Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

NASA Astrophysics Data System (ADS)

Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

2016-03-01

Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

PubMed Central

Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

2016-01-01

Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

Role of Cyclin D1 and cdk Inhibitors in Breast Cancer Pathogenesis

DTIC Science & Technology

2001-10-01

0.1 [tg of a Renilla luciferase expression plasmid (pRL-SV40 Promega) to normalize for transfection efficiency. After an overnight recovery, the...saline, collected, lysed, and analyzed for luciferase and Renilla luciferase activity by using the Dual-Luciferase reporter assay system (Promega...Cyclin A promoter-driven luciferase activity was then normalized to a constant activity of Renilla luciferase. 7 Results In our previous reports we

Transmission of 2.5 Gbit/s Spectrum-sliced WDM System for 50 km Single-mode Fiber

NASA Astrophysics Data System (ADS)

Ahmed, Nasim; Aljunid, Sayed Alwee; Ahmad, R. Badlisha; Fadil, Hilal Adnan; Rashid, Mohd Abdur

2011-06-01

The transmission of a spectrum-sliced WDM channel at 2.5 Gbit/s for 50 km of single mode fiber using an system channel spacing only 0.4 nm is reported. We have investigated the system performance using NRZ modulation format. The proposed system is compared with conventional system. The system performance is characterized as the bit-error-rate (BER) received against the system bit rates. Simulation results show that the NRZ modulation format performs well for 2.5 Gbit/s system bit rates. Using this narrow channel spectrum-sliced technique, the total number of multiplexed channels can be increased greatly in WDM system. Therefore, 0.4 nm channel spacing spectrum-sliced WDM system is highly recommended for the long distance optical access networks, like the Metro Area Network (MAN), Fiber-to-the-Building (FTTB) and Fiber-to-the-Home (FTTH).

Analysis of the spectrum of the (5d6+5d56s) -(5d56p+5d46s6p) transitions of two times ionized osmium (Os III)

NASA Astrophysics Data System (ADS)

Azarov, Vladimir I.; Tchang-Brillet, W.-Ü. Lydia; Gayasov, Robert R.

2018-05-01

The spectrum of osmium was observed in the (225-2100) Å wavelength region. The (5d6 + 5d56s) - (5d56p + 5d46s6p) transition array of two times ionized osmium, Os III, has been investigated and 1039 spectral lines have been classified in the region. The analysis has led to the determination of the 5d6, 5d56s, 5d56p and 5d46s6p configurations. Fifty-eight levels of the 5d6 and 5d56s configurations in the even system and 142 levels of the 5d56p and 5d46s6p configurations in the odd system have been established. The orthogonal operators technique was used to calculate the level structure and transition probabilities. The energy parameters have been determined by the least squares fit to the observed levels. Calculated transition probability and energy values, as well as LS-compositions obtained from the fitted parameters are presented.

The blue light indicator in rubidium 5S-5P-5D cascade excitation

NASA Astrophysics Data System (ADS)

Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

2017-07-01

The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

A Rapid and Inexpensive PCR-Based STR Genotyping Method for Identifying Forensic Specimens

DTIC Science & Technology

2006-06-01

this report) 20. Security Classif. (of this page) 21 . No. of Pages 22. Price Unclassified Unclassified 18 Form DOT F 1700.7 (8-72) Reproduction of...Promega PowerPlex 2.1 system (7) except that the buffer was 1x Amplitaq gold reaction buffer, 0.1% TritonX-100, and 0.2mM each dNTP in a 25µl final...electrophoresis were done using the PowerPlex 16 System (Promega Corp.; Madison, WI). rEsulTs ANd dIsCussION The goal of this study was to develop a simple DNA

Isothermal sections of the quasi-ternary systems Ag{sub 2}S(Se)–Ga{sub 2}S(Se){sub 3}–In{sub 2}S(Se){sub 3} at 820 K and the physical properties of the ternary phases Ga{sub 5.5}In{sub 4.5}S{sub 15}, Ga{sub 6}In{sub 4}Se{sub 15} and Ga{sub 5.5}In{sub 4.5}S{sub 15}:Er{sup 3+}, Ga{sub 6}In{sub 4}Se{sub 15}:Er{sup 3+}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ivashchenko, I.A., E-mail: Ivashchenko.Inna@eenu.edu.ua; Danyliuk, I.V.; Gulay, L.D.

Isothermal sections of the quasi-ternary systems Ag{sub 2}S(Se)–Ga{sub 2}S(Se){sub 3}–In{sub 2}S(Se){sub 3} at 820 K were compared. Along the 50 mol% Ag{sub 2}S(Se), both systems feature continuous solid solutions with the chalcopyrite structure. Along the 17 mol% Ag{sub 2}S(Se), the interactions at the AgIn{sub 5}S(Se){sub 8}–'AgGa{sub 5}S(Se){sub 8}' sections are different. In the Ag{sub 2}S–Ga{sub 2}S{sub 3}–In{sub 2}S{sub 3} system the existence of the layered phase AgGa{sub x}In{sub 5–x}S{sub 8}, 2.25≤x≤2.85, was confirmed (S.G. P6{sub 3}mc). The Ag{sub 2}Se–Ga{sub 2}Se{sub 3}–In{sub 2}Se{sub 3} system features the formation of solid solution (up to 53 mol% Ga{sub 2}Se{sub 3}) based on AgIn{submore » 5}Se{sub 8} (S.G. P-42m). Crystal structure, atomic coordinates were determined by powder diffraction method for samples from the homogeneity region of AgIn{sub 5}Se{sub 8}. Specific conductivities of the crystals Ga{sub 6}In{sub 4}Se{sub 15} (1.33·10{sup −6} Ω{sup −1} m{sup −1}), Ga{sub 5.94}In{sub 3.96}Er{sub 0.1}Se{sub 15} (3.17·10{sup −6} Ω{sup −1} m{sup −1}), Ga{sub 5.5}In{sub 4.5}S{sub 15} (7.94·10{sup −6} Ω{sup −1} m{sup −1}), Ga{sub 5.46}In{sub 4.47}Er{sub 0.07}S{sub 15} (1·10{sup −9} Ω{sup −1} m{sup −1}) were measured at room temperature. Optical absorption and photoconductivity spectra were recorded in the range 400–760 nm. The introduction of erbium leads to an increase in the absorption coefficient and to the appearance of absorption bands at 530, 660, 810, 980, 1530 nm. - Highlights: • Nature of solid solutions in Ag{sub 2}S(Se)–Ga{sub 2}S(Se){sub 3}–In{sub 2}S(Se){sub 3} (820 K) were discussed. • Crystal structures of ternary and quaternary compounds were discussed. • Specific conductivity, optical properties of four single crystals were measured. • Photoconductivity of the Ga{sub 5.5}In{sub 4.5}S{sub 15} in the range 400–760 nm were recorded.« less

Localized AdS_{5}×S^{5} Black Holes.

PubMed

Dias, Óscar J C; Santos, Jorge E; Way, Benson

2016-10-07

According to heuristic arguments, global AdS_{5}×S^{5} black holes are expected to undergo a phase transition in the microcanonical ensemble. At high energies, one expects black holes that respect the symmetries of the S^{5}; at low energies, one expects "localized" black holes that appear pointlike on the S^{5}. According to anti-de Sitter/conformal field theory correspondence, N=4 supersymmetric Yang-Mills (SYM) theory on a 3-sphere should therefore exhibit spontaneous R-symmetry breaking at strong coupling. In this Letter, we numerically construct these localized black holes. We extrapolate the location of this phase transition, and compute the expectation value of the broken scalar operator with lowest conformal dimension. Via the correspondence, these results offer quantitative predictions for N=4 SYM theory.

The Tetrahedral Zamolodchikov Algebra and the {AdS_5× S^5} S-matrix

NASA Astrophysics Data System (ADS)

Mitev, Vladimir; Staudacher, Matthias; Tsuboi, Zengo

2017-08-01

The S-matrix of the {AdS_5× S^5} string theory is a tensor product of two centrally extended su{(2|2)\\ltimes R^2 S-matrices, each of which is related to the R-matrix of the Hubbard model. The R-matrix of the Hubbard model was first found by Shastry, who ingeniously exploited the fact that, for zero coupling, the Hubbard model can be decomposed into two XX models. In this article, we review and clarify this construction from the AdS/CFT perspective and investigate the implications this has for the {AdS_5× S^5} S-matrix.

5 CFR 1330.403 - System certification.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 5 Administrative Personnel 3 2013-01-01 2013-01-01 false System certification. 1330.403 Section....403 System certification. (a) The performance appraisal system(s) covering senior employees must be... certify an agency's appraisal system(s) only when a review of that system's design, application, and...

5 CFR 1330.403 - System certification.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 3 2014-01-01 2014-01-01 false System certification. 1330.403 Section....403 System certification. (a) The performance appraisal system(s) covering senior employees must be... certify an agency's appraisal system(s) only when a review of that system's design, application, and...

Understanding Systems Theory for U.S. Marines

DTIC Science & Technology

2007-01-01

Combat Development Command Quantico, Virginia 22134-5068 FUTURE WAR Understanding Systems Theory for U.S. Marines SUBMITTED IN...Systems Theory for U.S. Marines 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f...attached as Appendix C). Developing solutions requires understanding the problem( s ). In complex situations, some behavior of the target system

21 CFR 820.5 - Quality system.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Quality system. 820.5 Section 820.5 Food and Drugs... QUALITY SYSTEM REGULATION General Provisions § 820.5 Quality system. Each manufacturer shall establish and maintain a quality system that is appropriate for the specific medical device(s) designed or manufactured...

21 CFR 820.5 - Quality system.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Quality system. 820.5 Section 820.5 Food and Drugs... QUALITY SYSTEM REGULATION General Provisions § 820.5 Quality system. Each manufacturer shall establish and maintain a quality system that is appropriate for the specific medical device(s) designed or manufactured...

21 CFR 820.5 - Quality system.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Quality system. 820.5 Section 820.5 Food and Drugs... QUALITY SYSTEM REGULATION General Provisions § 820.5 Quality system. Each manufacturer shall establish and maintain a quality system that is appropriate for the specific medical device(s) designed or manufactured...

Massively Parallel Sequencing of Forensic STRs Using the Ion Chef™ and the Ion S5™ XL Systems.

PubMed

Wang, Le; Chen, Man; Wu, Bo; Liu, Yi-Cheng; Zhang, Guang-Feng; Jiang, Li; Xu, Xiu-Lan; Zhao, Xing-Chun; Ji, An-Quan; Ye, Jian

2018-03-01

Next-generation sequencing (NGS) has been used to genotype forensic short tandem repeat (STR) markers for individual identification and kinship analysis. STR data from several NGS platforms have been published, but forensic application trials using the Ion S5™ XL system have not been reported. In this work, we report sensitivity, reproducibility, mixture, simulated degradation, and casework sample data on the Ion Chef™ and S5™ XL systems using an early access 25-plex panel. Sensitivity experiments showed that over 97% of the alleles were detectable with down to 62 pg input of genomic DNA. In mixture studies, alleles from minor contributors were correctly assigned at 1:9 and 9:1 ratios. NGS successfully gave 12 full genotype results from 13 challenging casework samples, compared with five full results using the CE platform. In conclusion, the Ion Chef™ and the Ion S5™ XL systems provided an alternative and promising approach for forensic STR genotyping. © 2018 American Academy of Forensic Sciences.

Lifetimes and oscillator strengths for the 5s5p6s, 5s5p5d and 5p3 levels in single-ionized tin

NASA Astrophysics Data System (ADS)

Colón, C.; Alonso-Medina, A.

2004-08-01

Radiative oscillator strengths for 103 lines arising from 5s5p6s, 5s5p5d and 5p3 configurations of Sn II and lifetimes corresponding to several levels of these configurations have been calculated. These values were obtained in intermediate coupling (IC) and using ab initio relativistic Hartree-Fock (HFR) calculations. We use the standard method of least square fitting of experimental energy levels for the IC calculations by means of computer codes from Cowan. Tables 1 and 2 are only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/A+A/422/1109

Making safety an integral part of 5S in healthcare.

PubMed

Ikuma, Laura H; Nahmens, Isabelina

2014-01-01

Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

Entanglement entropy of AdS5 × S5 with massless flavors at nonzero temperature

NASA Astrophysics Data System (ADS)

Hu, Sen; Wu, Guozhen

2018-03-01

We consider backreacted AdS5 × S5 coupled with Nf massless flavors introduced by D7-branes at nonzero temperature. The backreacted geometry is in the Veneziano limit. The temperature of this system is related to the event horizon at rh. Dividing one of the spatial directions into a line segment with length l, we will calculate the holographic entanglement entropy (HEE) between the two subspaces. We study the behavior near the event horizon, and finally find that there exists confinement/deconfinement phase transition phenomenon near the horizon since the difference between the entanglement entropy of the connected minimal surface and the disconnected one changes sign.

Implementation of 5S Method for Ergonomic Laboratory

NASA Astrophysics Data System (ADS)

Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

2017-06-01

This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

AdS5×S(5) mirror model as a string sigma model.

PubMed

Arutyunov, Gleb; van Tongeren, Stijn J

2014-12-31

Doing a double Wick rotation in the world sheet theory of the light cone AdS5×S(5) superstring results in an inequivalent, so-called mirror theory that plays a central role in the field of integrability in the AdS-CFT correspondence. We show that this mirror theory can be interpreted as the light cone theory of a free string on a different background. This background is related to dS5×H(5) by a double T-duality, and has hidden supersymmetry. The geometry can also be extracted from an integrable deformation of the AdS5×S(5) sigma model, and we prove the observed mirror duality of these deformed models at the bosonic level as a byproduct. While we focus on AdS5×S(5), our results apply more generally.

Prostate Cancer Evaluation: Design, Synthesis and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2009-10-01

NUMBER E -Mail: 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most...1) Cell preparation (a) Stably transfected PC3 cell line: E . coli lacZ gene (from pSV-β-gal vector, Promega, Madison,WI) was inserted into high

10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S5S (LEFT ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

Prenatal Adversities and Latino Children’s Autonomic Nervous System Reactivity Trajectories from 6 Months to 5 Years of Age

PubMed Central

Alkon, Abbey; Boyce, W. Thomas; Tran, Linh; Harley, Kim G.; Neuhaus, John; Eskenazi, Brenda

2014-01-01

The purpose of the study was to determine whether mothers’ adversities experienced during early pregnancy are associated with offspring’s autonomic nervous system (ANS) reactivity trajectories from 6 months to 5 years of age. This cohort study of primarily Latino families included maternal interviews at 13–14 weeks gestation about their experience of a range of adversities: father’s absence, general social support, poverty level, and household density. ANS measures of heart rate, respiratory sinus arrhythmia (parasympathetic nervous system) and preejection period (sympathetic nervous system) were collected during resting and challenging conditions on children at 6 months and 1, 3.5 and 5 years of age. Reactivity measures were calculated as the mean of the responses to challenging conditions minus a resting condition. Fixed effects models were conducted for the 212 children with two or more timepoints of ANS measures. Interactions between maternal prenatal adversity levels and child age at time of ANS protocol were included in the models, allowing the calculation of separate trajectories or slopes for each level of adversity. Results showed no significant relations between mothers’ prenatal socioeconomic or social support adversity and offspring’s parasympathetic nervous system trajectories, but there was a statistically significant relationship between social support adversity and offspring’s heart rate trajectories (p<.05) and a borderline significant relationship between socioeconomic adversity and offspring’s sympathetic nervous system trajectories (p = .05). Children whose mothers experienced one, not two, social support adversity had the smallest increases in heart rate reactivity compared to children whose mothers experienced no adversity. The children whose mothers experienced no social support and no socioeconomic adversity had the largest increases in heart rate and preejection period respectively from 6 months to 5 years showing the

5. SWITCH TOWER AND JUNCTION OF S.A.R. #1 & S.A.R. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. SWITCH TOWER AND JUNCTION OF S.A.R. #1 & S.A.R. #2 TRANSMISSION LINES, MARCH 7, 1916. SCE drawing no. 4932. - Santa Ana River Hydroelectric System, Transmission Lines, Redlands, San Bernardino County, CA

Integrability of the Ad{{S}_{5}}\\times {{S}^{5}} superstring and its deformations

NASA Astrophysics Data System (ADS)

van Tongeren, Stijn J.

2014-10-01

This article reviews the application of integrability to the spectral problem of strings on Ad{{S}5}× {{S}5} and its deformations. We begin with a pedagogical introduction to integrable field theories culminating in the description of their finite-volume spectra through the thermodynamic Bethe ansatz (TBA). Next, we apply these ideas to the Ad{{S}5}× {{S}5} string and in later sections discuss how to account for particular integrable deformations. Through the AdS/CFT correspondence this gives an exact description of anomalous scaling dimensions of single trace operators in planar N=4 supersymmetry Yang-Mills theory, its ‘orbifolds’, and β and γ-deformed supersymmetric Yang-Mills theory. We also touch upon some subtleties arising in these deformed theories. Furthermore, we consider complex excited states (bound states) in the su(2) sector and give their TBA description. Finally we discuss the TBA for a quantum deformation of the Ad{{S}5}× {{S}5} superstring S-matrix, with close relations to among others Pohlmeyer reduced string theory, and briefly indicate more recent developments in this area.

Entanglement entropy of AdS5 × S5 with massive flavors

NASA Astrophysics Data System (ADS)

Hu, Sen; Wu, Guozhen

2018-01-01

We consider backreacted AdS5 × S5 coupled with Nf massive flavors introduced by D7 branes. The backreacted geometry is in the Veneziano limit with fixed Nf/Nc. By dividing one of the directions into a line segment with length l, we get two subspaces. Then we calculate the entanglement entropy between them. With the method of [I. R. Klebanov, D. Kutasov and A. Murugan, Nucl. Phys. B 796, 274 (2008)], we are able to find the cut-off independent part of the entanglement entropy and finally find that this geometry shows no confinement/deconfinement phase transition at zero temperature from the holographic entanglement entropy point of view similar to the case in pure AdS5 × S5.

The AdS{sub 5}xS{sup 5} superstring worldsheet S matrix and crossing symmetry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Janik, Romuald A.

2006-04-15

An S matrix satisfying the Yang-Baxter equation with symmetries relevant to the AdS{sub 5}xS{sup 5} superstring recently has been determined up to an unknown scalar factor. Such scalar factors are typically fixed using crossing relations; however, due to the lack of conventional relativistic invariance, in this case its determination remained an open problem. In this paper we propose an algebraic way to implement crossing relations for the AdS{sub 5}xS{sup 5} superstring worldsheet S matrix. We base our construction on a Hopf-algebraic formulation of crossing in terms of the antipode and introduce generalized rapidities living on the universal cover of themore » parameter space which is constructed through an auxillary, coupling-constant dependent, elliptic curve. We determine the crossing transformation and write functional equations for the scalar factor of the S matrix in the generalized rapidity plane.« less

Chaperoning 5S RNA assembly.

PubMed

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-07-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

Chaperoning 5S RNA assembly

PubMed Central

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-01-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

5 CFR 430.403 - System certification.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 5 Administrative Personnel 1 2011-01-01 2011-01-01 false System certification. 430.403 Section 430... MANAGEMENT Performance Appraisal Certification for Pay Purposes § 430.403 System certification. (a) The performance appraisal system(s) covering senior employees must be certified by OPM, with OMB concurrence, as...

5 CFR 430.403 - System certification.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 1 2014-01-01 2014-01-01 false System certification. 430.403 Section 430... MANAGEMENT Performance Appraisal Certification for Pay Purposes § 430.403 System certification. (a) The performance appraisal system(s) covering senior employees must be certified by OPM, with OMB concurrence, as...

5 CFR 430.403 - System certification.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false System certification. 430.403 Section 430... MANAGEMENT Performance Appraisal Certification for Pay Purposes § 430.403 System certification. (a) The performance appraisal system(s) covering senior employees must be certified by OPM, with OMB concurrence, as...

Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

PubMed

Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

2014-11-01

During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Bisulfite Conversion of DNA: Performance Comparison of Different Kits and Methylation Quantitation of Epigenetic Biomarkers that Have the Potential to Be Used in Non-Invasive Prenatal Testing.

PubMed

Leontiou, Chrysanthia A; Hadjidaniel, Michael D; Mina, Petros; Antoniou, Pavlos; Ioannides, Marios; Patsalis, Philippos C

2015-01-01

Epigenetic alterations, including DNA methylation, play an important role in the regulation of gene expression. Several methods exist for evaluating DNA methylation, but bisulfite sequencing remains the gold standard by which base-pair resolution of CpG methylation is achieved. The challenge of the method is that the desired outcome (conversion of unmethylated cytosines) positively correlates with the undesired side effects (DNA degradation and inappropriate conversion), thus several commercial kits try to adjust a balance between the two. The aim of this study was to compare the performance of four bisulfite conversion kits [Premium Bisulfite kit (Diagenode), EpiTect Bisulfite kit (Qiagen), MethylEdge Bisulfite Conversion System (Promega) and BisulFlash DNA Modification kit (Epigentek)] regarding conversion efficiency, DNA degradation and conversion specificity. Performance was tested by combining fully methylated and fully unmethylated λ-DNA controls in a series of spikes by means of Sanger sequencing (0%, 25%, 50% and 100% methylated spikes) and Next-Generation Sequencing (0%, 3%, 5%, 7%, 10%, 25%, 50% and 100% methylated spikes). We also studied the methylation status of two of our previously published differentially methylated regions (DMRs) at base resolution by using spikes of chorionic villus sample in whole blood. The kits studied showed different but comparable results regarding DNA degradation, conversion efficiency and conversion specificity. However, the best performance was observed with the MethylEdge Bisulfite Conversion System (Promega) followed by the Premium Bisulfite kit (Diagenode). The DMRs, EP6 and EP10, were confirmed to be hypermethylated in the CVS and hypomethylated in whole blood. Our findings indicate that the MethylEdge Bisulfite Conversion System (Promega) was shown to have the best performance among the kits. In addition, the methylation level of two of our DMRs, EP6 and EP10, was confirmed. Finally, we showed that bisulfite

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

The Role of AhR in Breast Cancer Development

DTIC Science & Technology

2004-07-01

The renilla luciferase vectorphRL-TK (0.05 rtg) was co-transfected with firefly luciferase reporter constructs (0.1 ptg pGudLuc, 0.5-1.0 [tg wildtype...Glo Luciferase system (Promega, Madison, WI ) which allowed sequential reading of the firefly and renilla signals. Cells were lysed according to the...Madison, WI ). The renilla signal was read after quenching the firefly output, thus allowing normalization between sample wells. The normalized firefly

Estimating 3D L5/S1 moments and ground reaction forces during trunk bending using a full-body ambulatory inertial motion capture system.

PubMed

Faber, G S; Chang, C C; Kingma, I; Dennerlein, J T; van Dieën, J H

2016-04-11

Inertial motion capture (IMC) systems have become increasingly popular for ambulatory movement analysis. However, few studies have attempted to use these measurement techniques to estimate kinetic variables, such as joint moments and ground reaction forces (GRFs). Therefore, we investigated the performance of a full-body ambulatory IMC system in estimating 3D L5/S1 moments and GRFs during symmetric, asymmetric and fast trunk bending, performed by nine male participants. Using an ambulatory IMC system (Xsens/MVN), L5/S1 moments were estimated based on the upper-body segment kinematics using a top-down inverse dynamics analysis, and GRFs were estimated based on full-body segment accelerations. As a reference, a laboratory measurement system was utilized: GRFs were measured with Kistler force plates (FPs), and L5/S1 moments were calculated using a bottom-up inverse dynamics model based on FP data and lower-body kinematics measured with an optical motion capture system (OMC). Correspondence between the OMC+FP and IMC systems was quantified by calculating root-mean-square errors (RMSerrors) of moment/force time series and the interclass correlation (ICC) of the absolute peak moments/forces. Averaged over subjects, L5/S1 moment RMSerrors remained below 10Nm (about 5% of the peak extension moment) and 3D GRF RMSerrors remained below 20N (about 2% of the peak vertical force). ICCs were high for the peak L5/S1 extension moment (0.971) and vertical GRF (0.998). Due to lower amplitudes, smaller ICCs were found for the peak asymmetric L5/S1 moments (0.690-0.781) and horizontal GRFs (0.559-0.948). In conclusion, close correspondence was found between the ambulatory IMC-based and laboratory-based estimates of back load. Copyright © 2015 Elsevier Ltd. All rights reserved.

19 CFR 143.5 - System performance requirements.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 19 Customs Duties 2 2012-04-01 2012-04-01 false System performance requirements. 143.5 Section 143.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF... must demonstrate that his system can interface directly with the Customs computer and ensure accurate...

19 CFR 143.5 - System performance requirements.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 19 Customs Duties 2 2011-04-01 2011-04-01 false System performance requirements. 143.5 Section 143.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF... must demonstrate that his system can interface directly with the Customs computer and ensure accurate...

19 CFR 143.5 - System performance requirements.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 19 Customs Duties 2 2014-04-01 2014-04-01 false System performance requirements. 143.5 Section 143.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF... must demonstrate that his system can interface directly with the Customs computer and ensure accurate...

19 CFR 143.5 - System performance requirements.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false System performance requirements. 143.5 Section 143.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF... must demonstrate that his system can interface directly with the Customs computer and ensure accurate...

19 CFR 143.5 - System performance requirements.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 19 Customs Duties 2 2013-04-01 2013-04-01 false System performance requirements. 143.5 Section 143.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF... must demonstrate that his system can interface directly with the Customs computer and ensure accurate...

Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

2001-01-01

rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

Dominant Negative Mutants of the Estrogen Receptor as Probes of Estrogen Action and Inhibitors of Breast Cancer Growth

DTIC Science & Technology

1996-07-01

tetrazolium, inner salt; MTS; Promega], 1.9 mg/ml, and an electron coupling reagent ( phenazine methosulfate; PMS; Sigma), 0.044 mg/ml, in Dulbecco’s...acids PBS, phosphate buffered saline PCR, polymerase chain reaction PMS, phenazine methosulfate poly A, polyadenylation s.e., standard error TAE, tris

Synchrotron powder X-ray diffraction and structural analysis of Eu0.5La0.5FBiS2-x Se x

NASA Astrophysics Data System (ADS)

Nagasaka, K.; Jinno, G.; Miura, O.; Miura, A.; Moriyoshi, C.; Kuroiwa, Y.; Mizuguchi, Y.

2017-07-01

Eu0.5La0.5FBiS2-x Se x is a new BiS2-based superconductor system. In Eu0.5La0.5FBiS2-x Se x , electron carriers are doped to the BiS2 layer by the substitution of Eu by La. Bulk superconductivity in this system is induced by increasing the in-plane chemical pressure, which is controlled by the Se concentration (x). In this study, we have analysed the crystal structure of Eu0.5La0.5FBiS2-x Se x using synchrotron powder diffraction and the Rietveld refinement. The precise determination of the structural parameters and thermal factors suggest that the emergence of bulk superconductivity in Eu0.5La0.5FBiS2-x Se x is achieved by the enhanced in-plane chemical pressure and the decrease in in-plane disorder.

Tree-level S-matrix of Pohlmeyer reduced form of AdS 5 × S 5 superstring theory

NASA Astrophysics Data System (ADS)

Hoare, B.; Tseytlin, A. A.

2010-02-01

With a motivation to find a 2-d Lorentz-invariant solution of the AdS 5 × S 5 superstring we continue the study of the Pohlmeyer-reduced form of this theory. The reduced theory is constructed from currents of the superstring sigma model and is classically equivalent to it. Its action is that of G/ H = Sp(2, 2) × Sp(4)/[SU(2)]4 gauged WZW model deformed by an integrable potential and coupled to fermions. This theory is UV finite and is conjectured to be related to the superstring theory also at the quantum level. Expanded near the trivial vacuum it has the same elementary excitations (8+8 massive bosonic and fermionic 2-d degrees of freedom) as the AdS 5 × S 5 superstring in the S 5 light-cone gauge or near plane-wave expansion. In contrast to the superstring case, the interaction terms in the reduced action are manifestly 2-d Lorentz invariant. Since the theory is integrable, its S-matrix should be effectively determined by the two-particle scattering. Here we explicitly compute the tree-level two-particle S-matrix for the elementary excitations of the reduced theory. We find that this S-matrix has the same index structure and group factorization properties as the superstring S-matrix computed in hep-th/0611169 but has simpler coefficients, depending only on the difference of two rapidities. While the gauge-fixed form of the reduced action has only the bosonic [SU(2)]4 part of the PSU(2|2) × PSU(2|2) symmetry of the light-cone superstring spectrum as its manifest symmetry we conjecture that it should also have a hidden fermionic symmetry that effectively interchanges bosons and fermions and which should guide us towards understanding the relation between the two S-matrices.

5SRNAdb: an information resource for 5S ribosomal RNAs.

PubMed

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Generation, Analysis and Functional Annotation of Expressed Sequence Tags from the Sheepshead Minnow (Cyprinodon variegatus)

DTIC Science & Technology

2010-01-01

any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it does not display a...CA) were cloned using the pGEM-T Easy Vector System (Promega, Madison, WI) and Electromax DH10B T1 Phage Resistant Cells (Invitrogen, Carlsbad, CA...reactions were performed using 75ng of plasmid DNA template and a M13 (-40) forward primer according to the manufac- turer’s protocol for DNA sequencing of

Acute responsivity of the serotonergic system to S-citalopram and positive emotionality-the moderating role of the 5-HTTLPR.

PubMed

Wielpuetz, Catrin; Kuepper, Yvonne; Grant, Phillip; Munk, Aisha J L; Hennig, Juergen

2013-01-01

According to the idea that the central serotonergic system has a modulatory function on behavior and personality in general, we aimed to highlight its association to habitual positive emotionality. In a placebo-controlled double-blind and randomized cross-over neuroendocrine challenge design (n = 72 healthy males) we investigated the association of the central serotonergic responsivity, 5-HTTLPR-genotype as well as their combined effects on positive emotionality. Regression analyses revealed an involvement of the serotonergic system in positive emotionality. There was, however, no direct association between positive emotionality and cortisol responses to S-citalopram; rather 5-HTTLPR-genotype showed an association (p < 0.05). That is, positive emotionality scores increased with the number of s-alleles carried by the individuals. Most notable was the moderating role of 5-HTTLPR-genotype (p < 0.05) on the association between acute serotonergic responsivity and positive emotionality. Indeed, this association was only found in ss-homozygotes, in which the acute responsivity of the serotonergic system additionally seems to contribute to the level of positive emotionality (r = 0.70, p < 0.05). The findings correspond to previous research demonstrating that the 5-HTTLPR is not only involved in the negative-emotional aspects of behavior and temperament, but is associated, moreover, with positive affectivity-supporting the assumption of its valence-neutrality. In addition, our data are in line with the idea of possible influences of the 5-HTTLPR-genotype on early neuronal development. They also indicate the need for further studies in order to clearly elucidate the role of the serotonergic system and its subcomponents in the regulation of positive emotionality.

Acute responsivity of the serotonergic system to S-citalopram and positive emotionality—the moderating role of the 5-HTTLPR

PubMed Central

Wielpuetz, Catrin; Kuepper, Yvonne; Grant, Phillip; Munk, Aisha J. L.; Hennig, Juergen

2013-01-01

According to the idea that the central serotonergic system has a modulatory function on behavior and personality in general, we aimed to highlight its association to habitual positive emotionality. In a placebo-controlled double-blind and randomized cross-over neuroendocrine challenge design (n = 72 healthy males) we investigated the association of the central serotonergic responsivity, 5-HTTLPR-genotype as well as their combined effects on positive emotionality. Regression analyses revealed an involvement of the serotonergic system in positive emotionality. There was, however, no direct association between positive emotionality and cortisol responses to S-citalopram; rather 5-HTTLPR-genotype showed an association (p < 0.05). That is, positive emotionality scores increased with the number of s-alleles carried by the individuals. Most notable was the moderating role of 5-HTTLPR-genotype (p < 0.05) on the association between acute serotonergic responsivity and positive emotionality. Indeed, this association was only found in ss-homozygotes, in which the acute responsivity of the serotonergic system additionally seems to contribute to the level of positive emotionality (r = 0.70, p < 0.05). The findings correspond to previous research demonstrating that the 5-HTTLPR is not only involved in the negative-emotional aspects of behavior and temperament, but is associated, moreover, with positive affectivity—supporting the assumption of its valence-neutrality. In addition, our data are in line with the idea of possible influences of the 5-HTTLPR-genotype on early neuronal development. They also indicate the need for further studies in order to clearly elucidate the role of the serotonergic system and its subcomponents in the regulation of positive emotionality. PMID:23986679

25 Tb/s transmission over 5,530 km using 16QAM at 5.2 b/s/Hz spectral efficiency.

PubMed

Cai, J-X; Batshon, H G; Zhang, H; Davidson, C R; Sun, Y; Mazurczyk, M; Foursa, D G; Sinkin, O; Pilipetskii, A; Mohs, G; Bergano, Neal S

2013-01-28

We transmit 250x100G PDM RZ-16QAM channels with 5.2 b/s/Hz spectral efficiency over 5,530 km using single-stage C-band EDFAs equalized to 40 nm. We use single parity check coded modulation and all channels are decoded with no errors after iterative decoding between a MAP decoder and an LDPC based FEC algorithm. We also observe that the optimum power spectral density is nearly independent of SE, signal baud rate or modulation format in a dispersion uncompensated system.

Biosynthesis of tert-butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate by carbonyl reductase from Rhodosporidium toruloides in mono and biphasic media.

PubMed

Liu, Zhi-Qiang; Wu, Lin; Zheng, Ling; Wang, Wen-Zhong; Zhang, Xiao-Jian; Jin, Li-Qun; Zheng, Yu-Guo

2018-02-01

tert-Butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate ((3R,5S)-CDHH) is the key intermediate for synthesis of atorvastatin and rosuvastatin. Carbonyl reductase exhibits excellent activity toward tert-butyl (S)-6-chloro-5-hydroxy-3-oxohexanoate ((S)-CHOH) to synthesize (3R,5S)-CDHH. In this study, a whole cell biosynthesis reaction system to produce (3R,5S)-CDHH was constructed in organic solvents. A solution of 10% (v/v) Tween-80 was introduced to the reaction system as a co-solvent, which greatly enhanced biotransformation process, giving 98.9% yield, >99% ee and 1.8-fold higher space time yield in 5 h bioconversion of 1 M (S)-CHOH, compared with 98.7% yield and >99% ee in 9 h bioconversion of a purely aqueous reaction system. Moreover, a water-octanol biphasic reaction system was built and 20% of octanol was added as reservoir of substrate resulting in 98% yield, >99% ee and 4.08 mmol L -1  h -1  g -1 (wet cell weight) space time yield. This study paved a way for the whole cell biosynthesis of (3R,5S)-CDHH in mono and biphasic media. Copyright © 2017 Elsevier Ltd. All rights reserved.

AdS5 solutions from M5-branes on Riemann surface and D6-branes sources

DOE PAGES

Bah, Ibrahima

2015-09-24

Here, we describe the gravity duals of four-dimensional N = 1 superconformal field theories obtained by wrapping M5-branes on a punctured Riemann surface. The internal geometry, normal to the AdS 5 factor, generically preserves two U(1)s, with generators (J +, J –), that are fibered over the Riemann surface. The metric is governed by a single potential that satisfies a version of the Monge-Ampère equation. The spectrum of N = 1 punctures is given by the set of supersymmetric sources of the potential that are localized on the Riemann surface and lead to regular metrics near a puncture. We usemore » this system to study a class of punctures where the geometry near the sources corresponds to M-theory description of D6-branes. These carry a natural (p, q) label associated to the circle dual to the killing vector pJ + + qJ – which shrinks near the source. In the generic case the world volume of the D6-branes is AdS 5 × S 2 and they locally preserve N = 2 supersymmetry. When p = –q, the shrinking circle is dual to a flavor U(1). The metric in this case is non-degenerate only when there are co-dimension one sources obtained by smearing M5-branes that wrap the AdS 5 factor and the circle dual the superconformal R-symmetry. The D6-branes are extended along the AdS 5 and on cups that end on the co-dimension one branes. In the special case when the shrinking circle is dual to the R-symmetry, the D6-branes are extended along the AdS 5 and wrap an auxiliary Riemann surface with an arbitrary genus. When the Riemann surface is compact with constant curvature, the system is governed by a Monge-Ampère equation.« less

5 CFR 9701.405 - Performance management system requirements.

Code of Federal Regulations, 2013 CFR

2013-01-01

... performance management systems for DHS employees, subject to the requirements set forth in this subpart. (b) Each DHS performance management system must— (1) Specify the employees covered by the system(s); (2... 5 Administrative Personnel 3 2013-01-01 2013-01-01 false Performance management system...

5 CFR 9701.405 - Performance management system requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

... performance management systems for DHS employees, subject to the requirements set forth in this subpart. (b) Each DHS performance management system must— (1) Specify the employees covered by the system(s); (2... 5 Administrative Personnel 3 2011-01-01 2011-01-01 false Performance management system...

5 CFR 9701.405 - Performance management system requirements.

Code of Federal Regulations, 2012 CFR

2012-01-01

... performance management systems for DHS employees, subject to the requirements set forth in this subpart. (b) Each DHS performance management system must— (1) Specify the employees covered by the system(s); (2... 5 Administrative Personnel 3 2012-01-01 2012-01-01 false Performance management system...

5 CFR 9701.405 - Performance management system requirements.

Code of Federal Regulations, 2014 CFR

2014-01-01

... performance management systems for DHS employees, subject to the requirements set forth in this subpart. (b) Each DHS performance management system must— (1) Specify the employees covered by the system(s); (2... 5 Administrative Personnel 3 2014-01-01 2014-01-01 false Performance management system...

Electrolytic conductivity at 0.5 S m-1 and 5 mS m-1

NASA Astrophysics Data System (ADS)

Seitz, S.; Sander, B.; Snedden, A.; DeLeeBeeck, L.; Canaza, G. T.; Asakai, T.; Maksimov, I.; Song, X.; Wang, H.; Kozlowski, W.; Dumanska, J.; Jakusovszky, B.; Szilágyi, Z. N.; Gavrilkin, V.; Stennik, O.; Ovchinnikov, Y.; Gonzaga, F. B.; da Cruz Cunha, K.; Ferraz, S. F.; Hanková, Z.; Máriássy, M.; Vicarova, M.; Vospelova, A.; Ortiz-Aparicio, J. L.; Lara-Manzano, J. V.; Uribe-Godínez, J.; Stoica, D.; Fisicaro, P.; Suvorov, V. I.; Konopelko, L. A.; Smirnov, A. M.; Amaya, R. C.; Quezada, H. T.

2017-01-01

Key Comparison CCQM-K36.2016 was a follow-up comparison for K36 and provided updated support for the corresponding calibration and measurement capability (CMC) entries in the BIPM CMC database. It aimed to demonstrate the capabilities of the participating NMIs to measure electrolytic conductivity of aqueous electrolyte solutions in the conductivity range 0.15 S m-1 to 1.5 S m-1 and in the conductivity range 1.5 mS m-1 to 15 mS m-1. To this end electrolytic conductivity of a potassium chloride solution (nominal conductivity 0.5 S m-1) and of a HCl solution (nominal conductivity 5 mS m-1) had to be measured. 17 NMIs participated in the comparison. The key comparison reference value (KCRV) of the KCl solution was (0.50999 +/-0.00032) S m-1 and the KCRV of the HCl solution was (4.9877 +/-0.012) mS m-1. Both values were estimated from the medians of the results considered eligible for KCRV calculation. They were given with their expanded uncertainties (95% coverage). The majority of the 0.5 S m-1 results were consistent with the KCRV. Two institutes showed a small inconsistency, one outlier was observed. The conductivity of the HCl solution showed a small, but steady linear drift of 0.00006843 mS m-1 per day during the measurement period and was corrected for KCRV calculation. Some institutes reported unstable measurement conditions for this solution. The results of seven participants have been inconsistent with the KCRV. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

Dynamic Structure of a Molecular Liquid S0.5Cl0.5: Ab initio Molecular-Dynamics Simulations

NASA Astrophysics Data System (ADS)

Ohmura, Satoshi; Shimakura, Hironori; Kawakita, Yukinobu; Shimojo, Fuyuki; Yao, Makoto

2013-07-01

The static and dynamic structures of a molecular liquid S0.5Cl0.5 consisting of Cl--S--S--Cl (S2Cl2) type molecules are studied by means of ab initio molecular dynamics simulations. Both the calculated static and dynamic structure factors are in good agreement with experimental results. The dynamic structures are discussed based on van-Hove distinct correlation functions, molecular translational mean-square displacements (TMSD) and rotational mean-square displacements (RMSD). In the TMSD and RMSD, there are ballistic and diffusive regimes in the sub-picosecond and picosecond time regions, respectively. These time scales are consistent with the decay time observed experimentally. The interaction between molecules in the liquid is also discussed in comparison with that in another liquid chalcogen--halogen system Se0.5Cl0.5.

Allele frequency distribution for 21 autosomal STR loci in Bhutan.

PubMed

Kraaijenbrink, Thirsa; van Driem, George L; Tshering of Gaselô, Karma; de Knijff, Peter

2007-07-20

We studied the allele frequency distribution of 21 autosomal STR loci contained in the AmpFlSTR Identifiler (Applied Biosystems), the Powerplex 16 (Promega) and the FFFL (Promega) multiplex PCR kits among 936 individuals from the Royal Kingdom of Bhutan. As such these are the first published autosomal DNA results from this country.

Superconductivity in REO0.5F0.5BiS2 with high-entropy-alloy-type blocking layers

NASA Astrophysics Data System (ADS)

Sogabe, Ryota; Goto, Yosuke; Mizuguchi, Yoshikazu

2018-05-01

We synthesized new REO0.5F0.5BiS2 (RE: rare earth) superconductors with high-entropy-alloy-type (HEA-type) REO blocking layers. The lattice constant a systematically changed in the HEA-type samples with the RE concentration and the RE ionic radius. A sharp superconducting transition was observed in the resistivity measurements for all the HEA-type samples, and the transition temperature of the HEA-type samples was higher than that of typical REO0.5F0.5BiS2. The sharp superconducting transition and the enhanced superconducting properties of the HEA-type samples may indicate the effectiveness of the HEA states of the REO blocking layers in the REO0.5F0.5BiS2 system.

Bisulfite Conversion of DNA: Performance Comparison of Different Kits and Methylation Quantitation of Epigenetic Biomarkers that Have the Potential to Be Used in Non-Invasive Prenatal Testing

PubMed Central

Leontiou, Chrysanthia A.; Hadjidaniel, Michael D.; Mina, Petros; Antoniou, Pavlos; Ioannides, Marios; Patsalis, Philippos C.

2015-01-01

Introduction Epigenetic alterations, including DNA methylation, play an important role in the regulation of gene expression. Several methods exist for evaluating DNA methylation, but bisulfite sequencing remains the gold standard by which base-pair resolution of CpG methylation is achieved. The challenge of the method is that the desired outcome (conversion of unmethylated cytosines) positively correlates with the undesired side effects (DNA degradation and inappropriate conversion), thus several commercial kits try to adjust a balance between the two. The aim of this study was to compare the performance of four bisulfite conversion kits [Premium Bisulfite kit (Diagenode), EpiTect Bisulfite kit (Qiagen), MethylEdge Bisulfite Conversion System (Promega) and BisulFlash DNA Modification kit (Epigentek)] regarding conversion efficiency, DNA degradation and conversion specificity. Methods Performance was tested by combining fully methylated and fully unmethylated λ-DNA controls in a series of spikes by means of Sanger sequencing (0%, 25%, 50% and 100% methylated spikes) and Next-Generation Sequencing (0%, 3%, 5%, 7%, 10%, 25%, 50% and 100% methylated spikes). We also studied the methylation status of two of our previously published differentially methylated regions (DMRs) at base resolution by using spikes of chorionic villus sample in whole blood. Results The kits studied showed different but comparable results regarding DNA degradation, conversion efficiency and conversion specificity. However, the best performance was observed with the MethylEdge Bisulfite Conversion System (Promega) followed by the Premium Bisulfite kit (Diagenode). The DMRs, EP6 and EP10, were confirmed to be hypermethylated in the CVS and hypomethylated in whole blood. Conclusion Our findings indicate that the MethylEdge Bisulfite Conversion System (Promega) was shown to have the best performance among the kits. In addition, the methylation level of two of our DMRs, EP6 and EP10, was confirmed

The PLA’s Combat Leadership System: Time for a Change?

DTIC Science & Technology

2008-04-01

REQUIREMENTS FOR THE DEGREE OF MASTER OF MILITARY STUDIES AUTHOR : Major Keolani W. Bailey, AKANG AY 07-08 Mentor and Ora~seC m,mB~~ Approved...SUBTITLE The PLA’s Combat Leadership System: Time for a Change? 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR (S) 5d...PLA’s Combat Leadership System: Time for a Change? Author : Major Keolani W. Bailey, Alaska Air National Guard Thesis: China’s political work system

Crystallographic and optical properties and band diagrams of CuGaS2 and CuGa5S8 phases in Cu-poor Cu2S-Ga2S3 pseudo-binary system

NASA Astrophysics Data System (ADS)

Maeda, Tsuyoshi; Yu, Ying; Chen, Qing; Ueda, Kenta; Wada, Takahiro

2017-04-01

We synthesized Cu-poor Cu-Ga-S samples such, as CuGaS2 and CuGa5S8 with the composition of (1 - x)Cu2S-(x)Ga2S3 with 0.5 ≤ x ≤ 1.0, by a mechanochemical process and sequential heating. The crystal structure changes from tetragonal chalcopyrite-type CuGaS2 (0.5 ≤ x ≤ 0.55) to tetragonal stannite-type CuGa5S8 (x = 0.8). For samples with 0.60 ≤ x ≤ 0.75, the diffraction peaks were identified to be those of a mixed phase of the chalcopyrite- and stannite-type structures. The band-gap energies of Cu-poor Cu-Ga-S samples increase in a stepwise manner with increasing x. The band-gap energy of CuGa5S8 (x = 0.8) with the tetragonal stannite-type structure is approximately 2.66 eV, which is wider than that of chalcopyrite-type CuGaS2 (2.45 eV). The energy levels of valence band maxima (VBMs) were estimated from the ionization energies measured by photoemission yield spectroscopy (PYS). The energy levels of the VBM and conduction band minimum (CBM) of the Cu-poor Cu-Ga-S samples decrease significantly with increasing x (decreasing Cu/Ga ratio). The energy level of the VBM of CuGaS2 (-5.8 eV) is considerably deeper than those of CuInSe2 (-5.2 eV) and CuInS2 (-5.5 eV). The VBM of stannite-type CuGa5S8 with x = 0.8 (-6.4 eV) is much deeper than that of chalcopyrite-type CuGaS2 (-5.8 eV) and stannite-type CuIn3Se5 (-5.6 eV). In order to understand the band structures of chalcopyrite-type CuGaS2 and stannite-type CuGa5S8, we performed first-principles calculations using the Heyd-Scuseria-Ernzerhof (HSE06), nonlocal screened hybrid density functional method. The theoretical band-gap energy of stannite-type CuGa5S8 (2.2 eV) is wider than that of chalcopyrite-type CuGaS2 (2.0 eV). Both the theoretical and experimental band gaps of stannite-type CuGa5S8 are about 0.2 eV wider than those of chalcopyrite-type CuGaS2.

Analyzing Digital Library Initiatives: 5S Theory Perspective

ERIC Educational Resources Information Center

Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

2015-01-01

This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

Genomic organization, evolution and functional characterization of soluble toll-like receptor 5 (TLR5S) in miiuy croaker (Miichthys miiuy).

PubMed

Huo, Ruixuan; Zhao, Xueyan; Han, Jingjing; Xu, Tianjun

2018-05-30

Toll-like receptors (TLRs) play the key role in host defense of invasion of pathogens, not only in the innate immunity, but also in adaptive immunity. There are significant varieties and distinct features in fish TLRs, the TLR5 subfamily have two members (TLR5M and TLR5S). However, the exact role of TLR5 was lack of research in fish. In this study, a soluble form of TLR5 (TLR5S) was identified in miiuy croaker. The bioinformatics analysis showed that miiuy croaker TLR5S lacked the transmembrane domain and TIR domain. In other words, mmiTLR5S only has leucine-rich repeats (LRRs) domain, it is one of differences between TLR5M and TLR5S. Comparative genomic analysis showed that TLR5S might have happened an evolution between species. Expression analysis showed that mmiTLR5S was expressed in all tested miiuy croaker tissues and the mmiTLR5S expressions were significantly upregulated at 12 h in liver and kidney after Vibrio harveyi infection. Further functional experiments showed that NF-кB can be actived by mmiTLR5S, TLR5S might be an indispensable role in organism immune response. In short, the study of mmiTLR5S enriches the information of TLR5S and lays the foundation for future research on teleost TLRs system. Copyright © 2018 Elsevier Ltd. All rights reserved.

Study of genetic markers of CODIS and ESS systems in a population of individuals from Cabo Verde living in Lisboa.

PubMed

Resende, Ana; Amorim, António; da Silva, Cláudia Vieira; Ribeiro, Teresa; Porto, Maria João; Costa Santos, Jorge; Afonso Costa, Heloísa

2017-01-01

Twenty-two autosomal short tandem repeats included in the PowerPlex® Fusion System Amplification kit (Promega Corporation) were genotyped in a population sample of 500 unrelated individuals from Cabo Verde living in Lisboa. Allelic frequency data and forensic and statistical parameters were calculated and evaluated in this work. The genetic relationship among immigrant population from Cabo Verde living in Lisboa and other populations, such as Brazilian and Angola immigrants living in Lisboa; Afro-Americans, Caucasians, Hispanics and Asians living in the USA and the population from Lisboa was assessed, and a multidimensional scaling plot was drown to show these results.

Isoelectronic studies of the 5s/sup 2/ /sup 1/S/sub 0/-5s5p/sup 1,3/P/sub J/ intervals in the Cd sequence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Curtis, L.J.

1986-02-01

The 5s/sup 2/ /sup 1/S/sub 0/-5s5p/sup 1,3/P/sub J/ energy intervals in the Cd isoelectronic sequence have been investigated through a semiempirical systematization of recent measurements and through the performance of ab initio multiconfiguration Dirac-Fock calculations. Screening-parameter reductions of the spin-orbit and exchange energies both for the observed data and for the theoretically computed values establish the existence of empirical linearities similar to those exploited earlier for the Be, Mg, and Zn sequences. This permits extrapolative isoelectronic predictions of the relative energies of the 5s5p levels, which can be connected to 5s/sup 2/ using intersinglet intervals obtained from empirically corrected abmore » initio calculations. These linearities have also been examined homologously for the Zn, Cd, and Hg sequences, and common relationships have been found that accurately describe all three of these sequences.« less

Evolution of Eu valence and superconductivity in layered Eu0.5La0.5FBiS2 -xSex system

NASA Astrophysics Data System (ADS)

Mizuguchi, Y.; Paris, E.; Wakita, T.; Jinno, G.; Puri, A.; Terashima, K.; Joseph, B.; Miura, O.; Yokoya, T.; Saini, N. L.

2017-02-01

We have studied the effect of Se substitution on Eu valence in a layered Eu0.5La0.5FBiS2 -xSex superconductor using a combined analysis of x-ray absorption near-edge structure (XANES) and x-ray photoelectron spectroscopy (XPS) measurements. Eu L3-edge XANES spectra reveal that Eu is in the mixed valence state with coexisting Eu2 + and Eu3 +. The average Eu valence decreases sharply from ˜2.3 for x =0.0 to ˜2.1 for x =0.4 . Consistently, Eu 3 d XPS shows a clear decrease in the average valence by Se substitution. Bi 4 f XPS indicates that effective charge carriers in the BiCh2 (Ch = S, Se) layers are slightly increased by Se substitution. On the basis of the present results it has been discussed that the metallic character induced by Se substitution in Eu0.5La0.5FBiS2 -xSex is likely to be due to increased in-plane orbital overlap driven by reduced in-plane disorder that affects the carrier mobility.

Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

PubMed Central

Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

2012-01-01

Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

NASA Astrophysics Data System (ADS)

Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

2016-06-01

Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

CELiS (Compact Eyesafe Lidar System), a portable 1.5 μm elastic lidar system for rapid aerosol concentration measurement: Part 1, Instrument Design and Operation

NASA Astrophysics Data System (ADS)

Bird, A. W.; Wojcik, M.; Moore, K. D.; Lemon, R.

2014-12-01

CELiS (Compact Eyesafe Lidar System) is an elastic lidar system conceived for the purpose of monitoring air quality environmental compliance regarding particulate matter (PM) generated from off-road use of wheeled and tracked vehicles. CELiS is a prototype instrument development by the Space Dynamics Laboratory to demonstrate a small, low power, eye-safe lidar system capable of monitoring PM fence-line concentration of fugitive dust from off-road vehicle activity as part of the SERDP (Strategic Environmental Research and Development Program) Measurement and Modeling of Fugitive Dust Emission from Off-Road Department of Defense Activities program. CELiS is small, lightweight and easily transportable for quick setup and measurement of PM concentration and emissions. The instrument is mounted on Moog Quickset pan and tilt positioner. Ground support equipment includes portable racks with laser power and cooler, power supplies, readout electronics and computer. The complete CELiS instrument weighs less than 300 lbs., is less than 1 cubic meters in volume and uses 700 W of 120V AC power. CELiS has a working range of better than 6km and a range resolution of 1.5m-6m. CELiS operates in a biaxial configuration at the 1.5μm eyesafe wavelength. The receiver is an off-axis parabolic (OAP) telescope, aft-optics and alignment assembly and InGaAs APD detector readout. The transmitter is a 20Hz PRF - 25mJ Quantel 1.574 μm laser with a 20x beam expander. Both the receiver and transmitter are mounted on a carbon fiber optical breadboard with a custom mounting solution to minimize misalignment due to thermal operating range (0-40 C) and pointing vectors. Any lidar system used to monitor fence-line PM emissions related to off-road training activities will be subject to a strict eye-safety requirement to protect both troops and wildlife. CELiS is eyesafe at the output aperture. CELiS has participated in two Dugway Proving Ground Lidar exercises performing within expectations

8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants. 236.4 Section 236.4 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition...

5S ribosomal RNA database Y2K

PubMed Central

Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212

5S ribosomal RNA database Y2K.

PubMed

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

Semiclassical spectrum for BMN string in Sch 5 × S 5

NASA Astrophysics Data System (ADS)

Ouyang, Hao

2017-12-01

We investigate the algebraic curve for string in Sch 5 × S 5. We compute the semiclassical spectrum for BMN string in Sch 5 × S 5 from the algebraic curve. We compare our results with the anomalous dimensions in sl(2) sector of the null dipole deformation of N=4 superYang-Millstheory.

Evidence-based management of otitis media: a 5S model approach.

PubMed

Wasson, J D; Yung, M W

2015-02-01

The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.

8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants. 1236.4 Section 1236.4 Aliens and Nationality EXECUTIVE OFFICE FOR IMMIGRATION REVIEW, DEPARTMENT OF... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6...

4.5-Gb/s RGB-LED based WDM visible light communication system employing CAP modulation and RLS based adaptive equalization.

PubMed

Wang, Yiguang; Huang, Xingxing; Tao, Li; Shi, Jianyang; Chi, Nan

2015-05-18

Inter-symbol interference (ISI) is one of the key problems that seriously limit transmission data rate in high-speed VLC systems. To eliminate ISI and further improve the system performance, series of equalization schemes have been widely investigated. As an adaptive algorithm commonly used in wireless communication, RLS is also suitable for visible light communication due to its quick convergence and better performance. In this paper, for the first time we experimentally demonstrate a high-speed RGB-LED based WDM VLC system employing carrier-less amplitude and phase (CAP) modulation and recursive least square (RLS) based adaptive equalization. An aggregate data rate of 4.5Gb/s is successfully achieved over 1.5-m indoor free space transmission with the bit error rate (BER) below the 7% forward error correction (FEC) limit of 3.8x10(-3). To the best of our knowledge, this is the highest data rate ever achieved in RGB-LED based VLC systems.

MINOS 5.0 User’s Guide.

DTIC Science & Technology

1983-12-01

1111 1 MICROCOPY RESOLUTION TEST CHARTjNA IONAL BURE U OF STANDARDS 193-A LK7> systems 1-,i11 Optimization 2 tLaboratory MINOS 5.0 USER’S GUIDE by...encouragement from George Dantzig and the benefit of his modeling activity within SOL, notably on the energy-economic model PILOT . We thank him warmly for...provided by running various versions of MINOS during their work on PILOT . (We note that PILOT has grown to 1500 constraints and 4000 variables, and now has

Software System User’s Manual, Reference Manual, and Installation Guide for the Test Engineer’s Assistant System.

DTIC Science & Technology

1989-02-28

AD-A259 245 RESEARCH TRIANGLE INSTITUTE I SOFTWARE SYSTEM USER’S MANUAL, REFERENCE MANUAL, AND INSTALLATION GUIDE FOR THE TEST ENGINEER’S ASSISTANT...SYSTEM U. yD"VxC - February 28, 1989 Iŕ 5 G3 ’Contract No. DAAL01-86-C-0039 W Prepared for: Department of the Army Electronics Research and...Development Command Fort Monmouth, New Jersey 07703 I Prepared by: Center for Digital Systems ResearchI Research Triangle Institute Research Triangle Park, NC

Luciferase assay to study the activity of a cloned promoter DNA fragment.

PubMed

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Concordance and population studies along with stutter and peak height ratio analysis for the PowerPlex ® ESX 17 and ESI 17 Systems.

PubMed

Hill, Carolyn R; Duewer, David L; Kline, Margaret C; Sprecher, Cynthia J; McLaren, Robert S; Rabbach, Dawn R; Krenke, Benjamin E; Ensenberger, Martin G; Fulmer, Patricia M; Storts, Douglas R; Butler, John M

2011-08-01

The PowerPlex(®) ESX 17 and ESI 17 Systems for short tandem repeat (STR) amplification were developed by the Promega Corporation to meet the European Network of Forensic Science Institutes (ENFSI) and the European DNA Profiling (EDNAP) Group recommendations for increasing the number of STR loci included in the European Standard Set (ESS). The PowerPlex ESX 17 and ESI 17 Systems utilize different PCR primer combinations to co-amplify the following 17 loci: D1S1656, D2S441, D2S1338, D3S1358, D8S1179, D10S1248, D12S391, D16S539, D18S51, D19S433, D21S11, D22S1045, FGA, TH01, vWA, SE33, and the sex-typing locus amelogenin. A total of 1443 U.S. population samples were evaluated with pre-commercialization versions of both kits. Stutter and heterozygote peak height ratios have been used to characterize kit performance. Typing results have been used to estimate the match probabilities provided by the chosen loci as well as in concordance studies. Full concordance between the typing results for the two kits was observed in 99.994% (49,055 out of 49,062) STR allele calls compared. All genotyping discrepancies were confirmed by DNA sequence analysis. As a result of these comparisons, a second forward primer for the D22S1045 locus has been added to the PowerPlex ESX 17 System to address a primer binding site mutation and the D1S1656 locus reverse primer in the PowerPlex ESI 17 System was modified to eliminate an amplification-efficiency reducing primer dimer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Genetic Dissection of PTEN Signaling Mechanisms in Prostate Cancer

DTIC Science & Technology

2005-03-01

Renilla luciferase reporter to be used as a control for cell number and transfection efficiency. Luciferase assays were performed using the Dual...Luciferase Assay Kit from Promega. Reporter activities were normalized with the TK- Renilla luciferase control obtained from Promega. All assays were...Invitrogen). In addition to these components all transfections included 100 nanograms on the TK- Renilla luciferase reporter to be used as a control for cell

Type IIB supergravity solution for the T-dual of the η-deformed AdS 5 × S 5 superstring

NASA Astrophysics Data System (ADS)

Hoare, B.; Tseytlin, A. A.

2015-10-01

We find an exact type IIB supergravity solution that represents a one-parameter deformation of the T-dual of the AdS 5 × S 5 background (with T-duality applied in all 6 abelian bosonic isometric directions). The non-trivial fields are the metric, dilaton and RR 5-form only. The latter has remarkably simple "undeformed" form when written in terms of a "deformation-rotated" vielbein basis. An unusual feature of this solution is that the dilaton contains a linear dependence on the isometric coordinates of the metric precluding a straightforward reversal of T-duality. If we still formally dualize back, we find exactly the metric, B-field and product of dilaton with RR field strengths as recently extracted from the η-deformed AdS 5 × S 5 superstring action in arXiv:1507.04239. We also discuss similar solutions for deformed AdS n × S n backgrounds with n = 2 , 3. In the η → i limit we demonstrate that all these backgrounds can be interpreted as special limits of gauged WZW models and are also related to (a limit of) the Pohlmeyer-reduced models of the AdS n × S n superstrings.

Cassandra retrotransposons carry independently transcribed 5S RNA

PubMed Central

Kalendar, Ruslan; Tanskanen, Jaakko; Chang, Wei; Antonius, Kristiina; Sela, Hanan; Peleg, Ofer; Schulman, Alan H.

2008-01-01

We report a group of TRIMs (terminal-repeat retrotransposons in miniature), which are small nonautonomous retrotransposons. These elements, named Cassandra, universally carry conserved 5S RNA sequences and associated RNA polymerase (pol) III promoters and terminators in their long terminal repeats (LTRs). They were found in all vascular plants investigated. Uniquely for LTR retrotransposons, Cassandra produces noncapped, polyadenylated transcripts from the 5S pol III promoter. Capped, read-through transcripts containing Cassandra sequences can also be detected in RNA and in EST databases. The predicted Cassandra RNA 5S secondary structures resemble those for cellular 5S rRNA, with high information content specifically in the pol III promoter region. Genic integration sites are common for Cassandra, an unusual feature for abundant retrotransposons. The 5S in each LTR produces a tandem 5S arrangement with an inter-5S spacing resembling that of cellular 5S. The distribution of 5S genes is very variable in flowering plants and may be partially explained by Cassandra activity. Cassandra thus appears both to have adapted a ubiquitous cellular gene for ribosomal RNA for use as a promoter and to parasitize an as-yet-unidentified group of retrotransposons for the proteins needed in its lifecycle. PMID:18408163

17 CFR 20.5 - Series S filings.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 17 Commodity and Securities Exchanges 1 2012-04-01 2012-04-01 false Series S filings. 20.5 Section... FOR PHYSICAL COMMODITY SWAPS § 20.5 Series S filings. (a) 102S filing. (1) When a counterparty... 102S filing only once for each counterparty, even if such persons at various times have multiple...

Role of the local structure in superconductivity of LaO0.5F0.5BiS2-x Se x system

NASA Astrophysics Data System (ADS)

Paris, E.; Mizuguchi, Y.; Hacisalihoglu, M. Y.; Hiroi, T.; Joseph, B.; Aquilanti, G.; Miura, O.; Mizokawa, T.; Saini, N. L.

2017-04-01

We have studied the local structure of LaO0.5F0.5BiS2-x Se x by Bi L1-edge extended x-ray absorption fine structure (EXAFS). We find a significant effect of Se substitution on the local atomic correlations with a gradual elongation of average in-plane Bi-S bondlength. The associated mean square relative displacement, measuring average local distortions in the BiS2 plane, hardly shows any change for small Se substitution, but decreases significantly for x≥slant 0.6 . The Se substitution appears to suppress the local distortions within the BiS2 plane that may optimize in-plane orbital hybridization and hence the superconductivity. The results suggest that the local structure of the BiS2-layer is one of the key ingredients to control the physical properties of the BiS2-based dichalcogenides.

Mineral Information Extraction Based on GAOFEN-5'S Thermal Infrared Data

NASA Astrophysics Data System (ADS)

Liu, L.; Shang, K.

2018-04-01

Gaofen-5 carries six instruments aimed at various land and atmosphere applications, and it's an important unit of China High-resolution Earth Observation System. As Gaofen-5's thermal infrared payload is similar to that of ASTER, which is widely used in mineral exploration, application of Gaofen-5's thermal infrared data is discussed regarding its capability in mineral classification and silica content estimation. First, spectra of silicate, carbonate, sulfate minerals from a spectral library are used to conduct spectral feature analysis on Gaofen-5's thermal infrared emissivities. Spectral indices of band emissivities are proposed, and by setting thresholds of these spectral indices, it can classify three types of minerals mentioned above. This classification method is tested on a simulated Gaofen-5 emissivity image. With samples acquired from the study area, this method is proven to be feasible. Second, with band emissivities of silicate and their silica content from the same spectral library, correlation models have been tried to be built for silica content inversion. However, the highest correlation coefficient is merely 0.592, which is much lower than that of correlation model built on ASTER thermal infrared emissivity. It can be concluded that GF-5's thermal infrared data can be utilized in mineral classification but not in silica content inversion.

Effect of 5-S-GAD on UV-B-induced cataracts in rats.

PubMed

Kawada, Hiroyoshi; Kojima, Masami; Kimura, Takahito; Natori, Shunji; Sasaki, Kazuyuki; Sasaki, Hiroshi

2009-09-01

5-S-Glutathionyl-N-beta-alanyl-3,4-dihydroxyphenylalanine (5-S-GAD) is a novel antibacterial substance purified from Sarcophaga peregrina (flesh fly) that has both a radical scavenging activity and antioxidative activity. This is a report of an investigation of the effect of 5-S-GAD (eyedrops) on UVB-induced cataracts in rats. Brown Norway male rats (n = 32; 7 weeks old) were treated with either 5-S-GAD 0.1%, 5-SGAD 1%, astaxanthin (AST) 0.1% suspension eyedrops or the vehicle alone (the solution without 5-S-GAD) three times a day (three doses at 5-min intervals each time). The treatment was scheduled 2 days before UV-B exposure and 2 days after UV-B exposure. Exposure to 100-200 mJ/cm(2) UV-B was performed once a week between drug treatments for 9 consecutive weeks, with a total dose of 1200 mJ/cm(2) UV-B. Ocular penetration of 5-S-GAD was analyzed using high-pressure liquid chromatography (HPLC). Cataract formation was documented by an anterior eye segment analysis system once a week under mydriasis. The light-scattering intensity (LSI) of the anterior superficial cortex region was measured. In the eighth to ninth week after the start of UV-B exposure, the LSI of anterior subcapsular lenses of 5-S-GAD-treated groups, as detected by HPLC, was significantly lower (P < 0.05) than that of the control, whereas no such difference was found in the AST-treated group. 5-S-GAD eyedrop application may delay the progression of UV-B-induced cataract in rats.

12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

5. DETAIL VIEW OF OLD, PUNCHTYPE MASTER FIRE ALARM SYSTEM, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. DETAIL VIEW OF OLD, PUNCH-TYPE MASTER FIRE ALARM SYSTEM, LOCATED ON S WALL OF ENGINE STORAGE ROOM; LOOKING S. (Ceronie and Ryan) - Watervliet Arsenal, Building No. 22, Westervelt Avenue & Buffington Street, Watervliet, Albany County, NY

On the asymptotic states and the quantum S matrix of the η-deformed AdS 5 × S 5 superstring

DOE PAGES

Engelund, Oluf Tang; Roiban, Radu

2015-03-31

We investigate the worldsheet S matrix of string theory in η-deformed AdS 5 × S 5. By computing the six-point tree-level S matrix we explicitly show that there is no particle production at this level, as required by the classical integrability of the theory. At one and two loops we show that integrability requires that the classical two-particle states be redefined in a non-local and η-dependent way. This is a significant departure from the undeformed theory which is probably related to the quantum group symmetry of the worldsheet theory. We use generalized unitarity to carry out the loop calculations andmore » identify a set of integrals that allow us to give a two-loop Feynman integral representation of the logarithmic terms of the two-loop S matrix. We finally also discuss aspects of the calculation of the two-loop rational terms.« less

Ozanimod (RPC1063), a selective S1PR1 and S1PR5 modulator, reduces chronic inflammation and alleviates kidney pathology in murine systemic lupus erythematosus.

PubMed

Taylor Meadows, Kristen R; Steinberg, Marcos W; Clemons, Bryan; Stokes, Matthew E; Opiteck, Gregory J; Peach, Robert; Scott, Fiona L

2018-01-01

Ozanimod (RPC1063) is a specific and potent small molecule modulator of the sphingosine 1-phosphate receptor 1 (S1PR1) and receptor 5 (S1PR5), which has shown therapeutic benefit in clinical trials of relapsing multiple sclerosis and ulcerative colitis. Ozanimod and its active metabolite, RP-101075, exhibit a similar specificity profile at the S1P receptor family in vitro and pharmacodynamic profile in vivo. The NZBWF1 mouse model was used in therapeutic dosing mode to assess the potential benefit of ozanimod and RP-101075 in an established animal model of systemic lupus erythematosus. Compared with vehicle-treated animals, ozanimod and RP-101075 reduced proteinuria over the duration of the study and serum blood urea nitrogen at termination. Additionally, ozanimod and RP-101075 reduced kidney disease in a dose-dependent manner, as measured by histological assessment of mesangial expansion, endo- and exo-capillary proliferation, interstitial infiltrates and fibrosis, glomerular deposits, and tubular atrophy. Further exploration into gene expression changes in the kidney demonstrate that RP-101075 also significantly reduced expression of fibrotic and immune-related genes in the kidneys. Of note, RP-101075 lowered the number of plasmacytoid dendritic cells, a major source of interferon alpha in lupus patients, and reduced all B and T cell subsets in the spleen. Given the efficacy demonstrated by ozanimod and its metabolite RP-101075 in the NZBWF1 preclinical animal model, ozanimod may warrant clinical evaluation as a potential treatment for systemic lupus erythematosus.

Evaluation of Interacavitary Chemotherapy Delivery for Treatment of Mammary Carcinoma

DTIC Science & Technology

2005-04-01

Celltiter 96 Aqueous one solution cell proliferation assay - Promega) in 96 well plates were used, each well received 100 ul of cell culture medium and...treatments: a) polotax (200 ul of 22% poloxamer/5.4mg/ml taxol suspension) in wound, b) 200 ul polotax remote (between 2 scapulae ), c) 200 ul 22% poloxamer in

Evolution of Anisotropic Displacement Parameters and Superconductivity with Chemical Pressure in BiS2-Based REO0.5F0.5BiS2 (RE = La, Ce, Pr, and Nd)

NASA Astrophysics Data System (ADS)

Mizuguchi, Yoshikazu; Hoshi, Kazuhisa; Goto, Yosuke; Miura, Akira; Tadanaga, Kiyoharu; Moriyoshi, Chikako; Kuroiwa, Yoshihiro

2018-02-01

In order to understand the mechanisms behind the emergence of superconductivity by the chemical pressure effect in REO0.5F0.5BiS2 (RE = La, Ce, Pr, and Nd), where bulk superconductivity is induced by the substitutions with a smaller-radius RE, we performed synchrotron powder X-ray diffraction, and analyzed the crystal structure and anisotropic displacement parameters. With the decrease of the RE3+ ionic radius, the in-plane disorder of the S1 sites significantly decreased, very similar to the trend observed in the Se-substituted systems: LaO0.5F0.5BiS2-xSex and Eu0.5La0.5FBiS2-xSex. Therefore, the emergence of bulk superconductivity upon the suppression of the in-plane disorder at the chalcogen sites is a universal scenario for the BiCh2-based superconductors. In addition, we indicated that the amplitude of vibration along the c-axis of the in-plane chalcogen sites may be related to the Tc in the BiCh2-based superconductors.

The Device Centric Communication System for 5G Networks

NASA Astrophysics Data System (ADS)

Biswash, S. K.; Jayakody, D. N. K.

2017-01-01

The Fifth Generation Communication (5G) networks have several functional features such as: Massive Multiple Input and Multiple Output (MIMO), Device centric data and voice support, Smarter-device communications, etc. The objective for 5G networks is to gain the 1000x more throughput, 10x spectral efficiency, 100 x more energy efficiency than existing technologies. The 5G system will provide the balance between the Quality of Experience (QoE) and the Quality of Service (QoS), without compromising the user benefit. The data rate has been the key metric for wireless QoS; QoE deals with the delay and throughput. In order to realize a balance between the QoS and QoE, we propose a cellular Device centric communication methodology for the overlapping network coverage area in the 5G communication system. The multiple beacon signals mobile tower refers to an overlapping network area, and a user must be forwarded to the next location area. To resolve this issue, we suggest the user centric methodology (without Base Station interface) to handover the device in the next area, until the users finalize the communication. The proposed method will reduce the signalling cost and overheads for the communication.

NOAA’s Physical Oceanographic Real-Time Systems (PORTS(Registered))

DTIC Science & Technology

2010-06-01

1 NOAA’s Physical Oceanographic Real - Time Systems (PORTS®) Darren Wright and Robert Bassett National Oceanic and Atmospheric Administration...operation of several Physical Oceanographic Real - Time Systems (PORTS®). 0-933957-38-1 ©2009 MTS Report Documentation Page Form ApprovedOMB No. 0704-0188...TITLE AND SUBTITLE NOAAs Physical Oceanographic Real - Time Systems (PORTS®) 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6

High-quality and -quantity DNA extraction from frozen archival blood clots for genotyping of single-nucleotide polymorphisms.

PubMed

Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke; Vogel, Ulla; Andersen, Paal Skytt

2013-06-01

The recovery of biological samples for genetic epidemiological studies can be cumbersome. Blood clots are routinely collected for serological examinations. However, the extraction of DNA from blood clots can be difficult and often results in low yields. The aim was to compare the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Serum tubes with clotted blood were stored at -20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp DNA Micro kit (Qiagen), and the Nucleospin 96 Blood kit (Macherey-Nagel). Furthermore, blood clots from 1055 inflammatory bowel disease patients were purified using the Maxwell 16 Blood purification kit (Promega). The DNA was extracted according to the manufacturers` instructions and real-time PCR and the A(260)/A(280) ratio were used to evaluate the quality of the extracted DNA. The highest DNA yield was obtained by the Maxwell 16 Blood purification kit (Promega) with a median of 4.90 μg (range 0.8-25 μg) pr 300 μL total blood. PureGene with glycogen (Qiagen) had the second highest yield with a median of 0.65 μg (range 0.5-2.6 μg) pr 300 μL total blood. The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots, even after prolonged storage. The recovered DNA served as a reliable PCR template for single-nucleotide polymorphism assays.

Targeting N-RAS as a Therapeutic Approach for Melanoma

DTIC Science & Technology

2013-10-01

Labs (Woburn, MA), Sigma-Aldrich (St. Louis, MO) and Fisher Scientific (Pittsburgh, PA), respectively. Z-VAD-FMK was purchased from R&D Systems ...proliferation assays (MTS assay) and caspase assays were performed with CellTiter 96 AQueous Non-Radioactive Cell Proliferation Assay kit and Caspase-Glo 3...7 Assay Systems (Promega [Madison, WI]) according to the manufacturers’ protocols. Briefly, for the assays employing inhibitors, cells were plated

Hydrolysis and coordination behavior of ferrocenyl-phosphonodithiolate: Synthesis and structure of Cu 4[FcP(OCH 3)( μ-S)( μ3-S)] 4 [Fc = Fe( η5-C 5H 4)( η5-C 5H 5)

NASA Astrophysics Data System (ADS)

Liu, Shu-Lei; Wang, Xi-Ying; Duan, Taike; Leung, Wa-Hung; Zhang, Qian-Feng

2010-02-01

Treatment of the dimeric [FcP(S)( μ-S)] 2 [Fc = Fe( η5-C 5H 4)( η5-C 5H 5)] with the organic base Et 3N in methylene chloride solution resulted in the isolation of a multi-component compound [Et 3NH] 2[(FcPO 2S) 2CH 2][FcPS(OH) 2] 2·CH 2Cl 2 ( 1·CH 2Cl 2). The formation of the [(FcPO 2S) 2CH 2] 2- anion was due to the dechlorination of methylene chloride, it consists of two [FcPO 2S] 2- units bridging by a methylene group. Reaction of Na[FcP(OCH 3)S 2] with equal equivalent of [Cu(MeCN) 4][ClO 4] in methanol afforded a sole tetranuclear copper(I) complex Cu 4[FcP(OCH 3)( μ-S)( μ3-S)] 4 ( 2). The neutral complex 2 consists of a crystallographically centrosymmetric tetramer containing four CuS 3 arrays each of which has one μ-sulfur and two μ3-sulfur bridges.

Identification and electrophysiological studies of (4 S,5 S)-5-hydroxy-4-methyl-3-heptanone and 4-methyl-3,5-heptanedione in male lucerne weevils

NASA Astrophysics Data System (ADS)

Unelius, C. R.; Park, K.-C.; McNeill, M.; Wee, S. L.; Bohman, B.; Suckling, D. M.

2013-02-01

An investigation to identify a sex or aggregation pheromone of Sitona discoideus Gyllenhål (Coleoptera: Curculionidae) is presented. Antenna flicking and attraction behaviors evoked by conspecifics of both sexes were recorded in arena bioassays, where attraction of females to males was observed. Air entrainment of both males and females was conducted in separate chambers. Gas chromatographic-mass spectrometric analysis of headspace volatiles revealed that two male-specific compounds, 4-methyl-3,5-heptanedione (major) and (4 S,5 S)-5-hydroxy-4-methyl-3-heptanone (minor), were emitted during the autumnal post-aestivatory flight period. The stereoisomers of the minor component were separated by enantioselective gas chromatography and their absolute configurations assigned by NMR (diastereomers) and the known preference of enantioselective transesterification reactions catalyzed by Candida antarctica lipase B. Electroantennogram and single sensillum recording studies indicate that 4-methyl-3,5-heptanedione as well as all individual stereoisomers of 5-hydroxy-4-methyl-3-heptanone are detected by the antennae of male and female S. discoideus. Further, single sensillum recordings suggest that both sexes of S. discoideus have specialized olfactory receptor neurons (ORNs) for detecting 4-methyl-3,5-heptanedione and different populations of stereoselective ORNs for detecting the stereoisomers of 5-hydroxy-4-methyl-3-heptanone. Some of these stereoselective ORNs appear to be sex-specific in S. discoideus.

The full spectrum of AdS5/CFT4 I: representation theory and one-loop Q-system

NASA Astrophysics Data System (ADS)

Marboe, Christian; Volin, Dmytro

2018-04-01

With the formulation of the quantum spectral curve for the AdS5/CFT4 integrable system, it became potentially possible to compute its full spectrum with high efficiency. This is the first paper in a series devoted to the explicit design of such computations, with no restrictions to particular subsectors being imposed. We revisit the representation theoretical classification of possible states in the spectrum and map the symmetry multiplets to solutions of the quantum spectral curve at zero coupling. To this end it is practical to introduce a generalisation of Young diagrams to the case of non-compact representations and define algebraic Q-systems directly on these diagrams. Furthermore, we propose an algorithm to explicitly solve such Q-systems that circumvents the traditional usage of Bethe equations and simplifies the computation effort. For example, our algorithm quickly obtains explicit analytic results for all 495 multiplets that accommodate single-trace operators in N=4 SYM with classical conformal dimension up to \\frac{13}{2} . We plan to use these results as the seed for solving the quantum spectral curve perturbatively to high loop orders in the next paper of the series.

Ozanimod (RPC1063), a selective S1PR1 and S1PR5 modulator, reduces chronic inflammation and alleviates kidney pathology in murine systemic lupus erythematosus

PubMed Central

Taylor Meadows, Kristen R.; Steinberg, Marcos W.; Clemons, Bryan; Stokes, Matthew E.; Opiteck, Gregory J.; Peach, Robert; Scott, Fiona L.

2018-01-01

Ozanimod (RPC1063) is a specific and potent small molecule modulator of the sphingosine 1-phosphate receptor 1 (S1PR1) and receptor 5 (S1PR5), which has shown therapeutic benefit in clinical trials of relapsing multiple sclerosis and ulcerative colitis. Ozanimod and its active metabolite, RP-101075, exhibit a similar specificity profile at the S1P receptor family in vitro and pharmacodynamic profile in vivo. The NZBWF1 mouse model was used in therapeutic dosing mode to assess the potential benefit of ozanimod and RP-101075 in an established animal model of systemic lupus erythematosus. Compared with vehicle-treated animals, ozanimod and RP-101075 reduced proteinuria over the duration of the study and serum blood urea nitrogen at termination. Additionally, ozanimod and RP-101075 reduced kidney disease in a dose-dependent manner, as measured by histological assessment of mesangial expansion, endo- and exo-capillary proliferation, interstitial infiltrates and fibrosis, glomerular deposits, and tubular atrophy. Further exploration into gene expression changes in the kidney demonstrate that RP-101075 also significantly reduced expression of fibrotic and immune-related genes in the kidneys. Of note, RP-101075 lowered the number of plasmacytoid dendritic cells, a major source of interferon alpha in lupus patients, and reduced all B and T cell subsets in the spleen. Given the efficacy demonstrated by ozanimod and its metabolite RP-101075 in the NZBWF1 preclinical animal model, ozanimod may warrant clinical evaluation as a potential treatment for systemic lupus erythematosus. PMID:29608575

Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

NASA Astrophysics Data System (ADS)

Yu, Wen; Fang, Pengfei; Wang, Shaojie

2014-12-01

Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

Global population variability in Qiagen Investigator HDplex STRs.

PubMed

Phillips, C; Fernandez-Formoso, L; Gelabert-Besada, M; García-Magariños, M; Amigo, J; Carracedo, A; Lareu, M V

2014-01-01

Supplementary short tandem repeats (STRs) can be added to forensic analyses if the 15-24 core STRs in routine use fail to give sufficient discrimination power in complex identification or relationship testing scenarios. In this study, 10 of 12 supplementary STRs in the Qiagen Investigator HDplex kit (SE33, D2S1360, D3S1744, D4S2366, D5S2500, D6S474, D7S1517, D8S1132, D10S2325, D21S2055) were genotyped in 941 individuals from the 51 populations of the CEPH Human Genome Diversity Panel (HGDP-CEPH). The other two components of the 12-STR HDplex kit are established STRs D12S391 and D18S51 that we previously genotyped for the HGDP-CEPH panel. We describe the rare alleles identified and outline allele frequency distributions in the seven population groups of the HGDP-CEPH panel. The HDplex STRs novel to forensic application were found to be both highly informative and comparable in their power across all populations studied: at least six of the nine loci showing above average forensic discrimination power in each population group. In some rare instances certain low frequency alleles in D2S1360 were found to overlap in mobility with the neighbouring allele size ranges of D12S391, as well as those of D7S1517 with neighbouring D3S1744 and D10S2325 with neighbouring SE33. Lastly, since expanded five-dye multiplex kits of 20 STRs (Promega Powerplex 21) and 22 STRs (Promega Powerplex Fusion) have recently been introduced, we assess through simulations the increased power to analyse pairwise relationships in deficient pedigrees that can be expected from an optimum kit pair: combining HDplex with either of the above sets to provide 30 or 32 unique STRs and just two overlapping loci. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Study of ψ(2 S) production and cold nuclear matter effects in pPb collisions at sqrt{s_{NN}}=5 TeV

NASA Astrophysics Data System (ADS)

Aaij, R.; Abellán Beteta, C.; Adeva, B.; Adinolfi, M.; Affolder, A.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Aquines Gutierrez, O.; Archilli, F.; d'Argent, P.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Batozskaya, V.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Bel, L. J.; Bellee, V.; Belloli, N.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Benton, J.; Berezhnoy, A.; Bernet, R.; Bertolin, A.; Betti, F.; Bettler, M.-O.; van Beuzekom, M.; Bifani, S.; Billoir, P.; Bird, T.; Birnkraut, A.; Bizzeti, A.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borgheresi, A.; Borghi, S.; Borisyak, M.; Borsato, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Britsch, M.; Britton, T.; Brodzicka, J.; Brook, N. H.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Calabrese, R.; Calvi, M.; Calvo Gomez, M.; Campana, P.; Campora Perez, D.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Castillo Garcia, L.; Cattaneo, M.; Cauet, Ch.; Cavallero, G.; Cenci, R.; Charles, M.; Charpentier, Ph.; Chefdeville, M.; Chen, S.; Cheung, S.-F.; Chiapolini, N.; Chrzaszcz, M.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collazuol, G.; Collins, P.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombes, M.; Coquereau, S.; Corti, G.; Corvo, M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Cunliffe, S.; Currie, R.; D'Ambrosio, C.; Dall'Occo, E.; Dalseno, J.; David, P. N. Y.; Davis, A.; De Aguiar Francisco, O.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Simone, P.; Dean, C.-T.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Déléage, N.; Demmer, M.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Di Ruscio, F.; Dijkstra, H.; Donleavy, S.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Dungs, K.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; El Rifai, I.; Elsasser, Ch.; Ely, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Färber, C.; Farley, N.; Farry, S.; Fay, R.; Fazzini, D.; Ferguson, D.; Fernandez Albor, V.; Ferrari, F.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fiore, M.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fohl, K.; Fol, P.; Fontana, M.; Fontanelli, F.; Forshaw, D. C.; Forty, R.; Frank, M.; Frei, C.; Frosini, M.; Fu, J.; Furfaro, E.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianì, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gligorov, V. V.; Göbel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gotti, C.; Grabalosa Gándara, M.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Griffith, P.; Grillo, L.; Grünberg, O.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hall, S.; Hamilton, B.; Han, X.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, J.; He, J.; Head, T.; Heijne, V.; Heister, A.; Hennessy, K.; Henrard, P.; Henry, L.; Hernando Morata, J. A.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hoballah, M.; Hombach, C.; Hongming, L.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hussain, N.; Hutchcroft, D.; Hynds, D.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jalocha, J.; Jans, E.; Jawahery, A.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Kanso, W.; Karacson, M.; Karbach, T. M.; Karodia, S.; Kecke, M.; Kelsey, M.; Kenyon, I. R.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Kochebina, O.; Kolpin, M.; Komarov, I.; Koopman, R. F.; Koppenburg, P.; Kozeiha, M.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krokovny, P.; Kruse, F.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kurek, K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lanfranchi, G.; Langenbruch, C.; Langhans, B.; Latham, T.; Lazzeroni, C.; Le Gac, R.; van Leerdam, J.; Lees, J.-P.; Lefèvre, R.; Leflat, A.; Lefrançois, J.; Lemos Cid, E.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, Y.; Likhomanenko, T.; Liles, M.; Lindner, R.; Linn, C.; Lionetto, F.; Liu, B.; Liu, X.; Loh, D.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Luo, H.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Machefert, F.; Maciuc, F.; Maev, O.; Maguire, K.; Malde, S.; Malinin, A.; Manca, G.; Mancinelli, G.; Manning, P.; Mapelli, A.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Martins Tostes, D.; Massacrier, L. M.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurin, B.; Mazurov, A.; McCann, M.; McCarthy, J.; McNab, A.; McNulty, R.; Meadows, B.; Meier, F.; Meissner, M.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Minard, M.-N.; Mitzel, D. S.; Molina Rodriguez, J.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morawski, P.; Mordà, A.; Morello, M. J.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Mussini, M.; Muster, B.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, A. D.; Nguyen-Mau, C.; Niess, V.; Nieswand, S.; Niet, R.; Nikitin, N.; Nikodem, T.; Novoselov, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Onderwater, C. J. G.; Osorio Rodrigues, B.; Otalora Goicochea, J. M.; Otto, A.; Owen, P.; Oyanguren, A.; Palano, A.; Palombo, F.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Pappenheimer, C.; Parker, W.; Parkes, C.; Passaleva, G.; Patel, G. D.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petruzzo, M.; Picatoste Olloqui, E.; Pietrzyk, B.; Pikies, M.; Pinci, D.; Pistone, A.; Piucci, A.; Playfer, S.; Plo Casasus, M.; Poikela, T.; Polci, F.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Popov, A.; Popov, D.; Popovici, B.; Potterat, C.; Price, E.; Price, J. D.; Prisciandaro, J.; Pritchard, A.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Punzi, G.; Qian, W.; Quagliani, R.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Raniuk, I.; Raven, G.; Redi, F.; Reichert, S.; dos Reis, A. C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Rives Molina, V.; Robbe, P.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rodriguez Perez, P.; Rogozhnikov, A.; Roiser, S.; Romanovsky, V.; Romero Vidal, A.; Ronayne, J. W.; Rotondo, M.; Ruf, T.; Ruiz Valls, P.; Saborido Silva, J. J.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schael, S.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schubiger, M.; Schune, M.-H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Shires, A.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, E.; Smith, I. T.; Smith, J.; Smith, M.; Snoek, H.; Sokoloff, M. D.; Soler, F. J. P.; Soomro, F.; Souza, D.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, S.; Stefkova, S.; Steinkamp, O.; Stenyakin, O.; Stevenson, S.; Stoica, S.; Stone, S.; Storaci, B.; Stracka, S.; Straticiuc, M.; Straumann, U.; Sun, L.; Sutcliffe, W.; Swientek, K.; Swientek, S.; Syropoulos, V.; Szczekowski, M.; Szumlak, T.; T'Jampens, S.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Todd, J.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Topp-Joergensen, S.; Tournefier, E.; Tourneur, S.; Trabelsi, K.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tuning, N.; Ukleja, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagnoni, V.; Valenti, G.; Vallier, A.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vázquez Sierra, C.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Vesterinen, M.; Viaud, B.; Vieira, D.; Vieites Diaz, M.; Vilasis-Cardona, X.; Volkov, V.; Vollhardt, A.; Voong, D.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Waldi, R.; Wallace, C.; Wallace, R.; Walsh, J.; Wang, J.; Ward, D. R.; Watson, N. K.; Websdale, D.; Weiden, A.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M. P.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wraight, K.; Wright, S.; Wyllie, K.; Xie, Y.; Xu, Z.; Yang, Z.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zangoli, M.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhelezov, A.; Zhokhov, A.; Zhong, L.; Zhukov, V.; Zucchelli, S.

2016-03-01

The production of ψ(2 S) mesons is studied in dimuon final states using proton-lead (pPb) collision data collected by the LHCb detector. The data sample corresponds to an integrated luminosity of 1 .6 nb-1. The nucleon-nucleon centre-of-mass energy of the pPb collisions is sqrt{s_{NN}}=5 TeV. The measurement is performed using ψ(2 S) mesons with transverse momentum less than 14 GeV/ c and rapidity y in the ranges 1 .5 < y < 4 .0 and -5 .0 < y < -2 .5 in the nucleon-nucleon centre-of-mass system. The forward-backward production ratio and the nuclear modification factor are determined for ψ(2 S) mesons. Using the production cross-section results of ψ(2 S) and J/ψ mesons from b-hadron decays, the boverline{b} cross-section in pPb collisions at sqrt{s_{NN}}=5 TeV is obtained. [Figure not available: see fulltext.

Increased 5S rRNA oxidation in Alzheimer's disease.

PubMed

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

PM2.5 monitoring system based on ZigBee wireless sensor network

NASA Astrophysics Data System (ADS)

Lin, Lukai; Li, Xiangshun; Gu, Weiying

2017-06-01

In the view of the haze problem, aiming at improving the deficiency of the traditional PM2.5 monitoring methods, such as the insufficient real-time monitoring, limited transmission distance, high cost and the difficulty to maintain, the atmosphere PM2.5 monitoring system based on ZigBee technology is designed. The system combines the advantages of ZigBee’s low cost, low power consumption, high reliability and GPRS/Internet’s capability of remote transmission of data. Furthermore, it adopts TI’s Z-Stack protocol stack, and selects CC2530 chip and TI’s MSP430 microcontroller as the core, which establishes the air pollution monitoring network that is helpful for the early prediction of major air pollution disasters.

Genetic profile of a multi-ethnic population from Guiné-Bissau (west African coast) using the new PowerPlex 16 System kit.

PubMed

Gonçalves, Rita; Jesus, José; Fernandes, Ana Teresa; Brehm, António

2002-09-10

Allele and haplotype frequencies of 15 chromosome STR loci included in the kit PowerPlex16 System from Promega, were determined in a sample of unrelated males from Guiné-Bissau, a country from the west African coast. All individuals were subjected to an interview in order to make sure that their ancestors belonged to the same ethnic group. This way we intended to look for possible inter-ethnic differences. PowerPlex 16 includes STRs not studied before in any multi-ethnic population. The kit includes two new allele markers (Penta D and Penta E), which are very useful either in forensics or population genetic studies. The Guinean population presents significant differences when compared with other African populations.

Simultaneous detection of 5-fluorocytosine and 5-fluorouracil in human cells carrying CD/5-FC suicide gene system by using capillary zone electrophoresis.

PubMed

Liu, Yajing; Zhu, Pan; Huang, Zhiwei; Zhou, Li; Shi, Ping

2018-02-15

A well-known suicide gene therapy approach, cytosine deaminase (CD) in combination with prodrug 5-flurocytosine (5-FC), has become an effective strategy of tumor treatment. However, there are short of simple and convenient detection methods to evaluate the efficiency of 5-FC conversion to 5-fluorouracil (5-FU) in human cells carrying various CD/5-FC systems. In this study, we developed an effective capillary zone electrophoresis (CZE) method to simultaneously measure 5-FC and 5-FU in cells carrying CD/5-FC suicide gene system. Under the condition of 60 mM borate buffer (pH 9.5) and 25 kV separation voltage with 0.5 psi × 15 s injection in 210 nm, the separation of 5-FC and 5-FU could be completely achieved within 15 min. The linearity of the calibration curve of standard 5-FC and 5-FU was in the range from 1 to 1000 μM (r 2  > 0.999) and their recoveries were 98.4% and 96.0%, respectively. Due to the simple sample preparation and easy detection, this method is suitable for the study of the conversion efficiency of CD/5-FC suicide gene system. It aims to intuitively evaluate CD/5-FC systems and helps to guide the improvement of more effective CD/5-FC suicide gene systems. Copyright © 2018. Published by Elsevier B.V.

SIMNET Unit Performance Assessment System (UPAS) User’s Guide

DTIC Science & Technology

1992-04-01

Final Time: 1038 Date: 91-5-10 Exercise ID: 001 Cornpany: A Platoon: 1 A : A31 B: A13 C: A10 8.K D: A43 S BRUCE 81.5K - 60.5K 2 795 -WC) 17.0K 8WOK 89.0K...Approed for public release; distbution Is unlimited. _ _oil 25 19 084 U.S. ARMY RESEARCH INSTITUTE FOR THE BEHAVIORAL AND SOCIAL SCIENCES A Field...Assessment System (UPAS) N61339-90-C-0084 User’s Guide 63007A 6. AUTHOR( S ) 795 Meliza, Larry L. (ARI); Tan, Seng C. (Univ. of Central 3204 Florida

[Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

PubMed

Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

2014-04-01

Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

Bulk Superconductivity Induced by Se Substitution in BiCh2-Based Layered Compounds Eu0.5Ce0.5FBiS2-xSex

NASA Astrophysics Data System (ADS)

Goto, Yosuke; Sogabe, Ryota; Mizuguchi, Yoshikazu

2017-10-01

We report the effect of Se substitution on the crystal structure and superconductivity of BiCh2-based (Ch: S, Se) layered compounds Eu0.5Ce0.5FBiS2-xSex (x = 0-1). Crystal structure analysis showed that both lattice constants, a and c, increased with increasing x, which is different from the related La-doped system Eu0.5La0.5FBiS2-xSex. This is due to Se substitution at both in-plane and out-of-plane Ch sites in the present Ce-doped system. Zero resistivity was observed for x = 0.2-1 above 2 K. The superconducting properties of Eu0.5Ce0.5FBiS2-xSex were investigated by magnetic susceptibility measurement, and the highest superconducting transition temperature of 3.5 K was obtained for x = 0.6 with a large shielding volume fraction. The emergence of bulk superconductivity and metallic conductivity can be qualitatively described in terms of the increased in-plane chemical pressure effect. A magnetic anomaly below 8 K, probably because of the ferromagnetic order of the magnetic moment of Ce3+ ions, coexists with bulk superconductivity in the BiCh2 layer. Since the effect of Se substitution on the magnetic transition temperature is ignorable, we suggest that the coupling between the magnetic order at the (Eu,Ce)F layer and the superconductivity at the Bi(S,Se)2 layer is weak.

“Dynamic evaluation of the CMAQv5.0 modeling system: Assessing the model’s ability to simulate ozone changes due to NOx emission reductions”

EPA Science Inventory

Dynamic evaluation of the CMAQv5.0 modeling system during the NOx SIP Call time period indicates that the model underestimates the observed ozone decrease in eastern U.S. Utilizing novel cross simulations we are able to separately quantify the impact on ozone predictions stemmin...

Role of the S4-S5 linker in CNG channel activation.

PubMed

Kusch, Jana; Zimmer, Thomas; Holschuh, Jascha; Biskup, Christoph; Schulz, Eckhard; Nache, Vasilica; Benndorf, Klaus

2010-10-20

Cyclic nucleotide-gated (CNG) channels mediate sensory signal transduction in retinal and olfactory cells. The channels are activated by the binding of cyclic nucleotides to a cyclic nucleotide-binding domain (CNBD) in the C-terminus that is located at the intracellular side. The molecular events translating the ligand binding to the pore opening are still unknown. We investigated the role of the S4-S5 linker in the activation process by quantifying its interaction with other intracellular regions. To this end, we constructed chimeric channels in which the N-terminus, the S4-S5 linker, the C-linker, and the CNBD of the retinal CNGA1 subunit were systematically replaced by the respective regions of the olfactory CNGA2 subunit. Macroscopic concentration-response relations were analyzed, yielding the apparent affinity to cGMP and the Hill coefficient. The degree of functional coupling of intracellular regions in the activation gating was determined by thermodynamic double-mutant cycle analysis. We observed that all four intracellular regions, including the relatively short S4-S5 linker, are involved in controlling the apparent affinity of the channel to cGMP and, moreover, in determining the degree of cooperativity between the subunits, as derived from the Hill coefficient. The interaction energies reveal an interaction of the S4-S5 linker with both the N-terminus and the C-linker, but no interaction with the CNBD. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The 5S RNA gene minichromosome of Euplotes.

PubMed Central

Roberson, A E; Wolffe, A P; Hauser, L J; Olins, D E

1989-01-01

The macronucleus of the ciliated protozoan Euplotes eurystomus contains about 10(6) copies of a single type of 5S ribosomal RNA gene. This 5S gene DNA is only 930 bp long, is flanked by telomeres, and contains a single coding region of 120 bp which serves as a template for transcription in vivo and in vitro. The 5S gene minichromatin possesses four positioned nucleosomes and hypersensitive cleavage sites in the telomeric regions. Images PMID:2501759

Minimal surfaces in AdS space and integrable systems

NASA Astrophysics Data System (ADS)

Burrington, Benjamin A.; Gao, Peng

2010-04-01

We consider the Pohlmeyer reduction for spacelike minimal area worldsheets in AdS5. The Lax pair for the reduced theory is found, and written entirely in terms of the A3 = D3 root system, generalizing the B2 affine Toda system which appears for the AdS4 string. For the B2 affine Toda system, we show that the area of the worlsheet is obtainable from the moduli space Kähler potential of a related Hitchin system. We also explore the Saveliev-Leznov construction for solutions of the B2 affine Toda system, and recover the rotationally symmetric solution associated to Painleve transcendent.

High resolution emission Fourier transform infrared spectra of the 4p-5s and 5p-6s bands of ArH.

PubMed

Baskakov, O I; Civis, S; Kawaguchi, K

2005-03-15

In the 2500-8500 cm(-1) region several strong emission bands of (40)ArH were observed by Fourier transform spectroscopy through a dc glow discharge in a mixture of argon and hydrogen. Rotational-electronic transitions of the two previously unstudied 4p-5s and 5p-6s,v = 0-0, bands of (40)ArH were measured and assigned in the 6060 and 3770 cm(-1) regions, respectively. A simultaneous fit of the emission transitions of the 4p-5s and 5p-6s bands and an extended set of transitions of the 6s-4p band observed by Dabrowski, Tokaryk, and Watson [J. Mol. Spectrosc. 189, 95 (1998)] and remeasured in the present work yielded consistent values of the spectroscopic parameters of the electronic states under investigation. In the branch of the 4p-5s band with transitions of type (Q)Q(f(3)e) we observed a narrowing in the linewidths with increasing rotational quantum number N. The rotational dependence of the linewidth is caused by predissociation of the 5s state by the repulsive ground 4s state through homogeneous coupling and changes in overlap integrals of the vibrational wave functions with the rotational level. Analysis was based on the Fermi's golden rule approximation model. In the 4p-5s band region a vibrational sequence ofv(')-v(")=1-1, 2-2, and 3-3 were recorded and a number of transitions belonging to the strongest (Q)Q(f(3)e) form branch of the 1-1 band were analyzed.

Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

NASA Astrophysics Data System (ADS)

Czifra, György

2017-09-01

Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

PubMed

Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

2012-01-01

5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

PubMed Central

Xin, De-Dong; Wen, Jian-Fan

2012-01-01

Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID

The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

PubMed

Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

2017-10-27

The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

NASA Astrophysics Data System (ADS)

Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

2017-04-01

Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

A practical and improved synthesis of (3S,5S)-3-[(tert-butyloxycarbonyl)methyl]- 5-[(methanesulfonyloxy)methyl]-2- pyrrolidinone.

PubMed

Yee, Nathan K; Dong, Yong; Kapadia, Suresh R; Song, Jinhua J

2002-11-29

A practical and improved synthesis of (3S,5S)-3-[(tert-butyloxycarbonyl)methyl]-5-[(methanesulfonyloxy)methyl]-2-pyrrolidinone (1) is described. The key transformations involve a highly efficient reaction sequence consisting of ethoxycarbonylation, alkylation, hydrolysis, and decarboxylation to produce compound 10. The process described herein is practical, robust, and cost-effective, and it has been successfully implemented in a pilot plant to produce a multikilogram quantity of mesylate 1.

Volatile compounds of sulfur in the Fe-C-S system at 5.3 GPa and 1300°C

NASA Astrophysics Data System (ADS)

Zhimulev, E. I.; Sonin, V. M.; Bul'bak, T. A.; Chepurov, A. I.; Tomilenko, A. A.; Pokhilenko, N. P.

2015-05-01

This report presents the results of experimental studies of the fluid phase in the Fe-C-S system at high P and T values (5.3 GPa and 1300°C) conforming to diamond synthesis. The samples for experiments were mounted on air; therefore, the volatile compounds detected after the experiments are characterized by a wide variety and complicated composition involving both inorganic and organic components. Among the inorganic compounds, CO2, H2O, N2, SO2, CS2, and COS were detected. The GC/MS analysis revealed hydrocarbons (paraffins, olefins, and arenes), including high-molecular compounds. The formation of heavy hydrocarbons confirms their thermodynamic stability under high pressure. Oxygenated hydrocarbons (alcohols, aldehydes, ketones, carboxylic acids, and ethers) were also detected.

An ultra-stable optical frequency standard for telecommunication purposes based upon the 5S1/2 → 5D5/2 two-photon transition in rubidium

NASA Astrophysics Data System (ADS)

Terra, Osama; Hussein, Hatem

2016-02-01

In this study, we report the development of a frequency standard for optical fiber communication applications based on a two-photon transition in rubidium at 385.2 THz. This standard kills two birds with one stone in the sense it is capable of providing us with two highly stable serviceable wavelengths at 778.1 and 1556.2 nm. In this system, we exploit the narrow line-width of a fiber laser emitting at 1556.2 nm in conjunction with an erbium-doped fiber amplifier to generate a sufficient second harmonic laser beam at 778.1 nm in a periodically polled lithium niobate waveguide mixer in order to probe and frequency-lock the laser to the 5S1/2 ( F g = 3)-5D5/2 ( F e = 5) hyperfine two-photon transition component in 85Rb. The metrological performance of the standard is evaluated with the aid of an optical frequency comb synthesizer. Allan variance measurement shows a stability of 4 × 10-12 at 1 s (limited by the comb stability), reaching a floor of 6.8 × 10-13 at 1000 s. After correction of all the major systematic frequency shifts including the light shift, the absolute frequency is found to be 385 285 142 374.0 (5.0) kHz. Moreover, the absolute frequencies of most of the hyperfine components of the 5S1/2-5D5/2 transition of the two naturally existing rubidium isotopes are measured using a femtosecond frequency comb synthesizer after stabilizing a laser on each component.

The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management

PubMed Central

Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

2017-01-01

Abstract Background and Aims The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012–2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. Methods During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. Results The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Conclusions Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. PMID:28981622

Educating for Innovation: Finding Balance in the Army’s Professional Military Education System

DTIC Science & Technology

2016-06-10

Faculty of the U.S. Army Command and General Staff College in partial fulfillment of the requirements for the degree MASTER OF MILITARY ART AND...Balance in the Army’s Professional Military Education System 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ...Paul N. de León, Major 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) U.S

GEOS-5 Seasonal Forecast System: ENSO Prediction Skill and Bias

NASA Technical Reports Server (NTRS)

Borovikov, Anna; Kovach, Robin; Marshak, Jelena

2018-01-01

The GEOS-5 AOGCM known as S2S-1.0 has been in service from June 2012 through January 2018 (Borovikov et al. 2017). The atmospheric component of S2S-1.0 is Fortuna-2.5, the same that was used for the Modern-Era Retrospective Analysis for Research and Applications (MERRA), but with adjusted parameterization of moist processes and turbulence. The ocean component is the Modular Ocean Model version 4 (MOM4). The sea ice component is the Community Ice CodE, version 4 (CICE). The land surface model is a catchment-based hydrological model coupled to the multi-layer snow model. The AGCM uses a Cartesian grid with a 1 deg × 1.25 deg horizontal resolution and 72 hybrid vertical levels with the upper most level at 0.01 hPa. OGCM nominal resolution of the tripolar grid is 1/2 deg, with a meridional equatorial refinement to 1/4 deg. In the coupled model initialization, selected atmospheric variables are constrained with MERRA. The Goddard Earth Observing System integrated Ocean Data Assimilation System (GEOS-iODAS) is used for both ocean state and sea ice initialization. SST, T and S profiles and sea ice concentration were assimilated.

Regulation of AR and (Beta)-Catenin Signaling by Pin 1 in Prostate Cancer

DTIC Science & Technology

2005-10-01

Renilla luciferase activities were determined using a dual-luciferase reporter assay kit (Promega, Madison, WI), and Renilla activities were not...consistently affected by any of the cotransfected vectors. The firefly luciferase was divided by the control Renilla luciferase and the results, given as...transfected with pTopflash (50 ng) and CMV- Renilla (2.5 ng) reporter plasmids. Firefly versus Renilla luciferase activities were determined and

Analysis of Characteristics and Requirements for 5G Mobile Communication Systems

NASA Astrophysics Data System (ADS)

Ancans, G.; Stafecka, A.; Bobrovs, V.; Ancans, A.; Caiko, J.

2017-08-01

One of the main objectives of the fifth generation (5G) mobile communication systems, also known as IMT-2020, is to increase the current data rates up to several gigabits per second (Gbit/s) or even up to 10 Gbit/s and higher. One of the possibilities to consider is the use of higher frequencies in order to enlarge the available bandwidth. Wider bandwidth is necessary to achieve much higher data rates. It should be noted that wireless broadband transmission technologies require frequencies for their development. The main goal of the research is to investigate the characteristics and requirements of 5G mobile communication systems. The paper provides an insight into deployment scenario and radio wave propagation in frequencies above 24 GHz of IMT-2020.

Synthesis of ( 2S, 4S)-4-phenylamino-5-oxoproline derivatives.

PubMed

Nizova, I A; Krasnov, V P; Levit, G L; Kodess, M I

2002-01-01

The paper describes the synthesis of ( 2S, 4S)-4-(N-Ts)- and ( 2S, 4S)-4-(N-Boc)-phenylamino-5-oxoprolines (pyroglutamic acid). These derivatives have been shown to be useful for synthesis of their amides and peptides in spite of steric hindrances caused by bulky groups adjacent to the reaction centre. Under the conditions applied no lactam ring opening and no loss of stereochemical integrity of any of the chiral centres were observed, which has been confirmed by NMR techniques.

Pro-Inflammatory wnt5a and Anti-Inflammatory sFRP5 Are Differentially Regulated by Nutritional Factors in Obese Human Subjects

PubMed Central

Schulte, Dominik M.; Müller, Nike; Neumann, Katrin; Oberhäuser, Frank; Faust, Michael; Güdelhöfer, Heike; Brandt, Burkhard; Krone, Wilhelm; Laudes, Matthias

2012-01-01

Background Obesity is associated with macrophage infiltration of adipose tissue. These inflammatory cells affect adipocytes not only by classical cytokines but also by the secreted glycopeptide wnt5a. Healthy adipocytes are able to release the wnt5a inhibitor sFRP5. This protective effect, however, was found to be diminished in obesity. The aim of the present study was to examine (1) whether obese human subjects exhibit increased serum concentrations of wnt5a and (2) whether wnt5a and/or sFRP5 serum concentrations in obese subjects can be influenced by caloric restriction. Methodology 23 obese human subjects (BMI 44.1±1.1 kg/m2) and 12 age- and sex-matched lean controls (BMI 22.3±0.4 kg/m2) were included in the study. Obese subjects were treated with a very low-calorie diet (approximately 800 kcal/d) for 12 weeks. Body composition was assessed by impedance analysis, insulin sensitivity was estimated by HOMA-IR and the leptin-to-adiponectin ratio and wnt5a and sFRP5 serum concentrations were measured by ELISA. sFRP5 expression in human adipose tissue biopsies was further determined on protein level by immunohistology. Principal Findings Pro-inflammatory wnt5a was not measurable in any serum sample of lean control subjects. In patients with obesity, however, wnt5a became significantly detectable consistent with low grade inflammation in such subjects. Caloric restriction resulted in a weight loss from 131.9±4.0 to 112.3±3.2 kg in the obese patients group. This was accompanied by a significant decrease of HOMA-IR and leptin-to-adiponectin ratio, indicating improved insulin sensitivity. Interestingly, these metabolic improvements were associated with a significant increase in serum concentrations of the anti-inflammatory factor and wnt5a-inhibitor sFRP5. Conclusions/Significance Obesity is associated with elevated serum levels of pro-inflammatory wnt5a in humans. Furthermore, caloric restriction beneficially affects serum concentrations of anti-inflammatory sFRP5

Application of DNA Profiling in Resolving Aviation Forensic Toxicology Issues

DTIC Science & Technology

2009-10-01

National Technical Information Service, Springfield, VA 22161 19. Security Classif. (of this report) 20. Security Classif. (of this page) 21 ...J,. Schumm. JW ..Development. of. highly. polymorphic.pentanucleotide.tandem.repeat.loci. with.low.stutter ..Profiles in DNA ..1998;2:3–6 . 21 ... PowerPlex ™ 16 System, Technical Manual No. D012 ..Madison,.WI:.Promega.Cor- poration;. 2000. (Available. at:. www .cstl .nist .gov/ strbase/images

Eukaryotic 5S rRNA biogenesis

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

Developmental validation of the PowerPlex(®) ESI 16 and PowerPlex(®) ESI 17 Systems: STR multiplexes for the new European standard.

PubMed

Tucker, Valerie C; Hopwood, Andrew J; Sprecher, Cynthia J; McLaren, Robert S; Rabbach, Dawn R; Ensenberger, Martin G; Thompson, Jonelle M; Storts, Douglas R

2011-11-01

In response to the ENFSI and EDNAP groups' call for new STR multiplexes for Europe, Promega(®) developed a suite of four new DNA profiling kits. This paper describes the developmental validation study performed on the PowerPlex(®) ESI 16 (European Standard Investigator 16) and the PowerPlex(®) ESI 17 Systems. The PowerPlex(®) ESI 16 System combines the 11 loci compatible with the UK National DNA Database(®), contained within the AmpFlSTR(®) SGM Plus(®) PCR Amplification Kit, with five additional loci: D2S441, D10S1248, D22S1045, D1S1656 and D12S391. The multiplex was designed to reduce the amplicon size of the loci found in the AmpFlSTR(®) SGM Plus(®) kit. This design facilitates increased robustness and amplification success for the loci used in the national DNA databases created in many countries, when analyzing degraded DNA samples. The PowerPlex(®) ESI 17 System amplifies the same loci as the PowerPlex(®) ESI 16 System, but with the addition of a primer pair for the SE33 locus. Tests were designed to address the developmental validation guidelines issued by the Scientific Working Group on DNA Analysis Methods (SWGDAM), and those of the DNA Advisory Board (DAB). Samples processed include DNA mixtures, PCR reactions spiked with inhibitors, a sensitivity series, and 306 United Kingdom donor samples to determine concordance with data generated with the AmpFlSTR(®) SGM Plus(®) kit. Allele frequencies from 242 white Caucasian samples collected in the United Kingdom are also presented. The PowerPlex(®) ESI 16 and ESI 17 Systems are robust and sensitive tools, suitable for the analysis of forensic DNA samples. Full profiles were routinely observed with 62.5pg of a fully heterozygous single source DNA template. This high level of sensitivity was found to impact on mixture analyses, where 54-86% of unique minor contributor alleles were routinely observed in a 1:19 mixture ratio. Improved sensitivity combined with the robustness afforded by smaller amplicons

The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

NASA Technical Reports Server (NTRS)

Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

1982-01-01

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

[Structural organization of 5S ribosomal DNA of Rosa rugosa].

PubMed

Tynkevych, Iu O; Volkov, R A

2014-01-01

In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

Project 5S: A Safe Stepping Stone into the Solar System

NASA Technical Reports Server (NTRS)

Brophy, John; Culick, Fred; Dimotakis, Paul; Friedman, Louis

2012-01-01

The human exploration program, at least in NASA, has been directed to move beyond the Moon and travel on a flexible path into the solar system. Reaching a Near-Earth Asteroid (NEA) is a major human space flight goal but such missions have tight times and life-support requirements that require huge steps from current capabilities. An objective between the Moon and a NEA is needed. Example interim objectives are the Lagrangian points in either the Sun-Earth or Earth-Moon (EM) system. The nearest of these points beyond the Moon is E-M L2. The Lagrangian points are empty (as far as we know). As objectives for human flight,it has been argued that they suffer from a lack of public interest and of meaningful objectives for astronaut operations. To provide a physical target, a robotic spacecraft could retrieve a small NEA and bring it to a Lagrangian or other nearer-Earth point to be accessed and utilized for human-mission objectives. This paper reports on the results of a recently completed study of an asteroid retrieval mission sponsored by the Keck Institute for Space Studies (KISS) at the California Institute of Technology. The study included an evaluation of potential targets, mission objectives, mission and system design, and potential capture mechanisms. The study concluded that, while challenging, there are no fundamental show stoppers and that such a mission would be possible with technology expected to be available in this decade. The final destination selected (for safety and mission operations) was high lunar orbit. Two options for target selection are considered: (i) retrieving a small (7 meter) NEA with a mass of order 500,000 kg, and (ii) taking a similar size boulder of a large known carbonaceous NEA. Several areas of technology and program requirements were identified, but the most important conclusion was that this approach enables meeting a goal of humans going to a NEA by the mid-2020s. The advantages and benefits for human exploration are considerable

S5H/DMR6 Encodes a Salicylic Acid 5-Hydroxylase That Fine-Tunes Salicylic Acid Homeostasis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanjun; Zhao, Li; Zhao, Jiangzhe

The phytohormone salicylic acid (SA) plays essential roles in biotic and abiotic responses, plant development, and leaf senescence. 2,5-Dihydroxybenzoic acid (2,5-DHBA or gentisic acid) is one of the most commonly occurring aromatic acids in green plants and is assumed to be generated from SA, but the enzymes involved in its production remain obscure. DMR6 (Downy Mildew Resistant 6, At5g24530) has been proven essential in plant immunity of Arabidopsis, but its biochemical properties are not well understood. Here in this paper, we report the discovery and functional characterization of DMR6 as a SA 5-hydroxylase (S5H) that catalyzes the formation of 2,5-DHBAmore » by hydroxylating SA at the C5 position of its phenyl ring in Arabidopsis. S5H/DMR6 specifically converts SA to 2,5-DHBA in vitro and displays higher catalytic efficiency (K cat/K m=4.96×10 4 M -1s -1) than the previously reported SA 3-hydroxylase (S3H, K cat/K m=6.09 × 10 3 M -1s -1) for SA. Interestingly, S5H/DMR6 displays a substrate inhibition property that may enable automatic control of its enzyme activities. The s5h mutant and s5hs3h double mutant over accumulate SA and display phenotypes such as a smaller growth size, early senescence and a loss of susceptibility to Pseudomonas syringae pv. tomato DC3000 (Pst DC3000). S5H/DMR6 is sensitively induced by SA/pathogen treatment and is widely expressed from young seedlings to senescing plants, whereas S3H is more specifically expressed at the mature and senescing stages. Collectively, our results disclose the identity of the enzyme required for 2,5-DHBA formation and reveal a mechanism by which plants fine-tune SA homeostasis by mediating SA 5-hydroxylation.« less

S5H/DMR6 Encodes a Salicylic Acid 5-Hydroxylase That Fine-Tunes Salicylic Acid Homeostasis

DOE PAGES

Zhang, Yanjun; Zhao, Li; Zhao, Jiangzhe; ...

2017-09-12

The phytohormone salicylic acid (SA) plays essential roles in biotic and abiotic responses, plant development, and leaf senescence. 2,5-Dihydroxybenzoic acid (2,5-DHBA or gentisic acid) is one of the most commonly occurring aromatic acids in green plants and is assumed to be generated from SA, but the enzymes involved in its production remain obscure. DMR6 (Downy Mildew Resistant 6, At5g24530) has been proven essential in plant immunity of Arabidopsis, but its biochemical properties are not well understood. Here in this paper, we report the discovery and functional characterization of DMR6 as a SA 5-hydroxylase (S5H) that catalyzes the formation of 2,5-DHBAmore » by hydroxylating SA at the C5 position of its phenyl ring in Arabidopsis. S5H/DMR6 specifically converts SA to 2,5-DHBA in vitro and displays higher catalytic efficiency (K cat/K m=4.96×10 4 M -1s -1) than the previously reported SA 3-hydroxylase (S3H, K cat/K m=6.09 × 10 3 M -1s -1) for SA. Interestingly, S5H/DMR6 displays a substrate inhibition property that may enable automatic control of its enzyme activities. The s5h mutant and s5hs3h double mutant over accumulate SA and display phenotypes such as a smaller growth size, early senescence and a loss of susceptibility to Pseudomonas syringae pv. tomato DC3000 (Pst DC3000). S5H/DMR6 is sensitively induced by SA/pathogen treatment and is widely expressed from young seedlings to senescing plants, whereas S3H is more specifically expressed at the mature and senescing stages. Collectively, our results disclose the identity of the enzyme required for 2,5-DHBA formation and reveal a mechanism by which plants fine-tune SA homeostasis by mediating SA 5-hydroxylation.« less

The 5HT(1A) receptor ligand, S15535, antagonises G-protein activation: a [35S]GTPgammaS and [3H]S15535 autoradiography study.

PubMed

Newman-Tancredi, A; Rivet, J; Chaput, C; Touzard, M; Verrièle, L; Millan, M J

1999-11-19

4-(Benzodioxan-5-yl)1-(indan-2-yl)piperazine (S15535) is a highly selective ligand at 5-HT(1A) receptors. The present study compared its autoradiographic labelling of rat brain sections with its functional actions, visualised by guanylyl-5'-[gamma-thio]-triphosphate ([35S]GTPgammaS) autoradiography, which affords a measure of G-protein activation. [3H]S15535 binding was highest in hippocampus, frontal cortex, entorhinal cortex, lateral septum, interpeduncular nucleus and dorsal raphe, consistent with specific labelling of 5-HT(1A) receptors. In functional studies, S15535 (10 microM) did not markedly stimulate G-protein activation in any brain region, but abolished the activation induced by the selective 5-HT(1A) agonist, (+)-8-hydroxy-dipropyl-aminotetralin ((+)-8-OH-DPAT, 1 microM), in structures enriched in [3H]S15535 labelling. S15535 did not block 5-HT-stimulated activation in caudate nucleus or substantia nigra, regions where (+)-8-OH-DPAT was ineffective and [3H]S15535 binding was absent. Interestingly, S15535 attenuated (+)-8-OH-DPAT and 5-HT-stimulated G-protein activation in dorsal raphe, a region in which S15535 is known to exhibit agonist properties in vivo [Lejeune, F., Millan, M.J., 1998. Induction of burst firing in ventral tegmental area dopaminergic neurons by activation of serotonin (5-HT)(1A) receptors: WAY100,635-reversible actions of the highly selective ligands, flesinoxan and S15535. Synapse 30, 172-180.]. The present data show that (i) [3H]S15535 labels pre- and post-synaptic populations of 5-HT(1A) sites in rat brain sections, (ii) S15535 exhibits antagonist properties at post-synaptic 5-HT(1A) receptors in corticolimbic regions, and (iii) S15535 also attenuates agonist-stimulated G-protein activation at raphe-localised 5-HT(1A) receptors.

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

PubMed

Kamina, Anyango D; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP)

PubMed Central

Kamina, Anyango D.; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains’ interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP. PMID:28542332

48 CFR 215.407-5 - Estimating systems.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false Estimating systems. 215.407-5 Section 215.407-5 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM....407-5 Estimating systems. ...

48 CFR 215.407-5 - Estimating systems.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false Estimating systems. 215.407-5 Section 215.407-5 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM....407-5 Estimating systems. ...

48 CFR 215.407-5 - Estimating systems.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false Estimating systems. 215.407-5 Section 215.407-5 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM....407-5 Estimating systems. ...

48 CFR 215.407-5 - Estimating systems.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false Estimating systems. 215.407-5 Section 215.407-5 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM....407-5 Estimating systems. ...

48 CFR 215.407-5 - Estimating systems.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Estimating systems. 215.407-5 Section 215.407-5 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM....407-5 Estimating systems. ...

Synthesis of enantiopure trans-2,5-disubstituted trifluoromethylpyrrolidines and (2S,5R)-5-trifluoromethylproline.

PubMed

Lubin, Hodney; Pytkowicz, Julien; Chaume, Grégory; Sizun-Thomé, Gwenaëlle; Brigaud, Thierry

2015-03-06

Enantiopure trans-2,5-disubstituted trifluoromethylpyrrolidines were prepared on a several gram scale starting from a readily available chiral fluorinated oxazolidine (Fox). A pure oxazolopyrrolidine intermediate could be obtained after an efficient separation by selective diastereomer destruction. The addition of various Grignard reagents on this oxazolopyrrolidine provided disubstituted pyrrolidines with moderate to complete trans diastereoselectivity. The highly valuable compound (2S,5R)-5-trifluoromethylproline could be synthesized from the same oxazolopyrrolidine intermediate via a Strecker-type reaction.

Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions

NASA Astrophysics Data System (ADS)

Zhang, Yawei; Li, Gang

2018-01-01

Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.

Structure and properties of Li 2S-P 2S 5-P 2S 3 glass and glass-ceramic electrolytes

NASA Astrophysics Data System (ADS)

Minami, Keiichi; Hayashi, Akitoshi; Ujiie, Satoshi; Tatsumisago, Masahiro

High lithium ion conducting 70Li 2S·(30 - x)P 2S 5· xP 2S 3 (mol%) glasses and glass-ceramics were prepared by the mechanical milling method. Glasses were obtained in the composition range of 0 ≦ x ≦ 10. The substitution of P 2S 3 for P 2S 5 promoted the formation of the P 2S 6 4- units in the glasses. The conductivity of the glass increased with an increase in P 2S 3 contents up to 5 mol% and the glass with 5 mol% of P 2S 3 showed the conductivity of 1 × 10 -4 S cm -1 at room temperature. In the case of glass-ceramics, the conductivity increased with an increase in P 2S 3 contents up to 1 mol%, and the superionic conducting Li 7P 3S 11 crystal was precipitated in the glass-ceramic. The glass-ceramic with 1 mol% of P 2S 3 showed the highest conductivity of 3.9 × 10 -3 S cm -1 at room temperature.

Structural and electronic features of binary Li2S-P2S5 glasses

PubMed Central

Ohara, Koji; Mitsui, Akio; Mori, Masahiro; Onodera, Yohei; Shiotani, Shinya; Koyama, Yukinori; Orikasa, Yuki; Murakami, Miwa; Shimoda, Keiji; Mori, Kazuhiro; Fukunaga, Toshiharu; Arai, Hajime; Uchimoto, Yoshiharu; Ogumi, Zempachi

2016-01-01

The atomic and electronic structures of binary Li2S-P2S5 glasses used as solid electrolytes are modeled by a combination of density functional theory (DFT) and reverse Monte Carlo (RMC) simulation using synchrotron X-ray diffraction, neutron diffraction, and Raman spectroscopy data. The ratio of PSx polyhedral anions based on the Raman spectroscopic results is reflected in the glassy structures of the 67Li2S-33P2S5, 70Li2S-30P2S5, and 75Li2S-25P2S5 glasses, and the plausible structures represent the lithium ion distributions around them. It is found that the edge sharing between PSx and LiSy polyhedra increases at a high Li2S content, and the free volume around PSx polyhedra decreases. It is conjectured that Li+ ions around the face of PSx polyhedra are clearly affected by the polarization of anions. The electronic structure of the DFT/RMC model suggests that the electron transfer between the P ion and the bridging sulfur (BS) ion weakens the positive charge of the P ion in the P2S7 anions. The P2S7 anions of the weak electrostatic repulsion would causes it to more strongly attract Li+ ions than the PS4 and P2S6 anions, and suppress the lithium ionic conduction. Thus, the control of the edge sharing between PSx and LiSy polyhedra without the electron transfer between the P ion and the BS ion is expected to facilitate lithium ionic conduction in the above solid electrolytes. PMID:26892385

Evidence for Bs* Bs* production at the Gamma(5S) resonance.

PubMed

Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dorjkhaidav, O; Li, J; Menaa, N; Mountain, R; Nandakumar, R; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Bornheim, A; Pappas, S P; Weinstein, A J; Briere, R A; Chen, G P; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Crede, V; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Galik, R S; Gibbons, L; Gittelman, B; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Shepherd, M R; Stroiney, S; Sun, W M; Urner, D; Wilksen, T; Weaver, K M; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Williams, J; Wiss, J; Asner, D M; Edwards, K W; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Li, S Z; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Arms, K; Severini, H; Dytman, S A; Love, W; Mehrabyan, S; Mueller, J A; Savinov, V; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Adams, G S; Cravey, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Stroynowski, R

2005-12-31

We use data collected by the CLEO III detector at the Cornell Electron Storage Ring to measure the inclusive yields of D(s) mesons as B(Y(5S) --> D(s)X) = (44-7 +/- 4.2 +/- 9.9)% and B(Y(4S) --> D(s)X) = (18.1 +/- 0.5 +/- 2.8)%. From these measurements, we make a model dependent estimate of the ratio of B(s)*B(s)* to the total bb quark pair production of (16.0 +/- 2.6 +/- 5.8)% at the Y(5S) energy.

CaLecRK-S.5, a pepper L-type lectin receptor kinase gene, confers broad-spectrum resistance by activating priming

PubMed Central

Woo, Joo Yong; Jeong, Kwang Ju; Kim, Young Jin; Paek, Kyung-Hee

2016-01-01

In Arabidopsis, several L-type lectin receptor kinases (LecRKs) have been identified as putative immune receptors. However, to date, there have been few analyses of LecRKs in crop plants. Virus-induced gene silencing of CaLecRK-S.5 verified the role of CaLecRK-S.5 in broad-spectrum resistance. Compared with control plants, CaLecRK-S.5-silenced plants showed reduced hypersensitive response, reactive oxygen species burst, secondary metabolite production, mitogen-activated protein kinase activation, and defense-related gene expression in response to Tobacco mosaic virus pathotype P0 (TMV-P0) infection. Suppression of CaLecRK-S.5 expression significantly enhanced the susceptibility to Pepper mild mottle virus pathotype P1,2,3, Xanthomonas campestris pv. vesicatoria, Phytophthora capsici, as well as TMV-P0. Additionally, β-aminobutyric acid treatment and a systemic acquired resistance assay revealed that CaLecRK-S.5 is involved in priming of plant immunity. Pre-treatment with β-aminobutyric acid before viral infection restored the reduced disease resistance phenotypes shown in CaLecRK-S.5-silenced plants. Systemic acquired resistance was also abolished in CaLecRK-S.5-silenced plants. Finally, RNA sequencing analysis indicated that CaLecRK-S.5 positively regulates plant immunity at the transcriptional level. Altogether, these results suggest that CaLecRK-S.5-mediated broad-spectrum resistance is associated with the regulation of priming. PMID:27647723

Hagedorn Temperature of AdS5/CFT4 via Integrability

NASA Astrophysics Data System (ADS)

Harmark, Troels; Wilhelm, Matthias

2018-02-01

We establish a framework for calculating the Hagedorn temperature of AdS5/CFT4 via integrability. Concretely, we derive the thermodynamic Bethe ansatz equations that yield the Hagedorn temperature of planar N =4 super Yang-Mills theory at any value of the 't Hooft coupling. We solve these equations perturbatively at weak coupling via the associated Y system, confirming the known results at tree level and one-loop order as well as deriving the previously unknown two-loop Hagedorn temperature. Finally, we comment on solving the equations at finite coupling.

Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

PubMed

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-11-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

Systematic analysis and evolution of 5S ribosomal DNA in metazoans

PubMed Central

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-01-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690

6 CFR Appendix C to Part 5 - DHS Systems of Records Exempt From the Privacy Act

Code of Federal Regulations, 2010 CFR

2010-01-01

... DISCLOSURE OF RECORDS AND INFORMATION Pt. 5, App. C Appendix C to Part 5—DHS Systems of Records Exempt From... Homeland Security (DHS) Freedom of Information Act (FOIA) and Privacy Act (PA) Record System allows the DHS... information contained in other systems of records subject to such exemptions pursuant to 5 U.S.C. 552a(j)(2...

Technology Demonstration Summary. DuPont/Oberlin Microfiltration System. Palmerton, Pennsylvania (EPA/540/S5-90/007)

EPA Science Inventory

In April and May 1990, the U.S. Environmental Protection Agency (EPA), under the Superfund Innovative Technology Evaluation (SITE) program, demonstrated DuPont/Oberlin's microfiltration system at the Palmerton Zinc Superfund (PZS) site In Palmerton, Pennsylvania. The microfiltr...

Synthesis and X-ray structural investigation of (5R*,6S*)-1-benzoyl-5-methylthio-6-methoxy-1-azapenam

NASA Astrophysics Data System (ADS)

Krajewski, J. W.; Gluziński, P.; Grochowski, E.; Pupek, K.; Mishnyov, A.; Kemme, A.

1992-08-01

The compound (5R*,6S*)-1-benzoyl-5-methylthio-6-methoxy-1-azapenam ( 3) has been synthesized and its structure investigated by X-ray diffraction. The compound crystallizes in a monoclinic system, space group Cc, Z = 4, a = 12.01(1), b = 16.51(1), c = 8.048(6) Å, β = 115.87(6)°. The structure was solved by direct methods and refined by a full-matrix, least-squares procedure to give R = 0.070, Rw = 0.046, w = 1.34/(σ 2F). The expected cis configuration around the β-lactam ring was fully confirmed.

Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

PubMed

Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

2016-05-03

The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. Copyright © 2016 Elsevier Ltd. All rights reserved.

Metallic 1T-LixMoS2 Cocatalyst Significantly Enhanced the Photocatalytic H2 Evolution over Cd0.5Zn0.5S Nanocrystals under Visible Light Irradiation.

PubMed

Du, Hong; Guo, Hong-Li; Liu, Ya-Nan; Xie, Xiao; Liang, Kuang; Zhou, Xiao; Wang, Xin; Xu, An-Wu

2016-02-17

In the present work, metallic 1T-LixMoS2 is utilized as a novel cocatalyst for Cd0.5Zn0.5S photocatalyst. The obtained LixMoS2/Cd0.5Zn0.5S hybrids show excellent photocatalytic performance for H2 generation from aqueous solution containing Na2S and Na2SO3 under splitting visible light illumination (λ ≥ 420 nm) without precious metal cocatalysts. It turns out that a certain amount of intercalating Li(+) ions ultimately drives the transition of MoS2 crystal from semiconductor triagonal phase (2H phase) to metallic phase (1T phase). The distinct properties of 1T-LixMoS2 promote the efficient separation of photoexcited electrons and holes when used as cocatalyst for Cd0.5Zn0.5S photocatalyst. As compared to 2H-MoS2 nanosheets only having edge active sites, photoinduced electrons not only transfer to the edge sites of 1T-LixMoS2, but also to the plane active sites of 1T-LixMoS2 nanosheets. The content of LixMoS2 in hybrid photocatalysts influences the photocatalytic activity. The optimal 1T-LixMoS2 (1.0 wt %)/Cd0.5Zn0.5S nanojunctions display the best activity for hydrogen production, achieving a hydrogen evolution rate of 769.9 μmol h(-1), with no use of noble metal loading, which is about 3.5 times higher than that of sole Cd0.5Zn0.5S, and 2 times higher than that of 2H-MoS2 (1.0 wt %)/Cd0.5Zn0.5S samples. Our results demonstrate that Li(+)-intercalated MoS2 nanosheets with high conductivity, high densities of active sites, low cost, and environmental friendliness are a prominent H2 evolution cocatalyst that might substitute for noble metal for potential hydrogen energy applications.

Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

PubMed

Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

2011-11-01

Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

Phase diagrams of the sections As/sub 2/S/sub 3/-Tl/sub 3/AsS/sub 4/, Tl/sub 3/AsS/sub 4/-S, and Tl/sub 3/AsS/sub 4/-Tl/sub 2/S of the ternary system As-Tl-S

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vorob'ev, Yu.I.; Velikova, N.G.; Kirilenko, V.V.

1987-12-01

Using DTA and XPA methods, microstructural investigations, and microhardness measurements, phase diagrams of the quasibinary sections As/sub 2/S/sub 3/-Tl/sub 3/AsS/sub 4/, Tl/sub 3/AsS/sub 4/-S, and Tl/sub 3/AsS/sub 4/-Tl/sub 2/S, are characterized by five ternary compounds Tl/sub 3/As/sub 5/S/sub 10/, Tl/sub 9/As/sub 5/S/sub 15/, Tl/sub 9/As/sub 3/S/sub 13/, Tl/sub 3/AsS/sub 6/, and Tl/sub 8/As/sub 2/S/sub 9/, which decompose by peritectic reactions at 198, 307, 408, 362, and 318/degree/C, respectively. Interplanar spacings and line intensities are given for the detected compounds. Glass formation is considered in the Tl-As-S system.

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2013 CFR

2013-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2010 CFR

2010-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2014 CFR

2014-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2011 CFR

2011-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2012 CFR

2012-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

48 CFR 15.407-5 - Estimating systems.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Estimating systems. 15.407-5 Section 15.407-5 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 15.407-5 Estimating systems. (a...

48 CFR 15.407-5 - Estimating systems.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Estimating systems. 15.407-5 Section 15.407-5 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 15.407-5 Estimating systems. (a...

48 CFR 15.407-5 - Estimating systems.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Estimating systems. 15.407-5 Section 15.407-5 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 15.407-5 Estimating systems. (a...

48 CFR 15.407-5 - Estimating systems.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Estimating systems. 15.407-5 Section 15.407-5 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 15.407-5 Estimating systems. (a...

5 CFR 532.259 - Special appropriated fund wage schedules for U.S. insular areas.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Special appropriated fund wage schedules for U.S. insular areas. 532.259 Section 532.259 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PREVAILING RATE SYSTEMS Prevailing Rate Determinations § 532.259 Special...

Streptococcal 5'-Nucleotidase A (S5nA), a Novel Streptococcus pyogenes Virulence Factor That Facilitates Immune Evasion.

PubMed

Zheng, Lisa; Khemlani, Adrina; Lorenz, Natalie; Loh, Jacelyn M S; Langley, Ries J; Proft, Thomas

2015-12-25

Streptococcus pyogenes is an important human pathogen that causes a wide range of diseases. Using bioinformatics analysis of the complete S. pyogenes strain SF370 genome, we have identified a novel S. pyogenes virulence factor, which we termed streptococcal 5'-nucleotidase A (S5nA). A recombinant form of S5nA hydrolyzed AMP and ADP, but not ATP, to generate the immunomodulatory molecule adenosine. Michaelis-Menten kinetics revealed a Km of 169 μm and a Vmax of 7550 nmol/mg/min for the substrate AMP. Furthermore, recombinant S5nA acted synergistically with S. pyogenes nuclease A to generate macrophage-toxic deoxyadenosine from DNA. The enzyme showed optimal activity between pH 5 and pH 6.5 and between 37 and 47 °C. Like other 5'-nucleotidases, S5nA requires divalent cations and was active in the presence of Mg(2+), Ca(2+), or Mn(2+). However, Zn(2+) inhibited the enzymatic activity. Structural modeling combined with mutational analysis revealed a highly conserved catalytic dyad as well as conserved substrate and cation-binding sites. Recombinant S5nA significantly increased the survival of the non-pathogenic bacterium Lactococcus lactis during a human whole blood killing assay in a dose-dependent manner, suggesting a role as an S. pyogenes virulence factor. In conclusion, we have identified a novel S. pyogenes enzyme with 5'-nucleotidase activity and immune evasion properties. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

46 CFR 111.105-5 - System integrity.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 4 2011-10-01 2011-10-01 false System integrity. 111.105-5 Section 111.105-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Hazardous Locations § 111.105-5 System integrity. In order to maintain system integrity, each...

46 CFR 111.105-5 - System integrity.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 46 Shipping 4 2012-10-01 2012-10-01 false System integrity. 111.105-5 Section 111.105-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Hazardous Locations § 111.105-5 System integrity. In order to maintain system integrity, each...

46 CFR 111.105-5 - System integrity.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 46 Shipping 4 2013-10-01 2013-10-01 false System integrity. 111.105-5 Section 111.105-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Hazardous Locations § 111.105-5 System integrity. In order to maintain system integrity, each...

Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser.

PubMed

Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi

2018-06-01

In this work, we fabricate the Mo 0.5 W 0.5 S 2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo 0.5 W 0.5 S 2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm -2 . The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo 0.5 W 0.5 S 2 SAs.

Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser

NASA Astrophysics Data System (ADS)

Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi

2018-06-01

In this work, we fabricate the Mo0.5W0.5S2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo0.5W0.5S2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm‑2. The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo0.5W0.5S2 SAs.

Enhancement of photoelectrochemical activity of SnS thin-film photoelectrodes using TiO2, Nb2O5, and Ta2O5 metal oxide layers

NASA Astrophysics Data System (ADS)

Vequizo, Junie Jhon M.; Yokoyama, Masanori; Ichimura, Masaya; Yamakata, Akira

2016-06-01

Tin sulfide (SnS) fine photoelectrodes fabricated by three-step pulsed electrodeposition were active for H2 evolution. The incident-photon-conversion-efficiency increases from 900 nm and offers a good fit with the absorption spectrum. The activity was enhanced by 3.4, 3.0, and 1.8 times compared to bare SnS by loading Nb2O5, TiO2, and Ta2O5, respectively. Nb2O5 was most efficient because its conduction band is low enough to facilitate effective electron transfer from SnS; it also has sufficiently high potential for H2 evolution. The overall activity is determined by the competitive interfacial electron transfer between SnS/metal-oxide and metal-oxide/water. Therefore, constructing appropriate heterojunctions is necessary for further improving photoelectrochemical systems.

Asymptotic M5-brane entropy from S-duality

NASA Astrophysics Data System (ADS)

Kim, Seok; Nahmgoong, June

2017-12-01

We study M5-branes compactified on S 1 from the D0-D4 Witten index in the Coulomb phase. We first show that the prepotential of this index is S-dual, up to a simple anomalous part. This is an extension of the well-known S-duality of the 4d N=4 theory to the 6d (2, 0) theory on finite T 2. Using this anomalous S-duality, we find that the asymptotic free energy scales like N 3 when various temperature-like parameters are large. This shows that the number of 5d Kaluza-Klein fields for light D0-brane bound states is proportional to N 3. We also compute some part of the asymptotic free energy from 6d chiral anomalies, which precisely agrees with our D0-D4 calculus.

Stability of the high pressure phase Fe3S2 up to Earth's core pressures in the Fe-S-O and the Fe-S-Si systems

NASA Astrophysics Data System (ADS)

Zurkowski, C. C.; Chidester, B.; Davis, A.; Brauser, N.; Greenberg, E.; Prakapenka, V. B.; Campbell, A.

2017-12-01

Earth's core is comprised of an iron-nickel alloy that contains 5-15% of a light element component. The abundance and alloying capability of sulfur, silicon and oxygen in the bulk Earth make them important core alloy candidates; therefore, the high-pressure phase equilibria of the Fe-S-O and Fe-S-Si systems are relevant for understanding the possible chemistry of Earth's core. Previously, a Fe3S2 phase was recognized as a low-pressure intermediate phase in the Fe-FeS system that is stable from 14-21 GPa, but the structure of this phase has not been resolved. We report in-situ XRD and chemical analysis of recovered samples to further examine the stability and structure of Fe3S2 as it coexists with other phases in the Fe-S-O and Fe-S-Si systems. In situ high P-T synchrotron XRD experiments were conducted in the laser-heated diamond anvil cell to determine the equilibrium phases in Fe75S7O18 and Fe80S5Si15 compositions between 30 and 174 GPa and up to 3000 K. In the S,O-rich samples, an orthorhombic Fe3S2 phase coexists with hcp-Fe, Fe3S and FeO and undergoes two monoclinic distortions between 60 and 174 GPa. In the S,Si-rich samples, the orthorhombic Fe3S2 phase was observed up to 115 GPa. With increasing pressure, the Fe3S2 phase becomes stable to higher temperatures in both compositions, suggesting possible Fe3(S,O)2 or Fe3(S,Si)2 solid solutions. SEM analysis of a laser heated Fe75S7O18 sample recovered from 40 GPa and 1450 K confirms a Fe3(S,O)2 phase with O dissolved into the structure. Based on the current melting data in the Fe-S-O and Fe-S-Si systems, the Fe3(S,O)2 stability field intersects the solidus in the outer core and could be a possible liquidus phase in Fe,S,O-rich planetary cores, whereas Fe3S is the stable sulfide at outer core pressures in Fe,S,Si-rich systems.

Pretreatment of Human Epidermal Keratinocytes with D,L-Sulforaphane Protects Against Sulfur Mustard Cytotoxicity

DTIC Science & Technology

2006-01-01

phenazine methosulfate (PMS), by dehydrogenase enzymes, were purchased from Promega (Madison, WI). D,L-sulfora- phane (DLS), 5-sulfosalicylic acid (SSA), and...Form Approved REPORT DOCUMENTATION PAGE OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour...valid OMB control number PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1 . REPORT DATE (DD-MM-YYYY) 2. REPORT TYPE 3. DATES COVERED (From - To) 2006

MicroRNA Inhibitors as Anticancer Therapies

DTIC Science & Technology

2007-08-17

Promoter activity was determined by co-transfection of the pGL3 promoter reporter (400 ng/well) with pRLSV40 ( Renilla luciferase, Promega)(100 ng/well) into...performed in triplicate and standard deviations calculated. Activitywas defined as Firefly/ Renilla ratio, normalized to control vector transfection. For...was defined as Firefly/ Renilla ratio normalized to activity in the absence of transfected E2F1. 5-RACE Mapping of Transcript—HEK-293 cells were tran

Securing America’s Passenger-Rail Systems

DTIC Science & Technology

2007-01-01

around the world highlight the vulnerability of rail travel and the importance of rail security for these passengers. The use of passenger rail and...take to U.S. railways. Recent attacks on passenger-rail systems around the world highlight the vulnerability of rail travel and the importance of rail...rails (Boardman, 2005), making more than 3.5 billion trips (APTA, 2006).1 And these estimates do not count the passengers traveling on the National

Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

PubMed

Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

2017-01-23

Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Crohn’s Disease and Genetic Hitchhiking at IBD5

PubMed Central

Huff, Chad D.; Witherspoon, David J.; Zhang, Yuhua; Gatenbee, Chandler; Denson, Lee A.; Kugathasan, Subra; Hakonarson, Hakon; Whiting, April; Davis, Chadwick T.; Wu, Wilfred; Xing, Jinchuan; Watkins, W. Scott; Bamshad, Michael J.; Bradfield, Jonathan P.; Bulayeva, Kazima; Simonson, Tatum S.; Jorde, Lynn B.; Guthery, Stephen L.

2012-01-01

Inflammatory bowel disease 5 (IBD5) is a 250 kb haplotype on chromosome 5 that is associated with an increased risk of Crohn’s disease in Europeans. The OCTN1 gene is centrally located on IBD5 and encodes a transporter of the antioxidant ergothioneine (ET). The 503F variant of OCTN1 is strongly associated with IBD5 and is a gain-of-function mutation that increases absorption of ET. Although 503F has been implicated as the variant potentially responsible for Crohn’s disease susceptibility at IBD5, there is little evidence beyond statistical association to support its role in disease causation. We hypothesize that 503F is a recent adaptation in Europeans that swept to relatively high frequency and that disease association at IBD5 results not from 503F itself, but from one or more nearby hitchhiking variants, in the genes IRF1 or IL5. To test for evidence of recent positive selection on the 503F allele, we employed the iHS statistic, which was significant in the European CEU HapMap population (P = 0.0007) and European Human Genome Diversity Panel populations (P ≤ 0.01). To evaluate the hypothesis of disease-variant hitchhiking, we performed haplotype association tests on high-density microarray data in a sample of 1,868 Crohn’s disease cases and 5,550 controls. We found that 503F haplotypes with recombination breakpoints between OCTN1 and IRF1 or IL5 were not associated with disease (odds ratio [OR]: 1.05, P = 0.21). In contrast, we observed strong disease association for 503F haplotypes with no recombination between these three genes (OR: 1.24, P = 2.6 × 10−8), as expected if the sweeping haplotype harbored one or more disease-causing mutations in IRF1 or IL5. To further evaluate these disease-gene candidates, we obtained expression data from lower gastrointestinal biopsies of healthy individuals and Crohn’s disease patients. We observed a 72% increase in gene expression of IRF1 among Crohn’s disease patients (P = 0.0006) and no significant difference

Viscosity and Structure of CaO-SiO2-P2O5-FetO System with Varying P2O5 and FeO Content

NASA Astrophysics Data System (ADS)

Diao, Jiang; Gu, Pan; Liu, De-Man; Jiang, Lu; Wang, Cong; Xie, Bing

2017-10-01

A rotary viscosimeter and Raman spectrum were employed to measure the viscosity and structural information of the CaO-SiO2-P2O5-FetO system at 1673 K. The experimental data have been compared with the calculated results using different viscosity models. It shows that the National Physical Laboratory (NPL) and Pal models fit the CaO-SiO2-P2O5-FeOt system better. With the P2O5 content increasing from 5% to 14%, the viscosity increases from 0.12 Pa s to 0.27 Pa s. With the FeO content increasing from 30% to 40%, the viscosity decreases from 0.21 Pa s to 0.12 Pa s. Increasing FeO content makes the complicated molten melts become simple, and increasing P2O5 content will complicate the molten melts. The linear relation between viscosity and structure parameter Q(Si + P) was obtained by regression analysis. The calculated viscosity by using the optimized NPL and Pal model are almost identical with the fitted values.

Stellar and Planetary Parameters for K2 's Late-type Dwarf Systems from C1 to C5

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinez, Arturo O.; Crossfield, Ian J. M.; Peacock, Sarah

The NASA K2 mission uses photometry to find planets transiting stars of various types. M dwarfs are of high interest since they host more short-period planets than any other type of main-sequence star and transiting planets around M dwarfs have deeper transits compared to other main-sequence stars. In this paper, we present stellar parameters from K and M dwarfs hosting transiting planet candidates discovered by our team. Using the SOFI spectrograph on the European Southern Observatory’s New Technology Telescope, we obtained R ≈ 1000 J -, H -, and K -band (0.95–2.52 μ m) spectra of 34 late-type K2 planetmore » and candidate planet host systems and 12 bright K4–M5 dwarfs with interferometrically measured radii and effective temperatures. Out of our 34 late-type K2 targets, we identify 27 of these stars as M dwarfs. We measure equivalent widths of spectral features, derive calibration relations using stars with interferometric measurements, and estimate stellar radii, effective temperatures, masses, and luminosities for the K2 planet hosts. Our calibrations provide radii and temperatures with median uncertainties of 0.059 R {sub ⊙} (16.09%) and 160 K (4.33%), respectively. We then reassess the radii and equilibrium temperatures of known and candidate planets based on our spectroscopically derived stellar parameters. Since a planet’s radius and equilibrium temperature depend on the parameters of its host star, our study provides more precise planetary parameters for planets and candidates orbiting late-type stars observed with K2 . We find a median planet radius and an equilibrium temperature of approximately 3 R {sub ⊕} and 500 K, respectively, with several systems (K2-18b and K2-72e) receiving near-Earth-like levels of incident irradiation.« less

Entropy-driven loss of gas-phase Group 5 species from GOLD/3-5 compound semiconductor systems

NASA Astrophysics Data System (ADS)

Pugh, J. H.; Williams, R. S.

1986-02-01

Temperature dependent chemical interactions between Au and nine 3-5 compound semiconductors (3=A1, Ga, In and V=P, As, Sb) have been calculated using bulk thermodynamic properties. Enthalpic considerations alone are insufficient to predict metal/compound-semiconductor reactivities. The entropy of vaporization of the group 5 elements is shown to be an extremely important driving force for chemical reactions involving the 3-5's, since it enables several endothermic reactions to occur spontaneously under certain temperature and pressure conditions. Plots of either Gibb's free energies of reaction or equilibrium vapor pressure of the group 5 element versus temperature are used to predict critical reaction temperatures for each of the systems studied. These plots agree extremely well with previous experimental observations of thin film reactions of Au on GaAs.

Direct amplification of casework bloodstains using the Promega PowerPlex(®) 21 PCR amplification system.

PubMed

Gray, Kerryn; Crowle, Damian; Scott, Pam

2014-09-01

A significant number of evidence items submitted to Forensic Science Service Tasmania (FSST) are blood swabs or bloodstained items. Samples from these items routinely undergo phenol:chloroform:isoamyl alcohol organic extraction and quantitative Polymerase Chain Reaction (qPCR) testing prior to PowerPlex(®) 21 amplification. This multi-step process has significant cost and timeframe implications in a fiscal climate of tightening government budgets, pressure towards improved operating efficiencies, and an increasing emphasis on rapid techniques better supporting intelligence-led policing. Direct amplification of blood and buccal cells on cloth and Whatman FTA™ card with PowerPlex(®) 21 has already been successfully implemented for reference samples, eliminating the requirement for sample pre-treatment. Scope for expanding this method to include less pristine casework blood swabs and samples from bloodstained items was explored in an endeavour to eliminate lengthy DNA extraction, purification and qPCR steps for a wider subset of samples. Blood was deposited onto a range of substrates including those historically found to inhibit STR amplification. Samples were collected with micro-punch, micro-swab, or both. The potential for further fiscal savings via reduced volume amplifications was assessed by amplifying all samples at full and reduced volume (25 and 13μL). Overall success rate data showed 80% of samples yielded a complete profile at reduced volume, compared to 78% at full volume. Particularly high success rates were observed for the blood on fabric/textile category with 100% of micro-punch samples yielding complete profiles at reduced volume and 85% at full volume. Following the success of this trial, direct amplification of suitable casework blood samples has been implemented at reduced volume. Significant benefits have been experienced, most noticeably where results from crucial items have been provided to police investigators prior to interview of suspects, and a coronial identification has been successfully completed in a short timeframe to avoid delay in the release of human remains to family members. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Event activity dependence of Y(nS) production in $$\\sqrt{s_{NN}}$$=5.02 TeV pPb and $$\\sqrt{s}$$=2.76 TeV pp collisions

DOE PAGES

Chatrchyan, Serguei

2014-04-15

The production of Y(1S), Y(2S), and Y(3S) is investigated in pPb and pp collisions at centre-of-mass energies per nucleon pair of 5.02 TeV and 2.76 TeV, respectively. The datasets correspond to integrated luminosities of about 31 nb –1 (pPb) and 5.4 pb –1 (pp), collected in 2013 by the CMS experiment at the LHC. Upsilons that decay into muons are reconstructed within the rapidity interval (y CM) < 1.93 in the nucleon-nucleon centre-of-mass frame. Their production is studied as a function of two measures of event activity, namely the charged-particle multiplicity measured in the pseudorapidity interval |η| < 2.4, andmore » the sum of transverse energy deposited at forward pseudorapidity, 4.0 < |η|< 5.2. The Y cross sections normalized by their event activity integrated values, Y(nS)/, are found to rise with both measures of the event activity in pp and pPb. In both collision systems, the ratios of the excited to the ground state cross sections, Y(nS)/Y(1S), are found to decrease with the charged-particle multiplicity, while as a function of the transverse energy the variation is less pronounced. Lastly, the event activity integrated double ratios, [Y(nS)/Y(1S)] pPb / [Y(nS)/Y(1S)] pp, are also measured and found to be 0.83 +/- 0.05 (stat.) +/- 0.05 (syst.) and 0.71 +/- 0.08 (stat.) +/- 0.09 (syst.) for Y(2S) and Y(3S), respectively.« less

[Polymorphism analysis of 20 autosomal short-tandem repeat loci in southern Chinese Han population].

PubMed

Chen, Ling; Lu, Hui-Jie; DU, Wei-An; Qiu, Ping-Ming; Liu, Chao

2016-02-20

To evaluate the value of PowerPlex ® 21 System (Promega) and study the genetic polymorphism of its 20 short-tandem repeat (STR) loci in southern Chinese Han population. We conducted genotyping experiments using PowerPlex ® 21 System on 20 autosomal STR loci (D3S1358, D1S1656, D6S1043, D13S317, Penta E, D16S539, D18S51, D2S1338, CSF1PO, Penta D, TH01, vWA, D21S11, D7S820, D5S818, TPOX, D8S1179, D12S391, D19S433 and FGA) in 2367 unrelated Chinese Han individuals living in South China. The allele frequencies and parameters commonly used in forensic science were statistically analyzed in these individuals and compared with the reported data of other populations. The PowerPlex ® 21 System had a power of discrimination (PD) ranging from 0.7839 to 0.9852 and a power of exclusion (PE) ranging from 0.2974 to 0.8099 for the 20 loci. No significant deviation from Hardy-Weinberg expectations was found for all the loci except for D5S818. This southern Chinese Han population had significant differences in the allele frequencies from 8 ethnic groups reported in China, and showed significant differences at 8 to 20 STR foci from 5 foreign populations. The allele frequency at the locus D1S1656 in this southern Chinese Han population differed significantly from those in the 5 foreign populations and from 3 reported Han populations in Beijing, Zhejiang Province and Fujian Province of China. The neighbor-joining phylogenetictree showed clustering of all the Asian populations in one branch, while the northern Italian and Argentina populations clustered in a separate branch. This southern Chinese Han population had the nearest affinity with the Yi ethnic population in Yunnan Province of China. The 20 STR loci are highly polymorphic in this southern Chinese Han population, suggesting the value of this set of STR loci in forensic personal identification, paternity testing and anthropological study.

Streptococcal 5′-Nucleotidase A (S5nA), a Novel Streptococcus pyogenes Virulence Factor That Facilitates Immune Evasion*

PubMed Central

Zheng, Lisa; Khemlani, Adrina; Lorenz, Natalie; Loh, Jacelyn M. S.; Langley, Ries J.; Proft, Thomas

2015-01-01

Streptococcus pyogenes is an important human pathogen that causes a wide range of diseases. Using bioinformatics analysis of the complete S. pyogenes strain SF370 genome, we have identified a novel S. pyogenes virulence factor, which we termed streptococcal 5′-nucleotidase A (S5nA). A recombinant form of S5nA hydrolyzed AMP and ADP, but not ATP, to generate the immunomodulatory molecule adenosine. Michaelis-Menten kinetics revealed a Km of 169 μm and a Vmax of 7550 nmol/mg/min for the substrate AMP. Furthermore, recombinant S5nA acted synergistically with S. pyogenes nuclease A to generate macrophage-toxic deoxyadenosine from DNA. The enzyme showed optimal activity between pH 5 and pH 6.5 and between 37 and 47 °C. Like other 5′-nucleotidases, S5nA requires divalent cations and was active in the presence of Mg2+, Ca2+, or Mn2+. However, Zn2+ inhibited the enzymatic activity. Structural modeling combined with mutational analysis revealed a highly conserved catalytic dyad as well as conserved substrate and cation-binding sites. Recombinant S5nA significantly increased the survival of the non-pathogenic bacterium Lactococcus lactis during a human whole blood killing assay in a dose-dependent manner, suggesting a role as an S. pyogenes virulence factor. In conclusion, we have identified a novel S. pyogenes enzyme with 5′-nucleotidase activity and immune evasion properties. PMID:26527680

Transfusion-Free Cardiopulmonary Bypass in Jehovah’s Witness Patients Weighing Less Than 5 kg

PubMed Central

Boettcher, Wolfgang; Merkle, Frank; Huebler, Michael; Koster, Andreas; Schulz, Fritz; Kopitz, Michael; Kuppe, Hermann; Lange, Peter; Hetzer, Roland

2005-01-01

Abstract: Performing cardiac surgery on pediatric Jehovah’s Witness patients is a great challenge for the surgical team and especially for the perfusionist. Jehovah’s Witnesses reject blood transfusions on the grounds of their literal interpretation of passages of the Bible. In accordance with this belief, Jehovah’s Witnesses feel that it is also forbidden to retransfuse autologous blood that has been separated from their own circulatory system. We report the use of cardiopulmonary bypass (CPB) during open-heart surgery in three infants with a body weight of 4.5 kg, 3.5 kg, and 3.1 kg, respectively, without transfusion of blood components. A small-volume CPB circuit with a priming volume of 200 mL, including the arterial line filter, was designed to decrease the degree of hemodilution. A dedicated pediatric heart lung machine console with remote pump heads and intensive blood conservation efforts allowed the operation without the use of donor blood. The CPB circuits were primed with crystalloid solution only. The procedures were performed in normothermia or in moderate hypothermia. Pre-CPB hemoglobin levels were 10.8 g/dL, 10.6 g/dL, and 8.5 g/dL. The hemoglobin concentrations measured during CPB ranged from 5.9 to 6.5 g/dL, 6.4 to 6.8 g/dL, and 5.5 to 5.9 g/dL, respectively. The patients did not receive any blood or blood products during their entire hospital stay. PMID:16350381

ElarmS Earthquake Early Warning System: 2017 Performance and New ElarmS Version 3.0 (E3)

NASA Astrophysics Data System (ADS)

Chung, A. I.; Henson, I. H.; Allen, R. M.; Hellweg, M.; Neuhauser, D. S.

2017-12-01

The ElarmS earthquake early warning (EEW) system has been successfully detecting earthquakes throughout California since 2007. ElarmS version 2.0 (E2) is one of the three algorithms contributing alerts to ShakeAlert, a public EEW system being developed by the USGS in collaboration with UC Berkeley, Caltech, University of Washington, and University of Oregon. E2 began operating in test mode in the Pacific Northwest in 2013, and since April of this year E2 has been contributing real-time alerts from Oregon and Washington to the ShakeAlert production prototype system as part of the ShakeAlert roll-out throughout the West Coast. Since it began operating west-coast-wide, E2 has correctly alerted on 5 events that matched ANSS catalog events with M≥4, missed 1 event with M≥4, and incorrectly created alerts for 5 false events with M≥4. The most recent version of the algorithm, ElarmS version 3.0 (E3), is a significant improvement over E2. It addresses some of the most problematic causes of false events for which E2 produced alerts, without impacting reliability in terms of matched and missed events. Of the 5 false events that were generated by E2 since April, 4 would have been suppressed by E3. In E3, we have added a filterbank teleseismic filter. By analyzing the amplitude of the waveform filtered in various passbands, it is possible to distinguish between local and teleseismic events. We have also added a series of checks to validate triggers and filter out spurious and S-wave triggers. Additional improvements to the waveform associator also improve detections. In this presentation, we describe the improvements and compare the performance of the current production (E2) and development (E3) versions of ElarmS over the past year. The ShakeAlert project is now working through a streamlining process to identify the best components of various algorithms and merge them. The ElarmS team is participating in this effort and we anticipate that much of E3 will continue in the

Observation of grain size effect on multiferroism and magnetoelectric coupling of Na0.5Bi0.5TiO3 - BaFe12O19 novel composite system

NASA Astrophysics Data System (ADS)

Pattanayak, Ranjit; Kuila, Sourav; Raut, Subhajit; Ghosh, Surya Prakash; Dhal, Satyanarayan; Panigrahi, Simanchalo

2017-12-01

Four novel polycrystalline magnetoelectric composite systems: S1, S2, S3 and S4 having composition [90 wt% Na0.5Bi0.5TiO3 (NBT) - 10 wt% BaFe12O19 (BaM)] considering the variation of grain size of both the phases [NBT(Lg)-BaM(Lg)-[S1], NBT(Lg)-BaM(Sg)-[S2], NBT(Sg)-BaM(Lg)-[S3] and NBT(Sg)-BaM(Sg)-[S4

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Design and performance simulation of 532 nm Rayleigh-Mie Doppler lidar system for 5-50 km wind measurement

NASA Astrophysics Data System (ADS)

Shen, Fahua; Wang, Bangxin; Shi, Wenjuan; Zhuang, Peng; Zhu, Chengyun; Xie, Chenbo

2018-04-01

A novel design of the 532 nm Rayleigh-Mie Doppler lidar receiving system is carried out. The use of polarization isolation technology to effectively improve the receiving system optical reception efficiency, suppress the background noise, not only improves the system wind field detection accuracy, while achieving a high-accuracy temperature measurement. The wind speed and temperature measurement principle of the system are discussed in detail, and the triple Fabry-Perot etalon parameters are optimized. Utilizing the overall design parameters of the system, the system detection performance is simulated. The simulation results show that from 5 to 50 km altitude with vertical resolution of 0.1 km@5 ∼20 km, 0.5 km@20 ∼40 km, 1 km@40 ∼50 km, by using the laser with single pulse energy of 600 mJ, repetition frequency of 50 Hz and the receiving telescope with aperture of 0.8 m, with 2min integration time and in ±50 m/s radial wind speed range, the radial wind speed measurement accuracies of our designed lidar in the day and night are better than 2.6 m/s and 0.9 m/s respectively, and its performance is obviously superior to that of traditional system 5.6 m/s and 1.4 m/s wind speed accuracies; with 10min integration time and in 210 ∼280 K temperature range, the temperature measurement accuracies of the system in the day and night are better than 3.4 K and 1.2 K respectively; since the wind speed sensitivities of the Mie and Rayleigh scattering signals are not exactly the same, in ±50 m/s radial wind speed range, the wind speed bias induced by Mie signal is less than 1 m/s in the temperature range of 210-290 K and in the backscatter ratio range of 1-1.5 for pair measurement.

S5 Lipase: an organic solvent tolerant enzyme.

PubMed

Rahman, Raja Noor Zaliha Abdul; Baharum, Syarul Nataqain; Salleh, Abu Bakar; Basri, Mahiran

2006-12-01

In this study, an organic solvent tolerant bacterial strain was isolated. This strain was identified as Pseudomonas sp. strain S5, and was shown to degrade BTEX (Benzene, Toluene, Ethyl-Benzene, and Xylene). Strain S5 generates an organic solvent-tolerant lipase in the late logarithmic phase of growth. Maximum lipase production was exhibited when peptone was utilized as the sole nitrogen source. Addition of any of the selected carbon sources to the medium resulted in a significant reduction of enzyme production. Lower lipase generation was noted when an inorganic nitrogen source was used as the sole nitrogen source. This bacterium hydrolyzed all tested triglycerides and the highest levels of production were observed when olive oil was used as a natural triglyceride. Basal medium containing Tween 60 enhanced lipase production to the most significant degree. The absence of magnesium ions (Mg2+) in the basal medium was also shown to stimulate lipase production. Meanwhile, an alkaline earth metal ion, Na+, was found to stimulate the production of S5 lipase.

Planet-induced Stellar Pulsations in HAT-P-2's Eccentric System

NASA Astrophysics Data System (ADS)

de Wit, Julien; Lewis, Nikole K.; Knutson, Heather A.; Fuller, Jim; Antoci, Victoria; Fulton, Benjamin J.; Laughlin, Gregory; Deming, Drake; Shporer, Avi; Batygin, Konstantin; Cowan, Nicolas B.; Agol, Eric; Burrows, Adam S.; Fortney, Jonathan J.; Langton, Jonathan; Showman, Adam P.

2017-02-01

Extrasolar planets on eccentric short-period orbits provide a laboratory in which to study radiative and tidal interactions between a planet and its host star under extreme forcing conditions. Studying such systems probes how the planet’s atmosphere redistributes the time-varying heat flux from its host and how the host star responds to transient tidal distortion. Here, we report the insights into the planet-star interactions in HAT-P-2's eccentric planetary system gained from the analysis of ˜350 hr of 4.5 μm observations with the Spitzer Space Telescope. The observations show no sign of orbit-to-orbit variability nor of orbital evolution of the eccentric planetary companion, HAT-P-2 b. The extensive coverage allows us to better differentiate instrumental systematics from the transient heating of HAT-P-2 b’s 4.5 μm photosphere and yields the detection of stellar pulsations with an amplitude of approximately 40 ppm. These pulsation modes correspond to exact harmonics of the planet’s orbital frequency, indicative of a tidal origin. Transient tidal effects can excite pulsation modes in the envelope of a star, but, to date, such pulsations had only been detected in highly eccentric stellar binaries. Current stellar models are unable to reproduce HAT-P-2's pulsations, suggesting that our understanding of the interactions at play in this system is incomplete.

34 CFR 5b.11 - Exempt systems.

Code of Federal Regulations, 2010 CFR

2010-07-01

... information from the subject individual. (6) 5 U.S.C. 552a(e)(3) and § 5b.4(a)(3) of this part, regarding notice to individuals asked to provide information to the Department. (7) 5 U.S.C. 552a(e)(4) (G), (H... notice on subject individual if a record is made available under compulsory legal process if that process...

34 CFR 5b.11 - Exempt systems.

Code of Federal Regulations, 2014 CFR

2014-07-01

... information from the subject individual. (6) 5 U.S.C. 552a(e)(3) and § 5b.4(a)(3) of this part, regarding notice to individuals asked to provide information to the Department. (7) 5 U.S.C. 552a(e)(4) (G), (H... notice on subject individual if a record is made available under compulsory legal process if that process...

34 CFR 5b.11 - Exempt systems.

Code of Federal Regulations, 2011 CFR

2011-07-01

... information from the subject individual. (6) 5 U.S.C. 552a(e)(3) and § 5b.4(a)(3) of this part, regarding notice to individuals asked to provide information to the Department. (7) 5 U.S.C. 552a(e)(4) (G), (H... notice on subject individual if a record is made available under compulsory legal process if that process...

34 CFR 5b.11 - Exempt systems.

Code of Federal Regulations, 2012 CFR

2012-07-01

... information from the subject individual. (6) 5 U.S.C. 552a(e)(3) and § 5b.4(a)(3) of this part, regarding notice to individuals asked to provide information to the Department. (7) 5 U.S.C. 552a(e)(4) (G), (H... notice on subject individual if a record is made available under compulsory legal process if that process...

34 CFR 5b.11 - Exempt systems.

Code of Federal Regulations, 2013 CFR

2013-07-01

... information from the subject individual. (6) 5 U.S.C. 552a(e)(3) and § 5b.4(a)(3) of this part, regarding notice to individuals asked to provide information to the Department. (7) 5 U.S.C. 552a(e)(4) (G), (H... notice on subject individual if a record is made available under compulsory legal process if that process...

UTa 2O(S 2) 3Cl 6: A ribbon structure containing a heterobimetallic 5 d-5 f M 3 cluster

NASA Astrophysics Data System (ADS)

Wells, Daniel M.; Chan, George H.; Ellis, Donald E.; Ibers, James A.

2010-02-01

A new solid-state compound containing a heterobimetallic cluster of U and Ta, UTa 2O(S 2) 3Cl 6, has been synthesized and its structure has been characterized by single-crystal X-ray diffraction methods. UTa 2O(S 2) 3Cl 6 was synthesized from UCl 4 and Ta 1.2S 2 at 883 K. The O is believed to have originated in the Ta 1.2S 2 reactant. The compound crystallizes in the space group P1¯ of the triclinic system. The structure comprises a UTa 2 unit bridged by μ 2-S 2 and μ 3-O groups. Each Ta atom bonds to two μ 2-S 2, the μ 3-O, and two terminal Cl atoms. Each U atom bonds to two μ 2-S 2, the μ 3-O, and four Cl atoms. The Cl atoms bridge in pairs to neighboring U atoms to form a ribbon structure. The bond distances are normal and are consistent with formal oxidation states of +IV/+V/-II/-I/-I for U/Ta/O/S/Cl, respectively. The optical absorbance spectrum displays characteristic transition peaks near the absorption edge. Density functional theory was used to assign these peaks to transitions between S 1- valence-band states and empty U 5 f-6 d hybrid bands. Density-of-states analysis shows overlap between Ta 5 d and U bands, consistent with metal-metal interactions.

Bisphenol A, bisphenol F and bisphenol S affect differently 5α-reductase expression and dopamine–serotonin systems in the prefrontal cortex of juvenile female rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castro, Beatriz; Sánchez, Pilar; Torres, Jesús M., E-mail: torrespi@ugr.es

Background: Early-life exposure to the endocrine disruptor bisphenol A (BPA) affects brain function and behavior, which might be attributed to its interference with hormonal steroid signaling and/or neurotransmitter systems. Alternatively, the use of structural analogs of BPA, mainly bisphenol F (BPF) and bisphenol S (BPS), has increased recently. However, limited in vivo toxicity data exist. Objectives: We investigated the effects of BPA, BPF and BPS on 5α-reductase (5α-R), a key enzyme involved in neurosteroidogenesis, as well as on dopamine (DA)- and serotonin (5-HT)-related genes, in the prefrontal cortex (PFC) of juvenile female rats. Methods: Gestating Wistar rats were treated withmore » either vehicle or 10 μg/kg/day of BPA, BPF or BPS from gestational day 12 to parturition. Then, female pups were exposed from postnatal day 1 through day 21 (PND21), when they were euthanized and RT-PCR, western blot and quantitative PCR-array experiments were performed. Results: BPA decreased 5α-R2 and 5α-R3 mRNA and protein levels, while both BPF and BPS decreased 5α-R3 mRNA levels in PFC at PND21. Further, BPA, BPF and BPS significantly altered, respectively, the transcription of 25, 56 and 24 genes out of the 84 DA and 5-HT-related genes assayed. Of particular interest was the strong induction by all these bisphenols of Cyp2d4, implicated in corticosteroids synthesis. Conclusions: Our results demonstrate for the first time that BPA, BPF and BPS differentially affect 5α-R and genes related to DA/5-HT systems in the female PFC. In vivo evidence of the potential adverse effects of BPF and BPS in the brain of mammals is provided in this work, raising questions about the safety of these chemicals as substitutes for BPA. - Highlights: • Juvenile prefrontal cortex of female rats exposed to bisphenol A, F or S was analyzed. • We provide the first in vivo data of BPF and BPS effects in mammal brain. • BPA, BPF and BPS differently affected dopamine and serotonin

Effects of microbial DNA on human DNA profiles generated using the PowerPlex® 16 HS system.

PubMed

Dembinski, Gina M; Picard, Christine J

2017-11-01

Most crime scenes are not sterile and therefore may be contaminated with environmental DNA, especially if a decomposing body is found. Collecting biological evidence from this individual will yield DNA samples mixed with microbial DNA. This also becomes important if postmortem swabs are collected from sexually assaulted victims. Although genotyping kits undergo validation tests, including bacterial screens, they do not account for the diverse microbial load during decomposition. We investigated the effect of spiking human DNA samples with known concentrations of DNA from 17 microbe species associated with decomposition on DNA profiles produced using the Promega PowerPlex ® HS system. Two species, Bacillus subtilis and Mycobacterium smegmatis, produced an extraneous allele at the TPOX locus. When repeated with the PowerPlex ® Fusion kit, the extra allele no longer amplified with these two species. This experiment demonstrates that caution should be exhibited if microbial load is high and the PowerPlex ® 16HS system is used. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl: Interesting size effects originated from the tetrahedral anions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Ming-Yan; Xia, Sheng-Qing, E-mail: shqxia@sdu.edu.cn; Liu, Xiao-Cun

2014-11-15

Two new barium chalcogenides, Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl, were synthesized by using high temperature solid-state reactions and their structures were determined by single-crystal X-ray diffraction technique. Despite the similar chemical formula, the structures of Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl are subtly different due to the size effects originated from the tetrahedral anions. Ba{sub 3}GeS{sub 5} crystallizes in the orthorhombic space group Pnma (no. 62) with cell parameters of a=12.0528(9) Å, b=9.5497(7) Å and c=8.5979(6) Å, while Ba{sub 3}InS{sub 4}Cl adopts a different tetragonal system (space group: I4/mcm, no. 140, a=b=8.3613(6) Å, c=14.3806(18) Å). The measuredmore » optical band gap of Ba{sub 3}GeS{sub 5} is 3.0 eV, a little smaller than the value of 3.42 eV in Ba{sub 3}InS{sub 4}Cl. Theoretical calculations by Wien2k are provided as well in order to better understand these results. - Graphical abstract: The polyhedral structure view for Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl in which Ba, S and Cl atoms are plotted in purple, red and green spheres. - Highlights: • Two new barium chalcogenides, Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl, were synthesized from the BaCl{sub 2}-flux reactions. • Their crystal structures feature discrete [MS{sub 4}] tetrahedra which embody interesting size effects. • Both compounds exhibit a band gap around 3.0 eV. • They are thermally stable up to 1073 K.« less

Rolling Circle Transcription of Ribozymes Targeted to ras and mdr-1

DTIC Science & Technology

2001-09-01

ssDNA) to direct transcription of an tion-PCR, and recyclization were carried out to optimize active hammerhead ribozyme in E. coli cells. transcription...transcription I hammerhead ribozyme I in vitro selection and 12.5 units/ml RNase inhibitor (Promega), in a total reaction volume of 15 tk1. After a...sequence encoding a ssDNA, and splint ssDNA were ethanol-precipitated and used as hammerhead ribozyme . templates to begin the next round of in vitro

Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

PubMed

Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

2017-11-14

The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

PubMed Central

Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

1984-01-01

Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

36 CFR 212.5 - Road system management.

Code of Federal Regulations, 2011 CFR

2011-07-01

... safety or to environmental degradation. (c) Cost recovery on National Forest System roads. The Chief may... 36 Parks, Forests, and Public Property 2 2011-07-01 2011-07-01 false Road system management. 212.5... MANAGEMENT Administration of the Forest Transportation System § 212.5 Road system management. (a) Traffic...

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

PubMed Central

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

Physical mapping of 18S-25S rDNA and 5S rDNA in Lupinus via fluorescent in situ hybridization.

PubMed

Naganowska, Barbara; Zielińska, Anna

2002-01-01

Double-target fluorescent in situ hybridization (FISH) was used to determine the genomic distribution of ribosomal RNA genes in five Lupinus species: L. cosentinii (2n=32), L. pilosus (2n=42), L. angustifolius (2n=40), L. luteus (2n=52) and L. mutabilis (2n=48). 18S-25S rDNA and 5S rDNA were used as probes. Some interspecific variation was observed in the number and size of the 18S-25S rDNA loci. All the studied species had one chromosome pair carrying 5S rDNA.

Measurements of the exclusive decays of the upsilon(5S) to meson final states and improved B(s)* mass measurement.

PubMed

Aquines, O; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Stroynowski, R; Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Briere, R A; Brock, I; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Galik, R S; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Wiss, J; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Arms, K; Severini, H; Dytman, S A; Love, W; Mehrabyan, S; Savinov, V

2006-04-21

Using 420 pb(-1) of data collected on the upsilon(5S) resonance with the CLEO III detector, we reconstruct B mesons in 25 exclusive decay channels to measure or set upper limits on the decay rate of upsilon(5S) into B meson final states. We measure the inclusive B cross section to be sigma(upsilon(5S) --> BB(X)) = (0.177 +/- 0.030 +/- 0.016) nb and make the first measurements of the production rates of sigma(upsilon(5S) --> B*B*) = (0.131 +/- 0.025 +/- 0.014) nb and sigma(upsilon(5S) --> BB*) = (0.043 +/- 0.016 +/- 0.006) nb, respectively. We set 90% confidence level limits of sigma(upsilon(5S) -->BB) < 0.038 nb, sigma(upsilon(5S) --> B(*)B(*)pi) < 0.055 nb and sigma(upsilon(5S) --> BBpipi) < 0.024 nb. We also extract the most precise value of the B(s)* mass to date, M(B(s)*) = (5411.7 +/- 1.6 +/- 0.6) MeV/c2.

Effect of Pressure on the Stability and Electronic Structure of ZnO0.5S0.5 and ZnO0.5Se0.5

NASA Astrophysics Data System (ADS)

Manotum, R.; Klinkla, R.; Phaisangittisakul, N.; Pinsook, U.; Bovornratanaraks, T.

2017-12-01

Structures and high-pressure phase transitions in ZnO0.5S0.5 and ZnO0.5Se0.5 have been investigated using density functional theory calculations. The previously proposed structures of ZnO0.5S0.5 and ZnO0.5Se0.5 which are chalcopyrite ( I\\bar{4}2d ), rocksalt ( Fm3m ), wurtzite ( P63 mc ) and CuAu-I ( P\\bar{4}m2 ) have been fully investigated. Stabilities of these materials have been systematically studied up to 40 GPa using various approaches. We have confirmed the stability of the chalcopyrite structure up to 30 GPa for which the CuAu-I structure has been previously proposed. However, our calculation revealed that CuAu-I is not a stable structure under 32 GPa and 33 GPa for both ZnO0.5S0.5 and ZnO0.5Se0.5, respectively, which could explain the failure in several attempts to fabricate these materials under such conditions. We have also examined the pressure-dependence of the bandgap and electronic structure up to 30 GPa. We can conclude from our PDOS analysis that the applied pressure does not change the atomic state characters of electronic states near the top of valence and the bottom of conduction bands, but mainly modifies the dominant Zn-3d atomic state of the deep Bloch state at -1 eV below Fermi level.

Planet-induced Stellar Pulsations in HAT-P-2's Eccentric System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wit, Julien de; Lewis, Nikole K.; Knutson, Heather A.

2017-02-20

Extrasolar planets on eccentric short-period orbits provide a laboratory in which to study radiative and tidal interactions between a planet and its host star under extreme forcing conditions. Studying such systems probes how the planet’s atmosphere redistributes the time-varying heat flux from its host and how the host star responds to transient tidal distortion. Here, we report the insights into the planet–star interactions in HAT-P-2's eccentric planetary system gained from the analysis of ∼350 hr of 4.5 μ m observations with the Spitzer Space Telescope . The observations show no sign of orbit-to-orbit variability nor of orbital evolution of themore » eccentric planetary companion, HAT-P-2 b. The extensive coverage allows us to better differentiate instrumental systematics from the transient heating of HAT-P-2 b’s 4.5 μ m photosphere and yields the detection of stellar pulsations with an amplitude of approximately 40 ppm. These pulsation modes correspond to exact harmonics of the planet’s orbital frequency, indicative of a tidal origin. Transient tidal effects can excite pulsation modes in the envelope of a star, but, to date, such pulsations had only been detected in highly eccentric stellar binaries. Current stellar models are unable to reproduce HAT-P-2's pulsations, suggesting that our understanding of the interactions at play in this system is incomplete.« less

44 CFR 334.5 - GMR system description.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 44 Emergency Management and Assistance 1 2014-10-01 2014-10-01 false GMR system description. 334.5 Section 334.5 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF HOMELAND SECURITY PREPAREDNESS GRADUATED MOBILIZATION RESPONSE § 334.5 GMR system description. The GMR...

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

Penrose limits of Abelian and non-Abelian T-duals of AdS 5 × S 5 and their field theory duals

NASA Astrophysics Data System (ADS)

Itsios, Georgios; Nastase, Horatiu; Núñez, Carlos; Sfetsos, Konstantinos; Zacarías, Salomón

2018-01-01

We consider the backgrounds obtained by Abelian and non-Abelian T-duality applied on AdS 5 × S 5. We study geodesics, calculate Penrose limits and find the associated plane-wave geometries. We quantise the weakly coupled type-IIA string theory on these backgrounds. We study the BMN sector, finding operators that wrap the original quiver CFT. For the non-Abelian plane wave, we find a `flow' in the frequencies. We report some progress to understand this, in terms of deconstruction of a higher dimensional field theory. We explore a relation with the plane-wave limit of the Janus solution, which we also provide.

Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

PubMed

Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

2016-07-01

Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

First-principles study on structure stabilities of α-S and Na-S battery systems

NASA Astrophysics Data System (ADS)

Momida, Hiroyoshi; Oguchi, Tamio

2014-03-01

To understand microscopic mechanisms of charge and discharge reactions in Na-S batteries, there has been increasing needs to study fundamental atomic and electronic structures of elemental S as well as that of Na-S phases. The most stable form of S is known to be an orthorhombic α-S crystal at ambient temperature and pressure, and α-S consists of puckered S8 rings which crystallize in space group Fddd . In this study, the crystal structure of α-S is examined by using first-principles calculations with and without the van der Waals interaction corrections of Grimme's method, and results clearly show that the van der Waals interactions between the S8 rings have crucial roles on cohesion of α-S. We also study structure stabilities of Na2S, NaS, NaS2, and Na2S5 phases with reported crystal structures. Using calculated total energies of the crystal structure models, we estimate discharge voltages assuming discharge reactions from 2Na+ xS -->Na2Sx, and discharge reactions in Na/S battery systems are discussed by comparing with experimental results. This work was partially supported by Elements Strategy Initiative for Catalysts and Batteries (ESICB) of Ministry of Education, Culture, Sports, Science, and Technology (MEXT), Japan.

BORN CROSS SECTIONS FOR INELASTIC SCATTERING OF ELECTRONS BY HYDROGEN ATOMS. III. 5s, 5p, 5d, 5f, 5g STATES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milford, S.N.; Morrissey, J.J.; Scanlon, J.H.

1960-12-01

Born total cross sections were computed for the strong optically allowed transitions from n = 5 to n' = 6, at incident energies between 0.2 and 1361 ev. Thirty energy values were considered for the 5s to 6p and 5g to 6h cases, and nine for the other transitions. The cross sections obtained were larger than those of comparable transitions for lower n. The Bethe (dipole) approximation was also used, and was found to give good agreement with the Born results down to relatively low energies ( approx equal 3 ev). (auth)

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

46 CFR 62.25-5 - All control systems.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false All control systems. 62.25-5 Section 62.25-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING VITAL SYSTEM AUTOMATION General Requirements for All Automated Vital Systems § 62.25-5 All control systems. (a) Local and remote...

The 5-kwe reactor thermoelectric system summary

NASA Technical Reports Server (NTRS)

Vanosdol, J. H. (Editor)

1973-01-01

Design of the 5-kwe reactor thermoelectric system was initiated in February 1972 and extended through the conceptual design phase into the preliminary design phase. Design effort was terminated in January, 1973. This report documents the system and component requirements, design approaches, and performance and design characteristics for the 5-kwe system. Included is summary information on the reactor, radiation shields, power conversion systems, thermoelectric pump, radiator/structure, liquid metal components, and the control system.

10 CFR 960.5-1 - System guidelines.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 4 2013-01-01 2013-01-01 false System guidelines. 960.5-1 Section 960.5-1 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Preclosure Guidelines § 960.5-1 System guidelines. (a) Qualifying conditions—(1) Preclosure...

10 CFR 960.5-1 - System guidelines.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 4 2011-01-01 2011-01-01 false System guidelines. 960.5-1 Section 960.5-1 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Preclosure Guidelines § 960.5-1 System guidelines. (a) Qualifying conditions—(1) Preclosure...

10 CFR 960.5-1 - System guidelines.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 4 2012-01-01 2012-01-01 false System guidelines. 960.5-1 Section 960.5-1 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Preclosure Guidelines § 960.5-1 System guidelines. (a) Qualifying conditions—(1) Preclosure...

46 CFR 62.25-5 - All control systems.

Code of Federal Regulations, 2014 CFR

2014-10-01

... normal operation. (c) Inadvertent grounding of an electrical or electronic safety control system must not... 46 Shipping 2 2014-10-01 2014-10-01 false All control systems. 62.25-5 Section 62.25-5 Shipping... General Requirements for All Automated Vital Systems § 62.25-5 All control systems. (a) Local and remote...

46 CFR 62.25-5 - All control systems.

Code of Federal Regulations, 2012 CFR

2012-10-01

... normal operation. (c) Inadvertent grounding of an electrical or electronic safety control system must not... 46 Shipping 2 2012-10-01 2012-10-01 false All control systems. 62.25-5 Section 62.25-5 Shipping... General Requirements for All Automated Vital Systems § 62.25-5 All control systems. (a) Local and remote...

46 CFR 62.25-5 - All control systems.

Code of Federal Regulations, 2013 CFR

2013-10-01

... normal operation. (c) Inadvertent grounding of an electrical or electronic safety control system must not... 46 Shipping 2 2013-10-01 2013-10-01 false All control systems. 62.25-5 Section 62.25-5 Shipping... General Requirements for All Automated Vital Systems § 62.25-5 All control systems. (a) Local and remote...

46 CFR 62.25-5 - All control systems.

Code of Federal Regulations, 2011 CFR

2011-10-01

... normal operation. (c) Inadvertent grounding of an electrical or electronic safety control system must not... 46 Shipping 2 2011-10-01 2011-10-01 false All control systems. 62.25-5 Section 62.25-5 Shipping... General Requirements for All Automated Vital Systems § 62.25-5 All control systems. (a) Local and remote...

A Study on The Development of Local Exhaust Ventilation System (LEV’s) for Installation of Laser Cutting Machine

NASA Astrophysics Data System (ADS)

Harun, S. I.; Idris, S. R. A.; Tamar Jaya, N.

2017-09-01

Local exhaust ventilation (LEV) is an engineering system frequently used in the workplace to protect operators from hazardous substances. The objective of this project is design and fabricate the ventilation system as installation for chamber room of laser cutting machine and to stimulate the air flow inside chamber room of laser cutting machine with the ventilation system that designed. LEV’s fabricated with rated voltage D.C 10.8V and 1.5 ampere. Its capacity 600 ml, continuously use limit approximately 12-15 minute, overall length LEV’s fabricated is 966 mm with net weight 0.88 kg and maximum airflow is 1.3 meter cubic per minute. Stimulate the air flow inside chamber room of laser cutting machine with the ventilation system that designed and fabricated overall result get 2 main gas vapor which air and carbon dioxide. For air gas which experimented by using anemometer, general duct velocity that produce is same with other gas produce, carbon dioxide which 5 m/s until 10 m/s. Overall result for 5 m/s and 10 m/s as minimum and maximum duct velocity produce for both air and carbon dioxide. The air gas flow velocity that captured by LEV’s fabricated, 3.998 m/s average velocity captured from 5 m/s duct velocity which it efficiency of 79.960% and 7.667 m/s average velocity captured from 10 m/s duct velocity with efficiency of 76.665%. For carbon dioxide gas flow velocity that captured by LEV’s fabricated, 3.674 m/s average velocity captured from 5 m/s duct velocity which it efficiency of 73.480% and 8.255 m/s average velocity captured from 10 m/s duct velocity with efficiency of 82.545%.

Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

PubMed Central

Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

1978-01-01

A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

The conformational free-energy landscape of β-D-mannopyranose: evidence for a (1)S(5) → B(2,5) → (O)S(2) catalytic itinerary in β-mannosidases.

PubMed

Ardèvol, Albert; Biarnés, Xevi; Planas, Antoni; Rovira, Carme

2010-11-17

The mechanism of glycosidic bond cleavage by glycosidases involves substrate ring distortions in the Michaelis complex that favor catalysis. Retaining β-mannosidases bind the substrate in a (1)S(5) conformation, and recent experiments have proposed an unusual substrate conformational pathway ((1)S(5) → B(2,5) → (O)S(2)) for the hydrolysis reaction. By means of Car-Parrinello metadynamics simulations, we have obtained the conformational free-energy surface (FES) of a β-d-mannopyranose molecule associated with the ideal Stoddart conformational diagram. We have found that (1)S(5) is among the most stable conformers and simultaneously is the most preactivated conformation in terms of elongation/shortening of the C1-O1/C1-O5 bonds, C1-O1 orientation, and charge development at the anomeric carbon. Analysis of the computed FES gives support to the proposed (1)S(5) → B(2,5) → (O)S(2) catalytic itinerary, showing that the degree of preactivation of the substrate in glycoside hydrolases (GHs) is related to the properties of an isolated sugar ring. We introduce a simple preactivation index integrating several structural, electronic, and energetic properties that can be used to predict the conformation of the substrate in the Michaelis complex of any GH.

Information Systems: Opportunities Exist to Strengthen SEC’s Oversight of Capacity and Security

DTIC Science & Technology

2001-07-01

Strengthen SEC’s Oversight of Capacity and Security 5 . FUNDING NUMBERS 6. AUTHOR(S) GAO 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING...ANSI Std. Z39-18 298-102 Page i GAO-01-863 Information Systems Letter 1 Results in Brief 2 Background 4 Scope and Methodology 5 SEC Uses a Wide Range...or external organizations to conduct the independent reviews. These internal audits are performed cyclically based on an annual risk analysis. SEC

Young Children's Learning of Water Physics by Constructing Working Systems

ERIC Educational Resources Information Center

Levy, Sharona T.

2013-01-01

The present study explored young 5-6-year old children's design-based learning of science through building working physical systems and examined their evolving conceptions of water flow. Fifteen children in an experimental group individually built water-pipe systems during four sessions that included end-of-session interviews. In addition,…

Scale invariance of the η-deformed AdS5 × S5 superstring, T-duality and modified type II equations

NASA Astrophysics Data System (ADS)

Arutyunov, G.; Frolov, S.; Hoare, B.; Roiban, R.; Tseytlin, A. A.

2016-02-01

We consider the ABF background underlying the η-deformed AdS5 ×S5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that has 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R-R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R-R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdS3 ×S3 ×T4and AdS2 ×S2 ×T6models.

Scale invariance of the η-deformed AdS 5 × S 5 superstring, T-duality and modified type II equations

DOE PAGES

Arutyunov, G.; Frolov, S.; Hoare, B.; ...

2015-12-23

We consider the ABF background underlying the η-deformed AdS 5 × S 5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that hasmore » 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R–R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R–R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdS 3 × S 3 × T 4 and AdS 2 × S 2 × T 6 models.« less

Investigation of the FK5 system in the equatorial zone. Application to the instrumental system of the Second Quito astrolabe catalogue.

NASA Astrophysics Data System (ADS)

Kolesnik, Y. B.

1995-12-01

15 catalogues produced in the 1980s and 12 catalogues made from 1960 to 1978 have been used to assess the consistency of the FK5 system with observations in the declination zone from -30deg to 30deg. Classical δ-dependent and α-dependent systematic differences (Cat-FK5) have been formed for individual instrumental systems of the catalogues. The weighted mean instrumental systems for two subsets of catalogues centred at the epochs 1970 and 1987 have been constructed. External systematic and random accuracy of the catalogues under analysis and errors of the mean instrumental systems for both selections of catalogues have been estimated and presented in tables. The individual systematic differences of the catalogues and the mean instrumental systems are shown in figures. Numerical values of the total systematic deviations for both mean instrumental systems are given in tables. The results of intercomparison are discussed to assess the actual systematic deviations of the FK5 at the respective epochs and its actual random accuracy. It has been found that the mutual consistency of individual instrumental systems of catalogues of 1980s with respect to zonal systematic differences in both right ascension and declination is significantly better when comparing with the earlier catalogues. Consistency of both catalogue subsets is comparable with respect to α-dependent systematic differences. It is shown that the claimed random errors of the FK5 positions and proper motions are rather realistic, while deviations of the FK5 right ascension and declination system in the equatorial zone for both mean epochs exceed expected ones from the formal considerations. Quick degradation of the FK5 system with time is detected in right ascension. The results in declination are recognized to be less reliable, due to larger inconsistency of the individual instrumental systems. The system of the Second Quito Astrolabe Catalogue (QAC 2) has been investigated by comparison with two subsets of

The GEOS-5 Data Assimilation System-Documentation of Versions 5.0.1, 5.1.0, and 5.2.0

NASA Technical Reports Server (NTRS)

Suarez, Max J.; Rienecker, M. M.; Todling, R.; Bacmeister, J.; Takacs, L.; Liu, H. C.; Gu, W.; Sienkiewicz, M.; Koster, R. D.; Gelaro, R.;

Summary of EPA’s Review of Comments on the National Electric Energy Data System (NEEDS) v.5.15

EPA Pesticide Factsheets

This document summarizes EPA’s review of comments on inputs to the IPM, including the National Electric Energy Data System (NEEDS) database. and highlights common comment types and how EPA generally reviewed and acted on those comments.

Frequency measurement of the 5 S{1}/{2}(F = 3)-5 D{5}/{2}(F = 5) two-photon transition in rubidium

NASA Astrophysics Data System (ADS)

Touahri, D.; Acef, O.; Clairon, A.; Zondy, J.-J.; Felder, R.; Hilico, L.; de Beauvoir, B.; Biraben, F.; Nez, F.

1997-02-01

We have measured the frequencies of three diode lasers stabilized on the 5 S{1}/{2}(F = 3)-5 D{5}/{2}(F = 5) two-photon transition in rubidium at λ = 778.1 nm, with an uncertainty of 1 kHz, using BNM-LPTF frequency synthesis chain starting from a {CO 2}/{OsO 4} reference laser at 10.3 μm. We show that this frequency chain is able to reach the 10 -13 resolution level. After a discussion of the systematic effects that may shift the resonance, the transition frequency is found to be ν = 385 285 142 378.280 ± 2 kHz.

CLB5-dependent activation of late replication origins in S. cerevisiae.

PubMed

Donaldson, A D; Raghuraman, M K; Friedman, K L; Cross, F R; Brewer, B J; Fangman, W L

1998-08-01

Replication origins in chromosomes are activated at specific times during the S phase. We show that the B-type cyclins are required for proper execution of this temporal program. clb5 cells activate early origins but not late origins, explaining the previously described long clb5 S phase. Origin firing appears normal in cIb6 mutants. In clb5 clb6 double mutant cells, the late origin firing defect is suppressed, accounting for the normal duration of the phase despite its delayed onset. Therefore, Clb5p promotes the timely activation of early and late origins, but Clb6p can activate only early origins. In clb5 clb6 mutants, the other B-type cyclins (Clb1-4p) promote an S phase during which both early and late replication origins fire.

The Copernicus S5P Mission Performance Centre / Validation Data Analysis Facility for TROPOMI operational atmospheric data products

NASA Astrophysics Data System (ADS)

Compernolle, Steven; Lambert, Jean-Christopher; Langerock, Bavo; Granville, José; Hubert, Daan; Keppens, Arno; Rasson, Olivier; De Mazière, Martine; Fjæraa, Ann Mari; Niemeijer, Sander

2017-04-01

Sentinel-5 Precursor (S5P), to be launched in 2017 as the first atmospheric composition satellite of the Copernicus programme, carries as payload the TROPOspheric Monitoring Instrument (TROPOMI) developed by The Netherlands in close cooperation with ESA. Designed to measure Earth radiance and solar irradiance in the ultraviolet, visible and near infrared, TROPOMI will provide Copernicus with observational data on atmospheric composition at unprecedented geographical resolution. The S5P Mission Performance Center (MPC) provides an operational service-based solution for various QA/QC tasks, including the validation of S5P Level-2 data products and the support to algorithm evolution. Those two tasks are to be accomplished by the MPC Validation Data Analysis Facility (VDAF), one MPC component developed and operated at BIRA-IASB with support from S[&]T and NILU. The routine validation to be ensured by VDAF is complemented by a list of validation AO projects carried out by ESA's S5P Validation Team (S5PVT), with whom interaction is essential. Here we will introduce the general architecture of VDAF, its relation to the other MPC components, the generic and specific validation strategies applied for each of the official TROPOMI data products, and the expected output of the system. The S5P data products to be validated by VDAF are diverse: O3 (vertical profile, total column, tropospheric column), NO2 (total and tropospheric column), HCHO (tropospheric column), SO2 (column), CO (column), CH4 (column), aerosol layer height and clouds (fractional cover, cloud-top pressure and optical thickness). Starting from a generic validation protocol meeting community-agreed standards, a set of specific validation settings is associated with each data product, as well as the appropriate set of Fiducial Reference Measurements (FRM) to which it will be compared. VDAF collects FRMs from ESA's Validation Data Centre (EVDC) and from other sources (e.g., WMO's GAW, NDACC and TCCON). Data

Phenomenology with F-theory S U (5 )

NASA Astrophysics Data System (ADS)

Leontaris, George K.; Shafi, Qaisar

2017-09-01

We explore the low-energy phenomenology of an F-theory-based S U (5 ) model which, in addition to the known quarks and leptons, contains Standard Model (SM) singlets and vectorlike color triplets and S U (2 ) doublets. Depending on their masses and couplings, some of these new particles may be observed at the LHC and future colliders. We discuss the restrictions by Cabibbo-Kobayashi-Maskawa matrix constraints on their mixing with the ordinary down quarks of the three chiral families. The model is consistent with gauge coupling unification at the usual supersymmetric GUT scale; dimension-five proton decay is adequately suppressed, while dimension-six decay mediated by the superheavy gauge bosons is enhanced by a factor of 5-7. The third generation charged fermion Yukawa couplings yield the corresponding low-energy masses in reasonable agreement with observations. The hierarchical nature of the masses of lighter generations is accounted for via nonrenormalizable interactions, with the perturbative vacuum expectation values (VEVs) of the SM singlet fields playing an essential role.

Physical locations of 5S and 18S-25S rDNA in Asian and American diploid Hordeum species with the I genome.

PubMed

Taketa, S; Ando, H; Takeda, K; von Bothmer, R

2001-05-01

The physical locations of 5S and 18S-25S rDNA sequences in 15 diploid Hordeum species with the I genome were examined by double-target in situ hybridization with pTa71 (18S-25S rDNA) and pTa794 (5S rDNA) clones as probes. All the three Asian species had a species-specific rDNA pattern. In 12 American species studied, eight different rDNA types were found. The type reported previously in H. chilense (the 'chilense' type) was observed in eight American species. The chilense type had double 5S rDNA sites - two sites on one chromosome arm separated by a short distance - and two pairs of major 18S-25S rDNA sites on two pairs of satellite chromosomes. The other seven types found in American species were similar to the chilense type and could be derived from the chilense type through deletion, reduction or addition of a rDNA site. Intraspecific polymorphisms were observed in three American species. The overall similarity in rDNA patterns among American species indicates the close relationships between North and South American species and their derivation from a single ancestral source. The differences in the distribution patterns of 5S and 18S-25S rDNA between Asian and American species suggest differentiation between the I genomes of Asian and American species. The 5S and 18S-25S rDNA sites are useful chromosome markers for delimiting Asian species, but have limited value as a taxonomic character in American species. On the basis of rDNA patterns, karyotype evolution and phylogeny of the I-genome diploid species are discussed.

Constructing Cd0.5Zn0.5S@ZIF-8 nanocomposites through self-assembly strategy to enhance Cr(VI) photocatalytic reduction.

PubMed

Qiu, Jianhao; Zhang, Xiong-Fei; Zhang, Xingguang; Feng, Yi; Li, Yuxin; Yang, Lvye; Lu, Haiqiang; Yao, Jianfeng

2018-05-05

A novel and highly efficient photocatalyst of Cd 0.5 Zn 0.5 S@ZIF-8 nanocomposite has been developed by a facile self-assembly strategy. This is the first report on the application of Cd x Zn 1-x S and metal-organic framework (MOF) nanocomposite as photocatalysts for the reduction of Cr(VI). The resulting Cd 0.5 Zn 0.5 S@ZIF-8 exhibited higher photocatalytic activity than that of pristine Cd 0.5 Zn 0.5 S and ZIF-8. Particularly, the CZS@Z60 composite with 60 wt% of ZIF-8 exhibited a photocatalytic activity that is about 1.6 times as high as that of Cd 0.5 Zn 0.5 S. The dominant reason for the improved photocatalytic reduction potential is proved to be the newly-formed interfacial SZn bonds that firmly connect Cd 0.5 Zn 0.5 S and ZIF-8 and substantially improve the separation efficiency of photo-excited electrons and holes. The newly-formed chemical bonds are confirmed by XPS analyses, and the prolonged lifetime of photo-excited electrons is evidenced by the electrochemical measurement of photocurrent, which shows that the photocurrent on Cd 0.5 Zn 0.5 S@ZIF-8 is much higher than that of Cd 0.5 Zn 0.5 S and ZIF-8. This study clearly demonstrates that the MOF-based composite nanomaterials hold great promises for applications in the field of environmental remediation and for design of novel photocatalytic materials. Copyright © 2018 Elsevier B.V. All rights reserved.

CELiS (Compact Eyesafe Lidar System), a portable 1.5 μm elastic lidar system for rapid aerosol concentration measurement: Part 2, Retrieval of Particulate Matter Concentration

NASA Astrophysics Data System (ADS)

Moore, K. D.; Bird, A. W.; Wojcik, M.; Lemon, R.; Hatfield, J.

2014-12-01

An elastic backscatter light detection and ranging (Lidar) system emits a laser pulse and measures the return signal from molecules and particles along the path. It has been shown that particulate matter mass concentrations (PM) can be retrieved from Lidar data using multiple wavelengths. In this paper we describe a technique that allows for semi-quantitative PM determination under a set of guiding assumptions using only one laser wavelength. The Space Dynamics Laboratory has designed an eye-safe (1.5 μm) single wavelength elastic Lidar system called CELiS (Compact Eye-safe Lidar System), which is described in a companion paper, to which this technique is applied. Data utilized in the PM retrieval include the Lidar return signal, ambient temperature, ambient humidity, barometric pressure, particle size distribution, particle chemical composition, and PM measurements. Particle size distribution is measured with an optical particle counter. PM is measured with filter-based measurements. Chemical composition is determined through multiple analyses on exposed filter samples. Particle measurements are made both inside and outside of the plume of interest and collocated with the lidar beam for calibration. The meteorological and particle measurements are used to estimate the total extinction (σ) and backscatter (β) for background and plume aerosols. These σ and β values are used in conjunction with the lidar return signal in an inversion technique based on that of Klett (1985, Appl. Opt., 1638-1643). Variable σ/β ratios over the lidar beam path are used to estimate the values of σ and β at each lidar bin. A relationship between β and PM mass concentrations at calibration points is developed, which then allows the β values derived over the lidar beam path to be converted to PM. A PM-calibrated, scanning Lidar system like CELiS can be used to investigate PM concentrations and emissions over a large volume, a task that is very difficult to accomplish with typical

Bisphenol A, bisphenol F and bisphenol S affect differently 5α-reductase expression and dopamine-serotonin systems in the prefrontal cortex of juvenile female rats.

PubMed

Castro, Beatriz; Sánchez, Pilar; Torres, Jesús M; Ortega, Esperanza

2015-10-01

Early-life exposure to the endocrine disruptor bisphenol A (BPA) affects brain function and behavior, which might be attributed to its interference with hormonal steroid signaling and/or neurotransmitter systems. Alternatively, the use of structural analogs of BPA, mainly bisphenol F (BPF) and bisphenol S (BPS), has increased recently. However, limited in vivo toxicity data exist. We investigated the effects of BPA, BPF and BPS on 5α-reductase (5α-R), a key enzyme involved in neurosteroidogenesis, as well as on dopamine (DA)- and serotonin (5-HT)-related genes, in the prefrontal cortex (PFC) of juvenile female rats. Gestating Wistar rats were treated with either vehicle or 10 μg/kg/day of BPA, BPF or BPS from gestational day 12 to parturition. Then, female pups were exposed from postnatal day 1 through day 21 (PND21), when they were euthanized and RT-PCR, western blot and quantitative PCR-array experiments were performed. BPA decreased 5α-R2 and 5α-R3 mRNA and protein levels, while both BPF and BPS decreased 5α-R3 mRNA levels in PFC at PND21. Further, BPA, BPF and BPS significantly altered, respectively, the transcription of 25, 56 and 24 genes out of the 84 DA and 5-HT-related genes assayed. Of particular interest was the strong induction by all these bisphenols of Cyp2d4, implicated in corticosteroids synthesis. Our results demonstrate for the first time that BPA, BPF and BPS differentially affect 5α-R and genes related to DA/5-HT systems in the female PFC. In vivo evidence of the potential adverse effects of BPF and BPS in the brain of mammals is provided in this work, raising questions about the safety of these chemicals as substitutes for BPA. Copyright © 2015 Elsevier Inc. All rights reserved.

Agonist and antagonist actions of antipsychotic agents at 5-HT1A receptors: a [35S]GTPgammaS binding study.

PubMed

Newman-Tancredi, A; Gavaudan, S; Conte, C; Chaput, C; Touzard, M; Verrièle, L; Audinot, V; Millan, M J

1998-08-21

Recombinant human (h) 5-HT1A receptor-mediated G-protein activation was characterised in membranes of transfected Chinese hamster ovary (CHO) cells by use of guanosine-5'-O-(3-[35S]thio)-triphosphate ([35S]GTPgammaS binding). The potency and efficacy of 21 5-HT receptor agonists and antagonists was determined. The agonists, 5-CT (carboxamidotryptamine) and flesinoxan displayed high affinity (subnanomolar Ki values) and high efficacy (Emax > 90%, relative to 5-HT = 100%). In contrast, ipsapirone, zalospirone and buspirone displayed partial agonist activity. EC50s for agonist stimulation of [35S]GTPgammaS binding correlated well with Ki values from competition binding (r = +0.99). Among the compounds tested for antagonist activity, methiothepin and (+)butaclamol exhibited 'inverse agonist' behaviour, inhibiting basal [35S]GTPgammaS binding. The actions of 17 antipsychotic agents were investigated. Clozapine and several putatively 'atypical' antipsychotic agents, including ziprasidone, quetiapine and tiospirone, exhibited partial agonist activity and marked affinity at h5-HT1A receptors, similar to their affinity at hD2 dopamine receptors. In contrast, risperidone and sertindole displayed low affinity at h5-HT1A receptors and behaved as 'neutral' antagonists, inhibiting 5-HT-stimulated [35S]GTPgammaS binding. Likewise the 'typical' neuroleptics, haloperidol, pimozide, raclopride and chlorpromazine exhibited relatively low affinity and 'neutral' antagonist activity at h5-HT1A receptors with Ki values which correlated with their respective Kb values. The present data show that (i) [35S]GTPgammaS binding is an effective method to evaluate the efficacy and potency of agonists and antagonists at recombinant human 5-HT1A receptors. (ii) Like clozapine, several putatively 'atypical' antipsychotic drugs display balanced serotonin h5-HT1A/dopamine hD2 receptor affinity and partial agonist activity at h5-HT1A receptors. (iii) Several 'typical' and some putatively 'atypical

5 CFR 10.2 - Accountability systems.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 1 2014-01-01 2014-01-01 false Accountability systems. 10.2 Section 10.2 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE RULES AGENCY ACCOUNTABILITY SYSTEMS; OPM AUTHORITY TO REVIEW PERSONNEL MANAGEMENT PROGRAMS (RULE X) § 10.2 Accountability systems. The Director of...

5 CFR 10.2 - Accountability systems.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Accountability systems. 10.2 Section 10.2 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE RULES AGENCY ACCOUNTABILITY SYSTEMS; OPM AUTHORITY TO REVIEW PERSONNEL MANAGEMENT PROGRAMS (RULE X) § 10.2 Accountability systems. The Director of...

5 CFR 10.2 - Accountability systems.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 5 Administrative Personnel 1 2011-01-01 2011-01-01 false Accountability systems. 10.2 Section 10.2 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE RULES AGENCY ACCOUNTABILITY SYSTEMS; OPM AUTHORITY TO REVIEW PERSONNEL MANAGEMENT PROGRAMS (RULE X) § 10.2 Accountability systems. The Director of...

4 CFR 5.5 - Travel, transportation, and subsistence.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 4 Accounts 1 2010-01-01 2010-01-01 false Travel, transportation, and subsistence. 5.5 Section 5.5 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM COMPENSATION § 5.5 Travel, transportation, and subsistence. The provisions of chapter 57 of title 5, U.S. Code and the implementing regulations for the...

4 CFR 5.5 - Travel, transportation, and subsistence.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 4 Accounts 1 2011-01-01 2011-01-01 false Travel, transportation, and subsistence. 5.5 Section 5.5 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM COMPENSATION § 5.5 Travel, transportation, and subsistence. The provisions of chapter 57 of title 5, U.S. Code and the implementing regulations for the...

4 CFR 5.5 - Travel, transportation, and subsistence.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 4 Accounts 1 2012-01-01 2012-01-01 false Travel, transportation, and subsistence. 5.5 Section 5.5 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM COMPENSATION § 5.5 Travel, transportation, and subsistence. The provisions of chapter 57 of title 5, U.S. Code and the implementing regulations for the...

4 CFR 5.5 - Travel, transportation, and subsistence.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 4 Accounts 1 2014-01-01 2013-01-01 true Travel, transportation, and subsistence. 5.5 Section 5.5 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM COMPENSATION § 5.5 Travel, transportation, and subsistence. The provisions of chapter 57 of title 5, U.S. Code and the implementing regulations for the...

4 CFR 5.5 - Travel, transportation, and subsistence.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 4 Accounts 1 2013-01-01 2013-01-01 false Travel, transportation, and subsistence. 5.5 Section 5.5 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM COMPENSATION § 5.5 Travel, transportation, and subsistence. The provisions of chapter 57 of title 5, U.S. Code and the implementing regulations for the...

Demonstration of micro-projection enabled short-range communication system for 5G.

PubMed

Chou, Hsi-Hsir; Tsai, Cheng-Yu

2016-06-13

A liquid crystal on silicon (LCoS) based polarization modulated image (PMI) system architecture using red-, green- and blue-based light-emitting diodes (LEDs), which offers simultaneous micro-projection and high-speed data transmission at nearly a gigabit, serving as an alternative short-range communication (SRC) approach for personal communication device (PCD) application in 5G, is proposed and experimentally demonstrated. In order to make the proposed system architecture transparent to the future possible wireless data modulation format, baseband modulation schemes such as multilevel pulse amplitude modulation (M-PAM), M-ary phase shift keying modulation (M-PSK) and M-ary quadrature amplitude modulation (M-QAM) which can be further employed by more advanced multicarrier modulation schemes (such as DMT, OFDM and CAP) were used to investigate the highest possible data transmission rate of the proposed system architecture. The results demonstrated that an aggregative data transmission rate of 892 Mb/s and 900 Mb/s at a BER of 10^(-3) can be achieved by using 16-QAM baseband modulation scheme when data transmission were performed with and without micro-projection simultaneously.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed Central

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

iPhone 4s and iPhone 5s Imaging of the Eye.

PubMed

Jalil, Maaz; Ferenczy, Sandor R; Shields, Carol L

2017-01-01

To evaluate the technical feasibility of a consumer-grade cellular iPhone camera as an ocular imaging device compared to existing ophthalmic imaging equipment for documentation purposes. A comparison of iPhone 4s and 5s images was made with external facial images (macrophotography) using Nikon cameras, slit-lamp images (microphotography) using Zeiss photo slit-lamp camera, and fundus images (fundus photography) using RetCam II. In an analysis of six consecutive patients with ophthalmic conditions, both iPhones achieved documentation of external findings (macrophotography) using standard camera modality, tap to focus, and built-in flash. Both iPhones achieved documentation of anterior segment findings (microphotography) during slit-lamp examination through oculars. Both iPhones achieved fundus imaging using standard video modality with continuous iPhone illumination through an ophthalmic lens. Comparison to standard ophthalmic cameras, macrophotography and microphotography were excellent. In comparison to RetCam fundus photography, iPhone fundus photography revealed smaller field and was technically more difficult to obtain, but the quality was nearly similar to RetCam. iPhone versions 4s and 5s can provide excellent ophthalmic macrophotography and microphotography and adequate fundus photography. We believe that iPhone imaging could be most useful in settings where expensive, complicated, and cumbersome imaging equipment is unavailable.

Systems Engineering Approach and Metrics for Evaluating Network-Centric Operations for U.S. Army Battle Command

DTIC Science & Technology

2013-07-01

Systems Engineering Approach and Metrics for Evaluating Network-Centric Operations for U.S. Army Battle Command by Jock O. Grynovicki and...Battle Command Jock O. Grynovicki and Teresa A. Branscome Human Research and Engineering Directorate, ARL...NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Jock O. Grynovicki and Teresa A. Branscome 5d. PROJECT NUMBER 622716H70 5e. TASK NUMBER

Enzymes Involved in Naproxen Degradation by Planococcus sp. S5.

PubMed

Wojcieszyńska, Danuta; Domaradzka, Dorota; Hupert-Kocurek, Katarzyna; Guzik, Urszula

2016-01-01

Naproxen is a one of the most popular non-steroidal anti-inflammatory drugs (NSAIDs) entering the environment as a result of high consumption. For this reason, there is an emerging need to recognize mechanisms of its degradation and enzymes engaged in this process. Planococcus sp. S5 is a gram positive strain able to degrade naproxen in monosubstrate culture (27%). However, naproxen is not a sufficient growth substrate for this strain. In the presence of benzoate, 4-hydroxybenzoic acid, 3,4-dihydroxybenzoic acid or vanillic acid as growth substrates, the degradation of 21.5%, 71.71%, 14.75% and 8.16% of naproxen was observed respectively. It was shown that the activity of monooxygenase, hydroxyquinol 1,2-dioxygenase, protocatechuate 3,4-dioxygenase and protocatechuate 4,5-dioxyegnase in strain S5 was induced after growth of the strain with naproxen and 4-hydroxybenzoate. Moreover, in the presence of naproxen activity of gentisate 1,2-dioxygenase, enzyme engaged in 4-hydroxybenzoate metabolism, was completely inhibited. The obtained results suggest that monooxygenase and hydroxyquinol 1,2-dioxygenase are the main enzymes in naproxen degradation by Planococcus sp. S5.

Integration of multiple stimuli-sensing systems to regulate HrpS and type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Zhao, Youfu

2018-02-01

The bacterial enhancer binding protein (bEBP) HrpS is essential for Erwinia amylovora virulence by activating the type III secretion system (T3SS). However, how the hrpS gene is regulated remains poorly understood in E. amylovora. In this study, 5' rapid amplification of cDNA ends and promoter deletion analyses showed that the hrpS gene contains two promoters driven by HrpX/HrpY and the Rcs phosphorelay system, respectively. Electrophoretic mobility shift and gene expression assays demonstrated that integration host factor IHF positively regulates hrpS expression through directly binding the hrpX promoter and positively regulating hrpX/hrpY expression. Moreover, hrpX expression was down-regulated in the relA/spoT ((p)ppGpp-deficient) mutant and the dksA mutant, but up-regulated when the wild-type strain was treated with serine hydroxamate, which induced (p)ppGpp-mediated stringent response. Furthermore, the csrA mutant showed significantly reduced transcripts of major hrpS activators, including the hrpX/hrpY, rcsA and rcsB genes, indicating that CsrA is required for full hrpS expression. On the other hand, the csrB mutant exhibited up-regulation of the rcsA and rcsB genes, and hrpS expression was largely diminished in the csrB/rcsB mutant, indicating that the Rcs system is mainly responsible for the increased hrpS expression in the csrB mutant. These findings suggest that E. amylovora recruits multiple stimuli-sensing systems, including HrpX/HrpY, the Rcs phosphorelay system and the Gac-Csr system, to regulate hrpS and T3SS gene expression.

On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

PubMed

Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

2009-10-09

The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

Enamel Surface with Pit and Fissure Sealant Containing 45S5 Bioactive Glass.

PubMed

Yang, S-Y; Kwon, J-S; Kim, K-N; Kim, K-M

2016-05-01

Enamel demineralization adjacent to pit and fissure sealants leads to the formation of marginal caries, which can necessitate the replacement of existing sealants. Dental materials with bioactive glass, which releases ions that inhibit dental caries, have been studied. The purpose of this study was to evaluate the enamel surface adjacent to sealants containing 45S5 bioactive glass (BAG) under simulated microleakage between the material and the tooth in a cariogenic environment. Sealants containing 45S5BAG filler were prepared as follows: 0% 45S5BAG + 50.0% glass (BAG0 group), 12.5% 45S5BAG + 37.5% glass (BAG12.5 group), 25.0% 45S5BAG + 25.0% glass (BAG25.0 group), 37.5% 45S5BAG + 12.5% glass (BAG37.5 group), and 50.0% 45S5BAG + 0% glass (BAG50.0 group). A cured sealant disk was placed over a flat bovine enamel disk, separated by a 60-µm gap, and immersed in lactic acid solution (pH 4.0) at 37 °C for 15, 30, and 45 d. After the storage period, each enamel disk was separated from the cured sealant disk, and the enamel surface was examined with optical 3-dimensional surface profilometer, microhardness tester, and scanning electron microscopy. The results showed a significant increase in roughness and a decrease in microhardness of the enamel surface as the proportion of 45S5BAG decreased (P< 0.05). In the scanning electron microscopy images, enamel surfaces with BAG50.0 showed a smooth surface, similar to those in the control group with distilled water, even after prolonged acid storage. Additionally, an etched pattern was observed on the surface of the demineralized enamel with a decreasing proportion of 45S5BAG. Increasing the 45S5BAG filler contents of the sealants had a significant impact in preventing the demineralization of the enamel surface within microgaps between the material and the tooth when exposed to a cariogenic environment. Therefore, despite some marginal leakage, these novel sealants may be effective preventive dental materials for inhibiting

46 CFR 111.105-5 - System integrity.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false System integrity. 111.105-5 Section 111.105-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL... individual electrical installation in a hazardous location must comply specifically with Articles 500-505 of...

The 5S lean method as a tool of industrial management performances

NASA Astrophysics Data System (ADS)

Filip, F. C.; Marascu-Klein, V.

2015-11-01

Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

Predicting S2S in Deep Time Sedimentary Systems and Implications for Petroleum Systems

NASA Astrophysics Data System (ADS)

Bhattacharya, J.

2013-12-01

The source to sink concept is focused on quantification of the various components of siliciclastic sedimentary systems from initial source areas, through the dispersal system, and deposition within a number of potential ultimate sedimentary sinks. Sequence stratigraphy shows that depositional system are linked through time and show distinctively predictable 3D stratigraphic organization, which can be related to cycles of relative changes in accommodation and sediment supply. For example, erosion and formation of incised fluvial valleys generally occur during periods of falling base level with lowstand reservoir deposits favored in more basin distal settings (e.g. deepwater fans), whereas during highstands of sea level, significantly more sediment may be sequestered in the non-marine realm and more distal environments may favor deposition of slowly-deposited condensed sections, which may make excellent hydrocarbon source rocks. Only more recently have attempts been made to quantify the size and scaling relationships of the ultimate source areas on the basis of analysis of ancient depositional systems, and the use of these scaling relationships to predict the sixe of linked depositional systems along the S2S tract. The maximum size of depositional systems, such as rivers, deltas, and submarine fans, is significantly controlled by the area, relief, and climate regime of the source area, which in turn may linked to the plate tectonic and paleogeographic setting. Classic provenance studies, and more recent use of detrital zircons, provide critical information about source-areas, and may help place limits on the size and relief of a drainage basin. Provenance studies may also provide key information about rates of exhumation of source areas and the link to the tectonic setting, Examination of ancient river systems in the rock record, and especially the largest trunk rivers, which are typically within incised valleys, can also be used to estimate paleodischarge, which in

Feasibility of reducing fines in S-5 mixes.

DOT National Transportation Integrated Search

1975-01-01

The study investigated the feasibility of eliminating aggregate particulates passing the #200 and #100 sieves from a surface mix (S-5) gradation. Feasibility was to be determined on the basis of test mixtures, with particulates deleted, meeting Virgi...

U.S. Electric System Operating Data

EIA Publications

EIA provides hourly electricity operating data, including actual and forecast demand, net generation, and the power flowing between electric systems. EIA's new U.S. Electric System Operating Data tool provides nearly real-time demand data, plus analysis and visualizations of hourly, daily, and weekly electricity supply and demand on a national and regional level for all of the 66 electric system balancing authorities that make up the U.S. electric grid.

Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH

PubMed Central

Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

2013-01-01

We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G . incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G . raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377

Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

PubMed

Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

2013-01-01

We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

PubMed Central

Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

2006-01-01

As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

PubMed

Garcia, S; Kovařík, A

2013-07-01

In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

Teaching and Coaching Tennis Using System 5

ERIC Educational Resources Information Center

Helfrich, Janet

2006-01-01

The United States Professional Tennis Association (USPTA) has developed a universal language for tennis instruction entitled System 5: The Five Keys to Tennis, which is extremely easy to teach and learn and covers court positioning, strategy, and stroke selection. Many professional tennis instructors have used System 5 since its inception but…

Thermodynamic Database for the NdO(1.5)-YO(1.5)-YbO(1.5)-ScO(1.5)-ZrO2 System

NASA Technical Reports Server (NTRS)

Jacobson, Nathan S.; Copland, Evan H.; Kaufman, Larry

2001-01-01

A database for YO(1.5)-NdO(1.5)-YbO(1.5)-ScO(1.5)-ZrO2 for ThermoCalc (ThermoCalc AB, Stockholm, Sweden) has been developed. The basis of this work is the YO(1.5)-ZrO2 assessment by Y. Du, Z. Jin, and P. Huang, 'Thermodynamic Assessment of the ZrO2-YO(1.5) System'. Experimentally only the YO(1.5)-ZrO2 system has been well-studied. All other systems are only approximately known. The major simplification in this work is the treatment of each single cation unit as a component. The pure liquid oxides are taken as reference states and two term lattice stability descriptions are used for each of the components. The limited experimental phase diagrams are reproduced.

The Role of Tim50 in Chemoresistance and Oncogenesis of Breast Cancer

DTIC Science & Technology

2011-02-01

digested with Hind III and Kpn I and ligated into the pGL3 vector (Promega, Madison WI) upstream of the luciferase reporter gene. This construct was...expressing vector (HC5) or mutant p53-R273H (3 x 106) were cross-linked with 1% formaldehyde for 15 min and the reaction stopped by addition of glycine to...10 mg/ml) and treated with proteinase K (20 mg/ml). Proteins were removed by phenol – chloroform extraction and the DNA isolated by ethanol

9 CFR 102.5 - U.S. Veterinary Biological Product License.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false U.S. Veterinary Biological Product... BIOLOGICAL PRODUCTS § 102.5 U.S. Veterinary Biological Product License. (a) Authorization to produce each biological product shall be specified on a U.S. Veterinary Biological Product License, issued by the...

9 CFR 102.5 - U.S. Veterinary Biological Product License.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false U.S. Veterinary Biological Product... BIOLOGICAL PRODUCTS § 102.5 U.S. Veterinary Biological Product License. (a) Authorization to produce each biological product shall be specified on a U.S. Veterinary Biological Product License, issued by the...

Structures of (5′S)-8,5′-Cyclo-2′-deoxyguanosine Mismatched with dA or dT

PubMed Central

2012-01-01

Diastereomeric 8,5′-cyclopurine 2′-deoxynucleosides, containing a covalent bond between the deoxyribose and the purine base, are induced in DNA by ionizing radiation. They are suspected to play a role in the etiology of neurodegeneration in xeroderma pigmentosum patients. If not repaired, the S-8,5′-cyclo-2′-deoxyguanosine lesion (S-cdG) induces Pol V-dependent mutations at a frequency of 34% in Escherichia coli. Most are S-cdG → A transitions, suggesting mis-incorporation of dTTP opposite the lesion during replication bypass, although low levels of S-cdG → T transversions, arising from mis-incorporation of dATP, are also observed. We report the structures of 5′-d(GTGCXTGTTTGT)-3′·5′-d(ACAAACAYGCAC)-3′, where X denotes S-cdG and Y denotes either dA or dT, corresponding to the situation following mis-insertion of either dTTP or dATP opposite the S-cdG lesion. The S-cdG·dT mismatch pair adopts a wobble base pairing. This provides a plausible rationale for the S-cdG → A transitions. The S-cdG·dA mismatch pair differs in conformation from the dG·dA mismatch pair. For the S-cdG·dA mismatch pair, both S-cdG and dA intercalate, but no hydrogen bonding is observed between S-cdG and dA. This is consistent with the lower levels of S-cdG → T transitions in E. coli. PMID:22309170

Development of socketed foundations for S3X5.7 posts.

DOT National Transportation Integrated Search

2015-04-01

The objective of this study was to develop a socketed foundation for use with the S3x5.7 (S76x8.5) weak : post. The design focused on cylindrical, reinforced concrete foundations with a steel tube placed in the center for : use as the socket. The fou...

Centrality dependence of ψ(2S) suppression in p-Pb collisions at s N N = 5.02 $$ {\\sqrt{s}}_{\\mathrm{NN}}=5.02 $$ TeV

DOE PAGES

Adam, J.; Adamová, D.; Aggarwal, M. M.; ...

2016-06-08

The inclusive production of the ψ(2S) charmonium state was studied as a function of centrality in p-Pb collisions at the nucleon-nucleon center of mass energy √ sNN = 5.02 TeV at the CERN LHC. The measurement was performed with the ALICE detector in the center of mass rapidity ranges -4.46 < y cms < -2.96 and 2.03 < y cms < 3.53, down to zero transverse momentum, by reconstructing the ψ(2S) decay to a muon pair. The ψ(2S) production cross section σ ψ(2S) is presented as a function of the collision centrality, which is estimated through the energy deposited inmore » forward rapidity calorimeters. The relative strength of nuclear effects on the ψ(2S) and on the corresponding 1S charmonium state J/ψ is then studied by means of the double ratio of cross sections [σ ψ(2S) /σ J/ψ] pPb /[σ ψ(2S) /σ J/ψ] pp between p-Pb and pp collisions, and by the values of the nuclear modification factors for the two charmonium states. The results show a large suppression of ψ(2S) production relative to the J/ψ at backward (negative) rapidity, corresponding to the flight direction of the Pb-nucleus, while at forward (positive) rapidity the suppressions of the two states are comparable. Finally, comparisons to results from lower energy experiments and to available theoretical models are presented.« less

The Sixth Spectrum of Iridium (Ir VI): Determination of the 5d4, 5d36s and 5d36p Configurations

NASA Astrophysics Data System (ADS)

Azarov, V. I.; Gayasov, R. R.; Gayasov, R. R.; Joshi, Y. N.; Churilov, S. S.

The spectrum of five times ionized iridium, Ir VI, was investigated in the 420-1520 Å wavelength region. The analysis has led to the determination of the 5d4, 5d36s and 5d36p configurations. Thirty of thirty four theoretically possible 5d4 levels, 27 of 38 possible 5d36s levels and 96 of 110 possible 5d36p levels have been established. The levels are based on 711 classified spectral lines. The level structure of the configurations has been theoretically interpreted using the orthogonal operators technique. The energy parameters have been determined by a least squares fit to the observed levels. Calculated energy values and LS-compositions, obtained from the fitted parameter values are given.

Cytotoxicity of 45S5 bioglass paste used for dentine hypersensitivity treatment.

PubMed

Bakry, Ahmed Samir; Tamura, Yukihiko; Otsuki, Masayuki; Kasugai, Shohei; Ohya, Keiichi; Tagami, Junji

2011-09-01

45S5 bioglass mixed with 50% phosphoric acid has been suggested to treat dentine hypersensitivity and incipient enamel caries. This study is going to evaluate the biocompatibility of using the aforementioned technique with the rat pulpal cells. The relative cytotoxicity of 45S5 bioglass on rat dental pulp cells was compared to the cytotoxicity of a temporary filling material (Caviton; GC, Japan), Type 1 glass ionomer cement (Fuji I; GC, Tokyo, Japan) and commercial desensitising agent (SuperSeal; Phoenix Dental, Fenton, MI, USA) using a transwell insert model. Cell viability was measured by means of a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The number of viable cell counts were compared using one way ANOVA (p<0.05). The morphological alterations of the pulp cells were observed directly by phase contrast microscope. The results of this study indicated that cell viability recorded by the 45S5 bioglass paste group did not differ significantly from those of the Caviton, glass ionomer or superseal, moreover pulpal cells microscopic analysis revealed that 45S5 bioglass elicited minimal toxic effect. 45S5 bioglass paste can serve as a biocompatible material that can potentially be used safely on dentine. Copyright © 2011 Elsevier Ltd. All rights reserved.

iPhone 4s and iPhone 5s Imaging of the Eye

PubMed Central

Jalil, Maaz; Ferenczy, Sandor R.; Shields, Carol L.

2017-01-01

Background/Aims To evaluate the technical feasibility of a consumer-grade cellular iPhone camera as an ocular imaging device compared to existing ophthalmic imaging equipment for documentation purposes. Methods A comparison of iPhone 4s and 5s images was made with external facial images (macrophotography) using Nikon cameras, slit-lamp images (microphotography) using Zeiss photo slit-lamp camera, and fundus images (fundus photography) using RetCam II. Results In an analysis of six consecutive patients with ophthalmic conditions, both iPhones achieved documentation of external findings (macrophotography) using standard camera modality, tap to focus, and built-in flash. Both iPhones achieved documentation of anterior segment findings (microphotography) during slit-lamp examination through oculars. Both iPhones achieved fundus imaging using standard video modality with continuous iPhone illumination through an ophthalmic lens. Comparison to standard ophthalmic cameras, macrophotography and microphotography were excellent. In comparison to RetCam fundus photography, iPhone fundus photography revealed smaller field and was technically more difficult to obtain, but the quality was nearly similar to RetCam. Conclusions iPhone versions 4s and 5s can provide excellent ophthalmic macrophotography and microphotography and adequate fundus photography. We believe that iPhone imaging could be most useful in settings where expensive, complicated, and cumbersome imaging equipment is unavailable. PMID:28275604

Comparison of the King’s and MiToS staging systems for ALS

PubMed Central

Fang, Ton; Al Khleifat, Ahmad; Stahl, Daniel R; Lazo La Torre, Claudia; Murphy, Caroline; Young, Carolyn; Shaw, Pamela J; Leigh, P Nigel; Al-Chalabi, Ammar

2017-01-01

Abstract Objective: To investigate and compare two ALS staging systems, King’s clinical staging and Milano-Torino (MiToS) functional staging, using data from the LiCALS phase III clinical trial (EudraCT 2008-006891-31). Methods: Disease stage was derived retrospectively for each system from the ALS Functional Rating Scale-Revised subscores using standard methods. The two staging methods were then compared for timing of stages using box plots, correspondence using chi-square tests, agreement using a linearly weighted kappa coefficient and concordance using Spearman’s rank correlation. Results: For both systems, progressively higher stages occurred at progressively later proportions of the disease course, but the distribution differed between the two methods. King’s stage 3 corresponded to MiToS stage 1 most frequently, with earlier King’s stages 1 and 2 largely corresponding to MiToS stage 0 or 1. The Spearman correlation was 0.54. There was fair agreement between the two systems with kappa coefficient of 0.21. Conclusion: The distribution of timings shows that the two systems are complementary, with King’s staging showing greatest resolution in early to mid-disease corresponding to clinical or disease burden, and MiToS staging having higher resolution for late disease, corresponding to functional involvement. We therefore propose using both staging systems when describing ALS. PMID:28054828

Optimization study of small-scale solar membrane distillation desalination systems (s-SMDDS).

PubMed

Chang, Hsuan; Chang, Cheng-Liang; Hung, Chen-Yu; Cheng, Tung-Wen; Ho, Chii-Dong

2014-11-24

Membrane distillation (MD), which can utilize low-grade thermal energy, has been extensively studied for desalination. By incorporating solar thermal energy, the solar membrane distillation desalination system (SMDDS) is a potential technology for resolving energy and water resource problems. Small-scale SMDDS (s-SMDDS) is an attractive and viable option for the production of fresh water for small communities in remote arid areas. The minimum cost design and operation of s-SMDDS are determined by a systematic method, which involves a pseudo-steady-state approach for equipment sizing and dynamic optimization using overall system mathematical models. Two s-SMDDS employing an air gap membrane distillation module with membrane areas of 11.5 m(2) and 23 m(2) are analyzed. The lowest water production costs are $5.92/m(3) and $5.16/m(3) for water production rates of 500 kg/day and 1000 kg/day, respectively. For these two optimal cases, the performance ratios are 0.85 and 0.91; the recovery ratios are 4.07% and 4.57%. The effect of membrane characteristics on the production cost is investigated. For the commercial membrane employed in this study, the increase of the membrane mass transfer coefficient up to two times is beneficial for cost reduction.

Optimization Study of Small-Scale Solar Membrane Distillation Desalination Systems (s-SMDDS)

PubMed Central

Chang, Hsuan; Chang, Cheng-Liang; Hung, Chen-Yu; Cheng, Tung-Wen; Ho, Chii-Dong

2014-01-01

Membrane distillation (MD), which can utilize low-grade thermal energy, has been extensively studied for desalination. By incorporating solar thermal energy, the solar membrane distillation desalination system (SMDDS) is a potential technology for resolving energy and water resource problems. Small-scale SMDDS (s-SMDDS) is an attractive and viable option for the production of fresh water for small communities in remote arid areas. The minimum cost design and operation of s-SMDDS are determined by a systematic method, which involves a pseudo-steady-state approach for equipment sizing and dynamic optimization using overall system mathematical models. Two s-SMDDS employing an air gap membrane distillation module with membrane areas of 11.5 m2 and 23 m2 are analyzed. The lowest water production costs are $5.92/m3 and $5.16/m3 for water production rates of 500 kg/day and 1000 kg/day, respectively. For these two optimal cases, the performance ratios are 0.85 and 0.91; the recovery ratios are 4.07% and 4.57%. The effect of membrane characteristics on the production cost is investigated. For the commercial membrane employed in this study, the increase of the membrane mass transfer coefficient up to two times is beneficial for cost reduction. PMID:25421065

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Problems with the Small Business Administration’s Merit Appraisal and Compensation System.

DTIC Science & Technology

1981-09-21

TAD-AI07 181 GENERAL ACCOUNTING OFFICE WASHINGTON DC FEDERAL PERS-ETC F/6 5/9 PROBLEMS WITH THE SMALL BUSINESS ADMINISTRATION’S MERIT APPRAIS--ETC(U...Adninistrator, Small Business Administration Dear Mr. Car D Subjec::/ Problems with the Small Business Administra- tjon’s Merit Appraisal and Compensation...System, (rLP68 8i 71). We reviewed the Small Business Administration’s (SBA’s) performance appraisal/merit pay program as part of our review of

Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

PubMed

Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

2017-04-15

Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

Optimization of the thermodynamic properties and phase diagrams of P2O5-containing systems

NASA Astrophysics Data System (ADS)

Hudon, Pierre; Jung, In-Ho

2014-05-01

P2O5 is an important oxide component in the late stage products of numerous igneous rocks such as granites and pegmatites. Typically, P2O5 combines with CaO and crystallizes in the form of apatite, while in volatile-free conditions, Ca-whitlockite is formed. In spite of their interest, the thermodynamic properties and phase diagrams of P2O5-containg systems are not well known yet. In the case of the pure P2O5 for example, no experimental thermodynamic data are available for the liquid and the O and O' solid phases. As a result, we re-evaluated all the thermodynamic and phase diagram data of the P2O5 unary system [1]. Optimization of the thermodynamic properties and phase diagrams of the binary P2O5 systems was then performed including the Li2O-, Na2O-, MgO-, CaO-, BaO-, MnO-, FeO-, Fe2O3-, ZnO-, Al2O3-, and SiO2-P2O5 [2] systems. All available thermodynamic and phase equilibrium data were simultaneously reproduced in order to obtain a set of model equations for the Gibbs energies of all phases as functions of temperature and composition. In particular, the Gibbs energy of the liquid solution was described using the Modified Quasichemical Model [3-5] implemented in the FactSage software [6]. Thermodynamic modeling of the Li2O-Na2O-K2O-MgO-CaO-FeO-Fe2O3-Al2O3-SiO2 system, which include many granite-forming minerals such as nepheline, leucite, pyroxene, melilite, feldspar and spinel is currently in progress. [1] Jung, I.-H., Hudon, P. (2012) Thermodynamic assessment of P2O5. J. Am. Ceram. Soc., 95 (11), 3665-3672. [2] Rahman, M., Hudon, P. and Jung, I.-H. (2013) A coupled experimental study and thermodynamic modeling of the SiO2-P2O5 system. Metall. Mater. Trans. B, 44 (4), 837-852. [3] Pelton, A.D. and Blander, M. (1984) Computer-assisted analysis of the thermodynamic properties and phase diagrams of slags. Proc. AIME Symp. Metall. Slags Fluxes, TMS-AIME, 281-294. [4] Pelton, A.D. and Blander, M. (1986) Thermodynamic analysis of ordered liquid solutions by a modified

Structural, Electrical and Magnetic Properties in the System {Na}_{0.5} {CoO}_{3} Na 0.5 CoO 3

NASA Astrophysics Data System (ADS)

Estrada Rodriguez, C. A.; Pimentel, J. L.; Turatti, A. M.; Lopes, L. F.; Lopes, R. F.; Parra Vargas, C. A.

2018-03-01

The present study reports the structural, magnetic and electrical properties of the Na_{0.5}CoO3 system produced by the conventional solid state reaction method. The X-ray diffraction analysis allows to infer that the compound crystallizes in a monoclinic system with spatial group it{C2/m} and network parameters: a = 5.55 (8) Å, b = 4.87 (3) Å y c = 2.85 (8) Å. It is found that the mean grain size of the stoichiometric of system amounts approximately to 76 nm. Below 40 K, an antiferromagnetic behavior with {T}_{N }≈ 40 K was observed, while in the region between 80 and 190 K the system obeys the law of Curie-Weiss, and the effective magnetic moment was determined experimentally of 5.62{μ }B, indicating a high spin configuration for the Co^{2+ }ion ( S = 3/2) in the fundamental state 4T_{1g}. The system shows cluster spin glass properties with low temperatures, the temperature of magnetic moment freezing from ˜ 40 K. The behavior of the resistivity under absence of magnetic field and the presence of an insulating state between two different metallic states was observed. The metal-insulator transition occurred at two temperatures, the first around 170 K, and the second around 40 K, the latter in accordance with the magnetic transition temperature.

46 CFR 58.60-5 - Industrial systems: Locations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false Industrial systems: Locations. 58.60-5 Section 58.60-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND RELATED SYSTEMS Industrial Systems and Components on Mobile Offshore Drilling Units (MODU...

46 CFR 58.60-5 - Industrial systems: Locations.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 46 Shipping 2 2014-10-01 2014-10-01 false Industrial systems: Locations. 58.60-5 Section 58.60-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND RELATED SYSTEMS Industrial Systems and Components on Mobile Offshore Drilling Units (MODU...

46 CFR 58.60-5 - Industrial systems: Locations.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 46 Shipping 2 2012-10-01 2012-10-01 false Industrial systems: Locations. 58.60-5 Section 58.60-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND RELATED SYSTEMS Industrial Systems and Components on Mobile Offshore Drilling Units (MODU...

46 CFR 58.60-5 - Industrial systems: Locations.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 2 2011-10-01 2011-10-01 false Industrial systems: Locations. 58.60-5 Section 58.60-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND RELATED SYSTEMS Industrial Systems and Components on Mobile Offshore Drilling Units (MODU...

46 CFR 58.60-5 - Industrial systems: Locations.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 46 Shipping 2 2013-10-01 2013-10-01 false Industrial systems: Locations. 58.60-5 Section 58.60-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND RELATED SYSTEMS Industrial Systems and Components on Mobile Offshore Drilling Units (MODU...