining sites using antibody-ribosome-mRNA (ARM) complexes as selection particles. ARMs carrying single-chain (VH/K) binding fragments specific for progesterone were selected using antigen-coupled magnetic beads; selection simultaneously captured the genetic information as mRNA, making it possible to generate and amplify cDNA by single-step RT-PCR on the ribosome-bound mRNA for further manipulation. Using mutant libraries, antigen-binding ARMs were enriched by a factor of 10(4)-10(5)-fold in a single cycle, with further enrichment in repeated cycles. While demonstrated here for antibodies, the method has the potential to be applied equally for selection of receptors or peptides from libraries.
Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.
Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B
1997-06-05
We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.
NASA Astrophysics Data System (ADS)
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.
2011-07-01
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.
Trans-acting translational regulatory RNA binding proteins.
Harvey, Robert F; Smith, Tom S; Mulroney, Thomas; Queiroz, Rayner M L; Pizzinga, Mariavittoria; Dezi, Veronica; Villenueva, Eneko; Ramakrishna, Manasa; Lilley, Kathryn S; Willis, Anne E
2018-05-01
The canonical molecular machinery required for global mRNA translation and its control has been well defined, with distinct sets of proteins involved in the processes of translation initiation, elongation and termination. Additionally, noncanonical, trans-acting regulatory RNA-binding proteins (RBPs) are necessary to provide mRNA-specific translation, and these interact with 5' and 3' untranslated regions and coding regions of mRNA to regulate ribosome recruitment and transit. Recently it has also been demonstrated that trans-acting ribosomal proteins direct the translation of specific mRNAs. Importantly, it has been shown that subsets of RBPs often work in concert, forming distinct regulatory complexes upon different cellular perturbation, creating an RBP combinatorial code, which through the translation of specific subsets of mRNAs, dictate cell fate. With the development of new methodologies, a plethora of novel RNA binding proteins have recently been identified, although the function of many of these proteins within mRNA translation is unknown. In this review we will discuss these methodologies and their shortcomings when applied to the study of translation, which need to be addressed to enable a better understanding of trans-acting translational regulatory proteins. Moreover, we discuss the protein domains that are responsible for RNA binding as well as the RNA motifs to which they bind, and the role of trans-acting ribosomal proteins in directing the translation of specific mRNAs. This article is categorized under: RNA Interactions with Proteins and Other Molecules > RNA-Protein Complexes Translation > Translation Regulation Translation > Translation Mechanisms. © 2018 Medical Research Council and University of Cambridge. WIREs RNA published by Wiley Periodicals, Inc.
Thurlow, D L; Ehresmann, C; Ehresmann, B
1983-01-01
Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037
Timmins, P A; Langowski, J; Brown, R S
1988-01-01
The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700 +/- 10,000 and 86,700 +/- 9000 daltons from these two methods respectively. The observed match point of 54.4% D2O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. At high neutron scattering contrast radius of gyration of 42.3 +/- 2 A was found for the 7S particle. In addition a diffusion coefficient of 4.4 x 10(-11) [m2 s-1] and a sedimentation coefficient of 6.2S were determined. The hydrodynamic radius obtained for the 7S particle is 48 +/- 5 A. A simple elongated cylindrical model with dimensions of 140 A length and 59 A diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 A in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA. PMID:3419928
Thermodynamics of the pseudo-knot in helix 18 of 16S ribosomal RNA.
Wojciechowska, Monika; Dudek, Marta; Trylska, Joanna
2018-04-01
A fragment of E. coli 16S rRNA formed by nucleotides 500 to 545 is termed helix 18. Nucleotides 505-507 and 524-526 form a pseudo-knot and its distortion affects ribosome function. Helix 18 isolated from the ribosome context is thus an interesting fragment to investigate the structural properties and folding of RNA with pseudo-knots. With all-atom molecular dynamics simulations, spectroscopic and gel electrophoresis experiments, we investigated thermodynamics of helix 18, with a focus on its pseudo-knot. In solution studies at ambient conditions we observed dimerization of helix 18. We proposed that the loop, containing nucleotides forming the pseudo-knot, interacts with another monomer of helix 18. The native dimer is difficult to break but introducing mutations in the pseudo-knot indeed assured a monomeric form of helix 18. Molecular dynamics simulations at 310 K confirmed the stability of the pseudo-knot but at elevated temperatures this pseudo-knot was the first part of helix 18 to lose the hydrogen bond pattern. To further determine helix 18 stability, we analyzed the interactions of helix 18 with short oligomers complementary to a nucleotide stretch containing the pseudo-knot. The formation of higher-order structures by helix 18 impacts hybridization efficiency of peptide nucleic acid and 2'-O methyl RNA oligomers. © 2018 Wiley Periodicals, Inc.
Diner, Elie J.; Hayes, Christopher S.
2009-01-01
Summary Mutations in ribosomal proteins L4 and L22 confer resistance to erythromycin and other macrolide antibiotics in a variety of bacteria. L4 and L22 have elongated loops whose tips converge in the peptide exit tunnel near the macrolide binding site, and resistance mutations typically affect residues within these loops. Here, we use bacteriophage λ Red-mediated recombination, or “recombineering”, to uncover new L4 and L22 alleles that confer macrolide resistance in Escherichia coli. We randomized residues at the tips of the L4 and L22 loops using recombineered oligonucleotide libraries, and selected the mutagenized cells for erythromycin-resistant mutants. These experiments led to the identification of 341 different resistance mutations encoding 278 unique L4 and L22 proteins – the overwhelming majority of which are novel. Many resistance mutations were complex, involving multiple missense mutations, in-frame deletions, and insertions. Transfer of L4 and L22 mutations into wild-type cells by phage P1-mediated transduction demonstrated that each allele was sufficient to confer macrolide resistance. Although L4 and L22 mutants are typically resistant to most macrolides, selections carried out on different antibiotics revealed macrolide-specific resistance mutations. L22 Lys90Trp is one such allele, which confers resistance to erythromycin, but not tylosin or spiramycin. Purified L22 Lys90Trp ribosomes show reduced erythromycin binding, but have the same affinity for tylosin as wild-type ribosomes. Moreover, DMS methylation protection assays demonstrated that L22 Lys90Trp ribosomes bind tylosin more readily than erythromycin in vivo. This work underscores the exceptional functional plasticity of the L4 and L22 proteins, and highlights the utility of Red-mediated recombination in targeted genetic selections. PMID:19150357
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia
2017-01-01
Abstract Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an ‘all-or-none’ pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. PMID:28520982
Yang-Kolodji, Gloria; Mumenthaler, Shannon M; Mehta, Arjun; Ji, Lingyun; Tripathy, Debu
2015-01-01
To identify clinically relevant predictive biomarkers of trastuzumab resistance. MTT, FACS assays, immunoblotting and immunocytochemistry were used to phenotypically characterize drug responses of two cell models BT474R and SKBR3R. Student's t-test and Spearman's correlation were applied for statistic analysis. The activity of a downstream effector of the HER2 pathway phosphorylated ribosomal protein S6 (p-rpS6), was suppressed by trastuzumab in the parental cell lines yet remained unchanged in the resistant cells following treatment. The level of p-rpS6 was inversely correlated to the drug induced growth inhibition of trastuzumab-resistant cells when they are treated with selected HER2 targeting drugs. p-rpS6 is a robust post-treatment indicator of HER2 pathway-targeted therapy resistance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Ying; School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui; College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, Henan
2015-08-07
Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling,more » and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.« less
Fabbrini, Maria Serena; Katayama, Miku; Nakase, Ikuhiko; Vago, Riccardo
2017-01-01
Plant ribosome-inactivating protein (RIP) toxins are EC3.2.2.22 N-glycosidases, found among most plant species encoded as small gene families, distributed in several tissues being endowed with defensive functions against fungal or viral infections. The two main plant RIP classes include type I (monomeric) and type II (dimeric) as the prototype ricin holotoxin from Ricinus communis that is composed of a catalytic active A chain linked via a disulphide bridge to a B-lectin domain that mediates efficient endocytosis in eukaryotic cells. Plant RIPs can recognize a universally conserved stem-loop, known as the α-sarcin/ ricin loop or SRL structure in 23S/25S/28S rRNA. By depurinating a single adenine (A4324 in 28S rat rRNA), they can irreversibly arrest protein translation and trigger cell death in the intoxicated mammalian cell. Besides their useful application as potential weapons against infected/tumor cells, ricin was also used in bio-terroristic attacks and, as such, constitutes a major concern. In this review, we aim to summarize past studies and more recent progresses made studying plant RIPs and discuss successful approaches that might help overcoming some of the bottlenecks encountered during the development of their biomedical applications. PMID:29023422
Ribosomes in the sea: a window on taxon-specific lysis
NASA Astrophysics Data System (ADS)
Suttle, C.; Zhong, X.; Wirth, J.
2016-02-01
Microbes are estimated to comprise more than 90% of the biomass in the world's oceans, are major drivers of biogeochemical cycles, and have turnover rates ranging from hours to days. Despite the central role that microbes play in marine ecosystems, there is no robust method to evaluate taxon-specific mortality rates. Here, we report a method that employs extracellular free-ribosomes as a proxy to evaluate taxon-specific microbial lysis. The method was validated with laboratory cultures of the marine heterotrophic bacterium Vibrio natriegens strain PWH3a and the photoautotroph Synechococcus strain DC2, with and without grazers or viruses, to identify the origin and fate of the extracellular free-ribosomes. Our results showed both viral lysis and programmed-cell-death (PCD) contribute to free-ribosome production. Ribosomes were not released when cells were grazed, but grazers could consume free-ribosomes. We show that extracellular free-ribosomes can be used to evaluate microbial mortality caused by viral lysis and PCD. This approach was applied to environmental samples by examining the taxonomic composition and relative abundance of free 16S-ribosomes in seawater samples collected from the Strait of Georgia and Saanich Inlet, British Columbia, Canada. Based on the presence of free ribosomes, lysis was detected in 2198 out of 4013 prokaryotic taxa, representing 22 bacterial and three archaeal phyla. Of these, lysis of 140 taxa could be detected in all nine samples. Based on the ratio of free ribosomes to cellular ribosomes, some taxa associated with specific ecological niches appeared to be subject to high rates of lysis, including the genera Achromobacter, Chryseobacterium, Clostridium, Delftia, Ferruginibacter, Lactobacillus, Marinomonas, Massilia, Microbacterium, Ochrobactrum, Paenibacillus, Phyllobacterium, Pseudomonas, Rhodobacter, and Stenotrophomonas. Our results showed high-lysis coupled with low-abundance, suggesting that taxa in lower abundance are subject
Rama: a machine learning approach for ribosomal protein prediction in plants.
Carvalho, Thales Francisco Mota; Silva, José Cleydson F; Calil, Iara Pinheiro; Fontes, Elizabeth Pacheco Batista; Cerqueira, Fabio Ribeiro
2017-11-24
Ribosomal proteins (RPs) play a fundamental role within all type of cells, as they are major components of ribosomes, which are essential for translation of mRNAs. Furthermore, these proteins are involved in various physiological and pathological processes. The intrinsic biological relevance of RPs motivated advanced studies for the identification of unrevealed RPs. In this work, we propose a new computational method, termed Rama, for the prediction of RPs, based on machine learning techniques, with a particular interest in plants. To perform an effective classification, Rama uses a set of fundamental attributes of the amino acid side chains and applies a two-step procedure to classify proteins with unknown function as RPs. The evaluation of the resultant predictive models showed that Rama could achieve mean sensitivity, precision, and specificity of 0.91, 0.91, and 0.82, respectively. Furthermore, a list of proteins that have no annotation in Phytozome v.10, and are annotated as RPs in Phytozome v.12, were correctly classified by our models. Additional computational experiments have also shown that Rama presents high accuracy to differentiate ribosomal proteins from RNA-binding proteins. Finally, two novel proteins of Arabidopsis thaliana were validated in biological experiments. Rama is freely available at http://inctipp.bioagro.ufv.br:8080/Rama .
Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H.; Mills, Jason A.; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M.; Podsakoff, Gregory M.; Gadue, Paul; French, Deborah L.; Mason, Philip J.; Bessler, Monica
2013-01-01
Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the “safe harbor” AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells. PMID:23744582
Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J
2013-08-08
Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.
Ribosome flow model with positive feedback
Margaliot, Michael; Tuller, Tamir
2013-01-01
Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534
Yamanegi, Koji; Yamada, Naoko; Nakasho, Keiji; Nishiura, Hiroshi
2018-01-01
We recently found that erythroblast-like cells derived from human leukaemia K562 cells express C5a receptor (C5aR) and produce its antagonistic and agonistic ligand ribosomal protein S19 (RP S19) polymer, which is cross-linked between K122 and Q137 by tissue transglutaminases. RP S19 polymer binds to the reciprocal C5aRs on erythroblast-like cells and macrophage-like cells derived from human monocytic THP-1 cells and promotes differentiation into reticulocyte-like cells through enucleation in vitro. To examine the roles of RP S19 polymer in mouse erythropoiesis, we prepared Q137E mutant RP S19 gene knock-in C57BL/6J mice. In contrast to wild-type mice, erythroblast numbers at the preliminary stage (CD71 high /TER119 low ) in spleen based on transferrin receptor (CD71) and glycophorin A (TER119) values and erythrocyte numbers in orbital artery bloods were not largely changed in knock-in mice. Conversely, erythroblast numbers at the early stage (CD71 high /TER119 high ) were significantly decreased in spleen by knock-in mice. The reduction of early erythroblast numbers in spleen was enhanced by the phenylhydrazine-induced pernicious anemia model knock-in mice and was rescued by a functional analogue of RP S19 dimer S-tagged C5a/RP S19. These data indicated that RP S19 polymer plays the roles in the early erythroblast differentiation of C57BL/6J mouse spleen. Copyright © 2017 Elsevier GmbH. All rights reserved.
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)
Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo
2013-01-01
Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700
(11)C-PBR28 binding to translocator protein increases with progression of Alzheimer's disease.
Kreisl, William C; Lyoo, Chul Hyoung; Liow, Jeih-San; Wei, Monica; Snow, Joseph; Page, Emily; Jenko, Kimberly J; Morse, Cheryl L; Zoghbi, Sami S; Pike, Victor W; Turner, R Scott; Innis, Robert B
2016-08-01
This longitudinal study sought to determine whether the 18 kDa translocator protein (TSPO), a marker of neuroinflammation, increases over time in Alzheimer's disease. Positron emission tomography imaging with the TSPO radioligand (11)C-PBR28 was performed at baseline and after a median follow-up of 2.7 years in 14 amyloid-positive patients and 8 amyloid-negative controls. Patients had a greater increase in TSPO binding than controls in inferior parietal lobule, precuneus, occipital cortex, hippocampus, entorhinal cortex, and combined middle and inferior temporal cortex. TSPO binding in temporoparietal regions increased from 3.9% to 6.3% per annum in patients, but ranged from -0.5% to 1% per annum in controls. The change in TSPO binding correlated with cognitive worsening on clinical dementia rating scale-sum of boxes and reduced cortical volume. The annual rate of increased TSPO binding in temporoparietal regions was about 5-fold higher in patients with clinical progression (n = 9) compared with those who did not progress (n = 5). TSPO may serve as a biomarker of Alzheimer's progression and response to anti-inflammatory therapies. Published by Elsevier Inc.
Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio
2001-01-01
Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127
Au, Hilda H.; Cornilescu, Gabriel; Mouzakis, Kathryn D.; Ren, Qian; Burke, Jordan E.; Lee, Seonghoon; Butcher, Samuel E.; Jan, Eric
2015-01-01
The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame. PMID:26554019
Aryl-substituted aminobenzimidazoles targeting the hepatitis C virus internal ribosome entry site
Ding, Kejia; Wang, Annie; Boerneke, Mark A.; Dibrov, Sergey M.; Hermann, Thomas
2014-01-01
We describe the exploration of N1-aryl-substituted benzimidazoles as ligands for the hepatitis C virus (HCV) internal ribosome entry site (IRES) RNA. The design of the compounds was guided by the co-crystal structure of a benzimidazole viral translation inhibitor in complex with the RNA target. Structure-binding activity relationships of aryl-substituted benzimidazole ligands were established that were consistent with the crystal structure of the translation inhibitor complex. PMID:24856063
Tsurugi, K; Collatz, E; Todokoro, K; Wool, I G
1977-06-10
The proteins of the large subunit of rat liver ribosomes were separated into seven groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Twenty-one proteins (L3, L6, L7', L8, L10, L15, L17, L18, L19, L23', L25, L27', L28, L29, L31, L32, L34, L35, L36, L36', and L37') were isolated from three groups (C60, E60, and F60) by ion exchange chromatography on carboxymethycellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.3 to 25 mg. Nine of the proteins (L6, L8, L18, L27', L28, L29, L34, L36, and L36') had no detectable contamination: the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.
Sawicka, Kirsty; Pyronneau, Alexander; Chao, Miranda; Bennett, Michael V L; Zukin, R Suzanne
2016-10-11
Fragile X syndrome (FXS) is the most common heritable cause of intellectual disability and a leading genetic form of autism. The Fmr1 KO mouse, a model of FXS, exhibits elevated translation in the hippocampus and the cortex. ERK (extracellular signal-regulated kinase) and mTOR (mechanistic target of rapamycin) signaling regulate protein synthesis by activating downstream targets critical to translation initiation and elongation and are known to contribute to hippocampal defects in fragile X. Here we show that the effect of loss of fragile X mental retardation protein (FMRP) on these pathways is brain region specific. In contrast to the hippocampus, ERK (but not mTOR) signaling is elevated in the neocortex of fragile X mice. Phosphorylation of ribosomal protein S6, typically a downstream target of mTOR, is elevated in the neocortex, despite normal mTOR activity. This is significant in that S6 phosphorylation facilitates translation, correlates with neuronal activation, and is altered in neurodevelopmental disorders. We show that in fragile X mice, S6 is regulated by ERK via the "alternative" S6 kinase p90-ribosomal S6 kinase (RSK), as evidenced by the site of elevated phosphorylation and the finding that ERK inhibition corrects elevated RSK and S6 activity. These findings indicate that signaling networks are altered in the neocortex of fragile X mice such that S6 phosphorylation receives aberrant input from ERK/RSK. Importantly, an RSK inhibitor reduces susceptibility to audiogenic seizures in fragile X mice. Our findings identify RSK as a therapeutic target for fragile X and suggest the therapeutic potential of drugs for the treatment of FXS may vary in a brain-region-specific manner.
Rezgui, Vanessa Anissa Nathalie; Tyagi, Kshitiz; Ranjan, Namit; Konevega, Andrey L; Mittelstaet, Joerg; Rodnina, Marina V; Peter, Matthias; Pedrioli, Patrick G A
2013-07-23
tRNA modifications are crucial to ensure translation efficiency and fidelity. In eukaryotes, the URM1 and ELP pathways increase cellular resistance to various stress conditions, such as nutrient starvation and oxidative agents, by promoting thiolation and methoxycarbonylmethylation, respectively, of the wobble uridine of cytoplasmic (tK(UUU)), (tQ(UUG)), and (tE(UUC)). Although in vitro experiments have implicated these tRNA modifications in modulating wobbling capacity and translation efficiency, their exact in vivo biological roles remain largely unexplored. Using a combination of quantitative proteomics and codon-specific translation reporters, we find that translation of a specific gene subset enriched for AAA, CAA, and GAA codons is impaired in the absence of URM1- and ELP-dependent tRNA modifications. Moreover, in vitro experiments using native tRNAs demonstrate that both modifications enhance binding of tK(UUU) to the ribosomal A-site. Taken together, our data suggest that tRNA thiolation and methoxycarbonylmethylation regulate translation of genes with specific codon content.
A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling.
Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal
2017-01-01
Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein-EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here.
A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling
Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal
2017-01-01
Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein–EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here. PMID:28099529
Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David
2016-11-17
Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.
Shatsky, Ivan N; Dmitriev, Sergey E; Andreev, Dmitri E; Terenin, Ilya M
2014-01-01
The conventional paradigm of translation initiation in eukaryotes states that the cap-binding protein complex eIF4F (consisting of eIF4E, eIF4G and eIF4A) plays a central role in the recruitment of capped mRNAs to ribosomes. However, a growing body of evidence indicates that this paradigm should be revised. This review summarizes the data which have been mostly accumulated in a post-genomic era owing to revolutionary techniques of transcriptome-wide analysis. Unexpectedly, these techniques have uncovered remarkable diversity in the recruitment of cellular mRNAs to eukaryotic ribosomes. These data enable a preliminary classification of mRNAs into several groups based on their requirement for particular components of eIF4F. They challenge the widely accepted concept which relates eIF4E-dependence to the extent of secondary structure in the 5' untranslated regions of mRNAs. Moreover, some mRNA species presumably recruit ribosomes to their 5' ends without the involvement of either the 5' m(7)G-cap or eIF4F but instead utilize eIF4G or eIF4G-like auxiliary factors. The long-standing concept of internal ribosome entry site (IRES)-elements in cellular mRNAs is also discussed.
Li, Junhua; Zhang, Yang; Yang, Yanjun
2013-03-01
The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.
Heat-induced ribosome pausing triggers mRNA co-translational decay in Arabidopsis thaliana
Merret, Rémy; Nagarajan, Vinay K.; Carpentier, Marie-Christine; Park, Sunhee; Favory, Jean-Jacques; Descombin, Julie; Picart, Claire; Charng, Yee-yung; Green, Pamela J.; Deragon, Jean-Marc; Bousquet-Antonelli, Cécile
2015-01-01
The reprogramming of gene expression in heat stress is a key determinant to organism survival. Gene expression is downregulated through translation initiation inhibition and release of free mRNPs that are rapidly degraded or stored. In mammals, heat also triggers 5′-ribosome pausing preferentially on transcripts coding for HSC/HSP70 chaperone targets, but the impact of such phenomenon on mRNA fate remains unknown. Here, we provide evidence that, in Arabidopsis thaliana, heat provokes 5′-ribosome pausing leading to the XRN4-mediated 5′-directed decay of translating mRNAs. We also show that hindering HSC/HSP70 activity at 20°C recapitulates heat effects by inducing ribosome pausing and co-translational mRNA turnover. Strikingly, co-translational decay targets encode proteins with high HSC/HSP70 binding scores and hydrophobic N-termini, two characteristics that were previously observed for transcripts most prone to pausing in animals. This work suggests for the first time that stress-induced variation of translation elongation rate is an evolutionarily conserved process leading to the polysomal degradation of thousands of ‘non-aberrant’ mRNAs. PMID:25845591
Ribosome biogenesis in replicating cells: Integration of experiment and theory.
Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida
2016-10-01
Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. © 2016 Wiley Periodicals, Inc.
Li, Hongmei; Hu, Chuansheng; Bai, Ling; Li, Hua; Li, Mingfa; Zhao, Xiaodong; Czajkowsky, Daniel M; Shao, Zhifeng
2016-12-01
There is growing recognition that small open reading frames (sORFs) encoding peptides shorter than 100 amino acids are an important class of functional elements in the eukaryotic genome, with several already identified to play critical roles in growth, development, and disease. However, our understanding of their biological importance has been hindered owing to the significant technical challenges limiting their annotation. Here we combined ultra-deep sequencing of ribosome-associated poly-adenylated RNAs with rigorous conservation analysis to identify a comprehensive population of translated sORFs during early Drosophila embryogenesis. In total, we identify 399 sORFs, including those previously annotated but without evidence of translational capacity, those found within transcripts previously classified as non-coding, and those not previously known to be transcribed. Further, we find, for the first time, evidence for translation of many sORFs with different isoforms, suggesting their regulation is as complex as longer ORFs. Furthermore, many sORFs are found not associated with ribosomes in late-stage Drosophila S2 cells, suggesting that many of the translated sORFs may have stage-specific functions during embryogenesis. These results thus provide the first comprehensive annotation of the sORFs present during early Drosophila embryogenesis, a necessary basis for a detailed delineation of their function in embryogenesis and other biological processes. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Tanzawa, Takehito; Kato, Koji; Girodat, Dylan; Ose, Toyoyuki; Kumakura, Yuki; Wieden, Hans-Joachim; Uchiumi, Toshio; Tanaka, Isao; Yao, Min
2018-04-06
Archaea and eukaryotes have ribosomal P stalks composed of anchor protein P0 and aP1 homodimers (archaea) or P1•P2 heterodimers (eukaryotes). These P stalks recruit translational GTPases to the GTPase-associated center in ribosomes to provide energy during translation. The C-terminus of the P stalk is known to selectively recognize GTPases. Here we investigated the interaction between the P stalk and elongation factor 2 by determining the structures of Pyrococcus horikoshii EF-2 (PhoEF-2) in the Apo-form, GDP-form, GMPPCP-form (GTP-form), and GMPPCP-form bound with 11 C-terminal residues of P1 (P1C11). Helical structured P1C11 binds to a hydrophobic groove between domain G and subdomain G' of PhoEF-2, where is completely different from that of aEF-1α in terms of both position and sequence, implying that such interaction characteristic may be requested by how GTPases perform their functions on the ribosome. Combining PhoEF-2 P1-binding assays with a structural comparison of current PhoEF-2 structures and molecular dynamics model of a P1C11-bound GDP form, the conformational changes of the P1C11-binding groove in each form suggest that in response to the translation process, the groove has three states: closed, open, and release for recruiting and releasing GTPases.
Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.
Schnare, M N; Gray, M W
1982-01-01
In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176
Grossman, M J; Lampen, J O
1987-01-01
The location of the repressor gene, blaI, for the beta-lactamase gene blaP of Bacillus licheniformis 749, on the 5' side of blaP, was confirmed by sequencing the bla region of the constitutive mutant 749/C. An amber stop codon, likely to result in a nonfunctional truncated repressor, was found at codon 32 of the 128 codon blaI open reading frame (ORF) located 5' to blaP. In order to study the DNA binding activity of the repressor, the structural gene for blaI, from strain 749, with its ribosome binding site was expressed using a two plasmid T7 RNA polymerase/promotor system (S. Tabor and C. C. Richardson. Proc. Natl. Acad. Sci. 82, 1074-1078 (1985). Heat induction of this system in Escherichia coli K38 resulted in the production of BlaI as 5-10% of the soluble cell protein. Repressor protein was then purified by ammonium sulfate fractionation and cation exchange chromatography. The sequence of the N-terminal 28 amino acid residues was determined and was as predicted from the DNA. Binding of BlaI to DNA was detected by the slower migration of protein DNA complexes during polyacrylamide gel electrophoresis. BlaI was shown to selectively bind DNA fragments carrying the promoter regions of blaI and blaP. Images PMID:3498148
Crystal structure of the 28 kDa glutathione S-transferase from Schistosoma haematobium.
Johnson, Kenneth A; Angelucci, Francesco; Bellelli, Andrea; Hervé, Maxime; Fontaine, Josette; Tsernoglou, Demetrious; Capron, André; Trottein, François; Brunori, Maurizio
2003-09-02
Schistomiasis is a debilitating parasitic disease which affects 200 million people, causing life-threatening complications in 10% of the patients. This paper reports the crystal structure of the Schistosoma haematobium 28 kDa glutathione S-transferase, a multifunctional enzyme involved in host-parasite interactions and presently considered as a promising vaccine candidate against schistosomiasis. The structures of the GSH-free enzyme, as well as the partially (approximately 40%) and almost fully (approximately 80%) GSH-saturated enzyme, exhibit a unique feature, absent in previous GST structures, concerning the crucial and invariant Tyr10 side chain which occupies two alternative positions. The canonical conformer, which allows an H-bond to be formed between the side chain hydroxyl group and the activated thiolate of GSH, is somewhat less than 50% occupied. The new conformer, with the phenoxyl ring on the opposite side of the mobile loop connecting strand 1 and helix 1, is stabilized by a polar interaction with the guanidinium group of the conserved Arg21 side chain. The presence of two conformers of Tyr10 may provide a clue about clarifying the multiple catalytic functions of Sh28GST and might prove to be relevant for the design of specific antischistosomal drugs. The K(d) for GSH binding was determined by equilibrium fluorescence titrations to be approximately 3 microM and by stopped-flow rapid mixing experiments to be approximately 9 microM. The relatively tight binding of GSH by Sh28GST explains the residually bound GSH in the crystal and supports a possible role of GSH as a tightly bound cofactor involved in the catalytic mechanism for prostaglandin D(2) synthase activity.
Ribosomal DNA Organization Before and After Magnification in Drosophila melanogaster
Bianciardi, Alessio; Boschi, Manuela; Swanson, Ellen E.; Belloni, Massimo; Robbins, Leonard G.
2012-01-01
In all eukaryotes, the ribosomal RNA genes are stably inherited redundant elements. In Drosophila melanogaster, the presence of a Ybb− chromosome in males, or the maternal presence of the Ribosomal exchange (Rex) element, induces magnification: a heritable increase of rDNA copy number. To date, several alternative classes of mechanisms have been proposed for magnification: in situ replication or extra-chromosomal replication, either of which might act on short or extended strings of rDNA units, or unequal sister chromatid exchange. To eliminate some of these hypotheses, none of which has been clearly proven, we examined molecular-variant composition and compared genetic maps of the rDNA in the bb2 mutant and in some magnified bb+ alleles. The genetic markers used are molecular-length variants of IGS sequences and of R1 and R2 mobile elements present in many 28S sequences. Direct comparison of PCR products does not reveal any particularly intensified electrophoretic bands in magnified alleles compared to the nonmagnified bb2 allele. Hence, the increase of rDNA copy number is diluted among multiple variants. We can therefore reject mechanisms of magnification based on multiple rounds of replication of short strings. Moreover, we find no changes of marker order when pre- and postmagnification maps are compared. Thus, we can further restrict the possible mechanisms to two: replication in situ of an extended string of rDNA units or unequal exchange between sister chromatids. PMID:22505623
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).
Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo
2013-01-01
Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.
Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle
2012-01-01
Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455
Getting ready to translate: cytoplasmic maturation of eukaryotic ribosomes.
Panse, Vikram Govind
2011-01-01
The ribosome is the 'universal ribozyme' that is responsible for the final step of decoding genetic information into proteins. While the function of the ribosome is being elucidated at the atomic level, in comparison, little is known regarding its assembly in vivo and intracellular transport. In contrast to prokaryotic ribosomes, the construction of eukaryotic ribosomes, which begins in the nucleolus, requires >200 evolutionary conserved non-ribosomal trans-acting factors, which transiently associate with pre-ribosomal subunits at distinct assembly stages and perform specific maturation steps. Notably, pre-ribosomal subunits are transported to the cytoplasm in a functionally inactive state where they undergo maturation prior to entering translation. In this review, I will summarize our current knowledge of the eukaryotic ribosome assembly pathway with emphasis on cytoplasmic maturation events that render pre-ribosomal subunits translation competent.
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Human La binds mRNAs through contacts to the poly(A) tail.
Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A
2018-05-04
In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3'OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3'OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail.
Human La binds mRNAs through contacts to the poly(A) tail
Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A
2018-01-01
Abstract In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3’OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3’OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail. PMID:29447394
S-Layer Nanosheet Binding of Zn and Gd
Ajo-Franklin, Caroline (ORCID:0000000189096712); Charrier, Marimikel; Yang, Li
2016-04-15
This data characterizes binding of Zn2+ and Gd3+ to engineered nanosheets at 40C and in a brine solution. The engineered nanosheets are composed of surface-layer (S-layer) proteins which form 2 D crystalline sheets and display Zn2+- or Gd3+-binding domains on these sheets. Their ability to bind Zn2+ is compared to S-layer nanosheets that do not contain Zn2+-binding domains. We found that the purification method of these nanosheets was a critical determinant of their function and thus have provided data on the binding from two different purification methods. A key distinction of this dataset from other datasets is that the engineered nanosheets were expressed and purified from E. coli grown at 37C as described in (Kinns, 2010; Howorka, 2000), Kinns, H., et al. Identifying assembly-inhibiting and assembly-tolerant sites in the SbsB S-layer protein from Geobacillus stearothermophilus. Journal of Molecular Biology, 2010. 395(4): p. 742-753. Howorka, S., et al. Surface-accessible residues in the monomeric and assembled forms of a bacterial surface layer protein. Journal of Biological Chemistry, 2000. 275(48): p. 37876-37886.
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-11-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
Systematic analysis and evolution of 5S ribosomal DNA in metazoans
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-01-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690
Prp43p Is a DEAH-Box Spliceosome Disassembly Factor Essential for Ribosome Biogenesis
Combs, D. Joshua; Nagel, Roland J.; Ares, Manuel; Stevens, Scott W.
2006-01-01
The known function of the DEXH/D-box protein Prp43p is the removal of the U2, U5, and U6 snRNPs from the postsplicing lariat-intron ribonucleoprotein complex. We demonstrate that affinity-purified Prp43p-associated material includes the expected spliceosomal components; however, we also identify several preribosomal complexes that are specifically purified with Prp43p. Conditional prp43 mutant alleles confer a 35S pre-rRNA processing defect, with subsequent depletion of 27S and 20S precursors. Upon a shift to a nonpermissive temperature, both large and small-ribosomal-subunit proteins accumulate in the nucleolus of prp43 mutants. Pulse-chase analysis demonstrates delayed kinetics of 35S, 27S, and 20S pre-rRNA processing with turnover of these intermediates. Microarray analysis of pre-mRNA splicing defects in prp43 mutants shows a very mild effect, similar to that of nonessential pre-mRNA splicing factors. Prp43p is the first DEXH/D-box protein shown to function in both RNA polymerase I and polymerase II transcript metabolism. Its essential function is in its newly characterized role in ribosome biogenesis of both ribosomal subunits, positioning Prp43p to regulate both pre-mRNA splicing and ribosome biogenesis. PMID:16382144
The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.
Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina
2016-05-22
During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki
2013-08-01
Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.
Jones, Ronald N.; Farrell, David J.; Morrissey, Ian
2003-01-01
Resistance to quinupristin-dalfopristin (Q/D) among gram-positive cocci has been very uncommon. Two clinical isolates among 8,837 (0.02%) Streptococcus pneumoniae isolates were discovered in 2001 to 2002 with Q/D MICs of 4 μg/ml. Each had a 5-amino-acid tandem duplication (RTAHI) in the L22 ribosomal protein gene (rplV) preventing synergistic ribosomal binding of the streptogramin combination. Similar gene duplication has been reported in Q/D-resistant Staphylococcus aureus. PMID:12878545
Berneking, Laura; Schnapp, Marie; Rumm, Andreas; Trasak, Claudia; Ruckdeschel, Klaus; Alawi, Malik; Grundhoff, Adam; Kikhney, Alexey G; Koch-Nolte, Friedrich; Buck, Friedrich; Perbandt, Markus; Betzel, Christian; Svergun, Dmitri I; Hentschke, Moritz; Aepfelbacher, Martin
2016-06-01
Yersinia outer protein M (YopM) is a crucial immunosuppressive effector of the plaque agent Yersinia pestis and other pathogenic Yersinia species. YopM enters the nucleus of host cells but neither the mechanisms governing its nucleocytoplasmic shuttling nor its intranuclear activities are known. Here we identify the DEAD-box helicase 3 (DDX3) as a novel interaction partner of Y. enterocolitica YopM and present the three-dimensional structure of a YopM:DDX3 complex. Knockdown of DDX3 or inhibition of the exportin chromosomal maintenance 1 (CRM1) increased the nuclear level of YopM suggesting that YopM exploits DDX3 to exit the nucleus via the CRM1 export pathway. Increased nuclear YopM levels caused enhanced phosphorylation of Ribosomal S6 Kinase 1 (RSK1) in the nucleus. In Y. enterocolitica infected primary human macrophages YopM increased the level of Interleukin-10 (IL-10) mRNA and this effect required interaction of YopM with RSK and was enhanced by blocking YopM's nuclear export. We propose that the DDX3/CRM1 mediated nucleocytoplasmic shuttling of YopM determines the extent of phosphorylation of RSK in the nucleus to control transcription of immunosuppressive cytokines.
Ribosomes are optimized for autocatalytic production
NASA Astrophysics Data System (ADS)
Reuveni, Shlomi; Ehrenberg, Måns; Paulsson, Johan
2017-07-01
Many fine-scale features of ribosomes have been explained in terms of function, revealing a molecular machine that is optimized for error-correction, speed and control. Here we demonstrate mathematically that many less well understood, larger-scale features of ribosomes—such as why a few ribosomal RNA molecules dominate the mass and why the ribosomal protein content is divided into 55-80 small, similarly sized segments—speed up their autocatalytic production.
Independent suppression of ribosomal +1 frameshifts by different tRNA anticodon loop modifications.
Klassen, Roland; Bruch, Alexander; Schaffrath, Raffael
2017-09-02
Recently, a role for the anticodon wobble uridine modification 5-methoxycarbonylmethyl-2-thiouridine (mcm 5 s 2 U) has been revealed in the suppression of translational +1 frameshifts in Saccharomyces cerevisiae. Loss of either the mcm 5 U or s 2 U parts of the modification elevated +1 frameshift rates and results obtained with reporters involving a tRNA Lys UUU dependent frameshift site suggested these effects are caused by reduced ribosomal A-site binding of the hypomodified tRNA. Combined loss of mcm 5 U and s 2 U leads to increased ribosome pausing at tRNA Lys UUU dependent codons and synergistic growth defects but effects on +1 frameshift rates remained undefined to this end. We show in here that simultaneous removal of mcm 5 U and s 2 U results in synergistically increased +1 frameshift rates that are suppressible by extra copies of tRNA Lys UUU . Thus, two distinct chemical modifications of the same wobble base independently contribute to reading frame maintenance, loss of which may cause or contribute to observed growth defects. Since the thiolation pathway is sensitive to moderately elevated temperatures in yeast, we observe a heat-induced increase of +1 frameshift rates in wild type cells that depends on the sulfur transfer protein Urm1. Furthermore, we find that temperature-induced frameshifting is kept in check by the dehydration of N6-threonylcarbamoyladenosine (t 6 A) to its cyclic derivative (ct 6 A) at the anticodon adjacent position 37. Since loss of ct 6 A in elp3 or urm1 mutant cells is detrimental for temperature stress resistance we assume that conversion of t 6 A to ct 6 A serves to limit deleterious effects on translational fidelity caused by hypomodified states of wobble uridine bases.
Ribosomal S6 kinase (RSK) modulators: a patent review.
Ludwik, Katarzyna A; Lannigan, Deborah A
2016-09-01
The p90 ribosomal S6 kinases (RSK) are a family of Ser/Thr protein kinases that are downstream effectors of MEK1/2-ERK1/2. Increased RSK activation is implicated in the etiology of multiple pathologies, including numerous types of cancers, cardiovascular disease, liver and lung fibrosis, and infections. The review summarizes the patent and scientific literature on small molecule modulators of RSK and their potential use as therapeutics. The patents were identified using World Intellectual Property Organization and United States Patent and Trademark Office databases. The compounds described are predominantly RSK inhibitors, but a RSK activator is also described. The majority of the inhibitors are not RSK-specific. Based on the overwhelming evidence that RSK is involved in a number of diseases that have high mortalities it seems surprising that there are no RSK modulators that have pharmacokinetic properties suitable for in vivo use. MEK1/2 inhibitors are in the clinic, but the efficacy of these compounds appears to be limited by their side effects. We hypothesize that targeting the downstream effectors of MEK1/2, like RSK, are an untapped source of drug targets and that they will generate less side effects than MEK1/2 inhibitors because they regulate fewer effectors.