Sample records for s6 ribosomal protein

  1. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly,more » cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.« less

  2. Ribosomal protein S6 kinase 1 signaling regulates mammalian lifespan

    PubMed Central

    Selman, Colin; Tullet, Jennifer M.A.; Wieser, Daniela; Irvine, Elaine; Lingard, Steven J.; Choudhury, Agharul I.; Claret, Marc; Al-Qassab, Hind; Carmignac, Danielle; Ramadani, Faruk; Woods, Angela; Robinson, Iain C.A.; Schuster, Eugene; Batterham, Rachel L.; Kozma, Sara C.; Thomas, George; Carling, David; Okkenhaug, Klaus; Thornton, Janet M.; Partridge, Linda; Gems, David; Withers, Dominic J.

    2016-01-01

    Caloric restriction (CR) protects against aging and disease but the mechanisms by which this affects mammalian lifespan are unclear. We show in mice that deletion of the nutrient-responsive mTOR (mammalian target of rapamycin) signaling pathway component ribosomal S6 protein kinase 1 (S6K1) led to increased lifespan and resistance to age-related pathologies such as bone, immune and motor dysfunction and loss of insulin sensitivity. Deletion of S6K1 induced gene expression patterns similar to those seen in CR or with pharmacological activation of adenosine monophosphate (AMP)-activated protein kinase (AMPK), a conserved regulator of the metabolic response to CR. Our results demonstrate that S6K1 influences healthy mammalian lifespan, and suggest therapeutic manipulation of S6K1 and AMPK might mimic CR and provide broad protection against diseases of aging. PMID:19797661

  3. Synaptic Activation of Ribosomal Protein S6 Phosphorylation Occurs Locally in Activated Dendritic Domains

    ERIC Educational Resources Information Center

    Pirbhoy, Patricia Salgado; Farris, Shannon; Steward, Oswald

    2016-01-01

    Previous studies have shown that induction of long-term potentiation (LTP) induces phosphorylation of ribosomal protein S6 (rpS6) in postsynaptic neurons, but the functional significance of rpS6 phosphorylation is poorly understood. Here, we show that synaptic stimulation that induces perforant path LTP triggers phosphorylation of rpS6 (p-rpS6)…

  4. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6

    PubMed Central

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A.; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5′ untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5′ terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase. PMID:27877176

  5. The plastid ribosomal proteins. Identification of all the proteins in the 30 S subunit of an organelle ribosome (chloroplast).

    PubMed

    Yamaguchi, K; von Knoblauch, K; Subramanian, A R

    2000-09-15

    Identification of all the protein components of a plastid (chloroplast) ribosomal 30 S subunit has been achieved, using two-dimensional gel electropholesis, high performance liquid chromatography purification, N-terminal sequencing, polymerase chain reaction-based screening of cDNA library, nucleotide sequencing, and mass spectrometry (electrospray ionization, matrix-assisted laser desorption/ionization time-of-flight, and reversed-phase HPLC coupled with electrospray ionization mass spectrometry). 25 proteins were identified, of which 21 are orthologues of all Escherichia coli 30 S ribosomal proteins (S1-S21), and 4 are plastid-specific ribosomal proteins (PSRPs) that have no homologues in the mitochondrial, archaebacterial, or cytosolic ribosomal protein sequences in data bases. 12 of the 25 plastid 30 S ribosomal proteins (PRPs) are encoded in the plastid genome, whereas the remaining 13 are encoded by the nuclear genome. Post-translational transit peptide cleavage sites for the maturation of the 13 cytosolically synthesized PRPs, and post-translational N-terminal processing in the maturation of the 12 plastid synthesized PRPs are described. Post-translational modifications in several PRPs were observed: alpha-N-acetylation of S9, N-terminal processings leading to five mature forms of S6 and two mature forms of S10, C-terminal and/or internal modifications in S1, S14, S18, and S19, leading to two distinct forms differing in mass and/or charge (the corresponding modifications are not observed in E. coli). The four PSRPs in spinach plastid 30 S ribosomal subunit (PSRP-1, 26.8 kDa, pI 6.2; PSRP-2, 21.7 kDa, pI 5.0; PSRP-3, 13.8 kDa, pI 4.9; PSRP-4, 5.2 kDa, pI 11.8) comprise 16% (67.6 kDa) of the total protein mass of the 30 S subunit (429.3 kDa). PSRP-1 and PSRP-3 show sequence similarities with hypothetical photosynthetic bacterial proteins, indicating their possible origins in photosynthetic bacteria. We propose the hypothesis that PSRPs form a "plastid

  6. Stimulation of skeletal muscle myofibrillar protein synthesis, p70 S6 kinase phosphorylation, and ribosomal protein S6 phosphorylation by inhibition of myostatin in mature mice.

    PubMed

    Welle, Stephen; Burgess, Kerri; Mehta, Sangeeta

    2009-03-01

    Knocking out myostatin activity during development increases the rate of muscle protein synthesis. The present study was done to determine whether postdevelopmental loss of myostatin activity stimulates myofibrillar protein synthesis and the phosphorylation of some of the proteins involved in regulation of protein synthesis rate. Myostatin activity was inhibited for 4 days, in 4- to 5-mo-old male mice, with injections of an anti-myostatin antibody (JA16). The mean myofibrillar synthesis rate increased 19% (P < 0.01) relative to the mean rate in saline-treated mice, as determined by incorporation of deuterium-labeled phenylalanine. JA16 increased phosphorylation of p70 S6 kinase (S6K) and ribosomal protein S6 (rpS6) 1.9-fold (P < 0.05). It did not affect phosphorylation of eukaryotic initiation factor 4E-binding protein-1 or Akt. Microarrays and real-time PCR analyses indicated that JA16 administration did not selectively enrich levels of mRNAs encoding myofibrillar proteins, ribosomal proteins, or translation initiation and elongation factors. Rapamycin treatment did not affect the rate of myofibrillar protein synthesis whether or not the mice received JA16 injections, although it eliminated the phosphorylation of S6K and rpS6. We conclude that the normal level of myostatin activity in mature muscle is sufficient to inhibit myofibrillar synthesis rate and phosphorylation of S6K and rpS6. Reversal of the inhibition of myofibrillar synthesis with an anti-myostatin antibody is not dependent on mTOR activation.

  7. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    PubMed

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  8. Drosophila homolog of the human S6 ribosomal protein is required for tumor suppression in the hematopoietic system.

    PubMed Central

    Watson, K L; Konrad, K D; Woods, D F; Bryant, P J

    1992-01-01

    The tumor suppressor gene lethal(1)aberrant immune response 8 (air8) of Drosophila melanogaster encodes a homolog of the human S6 ribosomal protein. P element insertions that prevent expression of this gene cause overgrowth of the lymph glands (the hematopoietic organs), abnormal blood cell differentiation, and melanotic tumor formation. They also cause delayed development, inhibit growth of most of the larval organs, and lead to larval lethality. Mitotic recombination experiments indicate that the normal S6 gene is required for clone survival in the germ line and imaginal discs. The S6 gene produces a 1.1-kilobase transcript that is abundant throughout development in wild-type animals and in revertants derived from the insertional mutants but is barely detectable in the mutant larvae. cDNAs corresponding to this transcript show a 248-amino acid open reading frame with 75.4% identity and 94.8% similarity to both human and rat S6 ribosomal protein sequences. The results reveal a regulatory function of this ribosomal protein in the hematopoietic system of Drosophila that may be related to its developmentally regulated phosphorylation. Images PMID:1454811

  9. Phosphorylation of ribosomal protein S6 mediates compensatory renal hypertrophy

    PubMed Central

    Xu, Jinxian; Chen, Jianchun; Dong, Zheng; Meyuhas, Oded; Chen, Jian-Kang

    2014-01-01

    The molecular mechanism underlying renal hypertrophy and progressive nephron damage remains poorly understood. Here we generated congenic ribosomal protein S6 (rpS6) knockin mice expressing non-phosphorylatable rpS6 and found that uninephrectomy-induced renal hypertrophy was significantly blunted in these knockin mice. Uninephrectomy-induced increases in cyclin D1 and decreases in cyclin E in the remaining kidney were attenuated in the knockin mice compared to their wild-type littermates. Uninephrectomy induced rpS6 phosphorylation in the wild type mice; however, no rpS6 phosphorylation was detected in uninephrectomized or sham-operated knockin mice. Nonetheless, uninephrectomy stimulated comparable 4E-BP1 phosphorylation in both knockin and wild type mice, indicating that mTORC1 was still activated in the knockin mice. Moreover, the mTORC1 inhibitor rapamycin prevented both rpS6 and 4E-BP1 phosphorylation, significantly blunted uninephrectomy-induced renal hypertrophy in wild type mice, but did not prevent residual renal hypertrophy despite inhibiting 4E-BP1 phosphorylation in uninephrectomized knockin mice. Thus, both genetic and pharmacological approaches unequivocally demonstrate that phosphorylated rpS6 is a downstream effector of the mTORC1-S6K1 signaling pathway mediating renal hypertrophy. Hence, rpS6 phosphorylation facilitates the increase in cyclin D1 and decrease in cyclin E1 that underlie the hypertrophic nature of uninephrectomy-induced kidney growth. PMID:25229342

  10. Protein-protein interactions within late pre-40S ribosomes.

    PubMed

    Campbell, Melody G; Karbstein, Katrin

    2011-01-20

    Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  11. Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

    PubMed

    Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

    1979-01-01

    The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

  12. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    PubMed

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  13. Protein-Protein Interactions within Late Pre-40S Ribosomes

    PubMed Central

    Campbell, Melody G.; Karbstein, Katrin

    2011-01-01

    Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps. PMID:21283762

  14. Endotoxicosis induced by Coxiella burnetii lipopolysaccharide stimulates a ribosomal protein S6 kinase: some properties of the partially purified enzyme.

    PubMed Central

    Picking, W D; Hackstadt, T; Paretsky, D

    1989-01-01

    Guinea pig endotoxicosis induced by lipopolysaccharide from Coxiella burnetii Nine Mile phase I stimulates phosphorylation of liver ribosomal protein S6, with a 50% increase at 12 h postinoculation. The responsible protein kinase (S6PK) has been partially purified from liver; its activity is independent of cyclic AMP and of Ca2+ plus phosphatidyl serine or diacylglycerol. The preparation has an apparent optimum concentration of 20 mM Mg2+, while Ca2+ and Mn2+ are each inhibitory at 2 mM. The apparent Km for ATP is 30 microM with intact ribosomes. Because of the central role of phosphorylation in metabolic regulation and a purported role of phosphorylated S6 in protein synthesis, the lipopolysaccharide-induced stimulation of S6PK suggests a significant regulatory role of such enzymes in the pathobiochemistry of Q fever infection and endotoxicosis. Images PMID:2807543

  15. Molecular cloning of low-temperature-inducible ribosomal proteins from soybean.

    PubMed

    Kim, Kee-Young; Park, Seong-Whan; Chung, Young-Soo; Chung, Chung-Han; Kim, Jung-In; Lee, Jai-Heon

    2004-05-01

    Three ribosomal protein genes induced by low-temperature treatment were isolated from soybean. GmRPS13 (742 bp) encodes a 17.1 kDa protein which has 95% identity with the 40S ribosomal protein S13 of Panax ginseng (AB043974). GmRPS6 (925 bp) encodes a 28.1 kDa protein which has 94% identity with the 40S ribosomal protein S6 of Asparagus officinalis (AJ277533). GmRPL37 (494 bp) encodes a 10.7 kDa protein which has 85% identity with the 60S ribosomal protein L37 of Arabidopsis thaliana (AF370216). The expression of these ribosomal protein genes started to increase 3 d after low-temperature treatment, whereas the cold-stress protein src1 was highly induced from the first day. Such late response of these ribosomal protein genes may be due to secondary signals during cold adaptation. The induction of ribosomal protein genes might enhance the translation process or help proper ribosome functioning under low-temperature conditions.

  16. Ribosomal Protein S6 Phosphorylation Is Involved in Novelty-Induced Locomotion, Synaptic Plasticity and mRNA Translation

    PubMed Central

    Puighermanal, Emma; Biever, Anne; Pascoli, Vincent; Melser, Su; Pratlong, Marine; Cutando, Laura; Rialle, Stephanie; Severac, Dany; Boubaker-Vitre, Jihane; Meyuhas, Oded; Marsicano, Giovanni; Lüscher, Christian; Valjent, Emmanuel

    2017-01-01

    The phosphorylation of the ribosomal protein S6 (rpS6) is widely used to track neuronal activity. Although it is generally assumed that rpS6 phosphorylation has a stimulatory effect on global protein synthesis in neurons, its exact biological function remains unknown. By using a phospho-deficient rpS6 knockin mouse model, we directly tested the role of phospho-rpS6 in mRNA translation, plasticity and behavior. The analysis of multiple brain areas shows for the first time that, in neurons, phospho-rpS6 is dispensable for overall protein synthesis. Instead, we found that phospho-rpS6 controls the translation of a subset of mRNAs in a specific brain region, the nucleus accumbens (Acb), but not in the dorsal striatum. We further show that rpS6 phospho-mutant mice display altered long-term potentiation (LTP) in the Acb and enhanced novelty-induced locomotion. Collectively, our findings suggest a previously unappreciated role of phospho-rpS6 in the physiology of the Acb, through the translation of a selective subclass of mRNAs, rather than the regulation of general protein synthesis. PMID:29311811

  17. Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32

    PubMed Central

    Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto

    2011-01-01

    Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

  18. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  19. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae.

    PubMed

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine; Belyi, Yury

    2016-01-01

    The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5' untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62-K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62-K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62-K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62-K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62-K70 segment of Rps26 and the 5' untranslated region of mRNA. The data suggested a specific role of the Y62-K70 motif during translation initiation. Here, we report that single-site substitutions

  20. Sequential protein association with nascent 60S ribosomal particles.

    PubMed

    Saveanu, Cosmin; Namane, Abdelkader; Gleizes, Pierre-Emmanuel; Lebreton, Alice; Rousselle, Jean-Claude; Noaillac-Depeyre, Jacqueline; Gas, Nicole; Jacquier, Alain; Fromont-Racine, Micheline

    2003-07-01

    Ribosome biogenesis in eukaryotes depends on the coordinated action of ribosomal and nonribosomal proteins that guide the assembly of preribosomal particles. These intermediate particles follow a maturation pathway in which important changes in their protein composition occur. The mechanisms involved in the coordinated assembly of the ribosomal particles are poorly understood. We show here that the association of preribosomal factors with pre-60S complexes depends on the presence of earlier factors, a phenomenon essential for ribosome biogenesis. The analysis of the composition of purified preribosomal complexes blocked in maturation at specific steps allowed us to propose a model of sequential protein association with, and dissociation from, early pre-60S complexes for several preribosomal factors such as Mak11, Ssf1, Rlp24, Nog1, and Nog2. The presence of either Ssf1 or Nog2 in complexes that contain the 27SB pre-rRNA defines novel, distinct pre-60S particles that contain the same pre-rRNA intermediates and that differ only by the presence or absence of specific proteins. Physical and functional interactions between Rlp24 and Nog1 revealed that the assembly steps are, at least in part, mediated by direct protein-protein interactions.

  1. Ribosomal RNA and ribosomal proteins in corynebacteria.

    PubMed

    Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica

    2003-09-04

    Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.

  2. [C-terminal fragment of ribosomal protein S15 is located at the decoding site of the human ribosome].

    PubMed

    Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'iaminova, A G; Karpova, G G

    2008-01-01

    Protein S15 is a characteristic component of the mammalian 80S ribosome that neighbors mRNA codon at the decoding site and the downstream triplets. In this study we determined S15 protein fragments located close to mRNA positions +4 to +12 with respect to the first nucleotide of the P site codon on the human ribosome. For cross-linking to ribosomal protein S15, a set of mRNA was used that contained triplet UUU/UUC at the 5'-termini and a perfluorophenyl azide-modified uridine in position 3' of this triplet. The locations of mRNA analogues on the ribosome were governed by tRNAPhe cognate to the UUU/UUC triplet targeted to the P site. Cross-linked S15 protein was isolated from the irradiated with mild UV light complexes of 80S ribosomes with tRNAPhe and mRNA analogues with subsequent cleavage with CNBr that splits polypeptide chain after methionines. Analysis of modified oligopeptides resulted from the cleavage revealed that in all cases cross-linking site was located in C-terminal fragment 111-145 of protein S15 indicating that this fragment is involved in formation of decoding site of the eukaryotic ribosome.

  3. Cryo-EM structure of the spinach chloroplast ribosome reveals the location of plastid-specific ribosomal proteins and extensions

    PubMed Central

    Graf, Michael; Arenz, Stefan; Huter, Paul; Dönhöfer, Alexandra; Nováček, Jiří

    2017-01-01

    Abstract Ribosomes are the protein synthesizing machines of the cell. Recent advances in cryo-EM have led to the determination of structures from a variety of species, including bacterial 70S and eukaryotic 80S ribosomes as well as mitoribosomes from eukaryotic mitochondria, however, to date high resolution structures of plastid 70S ribosomes have been lacking. Here we present a cryo-EM structure of the spinach chloroplast 70S ribosome, with an average resolution of 5.4 Å for the small 30S subunit and 3.6 Å for the large 50S ribosomal subunit. The structure reveals the location of the plastid-specific ribosomal proteins (RPs) PSRP1, PSRP4, PSRP5 and PSRP6 as well as the numerous plastid-specific extensions of the RPs. We discover many features by which the plastid-specific extensions stabilize the ribosome via establishing additional interactions with surrounding ribosomal RNA and RPs. Moreover, we identify a large conglomerate of plastid-specific protein mass adjacent to the tunnel exit site that could facilitate interaction of the chloroplast ribosome with the thylakoid membrane and the protein-targeting machinery. Comparing the Escherichia coli 70S ribosome with that of the spinach chloroplast ribosome provides detailed insight into the co-evolution of RP and rRNA. PMID:27986857

  4. Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae.

    PubMed

    Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

    2018-05-18

    The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits.

  5. Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae

    PubMed Central

    Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

    2018-01-01

    Abstract The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits. PMID:29788267

  6. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  7. Ribosomal proteins: functions beyond the ribosome.

    PubMed

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-04-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

  8. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    PubMed

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  9. Folding behavior of ribosomal protein S6 studied by modified Go¯ -like model

    NASA Astrophysics Data System (ADS)

    Wu, L.; Zhang, J.; Wang, J.; Li, W. F.; Wang, W.

    2007-03-01

    Recent experimental and theoretical studies suggest that, although topology is the determinant factor in protein folding, especially for small single-domain proteins, energetic factors also play an important role in the folding process. The ribosomal protein S6 has been subjected to intensive studies. A radical change of the transition state in its circular permutants has been observed, which is believed to be caused by a biased distribution of contact energies. Since the simplistic topology-only Gō -like model is not able to reproduce such an observation, we modify the model by introducing variable contact energies between residues based on their physicochemical properties. The modified Gō -like model can successfully reproduce the Φ -value distributions, folding nucleus, and folding pathways of both the wild-type and circular permutants of S6. Furthermore, by comparing the results of the modified and the simplistic models, we find that the hydrophobic effect constructs the major force that balances the loop entropies. This may indicate that nature maintains the folding cooperativity of this protein by carefully arranging the location of hydrophobic residues in the sequence. Our study reveals a strategy or mechanism used by nature to get out of the dilemma when the native structure, possibly required by biological function, conflicts with folding cooperativity. Finally, the possible relationship between such a design of nature and amyloidosis is also discussed.

  10. Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night.

    PubMed

    Turkina, Maria V; Klang Årstrand, Hanna; Vener, Alexander V

    2011-01-01

    Protein synthesis in plants is characterized by increase in the translation rates for numerous proteins and central metabolic enzymes during the day phase of the photoperiod. The detailed molecular mechanisms of this diurnal regulation are unknown, while eukaryotic protein translation is mainly controlled at the level of ribosomal initiation complexes, which also involves multiple events of protein phosphorylation. We characterized the extent of protein phosphorylation in cytosolic ribosomes isolated from leaves of the model plant Arabidopsis thaliana harvested during day or night. Proteomic analyses of preparations corresponding to both phases of the photoperiod detected phosphorylation at eight serine residues in the C-termini of six ribosomal proteins: S2-3, S6-1, S6-2, P0-2, P1 and L29-1. This included previously unknown phosphorylation of the 40S ribosomal protein S6 at Ser-231. Relative quantification of the phosphorylated peptides using stable isotope labeling and mass spectrometry revealed a 2.2 times increase in the day/night phosphorylation ratio at this site. Phosphorylation of the S6-1 and S6-2 variants of the same protein at Ser-240 increased by the factors of 4.2 and 1.8, respectively. The 1.6 increase in phosphorylation during the day was also found at Ser-58 of the 60S ribosomal protein L29-1. It is suggested that differential phosphorylation of the ribosomal proteins S6-1, S6-2 and L29-1 may contribute to modulation of the diurnal protein synthesis in plants.

  11. Mice deficient in ribosomal protein S6 phosphorylation suffer from muscle weakness that reflects a growth defect and energy deficit.

    PubMed

    Ruvinsky, Igor; Katz, Maximiliano; Dreazen, Avigail; Gielchinsky, Yuval; Saada, Ann; Freedman, Nanette; Mishani, Eyal; Zimmerman, Gabriel; Kasir, Judith; Meyuhas, Oded

    2009-05-19

    Mice, whose ribosomal protein S6 cannot be phosphorylated due to replacement of all five phosphorylatable serine residues by alanines (rpS6(P-/-)), are viable and fertile. However, phenotypic characterization of these mice and embryo fibroblasts derived from them, has established the role of these modifications in the regulation of the size of several cell types, as well as pancreatic beta-cell function and glucose homeostasis. A relatively passive behavior of these mice has raised the possibility that they suffer from muscle weakness, which has, indeed, been confirmed by a variety of physical performance tests. A large variety of experimental methodologies, including morphometric measurements of histological preparations, high throughput proteomic analysis, positron emission tomography (PET) and numerous biochemical assays, were used in an attempt to establish the mechanism underlying the relative weakness of rpS6(P-/-) muscles. Collectively, these experiments have demonstrated that the physical inferiority appears to result from two defects: a) a decrease in total muscle mass that reflects impaired growth, rather than aberrant differentiation of myofibers, as well as a diminished abundance of contractile proteins; and b) a reduced content of ATP and phosphocreatine, two readily available energy sources. The abundance of three mitochondrial proteins has been shown to diminish in the knockin mouse. However, the apparent energy deficiency in this genotype does not result from a lower mitochondrial mass or compromised activity of enzymes of the oxidative phosphorylation, nor does it reflect a decline in insulin-dependent glucose uptake, or diminution in storage of glycogen or triacylglycerol (TG) in the muscle. This study establishes rpS6 phosphorylation as a determinant of muscle strength through its role in regulation of myofiber growth and energy content. Interestingly, a similar role has been assigned for ribosomal protein S6 kinase 1, even though it regulates

  12. [Protein kinase A inhibitor H-89 blocks polyploidization of SP600125-induced CMK cells by regulating phosphorylation of ribosomal protein S6 kinase 1].

    PubMed

    Zhao, Song; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Pu, Feifei; Ma, Dongchu

    2016-10-01

    Objective To investigate the regulatory effect of post-translation modification of ribosomal protein S6 kinase 1 (S6K1) on the polyploidization of megakaryocytes. Methods SP600125, a c-Jun N-terminal kinase (JNK) inhibitor, and H-89, a cAMP-dependent protein kinase (PKA) inhibitor, were used to treat CMK cells separately or in combination. With propidium iodide (PI) to dye DNA in the treated cells, the relative DNA content was detected by flow cytometry, and then the DNA polyploidy was analyzed. The change of expression and phosphorylation of ribosomal protein S6 kinase 1 (S6K1), an important mammalian target of rapamycin (mTOR) downstream target molecule, was analyzed by Western blotting. Molecular docking study and kinase activity assay were performed to analyze the combination of H-89 with S6K1 and the effect of H-89 on the activity of S6K1 kinase. Results SP600125 induced CMK cell polyploidization in a time-dependent and dose-dependent manner. At the same time, it increased the phosphorylation of S6K1 at Thr421/Ser424 and decreased the phosphorylation of S6K1 at Thr389. H-89 not only blocked polyploidization, but also decreased the phosphorylation of S6K1 at Thr421/Ser424 and increased the phosphorylation of S6K1 at Thr389. Molecular docking and kinase activity assay showed that H-89 occupied the ATP binding sites of S6K1 and inhibited its activity. Noticeably, both H-89 and SP600125 inhibited the activity of PKA. Moreover, the two drugs further inhibited the activity of PKA when used together. Therefore, these data indicated that H-89 blocked the SP600125-induced polyploidization of CMK cells mainly by changing S6K1 phosphorylation state, rather than its inhibitory effect on PKA. Conclusion H-89 can block the polyploidization of SP600125-induced CMK cells by regulating S6K1 phosphorylation state.

  13. Escherichia coli Ribosomal Protein S1 Unfolds Structured mRNAs Onto the Ribosome for Active Translation Initiation

    PubMed Central

    Duval, Mélodie; Korepanov, Alexey; Fuchsbauer, Olivier; Fechter, Pierre; Haller, Andrea; Fabbretti, Attilio; Choulier, Laurence; Micura, Ronald; Klaholz, Bruno P.; Romby, Pascale; Springer, Mathias; Marzi, Stefano

    2013-01-01

    Regulation of translation initiation is well appropriate to adapt cell growth in response to stress and environmental changes. Many bacterial mRNAs adopt structures in their 5′ untranslated regions that modulate the accessibility of the 30S ribosomal subunit. Structured mRNAs interact with the 30S in a two-step process where the docking of a folded mRNA precedes an accommodation step. Here, we used a combination of experimental approaches in vitro (kinetic of mRNA unfolding and binding experiments to analyze mRNA–protein or mRNA–ribosome complexes, toeprinting assays to follow the formation of ribosomal initiation complexes) and in vivo (genetic) to monitor the action of ribosomal protein S1 on the initiation of structured and regulated mRNAs. We demonstrate that r-protein S1 endows the 30S with an RNA chaperone activity that is essential for the docking and the unfolding of structured mRNAs, and for the correct positioning of the initiation codon inside the decoding channel. The first three OB-fold domains of S1 retain all its activities (mRNA and 30S binding, RNA melting activity) on the 30S subunit. S1 is not required for all mRNAs and acts differently on mRNAs according to the signals present at their 5′ ends. This work shows that S1 confers to the ribosome dynamic properties to initiate translation of a large set of mRNAs with diverse structural features. PMID:24339747

  14. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    PubMed

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  15. Translational control of ribosomal protein S15.

    PubMed

    Portier, C; Philippe, C; Dondon, L; Grunberg-Manago, M; Ebel, J P; Ehresmann, B; Ehresmann, C

    1990-08-27

    The expression of ribosomal protein S15 is shown to be translationally and negatively autocontrolled using a fusion within a reporter gene. Isolation and characterization of several deregulated mutants indicate that the regulatory site (the translational operator site) overlaps the ribosome loading site of the S15 messenger. In this region, three domains, each exhibiting a stem-loop structure, were determined using chemical and enzymatic probes. The most downstream hairpin carries the Shine-Dalgarno sequence and the initiation codon. Genetic and structural data derived from mutants constructed by site-directed mutagenesis show that the operator is a dynamic structure, two domains of which can form a pseudoknot. Binding of S15 to these two domains suggests that the pseudoknot could be stabilized by S15. A model is presented in which two alternative structures would explain the molecular basis of the S15 autocontrol.

  16. Pseudoknot and translational control in the expression of the S15 ribosomal protein.

    PubMed

    Bénard, L; Philippe, C; Ehresmann, B; Ehresmann, C; Portier, C

    1996-01-01

    Translational autocontrol of the expression of the ribosomal protein S15 proceeds through the transitory formation of a pseudoknot. A synopsis of the known data is used to propose a molecular model of the mechanism involved and for the role of the pseudoknot. This latter structure is able to recruit 30S ribosomal subunits to initiate translation, but also to bind S15 and to stop translation by trapping the ribosome on its loading site. Information on the S15 protein recognition of the messenger RNA site was deduced from mutational analyses and chemical probing. A comparison of this messenger site with the S15 ribosomal binding site was conducted by analysing hydroxyl radical footprintings of these two sites. The existence of two subsites in 16S RNA suggests that the ribosomal protein S15 might present either two different binding sites or at least one common subsite. Clues for the presence of a common site between the messenger and 16S RNA are given which cannot rule out that recognition specificity is linked to a few other determinants. Whether these determinants are different or not remains an open question.

  17. Cholecystokinin (CCK) stimulates S6 phosphorylation and induced activation of S6 protein kinase in rat pancreatic acini

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sung, C.; Okabayashi, Y.; Williams, J.

    CCK and insulin stimulate pancreatic protein synthesis at a post transcriptional step. To better understand this regulation the authors evaluated the phosphorylation state of ribosomal protein S6 and the presence of a specific S6 protein kinase in pancreatic acini from diabetic rats. Both CCK and insulin increased S6 phosphorylation by up to 400% in intact TSP-labelled acini. The phorbol ester 12-0-tetradecanoylphorbol 13-acetate also stimulated both protein synthesis and S6 phosphorlyation suggesting a role for protein kinase C in mediating the effect of CCK. By contrast, the CaS ionophore ionomycin had no effect on either parameter. Recently, insulin has been shownmore » to activate a unique S6 kinase in various cells. To test for its presence, cytosolic extracts were prepared from acini stimulated with CCK and insulin by homogenization in US -glycerophosphate buffer and assayed for the kinase using el-TSP ATP and rat pancreatic ribosomes followed by SDS-polyacrylamide gel electrophoresis. CCK and insulin both increased S6 kinase activity which required neither CaS or phospholipid. The dose response for CCk was similar to S6 phosphorlyation in the intact acini. TPA did not stimulate the S6 kinase. Thus, CCK may induce S6 phosphorylation both via C kinase and by activation of a unique S6 kinase.« less

  18. Ribosomal proteins L7 and L8 function in concert with six A3 assembly factors to propagate assembly of domains I and II of 25S rRNA in yeast 60S ribosomal subunits

    PubMed Central

    Jakovljevic, Jelena; Ohmayer, Uli; Gamalinda, Michael; Talkish, Jason; Alexander, Lisa; Linnemann, Jan; Milkereit, Philipp; Woolford, John L.

    2012-01-01

    Ribosome biogenesis is a complex multistep process that involves alternating steps of folding and processing of pre-rRNAs in concert with assembly of ribosomal proteins. Recently, there has been increased interest in the roles of ribosomal proteins in eukaryotic ribosome biogenesis in vivo, focusing primarily on their function in pre-rRNA processing. However, much less is known about participation of ribosomal proteins in the formation and rearrangement of preribosomal particles as they mature to functional subunits. We have studied ribosomal proteins L7 and L8, which are required for the same early steps in pre-rRNA processing during assembly of 60S subunits but are located in different domains within ribosomes. Depletion of either leads to defects in processing of 27SA3 to 27SB pre-rRNA and turnover of pre-rRNAs destined for large ribosomal subunits. A specific subset of proteins is diminished from these residual assembly intermediates: six assembly factors required for processing of 27SA3 pre-rRNA and four ribosomal proteins bound to domain I of 25S and 5.8S rRNAs surrounding the polypeptide exit tunnel. In addition, specific sets of ribosomal proteins are affected in each mutant: In the absence of L7, proteins bound to domain II, L6, L14, L20, and L33 are greatly diminished, while proteins L13, L15, and L36 that bind to domain I are affected in the absence of L8. Thus, L7 and L8 might establish RNP structures within assembling ribosomes necessary for the stable association and function of the A3 assembly factors and for proper assembly of the neighborhoods containing domains I and II. PMID:22893726

  19. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    PubMed

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  20. Comparative study between prokaryotes and eukaryotes by chemical iodination of ribosomal proteins.

    PubMed

    Bernabeu, C; Vázquez, D; Conde, F P

    1979-04-25

    Escherichia coli and Saccharomyces cerevisiae ribosomal proteins were chemically iodinated with 125I by chloramine T under conditions in which the proteins were denatured. The labelled proteins were subsequently separated by two-dimensional gel electrophoresis with an excess of untreated ribosomal proteins from the same species. The iodination did not change the electrophoretic mobility of the proteins as shown by the pattern of spots in the stained gel slabs and their autoradiography. The 125I radioactivity incorporated in the proteins was estimated by cutting out the gel spots from the two-dimensional electrophoresis gel slabs. The highest content of 125I was found in the ribosomal proteins L2, L11, L13, L20/S12, S4 and S9 from E. coli, and L2/L3, L4/L6/S7, L5, L19/L20, L22/S17, L29/S27, L35/L37 and S14/S15 from S. cerevisiae. Comparisons between the electrophoretic patterns of E. coli and S. cerevisiae ribosomal proteins were carried out by coelectrophoresis of labelled and unlabelled proteins from both species. E. coli ribosomal proteins L5, L11, L20, S2, S3 and S15/S16 were found to overlap with L15, L11/L16, L36/L37, S3, S10 and S33 from S. cerevisiae, respectively. Similar coelectrophoresis of E. coli 125I-labelled proteins with unlabelled rat liver and wheat germ ribosomal proteins showed the former to overlap with proteins L1, L11, L14, L16, L19, L20 and the latter with L2, L5, L6, L15, L17 from E. coli.

  1. The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits

    PubMed Central

    Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

    2016-01-01

    The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873

  2. [Family of ribosomal proteins S1 contains unique conservative domain].

    PubMed

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  3. The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits.

    PubMed

    Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

    2016-09-19

    The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Reduced Ribosomal Protein S6 Phosphorylation following Progressive Resistance Exercise in Growing Adolescent Rats

    PubMed Central

    Hellyer, Nathan J.; Nokleby, Jessica J.; Thicke, Bethany M.; Zhan, Wen-Zhi; Sieck, Gary C.; Mantilla, Carlos B.

    2011-01-01

    The purpose of the present study was to investigate moderate intensity progressive resistance exercise (PRE) in growing adolescent rats and its effect on muscle hypertrophy (defined as an increase in fiber cross-sectional area). We hypothesized that in adolescent animals moderate intensity PRE would increase: 1) fiber cross-sectional area (CSA); 2) myosin heavy chain (MyHC) content; and 3) expression and phosphorylation of cell signaling molecules involved in translational regulation, compared to age-matched sedentary controls (SED). In the PRE group, three-week old male rats were trained to climb a vertical ladder as a mode of PRE training such that by 10 weeks, all animals in the PRE group had progressed to carry an additional 80% of body weight per climb. In agreement with our hypotheses, we observed that 10 weeks of moderate PRE in adolescent animals was sufficient to increase CSA of muscle fibers and increase MyHC content. Average muscle fiber CSA increased by greater than 10% and total MyHC content increased by 35% (p<0.05) in the PRE group compared to SED animals. Concurrently, we investigated sustained changes in the expression and phosphorylation of key signaling molecules that are previously identified regulators of hypertrophy in adult animal models. Contrary to our hypotheses, expression and phosphorylation of the translational regulators mTOR and Akt were not increased in the PRE group. In addition, we observed that the ratio of phosphorylated-to-unphosphorylated ribosomal protein S6 (rpS6) was reduced over six-fold in PRE animals (p<0.05) and total rpS6 protein levels were unchanged between PRE and sedentary animals (p>0.05). We conclude that moderate intensity PRE is sufficient to induce muscle hypertrophy in adolescent animals while the signaling mechanisms associated with muscle hypertrophy may differ between growing adolescents and adults. PMID:22614147

  6. Enzymatic specificity of three ribosome-inactivating proteins against fungal ribosomes, and correlation with antifungal activity.

    PubMed

    Park, Sang-Wook; Stevens, Noah M; Vivanco, Jorge M

    2002-12-01

    Ribosome-inactivating proteins (RIPs) are enzymes that cleave a specific adenine base from the highly conserved sarcin/ricin (S/R) loop of the large ribosomal RNA, thus arresting protein synthesis at the translocation step. In the present study, we employed three RIPs to dissect the antifungal activity of RIPs as plant defense proteins. We measured the catalytic activity of RAT (the catalytic A-chain of ricin from Ricinus communis L.), saporin-S6 (from Saponaria officinalis L.), and ME (RIP from Mirabilis expansa R&P) against intact ribosomal substrates isolated from various pathogenic fungi. We further determined the enzymatic specificity of these three RIPs against fungal ribosomes, from Rhizoctonia solani Kuhn, Alternaria solani Sorauer, Trichoderma reesei Simmons and Candida albicans Berkhout, and correlated the data with antifungal activity. RAT showed the strongest toxicity against all tested fungal ribosomes, except for the ribosomes isolated from C. albicans, which were most susceptible to saporin. RAT and saporin showed higher enzymatic activity than ME against ribosomes from all of the fungal species assayed, but did not show detectable antifungal activity. In contrast, ME showed substantial inhibitory activity against fungal growth. Using N-hydroxysuccinimide-fluorescein labeling of RIPs and fluorescence microscopy, we determined that ME was targeted to the surface of fungal cells and transferred into the cells. Thus, ME caused ribosome depurination and subsequent fungal mortality. In contrast, saporin did not interact with fungal cells, correlating with its lack of antifungal activity.

  7. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    PubMed

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  8. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    NASA Astrophysics Data System (ADS)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  9. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    PubMed

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  10. Reductive alkylation of ribosomes as a probe to the topography of ribosomal proteins*

    PubMed Central

    Moore, Graham; Crichton, Robert R.

    1974-01-01

    Escherichia coli ribosomes were treated with a number of different aldehydes of various sizes in the presence of NaBH4. After incorporation of either 3H or 14C, the ribosomal proteins were separated by two-dimensional polyacrylamide-gel electrophoresis and the extent of alkylation of the lysine residues in each protein was measured. The same pattern of alkylation was observed with the four reagents used, namely formaldehyde, acetone, benzaldehyde and 3,4,5-trimethoxybenzaldehyde. Every protein in 30S and 50S subunits was modified, although there was considerable variation in the degree of alkylation of individual proteins. A topographical classification of ribosomal proteins is presented, based on the degree of exposure of lysine residues. The data indicate that every protein of the ribosome has at least one lysine residue exposed at or near the surface of the ribonucleo-protein complex. PMID:4462744

  11. [Protein S3 in the human 80S ribosome adjoins mRNA from 3'-side of the A-site codon].

    PubMed

    Molotkov, M V; Graĭfer, D M; Popugaeva, E A; Bulygin, K N; Meshchaninova, M I; Ven'iaminova, A G; Karpova, G G

    2007-01-01

    The protein environment of mRNA 3' of the A-site codon (the decoding site) in the human 80S ribosome was studied using a set of oligoribonucleotide derivatives bearing a UUU triplet at the 5'-end and a perfluoroarylazide group at one of the nucleotide residues at the 3'-end of this triplet. Analogues of mRNA were phased into the ribosome using binding at the tRNAPhe P-site, which recognizes the UUU codon. Mild UV irradiation of ribosome complexes with tRNAPhe and mRNA analogues resulted in the predominant crosslinking of the analogues with the 40S subunit components, mainly with proteins and, to a lesser extent, with rRNA. Among the 40S subunit ribosomal proteins, the S3 protein was the main target for modification in all cases. In addition, minor crosslinking with the S2 protein was observed. The crosslinking with the S3 and S2 proteins occurred both in triple complexes and in the absence of tRNA. Within triple complexes, crosslinking with S15 protein was also found, its efficiency considerably falling when the modified nucleotide was moved from positions +5 to +12 relative to the first codon nucleotide in the P-site. In some cases, crosslinking with the S30 protein was observed, it was most efficient for the derivative containing a photoreactive group at the +7 adenosine residue. The results indicate that the S3 protein in the human ribosome plays a key role in the formation of the mRNA binding site 3' of the codon in the decoding site.

  12. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    PubMed

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  13. Phosphorylation of Ribosomal Protein RPS6 Integrates Light Signals and Circadian Clock Signals

    DOE PAGES

    Enganti, Ramya; Cho, Sung Ki; Toperzer, Jody D.; ...

    2018-01-19

    The translation of mRNA into protein is tightly regulated by the light environment as well as by the circadian clock. Although changes in translational efficiency have been well documented at the level of mRNA-ribosome loading, the underlying mechanisms are unclear. The reversible phosphorylation of RIBOSOMAL PROTEIN OF THE SMALL SUBUNIT 6 (RPS6) has been known for 40 years, but the biochemical significance of this event remains unclear to this day. Here, we confirm using a clock-deficient strain of Arabidopsis thaliana that RPS6 phosphorylation (RPS6-P) is controlled by the diel light-dark cycle with a peak during the day. Strikingly, when wild-type,more » clock-enabled, seedlings that have been entrained to a light-dark cycle are placed under free-running conditions, the circadian clock drives a cycle of RPS6-P with an opposite phase, peaking during the subjective night. We show that in wild-type seedlings under a light-dark cycle, the incoherent light and clock signals are integrated by the plant to cause an oscillation in RPS6-P with a reduced amplitude with a peak during the day. Sucrose can stimulate RPS6-P, as seen when sucrose in the medium masks the light response of etiolated seedlings. However, the diel cycles of RPS6-P are observed in the presence of 1% sucrose and in its absence. Sucrose at a high concentration of 3% appears to interfere with the robust integration of light and clock signals at the level of RPS6-P. Finally, we addressed whether RPS6-P occurs uniformly in polysomes, non-polysomal ribosomes and their subunits, and non-ribosomal protein. It is the polysomal RPS6 whose phosphorylation is most highly stimulated by light and repressed by darkness. These data exemplify a striking case of contrasting biochemical regulation between clock signals and light signals. Although the physiological significance of RPS6-P remains unknown, our data provide a mechanistic basis for the future understanding of this enigmatic event.« less

  14. Phosphorylation of Ribosomal Protein RPS6 Integrates Light Signals and Circadian Clock Signals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Enganti, Ramya; Cho, Sung Ki; Toperzer, Jody D.

    The translation of mRNA into protein is tightly regulated by the light environment as well as by the circadian clock. Although changes in translational efficiency have been well documented at the level of mRNA-ribosome loading, the underlying mechanisms are unclear. The reversible phosphorylation of RIBOSOMAL PROTEIN OF THE SMALL SUBUNIT 6 (RPS6) has been known for 40 years, but the biochemical significance of this event remains unclear to this day. Here, we confirm using a clock-deficient strain of Arabidopsis thaliana that RPS6 phosphorylation (RPS6-P) is controlled by the diel light-dark cycle with a peak during the day. Strikingly, when wild-type,more » clock-enabled, seedlings that have been entrained to a light-dark cycle are placed under free-running conditions, the circadian clock drives a cycle of RPS6-P with an opposite phase, peaking during the subjective night. We show that in wild-type seedlings under a light-dark cycle, the incoherent light and clock signals are integrated by the plant to cause an oscillation in RPS6-P with a reduced amplitude with a peak during the day. Sucrose can stimulate RPS6-P, as seen when sucrose in the medium masks the light response of etiolated seedlings. However, the diel cycles of RPS6-P are observed in the presence of 1% sucrose and in its absence. Sucrose at a high concentration of 3% appears to interfere with the robust integration of light and clock signals at the level of RPS6-P. Finally, we addressed whether RPS6-P occurs uniformly in polysomes, non-polysomal ribosomes and their subunits, and non-ribosomal protein. It is the polysomal RPS6 whose phosphorylation is most highly stimulated by light and repressed by darkness. These data exemplify a striking case of contrasting biochemical regulation between clock signals and light signals. Although the physiological significance of RPS6-P remains unknown, our data provide a mechanistic basis for the future understanding of this enigmatic event.« less

  15. Phosphorylated ribosomal S6 (p-rpS6) as a post-treatment indicator of HER2 signalling targeted drug resistance.

    PubMed

    Yang-Kolodji, Gloria; Mumenthaler, Shannon M; Mehta, Arjun; Ji, Lingyun; Tripathy, Debu

    2015-01-01

    To identify clinically relevant predictive biomarkers of trastuzumab resistance. MTT, FACS assays, immunoblotting and immunocytochemistry were used to phenotypically characterize drug responses of two cell models BT474R and SKBR3R. Student's t-test and Spearman's correlation were applied for statistic analysis. The activity of a downstream effector of the HER2 pathway phosphorylated ribosomal protein S6 (p-rpS6), was suppressed by trastuzumab in the parental cell lines yet remained unchanged in the resistant cells following treatment. The level of p-rpS6 was inversely correlated to the drug induced growth inhibition of trastuzumab-resistant cells when they are treated with selected HER2 targeting drugs. p-rpS6 is a robust post-treatment indicator of HER2 pathway-targeted therapy resistance.

  16. Synaptically Driven Phosphorylation of Ribosomal Protein S6 Is Differentially Regulated at Active Synapses versus Dendrites and Cell Bodies by MAPK and PI3K/mTOR Signaling Pathways

    ERIC Educational Resources Information Center

    Pirbhoy, Patricia Salgado; Farris, Shannon; Steward, Oswald

    2017-01-01

    High-frequency stimulation of the medial perforant path triggers robust phosphorylation of ribosomal protein S6 (rpS6) in activated dendritic domains and granule cell bodies. Here we dissect the signaling pathways responsible for synaptically driven rpS6 phosphorylation in the dentate gyrus using pharmacological agents to inhibit PI3-kinase/mTOR…

  17. Reducing Ribosomal Protein S6 Kinase 1 Expression Improves Spatial Memory and Synaptic Plasticity in a Mouse Model of Alzheimer's Disease

    PubMed Central

    Caccamo, Antonella; Branca, Caterina; Talboom, Joshua S.; Shaw, Darren M.; Turner, Dharshaun; Ma, Luyao; Messina, Angela; Huang, Zebing; Wu, Jie

    2015-01-01

    Aging is the most important risk factor associated with Alzheimer's disease (AD); however, the molecular mechanisms linking aging to AD remain unclear. Suppression of the ribosomal protein S6 kinase 1 (S6K1) increases healthspan and lifespan in several organisms, from nematodes to mammals. Here we show that S6K1 expression is upregulated in the brains of AD patients. Using a mouse model of AD, we found that genetic reduction of S6K1 improved synaptic plasticity and spatial memory deficits, and reduced the accumulation of amyloid-β and tau, the two neuropathological hallmarks of AD. Mechanistically, these changes were linked to reduced translation of tau and the β-site amyloid precursor protein cleaving enzyme 1, a key enzyme in the generation of amyloid-β. Our results implicate S6K1 dysregulation as a previously unidentified molecular mechanism underlying synaptic and memory deficits in AD. These findings further suggest that therapeutic manipulation of S6K1 could be a valid approach to mitigate AD pathology. SIGNIFICANCE STATEMENT Aging is the most important risk factor for Alzheimer's disease (AD). However, little is known about how it contributes to AD pathogenesis. S6 kinase 1 (S6K1) is a protein kinase involved in regulation of protein translation. Reducing S6K1 activity increases lifespan and healthspan. We report the novel finding that reducing S6K1 activity in 3xTg-AD mice ameliorates synaptic and cognitive deficits. These improvement were associated with a reduction in amyloid-β and tau pathology. Mechanistically, lowering S6K1 levels reduced translation of β-site amyloid precursor protein cleaving enzyme 1 and tau, two key proteins involved in AD pathogenesis. These data suggest that S6K1 may represent a molecular link between aging and AD. Given that aging is the most important risk factor for most neurodegenerative diseases, our results may have far-reaching implications into other diseases. PMID:26468204

  18. Plastid ribosomal protein S5 is involved in photosynthesis, plant development, and cold stress tolerance in Arabidopsis

    PubMed Central

    Zhang, Junxiang; Yuan, Hui; Yang, Yong; Fish, Tara; Lyi, Sangbom M.; Thannhauser, Theodore W; Zhang, Lugang; Li, Li

    2016-01-01

    Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development. Mutations in plastid ribosomal proteins lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood, and the functions of some individual plastid ribosomal proteins remain unknown. To identify genes responsible for chloroplast development, we isolated and characterized a mutant that exhibited pale yellow inner leaves with a reduced growth rate in Arabidopsis. The mutant (rps5) contained a missense mutation of plastid ribosomal protein S5 (RPS5), which caused a dramatically reduced abundance of chloroplast 16S rRNA and seriously impaired 16S rRNA processing to affect ribosome function and plastid translation. Comparative proteomic analysis revealed that the rps5 mutation suppressed the expression of a large number of core components involved in photosystems I and II as well as many plastid ribosomal proteins. Unexpectedly, a number of proteins associated with cold stress responses were greatly decreased in rps5, and overexpression of the plastid RPS5 improved plant cold stress tolerance. Our results indicate that RPS5 is an important constituent of the plastid 30S subunit and affects proteins involved in photosynthesis and cold stress responses to mediate plant growth and development. PMID:27006483

  19. Evolution of ribosomal proteins in Enterobacteriaceae.

    PubMed Central

    Hori, H; Osawa, S

    1978-01-01

    The evolution of ribosomal proteins of about 70 bacterial strains belonging to the family Enterobacteriaceae has been studied by use of previously reported data (S. Osawa, T. Itoh, and E. Otaka, J. Bacteriol. 107:168-178, 1971) and those obtained in this paper. The proximity of the bacteria was quantified by co-chromatographing the differentially labeled ribosomal proteins from two strains on a column of carboxymethyl cellulose in various combinations. The were then classified into 12 groups (=species?) according to their ribosomal protein compositions and were placed in a phylogenic tree. PMID:346556

  20. In vitro expression of Escherichia coli ribosomal protein genes: autogenous inhibition of translation.

    PubMed Central

    Yates, J L; Arfsten, A E; Nomura, M

    1980-01-01

    Escherichia coli ribosomal protein L1 (0.5 micro M) was found to inhibit the synthesis of both proteins of the L11 operon, L11 and L1, but not the synthesis of other proteins directed by lambda rifd 18 DNA. Similarly, S4 (1 micro M) selectively inhibited the synthesis of three proteins of the alpha operon, S13, S11, and S4, directed by lambda spcI DNA or a restriction enzyme fragment obtained from this DNA. S8 (3.6 micro M) also showed preferential inhibitory effects on the synthesis of some proteins encoded in the spc operon, L24 and L5 (and probably S14 and S8), directed by lambda spcl DNA or a restriction enzyme fragment carrying the genes for these proteins. The inhibitory effect of L1 was observed only with L1 and not with other proteins examined, including S4 and S8. Similarly, the effect of S4 was not observed with L1 or S8, and that of S8 was not seen with L1 or S4. Inhibition was shown to take place at the level of translation rather than transcription. Thus, at least some ribosomal proteins (L1 S4, and S8) have the ability to cause selective translational inhibition of the synthesis of certain ribosomal proteins whose genes are in the same operon as their own. These results support the hypothesis that certain free ribosomal proteins not assembled into ribosomes act as "autogenous" feedback inhibitors to regulate the synthesis of ribosomal proteins. Images PMID:6445562

  1. Phosphorylation of Wheat Germ Initiation Factors and Ribosomal Proteins 1

    PubMed Central

    Browning, Karen S.; Yan, Tyan Fuh J.; Lauer, Stephen J.; Aquino, Lu Ann; Tao, Mariano; Ravel, Joanne M.

    1985-01-01

    The ability of the wheat germ initiation factors and ribosomes to serve as substrates for a wheat germ protein kinase (Yan and Tao 1982 J Biol Chem 257: 7037-7043) has been investigated. The wheat germ kinase catalyzes the phosphorylation of the 42,000 dalton subunit of eukaryotic initiation factor (eIF)-2 and the 107,000 dalton subunit of eIF-3. Other initiation factors, eIF-4B and eIF-4A, and elongation factors, EF-1 and EF-2, are not phosphorylated by the kinase. Quantitative analysis indicates that the kinase catalyzes the incorporation of about 0.5 to 0.6 mole of phosphate per mole of the 42,000 dalton subunit of eIF-2 and about 6 moles of phosphate per mole of the 107,000 dalton subunit of eIF-3. Three proteins (Mr = 38,000, 14,800, and 12,600) of the 60S ribosomal subunit are phosphorylated by the kinase, but none of the 40S ribosomal proteins are substrates of the kinase. No effects of phosphorylation on the activities of eIF-2, eIF-3, or 60S ribosomal subunits could be demonstrated in vitro. Images Fig. 1 Fig. 3 Fig. 4 PMID:16664060

  2. Ribosomal protein S6 kinase1 coordinates with TOR-Raptor2 to regulate thylakoid membrane biosynthesis in rice.

    PubMed

    Sun, Linxiao; Yu, Yonghua; Hu, Weiqin; Min, Qiming; Kang, Huiling; Li, Yilu; Hong, Yue; Wang, Xuemin; Hong, Yueyun

    2016-07-01

    Ribosomal protein S6 kinase (S6K) functions as a key component in the target of rapamycin (TOR) pathway involved in multiple processes in eukaryotes. The role and regulation of TOR-S6K in lipid metabolism remained unknown in plants. Here we provide genetic and pharmacological evidence that TOR-Raptor2-S6K1 is important for thylakoid galactolipid biosynthesis and thylakoid grana modeling in rice (Oryza sativa L.). Genetic suppression of S6K1 caused pale yellow-green leaves, defective thylakoid grana architecture. S6K1 directly interacts with Raptor2, a core component in TOR signaling, and S6K1 activity is regulated by Raptor2 and TOR. Plants with suppressed Raptor2 expression or reduced TOR activity by inhibitors mimicked the S6K1-deficient phenotype. A significant reduction in galactolipid content was found in the s6k1, raptor2 mutant or TOR-inhibited plants, which was accompanied by decreased transcript levels of the set of genes such as lipid phosphate phosphatase α5 (LPPα5), MGDG synthase 1 (MGD1), and DGDG synthase 1 (DGD1) involved in galactolipid synthesis, compared to the control plants. Moreover, loss of LPPα5 exhibited a similar phenotype with pale yellow-green leaves. These results suggest that TOR-Raptor2-S6K1 is important for modulating thylakoid membrane lipid biosynthesis, homeostasis, thus enhancing thylakoid grana architecture and normal photosynthesis ability in rice. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Crystal Structure of Ribosome-Inactivating Protein Ricin A Chain in Complex with the C-Terminal Peptide of the Ribosomal Stalk Protein P2.

    PubMed

    Shi, Wei-Wei; Tang, Yun-Sang; Sze, See-Yuen; Zhu, Zhen-Ning; Wong, Kam-Bo; Shaw, Pang-Chui

    2016-10-13

    Ricin is a type 2 ribosome-inactivating protein (RIP), containing a catalytic A chain and a lectin-like B chain. It inhibits protein synthesis by depurinating the N-glycosidic bond at α-sarcin/ricin loop (SRL) of the 28S rRNA, which thereby prevents the binding of elongation factors to the GTPase activation center of the ribosome. Here, we present the 1.6 Å crystal structure of Ricin A chain (RTA) complexed to the C-terminal peptide of the ribosomal stalk protein P2, which plays a crucial role in specific recognition of elongation factors and recruitment of eukaryote-specific RIPs to the ribosomes. Our structure reveals that the C-terminal GFGLFD motif of P2 peptide is inserted into a hydrophobic pocket of RTA, while the interaction assays demonstrate the structurally untraced SDDDM motif of P2 peptide contributes to the interaction with RTA. This interaction mode of RTA and P protein is in contrast to that with trichosanthin (TCS), Shiga-toxin (Stx) and the active form of maize RIP (MOD), implying the flexibility of the P2 peptide-RIP interaction, for the latter to gain access to ribosome.

  4. Elevated ERK/p90 ribosomal S6 kinase activity underlies audiogenic seizure susceptibility in fragile X mice.

    PubMed

    Sawicka, Kirsty; Pyronneau, Alexander; Chao, Miranda; Bennett, Michael V L; Zukin, R Suzanne

    2016-10-11

    Fragile X syndrome (FXS) is the most common heritable cause of intellectual disability and a leading genetic form of autism. The Fmr1 KO mouse, a model of FXS, exhibits elevated translation in the hippocampus and the cortex. ERK (extracellular signal-regulated kinase) and mTOR (mechanistic target of rapamycin) signaling regulate protein synthesis by activating downstream targets critical to translation initiation and elongation and are known to contribute to hippocampal defects in fragile X. Here we show that the effect of loss of fragile X mental retardation protein (FMRP) on these pathways is brain region specific. In contrast to the hippocampus, ERK (but not mTOR) signaling is elevated in the neocortex of fragile X mice. Phosphorylation of ribosomal protein S6, typically a downstream target of mTOR, is elevated in the neocortex, despite normal mTOR activity. This is significant in that S6 phosphorylation facilitates translation, correlates with neuronal activation, and is altered in neurodevelopmental disorders. We show that in fragile X mice, S6 is regulated by ERK via the "alternative" S6 kinase p90-ribosomal S6 kinase (RSK), as evidenced by the site of elevated phosphorylation and the finding that ERK inhibition corrects elevated RSK and S6 activity. These findings indicate that signaling networks are altered in the neocortex of fragile X mice such that S6 phosphorylation receives aberrant input from ERK/RSK. Importantly, an RSK inhibitor reduces susceptibility to audiogenic seizures in fragile X mice. Our findings identify RSK as a therapeutic target for fragile X and suggest the therapeutic potential of drugs for the treatment of FXS may vary in a brain-region-specific manner.

  5. The Phosphorylation of Ribosomal Protein in Lemna minor

    PubMed Central

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  6. Ribosome-inactivating proteins: potent poisons and molecular tools.

    PubMed

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-11-15

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms.

  7. Translational autocontrol of the Escherichia coli ribosomal protein S15.

    PubMed

    Portier, C; Dondon, L; Grunberg-Manago, M

    1990-01-20

    When rpsO, the gene encoding the ribosomal protein S15 in Escherichia coli, is carried by a multicopy plasmid, the mRNA synthesis rate of S15 increases with the gene dosage but the rate of synthesis of S15 does not rise. A translational fusion between S15 and beta-galactosidase was introduced on the chromosome in a delta lac strain and the expression of beta-galactosidase studied under different conditions. The presence of S15 in trans represses the beta-galactosidase level five- to sixfold, while the synthesis rate of the S15-beta-galactosidase mRNA decreases by only 30 to 50%. These data indicate that S15 is subject to autogenous translational control. Derepressed mutants were isolated and sequenced. All the point mutations map in the second codon of S15, suggesting a location for the operator site that is very near to the translation initiation codon. However, the creation of deletion mutations shows that the operator extends into the 5' non-coding part of the message, thus overlapping the ribosome loading site.

  8. Hypophosphorylation of Ribosomal Protein S6 is a Molecular Mechanism Underlying Ischemic Tolerance Induced by either Hibernation or Preconditioning

    PubMed Central

    Miyake, Shin-ichi; Wakita, Hideaki; Bernstock, Joshua D.; Castri, Paola; Ruetzler, Christl; Miyake, Junko; Lee, Yang-ja; Hallenbeck, John M.

    2015-01-01

    Thirteen-lined ground squirrels (Ictidomys tridecemlineatus) have an extraordinary capacity to withstand prolonged and profound reductions of blood flow and oxygen delivery to brain without incurring any cellular damage. As such, the hibernation torpor of I. tridecemlineatus provides a valuable model of tolerance to ischemic stress. Herein, we report that during hibernation torpor, a marked reduction in the phosphorylation of the ribosomal protein S6 (rpS6) occurs within the brains of I. tridecemlineatus. Of note, rpS6 phosphorylation was shown to increase in the brains of rats that underwent an occlusion of the middle cerebral artery. However, such an increase was attenuated after the implementation of an ischemic preconditioning paradigm. In addition, cultured cortical neurons treated with the rpS6 kinase (S6K) inhibitors, D-glucosamine or PF4708671, displayed a decrease in rpS6 phosphorylation and a subsequent increase in tolerance to oxygen/glucose deprivation, an in vitro model of ischemic stroke. Collectively, such evidence suggests that the down regulation of rpS6 signal transduction may account for a substantial part of the observed increase in cellular tolerance to brain ischemia that occurs during hibernation torpor and after ischemic preconditioning. Further identification and characterization of the mechanisms used by hibernating species to increase ischemic tolerance may eventually clarify how the loss of homeostatic control that occurs during and after cerebral ischemia in the clinic can ultimately be minimized and/or prevented. PMID:26375300

  9. Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones

    PubMed Central

    Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter

    2015-01-01

    Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation. PMID:26112308

  10. RNA and ribosomal protein patterns during aerial spore germination in Streptomyces granaticolor.

    PubMed

    Mikulík, K; Janda, I; Weiser, J; Stastná, J; Jiránová, A

    1984-12-03

    Disruption of the external sheath of Streptomyces granaticolor aerial spores and subsequent cultivation in a rich medium result in a synchronous germination. This method was used to analyze RNA and protein patterns during the germination. The germination process took place through a sequence of time-ordered events. RNA and protein synthesis started during the first 5 min and net DNA synthesis at 60-70 min of germination. Within the first 10 min of germination, synthesis of RNA was not sensitive to the inhibitory effect of rifamycin. During this period rRNA and other species including 4-5-S RNA were synthesized. Dormant spores contained populations of ribosomes or ribosomal precursors that were structurally and functionally defective. The ribosomal particles bound a sporulation pigment(s) of the melanine type. The ribosomal proteins complexed to the pigments formed insoluble aggregates which were easily removed from the ribosomes by one wash with 1 M NH4Cl. During the first 10 min of germination, pigment(s) were liberated from the complexes with the ribosomes and protein extracts of the washed ribosomes had essentially the same pattern as the extracts of ribosomes of vegetative cells. These structural alterations were accompanied by enhancement of the ribosome activities in polypeptide synthesis in vivo and in vitro. When the spores were incubated with a 14C-labelled amino acid mixture in the presence of rifamycin, only three proteins (GS1, GL1 and GS9) were identified to be radiolabelled in the extracts from the washed ribosomes. These experiments indicate that liberation of the sporulation pigment(s) from the complexes with ribosomal proteins and assembly of de novo synthesized proteins and proteins from a preexisting pool in the spore are involved in the reactivation of the ribosomes of dormant spores of S. granaticolor.

  11. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  12. mRNA 3' of the A site bound codon is located close to protein S3 on the human 80S ribosome.

    PubMed

    Molotkov, Maxim V; Graifer, Dmitri M; Popugaeva, Elena A; Bulygin, Konstantin N; Meschaninova, Maria I; Ven'yaminova, Aliya G; Karpova, Galina G

    2006-07-01

    Ribosomal proteins neighboring the mRNA downstream of the codon bound at the decoding site of human 80S ribosomes were identified using three sets of mRNA analogues that contained a UUU triplet at the 5' terminus and a perfluorophenylazide cross-linker at guanosine, adenosine or uridine residues placed at various locations 3' of this triplet. The positions of modified mRNA nucleotides on the ribosome were governed by tRNA(Phe) cognate to the UUU triplet targeted to the P site. Upon mild UV-irradiation, the mRNA analogues cross-linked preferentially to the 40S subunit, to the proteins and to a lesser extent to the 18S rRNA. Cross-linked nucleotides of 18S rRNA were identified previously. In the present study, it is shown that among the proteins the main target for cross-linking with all the mRNA analogues tested was protein S3 (homologous to prokaryotic S3, S3p); minor cross-linking to protein S2 (S5p) was also detected. Both proteins cross-linked to mRNA analogues in the ternary complexes as well as in the binary complexes (without tRNA). In the ternary complexes protein S15 (S19p) also cross-linked, the yield of the cross-link decreased significantly when the modified nucleotide moved from position +5 to position +12 with respect to the first nucleotide of the P site bound codon. In several ternary complexes minor cross-linking to protein S30 was likewise detected. The results of this study indicate that S3 is a key protein at the mRNA binding site neighboring mRNA downstream of the codon at the decoding site in the human ribosome.

  13. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  14. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  15. Structural domains within the HIV-1 mRNA and the ribosomal protein S25 influence cap-independent translation initiation

    PubMed Central

    Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth A.; Contreras, Nataly; Hertz, Marla I.; Olivares, Eduardo; Cáceres, C. Joaquín; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R.; López-Lastra, Marcelo

    2016-01-01

    The 5′leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work we examine the internal ribosome entry site (IRES) located in the 5′leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5′leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. PMID:27191820

  16. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  17. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  18. Ribosome protection by antibiotic resistance ATP-binding cassette protein.

    PubMed

    Su, Weixin; Kumar, Veerendra; Ding, Yichen; Ero, Rya; Serra, Aida; Lee, Benjamin Sian Teck; Wong, Andrew See Weng; Shi, Jian; Sze, Siu Kwan; Yang, Liang; Gao, Yong-Gui

    2018-05-15

    The ribosome is one of the richest targets for antibiotics. Unfortunately, antibiotic resistance is an urgent issue in clinical practice. Several ATP-binding cassette family proteins confer resistance to ribosome-targeting antibiotics through a yet unknown mechanism. Among them, MsrE has been implicated in macrolide resistance. Here, we report the cryo-EM structure of ATP form MsrE bound to the ribosome. Unlike previously characterized ribosomal protection proteins, MsrE is shown to bind to ribosomal exit site. Our structure reveals that the domain linker forms a unique needle-like arrangement with two crossed helices connected by an extended loop projecting into the peptidyl-transferase center and the nascent peptide exit tunnel, where numerous antibiotics bind. In combination with biochemical assays, our structure provides insight into how MsrE binding leads to conformational changes, which results in the release of the drug. This mechanism appears to be universal for the ABC-F type ribosome protection proteins. Copyright © 2018 the Author(s). Published by PNAS.

  19. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    PubMed

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  20. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    PubMed

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  1. [Protein S3 fragments neighboring mRNA during elongation and translation termination on the human ribosome].

    PubMed

    Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'yaminova, A G; Frolova, L Iu; Stahl, J; Karpova, G G

    2008-01-01

    Protein S3 fragments were determined that crosslink to modified mRNA analogues in positions +5 to +12 relative to the first nucleotide in the P-site binding codon in model complexes mimicking states of ribosomes at the elongation and translation termination steps. The mRNA analogues contained a Phe codon UUU/UUC at the 5'-termini that could predetermine the position of the tRNA(Phe) on the ribosome by the location of P-site binding and perfluorophenylazidobenzoyl group at a nucleotide in various positions 3' of the UUU/UUC codon. The crosslinked S3 protein was isolated from 80S ribosomal complexes irradiated with mild UV light and subjected to cyanogen bromide-induced cleavage at methionine residues with subsequent identification of the crosslinked oligopeptides. An analysis of the positions of modified oligopeptides resulting from the cleavage showed that, in dependence on the positions of modified nucleotides in the mRNA analogue, the crosslinking sites were found in the N-terminal half of the protein (fragment 2-127) and/or in the C-terminal fragment 190-236; the latter reflects a new peculiarity in the structure of the mRNA binding center in the ribosome, unknown to date. The results of crosslinking did not depend on the type of A-site codon or on the presence of translation termination factor eRF1.

  2. A Plasma Protein Indistinguishable from Ribosomal Protein S19

    PubMed Central

    Semba, Umeko; Chen, Jun; Ota, Yoshihiko; Jia, Nan; Arima, Hidetoshi; Nishiura, Hiroshi; Yamamoto, Tetsuro

    2010-01-01

    A monocyte-chemoattracting factor is generated during blood coagulation and during clotting of platelet-rich plasma. This chemotactic factor attracts monocytes as a ligand of the C5a receptor; however, it inhibits C5a-induced neutrophil chemotaxis as an apparent receptor antagonist. The curious dual function of the serum monocyte chemotactic factor resembles that of the cross-linked homodimer of ribosomal protein S19 (RP S19). Indeed, the inactive precursor of the monocyte chemotactic factor was present in plasma, and the precursor molecule and RP S19, as well as the active form and the RP S19 dimer, were indistinguishable in terms of immunological reactivity and molecular size. Coagulation factor XIIIa, plasma transglutaminase, and membrane phosphatidylserine on the activated platelets were required for conversion of the precursor to the active form. In addition, the precursor molecule in plasma could be replaced by wild-type recombinant RP S19 but not by mutant forms of it. These results indicate that a molecule indistinguishable from RP S19 was present in plasma, and that the RP S19-like molecule was converted to the active form by a transglutaminase-catalyzed reaction on a scaffold that included the phosphatidylserine-exposed platelet membrane. PMID:20093496

  3. Structural domains within the HIV-1 mRNA and the ribosomal protein S25 influence cap-independent translation initiation.

    PubMed

    Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth; Contreras, Nataly; Hertz, Marla I; Olivares, Eduardo; Cáceres, Carlos J; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R; López-Lastra, Marcelo

    2016-07-01

    The 5' leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work, we examine the internal ribosome entry site (IRES) located in the 5' leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5' leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. © 2016 Federation of European Biochemical Societies.

  4. Massively Convergent Evolution for Ribosomal Protein Gene Content in Plastid and Mitochondrial Genomes

    PubMed Central

    Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F.; Martin, William F.

    2013-01-01

    Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force. PMID:24259312

  5. The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site

    PubMed Central

    Pillet, Benjamin; García-Gómez, Juan J.; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter

    2015-01-01

    Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S

  6. Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.

    PubMed Central

    Prestle, J; Schönfelder, M; Adam, G; Mundry, K W

    1992-01-01

    Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614

  7. Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsurugi, K.; Motizuki, M.; Mitsui, K.

    1988-01-01

    When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were /sup 3/H-labeled in vitro and injected back into X. laevis oocytes, most /sup 3/H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, /sup 3/H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of /sup 3/H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide,more » a cysteine protease inhibitor, resulting in the accumulation of /sup 3/H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus.« less

  8. Topography of Escherichia coli ribosomal proteins. The order of reactivity of thiol groups*

    PubMed Central

    Bakardjieva, Anastasia; Crichton, Robert R.

    1974-01-01

    1. 30S and 50S ribosomal subunits of Escherichia coli were treated with N-[2,3-14C]-ethylmaleimide and iodo[14C]acetamide. 2. The proteins in the native subunits which reacted with the reagents were S1,‡ S2, S12, S13, S18, S21, L2, L5, L6, L10, L11, L15, L17, L20, L26+28 and L27. 3. Several proteins, such as S1, S12, S14, S18, L2, L6, L10, L11 and either L26 or 28, had thiol groups in an oxidized form and reacted to a greater extent after reduction with β-mercaptoethanol or dithiothreitol. 4. The total number of thiol groups in 30S and 50S subunits was determined as 16–17 and 26–27 respectively. The total number of thiol groups in each ribosomal protein was also determined. 5. The reaction of 30S and 50S subunits with iodoacetamide under several different conditions established the order of reactivity of thiol groups. PMID:4618476

  9. Lupus autoantibodies target ribosomal P proteins

    PubMed Central

    1985-01-01

    All nine SLE (systemic lupus erythematosus) sera with antiribosomal antibody activity targeted the same three ribosomal protein antigens, of molecular masses 38 and 17/19 kD when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting. One serum reacted with an additional protein of approximately kD. Ribosomal subunit fractionation by composite gel electrophoresis and sucrose density ultracentrifugation showed that these proteins were part of the large subunit. Isoelectric focusing in agarose, and two-dimensional polyacrylamide gel electrophoresis revealed that the antigens had pI between 4.5 and 6.5, but that the 17/19 kD antigens were more acidic than the 38 kD antigen. Similarities in the molecular masses, charges, as well as the presence of highly conserved crossreactive epitopes, failure to bind to carboxymethylcellulose at pH 4.2, and extractability of the 17/19 kD proteins by 400 mM NH4Cl-ethanol at 0 degrees C indicated that these antigens were analogous to the proteins P0 (38 kD) and P1/P2 (17/19 kD) described previously (25, 36). Co-identity was confirmed using reference antibodies and antigen. Although antibodies to these proteins were only found in 5-10% of more than 50 sera screened by radioimmunoassay or Western blotting, the selective production of antibodies to epitopes on three (out of a total of more than 80) ribosomal proteins may provide further clues to autoantibody induction of SLE. PMID:2410526

  10. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    PubMed Central

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  11. RNA regulators responding to ribosomal protein S15 are frequent in sequence space

    PubMed Central

    Slinger, Betty L.; Meyer, Michelle M.

    2016-01-01

    There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716

  12. Elucidation of Motifs in Ribosomal Protein S9 That Mediate Its Nucleolar Localization and Binding to NPM1/Nucleophosmin

    PubMed Central

    Lindström, Mikael S.

    2012-01-01

    Biogenesis of eukaryotic ribosomes occurs mainly in a specific subnuclear compartment, the nucleolus, and involves the coordinated assembly of ribosomal RNA and ribosomal proteins. Identification of amino acid sequences mediating nucleolar localization of ribosomal proteins may provide important clues to understand the early steps in ribosome biogenesis. Human ribosomal protein S9 (RPS9), known in prokaryotes as RPS4, plays a critical role in ribosome biogenesis and directly binds to ribosomal RNA. RPS9 is targeted to the nucleolus but the regions in the protein that determine its localization remains unknown. Cellular expression of RPS9 deletion mutants revealed that it has three regions capable of driving nuclear localization of a fused enhanced green fluorescent protein (EGFP). The first region was mapped to the RPS9 N-terminus while the second one was located in the proteins C-terminus. The central and third region in RPS9 also behaved as a strong nucleolar localization signal and was hence sufficient to cause accumulation of EGFP in the nucleolus. RPS9 was previously shown to interact with the abundant nucleolar chaperone NPM1 (nucleophosmin). Evaluating different RPS9 fragments for their ability to bind NPM1 indicated that there are two binding sites for NPM1 on RPS9. Enforced expression of NPM1 resulted in nucleolar accumulation of a predominantly nucleoplasmic RPS9 mutant. Moreover, it was found that expression of a subset of RPS9 deletion mutants resulted in altered nucleolar morphology as evidenced by changes in the localization patterns of NPM1, fibrillarin and the silver stained nucleolar organizer regions. In conclusion, RPS9 has three regions that each are competent for nuclear localization, but only the central region acted as a potent nucleolar localization signal. Interestingly, the RPS9 nucleolar localization signal is residing in a highly conserved domain corresponding to a ribosomal RNA binding site. PMID:23285058

  13. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    PubMed

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  14. [SP600125-induced polyploidization of megakaryocytic leukemia cell lines by ribosomal protein S6 kinase 1 depends on the degree of cell differentiation].

    PubMed

    Wang, Lili; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Zhao, Song; Ma, Dongchu

    2016-10-01

    Objective To investigate regulatory role of ribosomal protein S6 kinase 1 (S6K1) in the polyploidization of different megakaryocytic leukemia cell lines at the different differentiation stages. Methods Megakaryocytic leukemia cell lines (Dami, Meg-01 and HEL cells) were induced towards polyploidization by SP600125, a c-Jun N-terminal kinase (JNK) inhibitor. The SP600125-inducing process was blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor. The phenotype (CD41a, CD42a and CD42b) and DNA ploidy were detected by flow cytometry. The expression and phosphorylation of S6K1 and related proteins were detected by Western blotting. Results SP600125 induced polyploidization and increased the phosphorylation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1) in Dami, Meg-01 and HEL cells. However, the effect of SP600125 on polyploidization of the three cell lines was different, with the strongest effect on Dami cells and the weakest on Meg-01 cells. Moreover, SP600125 increased the phosphorylation of S6K1 Thr421/Ser424 and decreased the phosphorylation of Thr389 in Dami cells. However, it only increased the phosphorylation of Thr389 in HEL cells and had no effect on the phosphorylation of S6K1 in Meg-01 cells. Interestingly, H-89 only partially blocked the polyploidization of Dami cells, although it decreased the phosphorylation of 4E-BP1 in all SP600125-induced three cell lines. Noticeably, H-89 decreased the phosphorylation of S6K1 Thr421/Ser424 and increased the phosphorylation of Thr389 in Dami cells. However, H-89 had no effect on the phosphorylation of Thr421/Ser424, although it increased the phosphorylation of Thr389 in Meg-01 and HEL cells. Phenotypic analysis showed that the three cell lines were at different levels of differentiation in megakaryocytic lineage, with the highest differentiation in Dami and the lowest in Meg-01 cells. Conclusion SP600125-induced polyploidization of megakaryocytic leukemia cell lines is dependent on the effect

  15. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    PubMed Central

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  16. Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

    PubMed Central

    Heilek, G M; Noller, H F

    1996-01-01

    Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

  17. The path from nucleolar 90S to cytoplasmic 40S pre-ribosomes.

    PubMed

    Schäfer, Thorsten; Strauss, Daniela; Petfalski, Elisabeth; Tollervey, David; Hurt, Ed

    2003-03-17

    Recent reports have increased our knowledge of the consecutive steps during 60S ribosome biogenesis substantially, but 40S subunit formation is less well understood. Here, we investigate the maturation of nucleolar 90S pre-ribosomes into cytoplasmic 40S pre-ribosomes. During the transition from 90S to 40S particles, the majority of non-ribosomal proteins (approximately 30 species) dissociate, and significantly fewer factors associate with 40S pre-ribosomes. Notably, some of these components are part of both early 90S and intermediate 40S pre-particles in the nucleolus (e.g. Enp1p, Dim1p and Rrp12p), whereas others (e.g. Rio2p and Nob1p) are found mainly on late cytoplasmic pre-40S subunits. Finally, temperature-sensitive mutants mapping either in earlier (enp1-1) or later (rio2-1) components exhibit defects in the formation and nuclear export of pre-40S subunits. Our data provide an initial biochemical map of the pre-40S ribosomal subunit on its path from the nucleolus to the cytoplasm. This pathway involves fewer changes in composition than seen during 60S biogenesis.

  18. Factors Affecting Nuclear Export of the 60S Ribosomal Subunit In Vivo

    PubMed Central

    Stage-Zimmermann, Tracy; Schmidt, Ute; Silver, Pamela A.

    2000-01-01

    In Saccharomyces cerevisiae, the 60S ribosomal subunit assembles in the nucleolus and then is exported to the cytoplasm, where it joins the 40S subunit for translation. Export of the 60S subunit from the nucleus is known to be an energy-dependent and factor-mediated process, but very little is known about the specifics of its transport. To begin to address this problem, an assay was developed to follow the localization of the 60S ribosomal subunit in S. cerevisiae. Ribosomal protein L11b (Rpl11b), one of the ∼45 ribosomal proteins of the 60S subunit, was tagged at its carboxyl terminus with the green fluorescent protein (GFP) to enable visualization of the 60S subunit in living cells. A panel of mutant yeast strains was screened for their accumulation of Rpl11b–GFP in the nucleus as an indicator of their involvement in ribosome synthesis and/or transport. This panel included conditional alleles of several rRNA-processing factors, nucleoporins, general transport factors, and karyopherins. As predicted, conditional alleles of rRNA-processing factors that affect 60S ribosomal subunit assembly accumulated Rpl11b–GFP in the nucleus. In addition, several of the nucleoporin mutants as well as a few of the karyopherin and transport factor mutants also mislocalized Rpl11b–GFP. In particular, deletion of the previously uncharacterized karyopherin KAP120 caused accumulation of Rpl11b–GFP in the nucleus, whereas ribosomal protein import was not impaired. Together, these data further define the requirements for ribosomal subunit export and suggest a biological function for KAP120. PMID:11071906

  19. Gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein messenger RNAs as colonic carcinoma.

    PubMed

    Barnard, G F; Staniunas, R J; Mori, M; Puder, M; Jessup, M J; Steele, G D; Chen, L B

    1993-09-01

    The levels of a number of ribosomal protein mRNAs are reported to be increased in human colon cancer. We have assessed whether selected ribosomal protein mRNAs are overexpressed in other gastrointestinal malignancies, namely gastric and hepatocellular carcinomas. Subtracted complementary DNA libraries were generated from paired samples of human (a) colorectal carcinoma minus adjacent normal colonic mucosa and (b) hepatocellular carcinoma minus adjacent normal liver. Screening of approximately 3% of these library clones determined that ribosomal protein mRNAs encoding L18 and L37 (not previously reported) and P0 and S6 were overexpressed in one or the other library. Their complementary DNA inserts were then used as probes to evaluate their expression in a larger number of paired tumor/normal surgical samples of human colonic, gastric, and hepatocellular carcinomas, by Northern hybridization. The mRNA signal was greater in the colonic carcinoma than in paired adjacent normal colonic mucosa in 38 of 42 cases for P0 [tumor/normal (T/N) ratio = 3.0 +/- 0.3, mean +/- SE, P < 0.001] (G. F. Barnard, R. J. Staniunas, S. Bao, K. Mafune, J. L. Gollan, G. D. Steele, Jr., and L. B. Chen, Cancer Res., 52: 3067-3072, 1992), in 25 of 28 cases for L18 (T/N ratio = 3.7 +/- 0.5, P < 0.001), in 27 of 28 cases for L37 (T/N ratio = 5.3 +/- 0.4, P < 0.001), and in 24 of 28 cases for S6 (T/N ratio = 3.1 +/- 0.5, P < 0.01). The level of mRNA overexpression of L18 and S6 did not correlate with the Dukes' stage of disease. In hepatocellular carcinoma samples, using the same four ribosomal protein complementary DNA probes, only P0 mRNA was significantly increased (T/N ratio = 2.8 +/- 0.4, n = 6, P = 0.047). In gastric carcinoma samples, none of these mRNAs was increased (mean T/N ratios = 0.9-1.2, n = 6). Therefore, gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein mRNAs as do colonic carcinoma.

  20. Ribosomal S6 kinase (RSK) modulators: a patent review.

    PubMed

    Ludwik, Katarzyna A; Lannigan, Deborah A

    2016-09-01

    The p90 ribosomal S6 kinases (RSK) are a family of Ser/Thr protein kinases that are downstream effectors of MEK1/2-ERK1/2. Increased RSK activation is implicated in the etiology of multiple pathologies, including numerous types of cancers, cardiovascular disease, liver and lung fibrosis, and infections. The review summarizes the patent and scientific literature on small molecule modulators of RSK and their potential use as therapeutics. The patents were identified using World Intellectual Property Organization and United States Patent and Trademark Office databases. The compounds described are predominantly RSK inhibitors, but a RSK activator is also described. The majority of the inhibitors are not RSK-specific. Based on the overwhelming evidence that RSK is involved in a number of diseases that have high mortalities it seems surprising that there are no RSK modulators that have pharmacokinetic properties suitable for in vivo use. MEK1/2 inhibitors are in the clinic, but the efficacy of these compounds appears to be limited by their side effects. We hypothesize that targeting the downstream effectors of MEK1/2, like RSK, are an untapped source of drug targets and that they will generate less side effects than MEK1/2 inhibitors because they regulate fewer effectors.

  1. BI-D1870 is a specific inhibitor of the p90 RSK (ribosomal S6 kinase) isoforms in vitro and in vivo

    PubMed Central

    Sapkota, Gopal P.; Cummings, Lorna; Newell, Felicity S.; Armstrong, Christopher; Bain, Jennifer; Frodin, Morten; Grauert, Matthias; Hoffmann, Matthias; Schnapp, Gisela; Steegmaier, Martin; Cohen, Philip; Alessi, Dario R.

    2006-01-01

    Hormones and growth factors induce the activation of a number of protein kinases that belong to the AGC subfamily, including isoforms of PKA, protein kinase B (also known as Akt), PKC, S6K p70 (ribosomal S6 kinase), RSK (p90 ribosomal S6 kinase) and MSK (mitogen- and stress-activated protein kinase), which then mediate many of the physiological processes that are regulated by these extracellular agonists. It can be difficult to assess the individual functions of each AGC kinase because their substrate specificities are similar. Here we describe the small molecule BI-D1870, which inhibits RSK1, RSK2, RSK3 and RSK4 in vitro with an IC50 of 10–30 nM, but does not signi-ficantly inhibit ten other AGC kinase members and over 40 other protein kinases tested at 100-fold higher concentrations. BI-D1870 is cell permeant and prevents the RSK-mediated phorbol ester- and EGF (epidermal growth factor)-induced phosphoryl-ation of glycogen synthase kinase-3β and LKB1 in human embry-onic kidney 293 cells and Rat-2 cells. In contrast, BI-D1870 does not affect the agonist-triggered phosphorylation of substrates for six other AGC kinases. Moreover, BI-D1870 does not suppress the phorbol ester- or EGF-induced phosphorylation of CREB (cAMP-response-element-binding protein), consistent with the genetic evidence indicating that MSK, and not RSK, isoforms mediate the mitogen-induced phosphorylation of this transcription factor. PMID:17040210

  2. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    PubMed

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  3. Unique localization of the plastid-specific ribosomal proteins in the chloroplast ribosome small subunit provides mechanistic insights into the chloroplastic translation

    PubMed Central

    Ahmed, Tofayel; Shi, Jian

    2017-01-01

    Abstract Chloroplastic translation is mediated by a bacterial-type 70S chloroplast ribosome. During the evolution, chloroplast ribosomes have acquired five plastid-specific ribosomal proteins or PSRPs (cS22, cS23, bTHXc, cL37 and cL38) which have been suggested to play important regulatory roles in translation. However, their exact locations on the chloroplast ribosome remain elusive due to lack of a high-resolution structure, hindering our progress to understand their possible roles. Here we present a cryo-EM structure of the 70S chloroplast ribosome from spinach resolved to 3.4 Å and focus our discussion mainly on the architecture of the 30S small subunit (SSU) which is resolved to 3.7 Å. cS22 localizes at the SSU foot where it seems to compensate for the deletions in 16S rRNA. The mRNA exit site is highly remodeled due to the presence of cS23 suggesting an alternative mode of translation initiation. bTHXc is positioned at the SSU head and appears to stabilize the intersubunit bridge B1b during thermal fluctuations. The translation factor plastid pY binds to the SSU on the intersubunit side and interacts with the conserved nucleotide bases involved in decoding. Most of the intersubunit bridges are conserved compared to the bacteria, except for a new bridge involving uL2c and bS6c. PMID:28582576

  4. Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

    PubMed Central

    Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

    1982-01-01

    1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

  5. Deletion of L4 domains reveals insights into the importance of ribosomal protein extensions in eukaryotic ribosome assembly.

    PubMed

    Gamalinda, Michael; Woolford, John L

    2014-11-01

    Numerous ribosomal proteins have a striking bipartite architecture: a globular body positioned on the ribosomal exterior and an internal loop buried deep into the rRNA core. In eukaryotes, a significant number of conserved r-proteins have evolved extra amino- or carboxy-terminal tail sequences, which thread across the solvent-exposed surface. The biological importance of these extended domains remains to be established. In this study, we have investigated the universally conserved internal loop and the eukaryote-specific extensions of yeast L4. We show that in contrast to findings with bacterial L4, deleting the internal loop of yeast L4 causes severely impaired growth and reduced levels of large ribosomal subunits. We further report that while depleting the entire L4 protein blocks early assembly steps in yeast, deletion of only its extended internal loop affects later steps in assembly, revealing a second role for L4 during ribosome biogenesis. Surprisingly, deletion of the entire eukaryote-specific carboxy-terminal tail of L4 has no effect on viability, production of 60S subunits, or translation. These unexpected observations provide impetus to further investigate the functions of ribosomal protein extensions, especially eukaryote-specific examples, in ribosome assembly and function. © 2014 Gamalinda and Woolford; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  7. The discovery of potent ribosomal S6 kinase inhibitors by high-throughput screening and structure-guided drug design

    PubMed Central

    Kalusa, Andrew; Cano, Celine; Travers, Jon; Boxall, Kathy; Chow, Chiau Ling; Burns, Sam; Schmitt, Jessica; Pickard, Lisa; Barillari, Caterina; McAndrew, P. Craig; Clarke, Paul A.; Linardopoulos, Spiros; Griffin, Roger J.; Aherne, G. Wynne; Raynaud, Florence I.; Workman, Paul; Jones, Keith; van Montfort, Rob L.M.

    2013-01-01

    The ribosomal P70 S6 kinases play a crucial role in PI3K/mTOR regulated signalling pathways and are therefore potential targets for the treatment of a variety of diseases including diabetes and cancer. In this study we describe the identification of three series of chemically distinct S6K1 inhibitors. In addition, we report a novel PKA-S6K1 chimeric protein with five mutations in or near its ATP-binding site, which was used to determine the binding mode of two of the three inhibitor series, and provided a robust system to aid the optimisation of the oxadiazole-substituted benzimidazole inhibitor series. We show that the resulting oxadiazole-substituted aza-benzimidazole is a potent and ligand efficient S6 kinase inhibitor, which blocks the phosphorylation of RPS6 at Ser235/236 in TSC negative HCV29 human bladder cancer cells by inhibiting S6 kinase activity and thus provides a useful tool compound to investigate the function of S6 kinases. PMID:24072592

  8. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletionmore » and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.« less

  9. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    PubMed

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  10. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  11. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    PubMed

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  12. A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling.

    PubMed

    Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal

    2017-01-01

    Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein-EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here.

  13. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    PubMed

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  14. Proteomic analysis of rodent ribosomes revealed heterogeneity including ribosomal proteins L10-like, L22-like 1, and L39-like.

    PubMed

    Sugihara, Yoshihiko; Honda, Hiroki; Iida, Tomoharu; Morinaga, Takuma; Hino, Shingo; Okajima, Tetsuya; Matsuda, Tsukasa; Nadano, Daita

    2010-03-05

    Heterogeneity of ribosome structure, due to variations in ribosomal protein composition, has been shown to be of physiological significance in plants and yeast. Mammalian genomics have demonstrated numerous genes that are paralogous to genes encoding ribosomal proteins. Although the vast majority are considered to be pseudogenes, mRNA expression of a few paralogues, such as human ribosomal protein L39-like/L39-2, has been reported. In the present study, ribosomes from the liver, mammary gland, and testis of rodents were analyzed using a combination of two-dimensional gel electrophoresis under radical-free and highly reducing conditions, and mass spectrometry. This system allowed identification of 78 ribosomal proteins and Rack1 from a single gel. The degree of heterogeneity was far less than that reported for plant and yeast ribosomes, and was in accord with published biochemical and genetic data for mammalian ribosomes. Nevertheless, an uncharacterized paralogue of ribosomal protein L22, ribosomal protein L22-like 1, was identified as a minor ribosomal component. Ribosomal proteins L10-like and L39-like, paralogues of ribosomal proteins L10 and L39, respectively, were found in ribosomes only from the testis. Reverse transcription-polymerase chain reaction yielded supportive evidence for specific expression of L10-like and L39-like in the testis. Newly synthesized L39-like is likely to be transported to the nucleolus, where ribosome biosynthesis occurs, and then incorporated into translating ribosomes in the cytoplasm. Heterogeneity of mammalian testicular ribosomes is structurally non-negligible, and may offer valuable insights into the function of the customized ribosome.

  15. A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling

    PubMed Central

    Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal

    2017-01-01

    Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein–EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here. PMID:28099529

  16. Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

    NASA Technical Reports Server (NTRS)

    Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.

    1996-01-01

    A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

  17. Heptameric (L12)6/L10 rather than canonical pentameric complexes are found by tandem MS of intact ribosomes from thermophilic bacteria.

    PubMed

    Ilag, Leopold L; Videler, Hortense; McKay, Adam R; Sobott, Frank; Fucini, Paola; Nierhaus, Knud H; Robinson, Carol V

    2005-06-07

    Ribosomes are universal translators of the genetic code into protein and represent macromolecular structures that are asymmetric, often heterogeneous, and contain dynamic regions. These properties pose considerable challenges for modern-day structural biology. Despite these obstacles, high-resolution x-ray structures of the 30S and 50S subunits have revealed the RNA architecture and its interactions with proteins for ribosomes from Thermus thermophilus, Deinococcus radiodurans, and Haloarcula marismortui. Some regions, however, remain inaccessible to these high-resolution approaches because of their high conformational dynamics and potential heterogeneity, specifically the so-called L7/L12 stalk complex. This region plays a vital role in protein synthesis by interacting with GTPase factors in translation. Here, we apply tandem MS, an approach widely applied to peptide sequencing for proteomic applications but not previously applied to MDa complexes. Isolation and activation of ions assigned to intact 30S and 50S subunits releases proteins S6 and L12, respectively. Importantly, this process reveals, exclusively while attached to ribosomes, a phosphorylation of L12, the protein located in multiple copies at the tip of the stalk complex. Moreover, through tandem MS we discovered a stoichiometry for the stalk protuberance on Thermus thermophilus and other thermophiles and contrast this assembly with the analogous one on ribosomes from mesophiles. Together with evidence for a potential interaction with the degradosome, these results show that important findings on ribosome structure, interactions, and modifications can be discovered by tandem MS, even on well studied ribosomes from Thermus thermophilus.

  18. Heptameric (L12)6/L10 rather than canonical pentameric complexes are found by tandem MS of intact ribosomes from thermophilic bacteria

    PubMed Central

    Ilag, Leopold L.; Videler, Hortense; McKay, Adam R.; Sobott, Frank; Fucini, Paola; Nierhaus, Knud H.; Robinson, Carol V.

    2005-01-01

    Ribosomes are universal translators of the genetic code into protein and represent macromolecular structures that are asymmetric, often heterogeneous, and contain dynamic regions. These properties pose considerable challenges for modern-day structural biology. Despite these obstacles, high-resolution x-ray structures of the 30S and 50S subunits have revealed the RNA architecture and its interactions with proteins for ribosomes from Thermus thermophilus, Deinococcus radiodurans, and Haloarcula marismortui. Some regions, however, remain inaccessible to these high-resolution approaches because of their high conformational dynamics and potential heterogeneity, specifically the so-called L7/L12 stalk complex. This region plays a vital role in protein synthesis by interacting with GTPase factors in translation. Here, we apply tandem MS, an approach widely applied to peptide sequencing for proteomic applications but not previously applied to MDa complexes. Isolation and activation of ions assigned to intact 30S and 50S subunits releases proteins S6 and L12, respectively. Importantly, this process reveals, exclusively while attached to ribosomes, a phosphorylation of L12, the protein located in multiple copies at the tip of the stalk complex. Moreover, through tandem MS we discovered a stoichiometry for the stalk protuberance on Thermus thermophilus and other thermophiles and contrast this assembly with the analogous one on ribosomes from mesophiles. Together with evidence for a potential interaction with the degradosome, these results show that important findings on ribosome structure, interactions, and modifications can be discovered by tandem MS, even on well studied ribosomes from Thermus thermophilus. PMID:15923259

  19. Erythroblast differentiation at spleen in Q137E mutant ribosomal protein S19 gene knock-in C57BL/6J mice.

    PubMed

    Yamanegi, Koji; Yamada, Naoko; Nakasho, Keiji; Nishiura, Hiroshi

    2018-01-01

    We recently found that erythroblast-like cells derived from human leukaemia K562 cells express C5a receptor (C5aR) and produce its antagonistic and agonistic ligand ribosomal protein S19 (RP S19) polymer, which is cross-linked between K122 and Q137 by tissue transglutaminases. RP S19 polymer binds to the reciprocal C5aRs on erythroblast-like cells and macrophage-like cells derived from human monocytic THP-1 cells and promotes differentiation into reticulocyte-like cells through enucleation in vitro. To examine the roles of RP S19 polymer in mouse erythropoiesis, we prepared Q137E mutant RP S19 gene knock-in C57BL/6J mice. In contrast to wild-type mice, erythroblast numbers at the preliminary stage (CD71 high /TER119 low ) in spleen based on transferrin receptor (CD71) and glycophorin A (TER119) values and erythrocyte numbers in orbital artery bloods were not largely changed in knock-in mice. Conversely, erythroblast numbers at the early stage (CD71 high /TER119 high ) were significantly decreased in spleen by knock-in mice. The reduction of early erythroblast numbers in spleen was enhanced by the phenylhydrazine-induced pernicious anemia model knock-in mice and was rescued by a functional analogue of RP S19 dimer S-tagged C5a/RP S19. These data indicated that RP S19 polymer plays the roles in the early erythroblast differentiation of C57BL/6J mouse spleen. Copyright © 2017 Elsevier GmbH. All rights reserved.

  20. A Novel Marker for Purkinje Cells, Ribosomal Protein MPS1/S27: Expression of MPS1 in Human Cerebellum.

    PubMed

    Fernandez-Pol, J Alberto

    2016-01-01

    The ribosomal protein metallopanstimulin-1 (MPS1/S27) serves critical survival purposes in cell division, in normal and cancerous cells; for this reason, selective pressures of evolution have conserved the DNA sequences encoding MPS1/S27 in Archaea and Eukariotic cells. The expression of MPS1/S27 protein in human adult cerebellum has not been established. The presence of MPS1/S27, was screened in paraffin-embedded human adult brain specimens processed for tissue inmunohistochemistry. Affinity-purified specific antibodies were directed against the N-terminus of MPS1. The antibodies to MPS1 detected Purkinje cells (PC) and their dendrites. In PC, MPS1 antigen-positive staining was found in: the nucleolus, which was strongly stained; ribosomes attached to the external nuclear membrane; cytoplasm of PC, with strong staining in a punctuate fashion; the soma-attached large dendrite trunks of PC, which were MPS1 antigen-positive; and the granular cell layer, where cellular staining in a few cells that appeared to resemble smaller PC was observed. Since MPS1 is involved in cell division, DNA repair, and ribosomal biogenesis, it may be a useful antigen for studying processes such as protein synthesis, oncogenesis, regeneration, aging, and perhaps diseases of the human cerebellum. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

  1. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    PubMed

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  2. Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice

    PubMed Central

    Smith, Mark A.; Katsouri, Loukia; Irvine, Elaine E.; Hankir, Mohammed K.; Pedroni, Silvia M.A.; Voshol, Peter J.; Gordon, Matthew W.; Choudhury, Agharul I.; Woods, Angela; Vidal-Puig, Antonio; Carling, David; Withers, Dominic J.

    2015-01-01

    Summary Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC) and agouti-related protein (AgRP) neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons. PMID:25865886

  3. The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

    PubMed Central

    Sloan, Katherine E.; Bohnsack, Markus T.; Watkins, Nicholas J.

    2013-01-01

    Summary Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. PMID:24120868

  4. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    PubMed

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  5. Variation of the chemical reactivity of Thermus thermophilus HB8 ribosomal proteins as a function of pH.

    PubMed

    Running, William E; Reilly, James P

    2010-10-01

    Ribosomes occupy a central position in cellular metabolism, converting stored genetic information into active cellular machinery. Ribosomal proteins modulate both the intrinsic function of the ribosome and its interaction with other cellular complexes, such as chaperonins or the signal recognition particle. Chemical modification of proteins combined with mass spectrometric detection of the extent and position of covalent modifications is a rapid, sensitive method for the study of protein structure and flexibility. By altering the pH of the solution, we have induced non-denaturing changes in the structure of bacterial ribosomal proteins and detected these conformational changes by covalent labeling. Changes in ribosomal protein modification across a pH range from 6.6 to 8.3 are unique to each protein, and correlate with their structural environment in the ribosome. Lysine residues whose extent of modification increases as a function of increasing pH are on the surface of proteins, but in close proximity either to glutamate and aspartate residues, or to rRNA backbone phosphates. Increasing pH disrupts tertiary and quaternary interactions mediated by hydrogen bonding or ionic interactions, and regions of protein structure whose conformations are sensitive to these changes are of potential importance in modulating the flexibility of the ribosome or its interaction with other cellular complexes.

  6. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  7. Non-canonical mechanism for translational control in bacteria: synthesis of ribosomal protein S1

    PubMed Central

    Boni, Irina V.; Artamonova, Valentina S.; Tzareva, Nina V.; Dreyfus, Marc

    2001-01-01

    Translation initiation region (TIR) of the rpsA mRNA encoding ribosomal protein S1 is one of the most efficient in Escherichia coli despite the absence of a canonical Shine–Dalgarno-element. Its high efficiency is under strong negative autogenous control, a puzzling phenomenon as S1 has no strict sequence specificity. To define sequence and structural elements responsible for translational efficiency and autoregulation of the rpsA mRNA, a series of rpsA′–′lacZ chromosomal fusions bearing various mutations in the rpsA TIR was created and tested for β-galactosidase activity in the absence and presence of excess S1. These in vivo results, as well as data obtained by in vitro techniques and phylogenetic comparison, allow us to propose a model for the structural and functional organization of the rpsA TIR specific for proteobacteria related to E.coli. According to the model, the high efficiency of translation initiation is provided by a specific fold of the rpsA leader forming a non-contiguous ribosome entry site, which is destroyed upon binding of free S1 when it acts as an autogenous repressor. PMID:11483525

  8. Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

    PubMed

    Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

    1997-06-05

    We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

  9. Ribosomal vaccines. I. Immunogenicity of ribosomal fractions isolated from Salmonella typhimurium and Yersinia pestis.

    PubMed

    Johnson, W

    1972-06-01

    The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein.

  10. Acidic Ribosomal Proteins from the Extreme ’Halobacterium cutirubrum’,

    DTIC Science & Technology

    the extreme halophilic bacterium, Halobacterium cutirubrum. The identification of the protein moieties involved in these and other interactions in...the halophile ribosome requires a rapid and reproducible screening method for the separation, enumeration and identification of these acidic...polypeptides in the complex ribosomal protein mixtures. In this paper the authors present the results of analyses of the halophile ribosomal proteins using a

  11. Ribosome hijacking: a role for small protein B during trans-translation

    PubMed Central

    Nonin-Lecomte, Sylvie; Germain-Amiot, Noella; Gillet, Reynald; Hallier, Marc; Ponchon, Luc; Dardel, Frédéric; Felden, Brice

    2009-01-01

    Tight recognition of codon–anticodon pairings by the ribosome ensures the accuracy and fidelity of protein synthesis. In eubacteria, translational surveillance and ribosome rescue are performed by the ‘tmRNA–SmpB' system (transfer messenger RNA–small protein B). Remarkably, entry and accommodation of aminoacylated-tmRNA into stalled ribosomes occur without a codon–anticodon interaction but in the presence of SmpB. Here, we show that within a stalled ribosome, SmpB interacts with the three universally conserved bases G530, A1492 and A1493 that form the 30S subunit decoding centre, in which canonical codon–anticodon pairing occurs. The footprints at positions A1492 and A1493 of a small decoding centre, as well as on a set of conserved SmpB amino acids, were identified by nuclear magnetic resonance. Mutants at these residues display the same growth defects as for ΔsmpB strains. The SmpB protein has functional and structural similarities with initiation factor 1, and is proposed to be a functional mimic of the pairing between a codon and an anticodon. PMID:19132006

  12. Ribosome hijacking: a role for small protein B during trans-translation.

    PubMed

    Nonin-Lecomte, Sylvie; Germain-Amiot, Noella; Gillet, Reynald; Hallier, Marc; Ponchon, Luc; Dardel, Frédéric; Felden, Brice

    2009-02-01

    Tight recognition of codon-anticodon pairings by the ribosome ensures the accuracy and fidelity of protein synthesis. In eubacteria, translational surveillance and ribosome rescue are performed by the 'tmRNA-SmpB' system (transfer messenger RNA-small protein B). Remarkably, entry and accommodation of aminoacylated-tmRNA into stalled ribosomes occur without a codon-anticodon interaction but in the presence of SmpB. Here, we show that within a stalled ribosome, SmpB interacts with the three universally conserved bases G530, A1492 and A1493 that form the 30S subunit decoding centre, in which canonical codon-anticodon pairing occurs. The footprints at positions A1492 and A1493 of a small decoding centre, as well as on a set of conserved SmpB amino acids, were identified by nuclear magnetic resonance. Mutants at these residues display the same growth defects as for DeltasmpB strains. The SmpB protein has functional and structural similarities with initiation factor 1, and is proposed to be a functional mimic of the pairing between a codon and an anticodon.

  13. Protein folding on the ribosome studied using NMR spectroscopy

    PubMed Central

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  14. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    PubMed

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity.

    PubMed

    Andrade, José M; Dos Santos, Ricardo F; Chelysheva, Irina; Ignatova, Zoya; Arraiano, Cecília M

    2018-06-01

    Ribosome biogenesis is a complex process involving multiple factors. Here, we show that the widely conserved RNA chaperone Hfq, which can regulate sRNA-mRNA basepairing, plays a critical role in rRNA processing and ribosome assembly in Escherichia coli Hfq binds the 17S rRNA precursor and facilitates its correct processing and folding to mature 16S rRNA Hfq assists ribosome assembly and associates with pre-30S particles but not with mature 30S subunits. Inactivation of Hfq strikingly decreases the pool of mature 70S ribosomes. The reduction in ribosome levels depends on residues located in the distal face of Hfq but not on residues found in the proximal and rim surfaces which govern interactions with the sRNAs. Our results indicate that Hfq-mediated regulation of ribosomes is independent of its function as sRNA-regulator. Furthermore, we observed that inactivation of Hfq compromises translation efficiency and fidelity, both features of aberrantly assembled ribosomes. Our work expands the functions of the Sm-like protein Hfq beyond its function in small RNA-mediated regulation and unveils a novel role of Hfq as crucial in ribosome biogenesis and translation. © 2018 The Authors.

  17. Ribosomal Vaccines I. Immunogenicity of Ribosomal Fractions Isolated from Salmonella typhimurium and Yersinia pestis

    PubMed Central

    Johnson, William

    1972-01-01

    The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein. Images PMID:4564407

  18. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    PubMed

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Biogenesis of cytosolic ribosomes requires the essential iron–sulphur protein Rli1p and mitochondria

    PubMed Central

    Kispal, Gyula; Sipos, Katalin; Lange, Heike; Fekete, Zsuzsanna; Bedekovics, Tibor; Janáky, Tamás; Bassler, Jochen; Aguilar Netz, Daili J; Balk, Janneke; Rotte, Carmen; Lill, Roland

    2005-01-01

    Mitochondria perform a central function in the biogenesis of cellular iron–sulphur (Fe/S) proteins. It is unknown to date why this biosynthetic pathway is indispensable for life, the more so as no essential mitochondrial Fe/S proteins are known. Here, we show that the soluble ATP-binding cassette (ABC) protein Rli1p carries N-terminal Fe/S clusters that require the mitochondrial and cytosolic Fe/S protein biogenesis machineries for assembly. Mutations in critical cysteine residues of Rli1p abolish association with Fe/S clusters and lead to loss of cell viability. Hence, the essential character of Fe/S clusters in Rli1p explains the indispensable character of mitochondria in eukaryotes. We further report that Rli1p is associated with ribosomes and with Hcr1p, a protein involved in rRNA processing and translation initiation. Depletion of Rli1p causes a nuclear export defect of the small and large ribosomal subunits and subsequently a translational arrest. Thus, ribosome biogenesis and function are intimately linked to the crucial role of mitochondria in the maturation of the essential Fe/S protein Rli1p. PMID:15660134

  20. Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice.

    PubMed

    Smith, Mark A; Katsouri, Loukia; Irvine, Elaine E; Hankir, Mohammed K; Pedroni, Silvia M A; Voshol, Peter J; Gordon, Matthew W; Choudhury, Agharul I; Woods, Angela; Vidal-Puig, Antonio; Carling, David; Withers, Dominic J

    2015-04-21

    Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC) and agouti-related protein (AgRP) neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Small protein domains fold inside the ribosome exit tunnel.

    PubMed

    Marino, Jacopo; von Heijne, Gunnar; Beckmann, Roland

    2016-03-01

    Cotranslational folding of small protein domains within the ribosome exit tunnel may be an important cellular strategy to avoid protein misfolding. However, the pathway of cotranslational folding has so far been described only for a few proteins, and therefore, it is unclear whether folding in the ribosome exit tunnel is a common feature for small protein domains. Here, we have analyzed nine small protein domains and determined at which point during translation their folding generates sufficient force on the nascent chain to release translational arrest by the SecM arrest peptide, both in vitro and in live E. coli cells. We find that all nine protein domains initiate folding while still located well within the ribosome exit tunnel. © 2016 Federation of European Biochemical Societies.

  2. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    PubMed

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  3. The putative RNA helicase Dbp6p functionally interacts with Rpl3p, Nop8p and the novel trans-acting Factor Rsa3p during biogenesis of 60S ribosomal subunits in Saccharomyces cerevisiae.

    PubMed Central

    de la Cruz, Jesús; Lacombe, Thierry; Deloche, Olivier; Linder, Patrick; Kressler, Dieter

    2004-01-01

    Ribosome biogenesis requires at least 18 putative ATP-dependent RNA helicases in Saccharomyces cerevisiae. To explore the functional environment of one of these putative RNA helicases, Dbp6p, we have performed a synthetic lethal screen with dbp6 alleles. We have previously characterized the nonessential Rsa1p, whose null allele is synthetically lethal with dbp6 alleles. Here, we report on the characterization of the four remaining synthetic lethal mutants, which reveals that Dbp6p also functionally interacts with Rpl3p, Nop8p, and the so-far-uncharacterized Rsa3p (ribosome assembly 3). The nonessential Rsa3p is a predominantly nucleolar protein required for optimal biogenesis of 60S ribosomal subunits. Both Dbp6p and Rsa3p are associated with complexes that most likely correspond to early pre-60S ribosomal particles. Moreover, Rsa3p is co-immunoprecipitated with protA-tagged Dbp6p under low salt conditions. In addition, we have established a synthetic interaction network among factors involved in different aspects of 60S-ribosomal-subunit biogenesis. This extensive genetic analysis reveals that the rsa3 null mutant displays some specificity by being synthetically lethal with dbp6 alleles and by showing some synthetic enhancement with the nop8-101 and the rsa1 null allele. PMID:15126390

  4. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    DOE PAGES

    Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...

    2015-04-30

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less

  5. Structural basis for translational surveillance by the large ribosomal subunit-associated protein quality control complex

    PubMed Central

    Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.

    2014-01-01

    All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383

  6. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate.

    PubMed

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-09-27

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.

  7. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate

    PubMed Central

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-01-01

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515

  8. Research on ribosome-inactivating proteins from angiospermae to gymnospermae and cryptogamia

    PubMed Central

    Liu, Wang-Yi

    2017-01-01

    Ribosome-inactivating Proteins (RIPs) are a group of cytotoxin proteins that usually contain a RNA N-glycosidase domain, which irreversibly inactivates ribosome, thus inhibiting protein synthesis. During the past 14 years (1990-2004), the studies conducted in our laboratory had been focusing on the structure and enzymatic mechanism of several PIPs. Herein, we briefly described a summary of the studies conducted mainly in our laboratory on RIPs from angiospermae to gymnospermae and cryptogamia as follows. (1) Cinnamomin is a novel type II RIP isolated from mature seeds of camphor tree. Like ricin, it specifically removes the adenine at A4324 in rat liver 28S rRNA. We systematically studied this low-toxic RIP in term of its enzymatic mechanism, the primary and crystal structure and the nucleotide sequence of its gene, the genetic expression, and its physiological role in the seed cell and the toxicity to human cancer cells and insect larvae. The cleavage of supercoiled double-stranded DNA was its intrinsic property of cinnamomin A-chain, its N- and C-terminal regions were found to be required for deadenylation of rRNA and also necessary for deadenylation of supercoiled double-stranded circular DNA. These results strongly excluded the possibility that cleavage of supercoiled DNA was due to nuclease contamination. (2) Trichosanthin, an abortifacient protein, was purified from the Chinese medicinal herb, Tian-hua-fen, obtained from root tubers of Chinese trichosanthes plant. We proved that trichosanthin was a RNA N-glycosidase, inactivating eukaryotic ribosome by hydrolyzing the N-C glycosidic bond of the adenose at site 4324 in rat 28S rRNA, and inhibited protein synthesis in vitro. (3) A unique Biota orientalis RNase (RNase Bo) was extracted from the mature seeds of the cypress cypress tree (Oriental arborvita), which was gymnospermae plant. It cleaved only a specific phosphodiester bond between C4453 and A4454 of 28S RNA in rat ribosomes, producing a small RNA

  9. Regulation of the protein-conducting channel by a bound ribosome

    PubMed Central

    Gumbart, James; Trabuco, Leonardo G.; Schreiner, Eduard; Villa, Elizabeth; Schulten, Klaus

    2009-01-01

    Summary During protein synthesis, it is often necessary for the ribosome to form a complex with a membrane-bound channel, the SecY/Sec61 complex, in order to translocate nascent proteins across a cellular membrane. Structural data on the ribosome-channel complex are currently limited to low-resolution cryo-electron microscopy maps, including one showing a bacterial ribosome bound to a monomeric SecY complex. Using that map along with available atomic-level models of the ribosome and SecY, we have determined, through molecular dynamics flexible fitting (MDFF), an atomic-resolution model of the ribosome-channel complex. We characterized computationally the sites of ribosome-SecY interaction within the complex and determined the effect of ribosome binding on the SecY channel. We also constructed a model of a ribosome in complex with a SecY dimer by adding a second copy of SecY to the MDFF-derived model. The study involved 2.7-million-atom simulations over altogether nearly 50 ns. PMID:19913480

  10. Tobacco etch virus protein P1 traffics to the nucleolus and associates with the host 60S ribosomal subunits during infection.

    PubMed

    Martínez, Fernando; Daròs, José-Antonio

    2014-09-01

    The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly

  11. Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

    PubMed Central

    Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

    2007-01-01

    Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

  12. A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

    PubMed Central

    Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

    2009-01-01

    Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

  13. A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

    PubMed

    Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

    2009-05-01

    Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

  14. Identification of p90 Ribosomal S6 Kinase 2 as a Novel Host Protein in HBx Augmenting HBV Replication by iTRAQ-Based Quantitative Comparative Proteomics.

    PubMed

    Yan, Li-Bo; Yu, You-Jia; Zhang, Qing-Bo; Tang, Xiao-Qiong; Bai, Lang; Huang, FeiJun; Tang, Hong

    2018-05-01

    The aim of this study was to screen for novel host proteins that play a role in HBx augmenting Hepatitis B virus (HBV) replication. Three HepG2 cell lines stably harboring different functional domains of HBx (HBx, HBx-Cm6, and HBx-Cm16) were cultured. ITRAQ technology integrated with LC-MS/MS analysis was applied to identify the proteome differences among these three cell lines. In brief, a total of 70 different proteins were identified among HepG2-HBx, HepG2-HBx-Cm6, and HepG2-HBx-Cm16 by double repetition. Several differentially expressed proteins, including p90 ribosomal S6 kinase 2 (RSK2), were further validated. RSK2 was expressed at higher levels in HepG2-HBx and HepG2-HBx-Cm6 compared with HepG2-HBx-Cm16. Furthermore, levels of HBV replication intermediates were decreased after silencing RSK2 in HepG2.2.15. An HBx-minus HBV mutant genome led to decreased levels of HBV replication intermediates and these decreases were restored to levels similar to wild-type HBV by transient ectopic expression of HBx. After silencing RSK2 expression, the levels of HBV replication intermediates synthesized from the HBx-minus HBV mutant genome were not restored to levels that were observed with wild-type HBV by transient HBx expression. Based on iTRAQ quantitative comparative proteomics, RSK2 was identified as a novel host protein that plays a role in HBx augmenting HBV replication. © 2018 The Authors. Proteomics - Clinical Application Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. G-protein control of the ribosome-associated stress response protein SpoT.

    PubMed

    Jiang, Mengxi; Sullivan, Susan M; Wout, Patrice K; Maddock, Janine R

    2007-09-01

    The bacterial response to stress is controlled by two proteins, RelA and SpoT. RelA generates the alarmone (p)ppGpp under amino acid starvation, whereas SpoT is responsible for (p)ppGpp hydrolysis and for synthesis of (p)ppGpp under a variety of cellular stress conditions. It is widely accepted that RelA is associated with translating ribosomes. The cellular location of SpoT, however, has been controversial. SpoT physically interacts with the ribosome-associated GTPase CgtA, and we show here that, under an optimized salt condition, SpoT is also associated with a pre-50S particle. Analysis of spoT and cgtA mutants and strains overexpressing CgtA suggests that the ribosome associations of SpoT and CgtA are mutually independent. The steady-state level of (p)ppGpp is increased in a cgtA mutant, but the accumulation of (p)ppGpp during amino acid starvation is not affected, providing strong evidence that CgtA regulates the (p)ppGpp level during exponential growth but not during the stringent response. We show that CgtA is not associated with pre-50S particles during amino acid starvation, indicating that under these conditions in which (p)ppGpp accumulates, CgtA is not bound either to the pre-50S particle or to SpoT. We propose that, in addition to its role as a 50S assembly factor, CgtA promotes SpoT (p)ppGpp degradation activity on the ribosome and that the loss of CgtA from the ribosome is necessary for maximal (p)ppGpp accumulation under stress conditions. Intriguingly, we found that in the absence of spoT and relA, cgtA is still an essential gene in Escherichia coli.

  16. Role of blood ribosomal protein S19 in coagulum resorption: a study using Gln137Glu-ribosomal protein S19 gene knock-in mouse.

    PubMed

    Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro

    2014-11-01

    Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

  17. Influence of the stringent control system on the transcription of ribosomal ribonucleic acid and ribosomal protein genes in Escherichia coli.

    PubMed Central

    Dennis, P P

    1977-01-01

    The fraction of the total ribonucleic acid (RNA) synthesis rate that is messenger RNA (mRNA) for ribosomal protein (r-protein) and ribosomal RNA (rRNA) has been estimated in valS(Ts) rel+ stringent and valS(Ts) relA1 relaxed strains of Escherichia coli during a partial inhibition of valyl-transfer RNA aminoacylation. The partial inhibition was accomplished by shifting the strains from the permissive growth temperature of 29.5 degrees C to the semipermissive temperature of 35.5 degrees C. The RNA synthesized at the elevated temperature was pulse labeled with [3H]uracil. The fraction of the total incorpoarted 3H radioactivity in r-protein mRNA or in rRNA was estimated by specific hybridization to the transducing phages gammaspc1, which carries about 15 r-protein genes and lambdailv5, which carries an rRNA transcription unit. The results clearly demonstrate that the rel gene influences the fraction of the total RNA synthesis rate that is r protein mRNA and rRNA; in the rel+ strain they are significantly increased relative to control cultures. This indicates that the expression of the genes coding for the RNA and protein component of the ribosome are most likely regulated at the level of transcription. Furthermore, it appears that the distribution of functioning RNA polymerase between rRNA genes, r-protein genes, and other types of genes is influenced by the rel gene control system; presumably this influence is mediated through the unusual nucleotide guanosine tetraphosphate. PMID:320185

  18. Mutation of the key residue for extraribosomal function of ribosomal protein S19 cause increased grooming behaviors in mice.

    PubMed

    Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro

    2016-08-26

    Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. Structures of the orthosomycin antibiotics avilamycin and evernimicin in complex with the bacterial 70S ribosome

    PubMed Central

    Arenz, Stefan; Graf, Michael; Nguyen, Fabian; Huter, Paul; Polikanov, Yury S.; Blanchard, Scott C.; Wilson, Daniel N.

    2016-01-01

    The ribosome is one of the major targets for therapeutic antibiotics; however, the rise in multidrug resistance is a growing threat to the utility of our current arsenal. The orthosomycin antibiotics evernimicin (EVN) and avilamycin (AVI) target the ribosome and do not display cross-resistance with any other classes of antibiotics, suggesting that they bind to a unique site on the ribosome and may therefore represent an avenue for development of new antimicrobial agents. Here we present cryo-EM structures of EVN and AVI in complex with the Escherichia coli ribosome at 3.6- to 3.9-Å resolution. The structures reveal that EVN and AVI bind to a single site on the large subunit that is distinct from other known antibiotic binding sites on the ribosome. Both antibiotics adopt an extended conformation spanning the minor grooves of helices 89 and 91 of the 23S rRNA and interacting with arginine residues of ribosomal protein L16. This binding site overlaps with the elbow region of A-site bound tRNA. Consistent with this finding, single-molecule FRET (smFRET) experiments show that both antibiotics interfere with late steps in the accommodation process, wherein aminoacyl-tRNA enters the peptidyltransferase center of the large ribosomal subunit. These data provide a structural and mechanistic rationale for how these antibiotics inhibit the elongation phase of protein synthesis. PMID:27330110

  20. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  1. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    NASA Astrophysics Data System (ADS)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  2. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    PubMed

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  3. Mpp10 represents a platform for the interaction of multiple factors within the 90S pre-ribosome

    PubMed Central

    Kharde, Satyavati; Ahmed, Yasar Luqman; Stier, Gunter; Kunze, Ruth; Sinning, Irmgard

    2017-01-01

    In eukaryotes, ribosome assembly is a highly complex process that involves more than 200 assembly factors that ensure the folding, modification and processing of the different rRNA species as well as the timely association of ribosomal proteins. One of these factors, Mpp10 associates with Imp3 and Imp4 to form a complex that is essential for the normal production of the 18S rRNA. Here we report the crystal structure of a complex between Imp4 and a short helical element of Mpp10 to a resolution of 1.88 Å. Furthermore, we extend the interaction network of Mpp10 and characterize two novel interactions. Mpp10 is able to bind the ribosome biogenesis factor Utp3/Sas10 through two conserved motifs in its N-terminal region. In addition, Mpp10 interacts with the ribosomal protein S5/uS7 using a short stretch within an acidic loop region. Thus, our findings reveal that Mpp10 provides a platform for the simultaneous interaction with multiple proteins in the 90S pre-ribosome. PMID:28813493

  4. Purification, characterization and crystallization of the human 80S ribosome

    PubMed Central

    Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

    2014-01-01

    Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

  5. Phosphorylation of Ribosomal Protein S6 Kinase 1 at Thr421/Ser424 and Dephosphorylation at Thr389 Regulates SP600125-Induced Polyploidization of Megakaryocytic Cell Lines

    PubMed Central

    Lin, Di; Zhao, Yong-Shan; Liu, Shuo; Xing, Si-Ning; Zhao, Song; Chen, Cong-Qin; Jiang, Zhi-Ming; Pu, Fei-Fei; Cao, Jian-Ping; Ma, Dong-Chu

    2014-01-01

    Megakaryocytes (MKs) are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1) at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL) and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in the SP600125

  6. Phosphorylation of ribosomal protein S6 kinase 1 at Thr421/Ser424 and dephosphorylation at Thr389 regulates SP600125-induced polyploidization of megakaryocytic cell lines.

    PubMed

    Li, Chang-Ling; Yang, Jin-Gang; Lin, Di; Zhao, Yong-Shan; Liu, Shuo; Xing, Si-Ning; Zhao, Song; Chen, Cong-Qin; Jiang, Zhi-Ming; Pu, Fei-Fei; Cao, Jian-Ping; Ma, Dong-Chu

    2014-01-01

    Megakaryocytes (MKs) are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1) at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL) and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in the SP600125

  7. Pokeweed Antiviral Protein, a Ribosome Inactivating Protein: Activity, Inhibition and Prospects

    PubMed Central

    Domashevskiy, Artem V.; Goss, Dixie J.

    2015-01-01

    Viruses employ an array of elaborate strategies to overcome plant defense mechanisms and must adapt to the requirements of the host translational systems. Pokeweed antiviral protein (PAP) from Phytolacca americana is a ribosome inactivating protein (RIP) and is an RNA N-glycosidase that removes specific purine residues from the sarcin/ricin (S/R) loop of large rRNA, arresting protein synthesis at the translocation step. PAP is thought to play an important role in the plant’s defense mechanism against foreign pathogens. This review focuses on the structure, function, and the relationship of PAP to other RIPs, discusses molecular aspects of PAP antiviral activity, the novel inhibition of this plant toxin by a virus counteraction—a peptide linked to the viral genome (VPg), and possible applications of RIP-conjugated immunotoxins in cancer therapeutics. PMID:25635465

  8. Methylation of yeast ribosomal protein Rpl3 promotes translational elongation fidelity.

    PubMed

    Al-Hadid, Qais; Roy, Kevin; Chanfreau, Guillaume; Clarke, Steven G

    2016-04-01

    Rpl3, a highly conserved ribosomal protein, is methylated at histidine 243 by the Hpm1 methyltransferase in Saccharomyces cerevisiae. Histidine 243 lies close to the peptidyl transferase center in a functionally important region of Rpl3 designated as the basic thumb that coordinates the decoding, peptidyl transfer, and translocation steps of translation elongation. Hpm1 was recently implicated in ribosome biogenesis and translation. However, the biological role of methylation of its Rpl3 substrate has not been identified. Here we interrogate the role of Rpl3 methylation at H243 by investigating the functional impact of mutating this histidine residue to alanine (rpl3-H243A). Akin to Hpm1-deficient cells, rpl3-H243A cells accumulate 35S and 23S pre-rRNA precursors to a similar extent, confirming an important role for histidine methylation in pre-rRNA processing. In contrast, Hpm1-deficient cells but not rpl3-H243A mutants show perturbed levels of ribosomal subunits. We show that Hpm1 has multiple substrates in different subcellular fractions, suggesting that methylation of proteins other than Rpl3 may be important for controlling ribosomal subunit levels. Finally, translational fidelity assays demonstrate that like Hpm1-deficient cells, rpl3-H243A mutants have defects in translation elongation resulting in decreased translational accuracy. These data suggest that Rpl3 methylation at H243 is playing a significant role in translation elongation, likely via the basic thumb, but has little impact on ribosomal subunit levels. Hpm1 is therefore a multifunctional methyltransferase with independent roles in ribosome biogenesis and translation. © 2016 Al-Hadid et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  9. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    PubMed

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  10. Has1 regulates consecutive maturation and processing steps for assembly of 60S ribosomal subunits

    PubMed Central

    Dembowski, Jill A.; Kuo, Benjamin; Woolford, John L.

    2013-01-01

    Ribosome biogenesis requires ∼200 assembly factors in Saccharomyces cerevisiae. The pre-ribosomal RNA (rRNA) processing defects associated with depletion of most of these factors have been characterized. However, how assembly factors drive the construction of ribonucleoprotein neighborhoods and how structural rearrangements are coupled to pre-rRNA processing are not understood. Here, we reveal ATP-independent and ATP-dependent roles of the Has1 DEAD-box RNA helicase in consecutive pre-rRNA processing and maturation steps for construction of 60S ribosomal subunits. Has1 associates with pre-60S ribosomes in an ATP-independent manner. Has1 binding triggers exonucleolytic trimming of 27SA3 pre-rRNA to generate the 5′ end of 5.8S rRNA and drives incorporation of ribosomal protein L17 with domain I of 5.8S/25S rRNA. ATP-dependent activity of Has1 promotes stable association of additional domain I ribosomal proteins that surround the polypeptide exit tunnel, which are required for downstream processing of 27SB pre-rRNA. Furthermore, in the absence of Has1, aberrant 27S pre-rRNAs are targeted for irreversible turnover. Thus, our data support a model in which Has1 helps to establish domain I architecture to prevent pre-rRNA turnover and couples domain I folding with consecutive pre-rRNA processing steps. PMID:23788678

  11. Fabrication and characteristics of MOSFET protein chip for detection of ribosomal protein.

    PubMed

    Park, Keun-Yong; Kim, Min-Suk; Choi, Sie-Young

    2005-04-15

    A metal oxide silicon field effect transistor (MOSFET) protein chip for the easy detection of protein was fabricated and its characteristics were investigated. Generally, the drain current of the MOSFET is varied by the gate potential. It is expected that the formation of an antibody-antigen complex on the gate of MOSFET would lead to a detectable change in the charge distribution and thus, directly modulate the drain current of MOSFET. As such, the drain current of the MOSFET protein chip can be varied by ribosomal proteins absorbed by the self-assembled monolayer (SAM) immobilized on the gate (Au) surface, as ribosomal protein has positive charge, and these current variations then used as the response of the protein chip. The gate of MOSFET protein chip is not directly biased by an external voltage source, so called open gate or floating gate MOSFET, but rather chemically modified by immobilized molecular receptors called self-assembled monolayer (SAM). In our experiments, the current variation in the proposed protein chip was about 8% with a protein concentration of 0.7 mM. As the protein concentration increased, the drain current also gradually increased. In addition, there were some drift of the drain current in the device. It is considered that these drift might be caused by the drift from the MOSFET itself or protein absorption procedures that are relied on the facile attachment of thiol (-S) ligands to the gate (Au) surface. We verified the formation of SAM on the gold surface and the absorption of protein through the surface plasmon resonance (SPR) measurement.

  12. Protein Folding Activity of the Ribosome is involved in Yeast Prion Propagation

    PubMed Central

    Blondel, Marc; Soubigou, Flavie; Evrard, Justine; Nguyen, Phu hai; Hasin, Naushaba; Chédin, Stéphane; Gillet, Reynald; Contesse, Marie-Astrid; Friocourt, Gaëlle; Stahl, Guillaume; Jones, Gary W.; Voisset, Cécile

    2016-01-01

    6AP and GA are potent inhibitors of yeast and mammalian prions and also specific inhibitors of PFAR, the protein-folding activity borne by domain V of the large rRNA of the large subunit of the ribosome. We therefore explored the link between PFAR and yeast prion [PSI+] using both PFAR-enriched mutants and site-directed methylation. We demonstrate that PFAR is involved in propagation and de novo formation of [PSI+]. PFAR and the yeast heat-shock protein Hsp104 partially compensate each other for [PSI+] propagation. Our data also provide insight into new functions for the ribosome in basal thermotolerance and heat-shocked protein refolding. PFAR is thus an evolutionarily conserved cell component implicated in the prion life cycle, and we propose that it could be a potential therapeutic target for human protein misfolding diseases. PMID:27633137

  13. A gene family for acidic ribosomal proteins in Schizosaccharomyces pombe: two essential and two nonessential genes.

    PubMed Central

    Beltrame, M; Bianchi, M E

    1990-01-01

    We have cloned the genes for small acidic ribosomal proteins (A-proteins) of the fission yeast Schizosaccharomyces pombe. S. pombe contains four transcribed genes for small A-proteins per haploid genome, as is the case for Saccharomyces cerevisiae. In contrast, multicellular eucaryotes contain two transcribed genes per haploid genome. The four proteins of S. pombe, besides sharing a high overall similarity, form two couples of nearly identical sequences. Their corresponding genes have a very conserved structure and are transcribed to a similar level. Surprisingly, of each couple of genes coding for nearly identical proteins, one is essential for cell growth, whereas the other is not. We suggest that the unequal importance of the four small A-proteins for cell survival is related to their physical organization in 60S ribosomal subunits. Images PMID:2325655

  14. The antituberculosis antibiotic capreomycin inhibits protein synthesis by disrupting interaction between ribosomal proteins L12 and L10.

    PubMed

    Lin, Yuan; Li, Yan; Zhu, Ningyu; Han, Yanxing; Jiang, Wei; Wang, Yanchang; Si, Shuyi; Jiang, Jiandong

    2014-01-01

    Capreomycin is a second-line drug for multiple-drug-resistant tuberculosis (TB). However, with increased use in clinics, the therapeutic efficiency of capreomycin is decreasing. To better understand TB resistance to capreomycin, we have done research to identify the molecular target of capreomycin. Mycobacterium tuberculosis ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors during translation. Hence, the L12-L10 interaction is considered to be essential for ribosomal function and protein synthesis. Here we provide evidence showing that capreomycin inhibits the L12-L10 interaction by using an established L12-L10 interaction assay. Overexpression of L12 and/or L10 in M. smegmatis, a species close to M. tuberculosis, increases the MIC of capreomycin. Moreover, both elongation factor G-dependent GTPase activity and ribosome-mediated protein synthesis are inhibited by capreomycin. When protein synthesis was blocked with thiostrepton, however, the bactericidal activity of capreomycin was restrained. All of these results suggest that capreomycin seems to inhibit TB by interrupting the L12-L10 interaction. This finding might provide novel clues for anti-TB drug discovery.

  15. Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus.

    PubMed

    Jahn, O; Hartmann, R K; Boeckh, T; Erdmann, V A

    1991-06-01

    The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.

  16. Role of p70S6K1-mediated phosphorylation of eIF4B and PDCD4 proteins in the regulation of protein synthesis.

    PubMed

    Dennis, Michael D; Jefferson, Leonard S; Kimball, Scot R

    2012-12-14

    Modulation of mRNA binding to the 40 S ribosomal subunit during translation initiation controls not only global rates of protein synthesis but also regulates the pattern of protein expression by allowing for selective inclusion, or exclusion, of mRNAs encoding particular proteins from polysomes. The mRNA binding step is modulated by signaling through a protein kinase known as the mechanistic target of rapamycin complex 1 (mTORC1). mTORC1 directly phosphorylates the translational repressors eIF4E binding proteins (4E-BP) 1 and 2, releasing them from the mRNA cap binding protein eIF4E, thereby promoting assembly of the eIF4E·eIF4G complex. mTORC1 also phosphorylates the 70-kDa ribosomal protein S6 kinase 1 (p70S6K1), which subsequently phosphorylates eIF4B, and programmed cell death 4 (PDCD4), which sequesters eIF4A from the eIF4E·eIF4G complex, resulting in repressed translation of mRNAs with highly structured 5'-untranslated regions. In the present study, we compared the role of the 4E-BPs in the regulation of global rates of protein synthesis to that of eIF4B and PDCD4. We found that maintenance of eIF4E interaction with eIF4G was not by itself sufficient to sustain global rates of protein synthesis in the absence of mTORC1 signaling to p70S6K1; phosphorylation of both eIF4B and PDCD4 was additionally required. We also found that the interaction of eIF4E with eIF4G was maintained in the liver of fasted rats as well as in serum-deprived mouse embryo fibroblasts lacking both 4E-BP1 and 4E-BP2, suggesting that the interaction of eIF4G with eIF4E is controlled primarily through the 4E-BPs.

  17. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    PubMed

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  18. Genistein promotes insulin action through adenosine monophosphate-activated protein kinase activation and p70 ribosomal protein S6 kinase 1 inhibition in the skeletal muscle of mice fed a high energy diet.

    PubMed

    Arunkumar, Elumalai; Anuradha, Carani Venkatraman

    2012-08-01

    Genistein (GEN), a soy isoflavone, exerts insulin-sensitizing actions in animals; however, the underlying mechanisms have not been determined. Because GEN is a known activator of adenosine monophosphate-activated protein kinase (AMPK), we hypothesize that GEN activates insulin signaling through AMPK activation. To test this hypothesis, a high fat-high fructose diet (HFFD)-fed mice model of insulin resistance was administered GEN, and the insulin signaling pathway proteins in the skeletal muscle were examined. Hyperglycemia and hyperinsulinemia observed in HFFD-fed mice were significantly lowered by GEN. GEN increased insulin-stimulated tyrosine phosphorylation of insulin receptor-β and insulin receptor substrate (IRS) 1 but down-regulated IRS-1 serine phosphorylation in the skeletal muscle of HFFD-fed mice. Furthermore, GEN treatment improved muscle IRS-1-associated phospatidylinositol-3 kinase expression, phosphorylation of Akt at Ser(473), and translocation of glucose transporter subtype 4. Phosphorylation of AMPK at Thr(172) and acetyl coenzyme A carboxylase (ACC) at Ser(79) was augmented, whereas phosphorylation of p70 ribosomal protein S6 kinase 1 at Thr(389) was significantly decreased after GEN treatment in the skeletal muscle of HFFD-fed mice. These results suggest that GEN might improve insulin action in the skeletal muscle by targeting AMPK. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. The Flavonoid Apigenin Downregulates CDK1 by Directly Targeting Ribosomal Protein S9

    PubMed Central

    Iizumi, Yosuke; Oishi, Masakatsu; Taniguchi, Tomoyuki; Goi, Wakana; Sowa, Yoshihiro; Sakai, Toshiyuki

    2013-01-01

    Flavonoids have been reported to inhibit tumor growth by causing cell cycle arrest. However, little is known about the direct targets of flavonoids in tumor growth inhibition. In the present study, we developed a novel method using magnetic FG beads to purify flavonoid-binding proteins, and identified ribosomal protein S9 (RPS9) as a binding partner of the flavonoid apigenin. Similar to treatment with apigenin, knockdown of RPS9 inhibited the growth of human colon cancer cells at the G2/M phase by downregulating cyclin-dependent kinase 1 (CDK1) expression at the promoter level. Furthermore, knockdown of RPS9 suppressed G2/M arrest caused by apigenin. These results suggest that apigenin induces G2/M arrest at least partially by directly binding and inhibiting RPS9 which enhances CDK1 expression. We therefore raise the possibility that identification of the direct targets of flavonoids may contribute to the discovery of novel molecular mechanisms governing tumor growth. PMID:24009741

  20. Basic anatomy and tumor biology of the RPS6KA6 gene that encodes the p90 ribosomal S6 kinase-4

    PubMed Central

    Sun, Yuan; Cao, Shousong; Yang, Min; Wu, Sihong; Wang, Zhe; Lin, Xiukun; Song, Xiangrang; Liao, D.J.

    2012-01-01

    The RPS6KA6 gene encodes the p90 ribosomal S6 kinase-4 (RSK4) that is still largely uncharacterized. In this study we identified a new RSK4 transcription initiation site and several alternative splice sites with a 5’RACE approach. The resulting mRNA variants encompass four possible first start codons. The first 15 nucleotides (nt) of exon 22 in mouse and the penultimate exon in both human (exon 21) and mouse (exon 24) RSK4 underwent alternative splicing, although the penultimate exon deleted variant appeared mainly in cell clines, but not in most normal tissues. Demethylation agent 5-azacytidine inhibited the deletion of the penultimate exon whereas two indolocarbazole-derived inhibitors of cyclin dependent kinase 4 or 6 induced deletion of the first 39 nt from exon 21 of human RSK4. In all human cancer cell lines studied, the 90-kD wild type RSK4 was sparse but, surprisingly, several isoforms at or smaller than 72-kD were expressed as detected by seven different antibodies. On immunoblots, each of these smaller isoforms often appeared as a duplet or triplet and the levels of these isoforms varied greatly among different cell lines and culture conditions. Cyclin D1 inhibited RSK4 expression and serum starvation enhanced the inhibition, whereas c-Myc and RSK4 inhibited cyclin D1. The effects of RSK4 on cell growth, cell death and chemoresponse depended on the mRNA variant or the protein isoform expressed, on the specificity of the cell lines, as well as on the anchorage-dependent or -independent growth conditions and the in vivo situation. Moreover, we also observed that even a given cDNA might be expressed to multiple proteins; therefore, when using a cDNA, one needs to exclude this possibility before attribution of the biological results from the cDNA to the anticipated protein. Collectively, our results suggest that whether RSK4 is oncogenic or tumor suppressive depends on many factors. PMID:22614021

  1. High-resolution structure of the Escherichia coli ribosome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less

  2. High-resolution structure of the Escherichia coli ribosome

    DOE PAGES

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; ...

    2015-03-16

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less

  3. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    PubMed

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. The nuclear import of ribosomal proteins is regulated by mTOR

    PubMed Central

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  5. Quantitation of ten 30S ribosomal assembly intermediates using fluorescence triple correlation spectroscopy

    PubMed Central

    Ridgeway, William K.; Millar, David P.; Williamson, James R.

    2012-01-01

    The self-assembly of bacterial 30S ribosomes involves a large number of RNA folding and RNA-protein binding steps. The sequence of steps determines the overall assembly mechanism and the structure of the mechanism has ramifications for the robustness of biogenesis and resilience against kinetic traps. Thermodynamic interdependencies of protein binding inferred from omission-reconstitution experiments are thought to preclude certain assembly pathways and thus enforce ordered assembly, but this concept is at odds with kinetic data suggesting a more parallel assembly landscape. A major challenge is deconvolution of the statistical distribution of intermediates that are populated during assembly at high concentrations approaching in vivo assembly conditions. To specifically resolve the intermediates formed by binding of three ribosomal proteins to the full length 16S rRNA, we introduce Fluorescence Triple-Correlation Spectroscopy (F3CS). F3CS identifies specific ternary complexes by detecting coincident fluctuations in three-color fluorescence data. Triple correlation integrals quantify concentrations and diffusion kinetics of triply labeled species, and F3CS data can be fit alongside auto-correlation and cross-correlation data to quantify the populations of 10 specific ribosome assembly intermediates. The distribution of intermediates generated by binding three ribosomal proteins to the entire native 16S rRNA included significant populations of species that were not previously thought to be thermodynamically accessible, questioning the current interpretation of the classic omission-reconstitution experiments. F3CS is a general approach for analyzing assembly and function of macromolecular complexes, especially those too large for traditional biophysical methods. PMID:22869699

  6. Ribosome profiling: a Hi-Def monitor for protein synthesis at the genome-wide scale

    PubMed Central

    Michel, Audrey M; Baranov, Pavel V

    2013-01-01

    Ribosome profiling or ribo-seq is a new technique that provides genome-wide information on protein synthesis (GWIPS) in vivo. It is based on the deep sequencing of ribosome protected mRNA fragments allowing the measurement of ribosome density along all RNA molecules present in the cell. At the same time, the high resolution of this technique allows detailed analysis of ribosome density on individual RNAs. Since its invention, the ribosome profiling technique has been utilized in a range of studies in both prokaryotic and eukaryotic organisms. Several studies have adapted and refined the original ribosome profiling protocol for studying specific aspects of translation. Ribosome profiling of initiating ribosomes has been used to map sites of translation initiation. These studies revealed the surprisingly complex organization of translation initiation sites in eukaryotes. Multiple initiation sites are responsible for the generation of N-terminally extended and truncated isoforms of known proteins as well as for the translation of numerous open reading frames (ORFs), upstream of protein coding ORFs. Ribosome profiling of elongating ribosomes has been used for measuring differential gene expression at the level of translation, the identification of novel protein coding genes and ribosome pausing. It has also provided data for developing quantitative models of translation. Although only a dozen or so ribosome profiling datasets have been published so far, they have already dramatically changed our understanding of translational control and have led to new hypotheses regarding the origin of protein coding genes. © 2013 John Wiley & Sons, Ltd. PMID:23696005

  7. Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

    PubMed

    Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

    2016-09-01

    Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

  8. The Use of Plant-Derived Ribosome Inactivating Proteins in Immunotoxin Development: Past, Present and Future Generations

    PubMed Central

    Rust, Aleksander; Partridge, Lynda J.; Davletov, Bazbek

    2017-01-01

    Ribosome inactivating proteins (RIPs) form a class of toxins that was identified over a century ago. They continue to fascinate scientists and the public due to their very high activity and long-term stability which might find useful applications in the therapeutic killing of unwanted cells but can also be used in acts of terror. We will focus our review on the canonical plant-derived RIPs which display ribosomal RNA N-glycosidase activity and irreversibly inhibit protein synthesis by cleaving the 28S ribosomal RNA of the large 60S subunit of eukaryotic ribosomes. We will place particular emphasis on therapeutic applications and the generation of immunotoxins by coupling antibodies to RIPs in an attempt to target specific cells. Several generations of immunotoxins have been developed and we will review their optimisation as well as their use and limitations in pre-clinical and clinical trials. Finally, we endeavour to provide a perspective on potential future developments for the therapeutic use of immunotoxins. PMID:29076988

  9. Hypermethylation of 28S ribosomal RNA in β-thalassemia trait carriers.

    PubMed

    Sornjai, Wannapa; Lithanatudom, Pathrapol; Erales, Jenny; Joly, Philippe; Francina, Alain; Hacot, Sabine; Fucharoen, Suthat; Svasti, Saovaros; Diaz, Jean Jacques; Mertani, Hichem C; Smith, Duncan R

    2017-01-01

    Ribosome biogenesis is the process of synthesis of the cellular ribosomes which mediate protein translation. Integral with the ribosomes are four cytoplasmic ribosomal RNAs (rRNAs) which show extensive post-transcriptional modifications including 2'-O-methylation and pseudouridylation. Several hereditary hematologic diseases including Diamond-Blackfan anemia have been shown to be associated with defects in ribosome biogenesis. Thalassemia is the most important hematologic inherited genetic disease worldwide, and this study examined the post-transcriptional ribose methylation status of three specific active sites of the 28S rRNA molecule at positions 1858, 4197 and 4506 of β-thalassemia trait carriers and normal controls. Samples from whole blood and cultured erythroid cells were examined. Results showed that site 4506 was hypermethylated in β-thalassemia trait carriers in both cohorts. Expression of fibrillarin, the ribosomal RNA methyltransferase as well as snoRNAs were additionally quantified by RT-qPCR and evidence of dysregulation was seen. Hemoglobin E trait carriers also showed evidence of dysregulation. These results provide the first evidence that ribosome biogenesis is dysregulated in β-thalassemia trait carriers. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

    PubMed

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

    2017-11-01

    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  11. THE INTRACELLULAR SITE OF SYNTHESIS OF MITOCHONDRIAL RIBOSOMAL PROTEINS IN NEUROSPORA CRASSA

    PubMed Central

    Lizardi, Paul M.; Luck, David J. L.

    1972-01-01

    The intracellular site of synthesis of mitochondrial ribosomal proteins (MRP) in Neurospora crassa has been investigated using three complementary approaches. (a) Mitochondrial protein synthesis in vitro: Tritium-labeled proteins made by isolated mitochondria were compared to 14C-labeled marker MRP by cofractionation in a two-step procedure involving isoelectric focusing and polyacrylamide gel electrophoresis. Examination of the electrophoretic profiles showed that essentially none of the peaks of in vitro product corresponded exactly to any of the MRP marker peaks. (b) Sensitivity of in vivo MRP synthesis to chloramphenicol: Cells were labeled with leucine-3H in the presence of chloramphenicol, mitochondrial ribosomal subunits were subsequently isolated, and their proteins fractionated by isoelectric focusing followed by gel electrophoresis. The labeling of every single MRP was found to be insensitive to chloramphenicol, a selective inhibitor of mitochondrial protein synthesis. (c) Sensitivity of in vivo MRP synthesis to anisomycin: We have found this antibiotic to be a good selective inhibitor of cytoplasmic protein synthesis in Neurospora. In the presence of anisomycin the labeling of virtually all MRP is inhibited to the same extent as the labeling of cytoplasmic ribosomal proteins. On the basis of these three types of studies we conclude that most if not all 53 structural proteins of mitochondrial ribosomal subunits in Neurospora are synthesized by cytoplasmic ribosomes. PMID:4261038

  12. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli

    PubMed Central

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-01-01

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3′ domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3′-domain is unanchored and the 5′-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells. DOI: http://dx.doi.org/10.7554/eLife.04491.001 PMID:25313868

  13. RPG: the Ribosomal Protein Gene database.

    PubMed

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and information about orthologs. In addition, users can view and compare the gene structures of the above organisms and make multiple amino acid sequence alignments. RPG also provides information on small nucleolar RNAs (snoRNAs) that are encoded in the introns of RP genes.

  14. A Molecular Titration System Coordinates Ribosomal Protein Gene Transcription with Ribosomal RNA Synthesis.

    PubMed

    Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David

    2016-11-17

    Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Defective ribosome assembly in Shwachman-Diamond syndrome.

    PubMed

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  16. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    PubMed

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  17. Single-cell Pharmacodynamic Monitoring of S6 Ribosomal Protein Phosphorylation in AML Blasts During a Clinical Trial Combining the mTOR Inhibitor Sirolimus and Intensive Chemotherapy

    PubMed Central

    Perl, Alexander E.; Kasner, Margaret T.; Shank, Doris; Luger, Selina M.; Carroll, Martin

    2011-01-01

    Purpose Integration of signal transduction inhibitors into chemotherapy regimens generally has generally not led to anticipated increases in response and survival. However, it remains unclear whether this is because of inadequate or inconsistent inhibition of target or other complex biology. The mammalian target of rapamycin (mTOR) signaling pathway is frequently activated in acute myelogenous leukemia (AML) and we previously demonstrated the safety of combining the mTOR inhibitor, sirolimus, with mitoxantrone, etoposide, and cytarabine (MEC) chemotherapy. However, we did not reliably determine the extent of mTOR inhibition on that study. Here we sought to develop an assay that allowed us to serially quantify mTOR kinase’s activation state during therapy. Experimental design To provide evidence of mTOR kinase activation and inhibition, we applied a validated whole blood fixation/permeabilization technique for flow cytometry in order to serially monitor S6 ribosomal protein (S6) phosphorylation in immunophenotypically-identified AML blasts. Results With this approach, we demonstrate activation of mTOR signaling in 8/10 subjects’ samples (80%) and conclusively show inhibition of mTOR in the majority of subjects’ tumor cell during therapy. Of note, S6 phosphorylation in AML blasts is heterogeneous and, in some cases, intrinsically resistant to rapamycin at clinically achieved concentrations. Conclusions The methodology described is rapid and reproducible. We demonstrate the feasibility of real-time, direct pharmacodynamic monitoring by flow cytometry during clinical trials combining intensive chemotherapy and signal transduction inhibitors. This approach greatly clarifies pharmacokinetic/pharmacodynamic relationships and has broad application to pre-clinical and clinical testing of drugs whose direct or downstream effects disrupt PI3K/AKT/mTOR signaling. PMID:22167413

  18. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

    PubMed

    Root-Bernstein, Robert; Root-Bernstein, Meredith

    2016-05-21

    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

  19. RPG: the Ribosomal Protein Gene database

    PubMed Central

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and information about orthologs. In addition, users can view and compare the gene structures of the above organisms and make multiple amino acid sequence alignments. RPG also provides information on small nucleolar RNAs (snoRNAs) that are encoded in the introns of RP genes. PMID:14681386

  20. Differentiation of the Ribosomal Protein Compositions in the Genus Escherichia and Its Related Bacteria

    PubMed Central

    Osawa, Syozo; Itoh, Takuzi; Otaka, Eiko

    1971-01-01

    Compositions of the ribosomal proteins of 60 bacterial strains belonging to the genus Escherichia and its related genera were examined by use of a column of carboxymethyl cellulose. The ribosomes were classified into seven groups and were further differentiated into several types (subgroups) according to their protein compositions. It was shown that ribosomal protein composition is a useful characteristic for studies of bacterial taxonomy. PMID:5563866

  1. The double life of the ribosome: When its protein folding activity supports prion propagation.

    PubMed

    Voisset, Cécile; Blondel, Marc; Jones, Gary W; Friocourt, Gaëlle; Stahl, Guillaume; Chédin, Stéphane; Béringue, Vincent; Gillet, Reynald

    2017-03-04

    It is no longer necessary to demonstrate that ribosome is the central machinery of protein synthesis. But it is less known that it is also key player of the protein folding process through another conserved function: the protein folding activity of the ribosome (PFAR). This ribozyme activity, discovered more than 2 decades ago, depends upon the domain V of the large rRNA within the large subunit of the ribosome. Surprisingly, we discovered that anti-prion compounds are also potent PFAR inhibitors, highlighting an unexpected link between PFAR and prion propagation. In this review, we discuss the ancestral origin of PFAR in the light of the ancient RNA world hypothesis. We also consider how this ribosomal activity fits into the landscape of cellular protein chaperones involved in the appearance and propagation of prions and other amyloids in mammals. Finally, we examine how drugs targeting the protein folding activity of the ribosome could be active against mammalian prion and other protein aggregation-based diseases, making PFAR a promising therapeutic target for various human protein misfolding diseases.

  2. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  3. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    PubMed Central

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  4. Many nonuniversal archaeal ribosomal proteins are found in conserved gene clusters

    PubMed Central

    WANG, JIACHEN; DASGUPTA, INDRANI; FOX, GEORGE E.

    2009-01-01

    The genomic associations of the archaeal ribosomal proteins, (r-proteins), were examined in detail. The archaeal versions of the universal r-protein genes are typically in clusters similar or identical and to those found in bacteria. Of the 35 nonuniversal archaeal r-protein genes examined, the gene encoding L18e was found to be associated with the conserved L13 cluster, whereas the genes for S4e, L32e and L19e were found in the archaeal version of the spc operon. Eleven nonuniversal protein genes were not associated with any common genomic context. Of the remaining 19 protein genes, 17 were convincingly assigned to one of 10 previously unrecognized gene clusters. Examination of the gene content of these clusters revealed multiple associations with genes involved in the initiation of protein synthesis, transcription or other cellular processes. The lack of such associations in the universal clusters suggests that initially the ribosome evolved largely independently of other processes. More recently it likely has evolved in concert with other cellular systems. It was also verified that a second copy of the gene encoding L7ae found in some bacteria is actually a homolog of the gene encoding L30e and should be annotated as such. PMID:19478915

  5. Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

    PubMed Central

    Umaer, Khan; Ciganda, Martin

    2014-01-01

    Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

  6. Nucleotides in 16S rRNA that are required in unmodified form for features recognized by ribosomal protein S8.

    PubMed Central

    Thurlow, D L; Ehresmann, C; Ehresmann, B

    1983-01-01

    Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037

  7. Influence of ribosomal protein L39-L in the drug resistance mechanisms of lacrimal gland adenoid cystic carcinoma cells.

    PubMed

    Ye, Qing; Ding, Shao-Feng; Wang, Zhi-An; Feng, Jie; Tan, Wen-Bin

    2014-01-01

    Cancer constitutes a key pressure on public health regardless of the economy state in different countries. As a kind of highly malignant epithelial tumor, lacrimal gland adenoid cystic carcinoma can occur in any part of the body, such as salivary gland, submandibular gland, trachea, lung, breast, skin and lacrimal gland. Chemotherapy is one of the key treatment techniques, but drug resistance, especially MDR, seriously blunts its effects. As an element of the 60S large ribosomal subunit, the ribosomal protein L39-L gene appears to be documented specifically in the human testis and many human cancer samples of different origins. Total RNA of cultured drug-resistant and susceptible lacrimal gland adenoid cystic carcinoma cells was seperated, and real time quantitative RT-PCR were used to reveal transcription differences between amycin resistant and susceptible strains of lacrimal gland adenoid cystic carcinoma cells. Viability assays were used to present the amycin resistance difference in a RPL39-L transfected lacrimal gland adenoid cystic carcinoma cell line as compared to control vector and null-transfected lacrimal gland adenoid cystic carcinoma cell lines. The ribosomal protein L39-L transcription level was 6.5-fold higher in the drug-resistant human lacrimal gland adenoid cystic carcinoma cell line than in the susceptible cell line by quantitative RT-PCR analysis. The ribosomal protein L39-L transfected cells revealed enhanced drug resistance compared to plasmid vector-transfected or null-transfected cells as determined by methyl tritiated thymidine (3H-TdR) incorporation. The ribosomal protein L39-L gene could possibly have influence on the drug resistance mechanism of lacrimal gland adenoid cystic carcinoma cells.

  8. A computer model for the 30S ribosome subunit.

    PubMed Central

    Kuntz, I D; Crippen, G M

    1980-01-01

    We describe a computer-generated model for the locations of the 21 proteins of the 30S subunit of the E. coli ribosome. The model uses a new method of incorporating experimental measurements based on a mathematical technique called distance geometry. In this paper, we use data from two sources: immunoelectron microscopy and neutron-scattering studies. The data are generally self-consistent and lead to a set of relatively well-defined structures in which individual protein coordinates differ by approximately 20 A from one structure to another. Two important features of this calculation are the use of extended proteins rather than just the centers of mass, and the ability to confine the protein locations within an arbitrary boundary surface so that only solutions with an approximate 30S "shape" are permitted. PMID:7020786

  9. Targeting ricin to the ribosome.

    PubMed

    May, Kerrie L; Yan, Qing; Tumer, Nilgun E

    2013-07-01

    The plant toxin ricin is highly toxic for mammalian cells and is of concern for bioterrorism. Ricin belongs to a family of functionally related toxins, collectively referred to as ribosome inactivating proteins (RIPs), which disable ribosomes and halt protein synthesis. Currently there are no specific antidotes against ricin or related RIPs. The catalytic subunit of ricin is an N-glycosidase that depurinates a universally conserved adenine residue within the sarcin/ricin loop (SRL) of the 28S rRNA. This depurination activity inhibits translation and its biochemistry has been intensively studied. Yet, recent developments paint a more complex picture of toxicity, with ribosomal proteins and cellular signaling pathways contributing to the potency of ricin. In particular, several studies have now established the importance of the ribosomal stalk structure in facilitating the depurination activity and ribosome specificity of ricin and other RIPs. This review highlights recent developments defining toxin-ribosome interactions and examines the significance of these interactions for toxicity and therapeutic intervention. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Inhibition by ricin of protein synthesis in vitro. Ribosomes as the target of the toxin

    PubMed Central

    Montanaro, Lucio; Sperti, Simonetta; Stirpe, Fiorenzo

    1973-01-01

    1. Ricin (a toxic protein from the seeds of Ricinus communis) is a powerful inhibitor of the poly(U)-directed incorporation of phenylalanine into polypeptides catalysed by isolated rat liver ribosomes and elongation factors 1 and 2 (EF 1 and EF 2). The inhibition can be largely overcome by increasing the concentration of ribosomes. 2. The toxin does not affect the binding of phenylalanyl-tRNA to ribosomes catalysed by EF 1, nor does it inhibit the puromycin reaction used as a test for peptide-bond formation catalysed by ribosomes. 3. Ricin inhibits the ribosome-linked GTP hydrolysis catalysed by EF 2. 4. Ribosomes treated with ricin and washed through sucrose gradients containing 0.6m-NH4Cl are functionally inactive in those assay systems that are sensitive to the presence of added toxin. 5. It is suggested that ricin brings about an irreversible modification of ribosomes which impairs their ability to interact with EF 2. Since ricin inhibits at a molar concentration much lower than that of ribosomes it probably acts catalytically. No added cofactor is necessary for the inhibitory action of the toxin. PMID:4780693

  11. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    PubMed

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  12. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing

    PubMed Central

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L.

    2013-01-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2. PMID:23268442

  13. Ribosome abundance regulates the recovery of skeletal muscle protein mass upon recuperation from postnatal undernutrition in mice

    PubMed Central

    Fiorotto, Marta L; Davis, Teresa A; Sosa, Horacio A; Villegas-Montoya, Carolina; Estrada, Irma; Fleischmann, Ryan

    2014-01-01

    Nutritionally-induced growth faltering in the perinatal period has been associated with reduced adult skeletal muscle mass; however, the mechanisms responsible for this are unclear. To identify the factors that determine the recuperative capacity of muscle mass, we studied offspring of FVB mouse dams fed a protein-restricted diet during gestation (GLP) or pups suckled from postnatal day 1 (PN1) to PN11 (E-UN), or PN11 to PN22 (L-UN) on protein-restricted or control dams. All pups were refed under control conditions following the episode of undernutrition. Before refeeding, and 2, 7 and 21 days later, muscle protein synthesis was measured in vivo. There were no long-term deficits in protein mass in GLP and E-UN offspring, but in L-UN offspring muscle protein mass remained significantly smaller even after 18 months (P < 0.001). E-UN differed from L-UN offspring by their capacity to upregulate postprandial muscle protein synthesis when refed (P < 0.001), a difference that was attributable to a transient increase in ribosomal abundance, i.e. translational capacity, in E-UN offspring (P < 0.05); translational efficiency was similar across dietary treatments. The postprandial phosphorylation of Akt and extracellular signal-regulated protein kinases were similar among treatments. However, activation of the ribosomal S6 kinase 1 via mTOR (P < 0.02), and total upstream binding factor abundance were significantly greater in E-UN than L-UN offspring (P < 0.02). The results indicate that the capacity of muscles to recover following perinatal undernutrition depends on developmental age as this establishes whether ribosome abundance can be enhanced sufficiently to promote the protein synthesis rates required to accelerate protein deposition for catch-up growth. PMID:25239457

  14. Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

    PubMed

    Cukras, Anthony R; Green, Rachel

    2005-05-27

    The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

  15. Tempo and Mode of Gene Duplication in Mammalian Ribosomal Protein Evolution

    PubMed Central

    Gajdosik, Matthew D.; Simon, Amanda; Nelson, Craig E.

    2014-01-01

    Gene duplication has been widely recognized as a major driver of evolutionary change and organismal complexity through the generation of multi-gene families. Therefore, understanding the forces that govern the evolution of gene families through the retention or loss of duplicated genes is fundamentally important in our efforts to study genome evolution. Previous work from our lab has shown that ribosomal protein (RP) genes constitute one of the largest classes of conserved duplicated genes in mammals. This result was surprising due to the fact that ribosomal protein genes evolve slowly and transcript levels are very tightly regulated. In our present study, we identified and characterized all RP duplicates in eight mammalian genomes in order to investigate the tempo and mode of ribosomal protein family evolution. We show that a sizable number of duplicates are transcriptionally active and are very highly conserved. Furthermore, we conclude that existing gene duplication models do not readily account for the preservation of a very large number of intact retroduplicated ribosomal protein (RT-RP) genes observed in mammalian genomes. We suggest that selection against dominant-negative mutations may underlie the unexpected retention and conservation of duplicated RP genes, and may shape the fate of newly duplicated genes, regardless of duplication mechanism. PMID:25369106

  16. Role of conserved nucleotides in building the 16S rRNA binding site of E. coli ribosomal protein S8.

    PubMed Central

    Allmang, C; Mougel, M; Westhof, E; Ehresmann, B; Ehresmann, C

    1994-01-01

    Ribosomal protein S8 specifically recognizes a helical and irregular region of 16S rRNA that is highly evolutionary constrained. Despite its restricted size, the precise conformation of this region remains a question of debate. Here, we used chemical probing to analyze the structural consequences of mutations in this RNA region. These data, combined with computer modelling and previously published data on protein binding were used to investigate the conformation of the RNA binding site. The experimental data confirm the model in which adenines A595, A640 and A642 bulge out in the deep groove. In addition to the already proposed non canonical U598-U641 interaction, the structure is stabilized by stacking interactions (between A595 and A640) and an array of hydrogen bonds involving bases and the sugar phosphate backbone. Mutations that alter the ability to form these interdependent interactions result in a local destabilization or reorganization. The specificity of recognition by protein S8 is provided by the irregular and distorted backbone and the two bulged adenines 640 and 642 in the deep groove. The third adenine (A595) is not a direct recognition site but must adopt a bulged position. The U598-U641 pair should not be directly in contact with the protein. Images PMID:7937081

  17. Fitness advantages conferred by the L20-interacting RNA cis-regulator of ribosomal protein synthesis in Bacillus subtilis.

    PubMed

    Babina, Arianne M; Parker, Darren J; Li, Gene-Wei; Meyer, Michelle M

    2018-06-20

    In many bacteria, ribosomal proteins autogenously repress their own expression by interacting with RNA structures typically located in the 5'-UTRs of their mRNA transcripts. This regulation is necessary to maintain a balance between ribosomal proteins and rRNA to ensure proper ribosome production. Despite advances in non-coding RNA discovery and validation of RNA-protein regulatory interactions, the selective pressures that govern the formation and maintenance of such RNA cis-regulators in the context of an organism remain largely undetermined. To examine the impact disruptions to this regulation have on bacterial fitness, we introduced point mutations that abolish ribosomal protein binding and regulation into the RNA structure that controls expression of ribosomal proteins L20 and L35 within the Bacillus subtilis genome. Our studies indicate that removing this regulation results in reduced log phase growth, improper rRNA maturation, and the accumulation of a kinetically trapped or mis-assembled ribosomal particle at low temperatures, suggesting defects in ribosome synthesis. Such work emphasizes the important role regulatory RNAs play in the stoichiometric production of ribosomal components for proper ribosome composition and overall organism viability and reinforces the potential of targeting ribosomal protein production and ribosome assembly with novel antimicrobials. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  18. The ribosomes of Drosophila. II. Studies on intraspecific variation.

    PubMed

    Berger, E M; Weber, L

    1974-12-01

    Electrophoretic comparisons of 40S and 55S ribosomal subunit proteins from 18 strains of Drosophila melanogaster revealed the virtual absence of allelic variation. More detailed two-dimensional studies on the large subunit proteins in 6 of the strains demonstrated additional complexity but still no interstrain variation. The significance of these results is discussed with respect to present estimates of genic heterozygosity in natural populations.

  19. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    NASA Astrophysics Data System (ADS)

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  20. Rama: a machine learning approach for ribosomal protein prediction in plants.

    PubMed

    Carvalho, Thales Francisco Mota; Silva, José Cleydson F; Calil, Iara Pinheiro; Fontes, Elizabeth Pacheco Batista; Cerqueira, Fabio Ribeiro

    2017-11-24

    Ribosomal proteins (RPs) play a fundamental role within all type of cells, as they are major components of ribosomes, which are essential for translation of mRNAs. Furthermore, these proteins are involved in various physiological and pathological processes. The intrinsic biological relevance of RPs motivated advanced studies for the identification of unrevealed RPs. In this work, we propose a new computational method, termed Rama, for the prediction of RPs, based on machine learning techniques, with a particular interest in plants. To perform an effective classification, Rama uses a set of fundamental attributes of the amino acid side chains and applies a two-step procedure to classify proteins with unknown function as RPs. The evaluation of the resultant predictive models showed that Rama could achieve mean sensitivity, precision, and specificity of 0.91, 0.91, and 0.82, respectively. Furthermore, a list of proteins that have no annotation in Phytozome v.10, and are annotated as RPs in Phytozome v.12, were correctly classified by our models. Additional computational experiments have also shown that Rama presents high accuracy to differentiate ribosomal proteins from RNA-binding proteins. Finally, two novel proteins of Arabidopsis thaliana were validated in biological experiments. Rama is freely available at http://inctipp.bioagro.ufv.br:8080/Rama .

  1. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    PubMed

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Ribosome profiling reveals the what, when, where and how of protein synthesis.

    PubMed

    Brar, Gloria A; Weissman, Jonathan S

    2015-11-01

    Ribosome profiling, which involves the deep sequencing of ribosome-protected mRNA fragments, is a powerful tool for globally monitoring translation in vivo. The method has facilitated discovery of the regulation of gene expression underlying diverse and complex biological processes, of important aspects of the mechanism of protein synthesis, and even of new proteins, by providing a systematic approach for experimental annotation of coding regions. Here, we introduce the methodology of ribosome profiling and discuss examples in which this approach has been a key factor in guiding biological discovery, including its prominent role in identifying thousands of novel translated short open reading frames and alternative translation products.

  3. p90 ribosomal S6 kinase: a potential therapeutic target in lung cancer.

    PubMed

    Poomakkoth, Noufira; Issa, Aya; Abdulrahman, Nabeel; Abdelaziz, Somaia Gamal; Mraiche, Fatima

    2016-01-14

    A global survey of cancer has shown that lung cancer is the most common cause of the new cancer cases and cancer deaths in men worldwide. The mortality from lung cancer is more than the combined mortality from breast, prostate and colorectal cancers. The two major histological types of lung cancer are non-small cell lung cancer (NSCLC) accounting for about 85 % of cases and small cell lung cancer accounting for 15 % of cases. NSCLC, the more prevalent form of lung cancer, is often diagnosed at an advanced stage and has a very poor prognosis. Many factors have been shown to contribute to the development of lung cancer in humans including tobacco smoking, exposure to environmental carcinogens (asbestos, or radon) and genetic factors. Despite the advances in treatment, lung cancer remains one of the leading causes of cancer death worldwide. Interestingly, the overall 5 year survival from lung cancer has not changed appreciably in the past 25 years. For this reason, novel and more effective treatments and strategies for NSCLC are critically needed. p90 ribosomal S6 kinase (RSK), a serine threonine kinase that lies downstream of the Ras-MAPK (mitogen activated protein kinase) cascade, has been demonstrated to be involved in the regulation of cell proliferation in various malignancies through indirect (e.g., modulation of transcription factors) or direct effects on the cell-cycle machinery. Increased expression of RSK has been demonstrated in various cancers, including lung cancer. This review focuses on the role of RSK in lung cancer and its potential therapeutic application.

  4. Enhanced expression of glucose transporter-1 in vascular smooth muscle cells via the Akt/tuberous sclerosis complex subunit 2 (TSC2)/mammalian target of rapamycin (mTOR)/ribosomal S6 protein kinase (S6K) pathway in experimental renal failure.

    PubMed

    Lin, Chih-Yuan; Hsu, Shih-Che; Lee, Herng-Sheng; Lin, Shih-Hua; Tsai, Chien-Sung; Huang, Shih-Ming; Shih, Chun-Che; Hsu, Yu-Juei

    2013-02-01

    Chronic renal failure (CRF) is associated with increased cardiovascular mortality, and medial vascular smooth muscle cell (VSMC) hypertrophy, proliferation, and calcification play a pivotal role in uremic vasculopathy. Glucose transporter-1 (GLUT1) facilitates the transport of glucose into VSMCs, and GLUT1 overexpression associated with high glucose influx leads to a stimulation of VSMC proliferation. However, the role of GLUT1 in uremic vasculopathy remains unclear. This study aimed to identify changes in the expression of GLUT1 in VSMCs in the setting of experimental uremia and investigate whether Akt/tuberous sclerosis complex subunit 2 (TSC2)/mammalian target of rapamycin (mTOR)/ribosomal S6 protein kinase (S6K) signaling, which plays a crucial role in VSMC proliferation and glucose metabolism, is involved in the regulation of GLUT1 expression. In vivo experimental CRF was induced in Wistar rats by 5/6 nephrectomy, and the GLUT1 expression in aortic tissue was determined by the reverse transcriptase-polymerase chain reaction, immunoblotting, and immunohistochemical staining. Indoxyl sulfate (IS) is a uremic retention solute proven with pro-proliferative effect on rat VSMCs, and we further studied the expression of GLUT1 in rat A7r5 rat embryonic aortic cells stimulated by IS in the presence or absence of phloretin, a GLUT1 inhibitor, to explore the pathogenic role of GLUT1 in uremic vasculopathy. The contribution of Akt/TSC2/mTOR/S6K signaling in modifying the GLUT1 expression was also assessed. Eight weeks after 5/6 nephrectomy, aortic tissue obtained from CRF rats exhibited increased wall thickness and VSMC hypertrophy, hyperplasia, and degeneration. Compared with the sham-operated control group, the messenger (m)RNA and protein abundance of GLUT1 were both markedly increased in CRF rats. In vitro, IS induced a significant increase in expression of GLUT1 protein as well as pro-proliferative cyclin D1 and p21 mRNA and a modest increase in expression of

  5. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    NASA Astrophysics Data System (ADS)

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

    1986-08-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  6. Nmd3p Is a Crm1p-Dependent Adapter Protein for Nuclear Export of the Large Ribosomal Subunit

    PubMed Central

    Ho, Jennifer Hei-Ngam; Kallstrom, George; Johnson, Arlen W.

    2000-01-01

    In eukaryotic cells, nuclear export of nascent ribosomal subunits through the nuclear pore complex depends on the small GTPase Ran. However, neither the nuclear export signals (NESs) for the ribosomal subunits nor the receptor proteins, which recognize the NESs and mediate export of the subunits, have been identified. We showed previously that Nmd3p is an essential protein from yeast that is required for a late step in biogenesis of the large (60S) ribosomal subunit. Here, we show that Nmd3p shuttles and that deletion of the NES from Nmd3p leads to nuclear accumulation of the mutant protein, inhibition of the 60S subunit biogenesis, and inhibition of the nuclear export of 60S subunits. Moreover, the 60S subunits that accumulate in the nucleus can be coimmunoprecipitated with the NES-deficient Nmd3p. 60S subunit biogenesis and export of truncated Nmd3p were restored by the addition of an exogenous NES. To identify the export receptor for Nmd3p we show that Nmd3p shuttling and 60S export is blocked by the Crm1p-specific inhibitor leptomycin B. These results identify Crm1p as the receptor for Nmd3p export. Thus, export of the 60S subunit is mediated by the adapter protein Nmd3p in a Crm1p-dependent pathway. PMID:11086007

  7. Plastid ribosomal protein S5 plays a critical role in photosynthesis, plant development, and cold stress tolerance in arabidopsis

    USDA-ARS?s Scientific Manuscript database

    Plastid ribosomal proteins (RPs) are essential components for protein synthesis machinery and exert diverse roles in plant growth and development. Mutations in plastid RPs lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood and th...

  8. The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

    PubMed Central

    Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

    2018-01-01

    Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches

  9. Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack

    PubMed Central

    de Virgilio, Maddalena; Lombardi, Alessio; Caliandro, Rocco; Fabbrini, Maria Serena

    2010-01-01

    Ribosome-inactivating proteins (RIPs) are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat) and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential. PMID:22069572

  10. The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis

    PubMed Central

    Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert

    2015-01-01

    During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414

  11. Selection of peptides targeting helix 31 of bacterial 16S ribosomal RNA by screening M13 phage-display libraries.

    PubMed

    Lamichhane, Tek N; Abeydeera, N Dinuka; Duc, Anne-Cécile E; Cunningham, Philip R; Chow, Christine S

    2011-01-28

    Ribosomal RNA is the catalytic portion of ribosomes, and undergoes a variety of conformational changes during translation. Structural changes in ribosomal RNA can be facilitated by the presence of modified nucleotides. Helix 31 of bacterial 16S ribosomal RNA harbors two modified nucleotides, m²G966 and m⁵C967, that are highly conserved among bacteria, though the degree and nature of the modifications in this region are different in eukaryotes. Contacts between helix 31 and the P-site tRNA, initiation factors, and ribosomal proteins highlight the importance of this region in translation. In this work, a heptapeptide M13 phage-display library was screened for ligands that target the wild-type, naturally modified bacterial helix 31. Several peptides, including TYLPWPA, CVRPFAL, TLWDLIP, FVRPFPL, ATPLWLK, and DIRTQRE, were found to be prevalent after several rounds of screening. Several of the peptides exhibited moderate affinity (in the high nM to low µM range) to modified helix 31 in biophysical assays, including surface plasmon resonance (SPR), and were also shown to bind 30S ribosomal subunits. These peptides also inhibited protein synthesis in cell-free translation assays.

  12. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    PubMed

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  13. Ribonucleic Acid and Ribosomes of Bacillus stearothermophilus1

    PubMed Central

    Saunders, Grady F.; Campbell, L. Leon

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332–339. 1966.—The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10−2m MgCl2–10−2m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg++ concentration to 10−3m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10−2m Mg++ to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a Tm at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a Tm of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. Images PMID:5903099

  14. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

    PubMed

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

    2011-05-01

    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  15. Prp43p Is a DEAH-Box Spliceosome Disassembly Factor Essential for Ribosome Biogenesis

    PubMed Central

    Combs, D. Joshua; Nagel, Roland J.; Ares, Manuel; Stevens, Scott W.

    2006-01-01

    The known function of the DEXH/D-box protein Prp43p is the removal of the U2, U5, and U6 snRNPs from the postsplicing lariat-intron ribonucleoprotein complex. We demonstrate that affinity-purified Prp43p-associated material includes the expected spliceosomal components; however, we also identify several preribosomal complexes that are specifically purified with Prp43p. Conditional prp43 mutant alleles confer a 35S pre-rRNA processing defect, with subsequent depletion of 27S and 20S precursors. Upon a shift to a nonpermissive temperature, both large and small-ribosomal-subunit proteins accumulate in the nucleolus of prp43 mutants. Pulse-chase analysis demonstrates delayed kinetics of 35S, 27S, and 20S pre-rRNA processing with turnover of these intermediates. Microarray analysis of pre-mRNA splicing defects in prp43 mutants shows a very mild effect, similar to that of nonessential pre-mRNA splicing factors. Prp43p is the first DEXH/D-box protein shown to function in both RNA polymerase I and polymerase II transcript metabolism. Its essential function is in its newly characterized role in ribosome biogenesis of both ribosomal subunits, positioning Prp43p to regulate both pre-mRNA splicing and ribosome biogenesis. PMID:16382144

  16. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  17. Isolation of eukaryotic ribosomal proteins. Purification and characterization of 60 S ribosomal subunit proteins L3, L6, L7', L8, L10, L15, L17, L18, L19, L23', L25, L27', L28, L29, L31, L32, L34, L35, L36, L36', and L37'.

    PubMed

    Tsurugi, K; Collatz, E; Todokoro, K; Wool, I G

    1977-06-10

    The proteins of the large subunit of rat liver ribosomes were separated into seven groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Twenty-one proteins (L3, L6, L7', L8, L10, L15, L17, L18, L19, L23', L25, L27', L28, L29, L31, L32, L34, L35, L36, L36', and L37') were isolated from three groups (C60, E60, and F60) by ion exchange chromatography on carboxymethycellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.3 to 25 mg. Nine of the proteins (L6, L8, L18, L27', L28, L29, L34, L36, and L36') had no detectable contamination: the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.

  18. Suppression of Myc oncogenic activity by ribosomal protein haploinsufficiency

    PubMed Central

    Barna, Maria; Pusic, Aya; Zollo, Ornella; Costa, Maria; Kondrashov, Nadya; Rego, Eduardo; Rao, Pulivarthi H; Ruggero, Davide

    2008-01-01

    The Myc oncogene regulates the expression of multiple components of the protein synthetic machinery, including ribosomal proteins, initiation factors of translation, Pol III, and rDNA1,2. An outstanding question is whether and how increasing the cellular protein synthesis capacity can affect the multi-step process leading to cancer. We utilized ribosomal protein heterozygote mice as a genetic tool to restore increased protein synthesis in Eμ–Myc/+ transgenic mice to normal levels and show that in this context Myc's oncogenic potential is suppressed. Our findings demonstrate that the ability of Myc to increase protein synthesis directly augments cell size and is sufficient to accelerate cell cycle progression independently of known cell cycle targets transcriptionally regulated by Myc. In addition, when protein synthesis is restored to normal levels, Myc overexpressing precancerous cells are more efficiently eliminated by programmed cell death. Our findings reveal a novel paradigm that links increases in general protein synthesis rates downstream of an oncogenic signal to a specific molecular impairment in the modality of translation initiation employed to regulate the expression of selective mRNAs. We show that an aberrant increase in cap-dependent translation downstream Myc hyperactivation specifically impairs the translational switch to internal ribosomal entry site (IRES)-dependent translation required for accurate mitotic progression. Failure of this translational switch results in reduced mitotic-specific expression of the endogenous IRES-dependent form of Cdk11 (p58-PITSLRE)3-5, which leads to cytokinesis defects and is associated with increased centrosome numbers and genome instability in Eμ–Myc/+ mice. When accurate translational control is re-established in Eμ–Myc/+ mice, genome instability is suppressed. Our findings reveal how perturbations in translational control provide a highly specific outcome on gene expression, genome stability, and

  19. Purification and characterization of ribosomal proteins L27 and L30 having antimicrobial activity produced by the Lactobacillus salivarius SGL 03.

    PubMed

    Pidutti, P; Federici, F; Brandi, J; Manna, L; Rizzi, E; Marini, U; Cecconi, D

    2018-02-01

    The aim of this study was to investigate the antimicrobial potential of proteins secreted by a new strain of Lactobacillus salivarius. The secretome of L. salivarius SGL 03 strain was analysed by gel-assisted fractionation and MS/MS to identify low-molecular-mass proteins. This strategy allowed us to identify 10 secreted proteins. Then, a combination of heterologous expression and agar well diffusion was used to characterize them as to their antimicrobial activity, mechanisms of action and stability. Our findings indicate that L27 and L30 proteins of the 50S ribosomal subunit have antimicrobial activity against Streptococcus pyogenes, Streptococcus uberis and Enterococcus faecium. In addition, both proteins are bactericidal against S. pyogenes and maintain their antimicrobial activity after different protease treatments, at acidic pH, after heat treatment, and if stored in a refrigerated ambient at least at 4°C. The overall results demonstrated that the L27 and L30 ribosomal proteins are of interest as new antimicrobial molecules to prevent the growth of S. pyogenes, S. uberis and E. faecium. Our results provide the first insight into the extra-ribosomal activity of L27 and L30 secreted proteins of L. salivarius. This study demonstrated the capacity of L. salivarius SGL 03 to produce antimicrobial molecules and suggested this strain as a promising probiotic candidate. © 2017 The Society for Applied Microbiology.

  20. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    PubMed

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  1. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    PubMed

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  2. Mechanisms of In Vivo Ribosome Maintenance Change in Response to Nutrient Signals*

    PubMed Central

    Mathis, Andrew D.; Naylor, Bradley C.; Carson, Richard H.; Evans, Eric; Harwell, Justin; Knecht, Jared; Hexem, Eric; Peelor, Fredrick F.; Miller, Benjamin F.; Hamilton, Karyn L.; Transtrum, Mark K.; Bikman, Benjamin T.; Price, John C.

    2017-01-01

    Control of protein homeostasis is fundamental to the health and longevity of all organisms. Because the rate of protein synthesis by ribosomes is a central control point in this process, regulation, and maintenance of ribosome function could have amplified importance in the overall regulatory circuit. Indeed, ribosomal defects are commonly associated with loss of protein homeostasis, aging, and disease (1–4), whereas improved protein homeostasis, implying optimal ribosomal function, is associated with disease resistance and increased lifespan (5–7). To maintain a high-quality ribosome population within the cell, dysfunctional ribosomes are targeted for autophagic degradation. It is not known if complete degradation is the only mechanism for eukaryotic ribosome maintenance or if they might also be repaired by replacement of defective components. We used stable-isotope feeding and protein mass spectrometry to measure the kinetics of turnover of ribosomal RNA (rRNA) and 71 ribosomal proteins (r-proteins) in mice. The results indicate that exchange of individual proteins and whole ribosome degradation both contribute to ribosome maintenance in vivo. In general, peripheral r-proteins and those with more direct roles in peptide-bond formation are replaced multiple times during the lifespan of the assembled structure, presumably by exchange with a free cytoplasmic pool, whereas the majority of r-proteins are stably incorporated for the lifetime of the ribosome. Dietary signals impact the rates of both new ribosome assembly and component exchange. Signal-specific modulation of ribosomal repair and degradation could provide a mechanistic link in the frequently observed associations among diminished rates of protein synthesis, increased autophagy, and greater longevity (5, 6, 8, 9). PMID:27932527

  3. The 70 S monosome accumulation and in vitro initiation complex formation by Escherichia coli ribosomes at 5 C. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Broeze, R. J.; Pope, D. H.

    1978-01-01

    The inhibition of translation which is observed after shifting Escherichia coli to low temperature was investigated. 70 S ribosomes were isolated from E. coli 8 hours after a shift to 5 C synthesized protein in the absence of added mRNA (i.e., endogenous protein synthesis by 70 S monosomes) at a rate which was three times greater than the rate of endogenous protein synthesis by 70 S ribosomes which were isolated at the time of the shift to 5 C. Calculations based on the rates of endogenous protein synthesis and polyphenylalanine synthesis indicate that 70 S monosomes comprise only 0.1% of the total E. coli 70 S ribosome population after 8 hours at 5 c. Experiments designed to test initiation complex formation on ApUpG or formaldehyde treated MS-2 viral RNA demonstrated that, although the rate of formation of 30 S initiation complexes was not inhibited, the rate of formation of active 70 S initiation complexes, able to react with puromycin, was inhibited to a great extent at 5 C. A model depicting the effects of low temperature on the E. coli translation system is proposed.

  4. Principles of 60S ribosomal subunit assembly emerging from recent studies in yeast

    PubMed Central

    Konikkat, Salini; Woolford, John L.

    2017-01-01

    Ribosome biogenesis requires the intertwined processes of folding, modification, and processing of ribosomal RNA, together with binding of ribosomal proteins. In eukaryotic cells, ribosome assembly begins in the nucleolus, continues in the nucleoplasm, and is not completed until after nascent particles are exported to the cytoplasm. The efficiency and fidelity of ribosome biogenesis are facilitated by >200 assembly factors and ~76 different small nucleolar RNAs. The pathway is driven forward by numerous remodeling events to rearrange the ribonucleoprotein architecture of pre-ribosomes. Here, we describe principles of ribosome assembly that have emerged from recent studies of biogenesis of the large ribosomal subunit in the yeast Saccharomyces cerevisiae. We describe tools that have empowered investigations of ribosome biogenesis, and then summarize recent discoveries about each of the consecutive steps of subunit assembly. PMID:28062837

  5. c-Raf/MEK/ERK pathway controls protein kinase C-mediated p70S6K activation in adult cardiac muscle cells.

    PubMed

    Iijima, Yoshihiro; Laser, Martin; Shiraishi, Hirokazu; Willey, Christopher D; Sundaravadivel, Balasubramanian; Xu, Lin; McDermott, Paul J; Kuppuswamy, Dhandapani

    2002-06-21

    p70S6 kinase (S6K1) plays a pivotal role in hypertrophic cardiac growth via ribosomal biogenesis. In pressure-overloaded myocardium, we show S6K1 activation accompanied by activation of protein kinase C (PKC), c-Raf, and mitogen-activated protein kinases (MAPKs). To explore the importance of the c-Raf/MAPK kinase (MEK)/MAPK pathway, we stimulated adult feline cardiomyocytes with 12-O-tetradecanoylphorbol-13-acetate (TPA), insulin, or forskolin to activate PKC, phosphatidylinositol-3-OH kinase, or protein kinase A (PKA), respectively. These treatments resulted in S6K1 activation with Thr-389 phosphorylation as well as mammalian target of rapamycin (mTOR) and S6 protein phosphorylation. Thr-421/Ser-424 phosphorylation of S6K1 was observed predominantly in TPA-treated cells. Dominant negative c-Raf expression or a MEK1/2 inhibitor (U0126) treatment showed a profound blocking effect only on the TPA-stimulated phosphorylation of S6K1 and mTOR. Whereas p38 MAPK inhibitors exhibited only partial effect, MAPK-phosphatase-3 expression significantly blocked the TPA-stimulated S6K1 and mTOR phosphorylation. Inhibition of mTOR with rapamycin blocked the Thr-389 but not the Thr-421/Ser-424 phosphorylation of S6K1. Therefore, during PKC activation, the c-Raf/MEK/extracellular signal-regulated kinase-1/2 (ERK1/2) pathway mediates both the Thr-421/Ser-424 and the Thr-389 phosphorylation in an mTOR-independent and -dependent manner, respectively. Together, our in vivo and in vitro studies indicate that the PKC/c-Raf/MEK/ERK pathway plays a major role in the S6K1 activation in hypertrophic cardiac growth.

  6. The host antimicrobial peptide Bac71-35 binds to bacterial ribosomal proteins and inhibits protein synthesis.

    PubMed

    Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco

    2014-12-18

    Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. S6K is a morphogenic protein with a mechanism involving Filamin-A phosphorylation and phosphatidic acid binding.

    PubMed

    Henkels, Karen M; Mallets, Elizabeth R; Dennis, Patrick B; Gomez-Cambronero, Julian

    2015-04-01

    Change of cell shape in vivo plays many roles that are central to life itself, such as embryonic development, inflammation, wound healing, and pathologic processes such as cancer metastasis. Nonetheless, the spatiotemporal mechanisms that control the concerted regulation of cell shape remain understudied. Here, we show that ribosomal S6K, which is normally considered a protein involved in protein translation, is a morphogenic protein. Its presence in cells alters the overall organization of the cell surface and cell circularity [(4π × area)/(perimeter)(2)] from 0.47 ± 0.06 units in mock-treated cells to 0.09 ± 0.03 units in S6K-overexpressing macrophages causing stellation and arborization of cell shape. This effect was partially reversed in cells expressing a kinase-inactive S6K mutant and was fully reversed in cells silenced with small interference RNA. Equally important is that S6K is itself regulated by phospholipids, specifically phosphatidic acid, whereby 300 nM 1,2-dioleoyl-sn-glycero-3-phosphate (DOPA), but not the control 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), binds directly to S6K and causes an ∼ 2.9-fold increase in S6K catalytic activity. This was followed by an increase in Filamin A (FLNA) functionality as measured by phospho-FLNA (S(2152)) expression and by a subsequent elevation of actin nucleation. This reliance of S6K on phosphatidic acid (PA), a curvature-inducing phospholipid, explained the extra-large perimeter of cells that overexpressed S6K. Furthermore, the diversity of the response to S6K in several unrelated cell types (fibroblasts, leukocytes, and invasive cancer cells) that we report here indicates the existence of an underlying common mechanism in mammalian cells. This new signaling set, PA-S6K-FLNA-actin, sheds light for the first time into the morphogenic pathway of cytoskeletal structures that are crucial for adhesion and cell locomotion during inflammation and metastasis. © FASEB.

  8. Mapping of ribosomal 23S ribosomal RNA modifications in Clostridium sporogenes.

    PubMed

    Kirpekar, Finn; Hansen, Lykke H; Mundus, Julie; Tryggedsson, Stine; Teixeira Dos Santos, Patrícia; Ntokou, Eleni; Vester, Birte

    2018-06-27

    All organisms contain RNA modifications in their ribosomal RNA (rRNA), but the importance, positions and exact function of these are still not fully elucidated. Various functions such as stabilising structures, controlling ribosome assembly and facilitating interactions have been suggested and in some cases substantiated. Bacterial rRNA contains much fewer modifications than eukaryotic rRNA. The rRNA modification patterns in bacteria differ from each other, but too few organisms have been mapped to draw general conclusions. This study maps 23S ribosomal RNA modifications in Clostridium sporogenes that can be characterised as a non-toxin producing Clostridium botulinum. Clostridia are able to sporulate and thereby survive harsh conditions, and are in general considered to be resilient to antibiotics. Selected regions of the 23S rRNA were investigated by mass spectrometry and by primer extension analysis to pinpoint modified sites and the nature of the modifications. Apparently, C. sporogenes 23S rRNA contains few modifications compared to other investigated bacteria. No modifications were identified in domain II and III of 23S rRNA. Three modifications were identified in domain IV, all of which have also been found in other organisms. Two unusual modifications were identified in domain V, methylated dihydrouridine at position U2449 and dihydrouridine at position U2500 (Escherichia coli numbering), in addition to four previously known modified positions. The enzymes responsible for the modifications were searched for in the C. sporogenes genome using BLAST with characterised enzymes as query. The search identified genes potentially coding for RNA modifying enzymes responsible for most of the found modifications.

  9. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight intomore » the unique protein–protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.« less

  10. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    PubMed

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  11. Cryo-EM structure of the large subunit of the spinach chloroplast ribosome

    PubMed Central

    Ahmed, Tofayel; Yin, Zhan; Bhushan, Shashi

    2016-01-01

    Protein synthesis in the chloroplast is mediated by the chloroplast ribosome (chloro-ribosome). Overall architecture of the chloro-ribosome is considerably similar to the Escherichia coli (E. coli) ribosome but certain differences are evident. The chloro-ribosome proteins are generally larger because of the presence of chloroplast-specific extensions in their N- and C-termini. The chloro-ribosome harbours six plastid-specific ribosomal proteins (PSRPs); four in the small subunit and two in the large subunit. Deletions and insertions occur throughout the rRNA sequence of the chloro-ribosome (except for the conserved peptidyl transferase center region) but the overall length of the rRNAs do not change significantly, compared to the E. coli. Although, recent advancements in cryo-electron microscopy (cryo-EM) have provided detailed high-resolution structures of ribosomes from many different sources, a high-resolution structure of the chloro-ribosome is still lacking. Here, we present a cryo-EM structure of the large subunit of the chloro-ribosome from spinach (Spinacia oleracea) at an average resolution of 3.5 Å. High-resolution map enabled us to localize and model chloro-ribosome proteins, chloroplast-specific protein extensions, two PSRPs (PSRP5 and 6) and three rRNA molecules present in the chloro-ribosome. Although comparable to E. coli, the polypeptide tunnel and the tunnel exit site show chloroplast-specific features. PMID:27762343

  12. Abiotic Stress Resistance, a Novel Moonlighting Function of Ribosomal Protein RPL44 in the Halophilic Fungus Aspergillus glaucus

    PubMed Central

    Liu, Xiao-Dan; Xie, Lixia; Wei, Yi; Zhou, Xiaoyang; Jia, Baolei; Liu, Jinliang

    2014-01-01

    Ribosomal proteins are highly conserved components of basal cellular organelles, primarily involved in the translation of mRNA leading to protein synthesis. However, certain ribosomal proteins moonlight in the development and differentiation of organisms. In this study, the ribosomal protein L44 (RPL44), associated with salt resistance, was screened from the halophilic fungus Aspergillus glaucus (AgRPL44), and its activity was investigated in Saccharomyces cerevisiae and Nicotiana tabacum. Sequence alignment revealed that AgRPL44 is one of the proteins of the large ribosomal subunit 60S. Expression of AgRPL44 was upregulated via treatment with salt, sorbitol, or heavy metals to demonstrate its response to osmotic stress. A homologous sequence from the model fungus Magnaporthe oryzae, MoRPL44, was cloned and compared with AgRPL44 in a yeast expression system. The results indicated that yeast cells with overexpressed AgRPL44 were more resistant to salt, drought, and heavy metals than were yeast cells expressing MoRPL44 at a similar level of stress. When AgRPL44 was introduced into M. oryzae, the transformants displayed obviously enhanced tolerance to salt and drought, indicating the potential value of AgRPL44 for genetic applications. To verify the value of its application in plants, tobacco was transformed with AgRPL44, and the results were similar. Taken together, we conclude that AgRPL44 supports abiotic stress resistance and may have value for genetic application. PMID:24814782

  13. Characterization and analysis of posttranslational modifications of the human large cytoplasmic ribosomal subunit proteins by mass spectrometry and Edman sequencing.

    PubMed

    Odintsova, Tatyana I; Müller, Eva-Christina; Ivanov, Anton V; Egorov, Tsezi A; Bienert, Ralf; Vladimirov, Serguei N; Kostka, Susanne; Otto, Albrecht; Wittmann-Liebold, Brigitte; Karpova, Galina G

    2003-04-01

    The 60S ribosomal proteins were isolated from ribosomes of human placenta and separated by reversed phase HPLC. The fractions obtained were subjected to trypsin and Glu-C digestion and analyzed by mass fingerprinting (MALDI-TOF), MS/MS (ESI), and Edman sequencing. Forty-six large subunit proteins were found, 22 of which showed masses in accordance with the SwissProt database (June 2002) masses (proteins L6, L7, L9, L13, L15, L17, L18, L21, L22, L24, L26, L27, L30, L32, L34, L35, L36, L37, L37A, L38, L39, L41). Eleven (proteins L7, L10A, L11, L12, L13A, L23, L23A, L27A, L28, L29, and P0) resulted in mass changes that are consistent with N-terminal loss of methionine, acetylation, internal methylation, or hydroxylation. A loss of methionine without acetylation was found for protein L8 and L17. For nine proteins (L3, L4, L5, L7A, L10, L14, L19, L31, and L40), the molecular masses could not be determined. Proteins P1 and protein L3-like were not identified by the methods applied.

  14. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    PubMed

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  15. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    PubMed

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. p70 ribosomal S6 kinase regulates subpleural fibrosis following transforming growth factor-α expression in the lung

    PubMed Central

    Madala, Satish K.; Thomas, George; Edukulla, Ramakrishna; Davidson, Cynthia; Schmidt, Stephanie; Schehr, Angelica

    2015-01-01

    The p70 ribosomal S6 kinase (S6K) is a downstream substrate that is phosphorylated and activated by the mammalian target of rapamycin complex and regulates multiple cellular processes associated with fibrogenesis. Recent studies demonstrate that aberrant mTORC1-S6K signaling contributes to various pathological conditions, but a direct role in pulmonary fibroproliferation has not been established. Increased phosphorylation of the S6K pathway is detected immediately following transforming growth factor-α (TGF-α) expression in a transgenic model of progressive lung fibrosis. To test the hypothesis that the S6K directly regulates pulmonary fibroproliferative disease we determined the cellular sites of S6K phosphorylation during the induction of fibrosis in the TGF-α model and tested the efficacy of specific pharmacological inhibition of the S6K pathway to prevent and reverse fibrotic disease. Following TGF-α expression increased phosphorylation of the S6K was detected in the airway and alveolar epithelium and the mesenchyme of advanced subpleural fibrotic regions. Specific inhibition of the S6K with the small molecule inhibitor LY-2584702 decreased TGF-α and platelet-derived growth factor-β-induced proliferation of lung fibroblasts in vitro. Administration of S6K inhibitors to TGF-α mice prevented the development of extensive subpleural fibrosis and alterations in lung mechanics, and attenuated the increase in total lung hydroxyproline. S6K inhibition after fibrosis was established attenuated the progression of subpleural fibrosis. Together these studies demonstrate targeting the S6K pathway selectively modifies the progression of pulmonary fibrosis in the subpleural compartment of the lung. PMID:26566903

  17. Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

    PubMed

    Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

    2004-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

  18. IL-3 Maintains Activation of the p90S6K/RPS6 Pathway and Increases Translation in Human Eosinophils.

    PubMed

    Esnault, Stephane; Kelly, Elizabeth A B; Shen, Zhong-Jian; Johansson, Mats W; Malter, James S; Jarjour, Nizar N

    2015-09-15

    IL-5 is a major therapeutic target to reduce eosinophilia. However, all of the eosinophil-activating cytokines, such as IL-5, IL-3, and GM-CSF, are typically present in atopic diseases, including allergic asthma. As a result of the functional redundancy of these three cytokines on eosinophils and the loss of IL-5R on airway eosinophils, it is important to take IL-3 and GM-CSF into account to efficiently reduce tissue eosinophil functions. Moreover, these three cytokines signal through a common β-chain receptor but yet differentially affect protein production in eosinophils. Notably, the increased ability of IL-3 to induce the production of proteins, such as semaphorin-7A, without affecting mRNA levels suggests a unique influence of IL-3 on translation. The purpose of this study was to identify the mechanisms by which IL-3 distinctively affects eosinophil function compared with IL-5 and GM-CSF, with a focus on protein translation. Peripheral blood eosinophils were used to study intracellular signaling and protein translation in cells activated with IL-3, GM-CSF, or IL-5. We establish that, unlike GM-CSF or IL-5, IL-3 triggers prolonged signaling through activation of ribosomal protein S6 (RPS6) and the upstream kinase 90-kDa ribosomal S6 kinase (p90S6K). Blockade of p90S6K activation inhibited phosphorylation of RPS6 and IL-3-enhanced semaphorin-7A translation. Furthermore, in an allergen-challenged environment, in vivo phosphorylation of RPS6 and p90S6K was enhanced in human airway compared with circulating eosinophils. Our findings provide new insights into the mechanisms underlying differential activation of eosinophils by IL-3, GM-CSF, and IL-5. These observations identify IL-3 and its downstream intracellular signals as novel targets that should be considered to modulate eosinophil functions. Copyright © 2015 by The American Association of Immunologists, Inc.

  19. Ribosomal protein L24 defect in Belly spot and tail (Bst), a mouse Minute

    PubMed Central

    Oliver, Edward R.; Saunders, Thomas L.; Tarlé, Susan A.; Glaser, Tom

    2008-01-01

    Summary Ribosomal protein mutations, termed Minutes, have been instrumental in studying the coordination of cell and tissue growth in Drosophila. Although abundant in flies, equivalent defects in mammals are relatively unknown. Belly spot and tail (Bst) is a semidominant mouse mutation that disrupts pigmentation, somitogenesis and retinal cell fate determination. Here, we identify Bst as a deletion within the Rpl24 riboprotein gene. Bst significantly impairs Rpl24 splicing and ribosome biogenesis. Bst/+ cells have decreased rates of protein synthesis and proliferation, and are outcompeted by wild-type cells in C57BLKS↔ROSA26 chimeras. Bacterial artificial chromosome (BAC) and cDNA transgenes correct the mutant phenotypes. Our findings establish Bst as a mouse Minute and provide the first detailed characterization of a mammalian ribosomal protein mutation. PMID:15289434

  20. Ribosomal targets for antibiotic drug discovery

    DOEpatents

    Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

    2016-09-13

    The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

  1. Structure of the ribosome post-recycling complex probed by chemical cross-linking and mass spectrometry

    PubMed Central

    Kiosze-Becker, Kristin; Ori, Alessandro; Gerovac, Milan; Heuer, André; Nürenberg-Goloub, Elina; Rashid, Umar Jan; Becker, Thomas; Beckmann, Roland; Beck, Martin; Tampé, Robert

    2016-01-01

    Ribosome recycling orchestrated by the ATP binding cassette (ABC) protein ABCE1 can be considered as the final—or the first—step within the cyclic process of protein synthesis, connecting translation termination and mRNA surveillance with re-initiation. An ATP-dependent tweezer-like motion of the nucleotide-binding domains in ABCE1 transfers mechanical energy to the ribosome and tears the ribosome subunits apart. The post-recycling complex (PRC) then re-initiates mRNA translation. Here, we probed the so far unknown architecture of the 1-MDa PRC (40S/30S·ABCE1) by chemical cross-linking and mass spectrometry (XL-MS). Our study reveals ABCE1 bound to the translational factor-binding (GTPase) site with multiple cross-link contacts of the helix–loop–helix motif to the S24e ribosomal protein. Cross-linking of the FeS cluster domain to the ribosomal protein S12 substantiates an extreme lever-arm movement of the FeS cluster domain during ribosome recycling. We were thus able to reconstitute and structurally analyse a key complex in the translational cycle, resembling the link between translation initiation and ribosome recycling. PMID:27824037

  2. Genomic Location of the Major Ribosomal Protein Gene Locus Determines Vibrio cholerae Global Growth and Infectivity

    PubMed Central

    Soler-Bistué, Alfonso; Mondotte, Juan A.; Bland, Michael Jason; Val, Marie-Eve; Saleh, María-Carla; Mazel, Didier

    2015-01-01

    The effects on cell physiology of gene order within the bacterial chromosome are poorly understood. In silico approaches have shown that genes involved in transcription and translation processes, in particular ribosomal protein (RP) genes, localize near the replication origin (oriC) in fast-growing bacteria suggesting that such a positional bias is an evolutionarily conserved growth-optimization strategy. Such genomic localization could either provide a higher dosage of these genes during fast growth or facilitate the assembly of ribosomes and transcription foci by keeping physically close the many components of these macromolecular machines. To explore this, we used novel recombineering tools to create a set of Vibrio cholerae strains in which S10-spec-α (S10), a locus bearing half of the ribosomal protein genes, was systematically relocated to alternative genomic positions. We show that the relative distance of S10 to the origin of replication tightly correlated with a reduction of S10 dosage, mRNA abundance and growth rate within these otherwise isogenic strains. Furthermore, this was accompanied by a significant reduction in the host-invasion capacity in Drosophila melanogaster. Both phenotypes were rescued in strains bearing two S10 copies highly distal to oriC, demonstrating that replication-dependent gene dosage reduction is the main mechanism behind these alterations. Hence, S10 positioning connects genome structure to cell physiology in Vibrio cholerae. Our results show experimentally for the first time that genomic positioning of genes involved in the flux of genetic information conditions global growth control and hence bacterial physiology and potentially its evolution. PMID:25875621

  3. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    DOE R&D Accomplishments Database

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  4. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    PubMed Central

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  5. Growth Inhibition by Bupivacaine Is Associated with Inactivation of Ribosomal Protein S6 Kinase 1

    PubMed Central

    Beigh, Mushtaq Ahmad; Showkat, Mehvish; Bashir, Basharat; Bashir, Asma; Hussain, Mahboob ul; Andrabi, Khurshid Iqbal

    2014-01-01

    Bupivacaine is an amide type long acting local anesthetic used for epidural anesthesia and nerve blockade in patients. Use of bupivacaine is associated with severe cytotoxicity and apoptosis along with inhibition of cell growth and proliferation. Although inhibition of Erk, Akt, and AMPK seemingly appears to mediate some of the bupivacaine effects, potential downstream targets that mediate its effect remain unknown. S6 kinase 1 is a common downstream effector of several growth regulatory pathways involved in cell growth and proliferation known to be affected by bupivacaine. We have accordingly attempted to relate the growth inhibitory effects of bupivacaine with the status of S6K1 activity and we present evidence that decrease in cell growth and proliferation by bupivacaine is mediated through inactivation of S6 kinase 1 in a concentration and time dependent manner. We also show that ectopic expression of constitutively active S6 kinase 1 imparts substantial protection from bupivacaine induced cytotoxicity. Inactivation of S6K1 though associated with loss of putative mTOR mediated phosphorylation did not correspond with loss of similar phosphorylations in 4EBP1 indicating that S6K1 inhibition was not mediated through inactivation of mTORC1 signaling pathway or its down regulation. PMID:24605337

  6. Crystal structure of bacillus subtilis YdaF protein : a putative ribosomal N-acetyltransferase.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brunzelle, J. S.; Wu, R.; Korolev, S. V.

    2004-12-01

    Comparative sequence analysis suggests that the ydaF gene encodes a protein (YdaF) that functions as an N-acetyltransferase, more specifically, a ribosomal N-acetyltransferase. Sequence analysis using basic local alignment search tool (BLAST) suggests that YdaF belongs to a large family of proteins (199 proteins found in 88 unique species of bacteria, archaea, and eukaryotes). YdaF also belongs to the COG1670, which includes the Escherichia coli RimL protein that is known to acetylate ribosomal protein L12. N-acetylation (NAT) has been found in all kingdoms. NAT enzymes catalyze the transfer of an acetyl group from acetyl-CoA (AcCoA) to a primary amino group. Formore » example, NATs can acetylate the N-terminal {alpha}-amino group, the {epsilon}-amino group of lysine residues, aminoglycoside antibiotics, spermine/speridine, or arylalkylamines such as serotonin. The crystal structure of the alleged ribosomal NAT protein, YdaF, from Bacillus subtilis presented here was determined as a part of the Midwest Center for Structural Genomics. The structure maintains the conserved tertiary structure of other known NATs and a high sequence similarity in the presumed AcCoA binding pocket in spite of a very low overall level of sequence identity to other NATs of known structure.« less

  7. S6K1ing to ResTOR Adipogenesis with Polycomb.

    PubMed

    Juan, Aster H; Sartorelli, Vittorio

    2016-05-05

    Signal-directed chromatin recruitment of mammalian Polycomb complexes is a fundamental component of epigenetic regulation. In this issue, Yi et al. (2016) reveal how mTORC1 activation deploys the ribosomal serine/threonine kinase S6K1 and Polycomb proteins at genomic regulatory regions to repress expression of anti-adipogenic developmental regulators. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. New ribosome-inactivating proteins with polynucleotide:adenosine glycosidase and antiviral activities from Basella rubra L. and bougainvillea spectabilis Willd.

    PubMed

    Bolognesi, A; Polito, L; Olivieri, F; Valbonesi, P; Barbieri, L; Battelli, M G; Carusi, M V; Benvenuto, E; Del Vecchio Blanco, F; Di Maro, A; Parente, A; Di Loreto, M; Stirpe, F

    1997-12-01

    New single-chain (type 1) ribosome-inactivating proteins (RIPs) were isolated from the seeds of Basella rubra L. (two proteins) and from the leaves of Bougainvillea spectabilis Willd. (one protein). These RIPs inhibit protein synthesis both in a cell-free system, with an IC50 (concentration causing 50% inhibition) in the 10(-10) M range, and by various cell lines, with IC50S in the 10(-8)-10(-6) M range. All three RIPs released adenine not only from rat liver ribosomes but also from Escherichia coli rRNA, polyadenylic acid, herring sperm DNA, and artichoke mottled crinkle virus (AMCV) genomic RNA, thus being polynucleotide:adenosine glycosidases. The proteins from Basella rubra had toxicity to mice similar to that of most type 1 RIPs (Barbieri et al., 1993, Biochim Biophys Acta 1154: 237-282) with an LD50 (concentration that is 50% lethal) < or = 8 mg.kg-1 body weight, whilst the RIP from Bougainvillea spectabilis had an LD50 > 32 mg.kg-1. The N-terminal sequence of the two RIPs from Basella rubra had 80-93% identity, whereas it differed from the sequence of the RIP from Bougainvillea spectabilis. When tested with antibodies against various RIPs, the RIPs from Basella gave some cross-reactivity with sera against dianthin 32, and weak cross-reactivity with momordin I and momorcochin-S, whilst the RIP from Bougainvillea did not cross-react with any antiserum tested. An RIP from Basella rubra and one from Bougainvillea spectabilis were tested for antiviral activity, and both inhibited infection of Nicotiana benthamiana by AMCV.

  9. HMGB proteins involved in TOR signaling as general regulators of cell growth by controlling ribosome biogenesis.

    PubMed

    Vizoso-Vázquez, A; Barreiro-Alonso, A; González-Siso, M I; Rodríguez-Belmonte, E; Lamas-Maceiras, M; Cerdán, M E

    2018-04-30

    The number of ribosomes and their activity need to be highly regulated because their function is crucial for the cell. Ribosome biogenesis is necessary for cell growth and proliferation in accordance with nutrient availability and other external and intracellular signals. High-mobility group B (HMGB) proteins are conserved from yeasts to human and are decisive in cellular fate. These proteins play critical functions, from the maintenance of chromatin structure, DNA repair, or transcriptional regulation, to facilitation of ribosome biogenesis. They are also involved in cancer and other pathologies. In this review, we summarize evidence of how HMGB proteins contribute to ribosome-biogenesis control, with special emphasis on a common nexus to the target of rapamycin (TOR) pathway, a signaling cascade essential for cell growth and proliferation from yeast to human. Perspectives in this field are also discussed.

  10. Common Pharmacophore of Structurally Distinct Small-Molecule Inhibitors of Intracellular Retrograde Trafficking of Ribosome Inactivating Proteins

    NASA Astrophysics Data System (ADS)

    Yu, Shichao; Park, Jewn Giew; Kahn, Jennifer Nielsen; Tumer, Nilgun E.; Pang, Yuan-Ping

    2013-12-01

    We reported previously (+/-)-2-(5-methylthiophen-2-yl)-3-phenyl-2,3-dihydroquinazolin-4(1H)-one [(+/-)-Retro-2cycl] as the chemical structure of Retro-2 that showed mouse protection against ricin, a notorious ribosome inactivating protein (RIP). Herein we report our chemical resolution of (+/-)-Retro-2cycl, analog synthesis, and cell-based evaluation showing that the two optically pure enantiomers and their achiral analog have nearly the same degree of cell protection against ricin as (+/-)-Retro-2cycl. We also report our computational studies explaining the lack of stereo preference and revealing a common pharmacophore of structurally distinct inhibitors of intracellular retrograde trafficking of RIPs. This pharmacophore comprises a central aromatic ring o-substituted by an aromatic ring and a moiety bearing an O or S atom attached to sp2 C atom(s). These results offer new insights into lead identification and optimization for RIP antidote development to minimize the global health threat caused by ribosome-inactivating proteins.

  11. Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation.

    PubMed

    Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude

    2004-05-01

    The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.

  12. tRNA-derived short RNAs bind to Saccharomyces cerevisiae ribosomes in a stress-dependent manner and inhibit protein synthesis in vitro

    PubMed Central

    Kasprzyk, Marta; Twardowski, Tomasz

    2016-01-01

    Recently, a number of ribosome-associated non-coding RNAs (rancRNAs) have been discovered in all three domains of life. In our previous studies, we have described several types of rancRNAs in Saccharomyces cerevisiae, derived from many cellular RNAs, including mRNAs, rRNAs, tRNAs and snoRNAs. Here, we present the evidence that the tRNA fragments from simple eukaryotic organism S. cerevisiae directly bind to the ribosomes. Interestingly, rancRNA-tRFs in yeast are derived from both, 5′- and 3′-part of the tRNAs and both types of tRFs associate with the ribosomes in vitro. The location of tRFs within the ribosomes is distinct from classical A- and P-tRNA binding sites. Moreover, 3′-tRFs bind to the distinct site than 5′-tRFs. These interactions are stress dependent and as a consequence, provoke regulation of protein biosynthesis. We observe strong correlation between tRF binding to the ribosomes and inhibition of protein biosynthesis in particular environmental conditions. These results implicate the existence of an ancient and conserved mechanism of translation regulation with the involvement of ribosome-associating tRNA-derived fragments. PMID:27609601

  13. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    PubMed

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  14. Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

    PubMed

    Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C

    1998-03-03

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

  15. Identification in a pseudoknot of a U⋅G motif essential for the regulation of the expression of ribosomal protein S15

    PubMed Central

    Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude

    1998-01-01

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926

  16. Effects of the 1- N-(4-Amino-2 S-hydroxybutyryl) and 6'- N-(2-Hydroxyethyl) Substituents on Ribosomal Selectivity, Cochleotoxicity, and Antibacterial Activity in the Sisomicin Class of Aminoglycoside Antibiotics.

    PubMed

    Sonousi, Amr; Sarpe, Vikram A; Brilkova, Margarita; Schacht, Jochen; Vasella, Andrea; Böttger, Erik C; Crich, David

    2018-05-10

    Syntheses of the 6'- N-(2-hydroxyethyl) and 1- N-(4-amino-2 S-hydroxybutyryl) derivatives of the 4,6-aminoglycoside sisomicin and that of the doubly modified 1- N-(4-amino-2 S-hydroxybutyryl)-6'- N-(2-hydroxyethyl) derivative known as plazomicin are reported together with their antibacterial and antiribosomal activities and selectivities. The 6'- N-(2-hydroxyethyl) modification results in a moderate increase in prokaryotic/eukaryotic ribosomal selectivity, whereas the 1- N-(4-amino-2 S-hydroxybutyryl) modification has the opposite effect. When combined in plazomicin, the effects of the two groups on ribosomal selectivity cancel each other out, leading to the prediction that plazomicin will exhibit ototoxicity comparable to those of the parent and the current clinical aminoglycoside antibiotics gentamicin and tobramycin, as borne out by ex vivo studies with mouse cochlear explants. The 6'- N-(2-hydroxyethyl) modification restores antibacterial activity in the presence of the AAC(6') aminoglycoside-modifying enzymes, while the 1- N-(4-amino-2 S-hydroxybutyryl) modification overcomes resistance to the AAC(2') class but is still affected to some extent by the AAC(3) class. Neither modification is able to circumvent the ArmA ribosomal methyltransferase-induced aminoglycoside resistance. The use of phenyltriazenyl protection for the secondary amino group of sisomicin facilitates the synthesis of each derivative and their characterization through the provision of sharp NMR spectra for all intermediates.

  17. Access to Ribosomal Protein Rpl25p by the Signal Recognition Particle Is Required for Efficient Cotranslational Translocation

    PubMed Central

    Dalley, Jane A.; Selkirk, Alexander

    2008-01-01

    Targeting of proteins to the endoplasmic reticulum (ER) occurs cotranslationally necessitating the interaction of the signal recognition particle (SRP) and the translocon with the ribosome. Biochemical and structural studies implicate ribosomal protein Rpl25p as a major ribosome interaction site for both these factors. Here we characterize an RPL25GFP fusion, which behaves as a dominant mutant leading to defects in co- but not posttranslational translocation in vivo. In these cells, ribosomes still interact with ER membrane and the translocon, but are defective in binding SRP. Overexpression of SRP can restore ribosome binding of SRP, but only partially rescues growth and translocation defects. Our results indicate that Rpl25p plays a critical role in the recruitment of SRP to the ribosome. PMID:18448667

  18. RRP1B Targets PP1 to Mammalian Cell Nucleoli and Is Associated with Pre-60S Ribosomal Subunits

    PubMed Central

    Chamousset, Delphine; De Wever, Veerle; Moorhead, Greg B.; Chen, Yan; Boisvert, Francois-Michel; Lamond, Angus I.

    2010-01-01

    A pool of protein phosphatase 1 (PP1) accumulates within nucleoli and accounts for a large fraction of the serine/threonine protein phosphatase activity in this subnuclear structure. Using a combination of fluorescence imaging with quantitative proteomics, we mapped the subnuclear localization of the three mammalian PP1 isoforms stably expressed as GFP-fusions in live cells and identified RRP1B as a novel nucleolar targeting subunit that shows a specificity for PP1β and PP1γ. RRP1B, one of two mammalian orthologues of the yeast Rrp1p protein, shows an RNAse-dependent localization to the granular component of the nucleolus and distributes in a similar manner throughout the cell cycle to proteins involved in later steps of rRNA processing. Quantitative proteomic analysis of complexes containing both RRP1B and PP1γ revealed enrichment of an overlapping subset of large (60S) ribosomal subunit proteins and pre-60S nonribosomal proteins involved in mid-late processing. Targeting of PP1 to this complex by RRP1B in mammalian cells is likely to contribute to modulation of ribosome biogenesis by mechanisms involving reversible phosphorylation events, thus playing a role in the rapid transduction of cellular signals that call for regulation of ribosome production in response to cellular stress and/or changes in growth conditions. PMID:20926688

  19. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  20. Reengineering ribosome export.

    PubMed

    Lo, Kai-Yin; Johnson, Arlen W

    2009-03-01

    Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.

  1. Reengineering Ribosome Export

    PubMed Central

    Lo, Kai-Yin

    2009-01-01

    Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820

  2. Evolution of Drosophila ribosomal protein gene core promoters.

    PubMed

    Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

    2009-03-01

    The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, and mammals, demonstrating the evolutionary dynamics of the ribosomal gene regulatory network. We also report a motif present in similar numbers of RPGs among Drosophila species which does not appear to be conserved at the individual RPG gene level. A module-wise stabilizing selection theory is proposed to explain this observation. Overall, our results provide significant insight into the fast-evolving nature of transcriptional regulation in the RPG module.

  3. Evolution of Drosophila ribosomal protein gene core promoters

    PubMed Central

    Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

    2011-01-01

    The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, and mammals, demonstrating the evolutionary dynamics of the ribosomal gene regulatory network. We also report a motif present in similar numbers of RPGs among Drosophila species which does not appear to be conserved at the individual RPG gene level. A module-wise stabilizing selection theory is proposed to explain this observation. Overall, our results provide significant insight into the fast-evolving nature of transcriptional regulation in the RPG module. PMID:19059316

  4. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    PubMed

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P < 0.001) and total RNA content (-16 ± 2% vs. IGF-1; P < 0.001) in IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P < 0.05 vs. control) and total protein (+20 ± 2%; P < 0.001 vs. control) were not prevented by CX treatment. Suppression of rRNA synthesis during IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P < 0.001) and p70 S6K1 (269 ± 41% vs. CX; P < 0.001) phosphorylation. Despite robust inhibition of the dynamic ribosomal biogenesis response to IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  5. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    PubMed

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain

    PubMed Central

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan

    2017-01-01

    Abstract The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson–Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. PMID:28369621

  7. Translation Initiation Factor eIF4B Interacts with a Picornavirus Internal Ribosome Entry Site in both 48S and 80S Initiation Complexes Independently of Initiator AUG Location

    PubMed Central

    Ochs, Kerstin; Rust, René C.; Niepmann, Michael

    1999-01-01

    Most eukaryotic initiation factors (eIFs) are required for internal translation initiation at the internal ribosome entry site (IRES) of picornaviruses. eIF4B is incorporated into ribosomal 48S initiation complexes with the IRES RNA of foot-and-mouth disease virus (FMDV). In contrast to the weak interaction of eIF4B with capped cellular mRNAs and its release upon entry of the ribosomal 60S subunit, eIF4B remains tightly associated with the FMDV IRES during formation of complete 80S ribosomes. Binding of eIF4B to the IRES is energy dependent, and binding of the small ribosomal subunit to the IRES requires the previous energy-dependent association of initiation factors with the IRES. The interaction of eIF4B with the IRES in 48S and 80S complexes is independent of the location of the initiator AUG and thus independent of the mechanism by which the small ribosomal subunit is placed at the actual start codon, either by direct internal ribosomal entry or by scanning. eIF4B does not greatly rearrange its binding to the IRES upon entry of the ribosomal subunits, and the interaction of eIF4B with the IRES is independent of the polypyrimidine tract-binding protein, which enhances FMDV translation. PMID:10438840

  8. The Cyanobacterial Ribosomal-Associated Protein LrtA Is Involved in Post-Stress Survival in Synechocystis sp. PCC 6803.

    PubMed

    Galmozzi, Carla V; Florencio, Francisco J; Muro-Pastor, M Isabel

    2016-01-01

    A light-repressed transcript encodes the LrtA protein in cyanobacteria. We show that half-life of lrtA transcript from Synechocystis sp. PCC 6803 is higher in dark-treated cells as compared to light-grown cells, suggesting post-transcriptional control of lrtA expression. The lrtA 5´ untranslated leader region is involved in that darkness-dependent regulation. We also found that Synechocystis sp. PCC 6803 LrtA is a ribosome-associated protein present in both 30S and 70S ribosomal particles. In order to investigate the function of this protein we have constructed a deletion mutant of the lrtA gene. Cells lacking LrtA (∆lrtA) had significantly lower amount of 70S particles and a greater amount of 30S and 50S particles, suggesting a role of LrtA in stabilizing 70S particles. Synechocystis strains with different amounts of LrtA protein: wild-type, ∆lrtA, and LrtAS (overexpressing lrtA) showed no differences in their growth rate under standard laboratory conditions. However, a clear LrtA dose-dependent effect was observed in the presence of the antibiotic tylosin, being the LrtAS strains the most sensitive. Similar results were obtained under hyperosmotic stress caused by sorbitol. Conversely, after prolonged periods of starvation, ∆lrtA strains were delayed in their growth with respect to the wild-type and the LrtAS strains. A positive role of LrtA protein in post-stress survival is proposed.

  9. sORFs.org: a repository of small ORFs identified by ribosome profiling

    PubMed Central

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-01

    With the advent of ribosome profiling, a next generation sequencing technique providing a “snap-shot’’ of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these ‘sORFs’, indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. PMID:26527729

  10. Characterization and analysis of ribosomal proteins in two marine calanoid copepods

    NASA Astrophysics Data System (ADS)

    Yang, Feifei; Xu, Donghui; Zhuang, Yunyun; Huang, Yousong; Yi, Xiaoyan; Chen, Hongju; Liu, Guangxing; Zhang, Huan

    2016-11-01

    Copepods are among the most abundant and successful metazoans in the marine ecosystem. However, genomic resources related to fundamental cellular processes are still limited in this particular group of crustaceans. Ribosomal proteins are the building blocks of ribosomes, the primary site for protein synthesis. In this study, we characterized and analyzed the cDNAs of cytoplasmic ribosomal proteins (cRPs) of two calanoid copepods, Pseudodiaptomus poplesia and Acartia pacifica. We obtained 79 cRP cDNAs from P. poplesia and 67 from A. pacifica by cDNA library construction/sequencing and rapid amplification of cDNA ends. Analysis of the nucleic acid composition showed that the copepod cRP-encoding genes had higher GC content in the protein-coding regions (CDSs) than in the untranslated regions (UTRs), and single nucleotide repeats (>3 repeats) were common, with "A" repeats being the most frequent, especially in the CDSs. The 3'-UTRs of the cRP genes were significantly longer than the 5'-UTRs. Codon usage analysis showed that the third positions of the codons were dominated by C or G. The deduced amino acid sequences of the cRPs contained high proportions of positively charged residues and had high pI values. This is the first report of a complete set of cRP-encoding genes from copepods. Our results shed light on the characteristics of cRPs in copepods, and provide fundamental data for further studies of protein synthesis in copepods. The copepod cRP information revealed in this study indicates that additional comparisons and analysis should be performed on different taxonomic categories such as orders and families.

  11. Characterization of Ribosomes from Neurospora crassa

    PubMed Central

    Storck, R.

    1963-01-01

    Ribosomes isolated from growing hyphae of Neurospora crassa contain 53 per cent protein and 47 per cent RNA and have a sedimentation coefficient of 81S at 20°C and infinite dilution. These ribosomes are stable at pH 7.4 in the presence of 0.01 M and 0.002 M MgCl2 but undergo a dissociation into smaller particles if the MgCl2 concentration is lowered to 0.0001 M. Two types of RNA with sedimentation coefficients of 19S2050 and 13S2050 have been extracted from the 81S particles. PMID:13984420

  12. Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation

    PubMed Central

    Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J.; Ehresmann, Chantal; Portier, Claude

    2015-01-01

    Summary The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G•U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO–lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G•U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15–rpsO mRNA interactions can also be found, probably with A(−46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited. PMID:15101974

  13. Rice Ribosomal Protein Large Subunit Genes and Their Spatio-temporal and Stress Regulation

    PubMed Central

    Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Dutta, Mouboni; Madhav, Sheshu M.; Kirti, P. B.

    2016-01-01

    Ribosomal proteins (RPs) are well-known for their role in mediating protein synthesis and maintaining the stability of the ribosomal complex, which includes small and large subunits. In the present investigation, in a genome-wide survey, we predicted that the large subunit of rice ribosomes is encoded by at least 123 genes including individual gene copies, distributed throughout the 12 chromosomes. We selected 34 candidate genes, each having 2–3 identical copies, for a detailed characterization of their gene structures, protein properties, cis-regulatory elements and comprehensive expression analysis. RPL proteins appear to be involved in interactions with other RP and non-RP proteins and their encoded RNAs have a higher content of alpha-helices in their predicted secondary structures. The majority of RPs have binding sites for metal and non-metal ligands. Native expression profiling of 34 ribosomal protein large (RPL) subunit genes in tissues covering the major stages of rice growth shows that they are predominantly expressed in vegetative tissues and seedlings followed by meiotically active tissues like flowers. The putative promoter regions of these genes also carry cis-elements that respond specifically to stress and signaling molecules. All the 34 genes responded differentially to the abiotic stress treatments. Phytohormone and cold treatments induced significant up-regulation of several RPL genes, while heat and H2O2 treatments down-regulated a majority of them. Furthermore, infection with a bacterial pathogen, Xanthomonas oryzae, which causes leaf blight also induced the expression of 80% of the RPL genes in leaves. Although the expression of RPL genes was detected in all the tissues studied, they are highly responsive to stress and signaling molecules indicating that their encoded proteins appear to have roles in stress amelioration besides house-keeping. This shows that the RPL gene family is a valuable resource for manipulation of stress tolerance in

  14. Ferulic acid attenuates focal cerebral ischemia-induced decreases in p70S6 kinase and S6 phosphorylation.

    PubMed

    Koh, Phil-Ok

    2013-10-25

    Ferulic acid exhibits neuroprotective effects against focal cerebral ischemia. PI3/K and Akt signaling pathways play an essential role in protecting against cerebral ischemia. Mammalian target of rapamycin (mTOR), a major downstream target of Akt, regulates p70S6 kinase and S6, both of which are involved in ribosomal biogenesis and protein synthesis. I investigated whether ferulic acid regulates mTOR, p70S6 kinase, and S6 phosphorylation during brain ischemic injury. Rats were treated immediately with vehicle or ferulic acid (100mg/kg, i.v.) after middle cerebral artery occlusion (MCAO). Brains tissues were removed at 24h after the onset of MCAO and the cerebral cortex regions were collected. Ferulic acid reduced the MCAO-induced infarct volume. I showed previously that ferulic acid prevents the MCAO injury-induced decrease of Akt phosphorylation. In this study, MCAO injury induced decreases in mTOR, p70S6 kinase, and S6 phosphorylation levels, while ferulic acid attenuated the injury-induced decreases. Immunohistochemical staining demonstrated that ferulic acid prevented the MCAO-induced reduction in the number of positive cells for phosphorylated p70S6 kinase and phosphorylated S6. These findings suggest that ferulic acid has a neuroprotective function against focal cerebral ischemia by modulating p70S6 kinase expression and S6 phosphorylation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  15. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    PubMed

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  16. Role for ribosome-associated complex and stress-seventy subfamily B (RAC-Ssb) in integral membrane protein translation.

    PubMed

    Acosta-Sampson, Ligia; Döring, Kristina; Lin, Yuping; Yu, Vivian Y; Bukau, Bernd; Kramer, Günter; Cate, Jamie H D

    2017-12-01

    Targeting of most integral membrane proteins to the endoplasmic reticulum is controlled by the signal recognition particle, which recognizes a hydrophobic signal sequence near the protein N terminus. Proper folding of these proteins is monitored by the unfolded protein response and involves protein degradation pathways to ensure quality control. Here, we identify a new pathway for quality control of major facilitator superfamily transporters that occurs before the first transmembrane helix, the signal sequence recognized by the signal recognition particle, is made by the ribosome. Increased rates of translation elongation of the N-terminal sequence of these integral membrane proteins can divert the nascent protein chains to the ribosome-associated complex and stress-seventy subfamily B chaperones. We also show that quality control of integral membrane proteins by ribosome-associated complex-stress-seventy subfamily B couples translation rate to the unfolded protein response, which has implications for understanding mechanisms underlying human disease and protein production in biotechnology. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis

    PubMed Central

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia

    2017-01-01

    Abstract Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an ‘all-or-none’ pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. PMID:28520982

  18. Dianthins, ribosome-damaging proteins with anti-viral properties from Dianthus caryophyllus L. (carnation).

    PubMed Central

    Stirpe, F; Williams, D G; Onyon, L J; Legg, R F; Stevens, W A

    1981-01-01

    1. Dianthin 30 and dianthin 32, two proteins isolated from the leaves of Diathus caryophyllus (carnation), were purified to homogeneity by chromatography on CM-cellulose. 2. The mol.wt. of dianthin 30 is 29 500 and that of dianthin 32 is 31 700. Both dianthins are glycoproteins containing mannose. 3. Dianthins inhibit protein synthesis in a lysate of rabbit reticulocytes, with an ID50 (concentration giving 50% inhibition) of 9.15 ng/ml (dianthin 30) and 3.6 ng/ml (dianthin 32). They act by damaging ribosomes in a less-than-equimolar ratio. Protein synthesis by intact cells is partially inhibited by dianthins at a concentration of 100 microgram/ml. 4. Dianthins mixed with tobacco-mosaic virus strongly decrease the number of local lesions on leaves of Nicotiana glutinosa. Images Fig. 2. PMID:7316958

  19. Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul

    2009-06-01

    Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultantmore » fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.« less

  20. Alpha-momorcharin: a ribosome-inactivating protein from Momordica charantia, possessing DNA cleavage properties.

    PubMed

    Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi

    2013-11-01

    Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.

  1. [Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].

    PubMed

    Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G

    2005-01-01

    Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.

  2. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    NASA Astrophysics Data System (ADS)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production.

  3. Peeling the onion: ribosomes are ancient molecular fossils.

    PubMed

    Hsiao, Chiaolong; Mohan, Srividya; Kalahar, Benson K; Williams, Loren Dean

    2009-11-01

    We describe a method to establish chronologies of ancient ribosomal evolution. The method uses structure-based and sequence-based comparison of the large subunits (LSUs) of Haloarcula marismortui and Thermus thermophilus. These are the highest resolution ribosome structures available and represent disparate regions of the evolutionary tree. We have sectioned the superimposed LSUs into concentric shells, like an onion, using the site of peptidyl transfer as the origin (the PT-origin). This spherical approximation combined with a shell-by-shell comparison captures significant information along the evolutionary time line revealing, for example, that sequence and conformational similarity of the 23S rRNAs are greatest near the PT-origin and diverge smoothly with distance from it. The results suggest that the conformation and interactions of both RNA and protein can be described as changing, in an observable manner, over evolutionary time. The tendency of macromolecules to assume regular secondary structural elements such as A-form helices with Watson-Crick base pairs (RNA) and alpha-helices and beta-sheets (protein) is low at early time points but increases as time progresses. The conformations of ribosomal protein components near the PT-origin suggest that they may be molecular fossils of the peptide ancestors of ribosomal proteins. Their abbreviated length may have proscribed formation of secondary structure, which is indeed nearly absent from the region of the LSU nearest the PT-origin. Formation and evolution of the early PT center may have involved Mg(2+)-mediated assembly of at least partially single-stranded RNA oligomers or polymers. As one moves from center to periphery, proteins appear to replace magnesium ions. The LSU is known to have undergone large-scale conformation changes upon assembly. The T. thermophilus LSU analyzed here is part of a fully assembled ribosome, whereas the H. marismortui LSU analyzed here is dissociated from other ribosomal components

  4. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

    2007-11-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

  5. Genome-wide screening of Oryza sativa ssp. japonica and indica reveals a complex family of proteins with ribosome-inactivating protein domains.

    PubMed

    Wytynck, Pieter; Rougé, Pierre; Van Damme, Els J M

    2017-11-01

    Ribosome-inactivating proteins (RIPs) are cytotoxic enzymes capable of halting protein synthesis by irreversible modification of ribosomes. Although RIPs are widespread they are not ubiquitous in the plant kingdom. The physiological importance of RIPs is not fully elucidated, but evidence suggests a role in the protection of the plant against biotic and abiotic stresses. Searches in the rice genome revealed a large and highly complex family of proteins with a RIP domain. A comparative analysis retrieved 38 RIP sequences from the genome sequence of Oryza sativa subspecies japonica and 34 sequences from the subspecies indica. The RIP sequences are scattered over different chromosomes but are mostly found on the third chromosome. The phylogenetic tree revealed the pairwise clustering of RIPs from japonica and indica. Molecular modeling and sequence analysis yielded information on the catalytic site of the enzyme, and suggested that a large part of RIP domains probably possess N-glycosidase activity. Several RIPs are differentially expressed in plant tissues and in response to specific abiotic stresses. This study provides an overview of RIP motifs in rice and will help to understand their biological role(s) and evolutionary relationships. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Dissecting the transcriptional phenotype of ribosomal protein deficiency: implications for Diamond-Blackfan Anemia

    PubMed Central

    Aspesi, Anna; Pavesi, Elisa; Robotti, Elisa; Crescitelli, Rossella; Boria, Ilenia; Avondo, Federica; Moniz, Hélène; Da Costa, Lydie; Mohandas, Narla; Roncaglia, Paola; Ramenghi, Ugo; Ronchi, Antonella; Gustincich, Stefano; Merlin, Simone; Marengo, Emilio; Ellis, Steven R.; Follenzi, Antonia; Santoro, Claudio; Dianzani, Irma

    2014-01-01

    Defects in genes encoding ribosomal proteins cause Diamond Blackfan Anemia (DBA), a red cell aplasia often associated with physical abnormalities. Other bone marrow failure syndromes have been attributed to defects in ribosomal components but the link between erythropoiesis and the ribosome remains to be fully defined. Several lines of evidence suggest that defects in ribosome synthesis lead to “ribosomal stress” with p53 activation and either cell cycle arrest or induction of apoptosis. Pathways independent of p53 have also been proposed to play a role in DBA pathogenesis. We took an unbiased approach to identify p53-independent pathways activated by defects in ribosome synthesis by analyzing global gene expression in various cellular models of DBA. Ranking-Principal Component Analysis (Ranking-PCA) was applied to the identified datasets to determine whether there are common sets of genes whose expression is altered in these different cellular models. We observed consistent changes in the expression of genes involved in cellular amino acid metabolic process, negative regulation of cell proliferation and cell redox homeostasis. These data indicate that cells respond to defects in ribosome synthesis by changing the level of expression of a limited subset of genes involved in critical cellular processes. Moreover, our data support a role for p53-independent pathways in the pathophysiology of DBA. PMID:24835311

  7. Rrp5p, Noc1p and Noc2p form a protein module which is part of early large ribosomal subunit precursors in S. cerevisiae

    PubMed Central

    Hierlmeier, Thomas; Merl, Juliane; Sauert, Martina; Perez-Fernandez, Jorge; Schultz, Patrick; Bruckmann, Astrid; Hamperl, Stephan; Ohmayer, Uli; Rachel, Reinhard; Jacob, Anja; Hergert, Kristin; Deutzmann, Rainer; Griesenbeck, Joachim; Hurt, Ed; Milkereit, Philipp; Baßler, Jochen; Tschochner, Herbert

    2013-01-01

    Eukaryotic ribosome biogenesis requires more than 150 auxiliary proteins, which transiently interact with pre-ribosomal particles. Previous studies suggest that several of these biogenesis factors function together as modules. Using a heterologous expression system, we show that the large ribosomal subunit (LSU) biogenesis factor Noc1p of Saccharomyces cerevisiae can simultaneously interact with the LSU biogenesis factor Noc2p and Rrp5p, a factor required for biogenesis of the large and the small ribosomal subunit. Proteome analysis of RNA polymerase-I-associated chromatin and chromatin immunopurification experiments indicated that all members of this protein module and a specific set of LSU biogenesis factors are co-transcriptionally recruited to nascent ribosomal RNA (rRNA) precursors in yeast cells. Further ex vivo analyses showed that all module members predominantly interact with early pre-LSU particles after the initial pre-rRNA processing events have occurred. In yeast strains depleted of Noc1p, Noc2p or Rrp5p, levels of the major LSU pre-rRNAs decreased and the respective other module members were associated with accumulating aberrant rRNA fragments. Therefore, we conclude that the module exhibits several binding interfaces with pre-ribosomes. Taken together, our results suggest a co- and post-transcriptional role of the yeast Rrp5p–Noc1p–Noc2p module in the structural organization of early LSU precursors protecting them from non-productive RNase activity. PMID:23209026

  8. Structural and Functional Characterization of Ribosomal Protein Gene Introns in Sponges

    PubMed Central

    Perina, Drago; Korolija, Marina; Mikoč, Andreja; Roller, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with “higher” metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales. PMID:22880015

  9. Structural and functional characterization of ribosomal protein gene introns in sponges.

    PubMed

    Perina, Drago; Korolija, Marina; Mikoč, Andreja; Roller, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales.

  10. Evaluation of immune responses and analysis of the effect of vaccination of the Leishmania major recombinant ribosomal proteins L3 or L5 in two different murine models of cutaneous leishmaniasis.

    PubMed

    Ramírez, Laura; Santos, Diego M; Souza, Ana P; Coelho, Eduardo A F; Barral, Aldina; Alonso, Carlos; Escutia, Marta R; Bonay, Pedro; de Oliveira, Camila I; Soto, Manuel

    2013-02-18

    Four new antigenic proteins located in Leishmania ribosomes have been characterized: S4, S6, L3 and L5. Recombinant versions of the four ribosomal proteins from Leishmania major were recognized by sera from human and canine patients suffering different clinical forms of leishmaniasis. The prophylactic properties of these proteins were first studied in the experimental model of cutaneous leishmaniasis caused by L. major inoculation into BALB/c mice. The administration of two of them, LmL3 or LmL5 combined with CpG-oligodeoxynucleotides (CpG-ODN) was able to protect BALB/c mice against L. major infection. Vaccinated mice showed smaller lesions and parasite burden compared to mice inoculated with vaccine diluent or vaccine adjuvant. Protection was correlated with an antigen-specific increased production of IFN-γ paralleled by a decrease of the antigen-specific IL-10 mediated response in protected mice relative to non-protected controls. Further, it was demonstrated that BALB/c mice vaccinated with recombinant LmL3 or LmL5 plus CpG-ODN were also protected against the development of cutaneous lesions following inoculation of L. braziliensis. Together, data presented here indicate that LmL3 or LmL5 ribosomal proteins combined with Th1 inducing adjuvants, may be relevant components of a vaccine against cutaneous leishmaniasis caused by distinct species. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    PubMed

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  12. Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

    PubMed Central

    Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

    2018-01-01

    The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

  13. Unbiased Quantitative Models of Protein Translation Derived from Ribosome Profiling Data

    PubMed Central

    Gritsenko, Alexey A.; Hulsman, Marc; Reinders, Marcel J. T.; de Ridder, Dick

    2015-01-01

    Translation of RNA to protein is a core process for any living organism. While for some steps of this process the effect on protein production is understood, a holistic understanding of translation still remains elusive. In silico modelling is a promising approach for elucidating the process of protein synthesis. Although a number of computational models of the process have been proposed, their application is limited by the assumptions they make. Ribosome profiling (RP), a relatively new sequencing-based technique capable of recording snapshots of the locations of actively translating ribosomes, is a promising source of information for deriving unbiased data-driven translation models. However, quantitative analysis of RP data is challenging due to high measurement variance and the inability to discriminate between the number of ribosomes measured on a gene and their speed of translation. We propose a solution in the form of a novel multi-scale interpretation of RP data that allows for deriving models with translation dynamics extracted from the snapshots. We demonstrate the usefulness of this approach by simultaneously determining for the first time per-codon translation elongation and per-gene translation initiation rates of Saccharomyces cerevisiae from RP data for two versions of the Totally Asymmetric Exclusion Process (TASEP) model of translation. We do this in an unbiased fashion, by fitting the models using only RP data with a novel optimization scheme based on Monte Carlo simulation to keep the problem tractable. The fitted models match the data significantly better than existing models and their predictions show better agreement with several independent protein abundance datasets than existing models. Results additionally indicate that the tRNA pool adaptation hypothesis is incomplete, with evidence suggesting that tRNA post-transcriptional modifications and codon context may play a role in determining codon elongation rates. PMID:26275099

  14. Unbiased Quantitative Models of Protein Translation Derived from Ribosome Profiling Data.

    PubMed

    Gritsenko, Alexey A; Hulsman, Marc; Reinders, Marcel J T; de Ridder, Dick

    2015-08-01

    Translation of RNA to protein is a core process for any living organism. While for some steps of this process the effect on protein production is understood, a holistic understanding of translation still remains elusive. In silico modelling is a promising approach for elucidating the process of protein synthesis. Although a number of computational models of the process have been proposed, their application is limited by the assumptions they make. Ribosome profiling (RP), a relatively new sequencing-based technique capable of recording snapshots of the locations of actively translating ribosomes, is a promising source of information for deriving unbiased data-driven translation models. However, quantitative analysis of RP data is challenging due to high measurement variance and the inability to discriminate between the number of ribosomes measured on a gene and their speed of translation. We propose a solution in the form of a novel multi-scale interpretation of RP data that allows for deriving models with translation dynamics extracted from the snapshots. We demonstrate the usefulness of this approach by simultaneously determining for the first time per-codon translation elongation and per-gene translation initiation rates of Saccharomyces cerevisiae from RP data for two versions of the Totally Asymmetric Exclusion Process (TASEP) model of translation. We do this in an unbiased fashion, by fitting the models using only RP data with a novel optimization scheme based on Monte Carlo simulation to keep the problem tractable. The fitted models match the data significantly better than existing models and their predictions show better agreement with several independent protein abundance datasets than existing models. Results additionally indicate that the tRNA pool adaptation hypothesis is incomplete, with evidence suggesting that tRNA post-transcriptional modifications and codon context may play a role in determining codon elongation rates.

  15. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies

    PubMed Central

    Amanatiadou, Elsa P.; Papadopoulos, Giorgio L.; Strouboulis, John; Vizirianakis, Ioannis S.

    2015-01-01

    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  16. The E3 ubiquitin ligase and RNA-binding protein ZNF598 orchestrates ribosome quality control of premature polyadenylated mRNAs

    PubMed Central

    Garzia, Aitor; Jafarnejad, Seyed Mehdi; Meyer, Cindy; Chapat, Clément; Gogakos, Tasos; Morozov, Pavel; Amiri, Mehdi; Shapiro, Maayan; Molina, Henrik; Tuschl, Thomas; Sonenberg, Nahum

    2017-01-01

    Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs and their mechanism of action remain unknown. We studied the Zinc Finger Protein 598 (ZNF598) using PAR-CLIP and revealed that it cross-links to tRNAs, mRNAs and rRNAs, thereby placing the protein on translating ribosomes. Cross-linked reads originating from AAA-decoding tRNALys(UUU) were 10-fold enriched over its cellular abundance, and poly-lysine encoded by poly(AAA) induced RQC in a ZNF598-dependent manner. Encounter with translated polyA segments by ZNF598 triggered ubiquitination of several ribosomal proteins, requiring the E2 ubiquitin ligase UBE2D3 to initiate RQC. Considering that human CDS are devoid of >4 consecutive AAA codons, sensing of prematurely placed polyA tails by a specialized RNA-binding protein is a novel nucleic-acid-based surveillance mechanism of RQC. PMID:28685749

  17. The E3 ubiquitin ligase and RNA-binding protein ZNF598 orchestrates ribosome quality control of premature polyadenylated mRNAs.

    PubMed

    Garzia, Aitor; Jafarnejad, Seyed Mehdi; Meyer, Cindy; Chapat, Clément; Gogakos, Tasos; Morozov, Pavel; Amiri, Mehdi; Shapiro, Maayan; Molina, Henrik; Tuschl, Thomas; Sonenberg, Nahum

    2017-07-07

    Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs and their mechanism of action remain unknown. We studied the Zinc Finger Protein 598 (ZNF598) using PAR-CLIP and revealed that it cross-links to tRNAs, mRNAs and rRNAs, thereby placing the protein on translating ribosomes. Cross-linked reads originating from AAA-decoding tRNA Lys (UUU) were 10-fold enriched over its cellular abundance, and poly-lysine encoded by poly(AAA) induced RQC in a ZNF598-dependent manner. Encounter with translated polyA segments by ZNF598 triggered ubiquitination of several ribosomal proteins, requiring the E2 ubiquitin ligase UBE2D3 to initiate RQC. Considering that human CDS are devoid of >4 consecutive AAA codons, sensing of prematurely placed polyA tails by a specialized RNA-binding protein is a novel nucleic-acid-based surveillance mechanism of RQC.

  18. Amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui.

    PubMed

    Hatakeyama, T; Hatakeyama, T

    1990-07-06

    The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.

  19. Immunohistochemical analysis of S6K1 and S6K2 localization in human breast tumors.

    PubMed

    Filonenko, Valeriy V; Tytarenko, Ruslana; Azatjan, Sergey K; Savinska, Lilya O; Gaydar, Yuriy A; Gout, Ivan T; Usenko, Vasiliy S; Lyzogubov, Valeriy V

    2004-12-01

    To perform an immunohistochemical analysis of human breast adenomas and adenocarcinomas as well as normal breast tissues in respect of S6 ribosomal protein kinase (S6K) expression and localization in normal and transformed cells. The expression level and localization of S6K have been detected in formalin fixed, paraffin embedded sections of normal human breast tissues, adenomas and adenocarcinomas with different grade of differentiation. Immunohistochemical detection of S6K1 and S6K2 in normal human breast tissues and breast tumors were performed using specific monoclonal and polyclonal antibodies against S6K1 and S6K2 with following semiquantitative analysis. The increase of S6K content in the cytoplasm of epithelial cells in benign and malignant tumors has been detected. Nuclear accumulation of S6K1 and to a greater extend S6K2 have been found in breast adenocarcinomas. About 80% of breast adenocarcinomas cases revealed S6K2 nuclear staining comparing to normal tissues. In 31% of cases more then 50% of cancer cells had strong nuclear staining. Accumulation of S6K1 in the nucleus of neoplastic cells has been demonstrated in 25% of cases. Nuclear localization of S6K in the epithelial cells in normal breast tissues has not been detected. Immunohistochemical analysis of S6K1 and S6K2 expression in normal human breast tissues, benign and malignant breast tumors clearly indicates that both kinases are overexpressed in breast tumors. Semiquantitative analysis of peculiarities of S6K localization in normal tissues and tumors revealed that nucleoplasmic accumulation of S6K (especially S6K2) is a distinguishing feature of cancer cells.

  20. Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples.

    PubMed

    Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T

    1998-09-25

    A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

  1. Characterization of the diatomite binding domain in the ribosomal protein L2 from E. coli and functions as an affinity tag.

    PubMed

    Li, Junhua; Zhang, Yang; Yang, Yanjun

    2013-03-01

    The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.

  2. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    PubMed

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  3. Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

    PubMed

    Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

    1994-08-02

    Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

  4. Charged and Hydrophobic Surfaces on the A Chain of Shiga-Like Toxin 1 Recognize the C-Terminal Domain of Ribosomal Stalk Proteins

    PubMed Central

    McCluskey, Andrew J.; Bolewska-Pedyczak, Eleonora; Jarvik, Nick; Chen, Gang; Sidhu, Sachdev S.; Gariépy, Jean

    2012-01-01

    Shiga-like toxins are ribosome-inactivating proteins (RIP) produced by pathogenic E. coli strains that are responsible for hemorrhagic colitis and hemolytic uremic syndrome. The catalytic A1 chain of Shiga-like toxin 1 (SLT-1), a representative RIP, first docks onto a conserved peptide SD[D/E]DMGFGLFD located at the C-terminus of all three eukaryotic ribosomal stalk proteins and halts protein synthesis through the depurination of an adenine base in the sarcin-ricin loop of 28S rRNA. Here, we report that the A1 chain of SLT-1 rapidly binds to and dissociates from the C-terminal peptide with a monomeric dissociation constant of 13 µM. An alanine scan performed on the conserved peptide revealed that the SLT-1 A1 chain interacts with the anionic tripeptide DDD and the hydrophobic tetrapeptide motif FGLF within its sequence. Based on these 2 peptide motifs, SLT-1 A1 variants were generated that displayed decreased affinities for the stalk protein C-terminus and also correlated with reduced ribosome-inactivating activities in relation to the wild-type A1 chain. The toxin-peptide interaction and subsequent toxicity were shown to be mediated by cationic and hydrophobic docking surfaces on the SLT-1 catalytic domain. These docking surfaces are located on the opposite face of the catalytic cleft and suggest that the docking of the A1 chain to SDDDMGFGLFD may reorient its catalytic domain to face its RNA substrate. More importantly, both the delineated A1 chain ribosomal docking surfaces and the ribosomal peptide itself represent a target and a scaffold, respectively, for the design of generic inhibitors to block the action of RIPs. PMID:22355345

  5. A Hexane Fraction of Guava Leaves (Psidium guajava L.) Induces Anticancer Activity by Suppressing AKT/Mammalian Target of Rapamycin/Ribosomal p70 S6 Kinase in Human Prostate Cancer Cells

    PubMed Central

    Ryu, Nae Hyung; Park, Kyung-Ran; Kim, Sung-Moo; Yun, Hyung-Mun; Nam, Dongwoo; Lee, Seok-Geun; Jang, Hyeung-Jin; Ahn, Kyoo Seok; Kim, Sung-Hoon; Shim, Bum Sang; Choi, Seung-Hoon; Mosaddik, Ashik

    2012-01-01

    Abstract This study was carried out to evaluate the anticancer effects of guava leaf extracts and its fractions. The chemical compositions of the active extracts were also determined. In the present study, we set out to determine whether the anticancer effects of guava leaves are linked with their ability to suppress constitutive AKT/mammalian target of rapamycin (mTOR)/ribosomal p70 S6 kinase (S6K1) and mitogen-activated protein kinase (MAPK) activation pathways in human prostate cancer cells. We found that guava leaf hexane fraction (GHF) was the most potent inducer of cytotoxic and apoptotic effects in PC-3 cells. The molecular mechanism or mechanisms of GHF apoptotic potential were correlated with the suppression of AKT/mTOR/S6K1 and MAPK signaling pathways. This effect of GHF correlated with down-regulation of various proteins that mediate cell proliferation, cell survival, metastasis, and angiogenesis. Analysis of GHF by gas chromatography and gas chromatography–mass spectrometry tentatively identified 60 compounds, including β-eudesmol (11.98%), α-copaene (7.97%), phytol (7.95%), α-patchoulene (3.76%), β-caryophyllene oxide (CPO) (3.63%), caryophylla-3(15),7(14)-dien-6-ol (2.68%), (E)-methyl isoeugenol (1.90%), α-terpineol (1.76%), and octadecane (1.23%). Besides GHF, CPO, but not phytol, also inhibited the AKT/mTOR/S6K1 signaling pathway and induced apoptosis in prostate cancer cells. Overall, these findings suggest that guava leaves can interfere with multiple signaling cascades linked with tumorigenesis and provide a source of potential therapeutic compounds for both the prevention and treatment of cancer. PMID:22280146

  6. A hexane fraction of guava Leaves (Psidium guajava L.) induces anticancer activity by suppressing AKT/mammalian target of rapamycin/ribosomal p70 S6 kinase in human prostate cancer cells.

    PubMed

    Ryu, Nae Hyung; Park, Kyung-Ran; Kim, Sung-Moo; Yun, Hyung-Mun; Nam, Dongwoo; Lee, Seok-Geun; Jang, Hyeung-Jin; Ahn, Kyoo Seok; Kim, Sung-Hoon; Shim, Bum Sang; Choi, Seung-Hoon; Mosaddik, Ashik; Cho, Somi K; Ahn, Kwang Seok

    2012-03-01

    This study was carried out to evaluate the anticancer effects of guava leaf extracts and its fractions. The chemical compositions of the active extracts were also determined. In the present study, we set out to determine whether the anticancer effects of guava leaves are linked with their ability to suppress constitutive AKT/mammalian target of rapamycin (mTOR)/ribosomal p70 S6 kinase (S6K1) and mitogen-activated protein kinase (MAPK) activation pathways in human prostate cancer cells. We found that guava leaf hexane fraction (GHF) was the most potent inducer of cytotoxic and apoptotic effects in PC-3 cells. The molecular mechanism or mechanisms of GHF apoptotic potential were correlated with the suppression of AKT/mTOR/S6K1 and MAPK signaling pathways. This effect of GHF correlated with down-regulation of various proteins that mediate cell proliferation, cell survival, metastasis, and angiogenesis. Analysis of GHF by gas chromatography and gas chromatography-mass spectrometry tentatively identified 60 compounds, including β-eudesmol (11.98%), α-copaene (7.97%), phytol (7.95%), α-patchoulene (3.76%), β-caryophyllene oxide (CPO) (3.63%), caryophylla-3(15),7(14)-dien-6-ol (2.68%), (E)-methyl isoeugenol (1.90%), α-terpineol (1.76%), and octadecane (1.23%). Besides GHF, CPO, but not phytol, also inhibited the AKT/mTOR/S6K1 signaling pathway and induced apoptosis in prostate cancer cells. Overall, these findings suggest that guava leaves can interfere with multiple signaling cascades linked with tumorigenesis and provide a source of potential therapeutic compounds for both the prevention and treatment of cancer.

  7. Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation

    PubMed Central

    Schepetilnikov, Mikhail; Kobayashi, Kappei; Geldreich, Angèle; Caranta, Carole; Robaglia, Christophe; Keller, Mario; Ryabova, Lyubov A

    2011-01-01

    The protein kinase TOR (target-of-rapamycin) upregulates translation initiation in eukaryotes, but initiation restart after long ORF translation is restricted by largely unknown pathways. The plant viral reinitiation factor transactivator–viroplasmin (TAV) exceptionally promotes reinitiation through a mechanism involving retention on 80S and reuse of eIF3 and the host factor reinitiation-supporting protein (RISP) to regenerate reinitiation-competent ribosomal complexes. Here, we show that TAV function in reinitiation depends on physical association with TOR, with TAV–TOR binding being critical for both translation reinitiation and viral fitness. Consistently, TOR-deficient plants are resistant to viral infection. TAV triggers TOR hyperactivation and S6K1 phosphorylation in planta. When activated, TOR binds polyribosomes concomitantly with polysomal accumulation of eIF3 and RISP—a novel and specific target of TOR/S6K1—in a TAV-dependent manner, with RISP being phosphorylated. TAV mutants defective in TOR binding fail to recruit TOR, thereby abolishing RISP phosphorylation in polysomes and reinitiation. Thus, activation of reinitiation after long ORF translation is more complex than previously appreciated, with TOR/S6K1 upregulation being the key event in the formation of reinitiation-competent ribosomal complexes. PMID:21343906

  8. Structural analysis of a type 1 ribosome inactivating protein reveals multiple L-asparagine-N-acetyl-D-glucosamine monosaccharide modifications: Implications for cytotoxicity

    PubMed Central

    HOGG, TANIS; MENDEL, JAMESON T.; LAVEZO, JONATHAN L.

    2015-01-01

    Pokeweed antiviral protein (PAP) belongs to the family of type I ribosome-inactivating proteins (RIPs): Ribotoxins, which function by depurinating the sarcin-ricin loop of ribosomal RNA. In addition to its antibacterial and antifungal properties, PAP has shown promise in antiviral and targeted tumor therapy owing to its ability to depurinate viral RNA and eukaryotic rRNA. Several PAP genes are differentially expressed across pokeweed tissues, with natively isolated seed forms of PAP exhibiting the greatest cytotoxicity. To help elucidate the molecular basis of increased cytotoxicity of PAP isoenzymes from seeds, the present study used protein sequencing, mass spectroscopy and X-ray crystallography to determine the complete covalent structure and 1.7 Å X-ray crystal structure of PAP-S1aci isolated from seeds of Asian pokeweed (Phytolacca acinosa). PAP-S1aci shares ~95% sequence identity with PAP-S1 from P. americana and contains the signature catalytic residues of the RIP superfamily, corresponding to Tyr72, Tyr122, Glu175 and Arg178 in PAP-S1aci. A rare proline substitution (Pro174) was identified in the active site of PAP-S1aci, which has no effect on catalytic Glu175 positioning or overall active-site topology, yet appears to come at the expense of strained main-chain geometry at the pre-proline residue Val173. Notably, a rare type of N-glycosylation was detected consisting of N-acetyl-D-glucosamine monosaccharide residues linked to Asn10, Asn44 and Asn255 of PAP-S1aci. Of note, our modeling studies suggested that the ribosome depurination activity of seed PAPs would be adversely affected by the N-glycosylation of Asn44 and Asn255 with larger and more typical oligosaccharide chains, as they would shield the rRNA-binding sites on the protein. These results, coupled with evidence gathered from the literature, suggest that this type of minimal N-glycosylation in seed PAPs and other type I seed RIPs may serve to enhance cytotoxicity by exploiting receptor

  9. Interaction of tetracycline with RNA: photoincorporation into ribosomal RNA of Escherichia coli.

    PubMed Central

    Oehler, R; Polacek, N; Steiner, G; Barta, A

    1997-01-01

    Photolysis of [3H]tetracycline in the presence of Escherichia coli ribosomes results in an approximately 1:1 ratio of labelling ribosomal proteins and RNAs. In this work we characterize crosslinks to both 16S and 23S RNAs. Previously, the main target of photoincorporation of [3H]tetracycline into ribosomal proteins was shown to be S7, which is also part of the one strong binding site of tetracycline on the 30S subunit. The crosslinks on 23S RNA map exclusively to the central loop of domain V (G2505, G2576 and G2608) which is part of the peptidyl transferase region. However, experiments performed with chimeric ribosomal subunits demonstrate that peptidyltransferase activity is not affected by tetracycline crosslinked solely to the 50S subunits. Three different positions are labelled on the 16S RNA, G693, G1300 and G1338. The positions of these crosslinked nucleotides correlate well with footprints on the 16S RNA produced either by tRNA or the protein S7. This suggests that the nucleotides are labelled by tetracycline bound to the strong binding site on the 30S subunit. In addition, our results demonstrate that the well known inhibition of tRNA binding to the A-site is solely due to tetracycline crosslinked to 30S subunits and furthermore suggest that interactions of the antibiotic with 16S RNA might be involved in its mode of action. PMID:9092632

  10. Comparative genomics of bacterial zinc regulons: enhanced ion transport, pathogenesis, and rearrangement of ribosomal proteins.

    PubMed

    Panina, Ekaterina M; Mironov, Andrey A; Gelfand, Mikhail S

    2003-08-19

    Zinc is an important component of many proteins, but in large concentrations it is poisonous to the cell. Thus its transport is regulated by zinc repressors ZUR of proteobacteria and Gram-positive bacteria from the Bacillus group and AdcR of bacteria from the Streptococcus group. Comparative computational analysis allowed us to identify binding signals of ZUR repressors GAAATGTTATANTATAACATTTC for gamma-proteobacteria, GTAATGTAATAACATTAC for the Agrobacterium group, GATATGTTATAACATATC for the Rhododoccus group, TAAATCGTAATNATTACGATTTA for Gram-positive bacteria, and TTAACYRGTTAA of the streptococcal AdcR repressor. In addition to known transporters and their paralogs, zinc regulons were predicted to contain a candidate component of the ATP binding cassette, zinT (b1995 in Escherichia coli and yrpE in Bacillus subtilis). Candidate AdcR-binding sites were identified upstream of genes encoding pneumococcal histidine triad (PHT) proteins from a number of pathogenic streptococci. Protein functional analysis of this family suggests that PHT proteins are involved in the invasion process. Finally, repression by zinc was predicted for genes encoding a variety of paralogs of ribosomal proteins. The original copies of all these proteins contain zinc-ribbon motifs and thus likely bind zinc, whereas these motifs are destroyed in zinc-regulated paralogs. We suggest that the induction of these paralogs in conditions of zinc starvation leads to their incorporation in a fraction of ribosomes instead of the original ribosomal proteins; the latter are then degraded with subsequent release of some zinc for the utilization by other proteins. Thus we predict a mechanism for maintaining zinc availability for essential enzymes.

  11. Ribosome profiling reveals changes in translational status of soybean transcripts during immature cotyledon development

    PubMed Central

    Shamimuzzaman, Md.

    2018-01-01

    To understand translational capacity on a genome-wide scale across three developmental stages of immature soybean seed cotyledons, ribosome profiling was performed in combination with RNA sequencing and cluster analysis. Transcripts representing 216 unique genes demonstrated a higher level of translational activity in at least one stage by exhibiting higher translational efficiencies (TEs) in which there were relatively more ribosome footprint sequence reads mapping to the transcript than were present in the control total RNA sample. The majority of these transcripts were more translationally active at the early stage of seed development and included 12 unique serine or cysteine proteases and 16 2S albumin and low molecular weight cysteine-rich proteins that may serve as substrates for turnover and mobilization early in seed development. It would appear that the serine proteases and 2S albumins play a vital role in the early stages. In contrast, our investigation of profiles of 19 genes encoding high abundance seed storage proteins, such as glycinins, beta-conglycinins, lectin, and Kunitz trypsin inhibitors, showed that they all had similar patterns in which the TE values started at low levels and increased approximately 2 to 6-fold during development. The highest levels of these seed protein transcripts were found at the mid-developmental stage, whereas the highest ribosome footprint levels of only up to 1.6 TE were found at the late developmental stage. These experimental findings suggest that the major seed storage protein coding genes are primarily regulated at the transcriptional level during normal soybean cotyledon development. Finally, our analyses also identified a total of 370 unique gene models that showed very low TE values including over 48 genes encoding ribosomal family proteins and 95 gene models that are related to energy and photosynthetic functions, many of which have homology to the chloroplast genome. Additionally, we showed that genes of the

  12. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    PubMed

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  13. Ribosomal proteins L5 and L11 co-operatively inactivate c-Myc via RNA-induced silencing complex.

    PubMed

    Liao, J-M; Zhou, X; Gatignol, A; Lu, H

    2014-10-09

    Oncogene MYC is highly expressed in many human cancers and functions as a global regulator of ribosome biogenesis. Previously, we reported that ribosomal protein (RP) L11 binds to c-Myc and inhibits its transcriptional activity in response to ribosomal stress. Here, we show that RPL5, co-operatively with RPL11, guides the RNA-induced silencing complex (RISC) to c-Myc mRNA and mediates the degradation of the mRNA, consequently leading to inhibition of c-Myc activity. Knocking down of RPL5 induced c-Myc expression at both mRNA and protein levels, whereas overexpression of RPL5 suppressed c-Myc expression and activity. Immunoprecipitation revealed that RPL5 binds to 3'UTR of c-Myc mRNA and two subunits of RISC, TRBP (HIV-1 TAR RNA-binding protein) and Ago2, mediating the targeting of c-Myc mRNA by miRNAs. Interestingly, RPL5 and RPL11 co-resided on c-Myc mRNA and suppressed c-Myc expression co-operatively. These findings uncover a mechanism by which these two RPs can co-operatively suppress c-Myc expression, allowing a tightly controlled ribosome biogenesis in cells.

  14. Ribosomal protein RPS-14 modulates let-7 microRNA function in Caenorhabditis elegans

    PubMed Central

    Chan, Shih-Peng; Slack, Frank J.

    2009-01-01

    The let-7 microRNA (miRNA) regulates developmental timing at the larval-to-adult transition in Caenorhabditis elegans. Dysregulation of let-7 results in irregular hypodermal and vulval development. Disrupted let-7 function is also a feature of human lung cancer. However, little is known about the mechanism and co-factors of let-7. Here we demonstrate that ribosomal protein RPS-14 is able to modulate let-7 function in C. elegans. The RPS-14 protein co-immunoprecipitated with the nematode Argonaute homolog, ALG-1. Reduction of rps-14 gene expression by RNAi suppressed the aberrant vulva and hypodermis development phenotypes of let-7(n2853) mutant animals and the mis-regulation of a reporter bearing the lin-41 3′UTR, a well established let-7 target. Our results indicate an interactive relationship between let-7 miRNA function and ribosomal protein RPS-14 in regulation of terminal differentiation that may help in understanding the mechanism of translational control by miRNAs. PMID:19627982

  15. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  16. An N-terminal fragment of yeast ribosomal protein L3 inhibits the cytotoxicity of pokeweed antiviral protein in Saccharomyces cerevisiae.

    PubMed

    Di, Rong; Tumer, Nilgun E

    2014-04-11

    We have previously shown that ribosomal protein L3 is required for pokeweed antiviral protein (PAP), a type I ribosome inactivating protein, to bind to ribosomes and depurinate the α-sarcin/ricin loop (SRL) in yeast. Co-expression of the N-terminal 99 amino acids of yeast L3 (L3Δ99) with PAP in transgenic tobacco plants completely abolished the toxicity of PAP. In this study, we investigated the interaction between PAP and L3Δ99 in Saccharomyces cerevisiae. Yeast cells co-transformed with PAP and L3Δ99 showed markedly reduced growth inhibition and reduced rRNA depurination by PAP, compared to cells transformed with PAP alone. Co-transformation of yeast with PAP and L3Δ21 corresponding to the highly conserved N-terminal 21 amino acids of L3Δ99, reduced the cytotoxicity of PAP. PAP mRNA and protein levels were elevated and L3Δ99 or L3Δ21 mRNA and protein levels were reduced in yeast co-transformed with PAP and L3Δ99 or with PAP and L3Δ21, respectively. PAP interacted with L3Δ21 in yeast cells in vivo and by Biacore analysis in vitro, suggesting that the interaction between L3Δ21 and PAP may inhibit PAP-mediated depurination of the SRL, leading to a reduction in the cytotoxicity of PAP.

  17. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    PubMed

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  18. The ribosome as a missing link in the evolution of life.

    PubMed

    Root-Bernstein, Meredith; Root-Bernstein, Robert

    2015-02-21

    Many steps in the evolution of cellular life are still mysterious. We suggest that the ribosome may represent one important missing link between compositional (or metabolism-first), RNA-world (or genes-first) and cellular (last universal common ancestor) approaches to the evolution of cells. We present evidence that the entire set of transfer RNAs for all twenty amino acids are encoded in both the 16S and 23S rRNAs of Escherichia coli K12; that nucleotide sequences that could encode key fragments of ribosomal proteins, polymerases, ligases, synthetases, and phosphatases are to be found in each of the six possible reading frames of the 16S and 23S rRNAs; and that every sequence of bases in rRNA has information encoding more than one of these functions in addition to acting as a structural component of the ribosome. Ribosomal RNA, in short, is not just a structural scaffold for proteins, but the vestigial remnant of a primordial genome that may have encoded a self-organizing, self-replicating, auto-catalytic intermediary between macromolecules and cellular life. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Use of 16S Ribosomal RNA Sequences to Infer Relationships among Archaebacteria.

    DTIC Science & Technology

    1987-04-16

    the rRNAs of one or both other kingdoms , and among the archaebacteria there are also substantial variations) (1), echinoderms (5, 11), major...Security Classification) Ln Use of 16S Ribosomal RNA Sequences to infer Relationships among Archaebacteria : Annual Report (U) q 12 PERSONAL AUTHOR(S...FIELD GROUP SUB-GROUP Archaebacteria ; Eubacteria; Eukaryotes; 16S Ribosomal RNA; 08 I Phylogeny; rRNA; RNA Sequencing; Molecular Clock; Urkingdoms; r

  20. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients

    PubMed Central

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H.; Mills, Jason A.; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M.; Podsakoff, Gregory M.; Gadue, Paul; French, Deborah L.; Mason, Philip J.; Bessler, Monica

    2013-01-01

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the “safe harbor” AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells. PMID:23744582

  1. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    PubMed

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  2. Human melanoma cells resistant to MAPK inhibitors can be effectively targeted by inhibition of the p90 ribosomal S6 kinase

    PubMed Central

    Kosnopfel, Corinna; Sinnberg, Tobias; Sauer, Birgit; Niessner, Heike; Schmitt, Anja; Makino, Elena; Forschner, Andrea; Hailfinger, Stephan; Garbe, Claus; Schittek, Birgit

    2017-01-01

    The clinical availability of small molecule inhibitors specifically targeting mutated BRAF marked a significant breakthrough in melanoma therapy. Despite a dramatic anti-tumour activity and improved patient survival, rapidly emerging resistance, however, greatly limits the clinical benefit. The majority of the already described resistance mechanisms involve a reactivation of the MAPK signalling pathway. The p90 ribosomal S6 kinase (RSK), a downstream effector of the MAPK signalling cascade, has been reported to enhance survival of melanoma cells in response to chemotherapy. Here, we can show that RSK activity is significantly increased in human melanoma cells with acquired resistance to the BRAFV600E/K inhibitor vemurafenib. Interestingly, inhibition of RSK signalling markedly impairs the viability of vemurafenib resistant melanoma cells and is effective both in two-dimensional and in three-dimensional culture systems, especially in a chronic, long-term application. The effect of RSK inhibition can be partly replicated by downregulation of the well-known RSK target, Y-box binding protein 1 (YB-1). Intriguingly, RSK inhibition also retains its efficacy in melanoma cells with combined resistance to vemurafenib and the MEK inhibitor trametinib. These data suggest that active RSK signalling might be an attractive novel therapeutic target in melanoma with acquired resistance to MAPK pathway inhibitors. PMID:28415756

  3. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    PubMed

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  4. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Ying; School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui; College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, Henan

    2015-08-07

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling,more » and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.« less

  5. Functional dynamics within the human ribosome regulate the rate of active protein synthesis

    PubMed Central

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B.; Terry, Daniel S.; Juette, Manuel F.; Burnett, Benjamin J.; Alejo, Jose L.; Dass, Randall A.; Parks, Matthew M.; Vincent, Theresa C.; Blanchard, Scott C.

    2015-01-01

    SUMMARY The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule FRET methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. PMID:26593721

  6. NAD(+)- dependent deacetylase SIRT3 regulates mitochondrial protein synthesis by deacetylation of the ribosomal protein MRPL10

    USDA-ARS?s Scientific Manuscript database

    A member of the sirtuin family of NAD (+)-dependent deacetylases, SIRT3, is located in mammalian mitochondria and is important for regulation of mitochondrial metabolism, cell survival, and longevity. In this study, MRPL10 (mitochondrial ribosomal protein L10) was identified as the major acetylated ...

  7. Eaf1p Is Required for Recruitment of NuA4 in Targeting TFIID to the Promoters of the Ribosomal Protein Genes for Transcriptional Initiation In Vivo

    PubMed Central

    Uprety, Bhawana; Sen, Rwik

    2015-01-01

    NuA4 (nucleosome acetyltransferase of H4) promotes transcriptional initiation of TFIID (a complex of TBP and TBP-associated factors [TAFs])-dependent ribosomal protein genes involved in ribosome biogenesis. However, it is not clearly understood how NuA4 regulates the transcription of ribosomal protein genes. Here, we show that NuA4 is recruited to the promoters of ribosomal protein genes, such as RPS5, RPL2B, and RPS11B, for TFIID recruitment to initiate transcription, and the recruitment of NuA4 to these promoters is impaired in the absence of its Eaf1p component. Intriguingly, impaired NuA4 recruitment in a Δeaf1 strain depletes recruitment of TFIID (a TAF-dependent form of TBP) but not the TAF-independent form of TBP to the promoters of ribosomal protein genes. However, in the absence of NuA4, SAGA (Spt-Ada-Gcn5-acetyltransferase) is involved in targeting the TAF-independent form of TBP to the promoters of ribosomal protein genes for transcriptional initiation. Thus, NuA4 plays an important role in targeting TFIID to the promoters of ribosomal protein genes for transcriptional initiation in vivo. Such a function is mediated via its targeted histone acetyltransferase activity. In the absence of NuA4, ribosomal protein genes lose TFIID dependency and become SAGA dependent for transcriptional initiation. Collectively, these results provide significant insights into the regulation of ribosomal protein gene expression and, hence, ribosome biogenesis and functions. PMID:26100014

  8. Saporin-S6: A Useful Tool in Cancer Therapy

    PubMed Central

    Polito, Letizia; Bortolotti, Massimo; Mercatelli, Daniele; Battelli, Maria Giulia; Bolognesi, Andrea

    2013-01-01

    Thirty years ago, the type 1 ribosome-inactivating protein (RIP) saporin-S6 (also known as saporin) was isolated from Saponaria officinalis L. seeds. Since then, the properties and mechanisms of action of saporin-S6 have been well characterized, and it has been widely employed in the construction of conjugates and immunotoxins for different purposes. These immunotoxins have shown many interesting results when used in cancer therapy, particularly in hematological tumors. The high enzymatic activity, stability and resistance to conjugation procedures and blood proteases make saporin-S6 a very useful tool in cancer therapy. High efficacy has been reported in clinical trials with saporin-S6-containing immunotoxins, at dosages that induced only mild and transient side effects, which were mainly fever, myalgias, hepatotoxicity, thrombocytopenia and vascular leak syndrome. Moreover, saporin-S6 triggers multiple cell death pathways, rendering impossible the selection of RIP-resistant mutants. In this review, some aspects of saporin-S6, such as the chemico-physical characteristics, the structural properties, its endocytosis, its intracellular routing and the pathogenetic mechanisms of the cell damage, are reported. In addition, the recent progress and developments of saporin-S6-containing immunotoxins in cancer immunotherapy are summarized, including in vitro and in vivo pre-clinical studies and clinical trials. PMID:24105401

  9. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  10. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  11. Crystal structure of Gib2, a signal-transducing protein scaffold associated with ribosomes in Cryptococcus neoformans

    NASA Astrophysics Data System (ADS)

    Ero, Rya; Dimitrova, Valya Tenusheva; Chen, Yun; Bu, Wenting; Feng, Shu; Liu, Tongbao; Wang, Ping; Xue, Chaoyang; Tan, Suet Mien; Gao, Yong-Gui

    2015-03-01

    The atypical Gβ-like/RACK1 Gib2 protein promotes cAMP signalling that plays a central role in regulating the virulence of Cryptococcus neoformans. Gib2 contains a seven-bladed β transducin structure and is emerging as a scaffold protein interconnecting signalling pathways through interactions with various protein partners. Here, we present the crystal structure of Gib2 at a 2.2-Å resolution. The structure allows us to analyse the association between Gib2 and the ribosome, as well as to identify the Gib2 amino acid residues involved in ribosome binding. Our studies not only suggest that Gib2 has a role in protein translation but also present Gib2 as a physical link at the crossroads of various regulatory pathways important for the growth and virulence of C. neoformans.

  12. Transition state analogues in structures of ricin and saporin ribosome-inactivating proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, Meng-Chiao; Sturm, Matthew B.; Almo, Steven C.

    2010-01-12

    Ricin A-chain (RTA) and saporin-L1 (SAP) catalyze adenosine depurination of 28S rRNA to inhibit protein synthesis and cause cell death. We present the crystal structures of RTA and SAP in complex with transition state analogue inhibitors. These tight-binding inhibitors mimic the sarcin-ricin recognition loop of 28S rRNA and the dissociative ribocation transition state established for RTA catalysis. RTA and SAP share unique purine-binding geometry with quadruple {pi}-stacking interactions between adjacent adenine and guanine bases and 2 conserved tyrosines. An arginine at one end of the {pi}-stack provides cationic polarization and enhanced leaving group ability to the susceptible adenine. Common featuresmore » of these ribosome-inactivating proteins include adenine leaving group activation, a remarkable lack of ribocation stabilization, and conserved glutamates as general bases for activation of the H{sub 2}O nucleophile. Catalytic forces originate primarily from leaving group activation evident in both RTA and SAP in complex with transition state analogues.« less

  13. Ribosome Biogenesis in the Yeast Saccharomyces cerevisiae

    PubMed Central

    Woolford, John L.; Baserga, Susan J.

    2013-01-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  14. Na+/H+ exchanger isoform 1-induced osteopontin expression facilitates cardiac hypertrophy through p90 ribosomal S6 kinase.

    PubMed

    Abdulrahman, Nabeel; Jaspard-Vinassa, Beatrice; Fliegel, Larry; Jabeen, Aayesha; Riaz, Sadaf; Gadeau, Alain-Pierre; Mraiche, Fatima

    2018-05-01

    Cardiovascular diseases are the leading cause of death worldwide. One in three cases of heart failure is due to dilated cardiomyopathy. The Na + /H + exchanger isoform 1 (NHE1), a multifunctional protein and the key pH regulator in the heart, has been demonstrated to be increased in this condition. We have previously demonstrated that elevated NHE1 activity induced cardiac hypertrophy in vivo. Furthermore, the overexpression of active NHE1 elicited modulation of gene expression in cardiomyocytes including an upregulation of myocardial osteopontin (OPN) expression. To determine the role of OPN in inducing NHE1-mediated cardiomyocyte hypertrophy, double transgenic mice expressing active NHE1 and OPN knockout were generated and assessed by echocardiography and the cardiac phenotype. Our studies showed that hearts expressing active NHE1 exhibited cardiac remodeling indicated by increased systolic and diastolic left ventricular internal diameter and increased ventricular volume. Moreover, these hearts demonstrated impaired function with decreased fractional shortening and ejection fraction. Atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) mRNA was upregulated, and there was an increase in heart cell cross-sectional area confirming the cardiac hypertrophic effect. Moreover, NHE1 transgenic mice also showed increased collagen deposition, upregulation of CD44 and phosphorylation of p90 ribosomal s6 kinase (RSK), effects that were regressed in OPN knockout mice. In conclusion, we developed an interesting comparative model of active NHE1 transgenic mouse lines which express a dilated hypertrophic phenotype expressing CD44 and phosphorylated RSK, effects which were regressed in absence of OPN.

  15. Identification of cross-linked amino acids in the protein pair HmaL23-HmaL29 from the 50S ribosomal subunit of the archaebacterium Haloarcula marismortui.

    PubMed

    Bergmann, U; Wittmann-Liebold, B

    1993-03-23

    50S ribosomal subunits from the extreme halophilic archaebacterium Haloarcula marismortui were treated with the homobifunctional protein-protein cross-linking reagents diepoxybutane (4 A) and dithiobis(succinimidyl propionate) (12 A). The dominant product with both cross-linking reagents was identified on the protein level as HmaL23-HmaL29, which is homologous to the protein pair L23-L29 from Escherichia coli [Walleczek, J., Martin, T., Redl, B., Stöffler-Meilicke, M., & Stöffler, G. (1989) Biochemistry 28, 4099-4105] and from Bacillus stearothermophilus [Brockmöller, J., & Kamp, R. M. (1986) Biol. Chem. Hoppe-Seyler 367, 925-935]. To reveal the exact cross-linking site in HmaL23-HmaL29, the cross-linked complex was purified on a preparative scale by conventional and high-performance liquid chromatography. After endoproteolytic fragmentation of the protein pair, the amino acids engaged in cross-link formation were unambiguously identified by N-terminal sequence analysis and mass spectrometry of the cross-linked peptides. The cross-link is formed between lysine-57 in the C-terminal region of HmaL29 and the alpha-amino group of the N-terminal serine in protein HmaL23, irrespective of the cross-linking reagent. This result demonstrates that the N-terminal region of protein HmaL23 and the C-terminal domain of HmaL29 are highly flexible so that the distance between the two polypeptide chains can vary by at least 8 A. Comparison of our cross-linking results with those obtained with B. stearothermophilus revealed that the fine structure within this ribosomal domain is at least partially conserved.

  16. Eukaryotic ribosome display with in situ DNA recovery.

    PubMed

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  17. Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Hongbing; Franz, Carl J.; Wu, Guang

    2014-02-15

    Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated intomore » Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.« less

  18. Autophagic flux is required for the synthesis of triacylglycerols and ribosomal protein turnover in Chlamydomonas.

    PubMed

    Couso, Inmaculada; Pérez-Pérez, María Esther; Martínez-Force, Enrique; Kim, Hee-Sik; He, Yonghua; Umen, James G; Crespo, José L

    2018-03-14

    Autophagy is an intracellular catabolic process that allows cells to recycle unneeded or damaged material to maintain cellular homeostasis. This highly dynamic process is characterized by the formation of double-membrane vesicles called autophagosomes, which engulf and deliver the cargo to the vacuole. Flow of material through the autophagy pathway and its degradation in the vacuole is known as autophagic flux, and reflects the autophagic degradation activity. A number of assays have been developed to determine autophagic flux in yeasts, mammals, and plants, but it has not been examined yet in algae. Here we analyzed autophagic flux in the model green alga Chlamydomonas reinhardtii. By monitoring specific autophagy markers such as ATG8 lipidation and using immunofluorescence and electron microscopy techniques, we show that concanamycin A, a vacuolar ATPase inhibitor, blocks autophagic flux in Chlamydomonas. Our results revealed that vacuolar lytic function is needed for the synthesis of triacylglycerols and the formation of lipid bodies in nitrogen- or phosphate-starved cells. Moreover, we found that concanamycin A treatment prevented the degradation of ribosomal proteins RPS6 and RPL37 under nitrogen or phosphate deprivation. These results indicate that autophagy might play an important role in the regulation of lipid metabolism and the recycling of ribosomal proteins under nutrient limitation in Chlamydomonas.

  19. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae)

    PubMed Central

    Zhu, Jiajun; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-01-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. PMID:28973571

  20. Splicing Factor 2-Associated Protein p32 Participates in Ribosome Biogenesis by Regulating the Binding of Nop52 and Fibrillarin to Preribosome Particles*

    PubMed Central

    Yoshikawa, Harunori; Komatsu, Wataru; Hayano, Toshiya; Miura, Yutaka; Homma, Keiichi; Izumikawa, Keiichi; Ishikawa, Hideaki; Miyazawa, Naoki; Tachikawa, Hiroyuki; Yamauchi, Yoshio; Isobe, Toshiaki; Takahashi, Nobuhiro

    2011-01-01

    Ribosome biogenesis starts with transcription of the large ribosomal RNA precursor (47S pre-rRNA), which soon combines with numerous factors to form the 90S pre-ribosome in the nucleolus. Although the subsequent separation of the pre-90S particle into pre-40S and pre-60S particles is critical for the production process of mature small and large ribosomal subunits, its molecular mechanisms remain undetermined. Here, we present evidence that p32, fibrillarin (FBL), and Nop52 play key roles in this separation step. Mass-based analyses combined with immunoblotting showed that p32 associated with 155 proteins including 31 rRNA-processing factors (of which nine were components of small subunit processome, and six were those of RIX1 complex), 13 chromatin remodeling components, and six general transcription factors required for RNA polymerase III-mediated transcription. Of these, a late rRNA-processing factor Nop52 interacted directly with p32. Immunocytochemical analyses demonstrated that p32 colocalized with an early rRNA-processing factor FBL or Nop52 in the nucleolus and Cajal bodies, but was excluded from the nucleolus after actinomycin D treatment. p32 was present in the pre-ribosomal fractions prepared by cell fractionation or separated by ultracentrifugation of the nuclear extract. p32 also associated with pre-rRNAs including 47S/45S and 32S pre-rRNAs. Furthermore, knockdown of p32 with a small interfering RNA slowed the early processing from 47S/45S pre-rRNAs to 18S rRNA and 32S pre-rRNA. Finally, Nop52 was found to compete with FBL for binding to p32 probably in the nucleolus. Given the fact that FBL and Nop52 are associated with pre-ribosome particles distinctly different from each other, we suggest that p32 is a new rRNA maturation factor involved in the remodeling from pre-90S particles to pre-40S and pre-60S particles that requires the exchange of FBL for Nop52. PMID:21536856

  1. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    PubMed

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Molecular cloning and functional analysis of a recombinant ribosome-inactivating protein (alpha-momorcharin) from Momordica charantia.

    PubMed

    Wang, Shuzhen; Zhang, Yubo; Liu, Honggao; He, Ying; Yan, Junjie; Wu, Zhihua; Ding, Yi

    2012-11-01

    Alpha-momorcharin (α-MC), a member of the ribosome-inactivating protein (RIP) family, has been used not only as antiviral, antimicrobial, and antitumor agents, but also as toxicant to protozoa, insects, and fungi. In this study, we expressed the protein in Escherichia coli Rosetta (DE3) pLysS strain and purified it by nickel-nitrilotriacetic acid affinity chromatography. A total of 85 mg of homogeneous protein was obtained from 1 l culture supernatant of Rosetta (DE3) pLysS, showing a high recovery rate of 73.9%. Protein activity assay indicated that α-MC had both N-glycosidase activity and DNA-nuclease activity, the former releasing RIP diagnostic RNA fragment (Endo's fragment) from rice rRNAs and the latter converting supercoiled circular DNA of plasmid pET-32a(+) into linear conformations in a concentration-dependent manner. Specially, we found that α-MC could inhibit the mycelial growth of Fusarium solani and Fusarium oxysporum with IC(50) values of 6.23 and 4.15 μM, respectively. Results of optical microscopy and transmission electron microscopy demonstrated that α-MC caused extensive septum formation, loss of integrity of the cell wall, separation of the cytoplasm from the cell wall, deformation of cells with irregular budding sites, and apoptosis in F. solani. Moreover, α-MC was active against Pseudomonas aeruginosa with an IC(50) value of 0.59 μM. The α-MC protein carries a high potential for the design of new antifungal drugs or the development of transgenic crops resistant to pathogens.

  3. Association of nonribosomal nucleolar proteins in ribonucleoprotein complexes during interphase and mitosis.

    PubMed

    Piñol-Roma, S

    1999-01-01

    rRNA precursors are bound throughout their length by specific proteins, as the pre-rRNAs emerge from the transcription machinery. The association of pre-rRNA with proteins as ribonucleoprotein (RNP) complexes persists during maturation of 18S, 5.8S, and 28S rRNA, and through assembly of ribosomal subunits in the nucleolus. Preribosomal RNP complexes contain, in addition to ribosomal proteins, an unknown number of nonribosomal nucleolar proteins, as well as small nucleolar RNA-ribonucleoproteins (sno-RNPs). This report describes the use of a specific, rapid, and mild immunopurification approach to isolate and analyze human RNP complexes that contain nonribosomal nucleolar proteins, as well as ribosomal proteins and rRNA. Complexes immunopurified with antibodies to nucleolin-a major nucleolar RNA-binding protein-contain several distinct specific polypeptides that include, in addition to nucleolin, the previously identified nucleolar proteins B23 and fibrillarin, proteins with electrophoretic mobilities characteristic of ribosomal proteins including ribosomal protein S6, and a number of additional unidentified proteins. The physical association of these proteins with one another is mediated largely by RNA, in that the complexes dissociate upon digestion with RNase. Complexes isolated from M-phase cells are similar in protein composition to those isolated from interphase cell nuclear extracts. Therefore, the predominant proteins that associate with nucleolin in interphase remain in RNP complexes during mitosis, despite the cessation of rRNA synthesis and processing in M-phase. In addition, precursor rRNA, as well as processed 18S and 28S rRNA and candidate rRNA processing intermediates, is found associated with the immunopurified complexes. The characteristics of the rRNP complexes described here, therefore, indicate that they represent bona fide precursors of mature cytoplasmic ribosomal subunits.

  4. Determination of relative amounts of ribosome and subunits in Escherichia coli using asymmetrical flow field-flow fractionation.

    PubMed

    Nilsson, M; Birnbaum, S; Wahlund, K G

    1996-10-15

    The 30S and 50S subunits and the 70S ribosome of Escherichia coli were separated in 6 minutes by using asymmetrical flow field-flow fractionation (FFF). The total analysis time for determination of the relative amounts of ribosomes and free subunits in a preparation from a cell suspension was 8 min. The method can detect a change in the mass fraction of ribosomes if it exceeds approx, 10%. The separation is based on differences in diffusion coefficients, i.e., hydrodynamic diameters, and these can be determined from observed retention times. The hydrodynamic diameters were in good agreement with literature values obtained from electron microscopy. The mass fraction of ribosomes changed as a function of the magnesium ion concentration which confirms previous knowledge and shows the accuracy of the method. The method appears as an alternative to ultracentrifugation analysis and avoids some of its drawbacks and artefacts. An obvious application can be the optimisation of cell design in metabolic engineering in order to maximise translation and protein production.

  5. Mitochondrial ribosomal protein S18-2 is highly expressed in endometrial cancers along with free E2F1

    PubMed Central

    Iurchenko, Natalia; Kovalevska, Larysa; Stip, Maria C; Budnikova, Daria; Andersson, Sonia; Polischuk, Ludmila; Buchynska, Lubov; Kashuba, Elena

    2016-01-01

    Endometrial cancer (EC) is one of the most frequent causes of cancer death among women in developed countries. Histopathological diagnosis and imaging techniques for EC are limited, thus new prognostic markers are needed to offer patients the best treatment and follow-up. In the present paper we showed that the level of mitochondrial ribosomal protein MRPS18-2 (S18-2) increased in EC compared with the normal endometrium and hyperplasia, based on a study of 42 patient biopsies. Importantly, high expression of free E2F1 in EC correlates well with high S18-2 expression. The EC cell line HEC-1-A, which overexpresses S18-2 constitutively, showed an increased proliferation capacity in vitro and in vivo (in SCID mice). Moreover, pan-keratin, beta-catenin and E-cadherin signals are diminished in these cells, compared to the parental HEC-1-A line, in contrast to vimentin signal that is increased. This may be associated with epithelial-mesenchymal cell transition (EMT). We conclude that high expression of S18-2 and free E2F1, and low pan-keratin, beta-catenin, and E-cadherin signals might be a good set of prognostic markers for EC. PMID:26959119

  6. Inhibition of Protein Synthesis on the Ribosome by Tildipirosin Compared with Other Veterinary Macrolides

    PubMed Central

    Andersen, Niels Møller; Poehlsgaard, Jacob; Warrass, Ralf

    2012-01-01

    Tildipirosin is a 16-membered-ring macrolide developed to treat bacterial pathogens, including Mannheimia haemolytica and Pasteurella multocida, that cause respiratory tract infections in cattle and swine. Here we evaluated the efficacy of tildipirosin at inhibiting protein synthesis on the ribosome (50% inhibitory concentration [IC50], 0.23 ± 0.01 μM) and compared it with the established veterinary macrolides tylosin, tilmicosin, and tulathromycin. Mutation and methylation at key rRNA nucleotides revealed differences in the interactions of these macrolides within their common ribosomal binding site. PMID:22926570

  7. Rapamycin modulation of p70 S6 kinase signaling inhibits Rift Valley fever virus pathogenesis.

    PubMed

    Bell, Todd M; Espina, Virginia; Senina, Svetlana; Woodson, Caitlin; Brahms, Ashwini; Carey, Brian; Lin, Shih-Chao; Lundberg, Lindsay; Pinkham, Chelsea; Baer, Alan; Mueller, Claudius; Chlipala, Elizabeth A; Sharman, Faye; de la Fuente, Cynthia; Liotta, Lance; Kehn-Hall, Kylene

    2017-07-01

    Despite over 60 years of research on antiviral drugs, very few are FDA approved to treat acute viral infections. Rift Valley fever virus (RVFV), an arthropod borne virus that causes hemorrhagic fever in severe cases, currently lacks effective treatments. Existing as obligate intracellular parasites, viruses have evolved to manipulate host cell signaling pathways to meet their replication needs. Specifically, translation modulation is often necessary for viruses to establish infection in their host. Here we demonstrated phosphorylation of p70 S6 kinase, S6 ribosomal protein, and eIF4G following RVFV infection in vitro through western blot analysis and in a mouse model of infection through reverse phase protein microarrays (RPPA). Inhibition of p70 S6 kinase through rapamycin treatment reduced viral titers in vitro and increased survival and mitigated clinical disease in RVFV challenged mice. Additionally, the phosphorylation of p70 S6 kinase was decreased following rapamycin treatment in vivo. Collectively these data demonstrate modulating p70 S6 kinase can be an effective antiviral strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Structural Characterization of an Alternative Mode of Tigecycline Binding to the Bacterial Ribosome

    PubMed Central

    Schedlbauer, Andreas; Kaminishi, Tatsuya; Ochoa-Lizarralde, Borja; Dhimole, Neha; Zhou, Shu; López-Alonso, Jorge P.

    2015-01-01

    Although both tetracycline and tigecycline inhibit protein synthesis by sterically hindering the binding of tRNA to the ribosomal A site, tigecycline shows increased efficacy in both in vitro and in vivo activity assays and escapes the most common resistance mechanisms associated with the tetracycline class of antibiotics. These differences in activities are attributed to the tert-butyl-glycylamido side chain found in tigecycline. Our structural analysis by X-ray crystallography shows that tigecycline binds the bacterial 30S ribosomal subunit with its tail in an extended conformation and makes extensive interactions with the 16S rRNA nucleotide C1054. These interactions restrict the mobility of C1054 and contribute to the antimicrobial activity of tigecycline, including its resistance to the ribosomal protection proteins. PMID:25753625

  9. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba

    PubMed Central

    Galián, J A; Rosato, M; Rosselló, J A

    2012-01-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S–5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S–5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S–5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S–5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary. PMID:22354111

  10. Isolation of eukaryotic ribosomal proteins. Purification and characterization of the 60 S ribosomal subunit proteins L4, L5, L7, L9, L11, L12, L13, L21, L22, L23, L26, L27, L30, L33, L35', L37, and L39.

    PubMed

    Tsurugi, K; Collatz, E; Wool, E G; Lin, A

    1976-12-25

    The proteins of the large subunit of rat liver ribosomes were separated into seven groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Seventeen proteins (L4, L5, L7, L9, L11, L12, L13, L21, L22, L23, L26, L27, L30, L33, L35', L37, and L39) were isolated from three of the groups (B60, D60, G60) by ion exchange chromatography on carboxymethylcellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.5 to 15 mg. Eight of the proteins (L9, L11, L13, L21, L22, L35', L37 and L39) had no detectable contamination; the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.

  11. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    PubMed

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  12. Hepatitis-C-virus-like internal ribosome entry sites displace eIF3 to gain access to the 40S subunit

    NASA Astrophysics Data System (ADS)

    Hashem, Yaser; Des Georges, Amedee; Dhote, Vidya; Langlois, Robert; Liao, Hstau Y.; Grassucci, Robert A.; Pestova, Tatyana V.; Hellen, Christopher U. T.; Frank, Joachim

    2013-11-01

    Hepatitis C virus (HCV) and classical swine fever virus (CSFV) messenger RNAs contain related (HCV-like) internal ribosome entry sites (IRESs) that promote 5'-end independent initiation of translation, requiring only a subset of the eukaryotic initiation factors (eIFs) needed for canonical initiation on cellular mRNAs. Initiation on HCV-like IRESs relies on their specific interaction with the 40S subunit, which places the initiation codon into the P site, where it directly base-pairs with eIF2-bound initiator methionyl transfer RNA to form a 48S initiation complex. However, all HCV-like IRESs also specifically interact with eIF3 (refs 2, 5, 6, 7, 9, 10, 11, 12), but the role of this interaction in IRES-mediated initiation has remained unknown. During canonical initiation, eIF3 binds to the 40S subunit as a component of the 43S pre-initiation complex, and comparison of the ribosomal positions of eIF3 and the HCV IRES revealed that they overlap, so that their rearrangement would be required for formation of ribosomal complexes containing both components. Here we present a cryo-electron microscopy reconstruction of a 40S ribosomal complex containing eIF3 and the CSFV IRES. Remarkably, although the position and interactions of the CSFV IRES with the 40S subunit in this complex are similar to those of the HCV IRES in the 40S-IRES binary complex, eIF3 is completely displaced from its ribosomal position in the 43S complex, and instead interacts through its ribosome-binding surface exclusively with the apical region of domain III of the IRES. Our results suggest a role for the specific interaction of HCV-like IRESs with eIF3 in preventing ribosomal association of eIF3, which could serve two purposes: relieving the competition between the IRES and eIF3 for a common binding site on the 40S subunit, and reducing formation of 43S complexes, thereby favouring translation of viral mRNAs.

  13. STUDIES ON THE ORIGIN OF RIBOSOMES IN AMOEBA PROTEUS

    PubMed Central

    Craig, Nessly; Goldstein, Lester

    1969-01-01

    The origin of cytoplasmic RNA and ribosomes was studied in Amoeba proteus by transplantation of a radioactive nucleus into an unlabeled cell followed by examination of the cytoplasm of the recipient for the presence of label. When a RNA-labeled nucleus was used, label appeared in the ribosomes, ribosomal RNA, and soluble RNA. Since the kinetics of appearance of labeled RNA indicates that the nucleus was not injured during the transfer, and since the transferred nuclear pool of labeled acid-soluble RNA precursors is inadequate to account for the amount of cytoplasmic RNA label, it is concluded that cytoplasmic ribosomal RNA is derived from acid-insoluble nuclear RNA and is probably transported as an intact molecule. Likewise, cytoplasmic soluble RNA probably originated in the nucleus, although labeling by terminal exchange in the cytoplasm is also possible. The results were completely different when a protein-labeled nucleus was grafted into an unlabeled host. In this case, label was found only in soluble proteins in the host cell cytoplasm, and there were no (or very few) radioactive ribosomes. This suggests that the nuclear pool of ribosomal protein and ribosomal protein precursors is relatively small and perhaps nonexistent (and, furthermore, shows that there was no cytoplasmic ribosomal contamination of the transferred nucleus). PMID:5765758

  14. RBSDesigner: software for designing synthetic ribosome binding sites that yields a desired level of protein expression.

    PubMed

    Na, Dokyun; Lee, Doheon

    2010-10-15

    RBSDesigner predicts the translation efficiency of existing mRNA sequences and designs synthetic ribosome binding sites (RBSs) for a given coding sequence (CDS) to yield a desired level of protein expression. The program implements the mathematical model for translation initiation described in Na et al. (Mathematical modeling of translation initiation for the estimation of its efficiency to computationally design mRNA sequences with a desired expression level in prokaryotes. BMC Syst. Biol., 4, 71). The program additionally incorporates the effect on translation efficiency of the spacer length between a Shine-Dalgarno (SD) sequence and an AUG codon, which is crucial for the incorporation of fMet-tRNA into the ribosome. RBSDesigner provides a graphical user interface (GUI) for the convenient design of synthetic RBSs. RBSDesigner is written in Python and Microsoft Visual Basic 6.0 and is publicly available as precompiled stand-alone software on the web (http://rbs.kaist.ac.kr). dhlee@kaist.ac.kr

  15. Modeling of the structure of ribosomal protein L1 from the archaeon Haloarcula marismortui

    NASA Astrophysics Data System (ADS)

    Nevskaya, N. A.; Kljashtorny, V. G.; Vakhrusheva, A. V.; Garber, M. B.; Nikonov, S. V.

    2017-07-01

    The halophilic archaeon Haloarcula marismortui proliferates in the Dead Sea at extremely high salt concentrations (higher than 3 M). This is the only archaeon, for which the crystal structure of the ribosomal 50S subunit was determined. However, the structure of the functionally important side protuberance containing the abnormally negatively charged protein L1 (HmaL1) was not visualized. Attempts to crystallize HmaL1 in the isolated state or as its complex with RNA using normal salt concentrations (≤500 mM) failed. A theoretical model of HmaL1 was built based on the structural data for homologs of the protein L1 from other organisms, and this model was refined by molecular dynamics methods. Analysis of this model showed that the protein HmaL1 can undergo aggregation due to the presence of a cluster of positive charges unique for proteins L1. This cluster is located at the RNA-protein interface, which interferes with the crystallization of HmaL1 and the binding of the latter to RNA.

  16. Molecular mimicry between Mycobacterium leprae proteins (50S ribosomal protein L2 and Lysyl-tRNA synthetase) and myelin basic protein: a possible mechanism of nerve damage in leprosy.

    PubMed

    Singh, Itu; Yadav, Asha Ram; Mohanty, Keshar Kunja; Katoch, Kiran; Sharma, Prashant; Mishra, Bishal; Bisht, Deepa; Gupta, U D; Sengupta, Utpal

    2015-04-01

    Autoantibodies against various components of host are known to occur in leprosy. Nerve damage is the primary cause of disability associated with leprosy. The aim of this study was to detect the level of autoantibodies and lympho-proliferative response against myelin basic protein (MBP) in leprosy patients (LPs) and their correlation with clinical phenotypes of LPs. Further, probable role of molecular mimicry in nerve damage of LPs was investigated. We observed significantly high level of anti-MBP antibodies in LPs across the spectrum and a positive significant correlation between the level of anti-MBP antibodies and the number of nerves involved in LPs. We report here that 4 B cell epitopes of myelin A1 and Mycobacterium leprae proteins, 50S ribosomal L2 and lysyl tRNA synthetase are cross-reactive. Further, M. leprae sonicated antigen hyperimmunization was responsible for induction of autoantibody response in mice which could be adoptively transferred to naive mice. For the first time our findings suggest the role of molecular mimicry in nerve damage in leprosy. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  17. Kinetic analysis of pre-ribosome structure in vivo

    PubMed Central

    Swiatkowska, Agata; Wlotzka, Wiebke; Tuck, Alex; Barrass, J. David; Beggs, Jean D.; Tollervey, David

    2012-01-01

    Pre-ribosomal particles undergo numerous structural changes during maturation, but their high complexity and short lifetimes make these changes very difficult to follow in vivo. In consequence, pre-ribosome structure and composition have largely been inferred from purified particles and analyzed in vitro. Here we describe techniques for kinetic analyses of the changes in pre-ribosome structure in living cells of Saccharomyces cerevisiae. To allow this, in vivo structure probing by DMS modification was combined with affinity purification of newly synthesized 20S pre-rRNA over a time course of metabolic labeling with 4-thiouracil. To demonstrate that this approach is generally applicable, we initially analyzed the accessibility of the region surrounding cleavage site D site at the 3′ end of the mature 18S rRNA region of the pre-rRNA. This revealed a remarkably flexible structure throughout 40S subunit biogenesis, with little stable RNA–protein interaction apparent. Analysis of folding in the region of the 18S central pseudoknot was consistent with previous data showing U3 snoRNA–18S rRNA interactions. Dynamic changes in the structure of the hinge between helix 28 (H28) and H44 of pre-18S rRNA were consistent with recently reported interactions with the 3′ guide region of U3 snoRNA. Finally, analysis of the H18 region indicates that the RNA structure matures early, but additional protection appears subsequently, presumably reflecting protein binding. The structural analyses described here were performed on total, affinity-purified, newly synthesized RNA, so many classes of RNA and RNA–protein complex are potentially amenable to this approach. PMID:23093724

  18. Skeletal muscle plasticity induced by seasonal acclimatization involves IGF1 signaling: implications in ribosomal biogenesis and protein synthesis.

    PubMed

    Fuentes, Eduardo N; Zuloaga, Rodrigo; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

    2014-10-01

    One of the most fundamental biological processes in living organisms that are affected by environmental fluctuations is growth. In fish, skeletal muscle accounts for the largest proportion of body mass, and the growth of this tissue is mainly controlled by the insulin-like growth factor (IGF) system. By using the carp (Cyprinus carpio), a fish that inhabits extreme conditions during winter and summer, we assessed the skeletal muscle plasticity induced by seasonal acclimatization and the relation of IGF signaling with protein synthesis and ribosomal biogenesis. The expression of igf1 in muscle decreased during winter in comparison with summer, whereas the expression for both paralogues of igf2 did not change significantly between seasons. The expression of igf1 receptor a (igf1ra), but not of igf1rb, was down-regulated in muscle during the winter as compared to the summer. A decrease in protein contents and protein phosphorylation for IGF signaling molecules in muscle was observed in winter-acclimatized carp. This was related with a decreased expression in muscle for markers of myogenesis (myoblast determination factor (myod), myogenic factor 5 (myf5), and myogenin (myog)); protein synthesis (myosin heavy chain (mhc) and myosin light chain (mlc3 and mlc1b)); and ribosomal biogenesis (pre-rRNA and ribosomal proteins). IGF signaling, and key markers of ribosomal biogenesis, protein synthesis, and myogenesis were affected by seasonal acclimatization, with differential regulation in gene expression and signaling pathway activation observed in muscle between both seasons. This suggests that these molecules are responsible for the muscle plasticity induced by seasonal acclimatization in carp. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Structure of ratcheted ribosomes with tRNAs in hybrid states

    PubMed Central

    Julián, Patricia; Konevega, Andrey L.; Scheres, Sjors H. W.; Lázaro, Melisa; Gil, David; Wintermeyer, Wolfgang; Rodnina, Marina V.; Valle, Mikel

    2008-01-01

    During protein synthesis, tRNAs and mRNA move through the ribosome between aminoacyl (A), peptidyl (P), and exit (E) sites of the ribosome in a process called translocation. Translocation is accompanied by the displacement of the tRNAs on the large ribosomal subunit toward the hybrid A/P and P/E states and by a rotational movement (ratchet) of the ribosomal subunits relative to one another. So far, the structure of the ratcheted state has been observed only when translation factors were bound to the ribosome. Using cryo-electron microscopy and classification, we show here that ribosomes can spontaneously adopt a ratcheted conformation with tRNAs in their hybrid states. The peptidyl-tRNA molecule in the A/P state, which is visualized here, is not distorted compared with the A/A state except for slight adjustments of its acceptor end, suggesting that the displacement of the A-site tRNA on the 50S subunit is passive and is induced by the 30S subunit rotation. Simultaneous subunit ratchet and formation of the tRNA hybrid states precede and may promote the subsequent rapid and coordinated tRNA translocation on the 30S subunit catalyzed by elongation factor G. PMID:18971332

  20. Ribosomal protein L19 overexpression activates the unfolded protein response and sensitizes MCF7 breast cancer cells to endoplasmic reticulum stress-induced cell death.

    PubMed

    Hong, Mina; Kim, HyungRyong; Kim, Inki

    2014-07-18

    Although first identified for their roles in protein synthesis, certain ribosomal proteins exert pleiotropic physiological functions in the cell. Ribosomal protein L19 is overexpressed in breast cancer cells by amplification and copy number variation. In this study, we examined the novel pro-apoptotic role of ribosomal protein L19 in the breast cancer cell line MCF7. Overexpression of RPL19 sensitized MCF7 cells to endoplasmic reticulum stress-induced cell death. RPL19 overexpression itself was not cytotoxic; however, cell death induction was enhanced when RPL19 overexpressing cells were incubated with endoplasmic reticulum stress-inducing agents, and this sensitizing effect was specific to MCF7 cells. Examination of the cell signaling pathways that mediate the unfolded protein response (UPR) revealed that overexpression of RPL19 induced pre-activation of the UPR, including phosphorylation of pERK-like ER kinase (PERK), phosphorylation of eukaryotic translation initiation factor 2 alpha (eIF2α), and activation of p38 MAPK-associated stress signaling. Our findings suggest that upregulation of RPL19 induces ER stress, resulting in increased sensitivity to ER stress and enhanced cell death in MCF7 breast cancer cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition

    DOE PAGES

    Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.; ...

    2016-01-24

    Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less

  2. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.

    Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less

  3. Thermodynamics and kinetics of protein folding on the ribosome: Alteration in energy landscapes, denatured state, and transition state ensembles

    NASA Astrophysics Data System (ADS)

    O'Brien, Edward; Vendruscolo, Michele; Dobson, Christopher

    2010-03-01

    In vitro experiments examining cotranslational folding utilize ribosome-nascent chain complexes (RNCs) in which the nascent chain is stalled at different points of its biosynthesis on the ribosome. We investigate the thermodynamics, kinetics, and structural properties of RNCs containing five different globular and repeat proteins stalled at ten different nascent chain lengths using coarse grained replica exchange simulations. We find that when the proteins are stalled near the ribosome exit tunnel opening they exhibit altered folding coopserativity, quantified by the van't Hoff enthalpy criterion; a significantly altered denatured state ensemble, in terms of Rg and shape parameters (Rg tensor); and the appearance of partially folded intermediates during cotranslation, evidenced by the appearance of a third basin in the free energy profile. These trends are due in part to excluded volume (crowding) interactions between the ribosome and nascent chain. We perform in silico temperature-jump experiments on the RNCs and examine nascent chain folding kinetics and structural changes in the transition state ensemble at various stall lengths.

  4. Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

    PubMed

    Su, S; Bird, R C

    1995-09-15

    A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

  5. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  6. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    PubMed

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  7. Rmt1 catalyzes zinc-finger independent arginine methylation of ribosomal protein Rps2 in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lipson, Rebecca S.; Webb, Kristofor J.; Clarke, Steven G., E-mail: clarke@mbi.ucla.edu

    2010-01-22

    Rps2/rpS2 is a well conserved protein of the eukaryotic ribosomal small subunit. Rps2 has previously been shown to contain asymmetric dimethylarginine residues, the addition of which is catalyzed by zinc-finger-containing arginine methyltransferase 3 (Rmt3) in the fission yeast Schizosaccharomyces pombe and protein arginine methyltransferase 3 (PRMT3) in mammalian cells. Here, we demonstrate that despite the lack of a zinc-finger-containing homolog of Rmt3/PRMT3 in the budding yeast Saccharomyces cerevisiae, Rps2 is partially modified to generate asymmetric dimethylarginine and monomethylarginine residues. We find that this modification of Rps2 is dependent upon the major arginine methyltransferase 1 (Rmt1) in S. cerevisiae. These resultsmore » are suggestive of a role for Rmt1 in modifying the function of Rps2 in a manner distinct from that occurring in S. pombe and mammalian cells.« less

  8. Ribosomes slide on lysine-encoding homopolymeric A stretches

    PubMed Central

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  9. Mutations in Ribosomal Protein L3 Are Associated with Oxazolidinone Resistance in Staphylococci of Clinical Origin▿

    PubMed Central

    Locke, Jeffrey B.; Hilgers, Mark; Shaw, Karen Joy

    2009-01-01

    Following recent reports of ribosomal protein L3 mutations in laboratory-derived linezolid-resistant (LZDr) Staphylococcus aureus, we investigated whether similar mutations were present in LZDr staphylococci of clinical origin. Sequence analysis of a variety of LZDr isolates revealed two L3 mutations, ΔSer145 (S. aureus NRS127) and Ala157Arg (Staphylococcus epidermidis 1653059), both occurring proximal to the oxazolidinone binding site in the peptidyl transferase center. The oxazolidinone torezolid maintained a ≥8-fold potency advantage over linezolid for both strains. PMID:19805557

  10. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Treesearch

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  11. 5S ribosomal RNA database Y2K

    PubMed Central

    Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212

  12. 5S ribosomal RNA database Y2K.

    PubMed

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  13. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    PubMed Central

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George

    2013-01-01

    SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031

  14. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    PubMed

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  15. The p90 ribosomal S6 kinase 2 specifically affects mitotic progression by regulating the basal level, distribution and stability of mitotic spindles

    PubMed Central

    Park, Yun Yeon; Nam, Hyun-Ja; Do, Mihyang; Lee, Jae-Ho

    2016-01-01

    RSK2, also known as RPS6KA3 (ribosomal protein S6 kinase, 90 kDa, polypeptide 3), is a downstream kinase of the mitogen-activated protein kinase (MAPK) pathway, which is important in regulating survival, transcription, growth and proliferation. However, its biological role in mitotic progression is not well understood. In this study, we examined the potential involvement of RSK2 in the regulation of mitotic progression. Interestingly, depletion of RSK2, but not RSK1, caused the accumulation of mitotic cells. Time-lapse analysis revealed that mitotic duration, particularly the duration for metaphase-to-anaphase transition was prolonged in RSK2-depleted cells, suggesting activation of spindle assembly checkpoint (SAC). Indeed, more BubR1 (Bub1-related kinase) was present on metaphase plate kinetochores in RSK2-depleted cells, and depletion of BubR1 abolished the mitotic accumulation caused by RSK2 depletion, confirming BubR1-dependent SAC activation. Along with the shortening of inter-kinetochore distance, these data suggested that weakening of the tension across sister kinetochores by RSK2 depletion led to the activation of SAC. To test this, we analyzed the RSK2 effects on the stability of kinetochore–microtubule interactions, and found that RSK2-depleted cells formed less kinetochore–microtubule fibers. Moreover, RSK2 depletion resulted in the decrease of basal level of microtubule as well as an irregular distribution of mitotic spindles, which might lead to observed several mitotic progression defects such as increase in unaligned chromosomes, defects in chromosome congression and a decrease in pole-to-pole distance in these cells. Taken together, our data reveal that RSK2 affects mitotic progression by regulating the distribution, basal level and the stability of mitotic spindles. PMID:27491410

  16. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    PubMed

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  17. Immunosuppressive Yersinia Effector YopM Binds DEAD Box Helicase DDX3 to Control Ribosomal S6 Kinase in the Nucleus of Host Cells.

    PubMed

    Berneking, Laura; Schnapp, Marie; Rumm, Andreas; Trasak, Claudia; Ruckdeschel, Klaus; Alawi, Malik; Grundhoff, Adam; Kikhney, Alexey G; Koch-Nolte, Friedrich; Buck, Friedrich; Perbandt, Markus; Betzel, Christian; Svergun, Dmitri I; Hentschke, Moritz; Aepfelbacher, Martin

    2016-06-01

    Yersinia outer protein M (YopM) is a crucial immunosuppressive effector of the plaque agent Yersinia pestis and other pathogenic Yersinia species. YopM enters the nucleus of host cells but neither the mechanisms governing its nucleocytoplasmic shuttling nor its intranuclear activities are known. Here we identify the DEAD-box helicase 3 (DDX3) as a novel interaction partner of Y. enterocolitica YopM and present the three-dimensional structure of a YopM:DDX3 complex. Knockdown of DDX3 or inhibition of the exportin chromosomal maintenance 1 (CRM1) increased the nuclear level of YopM suggesting that YopM exploits DDX3 to exit the nucleus via the CRM1 export pathway. Increased nuclear YopM levels caused enhanced phosphorylation of Ribosomal S6 Kinase 1 (RSK1) in the nucleus. In Y. enterocolitica infected primary human macrophages YopM increased the level of Interleukin-10 (IL-10) mRNA and this effect required interaction of YopM with RSK and was enhanced by blocking YopM's nuclear export. We propose that the DDX3/CRM1 mediated nucleocytoplasmic shuttling of YopM determines the extent of phosphorylation of RSK in the nucleus to control transcription of immunosuppressive cytokines.

  18. Plant Ribosome-Inactivating Proteins: Progesses, Challenges and Biotechnological Applications (and a Few Digressions)

    PubMed Central

    Fabbrini, Maria Serena; Katayama, Miku; Nakase, Ikuhiko; Vago, Riccardo

    2017-01-01

    Plant ribosome-inactivating protein (RIP) toxins are EC3.2.2.22 N-glycosidases, found among most plant species encoded as small gene families, distributed in several tissues being endowed with defensive functions against fungal or viral infections. The two main plant RIP classes include type I (monomeric) and type II (dimeric) as the prototype ricin holotoxin from Ricinus communis that is composed of a catalytic active A chain linked via a disulphide bridge to a B-lectin domain that mediates efficient endocytosis in eukaryotic cells. Plant RIPs can recognize a universally conserved stem-loop, known as the α-sarcin/ ricin loop or SRL structure in 23S/25S/28S rRNA. By depurinating a single adenine (A4324 in 28S rat rRNA), they can irreversibly arrest protein translation and trigger cell death in the intoxicated mammalian cell. Besides their useful application as potential weapons against infected/tumor cells, ricin was also used in bio-terroristic attacks and, as such, constitutes a major concern. In this review, we aim to summarize past studies and more recent progresses made studying plant RIPs and discuss successful approaches that might help overcoming some of the bottlenecks encountered during the development of their biomedical applications. PMID:29023422

  19. Schizosaccharomyces pombe Noc3 Is Essential for Ribosome Biogenesis and Cell Division but Not DNA Replication▿

    PubMed Central

    Houchens, Christopher R.; Perreault, Audrey; Bachand, François; Kelly, Thomas J.

    2008-01-01

    The initiation of eukaryotic DNA replication is preceded by the assembly of prereplication complexes (pre-RCs) at chromosomal origins of DNA replication. Pre-RC assembly requires the essential DNA replication proteins ORC, Cdc6, and Cdt1 to load the MCM DNA helicase onto chromatin. Saccharomyces cerevisiae Noc3 (ScNoc3), an evolutionarily conserved protein originally implicated in 60S ribosomal subunit trafficking, has been proposed to be an essential regulator of DNA replication that plays a direct role during pre-RC formation in budding yeast. We have cloned Schizosaccharomyces pombe noc3+ (Spnoc3+), the S. pombe homolog of the budding yeast ScNOC3 gene, and functionally characterized the requirement for the SpNoc3 protein during ribosome biogenesis, cell cycle progression, and DNA replication in fission yeast. We showed that fission yeast SpNoc3 is a functional homolog of budding yeast ScNoc3 that is essential for cell viability and ribosome biogenesis. We also showed that SpNoc3 is required for the normal completion of cell division in fission yeast. However, in contrast to the proposal that ScNoc3 plays an essential role during DNA replication in budding yeast, we demonstrated that fission yeast cells do enter and complete S phase in the absence of SpNoc3, suggesting that SpNoc3 is not essential for DNA replication in fission yeast. PMID:18606828

  20. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    PubMed

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  1. Salicylic acid-related cotton (Gossypium arboreum) ribosomal protein GaRPL18 contributes to resistance to Verticillium dahliae.

    PubMed

    Gong, Qian; Yang, Zhaoen; Wang, Xiaoqian; Butt, Hamama Islam; Chen, Eryong; He, Shoupu; Zhang, Chaojun; Zhang, Xueyan; Li, Fuguang

    2017-03-03

    Verticillium dahliae is a phytopathogenic fungal pathogen that causes vascular wilt diseases responsible for considerable decreases in cotton yields. The complex mechanism underlying cotton resistance to Verticillium wilt remains uncharacterized. Identifying an endogenous resistance gene may be useful for controlling this disease. We cloned the ribosomal protein L18 (GaRPL18) gene, which mediates resistance to Verticillium wilt, from a wilt-resistant cotton species (Gossypium arboreum). We then characterized the function of this gene in cotton and Arabidopsis thaliana plants. GaRPL18 encodes a 60S ribosomal protein subunit important for intracellular protein biosynthesis. However, previous studies revealed that some ribosomal proteins are also inhibitory toward oncogenesis and congenital diseases in humans and play a role in plant disease defense. Here, we observed that V. dahliae infections induce GaRPL18 expression. Furthermore, we determined that the GaRPL18 expression pattern is consistent with the disease resistance level of different cotton varieties. GaRPL18 expression is upregulated by salicylic acid (SA) treatments, suggesting the involvement of GaRPL18 in the SA signal transduction pathway. Virus-induced gene silencing technology was used to determine whether the GaRPL18 expression level influences cotton disease resistance. Wilt-resistant cotton species in which GaRPL18 was silenced became more susceptible to V. dahliae than the control plants because of a significant decrease in the abundance of immune-related molecules. We also transformed A. thaliana ecotype Columbia (Col-0) plants with GaRPL18 according to the floral dip method. The plants overexpressing GaRPL18 were more resistant to V. dahliae infections than the wild-type Col-0 plants. The enhanced resistance of transgenic A. thaliana plants to V. dahliae is likely mediated by the SA pathway. Our findings provide new insights into the role of GaRPL18, indicating that it plays a crucial role in

  2. Mechanistic Insight into the Reactivation of BCAII Enzyme from Denatured and Molten Globule States by Eukaryotic Ribosomes and Domain V rRNAs

    PubMed Central

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964

  3. An unusual internal ribosomal entry site of inverted symmetry directs expression of a potato leafroll polerovirus replication-associated protein

    PubMed Central

    Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk

    2003-01-01

    Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413

  4. Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.

    PubMed

    Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V

    2010-10-01

    The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.

  5. Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

    PubMed Central

    Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

    2014-01-01

    Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

  6. Kinase Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    DTIC Science & Technology

    2017-02-01

    Ribosome assembly • Autophagy • CRISPR /Cas9 6 ACCOMPLISHMENTS Major goals The major goals in this reporting period were to use the CRISPR ...defects on ribosome assembly, drug sensitivity etc. Accomplishments under these goals To set up the CRISPR /Cas9 experiment, the Karbstein...recombinant Cas9, and then assayed CRISPR /Cas9 mediated cleavage of a PCR-generated DNA. This demonstrated that the guide RNAs we had designed based on

  7. S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

    PubMed Central

    Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

    2007-01-01

    The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

  8. Sorting Out Antibiotics' Mechanisms of Action: a Double Fluorescent Protein Reporter for High-Throughput Screening of Ribosome and DNA Biosynthesis Inhibitors

    PubMed Central

    Osterman, Ilya A.; Komarova, Ekaterina S.; Shiryaev, Dmitry I.; Korniltsev, Ilya A.; Khven, Irina M.; Lukyanov, Dmitry A.; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Efremenkova, Olga V.; Ivanenkov, Yan A.; Bogdanov, Alexey A.; Dontsova, Olga A.

    2016-01-01

    In order to accelerate drug discovery, a simple, reliable, and cost-effective system for high-throughput identification of a potential antibiotic mechanism of action is required. To facilitate such screening of new antibiotics, we created a double-reporter system for not only antimicrobial activity detection but also simultaneous sorting of potential antimicrobials into those that cause ribosome stalling and those that induce the SOS response due to DNA damage. In this reporter system, the red fluorescent protein gene rfp was placed under the control of the SOS-inducible sulA promoter. The gene of the far-red fluorescent protein, katushka2S, was inserted downstream of the tryptophan attenuator in which two tryptophan codons were replaced by alanine codons, with simultaneous replacement of the complementary part of the attenuator to preserve the ability to form secondary structures that influence transcription termination. This genetically modified attenuator makes possible Katushka2S expression only upon exposure to ribosome-stalling compounds. The application of red and far-red fluorescent proteins provides a high signal-to-background ratio without any need of enzymatic substrates for detection of the reporter activity. This reporter was shown to be efficient in high-throughput screening of both synthetic and natural chemicals. PMID:27736765

  9. Ribosomes are optimized for autocatalytic production

    NASA Astrophysics Data System (ADS)

    Reuveni, Shlomi; Ehrenberg, Måns; Paulsson, Johan

    2017-07-01

    Many fine-scale features of ribosomes have been explained in terms of function, revealing a molecular machine that is optimized for error-correction, speed and control. Here we demonstrate mathematically that many less well understood, larger-scale features of ribosomes—such as why a few ribosomal RNA molecules dominate the mass and why the ribosomal protein content is divided into 55-80 small, similarly sized segments—speed up their autocatalytic production.

  10. Downregulation of ribosome biogenesis during early forebrain development

    PubMed Central

    Chau, Kevin F; Shannon, Morgan L; Fame, Ryann M; Fonseca, Erin; Mullan, Hillary; Johnson, Matthew B; Sendamarai, Anoop K; Springel, Mark W; Laurent, Benoit

    2018-01-01

    Forebrain precursor cells are dynamic during early brain development, yet the underlying molecular changes remain elusive. We observed major differences in transcriptional signatures of precursor cells from mouse forebrain at embryonic days E8.5 vs. E10.5 (before vs. after neural tube closure). Genes encoding protein biosynthetic machinery were strongly downregulated at E10.5. This was matched by decreases in ribosome biogenesis and protein synthesis, together with age-related changes in proteomic content of the adjacent fluids. Notably, c-MYC expression and mTOR pathway signaling were also decreased at E10.5, providing potential drivers for the effects on ribosome biogenesis and protein synthesis. Interference with c-MYC at E8.5 prematurely decreased ribosome biogenesis, while persistent c-MYC expression in cortical progenitors increased transcription of protein biosynthetic machinery and enhanced ribosome biogenesis, as well as enhanced progenitor proliferation leading to subsequent macrocephaly. These findings indicate large, coordinated changes in molecular machinery of forebrain precursors during early brain development. PMID:29745900

  11. Assembly constraints drive co-evolution among ribosomal constituents.

    PubMed

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  13. Effect of HIV-1 Tat on the formation of the mitotic spindle by interaction with ribosomal protein S3.

    PubMed

    Kim, Jiyoung; Kim, Yeon-Soo

    2018-06-06

    Human immunodeficiency virus type 1 (HIV-1) Tat, an important regulator of viral transcription, interacts with diverse cellular proteins and promotes or inhibits cell proliferation. Here, we show that ribosomal protein S3 (RPS3) plays an important role in mitosis through an interaction with α-tubulin and that Tat binds to and inhibits the localization of RPS3 in the mitotic spindle during mitosis. RPS3 colocalized with α-tubulin around chromosomes in the mitotic spindle. Depletion of RPS3 promoted α-tubulin assembly, while overexpression of RPS3 impaired α-tubulin assembly. Depletion of RPS3 resulted in aberrant mitotic spindle formation, segregation failure, and defective abscission. Moreover, ectopic expression of RPS3 rescued the cell proliferation defect in RPS3-knockdown cells. HIV-1 Tat interacted with RPS3 through its basic domain and increased the level of RPS3 in the nucleus. Expression of Tat caused defects in mitotic spindle formation and chromosome assembly in mitosis. Moreover, the localization of RPS3 in the mitotic spindle was disrupted when HIV-1 Tat was expressed in HeLa and Jurkat cells. These results suggest that Tat inhibits cell proliferation via an interaction with RPS3 and thereby disrupts mitotic spindle formation during HIV-1 infection. These results might provide insight into the mechanism underlying lymphocyte pathogenesis during HIV-1 infection.

  14. Selective ribosome profiling as a tool to study the interaction of chaperones and targeting factors with nascent polypeptide chains and ribosomes

    PubMed Central

    Becker, Annemarie H.; Oh, Eugene; Weissman, Jonathan S.; Kramer, Günter; Bukau, Bernd

    2014-01-01

    A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors, and enzymes. Many factors act cotranslationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling, RP), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor–RNC interactions are stabilized by crosslinking, the resulting factor–RNC adducts are then nuclease-treated to generate monosomes, and affinity-purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor and is readily adaptable to other cotranslationally acting factors, including eukaryotic factors. Factor–RNC purification and sequencing library preparation takes 7–8 days, sequencing and data analysis can be completed in 5–6 days. PMID:24136347

  15. Matrine derivate MASM uncovers a novel function for ribosomal protein S5 in osteoclastogenesis and postmenopausal osteoporosis.

    PubMed

    Chen, Xiao; Zhi, Xin; Cao, Liehu; Weng, Weizong; Pan, Panpan; Hu, Honggang; Liu, Chao; Zhao, Qingjie; Zhou, Qirong; Cui, Jin; Su, Jiacan

    2017-09-07

    Postmenopausal osteoporosis (POMP) is a public health problem characterized by decreased bone density and increased fracture risk. Over-activated osteoclastogenesis plays a vital role in POMP. Here we developed a novel bioactive compound MASM (M19) based on sophocarpine. Although it showed no significant effects on osteogenesis and adipogenesis for bone marrow-derived mesenchymal stem cells (BMSCs) in vitro, it could significantly inhibit RANKL/M-CSF induced osteoclastogenesis through suppressing NF-κB, MAPKs and PI3K/Akt pathways in vitro and ameliorate bone loss in ovariectomized mice in vivo. Ribosomal protein s5 (RPS5) has been identified as a target of M19 and regulates PI3K/Akt, NF-κB and MAPKs pathways in osteoclastogenesis. Overexpressions of RPS5 synergistically inhibited osteoclastogenesis with M19 while silencing RPS5 compromised M19 inhibitory effects on osteoclastogenesis in vitro. Among the three pathways, Akt plays a major role in M19 effects. The Akt activator SC 79 partially reversed the inhibitory effects on osteoclastogenesis by M19 and RPS5-knocking-down. It indicates that RPS5 serves as a potential candidate target for inhibiting osteoclastogenesis and osteoporosis therapy and M19 is a promising agent for POMP treatment.

  16. Modular Assembly of the Bacterial Large Ribosomal Subunit

    PubMed Central

    Davis, Joseph H.; Tan, Yong Zi; Carragher, Bridget; Potter, Clinton S.; Lyumkis, Dmitry; Williamson, James R.

    2016-01-01

    SUMMARY The ribosome is a complex macromolecular machine and serves as an ideal system for understanding biological macromolecular assembly. Direct observation of ribosome assembly in vivo is difficult, as few intermediates have been isolated and thoroughly characterized. Herein, we deploy a genetic system to starve cells of an essential ribosomal protein, which results in the accumulation of assembly intermediates that are competent for maturation. Quantitative mass spectrometry and single-particle cryo-electron microscopy reveal 13 distinct intermediates, which were each resolved to ~4–5Å resolution and could be placed in an assembly pathway. We find that ribosome biogenesis is a parallel process, that blocks of structured rRNA and proteins assemble cooperatively, and that the entire process is dynamic and can be ‘re-routed’ through different pathways as needed. This work reveals the complex landscape of ribosome assembly in vivo and provides the requisite tools to characterize additional assembly pathways for ribosomes and other macromolecular machines. PMID:27912064

  17. The essential nature of YqfG, a YbeY homologue required for 3' maturation of Bacillus subtilis 16S ribosomal RNA is suppressed by deletion of RNase R.

    PubMed

    Baumgardt, Kathrin; Gilet, Laetitia; Figaro, Sabine; Condon, Ciarán

    2018-06-05

    Ribosomal RNAs are processed from primary transcripts containing 16S, 23S and 5S rRNAs in most bacteria. Maturation generally occurs in a two-step process, consisting of a first crude separation of the major species by RNase III during transcription, followed by precise trimming of 5' and 3' extensions on each species upon accurate completion of subunit assembly. The various endo- and exoribonucleases involved in the final processing reactions are strikingly different in Escherichia coli and Bacillus subtilis, the two best studied representatives of Gram-negative and Gram-positive bacteria, respectively. Here, we show that the one exception to this rule is the protein involved in the maturation of the 3' end of 16S rRNA. Cells depleted for the essential B. subtilis YqfG protein, a homologue of E. coli YbeY, specifically accumulate 16S rRNA precursors bearing 3' extensions. Remarkably, the essential nature of YqfG can be suppressed by deleting the ribosomal RNA degrading enzyme RNase R, i.e. a ΔyqfG Δrnr mutant is viable. Our data suggest that 70S ribosomes containing 30S subunits with 3' extensions of 16S rRNA are functional to a degree, but become substrates for degradation by RNase R and are eliminated.

  18. Biological Function of Ribosomal Protein L10 on Cell Behavior in Human Epithelial Ovarian Cancer

    PubMed Central

    Shi, Jimin; Zhang, Lingyun; Zhou, Daibing; Zhang, Jinguo; Lin, Qunbo; Guan, Wencai; Zhang, Jihong; Ren, Weimin; Xu, Guoxiong

    2018-01-01

    Ribosomal protein L10 (RPL10) is one of large ribosomal proteins and plays a role in Wilms' tumor and premature ovarian failure. However, the function of RPL10 in human epithelial ovarian cancer (EOC) remains unknown. The purpose of this study was to examine the expression level and function of RPL10 in EOC. RPL10 protein expression was detected by immunohistochemistry and Western blot. The association RPL10 expression with clinical features was analyzed. Loss-of-function and gain-of-function approaches were applied in cellular assays, including cell viability, migration, invasion, and apoptosis. Our study demonstrated for the first time that RPL10 was upregulated in human EOC compared with normal ovarian tissues. Knockdown of RPL10 inhibited cell viability, migration, and invasion, and increased cell apoptosis. On the contrary, upregulation of RPL10 increased cell viability, migration, invasion, and decreased cell apoptosis. Furthermore, miR-143-3p regulated RPL10 expression. Our data indicate that RPL10 is a potential tissue biomarker of patients with EOC and may be a therapeutic target of ovarian cancer. PMID:29556332

  19. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    PubMed

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  20. Analysis of Ribosome Stalling and Translation Elongation Dynamics by Deep Learning.

    PubMed

    Zhang, Sai; Hu, Hailin; Zhou, Jingtian; He, Xuan; Jiang, Tao; Zeng, Jianyang

    2017-09-27

    Ribosome stalling is manifested by the local accumulation of ribosomes at specific codon positions of mRNAs. Here, we present ROSE, a deep learning framework to analyze high-throughput ribosome profiling data and estimate the probability of a ribosome stalling event occurring at each genomic location. Extensive validation tests on independent data demonstrated that ROSE possessed higher prediction accuracy than conventional prediction models, with an increase in the area under the receiver operating characteristic curve by up to 18.4%. In addition, genome-wide statistical analyses showed that ROSE predictions can be well correlated with diverse putative regulatory factors of ribosome stalling. Moreover, the genome-wide ribosome stalling landscapes of both human and yeast computed by ROSE recovered the functional interplays between ribosome stalling and cotranslational events in protein biogenesis, including protein targeting by the signal recognition particles and protein secondary structure formation. Overall, our study provides a novel method to complement the ribosome profiling techniques and further decipher the complex regulatory mechanisms underlying translation elongation dynamics encoded in the mRNA sequence. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. IL-3 maintains activation of the P90S6K/RPS6 pathway and increases translation in human eosinophils1

    PubMed Central

    Esnault, Stephane; Kelly, Elizabeth A.B.; Shen, Zhong-Jian; Johansson, Mats W.; Malter, James S.; Jarjour, Nizar N.

    2015-01-01

    IL-5 is a major therapeutic target to reduce eosinophilia. However, all of the eosinophil-activating cytokines IL-5, IL-3, and GM-CSF are typically present in atopic diseases including allergic asthma. Due to the functional redundancy of these 3 cytokines on eosinophils and the loss of IL-5 receptor on airway eosinophils, it is important to take IL-3 and GM-CSF into account to efficiently reduce tissue eosinophil functions. Moreover, these 3 cytokines signal through a common β-chain receptor, and yet differentially affect protein production in eosinophils. Notably, the increased ability of IL-3 to induce production of proteins such as semaphorin-7A without affecting mRNA level suggests a unique influence by IL-3 on translation. The purpose of this study is to identify the mechanisms by which IL-3 distinctively affects eosinophil function compared to IL-5 and GM-CSF, with a focus on protein translation. Peripheral blood eosinophils were used to study intracellular signaling and protein translation in cells activated with IL-3, GM-CSF or IL-5. We establish that, unlike GM-CSF or IL-5, IL-3 triggers prolonged signaling through activation of ribosomal protein (RP) S6 and the upstream kinase, p90S6K. Blockade of p90S6K activation inhibited phosphorylation of RPS6 and IL-3-enhanced semaphorin-7A translation. Furthermore, in an allergen-challenged environment, in vivo phosphorylation of RPS6 and p90S6K was enhanced in human airway compared to circulating eosinophils. Our findings provide new insights into the mechanisms underlying differential activation of eosinophils by IL-3, GM-CSF, and IL-5. These observations place IL-3 and its downstream intracellular signals as novel targets that should be considered to modulate eosinophil functions. PMID:26276876

  2. Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells

    PubMed Central

    Stratford, Anna L; Fry, Christopher J; Desilets, Curtis; Davies, Alastair H; Cho, Yong Y; Li, Yvonne; Dong, Zigang; Berquin, Isabelle M; Roux, Philippe P; Dunn, Sandra E

    2008-01-01

    Introduction Basal-like breast cancers (BLBC) frequently overexpress the epidermal growth factor receptor (EGFR) and subsequently have high levels of signaling through the MAP kinase pathway, which is thought to contribute to their aggressive behavior. While we have previously reported the expression of Y-box binding protein-1 (YB-1) in 73% of BLBC, it is unclear whether it can be regulated by a component of the MAP kinase signaling pathway. Phosphorylation of YB-1 at the serine 102 residue is required for transcriptional activation of growth-enhancing genes, such as EGFR. Using Motifscan we identified p90 ribosomal S6 kinase (RSK) as a potential candidate for activating YB-1. Methods Inhibition of RSK1 and RSK2 was achieved using siRNA and the small molecule SL0101. RSK1, RSK2, activated RSK and kinase-dead RSK were expressed in HCC1937 cells. Kinase assays were performed to illustrate direct phosphorylation of YB-1 by RSK. The impact of inhibiting RSK on YB-1 function was measured by luciferase assays and chromatin immunoprecipitation. Results Using an in vitro kinase assay, RSK1 and RSK2 were shown to directly phosphorylate YB-1. Interestingly, they were more effective activators of YB-1 than AKT or another novel YB-1 kinase, PKCα. Phosphorylation of YB-1 (serine 102 residue) is blocked by inhibition of the MAP kinase pathway or by perturbing RSK1/RSK2 with siRNA or SL0101. In immortalized breast epithelial cells where RSK is active yet AKT is not, YB-1 is phosphorylated. Supporting this observation, RSK2-/- mouse embryo fibroblasts lose the ability to phosphorylate YB-1 in response to epidermal growth factor. This subsequently interfered with the ability of YB-1 to regulate the expression of EGFR. The RSK inhibitor SL0101 decreased the ability of YB-1 to bind the promoter, transactivate and ultimately reduce EGFR expression. In concordance with these results the expression of constitutively active RSK1 increased YB-1 phosphorylation, yet the kinase-dead RSK

  3. A Novel In Vivo Assay Reveals Inhibition of Ribosomal Nuclear Export in Ran-Cycle and Nucleoporin Mutants

    PubMed Central

    Hurt, Ed; Hannus, Stefan; Schmelzl, Birgit; Lau, Denise; Tollervey, David; Simos, George

    1999-01-01

    To identify components involved in the nuclear export of ribosomes in yeast, we developed an in vivo assay exploiting a green fluorescent protein (GFP)-tagged version of ribosomal protein L25. After its import into the nucleolus, L25-GFP assembles with 60S ribosomal subunits that are subsequently exported into the cytoplasm. In wild-type cells, GFP-labeled ribosomes are only detected by fluorescence in the cytoplasm. However, thermosensitive rna1-1 (Ran-GAP), prp20-1 (Ran-GEF), and nucleoporin nup49 and nsp1 mutants are impaired in ribosomal export as revealed by nuclear accumulation of L25-GFP. Furthermore, overexpression of dominant-negative RanGTP (Gsp1-G21V) and the tRNA exportin Los1p inhibits ribosomal export. The pattern of subnuclear accumulation of L25-GFP observed in different mutants is not identical, suggesting that transport can be blocked at different steps. Thus, nuclear export of ribosomes requires the nuclear/cytoplasmic Ran-cycle and distinct nucleoporins. This assay can be used to identify soluble transport factors required for nuclear exit of ribosomes. PMID:9971735

  4. Pea chloroplast DNA encodes homologues of Escherichia coli ribosomal subunit S2 and the beta'-subunit of RNA polymerase.

    PubMed Central

    Cozens, A L; Walker, J E

    1986-01-01

    The nucleotide sequence has been determined of a segment of 4680 bases of the pea chloroplast genome. It adjoins a sequence described elsewhere that encodes subunits of the F0 membrane domain of the ATP-synthase complex. The sequence contains a potential gene encoding a protein which is strongly related to the S2 polypeptide of Escherichia coli ribosomes. It also encodes an incomplete protein which contains segments that are homologous to the beta'-subunit of E. coli RNA polymerase and to yeast RNA polymerases II and III. PMID:3530249

  5. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

    PubMed

    Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

    2006-05-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

  6. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

    PubMed Central

    Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

    2006-01-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

  7. The participation of ribosomes in protein glycosylation. Interaction of the ribosome-UDP-N-acetyl-glucosamine complex with dolichol phosphate.

    PubMed

    Paszkiewicz-Gadek, A; Porowska, H; Gałasiński, W

    1992-01-01

    UDP-N-acetylglucosamine can be bound by pure ribosomes. The part of N-acetylglucosamine-1-P can be transferred from the complex ribosome-UDP-N-acetylglucosamine onto dolichol phosphate. Evidence is presented that N-acetylglucosamine bound to dolichol phosphate can be transferred to the nascent peptide synthesized on the ribosome.

  8. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  9. Genetic removal of p70 S6 kinase 1 corrects molecular, synaptic, and behavioral phenotypes in fragile X syndrome mice.

    PubMed

    Bhattacharya, Aditi; Kaphzan, Hanoch; Alvarez-Dieppa, Amanda C; Murphy, Jaclyn P; Pierre, Philippe; Klann, Eric

    2012-10-18

    Fragile X syndrome (FXS) is the leading inherited cause of autism and intellectual disability. Aberrant synaptic translation has been implicated in the etiology of FXS, but most lines of research on therapeutic strategies have targeted protein synthesis indirectly, far upstream of the translation machinery. We sought to perturb p70 ribosomal S6 kinase 1 (S6K1), a key translation initiation and elongation regulator, in FXS model mice. We found that genetic reduction of S6K1 prevented elevated phosphorylation of translational control molecules, exaggerated protein synthesis, enhanced mGluR-dependent long-term depression (LTD), weight gain, and macro-orchidism in FXS model mice. In addition, S6K1 deletion prevented immature dendritic spine morphology and multiple behavioral phenotypes, including social interaction deficits, impaired novel object recognition, and behavioral inflexibility. Our results support the model that dysregulated protein synthesis is the key causal factor in FXS and that restoration of normal translation can stabilize peripheral and neurological function in FXS. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Purification and characterization of a novel type i ribosome inactivating protein, pachyerosin, from Pachyrhizus erosus seeds, and preparation of its immunotoxin against human hepatoma cells.

    PubMed

    Guo, Jin-Lin; Cheng, Yuan-Liu; Qiu, Yi; Shen, Cai-Hong; Yi, Bin; Peng, Cheng

    2014-07-01

    Pachyrhizus erosus seeds have a high protein content and are used in China due to their cytotoxic effect. Here we report the biological and pharmacological activity of the protein extracts from P. erosus seeds. A novel ribosome-inactivating protein, pachyerosin, from P. erosus seeds was successively purified to homogeneity using ammonium sulfate precipitation, DEAE-sepharose FF, and Sephacryl S-200. Pachyerosin showed to be a type I ribosome-inactivating protein with a molecular mass of 29 kDa and an isoelectric point of 9.19. It strongly inhibited protein synthesis of rabbit reticulocyte lysate with an IC50 of 0.37 ng/mL and showed N-glycosidase activity on rat liver ribosomes with an EC50 of 85.9 pM. The N-terminal 27 amino acids of pachyerosin revealed a 60.71% sequence identity with abrin A from the seeds of Abrus precatorius. With the aim of targeting the delivery of pachyerosin, immunotoxin was prepared by conjugating pachyerosin with anti-human AFP monoclonal antibodies SM0736. The immunotoxin pachyerosin-SM0736 efficiently inhibited the growth of the human hepatoma cell line HuH-7 with an IC50 of 0.050 ± 0.004 nM, 2360 times lower than that of pachyerosin and 430 times lower than that of the immunotoxin against human gastric cancer cell line SGC7901. These results imply that pachyerosin may be used as a new promising anticancer agent. Georg Thieme Verlag KG Stuttgart · New York.

  11. Proteomic analysis of S-nitrosylated and S-glutathionylated proteins in wheat seedlings with different dehydration tolerances.

    PubMed

    Gietler, Marta; Nykiel, Małgorzata; Orzechowski, Sławomir; Fettke, Joerg; Zagdańska, Barbara

    2016-11-01

    A loss of dehydration tolerance in wheat seedlings on the fifth day following imbibition is associated with a disturbance in cellular redox homeostasis, as documented by a shift of the reduced/oxidized glutathione ratio to a more oxidized state and a significant increase in the ratio of protein thiols to the total thiol group content. Therefore, the identification and characterization of redox-sensitive proteins are important steps toward understanding the molecular mechanisms of the loss of dehydration tolerance. In the present study, proteins that were differentially expressed between fully turgid (control), dehydrated tolerant (four-day-old) and dehydrated sensitive (six-day-old) wheat seedlings were analysed. Protein spots having at least a significant (p < 0.05) two-fold change in protein abundance were selected by Delta2D as differentially expressed, identified by MALDI-TOF and LC-MS/MS, and classified according to their function. The observed changes in the proteomic patterns of the differentially S-nitrosylated and S-glutathionylated proteins were highly specific in dehydration-tolerant and -sensitive wheat seedlings. The metabolic function of these proteins indicates that dehydration tolerance is mainly related to nucleic acids, protein metabolism, and energy metabolism. It has been proven that leaf-specific thionins BTH6 and DB4, chloroplastic 50S ribosomal protein L16, phospholipase A1-II delta, and chloroplastic thioredoxin M2 are both S-nitrosylated and S-glutathionylated upon water deficiency. Our results revealed the existence of interplay between S-nitrosylation and S-glutathionylation, two redox-regulated protein posttranslational modifications that could enhance plant defence mechanisms and/or facilitate the acclimation of plants to unfavourable environmental conditions. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  12. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    PubMed Central

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  13. Modular Assembly of the Bacterial Large Ribosomal Subunit.

    PubMed

    Davis, Joseph H; Tan, Yong Zi; Carragher, Bridget; Potter, Clinton S; Lyumkis, Dmitry; Williamson, James R

    2016-12-01

    The ribosome is a complex macromolecular machine and serves as an ideal system for understanding biological macromolecular assembly. Direct observation of ribosome assembly in vivo is difficult, as few intermediates have been isolated and thoroughly characterized. Herein, we deploy a genetic system to starve cells of an essential ribosomal protein, which results in the accumulation of assembly intermediates that are competent for maturation. Quantitative mass spectrometry and single-particle cryo-electron microscopy reveal 13 distinct intermediates, which were each resolved to ∼4-5 Å resolution and could be placed in an assembly pathway. We find that ribosome biogenesis is a parallel process, that blocks of structured rRNA and proteins assemble cooperatively, and that the entire process is dynamic and can be "re-routed" through different pathways as needed. This work reveals the complex landscape of ribosome assembly in vivo and provides the requisite tools to characterize additional assembly pathways for ribosomes and other macromolecular machines. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome

    PubMed Central

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2’,3’-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2’- and 3’-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process. PMID:25191528

  15. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    PubMed

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  16. Characterization of a phorbol ester-stimulated S6 kinase from MDCK renal epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meier, K.E.; Krebs, E.G.

    Increased phosphorylation of S6, a 40S ribosomal subunit protein, is observed in mammalian cells in response to growth factors and phorbol esters. The goal of this study was to identify the S6 kinase that is stimulated by phorbol ester treatment of MDCK cells. MDCK clone D1 cells express high levels of protein kinase C(PKC). PKC and S6 kinase activities were measured following DEAE-Sephacel fractionation of cytosol; this procedure separated the two kinase activities. When confluent MDCK-D1 cells were exposed to 100 nM phorbol 12-myristate 13-acetate (PMA), 95% of the total cellular PKC activity became associated with the particulate fraction withinmore » 1 hour. Cytosolic S6 kinase activity was maximal by 1 hour and then declined thereafter, preceding any detectable loss of total cellular PKC. The PMA-responsive S6 kinase was partially purified from MDCK-D1 cytosol by consecutive steps of DEAE-Sephacel, ammonium sulfate precipitation, Ultrogel AcA 34, heparin-agarose, and Ultrogel AcA 34. The partially-purified enzyme had an apparent molecular size of approximately 80 kDa. In addition to S6, the enzyme phosphorylated synthetic peptides based on the carboxyl terminal sequence of S6. S6 kinase activity utilized ATP but not GTP, and was inhibited by heparin, NaCl, and ..beta..-glycerophosphate. In conclusion, a phorbol ester-stimulated S6 kinase has been partially purified from an epithelial cell line. This kinase is distinct from PKC.« less

  17. Overexpression, purification, molecular characterization and the effect on tumor growth of ribosomal protein L22 from the Giant Panda (Ailuropoda melanoleuca).

    PubMed

    Li, Jian; Hou, Yiling; Ding, Xiang; Hou, Wanru; Song, Bo; Zeng, Yichun

    2014-05-01

    The ribosomal protein L22 (RPL22) protein belongs to the L22E family of ribosomal proteins. It is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of RPL22 of the Giant Panda (Ailuropoda melanoleuca). The cDNA of RPL22 was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL22 cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. The result indicated that the length of the fragment cloned is 414 bp, and it contains an open-reading frame of 387 bp encoding 128 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL22 protein is 14.74 kDa with a theoretical pI 9.21. The RPL22 gene can be really expressed in E. coli and the RPL22 protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 20.1 kDa polypeptide. The data showed that the recombinant protein RPL22 had a time- and dose-dependency on the cell growth inhibition rate. The human laryngeal carcinoma Hep-2 cells treated with 0.05-6 μg/ml of RPL22 for 24 h displayed significant cell growth inhibition (p<0.05, n=8) in assayed using MTT compared to the control (untreated) cells. The data indicate that the effect at low concentrations is better than high concentrations, and the concentration of 1.5 μg/ml has the best rate of growth inhibition of 47.70%. The inhibitory rate in mice treated with 1.5 μg/ml RPL22 protein can reach 43.75%. Histology of tumor organs shows that the tissues arranged looser in RPL22 group than those in control group. Meanwhile, there is no obvious damage to other organs, such as heart, lung and kidney. Further research is on going to determine the bioactive principle(s) of recombinant protein RPL22 responsible for its anticancer activity.

  18. Blocking rpS6 Phosphorylation Exacerbates Tsc1 Deletion–Induced Kidney Growth

    PubMed Central

    Wu, Huijuan; Chen, Jianchun; Xu, Jinxian; Dong, Zheng; Meyuhas, Oded

    2016-01-01

    The molecular mechanisms underlying renal growth and renal growth–induced nephron damage remain poorly understood. Here, we report that in murine models, deletion of the tuberous sclerosis complex protein 1 (Tsc1) in renal proximal tubules induced strikingly enlarged kidneys, with minimal cystogenesis and occasional microscopic tumorigenesis. Signaling studies revealed hyperphosphorylation of eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) and increased phosphorylation of ribosomal protein S6 (rpS6) in activated renal tubules. Notably, knockin of a nonphosphorylatable rpS6 in these Tsc1-mutant mice exacerbated cystogenesis and caused drastic nephron damage and renal fibrosis, leading to kidney failure and a premature death rate of 67% by 9 weeks of age. In contrast, Tsc1 single-mutant mice were all alive and had far fewer renal cysts at this age. Mechanistic studies revealed persistent activation of mammalian target of rapamycin complex 1 (mTORC1) signaling causing hyperphosphorylation and consequent accumulation of 4E-BP1, along with greater cell proliferation, in the renal tubules of Tsc1 and rpS6 double-mutant mice. Furthermore, pharmacologic treatment of Tsc1 single-mutant mice with rapamycin reduced hyperphosphorylation and accumulation of 4E-BP1 but also inhibited phosphorylation of rpS6. Rapamycin also exacerbated cystic and fibrotic lesions and impaired kidney function in these mice, consequently leading to a premature death rate of 40% within 2 weeks of treatment, despite destroying tumors and decreasing kidney size. These findings indicate that Tsc1 prevents aberrant renal growth and tumorigenesis by inhibiting mTORC1 signaling, whereas phosphorylated rpS6 suppresses cystogenesis and fibrosis in Tsc1-deleted kidneys. PMID:26296742

  19. A Comparison of Structural and Evolutionary Attributes of Escherichia coli and Thermus thermophilus Small Ribosomal Subunits: Signatures of Thermal Adaptation

    PubMed Central

    Mallik, Saurav; Kundu, Sudip

    2013-01-01

    Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU). Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA) is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs) in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins) have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli) are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder) at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend. PMID:23940533

  20. The ribosome-inactivating, antiproliferative and teratogenic activities and immunoreactivities of a protein from seeds of Luffa aegyptiaca (Cucurbitaceae).

    PubMed

    Ng, T B; Chan, W Y; Yeung, H W

    1993-05-01

    1. The protein isolated from Luffa aegyptiaca seeds was capable of inhibiting protein synthesis in a rabbit reticulocyte lysate system and [3H]thymidine uptake by mouse melanoma (B16) cells. 2. It also adversely affected the development of mouse embryos in culture. 3. In enzyme-linked immunosorbent assay it reacted with antisera raised against other ribosome-inactivating proteins.

  1. Purification and crystallization of components of the protein-synthesizing system from Thermus thermophilus

    NASA Astrophysics Data System (ADS)

    Garber, M. B.; Agalarov, S. Ch.; Eliseikina, I. A.; Sedelnikova, S. E.; Tishchenko, S. V.; Shirokov, V. A.; Yusupov, M. M.; Reshetnikova, L. S.; Trakhanov, S. D.; Tukalo, M. A.; Yaremchuk, A. D.

    1991-03-01

    An extreme thermophilic bacterium Thermus thermophilus has been chosen as a source for the isolation of components of the protein-synthesizing system to investigate their structures by X-ray crystallographic methods. The scheme of simultaneous isolation of ribosomes, tRNA, three elongation factors, several aminoacyl-tRNA synthetases and several enzymes has been developed. Methods of purification of ribosomes and individual ribosomal proteins without denaturation were elaborated. Crystals of the elongation factor G, the 70S ribosome, the 30S ribosomal subunit, six ribosomal proteins and three aminoacyl-tRNA synthetases have been obtained. Structural investigations of EF-G and the 70S ribosome are underway.

  2. Single Molecule Force Measurement for Protein Synthesis on the Ribosome

    NASA Astrophysics Data System (ADS)

    Uemura, Sotaro

    2008-04-01

    The ribosome is a molecular machine that translates the genetic code described on the messenger RNA (mRNA) into an amino acid sequence through repetitive cycles of transfer RNA (tRNA) selection, peptide bond formation and translocation. Although the detailed interactions between the translation components have been revealed by extensive structural and biochemical studies, it is not known how the precise regulation of macromolecular movements required at each stage of translation is achieved. Here we demonstrate an optical tweezer assay to measure the rupture force between a single ribosome complex and mRNA. The rupture force was compared between ribosome complexes assembled on an mRNA with and without a strong Shine-Dalgarno (SD) sequence. The removal of the SD sequence significantly reduced the rupture force, indicating that the SD interactions contribute significantly to the stability of the ribosomal complex on the mRNA in a pre-peptidyl transfer state. In contrast, the post-peptidyl transfer state weakened the rupture force as compared to the complex in a pre-peptidyl transfer state and it was the same for both the SD-containing and SD-deficient mRNAs. The results suggest that formation of the first peptide bond destabilizes the SD interaction, resulting in the weakening of the force with which the ribosome grips an mRNA. This might be an important requirement to facilitate movement of the ribosome along mRNA during the first translocation step. In this article, we discuss about the above new results including the introduction of the ribosome translation mechanism and the optical tweezer method.

  3. TAM receptors, Gas6, and protein S: roles in inflammation and hemostasis.

    PubMed

    van der Meer, Jonathan H M; van der Poll, Tom; van 't Veer, Cornelis

    2014-04-17

    TAM receptors (Tyro3, Axl, and Mer) belong to a family of receptor tyrosine kinases that have important effects on hemostasis and inflammation. Also, they affect cell proliferation, survival, adhesion, and migration. TAM receptors can be activated by the vitamin K-dependent proteins Gas6 and protein S. Protein S is more commonly known as an important cofactor for protein C as well as a direct inhibitor of multiple coagulation factors. To our knowledge, the functions of Gas6 are limited to TAM receptor activation. When activated, the TAM receptors have effects on primary hemostasis and coagulation and display an anti-inflammatory or a proinflammatory effect, depending on cell type. To comprehend the effects that the TAM receptors and their ligands have on hemostasis and inflammation, we compare studies that report the different phenotypes displayed by mice with deficiencies in the genes of this receptor family and its ligands (protein S(+/-), Gas6(-/-), TAM(-/-), and variations of these). In this manner, we aim to display which features are attributable to the different ligands. Because of the effects TAM receptors have on hemostasis, inflammation, and cancer growth, their modulation could make interesting therapeutic targets in thromboembolic disease, atherosclerosis, sepsis, autoimmune disease, and cancer.

  4. Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

    PubMed Central

    Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

    2015-01-01

    Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

  5. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    NASA Astrophysics Data System (ADS)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  6. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics.

  7. 20-Hydroxyecdysone stimulates nuclear accumulation of BmNep1, a nuclear ribosome biogenesis-related protein in the silkworm, Bombyx mori.

    PubMed

    Ji, M-M; Liu, A-Q; Sima, Y-H; Xu, S-Q

    2016-10-01

    The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx. © 2016 The Royal Entomological Society.

  8. Pioglitazone Enhances Mitochondrial Biogenesis and Ribosomal Protein Biosynthesis in Skeletal Muscle in Polycystic Ovary Syndrome

    PubMed Central

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen; Tan, Qihua; Jensen, Thomas; Kruse, Torben A.; Beck-Nielsen, Henning; Højlund, Kurt

    2008-01-01

    Insulin resistance is a common metabolic abnormality in women with PCOS and leads to an elevated risk of type 2 diabetes. Studies have shown that thiazolidinediones (TZDs) improve metabolic disturbances in PCOS patients. We hypothesized that the effect of TZDs in PCOS is, in part, mediated by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp. Moreover, we explored gene expression changes between these PCOS patients before treatment and 13 healthy women. Treatment with pioglitazone improved insulin-stimulated glucose metabolism and plasma adiponectin, and reduced fasting serum insulin (all P<0.05). Global pathway analysis using Gene Map Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after pioglitazone therapy. Quantitative real-time PCR suggested that upregulation of OXPHOS genes was mediated by an increase in PGC-1α expression (P<0.05). Pretreatment expression of genes representing OXPHOS and ribosomal proteins was down-regulated in PCOS patients compared to healthy women. These data indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes in these women. PMID:18560589

  9. Use of Ribosome-Inactivating Proteins from Sambucus for the Construction of Immunotoxins and Conjugates for Cancer Therapy

    PubMed Central

    Ferreras, José M.; Citores, Lucía; Iglesias, Rosario; Jiménez, Pilar; Girbés, Tomás

    2011-01-01

    The type 2 ribosome-inactivating proteins (RIPs) isolated from some species belonging to the Sambucus genus, have the characteristic that although being even more active than ricin inhibiting protein synthesis in cell-free extracts, they lack the high toxicity of ricin and related type 2 RIPs to intact cells and animals. This is due to the fact that after internalization, they follow a different intracellular pathway that does not allow them to reach the cytosolic ribosomes. The lack of toxicity of type 2 RIPs from Sambucus make them good candidates as toxic moieties in the construction of immunotoxins and conjugates directed against specific targets. Up to now they have been conjugated with either transferrin or anti-CD105 to target either transferrin receptor- or endoglin-overexpressing cells, respectively. PMID:22069717

  10. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

    PubMed

    Llanos, Susana; Serrano, Manuel

    2010-10-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

  11. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway

    PubMed Central

    Llanos, Susana; Serrano, Manuel

    2013-01-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage. PMID:20935493

  12. DMR1 (CCM1/YGR150C) of Saccharomyces cerevisiae encodes an RNA-binding protein from the pentatricopeptide repeat family required for the maintenance of the mitochondrial 15S ribosomal RNA.

    PubMed

    Puchta, Olga; Lubas, Michal; Lipinski, Kamil A; Piatkowski, Jakub; Malecki, Michal; Golik, Pawel

    2010-04-01

    Pentatricopeptide repeat (PPR) proteins form the largest known RNA-binding protein family and are found in all eukaryotes, being particularly abundant in higher plants. PPR proteins localize mostly in mitochondria and chloroplasts, where they modulate organellar genome expression on the post-transcriptional level. The Saccharomyces cerevisiae DMR1 (CCM1, YGR150C) encodes a PPR protein that localizes to mitochondria. Deletion of DMR1 results in a complete and irreversible loss of respiratory capacity and loss of wild-type mtDNA by conversion to rho(-)/rho(0) petites, regardless of the presence of introns in mtDNA. The phenotype of the dmr1Delta mitochondria is characterized by fragmentation of the small subunit mitochondrial rRNA (15S rRNA), that can be reversed by wild-type Dmr1p. Other mitochondrial transcripts, including the large subunit mitochondrial rRNA (21S rRNA), are not affected by the lack of Dmr1p. The purified Dmr1 protein specifically binds to different regions of 15S rRNA in vitro, consistent with the deletion phenotype. Dmr1p is therefore the first yeast PPR protein, which has an rRNA target and is probably involved in the biogenesis of mitochondrial ribosomes and translation.

  13. Sublethal effects of imidacloprid on targeting muscle and ribosomal protein related genes in the honey bee Apis mellifera L.

    PubMed

    Wu, Yan-Yan; Luo, Qi-Hua; Hou, Chun-Sheng; Wang, Qiang; Dai, Ping-Li; Gao, Jing; Liu, Yong-Jun; Diao, Qing-Yun

    2017-11-21

    A sublethal concentration of imidacloprid can cause chronic toxicity in bees and can impact the behavior of honey bees. The nectar- and water-collecting, and climbing abilities of bees are crucial to the survival of the bees and the execution of responsibilities in bee colonies. Besides behavioral impact, data on the molecular mechanisms underlying the toxicity of imidacloprid, especially by the way of RNA-seq at the transcriptomic level, are limited. We treated Apis mellifera L. with sublethal concentrations of imidacloprid (0.1, 1 and 10 ppb) and determined the effect on behaviors and the transcriptomic changes. The sublethal concentrations of imidacloprid had a limited impact on the survival and syrup consumption of bees, but caused a significant increase in water consumption. Moreover, the climbing ability was significantly impaired by 10 ppb imidacloprid at 8 d. In the RNA-seq analysis, gene ontology (GO) term enrichment indicated a significant down-regulation of muscle-related genes, which might contribute to the impairment in climbing ability of bees. The enriched GO terms were attributed to the up-regulated ribosomal protein genes. Considering the ribosomal and extra-ribosomal functions of the ribosomal proteins, we hypothesized that imidacloprid also causes cell dysfunction. Our findings further enhance the understanding of imidacloprid sublethal toxicity.

  14. Efficient Cleavage of Ribosome-Associated Poly(A)-Binding Protein by Enterovirus 3C Protease

    PubMed Central

    Kuyumcu-Martinez, N. Muge; Joachims, Michelle; Lloyd, Richard E.

    2002-01-01

    Poliovirus (PV) causes a rapid and drastic inhibition of host cell cap-dependent protein synthesis during infection while preferentially allowing cap-independent translation of its own genomic RNA via an internal ribosome entry site element. Inhibition of cap-dependent translation is partly mediated by cleavage of an essential translation initiation factor, eIF4GI, during PV infection. In addition to cleavage of eIF4GI, cleavage of eIF4GII and poly(A)-binding protein (PABP) has been recently proposed to contribute to complete host translation shutoff; however, the relative importance of eIF4GII and PABP cleavage has not been determined. At times when cap-dependent translation is first blocked during infection, only 25 to 35% of the total cellular PABP is cleaved; therefore, we hypothesized that the pool of PABP associated with polysomes may be preferentially targeted by viral proteases. We have investigated what cleavage products of PABP are produced in vivo and the substrate determinants for cleavage of PABP by 2A protease (2Apro) or 3C protease (3Cpro). Our results show that PABP in ribosome-enriched fractions is preferentially cleaved in vitro and in vivo compared to PABP in other fractions. Furthermore, we have identified four N-terminal PABP cleavage products produced during PV infection and have shown that viral 3C protease generates three of the four cleavage products. Also, 3Cpro is more efficient in cleaving PABP in ribosome-enriched fractions than 2Apro in vitro. In addition, binding of PABP to poly(A) RNA stimulates 3Cpro-mediated cleavage and inhibits 2Apro-mediated cleavage. These results suggest that 3Cpro plays a major role in processing PABP during virus infection and that the interaction of PABP with translation initiation factors, ribosomes, or poly(A) RNA may promote its cleavage by viral 2A and 3C proteases. PMID:11836384

  15. S6K1 Is Required for Increasing Skeletal Muscle Force during Hypertrophy.

    PubMed

    Marabita, Manuela; Baraldo, Martina; Solagna, Francesca; Ceelen, Judith Johanna Maria; Sartori, Roberta; Nolte, Hendrik; Nemazanyy, Ivan; Pyronnet, Stéphane; Kruger, Marcus; Pende, Mario; Blaauw, Bert

    2016-10-04

    Loss of skeletal muscle mass and force aggravates age-related sarcopenia and numerous pathologies, such as cancer and diabetes. The AKT-mTORC1 pathway plays a major role in stimulating adult muscle growth; however, the functional role of its downstream mediators in vivo is unknown. Here, we show that simultaneous inhibition of mTOR signaling to both S6K1 and 4E-BP1 is sufficient to reduce AKT-induced muscle growth and render it insensitive to the mTORC1-inhibitor rapamycin. Surprisingly, lack of mTOR signaling to 4E-BP1 only, or deletion of S6K1 alone, is not sufficient to reduce muscle hypertrophy or alter its sensitivity to rapamycin. However, we report that, while not required for muscle growth, S6K1 is essential for maintaining muscle structure and force production. Hypertrophy in the absence of S6K1 is characterized by compromised ribosome biogenesis and the formation of p62-positive protein aggregates. These findings identify S6K1 as a crucial player for maintaining muscle function during hypertrophy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Getting ready to translate: cytoplasmic maturation of eukaryotic ribosomes.

    PubMed

    Panse, Vikram Govind

    2011-01-01

    The ribosome is the 'universal ribozyme' that is responsible for the final step of decoding genetic information into proteins. While the function of the ribosome is being elucidated at the atomic level, in comparison, little is known regarding its assembly in vivo and intracellular transport. In contrast to prokaryotic ribosomes, the construction of eukaryotic ribosomes, which begins in the nucleolus, requires >200 evolutionary conserved non-ribosomal trans-acting factors, which transiently associate with pre-ribosomal subunits at distinct assembly stages and perform specific maturation steps. Notably, pre-ribosomal subunits are transported to the cytoplasm in a functionally inactive state where they undergo maturation prior to entering translation. In this review, I will summarize our current knowledge of the eukaryotic ribosome assembly pathway with emphasis on cytoplasmic maturation events that render pre-ribosomal subunits translation competent.

  17. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

    PubMed

    Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

    1991-09-15

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

  18. Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

    PubMed Central

    Lill, R; Robertson, J M; Wintermeyer, W

    1989-01-01

    A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

  19. MoYvh1 subverts rice defense through functions of ribosomal protein MoMrt4 in Magnaporthe oryzae.

    PubMed

    Liu, Xinyu; Yang, Jie; Qian, Bin; Cai, Yongchao; Zou, Xi; Zhang, Haifeng; Zheng, Xiaobo; Wang, Ping; Zhang, Zhengguang

    2018-04-01

    The accumulation of the reactive oxygen species (ROS) in rice is important in its interaction with the rice blast fungus Magnaporthe oryzae during which the pathogen scavenges ROS through the production of extracellular enzymes that promote blast. We previously characterized the MoYvh1 protein phosphatase from M. oryzae that plays a role in scavenging of ROS. To understand the underlying mechanism, we found that MoYvh1 is translocated into the nucleus following oxidative stress and that this translocation is dependent on MoSsb1 and MoSsz1 that are homologous to heat-shock protein 70 (Hsp70) proteins. In addition, we established a link between MoYvh1 and MoMrt4, a ribosome maturation factor homolog whose function also involves shuttling between the cytoplasm and the nucleus. Moreover, we found that MoYvh1 regulates the production of extracellular proteins that modulate rice-immunity. Taking together, our evidence suggests that functions of MoYvh1 in regulating ROS scavenging require its nucleocytoplasmic shuttling and the partner proteins MoSsb1 and MoSsz1, as well as MoMrt4. Our findings provide novel insights into the mechanism by which M. oryzae responds to and subverts host immunity through the regulation of ribosome biogenesis and protein biosynthesis.

  20. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    PubMed

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  1. Slowing Translation between Protein Domains by Increasing Affinity between mRNAs and the Ribosomal Anti-Shine-Dalgarno Sequence Improves Solubility.

    PubMed

    Vasquez, Kevin A; Hatridge, Taylor A; Curtis, Nicholas C; Contreras, Lydia M

    2016-02-19

    Recent studies have demonstrated that effective protein production requires coordination of multiple cotranslational cellular processes, which are heavily affected by translation timing. Until recently, protein engineering has focused on codon optimization to maximize protein production rates, mostly considering the effect of tRNA abundance. However, as it relates to complex multidomain proteins, it has been hypothesized that strategic translational pauses between domains and between distinct individual structural motifs can prevent interactions between nascent chain fragments that generate kinetically trapped misfolded peptides and thereby enhance protein yields. In this study, we introduce synthetic transient pauses between structural domains in a heterologous model protein based on designed patterns of affinity between the mRNA and the anti-Shine-Dalgarno (aSD) sequence on the ribosome. We demonstrate that optimizing translation attenuation at domain boundaries can predictably affect solubility patterns in bacteria. Exploration of the affinity space showed that modifying less than 1% of the nucleotides (on a small 12 amino acid linker) can vary soluble protein yields up to ∼7-fold without altering the primary sequence of the protein. In the context of longer linkers, where a larger number of distinct structural motifs can fold outside the ribosome, optimal synonymous codon variations resulted in an additional 2.1-fold increase in solubility, relative to that of nonoptimized linkers of the same length. While rational construction of 54 linkers of various affinities showed a significant correlation between protein solubility and predicted affinity, only weaker correlations were observed between tRNA abundance and protein solubility. We also demonstrate that naturally occurring high-affinity clusters are present between structural domains of β-galactosidase, one of Escherichia coli's largest native proteins. Interdomain ribosomal affinity is an important factor

  2. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    PubMed Central

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  3. Translational Control of Hemoglobin Synthesis by an Initiation Factor Required for Recycling of Ribosomes and for their Binding to Messenger RNA

    PubMed Central

    Kaempfer, Raymond; Kaufman, Jennifer

    1972-01-01

    The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325

  4. Ribosomal protein NtRPL17 interacts with kinesin-12 family protein NtKRP and functions in the regulation of embryo/seed size and radicle growth.

    PubMed

    Tian, Shujuan; Wu, Jingjing; Liu, Yuan; Huang, Xiaorong; Li, Fen; Wang, Zhaodan; Sun, Meng-Xiang

    2017-11-28

    We previously reported that a novel motor protein belonging to the kinesin-12 family, NtKRP, displays critical roles in regulating embryo and seed size establishment. However, it remains unknown exactly how NtKRP contributes to this developmental process. Here, we report that a 60S ribosomal protein NtRPL17 directly interacts with NtKRP. The phenotypes of NtRPL17 RNAi lines show notable embryo and seed size reduction. Structural observations of the NtRPL17-silenced embryos/seeds reveal that the embryo size reduction is due to a decrease in cell number. In these embryos, cell division cycle progression is delayed at the G2/M transition. These phenotypes are similar to that in NtKRP-silenced embryos/seeds, indicating that NtKRP and NtRPL17 function as partners in the same regulatory pathway during seed development and specifically regulate cell cycle progression to control embryo/seed size. This work reveals that NtRPL17, as a widely distributed ribosomal protein, plays a critical role in seed development and provides a new clue in the regulation of seed size. Confirmation of the interaction between NtKRP and NtRPL17 and their co-function in the control of the cell cycle also suggests that the mechanism might be conserved in both plants and animals. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  5. Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome

    PubMed Central

    Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.

    2014-01-01

    SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919

  6. Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

    PubMed Central

    Chang, F. N.; Flaks, Joel G.

    1972-01-01

    The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and

  7. Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae.

    PubMed

    Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

    2016-07-27

    In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Direct TFIIA-TFIID Protein Contacts Drive Budding Yeast Ribosomal Protein Gene Transcription*

    PubMed Central

    Layer, Justin H.; Weil, P. Anthony

    2013-01-01

    We have previously shown that yeast TFIID provides coactivator function on the promoters of ribosomal protein-encoding genes (RPGs) by making direct contact with the transactivator repressor activator protein 1 (Rap1). Further, our structural studies of assemblies generated with purified Rap1, TFIID, and TFIIA on RPG enhancer-promoter DNA indicate that Rap1-TFIID interaction induces dramatic conformational rearrangements of enhancer-promoter DNA and TFIID-bound TFIIA. These data indicate a previously unknown yet critical role for yeast TFIIA in the integration of activator-TFIID contacts with promoter conformation and downstream preinitiation complex formation and/or function. Here we describe the use of systematic mutagenesis to define how specific TFIIA contacts contribute to these processes. We have verified that TFIIA is required for RPG transcription in vivo and in vitro, consistent with the existence of a critical Rap1-TFIIA-TFIID interaction network. We also identified essential points of contact for TFIIA and Rap1 within the Rap1 binding domain of the Taf4 subunit of TFIID. These data suggest a mechanism for how interactions between TFIID, TFIIA, and Rap1 contribute to the high rate of transcription initiation seen on RPGs in vivo. PMID:23814059

  9. Protein charge distribution in proteomes and its impact on translation

    PubMed Central

    Requião, Rodrigo D.; Fernandes, Luiza; de Souza, Henrique José Araujo; Rossetto, Silvana; Domitrovic, Tatiana

    2017-01-01

    As proteins are synthesized, the nascent polypeptide must pass through a negatively charged exit tunnel. During this stage, positively charged stretches can interact with the ribosome walls and slow the translation. Therefore, charged polypeptides may be important factors that affect protein expression. To determine the frequency and distribution of positively and negatively charged stretches in different proteomes, the net charge was calculated for every 30 consecutive amino acid residues, which corresponds to the length of the ribosome exit tunnel. The following annotated and reviewed proteins in the UniProt database (Swiss-Prot) were analyzed: 551,705 proteins from different organisms and a total of 180 million protein segments. We observed that there were more negative than positive stretches and that super-charged positive sequences (i.e., net charges ≥ 14) were underrepresented in the proteomes. Overall, the proteins were more positively charged at their N-termini and C-termini, and this feature was present in most organisms and subcellular localizations. To investigate whether the N-terminal charges affect the elongation rates, previously published ribosomal profiling data obtained from S. cerevisiae, without translation-interfering drugs, were analyzed. We observed a nonlinear effect of the charge on the ribosome occupancy in which values ≥ +5 and ≤ -6 showed increased and reduced ribosome densities, respectively. These groups also showed different distributions across 80S monosomes and polysomes. Basic polypeptides are more common within short proteins that are translated by monosomes, whereas negative stretches are more abundant in polysome-translated proteins. These findings suggest that the nascent peptide charge impacts translation and can be one of the factors that regulate translation efficiency and protein expression. PMID:28531225

  10. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    PubMed

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  11. The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

    PubMed Central

    Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

    1989-01-01

    Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of

  12. The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

    PubMed

    Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

    1989-12-11

    Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of

  13. Modular Organization of Residue-Level Contacts Shapes the Selection Pressure on Individual Amino Acid Sites of Ribosomal Proteins.

    PubMed

    Mallik, Saurav; Kundu, Sudip

    2017-04-01

    Understanding the molecular evolution of macromolecular complexes in the light of their structure, assembly, and stability is of central importance. Here, we address how the modular organization of native molecular contacts shapes the selection pressure on individual residue sites of ribosomal complexes. The bacterial ribosomal complex is represented as a residue contact network where nodes represent amino acid/nucleotide residues and edges represent their van der Waals interactions. We find statistically overrepresented native amino acid-nucleotide contacts (OaantC, one amino acid contacts one or multiple nucleotides, internucleotide contacts are disregarded). Contact number is defined as the number of nucleotides contacted. Involvement of individual amino acids in OaantCs with smaller contact numbers is more random, whereas only a few amino acids significantly contribute to OaantCs with higher contact numbers. An investigation of structure, stability, and assembly of bacterial ribosome depicts the involvement of these OaantCs in diverse biophysical interactions stabilizing the complex, including high-affinity protein-RNA contacts, interprotein cooperativity, intersubunit bridge, packing of multiple ribosomal RNA domains, etc. Amino acid-nucleotide constituents of OaantCs with higher contact numbers are generally associated with significantly slower substitution rates compared with that of OaantCs with smaller contact numbers. This evolutionary rate heterogeneity emerges from the strong purifying selection pressure that conserves the respective amino acid physicochemical properties relevant to the stabilizing interaction with OaantC nucleotides. An analysis of relative molecular orientations of OaantC residues and their interaction energetics provides the biophysical ground of purifying selection conserving OaantC amino acid physicochemical properties. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and

  14. Oxidative stress damages rRNA inside the ribosome and differentially affects the catalytic center

    PubMed Central

    Willi, Jessica; Küpfer, Pascal; Evéquoz, Damien; Fernandez, Guillermo; Polacek, Norbert

    2018-01-01

    Abstract Intracellular levels of reactive oxygen species (ROS) increase as a consequence of oxidative stress and represent a major source of damage to biomolecules. Due to its high cellular abundance RNA is more frequently the target for oxidative damage than DNA. Nevertheless the functional consequences of damage on stable RNA are poorly understood. Using a genome-wide approach, based on 8-oxo-guanosine immunoprecipitation, we present evidence that the most abundant non-coding RNA in a cell, the ribosomal RNA (rRNA), is target for oxidative nucleobase damage by ROS. Subjecting ribosomes to oxidative stress, we demonstrate that oxidized 23S rRNA inhibits the ribosome during protein biosynthesis. Placing single oxidized nucleobases at specific position within the ribosome's catalytic center by atomic mutagenesis resulted in markedly different functional outcomes. While some active site nucleobases tolerated oxidative damage well, oxidation at others had detrimental effects on protein synthesis by inhibiting different sub-steps of the ribosomal elongation cycle. Our data provide molecular insight into the biological consequences of RNA oxidation in one of the most central cellular enzymes and reveal mechanistic insight on the role of individual active site nucleobases during translation. PMID:29309687

  15. Verification of Ribosomal Proteins of Aspergillus fumigatus for Use as Biomarkers in MALDI-TOF MS Identification.

    PubMed

    Nakamura, Sayaka; Sato, Hiroaki; Tanaka, Reiko; Yaguchi, Takashi

    2016-01-01

    We have previously proposed a rapid identification method for bacterial strains based on the profiles of their ribosomal subunit proteins (RSPs), observed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). This method can perform phylogenetic characterization based on the mass of housekeeping RSP biomarkers, ideally calculated from amino acid sequence information registered in public protein databases. With the aim of extending its field of application to medical mycology, this study investigates the actual state of information of RSPs of eukaryotic fungi registered in public protein databases through the characterization of ribosomal protein fractions extracted from genome-sequenced Aspergillus fumigatus strains Af293 and A1163 as a model. In this process, we have found that the public protein databases harbor problems. The RSP names are in confusion, so we have provisionally unified them using the yeast naming system. The most serious problem is that many incorrect sequences are registered in the public protein databases. Surprisingly, more than half of the sequences are incorrect, due chiefly to mis-annotation of exon/intron structures. These errors could be corrected by a combination of in silico inspection by sequence homology analysis and MALDI-TOF MS measurements. We were also able to confirm conserved post-translational modifications in eleven RSPs. After these verifications, the masses of 31 expressed RSPs under 20,000 Da could be accurately confirmed. These RSPs have a potential to be useful biomarkers for identifying clinical isolates of A. fumigatus .

  16. Genome-Wide Identification and Comprehensive Expression Profiling of Ribosomal Protein Small Subunit (RPS) Genes and their Comparative Analysis with the Large Subunit (RPL) Genes in Rice

    PubMed Central

    Saha, Anusree; Das, Shubhajit; Moin, Mazahar; Dutta, Mouboni; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

    2017-01-01

    Ribosomal proteins (RPs) are indispensable in ribosome biogenesis and protein synthesis, and play a crucial role in diverse developmental processes. Our previous studies on Ribosomal Protein Large subunit (RPL) genes provided insights into their stress responsive roles in rice. In the present study, we have explored the developmental and stress regulated expression patterns of Ribosomal Protein Small (RPS) subunit genes for their differential expression in a spatiotemporal and stress dependent manner. We have also performed an in silico analysis of gene structure, cis-elements in upstream regulatory regions, protein properties and phylogeny. Expression studies of the 34 RPS genes in 13 different tissues of rice covering major growth and developmental stages revealed that their expression was substantially elevated, mostly in shoots and leaves indicating their possible involvement in the development of vegetative organs. The majority of the RPS genes have manifested significant expression under all abiotic stress treatments with ABA, PEG, NaCl, and H2O2. Infection with important rice pathogens, Xanthomonas oryzae pv. oryzae (Xoo) and Rhizoctonia solani also induced the up-regulation of several of the RPS genes. RPS4, 13a, 18a, and 4a have shown higher transcript levels under all the abiotic stresses, whereas, RPS4 is up-regulated in both the biotic stress treatments. The information obtained from the present investigation would be useful in appreciating the possible stress-regulatory attributes of the genes coding for rice ribosomal small subunit proteins apart from their functions as house-keeping proteins. A detailed functional analysis of independent genes is required to study their roles in stress tolerance and generating stress- tolerant crops. PMID:28966624

  17. Molecular mechanisms of ribosomal protein gene coregulation

    PubMed Central

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B. Franklin

    2015-01-01

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20–50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1–TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  18. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. © 2015 Reja et al.; Published by Cold Spring Harbor Laboratory Press.

  19. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

    PubMed Central

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-01

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

  20. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    PubMed

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  1. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP)

    PubMed Central

    Kamina, Anyango D.; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains’ interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP. PMID:28542332

  2. The Circadian Clock Coordinates Ribosome Biogenesis

    PubMed Central

    Symul, Laura; Martin, Eva; Atger, Florian; Naef, Felix; Gachon, Frédéric

    2013-01-01

    Biological rhythms play a fundamental role in the physiology and behavior of most living organisms. Rhythmic circadian expression of clock-controlled genes is orchestrated by a molecular clock that relies on interconnected negative feedback loops of transcription regulators. Here we show that the circadian clock exerts its function also through the regulation of mRNA translation. Namely, the circadian clock influences the temporal translation of a subset of mRNAs involved in ribosome biogenesis by controlling the transcription of translation initiation factors as well as the clock-dependent rhythmic activation of signaling pathways involved in their regulation. Moreover, the circadian oscillator directly regulates the transcription of ribosomal protein mRNAs and ribosomal RNAs. Thus the circadian clock exerts a major role in coordinating transcription and translation steps underlying ribosome biogenesis. PMID:23300384

  3. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  4. A non-catalytic role for inositol 1,3,4,5,6-pentakisphosphate 2-kinase in the synthesis of ribosomal RNA

    PubMed Central

    Brehm, Maria A.; Wundenberg, Torsten; Williams, Jason; Mayr, Georg W.; Shears, Stephen B.

    2013-01-01

    Summary Fundamental to the life and destiny of every cell is the regulation of protein synthesis through ribosome biogenesis, which begins in the nucleolus with the production of ribosomal RNA (rRNA). Nucleolar organization is a highly dynamic and tightly regulated process; the structural factors that direct nucleolar assembly and disassembly are just as important in controlling rRNA synthesis as are the catalytic activities that synthesize rRNA. Here, we report that a signaling enzyme, inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5K) is also a structural component in the nucleolus. We demonstrate that IP5K has functionally significant interactions with three proteins that regulate rRNA synthesis: protein kinase CK2, TCOF1 and upstream-binding-factor (UBF). Through molecular modeling and mutagenic studies, we identified an Arg-Lys-Lys tripeptide located on the surface of IP5K that mediates its association with UBF. Nucleolar IP5K spatial dynamics were sensitive to experimental procedures (serum starvation or addition of actinomycin D) that inhibited rRNA production. We show that IP5K makes stoichiometrically sensitive contributions to the architecture of the nucleoli in intact cells, thereby influencing the degree of rRNA synthesis. Our study adds significantly to the biological significance of IP5K; previously, it was the kinase activity of this protein that had attracted attention. Our demonstration that IP5K ‘moonlights’ as a molecular scaffold offers an unexpected new example of how the biological sophistication of higher organisms can arise from gene products acquiring multiple functions, rather than by an increase in gene number. PMID:23203802

  5. A non-catalytic role for inositol 1,3,4,5,6-pentakisphosphate 2-kinase in the synthesis of ribosomal RNA.

    PubMed

    Brehm, Maria A; Wundenberg, Torsten; Williams, Jason; Mayr, Georg W; Shears, Stephen B

    2013-01-15

    Fundamental to the life and destiny of every cell is the regulation of protein synthesis through ribosome biogenesis, which begins in the nucleolus with the production of ribosomal RNA (rRNA). Nucleolar organization is a highly dynamic and tightly regulated process; the structural factors that direct nucleolar assembly and disassembly are just as important in controlling rRNA synthesis as are the catalytic activities that synthesize rRNA. Here, we report that a signaling enzyme, inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5K) is also a structural component in the nucleolus. We demonstrate that IP5K has functionally significant interactions with three proteins that regulate rRNA synthesis: protein kinase CK2, TCOF1 and upstream-binding-factor (UBF). Through molecular modeling and mutagenic studies, we identified an Arg-Lys-Lys tripeptide located on the surface of IP5K that mediates its association with UBF. Nucleolar IP5K spatial dynamics were sensitive to experimental procedures (serum starvation or addition of actinomycin D) that inhibited rRNA production. We show that IP5K makes stoichiometrically sensitive contributions to the architecture of the nucleoli in intact cells, thereby influencing the degree of rRNA synthesis. Our study adds significantly to the biological significance of IP5K; previously, it was the kinase activity of this protein that had attracted attention. Our demonstration that IP5K 'moonlights' as a molecular scaffold offers an unexpected new example of how the biological sophistication of higher organisms can arise from gene products acquiring multiple functions, rather than by an increase in gene number.

  6. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    PubMed

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  7. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana

    PubMed Central

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L.; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    ABSTRACT Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast. PMID:26980300

  8. DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.

    PubMed

    Lafuente, M J; Gamo, F J; Gancedo, C

    1996-09-01

    We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.

  9. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    PubMed

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  10. Expression, purification, and evaluation for anticancer activity of ribosomal protein L31 gene (RPL31) from the giant panda (Ailuropoda melanoleuca).

    PubMed

    Su, Xiu-Lan; Hou, Yi-Ling; Yan, Xiang-Hui; Ding, Xiang; Hou, Wan-Ru; Sun, Bing; Zhang, Si-Nan

    2012-09-01

    Ribosomal protein L31 gene is a component of the 60S large ribosomal subunit encoded by RPL31 gene, while ribosomal protein L31 (RPL31) is an important constituent of peptidyltransferase center. In our research, the cDNA and the genomic sequence of RPL31 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology respectively, following sequencing and analyzing preliminarily. We constructed a recombinant expression vector contained RPL31 cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product was purified to obtain recombinant protein of RPL31 from the giant panda. Recombinant protein of RPL31 obtained from the experiment acted on human laryngeal carcinoma Hep-2 and human hepatoma HepG-2 cells for study of its anti-cancer activity by MTT [3-(4, 5-dimehyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide] method. Then observe these cells growth depressive effect. The result indicated that the cDNA fragment of the RPL31 cloned from the giant panda is 419 bp in size, containing an open reading frame of 378 bp, and deduced protein was composed of 125 amino acids with an estimated molecular weight of 14.46-kDa and PI of 11.21. The length of the genomic sequence is 8,091 bp, which was found to possess four exons and three introns. The RPL31 gene can be readily expressed in E.coli, expecting 18-kDa polypeptide that formed inclusion bodies. Recombinant protein RPL31 from the giant panda consists of 157 amino acids with an estimated molecular weight of 17.86 kDa and PI of 10.77. The outcomes showed that the cell growth inhibition rate in a time- and dose-dependent on recombinant protein RPL31. And also indicated that the effect at low concentrations was better than high concentrations on Hep-2 cells, and the concentration of 0.33 μg/mL had the best rate of growth inhibition, 44 %. Consequently, our study aimed at revealing the recombinant protein RPL31 anti-cancer function from the giant panda

  11. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    PubMed Central

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  12. Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

    PubMed Central

    Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

    1981-01-01

    The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

  13. Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

    PubMed

    Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

    2014-08-01

    In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

    PubMed Central

    Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix

    2014-01-01

    In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

  15. A mixed group II/group III twintron in the Euglena gracilis chloroplast ribosomal protein S3 gene: evidence for intron insertion during gene evolution.

    PubMed Central

    Copertino, D W; Christopher, D A; Hallick, R B

    1991-01-01

    The splicing of a 409 nucleotide intron from the Euglena gracilis chloroplast ribosomal protein S3 gene (rps3) was examined by cDNA cloning and sequencing, and northern hybridization. Based on the characterization of a partially spliced pre-mRNA, the intron was characterized as a 'mixed' twintron, composed of a 311 nucleotide group II intron internal to a 98 nucleotide group III intron. Twintron excision is via a 2-step sequential splicing pathway, with removal of the internal group II intron preceding excision of the external group III intron. Based on secondary structural analysis of the twintron, we propose that group III introns may represent highly degenerate versions of group II introns. The existence of twintrons is interpreted as evidence that group II introns were inserted during the evolution of Euglena chloroplast genes from a common ancestor with eubacteria, archaebacteria, cyanobacteria, and other chloroplasts. Images PMID:1721702

  16. Expanding the ribosomal universe.

    PubMed

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  17. Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach

    NASA Astrophysics Data System (ADS)

    Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.

    2012-10-01

    In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.

  18. Cryo-EM structure of a late pre-40S ribosomal subunit from Saccharomyces cerevisiae

    PubMed Central

    Schmidt, Christian; Berninghausen, Otto; Becker, Thomas

    2017-01-01

    Mechanistic understanding of eukaryotic ribosome formation requires a detailed structural knowledge of the numerous assembly intermediates, generated along a complex pathway. Here, we present the structure of a late pre-40S particle at 3.6 Å resolution, revealing in molecular detail how assembly factors regulate the timely folding of pre-18S rRNA. The structure shows that, rather than sterically blocking 40S translational active sites, the associated assembly factors Tsr1, Enp1, Rio2 and Pno1 collectively preclude their final maturation, thereby preventing untimely tRNA and mRNA binding and error prone translation. Moreover, the structure explains how Pno1 coordinates the 3’end cleavage of the 18S rRNA by Nob1 and how the late factor’s removal in the cytoplasm ensures the structural integrity of the maturing 40S subunit. PMID:29155690

  19. Sex- and Age-Related Differences in Ribosomal Proteins L17 and L37, as well as Androgen Receptor Protein, in the Song Control System of Zebra Finches

    PubMed Central

    Tang, Yu Ping; Wade, Juli

    2010-01-01

    The zebra finch song system is sexually dimorphic – only males sing, and the morphology of forebrain regions controlling the learning and production of this song is greatly enhanced in males compared to females. Masculinization appears to involve effects of steroid hormones as well as other factors, perhaps including the expression of sex chromosome genes (males: ZZ, females: ZW). The present study investigated three proteins – two encoded by Z-linked genes, ribosomal proteins L17 and L37 (RPL 17 and RPL37), including their co-localization with androgen receptor (AR), from post-hatching day 25 to adulthood. Extensive co-expression of AR with the ribosomal proteins was detected in the three song nuclei investigated (HVC, RA, and Area X) across these ages. In general, more cells expressed each of these proteins in males compared to females, and the sex differences increased as animals matured. Specific patterns differed across regions and between RPL17 and RPL37, which suggest potential roles of one or both of these proteins in the incorporation and/or differentiation of song system cells. PMID:20933575

  20. Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

    PubMed

    Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

    2015-03-20

    Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.