Atomic Force Microscope (AFM) measurements and analysis on Sagem 05R0025 secondary substrate
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soufli, R; Baker, S L; Robinson, J C
2006-02-22
The summary of Atomic Force Microscope (AFM) on Sagem 05R0025 secondary substrate: (1) 2 x 2 {micro}m{sup 2} and 10 x 10 {micro}m{sup 2} AFM measurements and analysis on Sagem 05R0025 secondary substrate at LLNL indicate rather uniform and extremely isotropic finish across the surface, with high-spatial frequency roughness {sigma} in the range 5.1-5.5 {angstrom} rms; (2) the marked absence of pronounced long-range polishing marks in any direction, combined with increased roughness in the very high spatial frequencies, are consistent with ion-beam polishing treatment on the surface. These observations are consistent with all earlier mirrors they measured from the samemore » vendor; and (3) all data were obtained with a Digital Instruments Dimension 5000{trademark} atomic force microscope.« less
Space optics technology at SAGEM
NASA Astrophysics Data System (ADS)
Geyl, Roland; Thepaut, Luc
2017-11-01
Space optics is continuously pushing its suppliers like SAGEM towards new limits. In this paper, latest developments of state of the art space optical equipment will be presented through SAGEM, and its REOSC Products family, contribution to several projects presently running in the company.
EUV near normal incidence collector development at SAGEM
NASA Astrophysics Data System (ADS)
Mercier Ythier, R.; Bozec, X.; Geyl, R.; Rinchet, A.; Hecquet, Christophe; Ravet-Krill, Marie-Françoise; Delmotte, Franck; Sassolas, Benoît; Flaminio, Raffaele; Mackowski, Jean-Marie; Michel, Christophe; Montorio, Jean-Luc; Morgado, Nazario; Pinard, Laurent; Roméo, Elodie
2008-03-01
Through its participation to European programs, SAGEM has worked on the design and manufacturing of normal incidence collectors for EUV sources. By opposition to grazing incidence, normal incidence collectors are expected to collect more light with a simpler and cheaper design. Designs are presented for the two current types of existing sources: Discharge Produced Plasma (DPP) and Laser Produced Plasma (LPP). Collection efficiency is calculated in both cases. It is shown that these collectors can achieve about 10 % efficiency for DPP sources and 40 % for LPP sources. SAGEM works on the collectors manufacturability are also presented, including polishing, coating and cooling. The feasibility of polishing has been demonstrated with a roughness better than 2 angstroms obtained on several materials (glass, silicon, Silicon Carbide, metals...). SAGEM is currently working with the Institut d'Optique and the Laboratoire des Materiaux Avancés on the design and the process of EUV coatings for large mirrors. Lastly, SAGEM has studied the design and feasibility of an efficient thermal control, based on a liquid cooling through slim channels machined close to the optical surface.
Recent developments for Astronomy at SAGEM
NASA Astrophysics Data System (ADS)
Geyl, Roland
2003-02-01
SAGEM, through its REOSC product line, is offering a high skill of optics design fabrication and assembly to the astronomical community. Beside large projects like ESO VLT, SOFIA or the Spain GTC, SAGEM is continuously active with smaller projects. In this paper, we will present our recent work in the field of thin films with mirror broadband and durable coating and large area filters for multimegapixel camera. Latest results of Sofia primary mirror integration will be presented. Work on large prime focus correctors like the one of CFHT MegaPrime and the SALT Spherical Aberration Corrector. For space astronomy it is our new activity of mold smoothing for large telecom antenna or submillimeter reflectors that will be presented.
Thermoelectric Properties of the Homologous Compounds Pb5Bi6Se14- x I x ( x = 0.0, 0.025, and 0.05)
NASA Astrophysics Data System (ADS)
Sassi, S.; Candolfi, C.; Dauscher, A.; Lenoir, B.
2018-06-01
Homologous compounds represent an interesting platform for design of new thermoelectric materials. We report herein on synthesis, structural and chemical characterizations, and high-temperature (300 K to 700 K) transport properties measurements of Pb5Bi6Se14- x I x ( x = 0.0, 0.025, and 0.05) homologous compounds. Successful insertion of iodine into the crystal structure of Pb5Bi6Se14 was confirmed by its influence on the transport properties. The doping effectiveness of iodine was demonstrated by the increase in the electron concentration, resulting in more pronounced metallic character of transport with respect to undoped Pb5Bi6Se14. The peak ZT value of 0.5, which was achieved at 700 K in the x = 0.025 sample, remains similar to that obtained in Pb5Bi6Se14.
NASA Astrophysics Data System (ADS)
Lakhani, Archana; Kushwaha, Pallavi; Rawat, R.; Kumar, Kranti; Banerjee, A.; Chaddah, P.
2010-01-01
Glass-like arrest has recently been reported in various magnetic materials. As in structural glasses, the kinetics of a first order transformation is arrested while retaining the higher entropy phase as a non-ergodic state. We show visual mesoscopic evidence of the irreversible transformation of the arrested antiferromagnetic-insulating phase in Pr0.5Ca0.5Mn0.975Al0.025O3 to its equilibrium ferromagnetic-metallic phase with an isothermal increase of magnetic field, similar to its iso-field transformation on warming. The magnetic field dependence of the non-equilibrium to equilibrium transformation temperature is shown to be governed by Le Chatelier's principle.
NASA Astrophysics Data System (ADS)
Duclos, D.; Lonnoy, J.; Guillerm, Q.; Jurie, F.; Herbin, S.; D'Angelo, E.
2008-04-01
Over the five past years, the computer vision community has explored many different avenues of research for Automatic Target Recognition. Noticeable advances have been made and we are now in the situation where large-scale evaluations of ATR technologies have to be carried out, to determine what the limitations of the recently proposed methods are and to determine the best directions for future works. ROBIN, which is a project funded by the French Ministry of Defence and by the French Ministry of Research, has the ambition of being a new reference for benchmarking ATR algorithms in operational contexts. This project, headed by major companies and research centers involved in Computer Vision R&D in the field of Defense (Bertin Technologies, CNES, ECA, DGA, EADS, INRIA, ONERA, MBDA, SAGEM, THALES) recently released a large dataset of several thousands of hand-annotated infrared and RGB images of different targets in different situations. Setting up an evaluation campaign requires us to define, accurately and carefully, sets of data (both for training ATR algorithms and for their evaluation), tasks to be evaluated, and finally protocols and metrics for the evaluation. ROBIN offers interesting contributions to each one of these three points. This paper first describes, justifies and defines the set of functions used in the ROBIN competitions and relevant for evaluating ATR algorithms (Detection, Localization, Recognition and Identification). It also defines the metrics and the protocol used for evaluating these functions. In the second part of the paper, the results obtained by several state-of-the-art algorithms on the SAGEM DS database (a subpart of ROBIN) are presented and discussed
NASA Astrophysics Data System (ADS)
Duclos, D.; Lonnoy, J.; Guillerm, Q.; Jurie, F.; Herbin, S.; D'Angelo, E.
2008-04-01
The last five years have seen a renewal of Automatic Target Recognition applications, mainly because of the latest advances in machine learning techniques. In this context, large collections of image datasets are essential for training algorithms as well as for their evaluation. Indeed, the recent proliferation of recognition algorithms, generally applied to slightly different problems, make their comparisons through clean evaluation campaigns necessary. The ROBIN project tries to fulfil these two needs by putting unclassified datasets, ground truths, competitions and metrics for the evaluation of ATR algorithms at the disposition of the scientific community. The scope of this project includes single and multi-class generic target detection and generic target recognition, in military and security contexts. From our knowledge, it is the first time that a database of this importance (several hundred thousands of visible and infrared hand annotated images) has been publicly released. Funded by the French Ministry of Defence (DGA) and by the French Ministry of Research, ROBIN is one of the ten Techno-vision projects. Techno-vision is a large and ambitious government initiative for building evaluation means for computer vision technologies, for various application contexts. ROBIN's consortium includes major companies and research centres involved in Computer Vision R&D in the field of defence: Bertin Technologies, CNES, ECA, DGA, EADS, INRIA, ONERA, MBDA, SAGEM, THALES. This paper, which first gives an overview of the whole project, is focused on one of ROBIN's key competitions, the SAGEM Defence Security database. This dataset contains more than eight hundred ground and aerial infrared images of six different vehicles in cluttered scenes including distracters. Two different sets of data are available for each target. The first set includes different views of each vehicle at close range in a "simple" background, and can be used to train algorithms. The second set
NASA Technical Reports Server (NTRS)
2005-01-01
KENNEDY SPACE CENTER, FLA. A tugboat tows the barge carrying the newly redesigned External Tank, designated for use on Return to Flight mission STS-114, to the dock at the Launch Complex 39 Area Turn Basin at Kennedy. The barge arrived after an approximately 900-mile journey at sea from the Michoud Assembly Facility in New Orleans. It left the facility Dec. 31 on the Pegasus, NASAs specially designed barge, towed by Solid Rocket Booster retrieval ship Liberty Star. At Port Canaveral, the barge was then hooked up to the tugs for the last part of the journey to the Launch Complex 39 Area Turn Basin at Kennedy. Next, the External Tank will be off-loaded from the barge and transported to the Vehicle Assembly Building for its final checkout and mating to the twin Solid Rocket Boosters and orbiter Discovery. NASA and Lockheed Martin Corp. spent nearly two years modifying the 15-story, bronze-colored tank to make it safer for liftoff. Among dozens of changes is a redesigned forward bipod fitting -- a design that meets the recommendation of the Columbia Accident Investigation Board to reduce the risk to the Space Shuttle from falling debris during ascent. STS-114 is targeted for a launch opportunity beginning in May. The seven-member Discovery crew will fly to the International Space Station primarily to test and evaluate new procedures for flight safety, including Space Shuttle inspection and repair techniques.
Dielectric and impedance properties of NiFe1.95R0.05O4 (R = Y, Yb and Lu)
NASA Astrophysics Data System (ADS)
Ugendar, Kodam; Kumar, Hanuma; Markaneyulu, G.; Rani, G. Neeraja
2018-04-01
The dielectric and impedance spectroscopic properties of NiFe1.95R0.05O4 (R = Y, Yb and Lu) were investigated. The materials were prepared by solid state reaction and crystallized in the cubic inverse spinel phase with a very small amount additional phase of RFeO3 (R = Y, Yb and Lu) as secondary phase. The scanning electron micrograph images clearly show grains (˜2μm) which are separated by thin grain boundaries. The presences of all elements were confirmed by the energy dispersive X-ray elemental mapping. The frequency variation of ɛ' shows the dispersion, following the Koop's phenomenological theory, which considers the dielectric structure as an inhomogeneous medium of two-layers of the Maxwell-Wagner type. Impedance spectroscopic analysis indicates the different relaxation mechanisms, which corresponds to bulk grain and grain-boundaries. Their contributions to the electrical conductivity and capacitance of these materials were discussed in detailed.
Intracellular calcium release through IP3R or RyR contributes to secondary axonal degeneration.
Orem, Ben C; Pelisch, Nicolas; Williams, Joshua; Nally, Jacqueline M; Stirling, David P
2017-10-01
Severed CNS axons often retract or dieback away from the injury site and fail to regenerate. The precise mechanisms underlying acute axonal dieback and secondary axonal degeneration remain poorly understood. Here we investigate the role of Ca 2+ store mediated intra-axonal Ca 2+ release in acute axonal dieback and secondary axonal degeneration. To differentiate between primary (directly transected) and "bystander" axonal injury (axons spared by the initial injury but then succumb to secondary degeneration) in real-time we use our previously published highly focal laser-induced spinal cord injury (LiSCI) ex vivo model. Ascending spinal cord dorsal column axons that express YFP were severed using an 800 nm laser pulse while being imaged continuously using two-photon excitation microscopy. We inhibited two major intra-axonal Ca 2+ store channels, ryanodine receptors (RyR) and IP 3 R, with ryanodine or 2-APB, respectively, to individually determine their role in axonal dieback and secondary axonal degeneration. Each antagonist was dissolved in artificial CSF and applied 1h post-injury alone or in combination, and continuously perfused for the remainder of the imaging session. Initially following LiSCI, transected axons retracted equal distances both distal and proximal to the lesion. However, by 4h after injury, the distal axonal segments that are destined for Wallerian degeneration had significantly retracted further than their proximal counterparts. We also found that targeting either RyR or IP 3 R using pharmacological and genetic approaches significantly reduced proximal axonal dieback and "bystander" secondary degeneration of axons compared to vehicle controls at 6h post-injury. Combined treatment effects on secondary axonal degeneration were similar to either drug in isolation. Together, these results suggest that intra-axonal Ca 2+ store mediated Ca 2+ release through RyR or IP 3 R contributes to secondary axonal degeneration following SCI. Copyright © 2017
R-chie: a web server and R package for visualizing RNA secondary structures
Lai, Daniel; Proctor, Jeff R.; Zhu, Jing Yun A.; Meyer, Irmtraud M.
2012-01-01
Visually examining RNA structures can greatly aid in understanding their potential functional roles and in evaluating the performance of structure prediction algorithms. As many functional roles of RNA structures can already be studied given the secondary structure of the RNA, various methods have been devised for visualizing RNA secondary structures. Most of these methods depict a given RNA secondary structure as a planar graph consisting of base-paired stems interconnected by roundish loops. In this article, we present an alternative method of depicting RNA secondary structure as arc diagrams. This is well suited for structures that are difficult or impossible to represent as planar stem-loop diagrams. Arc diagrams can intuitively display pseudo-knotted structures, as well as transient and alternative structural features. In addition, they facilitate the comparison of known and predicted RNA secondary structures. An added benefit is that structure information can be displayed in conjunction with a corresponding multiple sequence alignments, thereby highlighting structure and primary sequence conservation and variation. We have implemented the visualization algorithm as a web server R-chie as well as a corresponding R package called R4RNA, which allows users to run the software locally and across a range of common operating systems. PMID:22434875
Bassan, Milan S; Sundaralingam, Praka; Fanning, Scott B; Lau, James; Menon, Jayaram; Ong, Evan; Rerknimitr, Rungsun; Seo, Dong-Wan; Teo, Eng Kiong; Wang, Hsiu-Po; Reddy, D Nageshwar; Goh, Khean Lee; Bourke, Michael J
2018-06-01
Wire-guided biliary cannulation has been demonstrated to improve cannulation rates and reduce post-ERCP pancreatitis (PEP), but the impact of wire caliber has not been studied. This study compares successful cannulation rates and ERCP adverse events by using a 0.025-inch and 0.035-inch guidewire. A randomized, single blinded, prospective, multicenter trial at 9 high-volume tertiary-care referral centers in the Asia-Pacific region was performed. Patients with an intact papilla and conventional anatomy who did not have malignancy in the head of the pancreas or ampulla and were undergoing ERCP were recruited. ERCP was performed by using a standardized cannulation algorithm, and patients were randomized to either a 0.025-inch or 0.035-inch guidewire. The primary outcomes of the study were successful wire-guided cannulation and the incidence of PEP. Overall successful cannulation and ERCP adverse events also were studied. A total of 710 patients were enrolled in the study. The primary wire-guided biliary cannulation rate was similar in 0.025-inch and 0.035-inch wire groups (80.7% vs 80.3%; P = .90). The rate of PEP between the 0.025-inch and the 0.035-inch wire groups did not differ significantly (7.8% vs 9.3%; P = .51). No differences were noted in secondary outcomes. Similar rates of successful cannulation and PEP were demonstrated in the use of 0.025-inch and 0.035-inch guidewires. (Clinical trial registration number: NCT01408264.). Copyright © 2018. Published by Elsevier Inc.
Kitamura, Katsuya; Yamamiya, Akira; Ishii, Yu; Sato, Yoshiki; Iwata, Tomoyuki; Nomoto, Tomohiro; Ikegami, Akitoshi; Yoshida, Hitoshi
2015-01-01
AIM: To compare the clinical outcomes between 0.025-inch and 0.035-inch guide wires (GWs) when used in wire-guided cannulation (WGC). METHODS: A single center, randomized study was conducted between April 2011 and March 2013. This study was approved by the Medical Ethics Committee at our hospital. Informed, written consent was obtained from each patient prior to study enrollment. Three hundred and twenty-two patients with a naïve papilla of Vater who underwent endoscopic retrograde cholangiopancreatography (ERCP) for the purpose of selective bile duct cannulation with WGC were enrolled in this study. Fifty-three patients were excluded based on the exclusion criteria, and 269 patients were randomly allocated to two groups by a computer and analyzed: the 0.025-inch GW group (n = 109) and the 0.035-inch GW group (n = 160). The primary endpoint was the success rate of selective bile duct cannulation with WGC. Secondary endpoints were the success rates of the pancreatic GW technique and precutting, selective bile duct cannulation time, ERCP procedure time, the rate of pancreatic duct stent placement, the final success rate of selective bile duct cannulation, and the incidence of post-ERCP pancreatitis (PEP). RESULTS: The primary success rates of selective bile duct cannulation with WGC were 80.7% (88/109) and 86.3% (138/160) for the 0.025-inch and the 0.035-inch groups, respectively (P = 0.226). There were no statistically significant differences in the success rates of selective bile duct cannulation using the pancreatic duct GW technique (46.7% vs 52.4% for the 0.025-inch and 0.035-inch groups, respectively; P = 0.884) or in the success rates of selective bile duct cannulation using precutting (66.7% vs 63.6% for the 0.025-inch and 0.035-inch groups, respectively; P = 0.893). The final success rates for selective bile duct cannulation using these procedures were 92.7% (101/109) and 97.5% (156/160) for the 0.025-inch and 0.035-inch groups, respectively (P = 0
Co-doping of (Bi(0.5)Na(0.5))TiO(3): secondary phase formation and lattice site preference of Co.
Schmitt, V; Staab, T E M
2012-11-14
Bismuth sodium titanate (Bi(0.5)Na(0.5))TiO(3) (BNT) is considered to be one of the most promising lead-free alternatives to piezoelectric lead zirconate titanate (PZT). However, the effect of dopants on the material has so far received little attention from an atomic point of view. In this study we investigated the effects of cobalt-doping on the formation of additional phases and determined the preferred lattice site of cobalt in BNT. The latter was achieved by comparing the measured x-ray absorption near-edge structure (XANES) spectra to numerically calculated spectra of cobalt on various lattice sites in BNT. (Bi(0.5)Na(0.5))TiO(3) + x mol% Co (x = 0.0, 0.5, 1.0, 2.6) was synthesized via solid state reaction. As revealed by SEM backscattering images, a secondary phase formed in all doped specimens. Using both XRD and SEM-EDX, it was identified as Co(2)TiO(4) for dopant levels >0.5 mol%. In addition, a certain amount of cobalt was incorporated into BNT, as shown by electron probe microanalysis. This amount increased with increasing dopant levels, suggesting that an equilibrium forms together with the secondary phase. The XANES experiments revealed that cobalt occupies the octahedral B-site in the BNT perovskite lattice, substituting Ti and promoting the formation of oxygen vacancies in the material.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Shucai; Li, Eryang; Porth, Ilga
2014-05-23
Poplar has 192 annotated R2R3 MYB genes, of which only three have been shown to play a role in the regulation of secondary cell wall formation. Here we report the characterization of PtrMYB152, a poplar homolog of the Arabidopsis R2R3 MYB transcription factor AtMYB43, in the regulation of secondary cell wall biosynthesis. The expression of PtrMYB152 in secondary xylem is about 18 times of that in phloem. When expressed in Arabidopsis under the control of either 35S or PtrCesA8 promoters, PtrMYB152 increased secondary cell wall thickness, which is likely caused by increased lignification. Accordingly, elevated expression of genes encoding setsmore » of enzymes in secondary wall biosynthesis were observed in transgenic plants expressing PtrMYB152. Arabidopsis protoplast transfection assays suggested that PtrMYB152 functions as a transcriptional activator. Taken together, our results suggest that PtrMYB152 may be part of a regulatory network activating expression of discrete sets of secondary cell wall biosynthesis genes.« less
Electronic and optical properties of La-doped S r3I r2O7 epitaxial thin films
NASA Astrophysics Data System (ADS)
Souri, M.; Terzic, J.; Johnson, J. M.; Connell, J. G.; Gruenewald, J. H.; Thompson, J.; Brill, J. W.; Hwang, J.; Cao, G.; Seo, A.
2018-02-01
We have investigated structural, transport, and optical properties of tensile strained (Sr1-xL ax ) 3I r2O7 (x =0 , 0.025, 0.05) epitaxial thin films. While high-Tc superconductivity is predicted theoretically in the system, we have observed that all of the samples remain insulating with finite optical gap energies and Mott variable-range hopping characteristics in transport. Cross-sectional scanning transmission electron microscopy indicates that structural defects such as stacking faults appear in this system. The insulating behavior of the La-doped S r3I r2O7 thin films is presumably due to disorder-induced localization and ineffective electron doping of La, which brings to light the intriguing difference between epitaxial thin films and bulk single crystals of the iridates.
Structural, magnetic and magnetoreactance studies in NiFe2-xRxO4 (x = 0, 0.05; R = Y, Yb and Lu)
NASA Astrophysics Data System (ADS)
Ugendar, Kodam; Chunchu, Venkatrao; Rani, G. Neeraja; Markaneyulu, G.
2018-04-01
Structural, magnetic and magnetoreactance (mr) properties of NiFe2-xRxO4 (x = 0, 0.05; R = Y, Yb and Lu) compounds were investigated and the results are discussed and presented in this paper. Rietveld refined X-ray diffraction (XRD) patterns and Raman spectroscopy revealed the cubic inverse spinel phase for all the compounds investigated. The former also identified small amounts of RFeO3 as the secondary phase. Lattice constant values were increased upon partial substitution of Fe3+ by R3+ (R = Y, Yb and Lu). Magnetization measurements revealed that the magnetic moment of R3+ (R = Y, Yb and Lu) substituted compounds decreased compared with NiFe2O4. mr was measured at 3 kHz and 3 MHz both longitudinal (LT) and transverse (TR) configuration. A maximum mr of 54 % was observed in Y3+ substituted NiFe2O4 in TR mode.
Raithel, Martin; Naegel, Andreas; Seidel, Sebastian; Raithel, Sandra; Diebel, Hiwot; Neurath, Markus F; Maiss, Juergen
2011-10-01
Prospective evaluation of the new 0.025 in. Visiglide(®) guidewire to facilitate endoscopic retrograde cholangiopancreaticography using the Olympus V-scope. Interventional endoscopic retrograde cholangiopancreaticography was performed in 9 patients with the Olympus V-scope and the 0.025 in. Visiglide(®) guidewire (VS group), whilst 9 other patients underwent endoscopic retrograde cholangiopancreaticography with a conventional Olympus duodenoscope using 0.035 in. conventional guidewires (controls). Exchange time of accessories, X-ray time, dose and endoscopic retrograde cholangiopancreaticography examination time were investigated. The VS group showed a significantly lower exchange time of endoscopic retrograde cholangiopancreaticography accessories (9; 4-10s, p<0.0001) than controls (29; 19-44s). The Visiglide(®) guidewire was complete fixable by the elevator in 35/36 instrument exchanges (97%) compared to 16/31 exchanges (52%) using conventional guidewires. Single-centre study, small patient numbers, two investigators. Endoscopic retrograde cholangiopancreaticography using the Olympus V-scope with the new 0.025 in. Visiglide(®) guidewire enables a 3-fold faster exchange of accessories due to a nearly complete fixation of the guidewire. Copyright © 2011 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Krishnan, Rajagopalan; Thirumalai, Jagannathan; Kathiravan, Arunkumar
2015-01-01
For the first time, we report the successful synthesis of novel nanoparticle-sheathed bipyramid-like and almond-like Fe0.5R0.5(MoO4)1.5:Ln3+ (R = Gd3+, La3+), (Ln = Eu, Tb, Dy) 3D hierarchical microstructures through a simple disodium ethylenediaminetetraacetic acid (Na2EDTA) facilitated hydrothermal method. Interestingly, time-dependent experiments confirm that the assembly-disassembly process is responsible for the formation of self-aggregated 3D architectures via Ostwald ripening phenomena. The resultant products are characterized by x-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), high resolution transmission electron microscopy (HRTEM), photoluminescence (PL), and magnetic measurements. The growth and formation mechanisms of the self-assembled 3D micro structures are discussed in detail. To confirm the presence of all the elements in the microstructure, the energy loss induced by the K, L shell electron ionization is observed in order to map the Fe, Gd, Mo, O, and Eu components. The photo luminescence properties of Fe0.5R0.5(MoO4)1.5 doped with Eu3+, Tb3+, Dy3+ are investigated. The room temperature and low temperature magnetic properties suggest that the interaction between the local-fields introduced by the magnetic Fe3+ ions and the R3+ (La, Gd) ions in the dodecahedral sites determine the magnetism in Fe0.5R0.5(MoO4)1.5:Eu3+. This work provides a new approach to synthesizing the novel Fe0.5R0.5(MoO4)1.5:Ln3+ for bi-functional magnetic and luminescence applications.
The APSU 0.5m Telescope - A Hands-On Learning Environment for Secondary Teachers
NASA Astrophysics Data System (ADS)
Allyn Smith, J.; Buckner, S. L.; Pirkle, S. F.
2012-05-01
Physical science teachers with hands-on experience are critical to secondary education learning. In "Before It’s Too Late," the U.S. Department of Education (2000) estimated "about 56% of high school students taking physical science are taught by out-of-field teachers." In Tennessee, the problem is even greater, while the demand is increasing. This project aims to address the shortage of well-prepared physics and astronomy teachers. Austin Peay State University has recently installed a 0.5m telescope with imaging and rudimentary spectroscopic capability. We are committed to working with the College of Education to bring secondary teachers in training and practicing secondary teachers to the telescope to experience basic operations and conduct small research projects. This is done via classes and summer workshops. We describe the program setup, expectations for the participants, learning outcomes, and the evaluation process.
Design and Performance Evaluation Study of a Prototype of a Tactical Unmanned Aerial Vehicle
2007-12-01
Sperwer B – Sagem , France ................................................................8 B. EXISTING TACTICAL UAV SYSTEMS...Predator B armed with Hellfire missiles 8 2. Sperwer B – Sagem , France Sperwer B was designed and developed by Sagem , France, to support Intelligence...that can carry external loads of up to 30kg each. Sagem has already demonstrated the integration of Sperwer B with the Spike LR missile. They are
Mathews, D H; Banerjee, A R; Luan, D D; Eickbush, T H; Turner, D H
1997-01-01
RNA transcripts corresponding to the 250-nt 3' untranslated region of the R2 non-LTR retrotransposable element are recognized by the R2 reverse transcriptase and are sufficient to serve as templates in the target DNA-primed reverse transcription (TPRT) reaction. The R2 protein encoded by the Bombyx mori R2 can recognize this region from both the B. mori and Drosophila melanogaster R2 elements even though these regions show little nucleotide sequence identity. A model for the RNA secondary structure of the 3' untranslated region of the D. melanogaster R2 retrotransposon was developed by sequence comparison of 10 species aided by free energy minimization. Chemical modification experiments are consistent with this prediction. A secondary structure model for the 3' untranslated region of R2 RNA from the R2 element from B. mori was obtained by a combination of chemical modification data and free energy minimization. These two secondary structure models, found independently, share several common sites. This study shows the utility of combining free energy minimization, sequence comparison, and chemical modification to model an RNA secondary structure. PMID:8990394
NASA Astrophysics Data System (ADS)
Dai, Xiu Hong; Zhao, Hong Dong; Zhang, Lei; Zhu, Hui Juan; Li, Xiao Hong; Zhao, Ya Jun; Guo, Jian Xin; Zhao, Qing Xun; Wang, Ying Long; Liu, Bao Ting; Ma, Lian Xi
2014-03-01
Polycrystalline Bi0.975La0.025Fe0.975Ni0.025O3 (BLFNO) film is fabricated on Pt/Ti/SiO2/Si(111) substrate by sol-gel method. It is found that the well-crystallized BLFNO film is polycrystalline, and the Pt/BLFNO/Pt capacitor possesses good ferroelectric properties with remnant polarization of 74 μC/cm2 at electric field of 833 kV/cm. Moreover, it is also found that the leakage current density of the Pt/BLFNO/Pt capacitor increases with the increase of measurement temperature ranging from 100 to 300 K. The leakage density of the Pt/BLFNO/Pt capacitor satisfies space-charge-limited conduction (SCLC) at higher electric field and shows little dependence on voltage polarity and temperature, but shows polarity and temperature dependence at lower applied electric field. With temperature increasing from 100 to 300 K at lower applied electric field, the most likely conduction mechanism is from Ohmic behavior to SCLC for positive biases, but no clear dominant mechanism for negative biases is shown.
R2R--software to speed the depiction of aesthetic consensus RNA secondary structures.
Weinberg, Zasha; Breaker, Ronald R
2011-01-04
With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file.
R2R - software to speed the depiction of aesthetic consensus RNA secondary structures
2011-01-01
Background With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. Results We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. Conclusions R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file. PMID:21205310
Bouloc, Anne; Vergnanini, Andre Luiz; Issa, Maria Claudia
2015-03-01
Topical tretinoin is considered the gold standard to treat photoaged skin, but it is associated with side effects and only available upon prescription. To compare the efficacy, tolerance, and perception of a fixed proprietary combination (Retinol 0.2%/LR2412 2%) vs. tretinoin 0.025% cream in women with photoaged skin. In this randomized, parallel, double-blind, controlled clinical study, women applied to the entire face for 3 months in the morning a SPF 50 sunscreen and in the evening either the association of Retinol 0.2%/LR2412 2% or tretinoin 0.025%. Clinical and instrumental parameters were assessed at days 0, 28, 56, and 84. Subject perception of the efficacy, tolerance and cosmeticity of the tested products were assessed at days 28, 56, and 84. A total of 120 women (60 to Retinol 0.2%/LR2412 2% cream and 60 to tretinoin 0.025% cream) were included in the study. Both products improved considerably wrinkles, mottled pigmentation, pores, and global photodamage. No statistically significant differences were noted between Retinol 0.2%/LR2412 2% cream and tretinoin 0.025% cream. Adverse effects were mostly graded mild. Overall, Retinol 0.2%/LR2412 2% cream was better tolerated than tretinoin 0.025% cream. At all visits, subject perception of the association of Retinol 0.2%/LR2412 2% was either comparable to or better than tretinoin 0.025% cream. The treatment outcome of Retinol 0.2%/LR2412 2% cream does not differ from the one of tretinoin 0.025% cream. Clinical results were not statistically different. Furthermore, Retinol 0.2%/LR2412 2% cream is better tolerated and better perceived by women used to rejuvenation procedures. © 2015 The Authors Journal of Cosmetic Dermatology Published by Wiley Periodicals, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-06-11
... been discontinued from marketing for reasons other than safety or effectiveness. ANDAs that refer to... Reasons of Safety or Effectiveness AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The...% and 0.05%, were not withdrawn from sale for reasons of safety or effectiveness. This determination...
Mao, Dainan; Bushin, Leah B; Moon, Kyuho; Wu, Yihan; Seyedsayamdost, Mohammad R
2017-04-04
Bacteria produce a diverse array of secondary metabolites that have been invaluable in the clinic and in research. These metabolites are synthesized by dedicated biosynthetic gene clusters (BGCs), which assemble architecturally complex molecules from simple building blocks. The majority of BGCs in a given bacterium are not expressed under normal laboratory growth conditions, and our understanding of how they are silenced is in its infancy. Here, we have addressed this question in the Gram-negative model bacterium Burkholderia thailandensis E264 using genetic, transcriptomic, metabolomic, and chemical approaches. We report that a previously unknown, quorum-sensing-controlled LysR-type transcriptional regulator, which we name ScmR (for secondary metabolite regulator), serves as a global gatekeeper of secondary metabolism and a repressor of numerous BGCs. Transcriptionally, we find that 13 of the 20 BGCs in B. thailandensis are significantly (threefold or more) up- or down-regulated in a scmR deletion mutant ( ΔscmR) Metabolically, the ΔscmR strain displays a hyperactive phenotype relative to wild type and overproduces a number of compound families by 18- to 210-fold, including the silent virulence factor malleilactone. Accordingly, the ΔscmR mutant is hypervirulent both in vitro and in a Caenorhabditis elegans model in vivo. Aside from secondary metabolism, ScmR also represses biofilm formation and transcriptionally activates ATP synthesis and stress response. Collectively, our data suggest that ScmR is a pleiotropic regulator of secondary metabolism, virulence, biofilm formation, and other stationary phase processes. A model for how the interplay of ScmR with pathway-specific transcriptional regulators coordinately silences virulence factor production is proposed.
NASA Astrophysics Data System (ADS)
Priyono, Slamet; Triwibowo, Joko; Prihandoko, Bambang
2016-02-01
The effect of 0.025 Al-doped Li4Ti5O12 as anode material for Lithium Ion battery had been studied. The pure and 0.025 Al-doped Li4Ti5O12 were synthesized through solid state process in air atmosphere. Physical characteristics of all samples were observed by XRD, FTIR, and PSA. The XRD analysis revealed that the obtained particle was highly crystalline and had a face-centered cubic spinel structure. The XRD pattern also showed that the 0.025 Al-doped on the Li4Ti5O12 did not change crystal structure of Li4Ti5O12. FTIR analysis confirmed that the spinel structure in fingerprint region was unchanged when the structure was doped by 0.025 Al. However the doping of 0.025 Al increased particle size significantly. The electrochemical performance was studied by using cyclic voltammetry (CV) and charge-discharge (CD) curves. Electrochemical analysis showed that pure Li4Ti5O12 has higher capacity than 0.025 Al-doped Li4Ti5O12 had. But 0.025 Al-doped Li4Ti5O12 possesses a better cycling stability than pure Li4Ti5O12.
Matosin, Natalie; Fernandez-Enright, Francesca; Frank, Elisabeth; Deng, Chao; Wong, Jenny; Huang, Xu-Feng; Newell, Kelly A
2014-11-01
Metabotropic glutamate receptors 2/3 (mGluR2/3) and 5 (mGluR5) are novel therapeutic targets for major depression (MD), bipolar disorder (BD) and schizophrenia. We aimed to determine whether mGluR2/3 and mGluR5 binding in the anterior cingulate cortex (ACC), a brain region essential for the regulation of mood, cognition and emotion, were differentially altered in these pathologies. Using postmortem human brains derived from 2 cohorts, [(3)H]LY341495 binding to mGluR2/3 and [(3)H]MPEP binding to mGluR5 were measured by receptor autoradiography in the ACC. The first cohort comprised samples from individuals who had MD with psychosis (MDP), MD without psychosis (MDNP) and matched controls (n = 11-12 per group). The second cohort comprised samples from individuals who had MDNP, BD, schizophrenia and matched controls (n = 15 per group). No differences in mGluR2/3 or mGluR5 binding were observed in the MDP, MDNP, BD or schizophrenia groups compared with the control group (all p > 0.05). Importantly, there were also no differences in binding densities between the psychiatric disorders (p > 0.05). We did, however, observe age-related effects, with consistent negative associations between mGluR2/3 and age in the control group (r < -0.575, p < 0.025) and the psychotic disorder groups (MDP and schizophrenia: r = -0.765 to -0.515, p < 0.05), but not in the mood disorder groups (MDNP, BD). Replication in larger independent cohorts and medication-naive individuals would strengthen these findings. Our findings suggest that mGluRs are unaltered in the ACC; however, the presence of altered receptor function cannot be discounted and requires further investigation. Taken together with previous studies, which report differential changes in mGluR2, 3 and 5 across these disorders, we suggest mGluRs may be affected in a brain region-specific manner.
Draelos, Zoe Diana; Raab, Susana; Yatskayer, Margarita; Chen, Nannan; Krol, Yevgeniy; Oresajo, Christian
2015-04-01
Facial dyspigmentation treatment is an unmet need in dermatology with increasing challenges due to the questionable safety of hydroquinone. This research examined a new OTC formulation containing hydroxyphenoxy propionic acid, ellagic acid, yeast extract, and salicylic acid on subjects who previously completed 12 weeks of treatment with 4% hydroquinone and 0.025% retinoic acid. The goal of this study was to evaluate the skin lightening and tolerability profile of a 20-week maintanence therapy with a cosmeceutical formulation during the summer months. 33 healthy subjects ages 25-60 years with moderate facial dyspigmentation defined as a score of 3 on a 5-point scale were enrolled. There was statistically significant improvement at week 20 in terms of even skin tone (P<0.001), spot intensity (P<0.001), spot size (P<0.05) and overall hyperpigmentation (P>=0.002).
Gupta, Rupali; Singh, Akanksha; Pandey, Rakesh
2016-09-01
Despite the vast exploration of microbes for plant health, there is a lack of knowledge about the synergistic effects of specific microorganisms in sustainable agriculture, especially in medicinal plants such as Pelargonium graveolens L'Hér. The aim of this study was to evaluate how synergistic microbes Trichoderma harzianum ThU, Glomus intraradices and Bacillus subtilis CIM affected crop productivity, secondary metabolites and glandular trichome number in P. graveolens. The results demonstrated a significant (P < 0.05) increase in plant growth, secondary metabolites, total chlorophyll, carotenoids, carbohydrates, total phenolics, total flavonoids, free radical-scavenging activity and total antioxidant capacity of P. graveolens treated with synergistic bioinoculants as compared with the control. Most interestingly, an increase in essential oil by 32% in the treatment with all three microbes was observed. Furthermore, the principal aroma compounds citronellol and geraniol also increased in the same treatment. A positive and direct correlation was observed between essential oil content and number of glandular trichomes in all treatments. The present study highlights an explicit amalgamation of prospective microbes showing potential for synergism that act as biostimulants in enhancing plant production and improving the antioxidant and aroma profile of P. graveolens. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Côrtes, Carlos Alberto Figueiredo; Oliveira, Amaury Sanchez; Castro, Luis Fernando Lima; Cavalcanti, Franz Schubert; Serafim, Maurício Marsaioli; Taia, César; Taia Filho, Siguero
2003-04-01
Clinical trials with local anesthetic levo-enantiomers have shown higher safety due to lower cardiotoxicity. This study aimed at evaluating quality of anesthesia and maternal/fetal repercussions of 0.5% bupivacaine, enantiomeric 0.5% bupivacaine (S75-R25) and 0.75% ropivacaine, all associated to fentanyl, in epidural cesarean section anesthesia. Participated in this study 90 full-term pregnant women, physical status ASA I, submitted to elective cesarean section under epidural anesthesia, who were divided into tree groups: group I - 23 ml racemic 0.5% bupivacaine with epinephrine; Group II -23 ml enantiomeric 0.5% bupivacaine (S75-R25) with epinephrine; Group III - 23 ml of 0.75% ropivacaine. Fentanyl (2 ml) was associated to local anesthetics in all groups. The following parameters were evaluated: onset, analgesia duration, sensory and motor block degree, time to hysterotomy and delivery, quality of muscle relaxation and anesthesia, maternal hemodynamic and respiratory changes, newborn vitality (evaluated through Apgar score and cord-blood gases analysis), and side-effects. There were no differences among groups, except for anesthesia quality. In groups with predominant levo-enantiomer fraction were clinically worse with the need for anesthetic complementation in three cases. Analgesia duration was longer in the ropivacaine group. Enantiomeric mixture 0.5% bupivacaine (S75-R25) and 0.75% ropivacaine for epidural anesthesia have provided as good conditions as racemic 0.5% bupivacaine for the surgical act. Newborn repercussions have shown that all solutions were equally safe.
Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li
2013-10-01
According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.
Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.
Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S
1984-01-01
Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981
Dong, Ying; Si, Jing-Wen; Li, Wen-Ting; Liang, Li; Zhao, Jian; Zhou, Mei; Li, Dong; Li, Ting
2015-01-01
The aim of this study was to compare the clinicopathological significance of miR-200a/miR-141 and miR-205 expression in endometrioid carcinomas (ECs) versus nonendometrioid carcinomas (NECs) and to assess their correlation with hormone receptor status. miR-200a/miR-141 and miR-205 expression in 154 endometrial cancers was determined by qRT-PCR. The status of estrogen and progesterone receptor (ER/PR) was assessed using immunohistochemistry. miR-200a/miR-141 and miR-205 increased significantly in ECs and in NECs. The expression level of miR-200a was significantly higher in NECs than in ECs (P=0.025). Furthermore, there was a trend that NECs with worse clinicopathological variables had a higher miR-200a expression, while an inverse trend existed in ECs. miR-205 upregulation occurred frequently in NECs without lymph node metastases (P=0.030), whereas such association was not present in ECs. Interestingly, In ECs, miR-200a/miR-141 upregulation occurred frequently in the hormone receptor positive subgroups than the negative subgroups (P<0.05). Similarly, the expression level of miR-205 was higher in the hormone receptor positive subgroups and the association between miR-205 and PR reached statistical significance (P=0.024). In contrast, in NECs, a negative correlation was found between miR-200a/miR-141 and ER or PR status. Meanwhile, in ECs, miR-200a upregulation correlated with prolonged survival in the ER positive subgroup (P=0.046), whereas an inverse trend existed in the ER negative subgroup. Our findings suggest that miR-200a/miR-141 and miR-205 increased significantly in ECs and in NECs. However, they might behave differently in ECs versus NECs. miR-200a/miR-141 and miR-205 might be associated with hormone receptor status in endometrial cancer and may possess prognostic impacts.
2007-04-01
the underlying parameters are available. Standard data format. Battelle, SAGEM Avionics, and Austin Digital, Inc. agreed upon a standard data format...data was initiated at four airlines by SAGEM Avionics beginning January 1, 2006. Transfer was initiated at one airline by Aus- tin Digital, Inc...internal issues have been resolved. As of April 0, 2006, more than 124,000 flights have been transferred to local archive servers by SAGEM and over
Rogge, Andreas; Vogts, Angela; Voss, Maren; Jürgens, Klaus; Jost, Günter; Labrenz, Matthias
2017-06-01
Chemolithoautotrophic sulfur-oxidizing and denitrifying Gamma- (particularly the SUP05 cluster) and Epsilonproteobacteria (predominantly Sulfurimonas subgroup GD17) are assumed to compete for substrates (electron donors and acceptors) in marine pelagic redox gradients. To elucidate their ecological niche separation we performed 34 S 0 , 15 NO3- and H 13 CO3- stable-isotope incubations with water samples from Baltic Sea suboxic, chemocline and sulfidic zones followed by combined phylogenetic staining and high-resolution secondary ion mass spectrometry of single cells. SUP05 cells were small-sized (0.06-0.09 µm 3 ) and most abundant in low-sulfidic to suboxic zones, whereas Sulfurimonas GD17 cells were significantly larger (0.26-0.61 µm 3 ) and most abundant at the chemocline and below. Together, SUP05 and GD17 cells accumulated up to 48% of the labelled substrates but calculation of cell volume-specific rates revealed that GD17 cells incorporated labelled substrates significantly faster throughout the redox zone, thereby potentially outcompeting SUP05 especially at high substrate concentrations. Thus, in synopsis with earlier described features of SUP05/GD17 we conclude that their spatially overlapping association in stratified sulfidic zones is facilitated by their different lifestyles: whereas SUP05 cells are streamlined, non-motile K-strategists adapted to low substrate concentrations, GD17 cells are motile r-strategists well adapted to fluctuating substrate and redox conditions. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Fita, I.; Markovich, V.; Moskvin, A. S.; Wisniewski, A.; Puzniak, R.; Iwanowski, P.; Martin, C.; Maignan, A.; Carbonio, Raúl E.; Gutowska, M. U.; Szewczyk, A.; Gorodetsky, G.
2018-03-01
The exchange-bias (EB) effect with sign reversal was found in LuF e0.5C r0.5O3 ferrite-chromite, which is a weak ferrimagnet below TN=265 K , exhibiting antiparallel orientation of the ferromagnetic (FM) moments of the Fe and Cr sublattices due to opposite sign of the Fe-Cr Dzyaloshinskii vector, as compared to that of the Fe-Fe and Cr-Cr. The weak FM moments of the studied compound compensate each other at temperature Tcomp=23 0 K , leading to the net magnetic moment reversal and to observed negative magnetization, at moderate applied fields, below Tcomp. Both vertical and horizontal shifts from the origin were gotten in the field-cooled magnetization hysteresis loops. The EB sign was found to be positive below Tcomp and negative above Tcomp, with nonmonotonic dependence on cooling field Hcool. It sharply increases at small values of magnetic fields up to Hcool˜1 kOe , then remains almost unchanged in the range 1-30 kOe and strongly decreases with further increase of Hcool. This unusual behavior results from the competition of various Dzyaloshinskii-Moriya interactions between F e3 + and C r3 + ions.
Quispe-Mauricio, Angel; Callacondo, David; Rojas, José; Zavala, David; Posso, Margarita; Vaisberg, Abraham
2009-01-01
The plants have been used as drugs for centuries. However, limited research has been done on its great potential as sources of new therapeutic agents. The purpose of this study was to evaluate Physalis peruviana cytotoxic activity on cell lines HT-29, PC-3, K-562 and VERO. The HT-29 cell lines, PC-3, K-562 and VERO, were exposed to four concentrations of P. peruviana ethanolic leave and stem extracts, also at different concentrations of cisplatin and 5-fluorouracil (5-FU), which were used as positive controls. We found rates of growth within 48 hours, then we determined the inhibitory concentration 50 (IC50) using linear regression analysis and the index of selectivity of each sample. The P. peruviana ethanolic leave and stem extracts showed cytotoxic activity. The IC50 in g/mL in leaves and stems were, 0.35 (r =-0.95 p <0.025) and 0.37 (r =- 0.90 p <0.05 ) for HT-29; 0.87 (r =-0.98 p <0.01) and 1.01 (r =-0.95 p <0.025) for PC-3; 0.02 (r =-0.98 p <0.01) and 0.03 (r =-0.98 p <0.01) for K-562; 4.9 (r =-0.95 p <0.025) and 6.2 (r =-0.98 p <0.01) for VERO. The IC50 for antineoplastic were: for cisplatin: 4.2 (r =-0.96 p <0.025), 10.3 (r =-0.97 p <0.025), 0.15 (r =-0.98 p = 0.01) and 1.1 (r =- 0.98 p = 0.01); for 5-FU: 2.3 (r =-0.97 p <0.025), 17.9 (r =-0.95 p <0.025), 0.15 (r =-0.98 p = 0.01) and 1.1 (r =-0.94 p = 0.05) for HT-29, PC-3, K562 and VERO respectively. The leaves and stems extracts selectivity index were between 5.6 and 245 for tumor cell lines evaluated, by contrast, cisplatin and 5-FU, only showed values between 0.11 and 7.3. The P. peruviana leaves and steams ethanolic extracts were more cytotoxic than cisplatin and 5 FU, on the lines HT-29, PC-3 and K562. Furthermore the P. peruviana cytotoxic effects were less than cisplatin and 5-FU for VERO control cells lines.
Méndez-Giménez, Antonio; Cecchini-Estrada, José-Antonio; Fernández-Río, Javier; Prieto Saborit, José Antonio; Méndez-Alonso, David
2017-09-20
The main objective was to analyze relationships and predictive patterns between 3x2 classroom goal structures (CGS), and motivational regulations, dimensions of self-concept, and affectivity in the context of secondary education. A sample of 1,347 secondary school students (56.6% young men, 43.4% young women) from 10 different provinces of Spain agreed to participate (M age = 13.43, SD = 1.05). Hierarchical regression analyses indicated the self-approach CGS was the most adaptive within the spectrum of self-determination, followed by the task-approach CGS. The other-approach CGS had an ambivalent influence on motivation. Task-approach and self-approach CGS predicted academic self-concept (p < .01; p < .001, respectively; R 2 = .134), and both along with other-approach CGS (negatively) predicted family self-concept (p < .05; p < .001; p < .01, respectively; R 2 = .064). Physical self-concept was predicted by the task-approach and other-approach CGS's (p < .05; p < .001, respectively; R 2 = .078). Finally, positive affect was predicted by all three approach-oriented CGS's (p < .001; R 2 = .137), whereas negative affect was predicted by other-approach (positively) and self-approach (negatively) CGS (p < .001; p < .05, respectively; R 2 = .028). These results expand the 3x2 achievement goal framework to include environmental factors, and reiterate that teachers should focus on raising levels of self- and task-based goals for students in their classes.
Lucky, A W; Cullen, S I; Jarratt, M T; Quigley, J W
1998-04-01
The addition of polyolprepolymer-2 in tretinoin formulations may reduce tretinoin-induced cutaneous irritation. This study compared the efficacy and safety of a new 0.025% tretinoin gel containing polyolprepolymer-2, its vehicle, and a commercially-available 0.025% tretinoin gel in patients with mild to moderate acne vulgaris. In this 12-week multicenter, double-blind, parallel group study, efficacy was evaluated by objective lesion counts and the investigators' global evaluations. Subjective assessment of cutaneous irritation by the investigators and patients evaluated safety. The efficacy of the two active treatments in this 215 patient study was comparable, and both treatments were statistically significantly more effective than vehicle. When compared with the commercially-available tretinoin gel, the formulation containing polyolprepolymer-2 demonstrated statistically significantly less peeling at days 28, 56, and 84, statistically significantly less dryness by day 84, and statistically significantly less itching at day 14. Irritation scores for the formulation containing polyolprepolymer-2 were numerically lower but not statistically different from those of the commercially-available gel for erythema and burning. The number of cutaneous and noncutaneous adverse events were similar for both active medications. The two 0.025% gels studied demonstrated comparable efficacy. However, the gel formulation containing polyolprepolymer-2 caused significantly less peeling and drying than the commercially-available formulation by day 84 of the study.
Magnetic and dielectric studies on half-doped orthochromite R(Fe0.5Cr0.5)O3 (R=Gd, Sm) ceramics
NASA Astrophysics Data System (ADS)
Tirupathi, Patri; Reddy, H. Satish Kumar
2018-05-01
In the present paper, we report a details on magnetic and dielectric studies on ball milled single phase Gd(Fe0.5Cr0.5)O3 (GFC) and Sm(Fe0.5Cr0.5)O3 (SmFC) ceramics. The room temperature X-ray diffraction suggest that GFC and SmFC are exhibit orthorhombic crystal system with Pnma space group. Temperature dependent dc-magnetic studies exhibit a complex sequence of magnetic transitions (TN = 281 K) for GFC (TN = 249 K for SmFC ceramics respectively. A weak ferromagnetic character at low temperature were observed for both compounds. In addition, high temperature dielectric studies were also reported for SmFC ceramics.
Goh, Chee Leok; Tang, Mark B Y; Briantais, Philippe; Kaoukhov, Alexandre; Soto, Pascale
2009-01-01
The efficacious acne treatment adapalene gel 0.1% is significantly less irritating than tretinoin of various concentrations and formulations, according to several clinical studies conducted predominantly in Caucasian patients. To confirm the lower irritation potential of adapalene gel 0.1% compared to tretinoin gel 0.025% among volunteers of various ethnic origins and to explore the difference in the irritant susceptibility among ethnic groups. The study was a single-centre, randomized, investigator-masked and intra-individual comparison. Healthy volunteers applied adapalene and tretinoin daily to the face for 21 days and to the forearms for 4 days, and were then evaluated for the level of irritation. The irritation potential of adapalene gel 0.1% was significantly lower than that of tretinoin gel 0.025% in all tolerability assessments, irrespective of the volunteers' ethnic origins. The between-treatment differences were similar among various ethnic groups. Statistically significant but small inter-ethnicity differences were observed in the evaluation of facial signs, with Caucasians being less susceptible than Chinese, Asian Indians and Malays. Adapalene gel 0.1% was significantly better tolerated than tretinoin gel 0.025% among various ethnic groups. The patients' ethnic origins had no impact on the difference between adapalene and tretinoin treatments in terms of tolerability.
Light-weighting, polishing and bonding for the SEOSAT/Ingenio telescope mirrors
NASA Astrophysics Data System (ADS)
Harel, Emmanuelle
2017-11-01
Sagem presents its recent developments in light-weighting, polishing, bonding and testing of Zerodur space mirrors equipped with pads and fixation devices. The presentation is based on Sagem's recent successful project for the SEOSAT/Ingenio satellite.
Stella, Nicholas A; Lahr, Roni M; Brothers, Kimberly M; Kalivoda, Eric J; Hunt, Kristin M; Kwak, Daniel H; Liu, Xinyu; Shanks, Robert M Q
2015-08-01
Serratia marcescens generates secondary metabolites and secreted enzymes, and it causes hospital infections and community-acquired ocular infections. Previous studies identified cyclic AMP (cAMP) receptor protein (CRP) as an indirect inhibitor of antimicrobial secondary metabolites. Here, we identified a putative two-component regulator that suppressed crp mutant phenotypes. Evidence supports that the putative response regulator eepR was directly transcriptionally inhibited by cAMP-CRP. EepR and the putative sensor kinase EepS were necessary for the biosynthesis of secondary metabolites, including prodigiosin- and serratamolide-dependent phenotypes, swarming motility, and hemolysis. Recombinant EepR bound to the prodigiosin and serratamolide promoters in vitro. Together, these data introduce a novel regulator of secondary metabolites that directly connects the broadly conserved metabolism regulator CRP with biosynthetic genes that may contribute to competition with other microbes. This study identifies a new transcription factor that is directly controlled by a broadly conserved transcription factor, CRP. CRP is well studied in its role to help bacteria respond to the amount of nutrients in their environment. The new transcription factor EepR is essential for the bacterium Serratia marcescens to produce two biologically active compounds, prodigiosin and serratamolide. These two compounds are antimicrobial and may allow S. marcescens to compete for limited nutrients with other microorganisms. Results from this study tie together the CRP environmental nutrient sensor with a new regulator of antimicrobial compounds. Beyond microbial ecology, prodigiosin and serratamolide have therapeutic potential; therefore, understanding their regulation is important for both applied and basic science. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Pressure-induced structural and semiconductor-semiconductor transitions in C o0.5M g0.5C r2O4
NASA Astrophysics Data System (ADS)
Rahman, S.; Saqib, Hajra; Zhang, Jinbo; Errandonea, D.; Menéndez, C.; Cazorla, C.; Samanta, Sudeshna; Li, Xiaodong; Lu, Junling; Wang, Lin
2018-05-01
The effect of pressure on the structural, vibrational, and electronic properties of Mg-doped Cr bearing spinel C o0.5M g0.5C r2O4 was studied up to 55 GPa at room-temperature using x-ray diffraction, Raman spectroscopy, electrical transport measurements, and ab initio calculations. We found that the ambient-pressure phase is cubic (spinel-type, F d 3 ¯m ) and underwent a pressure-induced structural transition to a tetragonal phase (space group I 4 ¯m 2 ) above 28 GPa. The ab initio calculation confirmed this first-order phase transition. The resistivity of the sample decreased at low pressures with the existence of a low-pressure (LP) phase and started to increase with the emergence of a high-pressure (HP) phase. The temperature dependent resistivity experiments at different pressures illustrated the wide band gap semiconducting nature of both the LP and HP phases with different activation energies, suggesting a semiconductor-semiconductor transition at HP. No evidence of chemical decomposition or a semiconductor-metal transition was observed in our studies.
Aircraft Update Programmes. The Economical Alternative
2000-04-01
will drive the desired level of integration but cost will determine the achieved level. Paper #15 by Christian Dedieu-Eric Loffler ( SAGEM SA) presented...requirements. The SAGEM SA upgrade concept allows one to match specifications ranging from basics performance enhancement, such as high accuracy navigation for
Treating epidermal melasma with a 4% hydroquinone skin care system plus tretinoin cream 0.025%.
Grimes, Pearl; Watson, JoAnne
2013-01-01
We sought to evaluate the efficacy and tolerability of treating melasma using a 4% hydroquinone skin care system, including a proprietary cleanser, toner, 4% hydroquinone, exfoliation enhancer, and sunscreen, plus tretinoin cream 0.025%. Together these products offer not only treatment of melasma but also a complete skin care regimen. Twenty participants with mild or moderate epidermal melasma with Fitzpatrick skin types III to VI were instructed to use the hydroquinone skin care system and tretinoin cream for 12 weeks. Melasma severity, melasma pigmentation intensity, and melasma area and severity index (MASI) score were significantly reduced from week 4 onward relative to baseline (P < or = .01). The proportion of participants who felt embarrassed or self-conscious about their skin very much or a lot declined from 80% (16/20) to 20% (4/20) between baseline and week 12. Similarly, the proportion of those who made very much or a lot of effort to hide their skin discoloration declined from 90% (18/20) to 37% (7/19). In total, 85% (17/20) of participants were satisfied with the overall effectiveness of the study treatment. Three participants had adverse events probably related to treatment (dryness, erythema, peeling, and stinging sensation). The 4% hydroquinone skin care system plus tretinoin cream 0.025% is effective and well-tolerated in the treatment of melasma.
["Abdominal dressing" - a new method of treatment for open abdomen following secondary peritonitis].
Wild, T; Stremitzer, S; Budzanowski, A; Rinder, H; Tamandl, D; Zeisel, C; Hölzenbein, T; Sautner, T
2004-05-01
Treatment of open abdomen following secondary peritonitis is a challenge for surgery and intensive care units (ICU). The aim of this study was to compare three different concurrent treatment strategies. Patients suffering an open abdomen following surgery for secondary peritonitis at the Department of General Surgery from 01/01 to 12/03 were investigated. Factor studied: duration of open abdomen, incidence of multi-organ failure, need for surgical revisions, length of stay (LOS) in ICU, nursing requirements (change of dressing/day), survival and integrity of abdominal wall after discharge. Treatment strategies included: open packing (OP), classic vacuum assisted (V.A.C.(R))-therapy with silicone net protection for the intestine (CV) and V.A.C.(R)-therapy with "abdominal dressing" a newly developed meshed polyvinyl wrap (AD). 21 patients were studied: 5 patients were treated with OP, 8 patients with CV and 8 patients with AD. Mean LOS was 65 (OP) vs. 53 (CV) vs. 42 (AD) days (NS), peritonitis related death was 3 (OP) vs. 1 (CV) vs. 0 (AD) (p < 0.05 Chisquare test). Median nursing effort was 4 dressings/day (OP), 0.5 (CV) and 0.5 (AD) (p < 0.005 OP vs CV, AD Kruskal-Wallis test). The "abdominal dressing"-therapy seems to be a more efficient treatment option in patients suffering from open abdomen following secondary peritonitis. A trend towards shorter ICU-LOS, lower mortality rates and reduced nursing requirements support our hypothesis.
Sperwer After S/A TC. Military Aviation Requirements; An Approach to Address the New RNLA UAV Domain
2003-09-02
houder BVLn (t.z.t. over te dragen aan C-1Div) D-DMKLu (Airworthiness Authority RNLAF) BLS Type Certificate Holder (DM) Sagem (delegated TC Holder...1Div 1 ) Airworthiness Authority (RNLAF) TC-Houder (LE-21) Ontwerper, Producent, Sagem (JAR-21) Type certificaat (TC) Bewijzen van Luchtwaardig- heid
Adolescent low back pain among secondary school students in Ibadan, Nigeria.
Adegoke, Babatunde O A; Odole, Adesola C; Adeyinka, Adebayo A
2015-06-01
Adolescent low back pain (ALBP) can be considered a signal or precursor of a serious organic disease or telltale sign of future incidence of low back pain in adulthood. Published articles on ALBP in Nigeria are not readily available. The study's objectives were to investigate the prevalence of Adolescent Low Back Pain (ALBP) among secondary school students in Ibadan, Nigeria and the prevalence's association with some socio-demographic variables. Participants were adolescent students from 15 secondary schools in Ibadan. Data was collected using a respondent-administered, validated questionnaire on low back pain in adolescents. Participants (Female: 298; Male: 273) aged 14.23 ±2.27 years (range 10-19) were recruited through multi-stage random sampling. Five hundred and seventy-one (83.97%) of the 680 copies of the questionnaire administered were returned. Data was analysed using mean, standard deviation, frequency, percentages, and Chi-square test with alpha level at 0.05. Lifetime, twelve-month, one-month and point prevalence rates of ALBP were 58.0%, 43.8%, 25.6% and 14.7% respectively. Age at first experience of ALBP was 11.86 ± 2.36 years. Gender was not significantly associated with any rate (p ≥0.317). Age (p ≤ 0.043) and engagement in commercial activities (p ≤ 0.025) were significantly associated with all period prevalence rates while injury to the back was significantly associated with all period prevalence rates except point prevalence (p = 0.087). Adolescent low back pain is common among secondary school students in Ibadan and its prevalence is significantly associated with age and engagement in commercial activities, but not with gender.
Final Report - LAW Envelope C Glass Formulation Testing to Increase Waste Loading, VSL-05R5900-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kruger, Albert A.; Pegg, I. L.; Matlack, K. S.
2013-12-03
This report describes the results of testing specified by Test Plan VSL-05R5900-1 Rev.0. The work was performed in compliance with the quality assurance requirements specified in the Test Plan. Results required by the Test Plan are reported. The test results and this report have been reviewed for correctness, technical adequacy, completeness, and accuracy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, R. R.; Qin, X. Y.; Li, L. L.
2012-12-15
The Sr{sub 3}(Ti{sub 0.95}R{sub 0.05}){sub 2}O{sub 7} (R = Ta, Nb, W) polycrystalline compounds were fabricated, and their transport and thermoelectric properties were investigated. The results indicate that at T > 300 K electrical resistivity {rho} for all the doped compounds increases monotonically with temperature, and basically can be described by a relation {rho}{proportional_to}T{sup M} at T > {approx}650 K, with M = 1.39, 1.66, and 1.77 for R = Ta, Nb, and W, respectively, implying that at the high temperatures the acoustic phonon scattering dominates the scattering process. Although the resistivity {rho} of Sr{sub 3}(Ti{sub 0.95}Ta{sub 0.05}){sub 2}O{sub 7}more » exhibits a metallic-like behavior at the temperature as low as 5 K, a transition from metallic state (d{rho}/dT > 0) to semiconductor-like state (d{rho}/dT < 0) was observed at a critical low temperature {approx}41 K and {approx}79 K for R = Nb and W, respectively. At T < {approx}22 K, {approx}57 K, and {approx}80 K, a relation of {sigma}{proportional_to}T{sup 1/2} (here conductivity {sigma} = 1/{rho}) holds for the doped compounds with R = Nb, Ta, and W, respectively, suggesting that at the low temperatures the main transport mechanism is electron-electron interaction due to the presence of disorder induced by the dopants. The thermoelectric figure of merit (ZT) for Ta-doped compound increases more steeply with increasing temperature among the three compounds and reaches 0.066 at 1000 K.« less
Chang, Anne Lynn S; Alora-Palli, Maria; Lima, Xinaida T; Chang, Tiffany C; Cheng, Carol; Chung, Connie M; Amir, Omar; Kimball, Alexa B
2012-03-01
Papulopustular acne rosacea is a chronic inflammatory condition which can be difficult to treat. Many patients are unwilling to use systemic medications, and single topical agents alone may not address all the symptoms of rosacea. A combination topical clindamycin phosphate 1.2% and tretinoin 0.025% gel is efficacious for acne vulgaris, and may be helpful for rosacea, since acne vulgaris and rosacea shares many similar clinical and histologic features. To assess the preliminary efficacy and safety of a combination gel consisting of clindamycin phosphate 1.2% and tretinoin 0.025% on papulopustular rosacea after 12 weeks of usage. Randomized, double-blind, placebo controlled two site study of 79 participants with moderate to severe papulopustular acne rosacea using both physician and subjects' validated assessment tools. Primary endpoint consisted of statistically significant reduction in absolute papule or pustule count after 12 weeks of usage. There was no significant difference in papule/pustule count between placebo and treated groups after 12 weeks (P=0.10). However, there was nearly significant improvement in physicians' assessments of the telangiectasia component of rosacea (P=0.06) and erythematotelangiectatic rosacea subtype (P=0.05) in treated versus placebo group after 12 weeks. The only significant adverse event different was facial scaling, which was significantly increased in treated group (P=0.01), but this did not result in discontinuation of study drug. A combination gel of clindamycin phosphate 1.2% and tretinoin 0.025% may improve the telangiectatic component of rosacea and appears to better treat the erythemotelangiectatic subtype of rosacea rather than papulopustular subtype. Our preliminary study suggests that future studies with much larger sample size might confirm our findings.
NASA Astrophysics Data System (ADS)
Singh, Laxman; Yadava, Shiva Sundar; Sin, Byung Cheol; Rai, Uma Shanker; Mandal, K. D.; Lee, Youngil
2016-06-01
The dielectric and ferroelectric characteristics of Bi0.5Na0.5TiO3 (BNT), CaCu3Ti4O12 (CCTO), and 0.5Bi0.5Na0.5TiO3-0.5CaCu3Ti4O12 (BNT/CCTO) ceramics are compared. X-ray diffraction patterns confirmed the formation of single phase of all the ceramics after sintering at 950°C for 15 h. Scanning electron microscopy images of the sintered ceramics reveal average grain sizes in the range from 200 nm to 2.5 μm. Energy-dispersive x-ray mapping and x-ray photoelectron spectroscopy show the presence of the elements Bi, Na, Ca, Cu, Ti, and O with uniform distribution in the ceramics. BNT/CCTO exhibits high dielectric constant ( ɛ r ˜ 6.9 × 104) compared with BNT ( ɛ r ˜ 0.13 × 104) and CCTO ( ɛ r ˜ 1.68 × 104) ceramics at 1 kHz and 503 K. The high dielectric constant of BNT/CCTO compared with BNT and CCTO is associated with a major contribution from grain boundaries, as confirmed by impedance and modulus analyses. The P- E hysteresis loop of all the ceramics measured at room temperature and 50°C exhibited typical ferroelectric nature. The remanent polarization ( P r) of BNT (1.58 μC/cm2) and CCTO (0.654 μC/cm2) ceramics are higher than that of BNT/CCTO (0.267 μC/cm2) ceramic.
Study of xCo0.8Ni0.2Fe2O4+(1-x) Pb0.99625 La0.0025Zr0.55Ti0.45O3 magnetoelectric composites
NASA Astrophysics Data System (ADS)
Dipti; Singh, Sangeeta; Juneja, J. K.; Raina, K. K.; Kotnala, R. K.; Prakash, Chandra
2016-06-01
We are reporting here, the studies of the structural, dielectric, ferroelectric and magnetic properties of magnetoelectric composites of La modified lead zirconate titanate (PLZT) and Ni modified cobalt ferrite (CNFO) with compositional formula xCo0.8Ni0.2Fe2O4+(1-x) Pb0.99625La0.0025Zr0.55Ti0.45O3 (x=0.00, 0.05, 0.10, 0.15 and 1.00 by weight) prepared by the solid state reaction method. Coexistence of both the phases in composites was confirmed by X-Ray diffraction technique. The microstructure and average grain size were determined from Scanning Electron Micrograph (SEM) in backscattered mode. Both the phases could be observed clearly. The variations of dielectric properties with frequency and temperature were also studied. P-E and M-H hysteresis measurements were carried. Magnetoelectric coupling (ME) coefficient for samples with x=0.05 and 0.10 were measured as a function of DC magnetic field. Maximum value of ME coefficient (1.2 mV/cm Oe) and piezoelectric coefficient (96 pC/N) for x=0.05 were observed.
The GLC8 - A miniature low cost ring laser gyroscope
NASA Astrophysics Data System (ADS)
Godart, D.-F.; Peghaire, J.-P.
SAGEM is enlarging its family of ring laser gyros (RLG) which already includes a triangular 32-cm path-length gyro and a square 16-cm path-length gyro, in order to meet the increasing demand for low cost, medium accuracy strap-down inertial measurement units for applications such as short- and medium-range tactical missiles as well as aided navigation systems for aircrafts and land vehicles. Based on the experience acquired in the past 13 years in the RLG field, and especially in mirror manufacturing, SAGEM developed the GLC8 which has a square 8-cm path length cavity, central piezoelectric dither. It incorporates two cathodes, a single anode, and is technologically designed to minimize production-costs while optimizing the performance to global device size ratio. This gyro is characterized by a bias and a scale-factor stability respectively better than 0.5 deg/h and 100 ppm (1 sigma), and has an operating lifetime compatible with the most demanding relevant applications and a high robustness to mechanical environments.
Zhao, Chunlin; Wu, Jiagang
2018-01-31
The intensive demands of microelectronics and energy-storage applications are driving the increasing investigations on the colossal permittivity (CP) materials. In this study, we designed a new system of Dy and Nb co-doped TiO 2 ceramics [(Dy 0.5 Nb 0.5 ) x Ti 1-x O 2 ] with the formation of secondary phases, and then the enhancement of overall dielectric properties (ε r ∼ 5.0-6.5 × 10 4 and tan δ < 8%) was realized in the broad composition range of 0.5 ≤ x ≤ 5%. More importantly, effects of secondary phases on microstructure, dielectric properties, and stability were explored from the views of defect-dipoles and internal barrier layer capacitance (IBLC) effect. According to the defect-dipoles theory, the CP should mainly originate from Nb 5+ , and the Dy 3+ largely contributes to the decreased dielectric loss. Both CP and low dielectric loss were obtained for co-doping with Dy 3+ and Nb 5+ . Besides, the Dy enrichment induced the formation of secondary phases, which were regarded as the low loss unit dispersed into the ceramic matrix, and largely facilitate the decreased dielectric loss. In particular, the analysis of temperature-dependent complex impedance spectra indicated that a stronger IBLC effect caused by the increased grain boundary resistance can also contribute to the optimized CP and low dielectric loss under appropriate contents of secondary phases.
Curtiss, W C; Vournakis, J N
1984-01-01
Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.
Comparison of endotoxin levels found in primary and secondary endodontic infections.
Gomes, Brenda P F A; Endo, Marcos S; Martinho, Frederico C
2012-08-01
This clinical study was conducted to compare the levels of endotoxins (lipopolysaccharides [LPSs]) found in primary and secondary endodontic infections with apical periodontitis by correlating LPS contents with clinical/radiographic findings. In addition, the presence of target gram-negative anaerobic bacteria was also investigated. Samples were taken from 15 root canals with primary infections and 15 with secondary infections by using paper points. The limulus amebocyte lysate assay was used to quantify endotoxins, and the polymerase chain reaction technique (16S rDNA) was used for bacterial investigation. Endotoxins were detected in 100% of the root canal samples collected from primary (15/15) and secondary (15/15) infections with median values of 7.49 EU/mL and 3.96 EU/mL, respectively (P < .05). The median value of endotoxins found in the presence of clinical symptoms was significantly higher than in asymptomatic teeth with primary infections (P < .05). A positive correlation was found between endotoxin contents and a larger size of the radiolucent area (>3 mm) (P < .05). Prevotella nigrescens (10/15, 4/15), Fusobacterium nucleatum (5/15, 1/15), Treponema denticola (3/15, 1/15), and Treponema socranskii (5/15, 1/15) were detected in teeth with primary and secondary infections, respectively. P. endodontalis was present only in teeth with primary infections (5/15). Teeth with primary endodontic infections had higher contents of endotoxins and a more complex gram-negative bacterial community than teeth with secondary infections. Moreover, the levels of endotoxins were related to the severity of bone destruction in periapical tissues as well as the development of clinical features in teeth with primary infections. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sasaki, Toru; Matsushita, Kyoko; Sato, Kosuke, E-mail: j1213703@ed.tus.ac.jp, E-mail: matusita@rs.kagu.tus.ac.jp
2014-01-20
We studied the distributions of metal abundances and metal-mass-to-light ratios in the intracluster medium (ICM) of four galaxy groups, MKW 4, HCG 62, the NGC 1550 group, and the NGC 5044 group, out to ∼0.5 r {sub 180} observed with Suzaku. The iron abundance decreases with radius and is about 0.2-0.4 solar beyond 0.1 r {sub 180}. At a given radius in units of r {sub 180}, the iron abundance in the ICM of the four galaxy groups was consistent with or smaller than those of clusters of galaxies. The Mg/Fe and Si/Fe ratios in the ICM are nearly constantmore » at the solar ratio out to 0.5 r {sub 180}. We also studied systematic uncertainties in the derived metal abundances, comparing the results from two versions of atomic data for astrophysicists (ATOMDB) and single- and two-temperature model fits. Since the metals have been synthesized in galaxies, we collected K-band luminosities of galaxies from the Two Micron All Sky Survey catalog and calculated the integrated iron-mass-to-light-ratios (IMLR), or the ratios of the iron mass in the ICM to light from stars in galaxies. The groups with smaller gas-mass-to-light ratios have smaller IMLR values and the IMLR is inversely correlated with the entropy excess. Based on these abundance features, we discussed the past history of metal enrichment processes in groups of galaxies.« less
Bussières, Sylvain; Cantin, Line; Salesse, Christian
2011-11-01
Recent work on Lecithin:retinol acyltransferase (LRAT) allowed to gather a large amount of information on its secondary structure, enzymatic properties and membrane binding. A truncated form of LRAT (tLRAT) as well as its S175R mutant leading to retinis pigmentosa, a severe form of retinal dystrophy, were studied to understand the role of this mutation on the dysfunction of this protein. Consistently with previous reports, the S175R-tLRAT mutant was shown to lack enzyme activity. However, very similar secondary structures probed by circular dichroism have been obtained with the S175R-tLRAT mutant and tLRAT. Moreover, similar values of maximum insertion pressure of the S175R-tLRAT mutant and tLRAT have been obtained using Langmuir monolayers, thus suggesting that the S175R mutation has no effect on the membrane binding properties of tLRAT. These findings leave open the possibility that the loss of enzymatic activity associated with the S175R mutant is related to loss of an essential nucleophile near the active site, or alternatively, to steric obstruction of the active site that impedes substrate binding. Copyright © 2011 Elsevier Ltd. All rights reserved.
[A study of relationship between occupational stress and diseases in secondary school teachers].
Zhang, Yang; Zhu, Tao; Tang, Liu; Li, Jian; Lan, Yajia
2015-10-01
To analyze the relationship between occupational stress and diseases in secondary school teachers in a city of Sichuan Province, and to provide a basis for the evaluation of the long-term effects of occupational stress in teachers. With secondary school teachers as the target population, the stratified cluster sampling was adopted to conduct three studies among 780, 119, and 689 secondary school teachers in a city of Sichuan Province in 1999, 2005, and 2009, respectively. The Occupational Stress Inventory-Revised Edition (OSI-R) and working ability index (WAI) were used to investigate occupational stress and diseases in secondary school teachers. The variation of occupational stress in secondary school teachers was compared between different periods and the relationship between the intensity of stress and diseases was evaluated, on the basis of which the variation of the relationship over time was analyzed. There were significant differences in occupational stress in secondary school teachers between different periods (P<0.05). The incidence rates of medium and high physiological stress and psychological stress were significantly higher in 2009 than in 1999 (P<0.05). Compared with the year of 1999, the intensity of occupational stress in 2009 changed with cardiovascular, respiratory, and mental diseases. The incidence of abnormal psychological stress was a risk factor for all chronic, respiratory, and mental diseases (OR: 1.88, 2.25, and 5.91). The time dependence of odds ratio was only found in the risk of respiratory diseases: occupational stress resulted in a significant increase in the risk of respiratory diseases over time (P<0.05). Physiological stress was a risk factor for mental diseases (OR=2.31). The intensity of occupational stress in secondary school teachers changes over time. Occupational stress elevates the risks of certain diseases and has a time-dependent effect on the risk of respiratory diseases. Occupational stress in secondary school teachers
NASA Astrophysics Data System (ADS)
García-Muñoz, José Luis; Padilla-Pantoja, Jessica; Torrelles, Xavier; Blasco, Javier; Herrero-Martín, Javier; Bozzo, Bernat; Rodríguez-Velamazán, José A.
2016-07-01
In half-doped P r0.50A0.50Co O3 metallic perovskites, the spin-lattice coupling brings about distinct magnetostructural transitions for A =Ca and A =Sr at temperatures close to ˜100 K. However, the ground magnetic properties of P r0.50S r0.50Co O3 (PSCO) strongly differ from P r0.50C a0.50Co O3 ones, where a partial P r3 + to P r4 + valence shift and Co spin transition makes the system insulating below the transition. This paper investigates and describes the relationship between the I m m a →I 4 /m c m symmetry change [Padilla-Pantoja, García-Muñoz, Bozzo, Jirák, and Herrero-Martín, Inorg. Chem. 53, 12297 (2014)] and the original magnetic behavior of PSCO versus temperature and external magnetic fields. The FM1 and FM2 ferromagnetic phases, above and below the magnetostructural transition (TS 1˜120 K ) have been investigated. The FM2 phase of PSCO is composed of [100] FM domains, with magnetic symmetry I m'm'a (mx≠0 , mz=0 ). The magnetic space group of the FM1 phase is F m'm'm (with mx=my ). Neutron data analyses in combination with magnetometry and earlier reports results agrees with a reorientation of the magnetization axis by 45∘ within the a b plane across the transition, in which the system retains its metallic character. The presence below TS 1 of conjugated magnetic domains, both of F m'm'm symmetry but having perpendicular spin orientations along the diagonals in the x y plane of the tetragonal unit cell, is at the origin of the anomalies observed in the macroscopic magnetization. A relatively small field μ0H [⊥ z ] ≳30 mT is able to reorient the magnetization within the a b plane, whereas a higher field (μ0H [∥z ] ≳1.2 T at 2 K) is necessary to align the Co moments perpendicular to the a b plane. Such a spin reorientation, in which the orbital and spin components of the Co moment rotate joined by 45∘, was not observed previously in analogous cobaltites without praseodymium.
Environmental Consequences of Nanotechnologies: Nanoparticle Dispersion in Aqueous Media: SOP-T-1
2015-02-01
containing ice • Bath sonicator • Weighing dish (aluminum) • Stainless steel spatula • Analytical balance • Lab jack for lifting sample • Volumetric...balance and an aluminum dish, weigh an adequate mass of dry powder under a fume hood to achieve the desired concentration into ultrapure water (<T>, <R...0.025 0.5 0.05 1 0.5 10 1 20 2. Add ultra-pure water in a glass beaker with NP powder to /flask under fume hood (<T>, <R>). 3. Degas the bath
[Secondary metabolites from a deep-sea-derived actinomycete Micrococcus sp. R21].
Peng, Kun; Su, Rui-qiang; Zhang, Gai-yun; Cheng, Xuan-xuan; Yang, Quan; Liu, Yong-hong; Yang, Xian-wen
2015-06-01
To investigate cytotoxic secondary metabolites of Micrococcus sp. R21, an actinomycete isolated from a deep-sea sediment (-6 310 m; 142 degrees 19. 9' E, 10 degrees 54. 6' N) of the Western Pacific Ocean, column chromatography was introduced over silica gel, ODS, and Sephadex LH-20. As a result, eight compounds were obtained. By mainly detailed analysis of the NMR data, their structures were elucidated as cyclo(4-hydroxy-L-Pro-L-leu) (1), cyclo(L-Pro-L-Gly) (2), cyclo( L-Pro-L-Ala) (3), cyclo( D-Pro-L-Leu) (4), N-β-acetyltryptamine (5), 2-hydroxybenzoic acid (6), and phenylacetic acid (7). Compound 1 exhibited weak cytotoxic activity against RAW264. 7 cells with IC50 value of 9.1 μmol x L(-1).
NASA Astrophysics Data System (ADS)
Sorokin, N. I.; Ivanovskaya, N. A.; Sobolev, B. P.
2014-03-01
Cold-pressed ceramics of fluorine-conducting solid electrolytes La1 - y M y F3 - y ( M = Ca, Sr, Ba) and Nd1 - y Ca y F3 - y with y = 0.95 have been synthesized in a melt of RF3 ( R = La, Nd) and MF2 components in a fluorinating atmosphere and ground in a ball mill. The as-prepared ceramics require annealing, during which their porosity decreases and the conductivity is stably increased (by a factor of 250 for the R 1 - y M y F3 - y composition at 293 K). The Nd0.95Ca0.05F2.95 and Nd0.95Ca0.05F2.95 compositions have a maximum ionic conductivity σ(293 K) ˜ 5 × 10-6 Sm/cm. This value is larger (by a factor of about 10) than σ (293 K) for the R 1 - y M y F3 - y ceramics of tysonite phases prepared by mechanochemical synthesis with the cold pressing of reaction products.
OLED study for military applications
NASA Astrophysics Data System (ADS)
Barre, F.; Chiquard, A.; Faure, S.; Landais, L.; Patry, P.
2005-07-01
The presentation deals with some applications of OLED displays in military optronic systems, which are scheduled by SAGEM DS (Defence and Security). SAGEM DS, one of the largest group in the defence and security market, is currently investigating OLED Technologies for military programs. This technology is close from being chosen for optronic equipment such as future infantry night vision goggles, rifle-sight, or, more generally, vision enhancement systems. Most of those applications requires micro-display with an active matrix size below 1". Some others, such as, for instance, ruggedized flat displays do have a need for higher active matrix size (1,5" to 15"). SAGEM DS takes advantages of this flat, high luminance and emissive technology in highly integrated systems. In any case, many requirements have to be fulfilled: ultra-low power consumption, wide viewing angle, good pixel to pixel uniformity, and satisfactory behaviour in extreme environmental conditions.... Accurate measurements have been achieved at SAGEM DS on some micro display OLEDs and will be detailed: luminance (over 2000 cd/m2 achieved), area uniformity and pixel to pixel uniformity, robustness at low and high temperature (-40°C to +60°C), lifetime. These results, which refer to military requirements, provide a valuable feedback representative of the state of the art OLED performances.
Pressure induced superconductivity in very lightly doped LaFeAsO0.975F0.025
NASA Astrophysics Data System (ADS)
Miyoshi, K.; Otsuka, K.; Shiota, A.; Shimojo, Y.; Motoyama, G.; Fujiwara, K.; Kitagawa, H.; Nishigori, S.
2018-05-01
We have investigated whether or not superconductivity is induced by the application of pressure in very lightly F-doped LaFeAsO1-xFx , which shows spin density wave (SDW) state at ambient pressure, through the measurements of DC magnetization and electrical resistivity under pressure using pulse current sintered (PCS) high density polycrystalline specimens. It has been confirmed that the specimens with x = 0.025 shows superconductivity with Tcdia ∼ 15 K under pressure above ∼ 1.3 GPa. The pressure induced superconductivity can be explained by the lattice compression along c-axis, which enhances the electron doping from LaO layers to FeAs layers.
A 0.5 MV magnetically self-insulated pulsed transformer
NASA Astrophysics Data System (ADS)
Istenic, M.; Novac, B. M.; Luo, J.; Kumar, R.; Smith, I. R.
2006-11-01
This paper describes the successful development of a light and compact 0.5 MV spiral-strip transformer, with the secondary winding contained in vacuum and based on magnetic self-insulation. Ensuring trouble-free operation required the use of conductive elastomers in electric field grading techniques and the adoption in the secondary winding of glass/ceramic conductor spacers. It is demonstrated that the primary-current/secondary breakdown-voltage characteristic is a function of the vacuum pressure, with only 52 kA being necessary to produce 0.5 MV at 10-6 Torr. The difficult task of modelling the transformer required 3D electric and magnetic field computation, together with state-of-the-art calculation of the electron flow in the vacuum. Based on the results obtained to date, scaling up to multi-megavolt transformers can readily be envisaged.
TMA optics for HISUI HSS and MSS imagers
NASA Astrophysics Data System (ADS)
Rodolfo, J.; Geyl, R.; Leplan, H.; Ruch, E.
2017-11-01
Sagem is presently working on a new project for the Japanese HISUI instrument made from a Hyper Spectral Sensor and a Multi Spectral Sensor, both including a Three Mirror Anastigmat (TMA) main optics. Mirrors are made from Zerodur from Schott but also from NTSIC, the New Technology Silicon Carbide developed in Japan. This report is also the opportunity to show to the community Sagem recent progress in precision TMA optics polishing and alignment.
NASA Astrophysics Data System (ADS)
Zaman, Arif; Malik, Rizwan Ahmed; Maqbool, Adnan; Hussain, Ali; Ahmed, Tanveer; Song, Tae Kwon; Kim, Won-Jeong; Kim, Myong-Ho
2018-03-01
Crystal structure, dielectric, ferroelectric, piezoelectric, and electric field-induced strain properties of lead-free Nb-modified 0.96Bi0.5K0.5TiO3-0.04Bi(Mg0.5Ti0.5)O3 (BKT-BMT) piezoelectric ceramics were investigated. Crystal structure analysis showed a gradual phase transition from tetragonal to pseudocubic phase with increasing Nb content. The optimal piezoelectric property of small-signal d 33 was enhanced up to ˜ 68 pC/N with a lower coercive field ( E c) of ˜ 22 kV/cm and an improved remnant polarization ( P r) of ˜ 13 μC/cm2 for x = 0.020. A relaxor-like behavior with a frequency-dependent Curie temperature T m was observed, and a high T m around 320°C was obtained in the investigated system. This study suggests that the ferroelectric properties of BKT-BMT was significantly improved by means of Nb substitution. The possible shift of depolarization temperature T d toward high temperature T m may have triggered the spontaneous relaxor to ferroelectric phase transition with long-range ferroelectric order without any traces of a nonergodic relaxor state in contradiction with Bi0.5Na0.5TiO3-based systems. The possible enhancement in ferroelectric and piezoelectric properties near the critical composition x = 0.020 may be attributed to the increased anharmonicity of lattice vibrations which may facilitate the observed phase transition from a low-symmetry tetragonal to a high-symmetry cubic phase with a decrease in the lattice anisotropy of an undoped sample. This highly flexible (at a unit cell level) narrow compositional range triggers the enhancement of d 33 and P r values.
Structure and dielectric properties of Na0.5Bi0.5TiO3-CaTiO3 solid solutions
NASA Astrophysics Data System (ADS)
Birks, E.; Dunce, M.; Ignatans, R.; Kuzmin, A.; Plaude, A.; Antonova, M.; Kundzins, K.; Sternberg, A.
2016-02-01
Despite wide studies of Na0.5Bi0.5TiO3, structure of this material and its connection with the observed physical properties still raise numerous questions due to mutually contradicting results obtained. Here, structure and dielectric properties of poled and unpoled Na0.5Bi0.5TiO3-CaTiO3 solid solutions are studied, projecting the obtained concentration dependence of structure and dielectric properties on pure Na0.5Bi0.5TiO3 as the end member of this material group. X-ray diffraction patterns for Na0.5Bi0.5TiO3-CaTiO3 solid solutions reveal dominating of an orthorhombic Pnma phase, even for the compositions approaching the end composition (Na0.5Bi0.5TiO3), whereas structure of pure Na0.5Bi0.5TiO3 can be considered, assuming coexistence of rhombohedral and orthorhombic phases. This allows one to avoid appearance of a large difference of rhombohedral distortions between the unpoled and poled Na0.5Bi0.5TiO3, if the rhombohedral distortion is calculated as for single R3c phase. Features of dielectric permittivity, corresponding to the observed structural phase transition, are identified. It is discussed that the rhombohedral R3c phase is responsible for appearance of the frequency-dependent shoulder of dielectric permittivity temperature dependence, characteristic for unpoled Na0.5Bi0.5TiO3.
[Appraisal of occupational stress and strain in primary and secondary school teachers].
Wang, Z; Lan, Y; Li, J; Wang, M
2001-09-01
This study was conducted to assess occupational stress and strain in primary and secondary school teachers. A test of occupational stress and strain was carried out by using Occupational Stress Inventory Revised Edition (OSI-R) in 1460 primary and secondary school teachers (teacher group) and 319 mental workers in non-educational area (non-teacher group as control). The results showed the level of occupational stress in role overload and physical environment in the teacher group was significantly higher than that in the non-teacher group (P < 0.05). In teacher group the level of occupational stress and strain increased with age; the occupational stress and strain in male teachers were significantly higher than those in female teachers (P < 0.01); the occupational stress and strain in secondary school teachers were significantly higher than those in primary school teachers. These results indicate: to protect and promote primary and secondary school teacher's health, particularly male teachers' health, to mitigate their work pressure and to raise the quality of education are important tasks in the area of occupational health.
NASA Astrophysics Data System (ADS)
Rubnikovich, S. P.; Denisova, Yu. A.; Fomin, N. A.
2017-11-01
A method has been developed for estimating the stressed-strained state in the ″orthodontic apparatus-dentin″ system with the use of laser-optical diagnostics based on speckle photography. We have determined the indices of the stressed-strained state in the ″orthodontic apparatus-dentin″ system depending on the composition and form of the orthodontic arch cross section. We have determined the optimum indices of the stressed-strained state of orthodontic arches in patients with periodontium diseases in combination with maxillodental anomalies and deformations, to which the following arches correspond: from copper-nickel-titanium (CuNiTi) alloy with circular (0.012″, 0.013″, 0.014″, 0.016″, 0.018″), and rectangular (0.014 × 0.025″, 0.016 × 0.025″) cross sections, from titanium-molybdenum alloy (TMA) with a rectangular cross section (0.016 × 0.025″), and from stainless steel (SS) with a circular (0.016″, 0.018″) cross section. Direct correlation has been established between indices of the stressed-strained state in the ″orthodontic apparatus-dentin″ system and the periodontium capillary pressure (r = 0.78, p < 0.05), as well as inverse strong correlation with the periodontium microcirculation intensity (r = -0.88, p < 0.05).
Meffert, Matthias; Störmer, Heike; Gerthsen, Dagmar
2016-02-01
(Ba0.5Sr0.5)(Co0.8Fe0.2)O3-δ (BSCF) is a promising material with mixed ionic and electronic conductivity which is considered for oxygen separation membranes. Selective improvement of material properties, e.g. oxygen diffusivity or suppression of secondary phase formation, can be achieved by B-site doping. This study is concerned with the formation of Co-oxide precipitates in undoped BSCF at typical homogenization temperatures of 1,000°C, which act as undesirable nucleation sites for other secondary phases in the application-relevant temperature range. Y-doping successfully suppresses Co-oxide formation, whereas only minor improvements are achieved by Sc-doping. To understand the reason for the different behavior of Y and Sc, the lattice sites of dopant cations in BSCF were experimentally determined in this work. Energy-dispersive X-ray spectroscopy in a transmission electron microscope was applied to locate dopant sites exploiting the atom location by channeling enhanced microanalysis technique. It is shown that Sc exclusively occupies B-cation sites, whereas Y is detected on A- and B-cation sites in Y-doped BSCF, although solely B-site doping was intended. A model is presented for the suppression of Co-oxide formation in Y-doped BSCF based on Y double-site occupancy.
Composition and annealing effects on superconductivity in sintered and arc-melted Fe1+εTe0.5Se0.5
NASA Astrophysics Data System (ADS)
Foreman, M. M.; Ponti, G.; Mozaffari, S.; Markert, J. T.
2018-03-01
We present the results of x-ray diffraction, electrical resistivity, and ac magnetic susceptibility measurements on specimens of the “11”-structure superconductor Fe1+εTe0.50Se0.50 (0 ≤ ε ≤ 0.15). Samples were initially either sintered in sealed quartz tubes or melted in a zirconium-gettered arc furnace. Sintered samples were fired two to three times at temperatures of 425°C, 600°C, or 675°C, while arc-melted samples were studied both asmelted and after annealing at 650°C. X-ray diffraction data show a predominant PbO-type tetragonal phase, with a secondary hexagonal NiAs-type phase; for sintered specimens annealed at 600°C, the secondary phase decreases as ε increases over the range 0 ≤ ε ≤ 0.10, with the composition Fe1.10Te0.5Se0.5 exhibiting x-ray phase purity. A higher annealing temperature of 675°C provided such tetragonal phase purity at the composition Fe1.05Te0.5Se0.5. The resistive superconducting transition temperature Tc was nearly independent of the iron concentration 1+ε, suggesting a single superconducting phase, while the magnetic screening fraction varied greatly with concentration and conditions, peaking at ɛ = 0.07, indicating that the amount of superconducting phase is strongly dependent on conditions. We propose that the behaviour can also be viewed in terms of an electron-doped, chalcogen-deficient stoichiometry.
NIRSpec optics development: final report
NASA Astrophysics Data System (ADS)
Geyl, R.; Ruch, E.; Vayssade, H.; Leplan, H.; Rodolfo, J.
2017-11-01
As shown and discussed on a Sagem poster presented at the ICSO 2010 conference [1], scientific or commercial earth observation space instruments are more and more taking advantage of the remarkable properties of Silicon Carbide in term of hardness, stiffness and thermal stability combined with a reasonable density which are indeed of primary importance for all space applications. Sagem-REOSC High Performance Optics Unit works on the polishing, coating and integration technologies of SiC mirrors since more than ten year through various successful space programs for various customers: INSAT 3D scan mirror, ROCSAT II and SPIRALE main telescopes, GAIA large primary mirrors and Auto-collimation flats, …). This paper aims to provide to the international space community an exhaustive vision of the work performed by Sagem-REOSC on the polishing, coating and integration of the three Three Mirror Anastigmats of the NIRSpec spectrographic instrument which is the main ESA contribution to the JWST.
Schneider, Robert H; Grim, Clarence E; Rainforth, Maxwell V; Kotchen, Theodore; Nidich, Sanford I; Gaylord-King, Carolyn; Salerno, John W; Kotchen, Jane Morley; Alexander, Charles N
2012-11-01
Blacks have disproportionately high rates of cardiovascular disease. Psychosocial stress may contribute to this disparity. Previous trials on stress reduction with the Transcendental Meditation (TM) program have reported improvements in cardiovascular disease risk factors, surrogate end points, and mortality in blacks and other populations. This was a randomized, controlled trial of 201 black men and women with coronary heart disease who were randomized to the TM program or health education. The primary end point was the composite of all-cause mortality, myocardial infarction, or stroke. Secondary end points included the composite of cardiovascular mortality, revascularizations, and cardiovascular hospitalizations; blood pressure; psychosocial stress factors; and lifestyle behaviors. During an average follow-up of 5.4 years, there was a 48% risk reduction in the primary end point in the TM group (hazard ratio, 0.52; 95% confidence interval, 0.29-0.92; P=0.025). The TM group also showed a 24% risk reduction in the secondary end point (hazard ratio, 0.76; 95% confidence interval, 0.51-0.1.13; P=0.17). There were reductions of 4.9 mmHg in systolic blood pressure (95% confidence interval -8.3 to -1.5 mmHg; P=0.01) and anger expression (P<0.05 for all scales). Adherence was associated with survival. A selected mind-body intervention, the TM program, significantly reduced risk for mortality, myocardial infarction, and stroke in coronary heart disease patients. These changes were associated with lower blood pressure and psychosocial stress factors. Therefore, this practice may be clinically useful in the secondary prevention of cardiovascular disease. Clinical Trial Registration- URL: www.clinicaltrials.gov Unique identifier: NCT01299935.
Symmetry and defects in rhombohedral single-crystalline Na0.5Bi0.5TiO3
NASA Astrophysics Data System (ADS)
Beanland, Richard; Thomas, Pam A.
2014-05-01
Recent work has indicated that the symmetry of the lead-free piezoelectric perovskite Na0.5Bi0.5TiO3 can be changed from monoclinic to rhombohedral through the application of an electric field, which may have implications for the study and design of piezoelectric materials close to a morphotropic phase boundary. We have examined high-quality, single-crystal Na0.5Bi0.5TiO3 using transmission electron microscopy and have used digital electron diffraction to observe the symmetry of defect-free regions of material on length scales of a few nanometers. This unequivocally demonstrates that the material is rhombohedral with space group R3c on this length scale. We find that a model that allows disordered displacements of Bi atoms from their nominal sites in the R3c symmetry, while retaining this symmetry on average, gives a very significant improvement in fit to simulations. We use conventional transmission electron microscopy to enumerate the different types of defects that are observed in other regions of the crystal and find a complex microstructure of antiphase boundaries, domain walls, and tetragonal platelets. Their interaction leads to the formation of very high densities of nanotwins. We show that these are expected to have a variable monoclinic Cc symmetry that is driven by the constraint of continuity of the crystal across a domain wall.
NASA Astrophysics Data System (ADS)
Kimura, Kenji; Usui, Satoshi; Nakajima, Kaoru
2000-12-01
We have measured secondary-electron (SE) yield γ induced by 0.5 MeV/u H, He, and Li ions specularly reflected from a SnTe(001) surface. The position-dependent SE production rate is derived from the observed γ. The SE production rate normalized by the observed mean square charge of the reflected ions is almost independent of the atomic number of the projectile ion. This indicates that the surface track potential induced by the projectile ion is negligibly small to affect the SE emission at semiconductor surfaces probably due to rapid relaxation processes.
[Clinical study of aged patients with secondary benign paroxysmal positional vertigo].
Zhu, Z J; Wei, L P; Xu, Z X; Xu, H J; Liu, Q; Luo, N
2017-09-07
Objective: To investigate the clinical features and evaluate the efficacy of manual reduction in treatment of age patients with secondary benign paroxysmal positional vertigo (s-BPPV). Methods: Thirty-two cases of aged patients ( the s-BPPV group: including 19 cases of female and 13 males, age from 60 to 86 years old)with secondary benign paroxysmal positional vertigo from Jul. 2013 to Sep. 2015 in our hospital were retrospectively analyzed. The results were compared with 121 patients( the primary group: including 82 cases of female and 39males, aged from 60 to 86 years old)with aged primary benign paroxysmal positional vertigo(p -BPPV). All the patients were followed up for 12 months. Statistical data analysis was carried out with SPSS 19.0. Results: 20.92%(32/153)of all the observed elderly patients with BPPV was the aged s-BPPV. The sex ratio and onset age had no significant difference between the two groups(χ(2)=0.79, P >0.05; t =0.37, P >0.05). The rate of two or more semicircular canal involvement in the secondary group(21.88%) was higher than that in primary group(6.61%)(χ(2)=6.67, P <0.05). Bilateral semicircular canals were involved in 5 of the 32 cases in secondary group(15.63%) and 4 of the 121 cases in aged primary group(3.31%), The difference was significant(χ(2)=6.94, P <0.05). The effective rate after first manual reduction was 57.50%(23/40)in secondary group and 82.31%(107/130)in primary group, the difference was significant(χ(2)=10.46, P <0.05). The total effective rate were 87.50%(35/40) after more than once manual reduction in secondary group and 91.54%(119/130) in primary group, the difference was not significant(χ(2)= 0.59, P >0.05). The numbers of circulation of the first successful manual reduction management were (3.9±1.3)times in secondary group and (2.1±1.1)times in primary group, the difference was significant( t =3.15, P <0.05). The recurrence rate was 37.50%(15/40) in the secondary group and 16.15%(21/130)in primary group after
ERIC Educational Resources Information Center
Congress of the U.S., Washington, DC. House Committee on Education and Labor.
Two bills concerning national reading programs were the subjects of a hearing held in Washington, D. C. on November 13, 1975, by the Subcommittee on Elementary, Secondary, and Vocational Education of the Committee on Education and Labor of the House of Representatives. H. R. 9048 is a bill to provide federal assistance for the distribution of…
Study of electrical and magneto-transport properties in La0.5Sr0.5CoO3
NASA Astrophysics Data System (ADS)
Sharma, Gaurav; Tyagi, Shekhar; Rawat, R.; Sathe, V. G.
2018-04-01
Electric and Magneto-Transport properties of La0.5Sr0.5CoO3 have been investigated in the temperature range of 5-300K and under the magnetic field up to 8T. The para- to ferromagnetic transition is reflected in zero field R-T measurements in the form of change in slope. La0.5Sr0.5CoO3 is a well-known cluster glass compound with Tc˜250K. The compound show metallic behavior throughout the whole temperature range of measurement. The compound exhibits negative magneto-resistance around the magnetic ordering temperature due to suppression of spin disorder resistivity. The Seebeck coefficient as a function of temperature is also measured and the results are discussed.
Yang, Ruiqi; Wang, Fei; Zhang, Jialing; Zhu, Chonglei; Fan, Limei
2015-05-19
To establish the reference values of thalamus, caudate nucleus and lenticular nucleus diameters through fetal thalamic transverse section. A total of 265 fetuses at our hospital were randomly selected from November 2012 to August 2014. And the transverse and length diameters of thalamus, caudate nucleus and lenticular nucleus were measured. SPSS 19.0 statistical software was used to calculate the regression curve of fetal diameter changes and gestational weeks of pregnancy. P < 0.05 was considered as having statistical significance. The linear regression equation of fetal thalamic length diameter and gestational week was: Y = 0.051X+0.201, R = 0.876, linear regression equation of thalamic transverse diameter and fetal gestational week was: Y = 0.031X+0.229, R = 0.817, linear regression equation of fetal head of caudate nucleus length diameter and gestational age was: Y = 0.033X+0.101, R = 0.722, linear regression equation of fetal head of caudate nucleus transverse diameter and gestational week was: R = 0.025 - 0.046, R = 0.711, linear regression equation of fetal lentiform nucleus length diameter and gestational week was: Y = 0.046+0.229, R = 0.765, linear regression equation of fetal lentiform nucleus diameter and gestational week was: Y = 0.025 - 0.05, R = 0.772. Ultrasonic measurement of diameter of fetal thalamus caudate nucleus, and lenticular nucleus through thalamic transverse section is simple and convenient. And measurements increase with fetal gestational weeks and there is linear regression relationship between them.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vanderhoff, J. F.; Rao, G. V.; Stein, A.
2012-07-01
The issue of Flow Accelerated Erosion-Corrosion (FAC) in power plant piping is a known phenomenon that has resulted in material replacements and plant accidents in operating power plants. Therefore, it is important for FAC resistance to be considered in the design of new nuclear power plants. This paper describes the design considerations related to FAC that were used to develop a safe and robust AP1000{sup R} plant secondary side piping design. The primary FAC influencing factors include: - Fluid Temperature - Pipe Geometry/layout - Fluid Chemistry - Fluid Velocity - Pipe Material Composition - Moisture Content (in steam lines) Duemore » to the unknowns related to the relative impact of the influencing factors and the complexities of the interactions between these factors, it is difficult to accurately predict the expected wear rate in a given piping segment in a new plant. This paper provides: - a description of FAC and the factors that influence the FAC degradation rate, - an assessment of the level of FAC resistance of AP1000{sup R} secondary side system piping, - an explanation of options to increase FAC resistance and associated benefits/cost, - discussion of development of a tool for predicting FAC degradation rate in new nuclear power plants. (authors)« less
40 CFR 180.433 - Fomesafen; tolerances for residues.
Code of Federal Regulations, 2010 CFR
2010-07-01
... application of its sodium salt in or on the following commodities: Commodity Parts per million Bean, dry 0.05 Bean, snap, succulent 0.05 Cotton, gin byproducts 0.025 Cotton, undelinted seed 0.025 Soybean 0.05 (b...
Han, R-F; Li, H-Y; Wang, J-W; Cong, X-J
2016-05-01
To study the clinical effects and immunologic mechanism of infant capillary bronchitis secondary bronchial asthma treated with bacterial lysates (Broncho-Vaxom OM-85BV). Between February 2013 and February 2014, 136 infant capillary bronchitis secondary bronchial asthma cases were chosen. This research was approved by Ethics Committee in our hospital and obtained the informed consent right from patients and guardians. Patients were divided into the control group (n = 62) and the observation group (n = 74) using random number table method. Patients in the control group were treated with normal glucocorticoid atomizing inhalation, aminophylline and antibiotic treatment. In the observation group besides the abovementioned treatment, we added Broncho-Vaxom OM-85BV, qd po for 10 days continuously and quitted it for 20 days. This continued for a total of 3 months. Follow-ups were set for about one year to compare the effects. The onset frequency and duration of capillary bronchitis and asthma in observation group declined remarkably compared with control group and the differences were statistically significant (p < 0.05). The level of IL-17 and IL-4 in the observation group decreased significantly, whereas, the level of IL-10 and IFN- γ increased considerably. Differences were all statistically significant (p < 0.05). Peripheral blood CD4+ T lymphocytes in the observation group patients expressed lower levels of nicotinic acetylcholine receptors α7 (α7nAChR) compared to the control group. Then difference was statistically significant (p < 0.05). Broncho-Vaxom OM-85BV reduced the onset of infant capillary bronchitis secondary bronchial asthma, relating to the reduced inflammation reaction. It also regulated the immunologic function of Th1/Th2, and lowered the α7nAChR level.
NASA Astrophysics Data System (ADS)
Hung, Nguyen The; Bac, Luong Huu; Trung, Nguyen Ngoc; Hoang, Nguyen The; Van Vinh, Pham; Dung, Dang Duc
2018-04-01
The integration of ferromagnetism in lead-free ferroelectric materials is important to fabricate smart materials for electronic devices. In this work, (1 - x)Bi0.5Na0.5TiO3 + xMgFeO3-δ materials (x = 0-9 mol%) were prepared through sol-gel method. X-ray diffraction characterization indicated that MgFeO3-δ materials existed as a well solid solution in lead-free ferroelectric Bi0.5Na0.5TiO3 materials. The rhombohedral structure of Bi0.5Na0.5TiO3 materials was distorted due to the random distribution of Mg and Fe cations into the host lattice. The reduced optical band gap and the induced room-temperature ferromagnetism were due to the spin splitting of transition metal substitution at the B-site of perovskite Bi0.5Na0.5TiO3 and the modification by A-site co-substitution. This work elucidates the role of secondary phase as solid solution in Bi0.5Na0.5TiO3 material for development of lead-free multiferroelectric materials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Tae-Ho; Lee, Sung-Gap, E-mail: lsgap@gnu.ac.kr; Yeo, Jin-Ho
2014-10-15
Highlights: • We fabricated lead-free (Na{sub 0.5}K{sub 0.5})NbO{sub 3} ceramics. • We studied the structural and electrical properties of 1 − x(Na{sub 0.5}K{sub 0.5})NbO{sub 3}–x(Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3} ceramics. • The structural and electrical properties improved with increasing amount of (Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3}. - Abstract: In this study, 1 − x(Na{sub 0.5}K{sub 0.5})NbO{sub 3}–x(Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3} ceramics were fabricated using the conventional mixed oxide method. The effects of the addition of (Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3} on the structural and electrical properties of the specimens were investigated for their application in piezoelectric devices. As the results of X-ray diffractionmore » analysis show, all specimens display the typical polycrystalline perovskite structure without the presence of the second phase. Sintered densities increased with an increase in the amount of (Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3} added and the specimen with 0.08 mol% of (Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3} added showed the maximum value of 4.54 g/cm{sup 3}. Both average grain size and densification increased with an increase in the amount of (Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3}. The electromechanical coupling factor, dielectric constant ϵ{sub r}, dielectric loss tan δ, d{sub 33} and Curie temperature of the 0.92(Na{sub 0.5}K{sub 0.5})NbO{sub 3}–0.08(Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3} specimens doped with 0.08 mol% of (Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3} were 0.31, 1338, 0.021, 138 and 445 °C, respectively.« less
Preserving an Incentive for Global Health R&D: The Priority Review Voucher Secondary Market.
Robertson, Andrew S
2016-05-01
In December 2014, the United States government expanded the Priority Review Voucher ("PRV" or "voucher") program to include Ebola and other related Filoviruses. By doing so, lawmakers provided a potentially powerful incentive for drug companies to invest time and money in the development of novel medicines for terrifying diseases. This expansion is one of several additions made to the PRV programs since 2012. Many companies rely on voucher resale to recoup research and development ("R&D") costs; however, it is unclear whether the PRV program could be overextended, thereby diluting the value of the incentives. In this paper, I use historical approval data from the Food and Drug Administration ("FDA") and United States drug revenue data to better understand the secondary market value of a PRV. The data suggests that that purchase prices of a PRV could continue to climb; despite this, the market size for these vouchers is limited. The implications of these findings are discussed further.
Pressure-induced transformations of multiferroic relaxor PbFe0.5Nb0.5O3
NASA Astrophysics Data System (ADS)
Basu, Abhisek; Ahart, Muhtar; Holtgrewe, Nicholas; Lin, Chuanlong; Hemley, Russell J.
2018-02-01
The effects of hydrostatic pressure at ambient temperature on the structural and dielectric properties of PbFe0.5Nb0.5O3 (PFN) were investigated using second harmonic generation (SHG) and powder x-ray diffraction measurements to 31 GPa. The results demonstrate that PFN undergoes a pressure-induced structural transition from the R3m ferroelectric to the R 3 ¯ m paraelectric phase. SHG measurements showed a continuous decrease in the signal with pressure and complete disappearance at 7.1 GPa. Effective nonlinear optical coefficients were determined from the SHG data, and their pressure behavior was used to infer the nature of the transition. The loss of the SHG signal is accompanied by drastic changes in line widths of Bragg reflections, but no discontinuous change in volume was observed. The pressure-volume data were fit to various equations of state, and a bulk modulus K0 = 136 (±2) GPa, bulk modulus pressure derivative K0' = 4.0 (±0.2), and initial volume V0 = 64.5 (±0.1) Å3 were obtained.
Nwoke, E A; Okafor, J O; Chukwuocha, U M; Nworuh, B O
2011-03-01
The study was designed to determine the socio-demographic correlates of sexual behaviours of the adolescents in Imo State secondary schools. Three objectives and three hypotheses were formulated to guide the study. A cross sectional survey design was used and sample size was 3360 (2.2%) adolescents. A structured, validated and reliable questionnaire (r = 0.79) and focus group discussion were used as the instruments for data collection. Data analysis was done using mean and ANOVA statistics. The result generally, showed that the average sexual behaviours of the adolescents were below the decision mean of 2.50 and as such the adolescents were said to be sexually inactive. In Imo State secondary schools, various family sizes did not significantly influence the sexual behaviours of the adolescents (F-cal. 2.39, F-tab. 3.00 & P > 0.05), family structure significantly influenced their sexual behaviours (F-cal. 17.78, F-tab. 3.00 & P < 0.05) and different financial strengths influenced the adolescents sexual behaviours significantly (F-cal. 22.88, F-tab. 2.37 & P < 0.05. Of great worry is that unrestricted/uncontrolled adolescents sexual behaviours may expose them to sexually transmitted infections/HIV/AIDS, unwanted pregnancies, illegal abortion and dropping out of school. Thus comprehensive sex education was recommended.
Synthesis and piezoelectric properties of (1 - x)Bi0.5(Na0.8K0.2)0.5TiO3-xSr2ZrTiO6 ceramics
NASA Astrophysics Data System (ADS)
Onishi, Ryo; Ogawa, Hirotaka; Iida, Daiki; Kan, Akinori
2017-10-01
The effects of Sr2ZrTiO6 (SZT) addition on the piezoelectric properties of (1 - x)Bi0.5(Na0.8K0.2)0.5TiO3 (BNKT)-xSZT ceramics were characterized in this study. The X-ray powder diffraction (XRPD) profiles and Raman spectra of the ceramics in the composition range of 0-0.02 implies the presence of morphotropic phase boundary (MPB) which consists of the rhombohedral and tetragonal phases. Moreover, the temperature dependence of dielectric loss indicated a presence of the ferroelectric-relaxor transition temperature (T F-R) of around 75 °C for x = 0.005 and the temperature dependence shifted to a lower temperature at x = 0.01. The temperature dependence of the P-E hysteresis loop of the ceramics at the compositions of x = 0.005-0.02 showed pinched hysteresis loops above T F-R. Regarding the piezoelectric constant (d 33), it was increased by SZT addition in the MPB region (x = 0-0.01) and the highest d 33 of 202 pC/N was obtained at the composition of x = 0.0025. The S-E unipolar loop was also evaluated, the strain of the ceramic increased up to x = 0.02; and the highest d33* = 436 pm/V was obtained at the composition of x = 0.02.
Draelos, Zoe Diana; Potts, Aaron; Alió Saenz, Alessandra B
2010-12-01
The multiple etiologic factors involved in acne vulgaris make the use of several medications necessary to treat the condition. Use of a fixed combination of clindamycin phosphate 1.2% and tretinoin 0.025% in conjunction with a benzoyl peroxide (BPO) wash 4% targets several pathologic factors simultaneously and mitigates the potential for clindamycin-induced Propionibacterium acnes-resistant strains. New formulations may allow such regimens to be effectively used without overly reduced tolerability resulting from the irritation potential of tretinoin and BPO. This randomized, single-blind study investigated the local tolerability, irritation potential, and safety of an aqueous-based gel (clindamycin phosphate 7.2%-tretinoin 0.025% [CT gel]) when used in conjunction with a BPO wash 4% in participants with mild to moderate acne vulgaris. Participants applied the CT gel once daily in the evening for 4 weeks in conjunction with once-daily morning use of either BPO wash 4% or nonmedicated soap-free cleanser lotion (SFC). Local tolerability and irritation potential were assessed by participants and investigators using separate 6-point scales. The frequency and severity of dryness, scaling, erythema, burning/stinging, and itching increased during the first week of treatment in both treatment arms but decreased thereafter. Local tolerability reactions were slightly more frequent in the CT gel + BPO wash group versus the CT gel + SFC group at week 1 but were generally mild and improved within 1 to 2 weeks. In conclusion, therapy with CT gel + BPO wash appears safe and well-tolerated in participants with mild to moderate acne vulgaris.
Burlacu, Crina L; McKeating, Kevin; McShane, Alan J
2011-06-01
To determine the analgesic efficacy of three different rates of remifentanil infusion in patients undergoing insertion or removal of long-term central venous access devices during monitored anesthesia care and local anesthetic field infiltration. Double-blinded, randomized, controlled study. Operating theatre of an University hospital. 44 unpremedicated, ASA physical status 1 and 2 patients, aged 18-65 years, undergoing insertion or removal of a Port-a-Cath or Hickman catheter. Patients sedated with a propofol target-controlled infusion were randomly allocated to three groups: Group R25 (n = 14), Group R50 (n = 15), and Group R75 (n = 15), to receive remifentanil 0.025, 0.05, and 0.075 μg/kg/min, respectively. Rescue remifentanil 0.5 μg/kg was administered for pain scores > 3. The remifentanil infusion rate was maintained constant unless respiratory and/or cardiovascular unwanted events occurred, whereupon the rate was adjusted in 0.01 μg/kg/min decrements as necessary. Pain scores (primary outcome), sedation, and movement scores (secondary outcomes) were assessed during local anesthetic infiltration of the anterior chest wall and 5 other procedural steps. All infusion rates had equal analgesic efficacy, as shown by comparable pain scores, number of rescue boluses, and number of patients requiring rescue analgesia. Excessive sedation was associated with the highest remifentanil rate such that Group R75 patients were significantly more sedated than Groups R25 or R50 at selective procedural steps (P < 0.05). More Group R75 patients (6/15) required remifentanil rate reduction than did patients from Group R50 (1/15) or Group R25 (0/14), P < 0.01, most commonly because of respiratory depression. For the insertion or removal of long-term central venous access devices, all three remifentanil infusion rates proved to be equally analgesic-efficient. However, the excessive sedation and tendency to respiratory and cardiovascular events associated with the highest
NASA Astrophysics Data System (ADS)
Walter, Jeff; Yu, Guichuan; Yu, Biqiong; Grutter, Alexander; Kirby, Brian; Borchers, Julie; Zhang, Zhan; Zhou, Hua; Birol, Turan; Greven, Martin; Leighton, Chris
2017-12-01
Ionic-liquid/gel-based transistors have emerged as a potentially ideal means to accumulate high charge-carrier densities at the surfaces of materials such as oxides, enabling control over electronic phase transitions. Substantial gaps remain in the understanding of gating mechanisms, however, particularly with respect to charge carrier vs oxygen defect creation, one contributing factor being the dearth of experimental probes beyond electronic transport. Here we demonstrate the use of synchrotron hard x-ray diffraction and polarized neutron reflectometry as in operando probes of ion-gel transistors based on ferromagnetic L a0.5S r0.5Co O3 -δ . An asymmetric gate-bias response is confirmed to derive from electrostatic hole accumulation at negative gate bias vs oxygen vacancy formation at positive bias. The latter is detected via a large gate-induced lattice expansion (up to 1%), complementary bulk measurements and density functional calculations enabling quantification of the bias-dependent oxygen vacancy density. Remarkably, the gate-induced oxygen vacancies proliferate through the entire thickness of 30-40-unit-cell-thick films, quantitatively accounting for changes in the magnetization depth profile. These results directly elucidate the issue of electrostatic vs redox-based response in electrolyte-gated oxides, also demonstrating powerful approaches to their in operando investigation.
NASA Astrophysics Data System (ADS)
Rather, Mehraj ud Din; Samad, Rubiya; Want, Basharat
2018-03-01
The physical properties of BaY0.025Ti0.9625O3, SrFe12O19, and 0.90BaY0.025Ti0.9625O3-0.10 SrFe12O19 composite have been studied. The proposed composite was synthesized by solid-state reaction method from yttrium barium titanate processed by solid-state reaction and strontium hexaferrite obtained by a sol-gel process. Microstructural analysis revealed monophasic grains for yttrium barium titanate phase, while loosely packed biphasic structure was observed for the composite. Powder x-ray analysis showed that the individual phases retained their crystal structure in the composite, without formation of any new additional phase. Measurement of magnetic hysteresis loops at room temperature indicated that the magnetic parameters of the composite were diluted by the presence of the ferroelectric phase. The ferroelectric hysteresis of yttrium barium titanate confirmed the ferroelectric transition at 119°C. Meanwhile, the symmetrical ferroelectric loops observed at different fields established the ferroelectric nature of the composite. Improved dielectric properties and low dielectric losses were observed due to yttrium doping in the composite. The diffuseness of the ferroelectric transitions for the composite was confirmed by the Curie-Weiss law. Activation energy calculations revealed the charge-hopping conduction mechanism in the composite. Magnetodielectric studies confirmed that the overall magnetocapacitance in the composite exhibited combined effects of magnetoresistance and magnetoelectric coupling.
In Situ Dechlorination of Solvents in Saturated Soils
1996-05-01
riboflavin 0.025 nicotinic acid 0.025 DL-calcium pantothenate 0.025 vitamin B12 0.025 p-aminobenzoic acid 0.025 lipoic acid 0.025 yeast extract...contaminated core materials collected from the Coast Guard Air Station in Traverse City, MI. Four fatty acids and three alcohols were tested for their...EXTRACT CONCENTRATIONS Vitamin/Yeast Extract Concentration (mg/L) d-biotin 0.01 folic acid 0.01 pyridoxine hydrochloride 0.05 thiamin hydrochloride 0.025
Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song
2016-03-10
The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5'-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis.
Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song
2016-01-01
The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5′-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis. PMID:26962011
Soft ferromagnetism in mixed valence Sr(1-x)La(x)Ti(0.5)Mn(0.5)O₃ perovskites.
Qasim, Ilyas; Blanchard, Peter E R; Kennedy, Brendan J; Ling, Chris D; Jang, Ling-Yun; Kamiyama, Takashi; Miao, Ping; Torii, Shuki
2014-05-14
The structural, magnetic and electrical properties of the mixed Ti-Mn oxides Sr(1-x)La(x)Ti(0.5)Mn(0.5)O3 (0 ≤ x ≤ 0.5) are reported. At room temperature the oxides have a cubic structure in space group Pm3m for x ≤ 0.25 and rhombohedral in R3c for 0.3 ≤ x ≤ 0.50. X-ray absorption spectroscopic measurements demonstrate the addition of La(3+) is compensated by the partial reduction of Mn(4+) to Mn(3+). Variable temperature neutron diffraction measurements show that cooling Sr(0.6)La(0.4)Ti(0.5)Mn(0.5)O3 results in a first order transition from rhombohedra to an orthorhombic structure in Imma. Complex magnetic behaviour is observed. The magnetic behaviour of the mixed valent (Mn(3+/4+)) examples is dominated by ferromagnetic interactions, although cation disorder frustrates long range magnetic ordering.
40 CFR 143.3 - Secondary maximum contaminant levels.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Secondary maximum contaminant levels... levels. The secondary maximum contaminant levels for public water systems are as follows: Contaminant Level Aluminum 0.05 to 0.2 mg/l. Chloride 250 mg/l. Color 15 color units. Copper 1.0 mg/l. Corrosivity...
Dinga, Jerome Nyhalah; Wamalwa, Mark; Njimoh, Dieudonné Lemuh; Njahira, Moses N; Djikeng, Appolinaire; Skilton, Rob; Titanji, Vincent Pryde Kehdingha; Pellé, Roger
2015-01-01
East Coast fever, a devastating disease of cattle, can be controlled partially by vaccination with live T. parva sporozoites. The antigens responsible for conferring immunity are not fully characterized. Recently it was shown that the P. falciparum immunodominant protein UB05 is highly conserved in T. parva, the causative agent of East Coast fever. The aim of the present investigation was to determine the role of the homologue TpUB05 in protective immunity to East Coast fever. The cloning, sequencing and expression of TpUB05 were done according to standard protocols. Bioinformatics analysis of TpUB05 gene was carried out using algorithms found in the public domain. Polyclonal antiserum against recombinant TpUB05 were raised in rabbits and used for further analysis by Western blotting, ELISA, immunolocalization and in vitro infection neutralization assay. The ability of recombinant TpUB05 (r-TpUB05) to stimulate bovine PBMCs ex-vivo to produce IFN-γ or to proliferate was tested using ELISpot and [3H]-thymidine incorporation assays, respectively. All the 20 cattle immunised by the infection and treatment method (ITM) developed significantly higher levels of TpUB05 specific antibodies (p<0.0001) compared to the non-vaccinated ones. Similarly, r-TpUB05 highly stimulated bovine PMBCs from 8/12 (67%) of ITM-immunized cattle tested to produce IFN-γ and proliferate (p< 0.029) as compared to the 04 naїve cattle included as controls. Polyclonal TpUB05 antiserum raised against r-TpUB05 also marginally inhibited infection (p < 0.046) of bovine PBMCs by T. parva sporozoites. In further experiments RT-PCR showed that the TpUB05 gene is expressed by the parasite. This was confirmed by immunolocalization studies which revealed TpUB05 expression by schizonts and piroplasms. Bioinformatics analysis also revealed that this antigen possesses two transmembrane domains, a N-glycosylation site and several O-glycosylation sites. It was concluded that TpUB05 is a potential marker of
Soler, Marçal; Camargo, Eduardo Leal Oliveira; Carocha, Victor; Cassan-Wang, Hua; San Clemente, Hélène; Savelli, Bruno; Hefer, Charles A; Paiva, Jorge A Pinto; Myburg, Alexander A; Grima-Pettenati, Jacqueline
2015-06-01
The R2R3-MYB family, one of the largest transcription factor families in higher plants, controls a wide variety of plant-specific processes including, notably, phenylpropanoid metabolism and secondary cell wall formation. We performed a genome-wide analysis of this superfamily in Eucalyptus, one of the most planted hardwood trees world-wide. A total of 141 predicted R2R3-MYB sequences identified in the Eucalyptus grandis genome sequence were subjected to comparative phylogenetic analyses with Arabidopsis thaliana, Oryza sativa, Populus trichocarpa and Vitis vinifera. We analysed features such as gene structure, conserved motifs and genome location. Transcript abundance patterns were assessed by RNAseq and validated by high-throughput quantitative PCR. We found some R2R3-MYB subgroups with expanded membership in E. grandis, V. vinifera and P. trichocarpa, and others preferentially found in woody species, suggesting diversification of specific functions in woody plants. By contrast, subgroups containing key genes regulating lignin biosynthesis and secondary cell wall formation are more conserved across all of the species analysed. In Eucalyptus, R2R3-MYB tandem gene duplications seem to disproportionately affect woody-preferential and woody-expanded subgroups. Interestingly, some of the genes belonging to woody-preferential subgroups show higher expression in the cambial region, suggesting a putative role in the regulation of secondary growth. © 2014 The Authors New Phytologist © 2014 New Phytologist Trust.
Study of structural and magnetic characterization of polycrystalline Y0.5Ho0.5CrO3
NASA Astrophysics Data System (ADS)
Mall, Ashish Kumar; Garg, Ashish; Gupta, Rajeev
2018-05-01
A polycrystalline ceramic sample of Y0.5Ho0.5CrO3 was studied using powder X-ray diffraction, Raman spectroscopic and dc magnetometry measurement to understand the structural and magnetic properties. The Rietveld refinement of X-ray data suggests sample crystallized in Pnma orthorhombic structure without formation of any secondary phases confirming their phase-pure nature. However, Raman study shows a prominent effect of Ho doping in low wavenumber Raman active phonon modes. Further, M-T measurement shows magnetic phase transition (TN) at 141 K and a negative value of Curie-Weiss temperature suggesting an antiferromagnetic system. Subsequent, the appearance of the clear opening in the M-H loop below TN is an evidence of the appearance of a weak ferromagnetic component in the low- temperature regime while the magnetization increases linearly in the high magnetic field regime suggest antiferromagnetic component.
Up-Regulation of miR-21, miR-25, miR-93, and miR-106b in Gastric Cancer
LArki, Pegah; Ahadi, Alireza; Zare, Ali; Tarighi, Shahriar; Zaheri, Mahrokh; Souri, Mojgan; Zali, Mohammad Reza; Ghaedi, Hamid; Omrani, Mir Davood
2018-06-03
Differential expression profile of microRNAs (miRNAs) could be a diagnosis signature for the monitoring of gastric cancer (GC) progression. In this study, we focus on the comparison of expression levels of miR-21, miR-25, miR-93, miR-106b, and miR-375 during the sequential pattern of GC development, including normal gastric, gastric dysplasia, and GC sample. We used SYBR Green-based quantitative-PCR to quantify miRNAs expression. Our analysis revealed the increased expression levels of miR-21 (p = 0.034), miR-25 (p = 0.0003) miR-93 (p = 0.0406), and miR-106b (p = 0.023) in GC samples. In addition, GC patients with positive lymph node metastasis showed the up-regulation of miR-25, miR-93, and miR-106b (p < 0.05). Our findings suggested that miR-21, miR-25, miR-93, and miR-106b altered expression in GC, and some of them may be further investigated as biomarkers for GC early detection and prognosis prediction.
EVALUATION OF SECONDARY ORGANIC AEROSOL FORMATION IN WINTER. (R823514)
Three different methods are used to predict secondary organic aerosol (SOA)
concentrations in the San Joaquin Valley of California during the winter of 1995-1996 [Integrated
Monitoring Study, (IMS95)]. The first of these methods estimates SOA by using elemental carbon as
Odorico, D M; Miller, D J
1997-01-01
Since both internal (class-level) and external relationships of the Cnidaria remain unclear on the basis of analyses of 18S and (partial) 16S rDNA sequence data, we examined the informativeness of the 5'-end of the 23S-like rDNA. Here we describe analyses of both primary and predicted secondary structure data for this region from the ctenophore Bolinopsis sp., the placozoan Trichoplax adhaerens, the sponge Hymeniacidon heliophila, and representatives of all four cnidarian classes. Primary sequence analyses clearly resolved the Cnidaria from other lower Metazoa, supported sister group relationships between the Scyphozoa and Cubozoa and between the Ctenophora and the Placozoa, and confirmed the basal status of the Anthozoa within the Cnidaria. Additionally, in the ctenophore, placozoan and sponge, non-canonical base pairing is required to maintain the secondary structure of the B12 region, whereas amongst the Cnidaria this is not the case. Although the phylogenetic significance of this molecular character is unclear, our analyses do not support the close relationship between Cnidaria and Placozoa suggested by previous studies. PMID:9061962
Mishra, Virendra K; Upadhyay, Alka R; Tripathi, B D
2009-09-01
Four crop plants Oryza sativa (rice), Solanum melongena (brinjal), Spinacea oleracea (spinach) and Raphanus sativus (radish) were grown to study the impact of secondary treated municipal waste water irrigation. These plants were grown in three plots each of 0.5 ha, and irrigated with secondary treated waste water from a sewage treatment plant. Sludge from the same sewage treatment plant was applied as manure. Cultivated plants were analyzed for accumulation of heavy metals and pesticides. Results revealed the accumulation of six heavy metals cadmium (Cd), chromium (Cr), iron (Fe), copper (Cu), nickel (Ni), and zinc (Zn) as well as two pesticides [1,1-bis(p-chlorophenyl)-2,2,2-trichloroethane; DDT] and benzene hexa chloride (BHC). Order of the plants for the extent of bioaccumulation was S. oleracea > R. sativus > S. melongena > O. sativa. The study has shown the secondary treated waste water can be a source of contamination to the soil and plants.
NASA Astrophysics Data System (ADS)
Ha, Sang Bu; Cho, Pyeong-Seok; Cho, Yoon Ho; Lee, Dokyol; Lee, Jong-Heun
A range of La 0.75Sr 0.25Cr 0.5Mn 0.5O 3- δ (LSCM) powders is prepared by the carbonate coprecipitation method for use as anodes in solid oxide fuel cells. The supersaturation ratio (R = [(NH 4) 2CO 3]/([La 3+] + [Sr 2+] + [Cr 3+] + [Mn 2+])) during the coprecipitation determines the relative compositions of La, Sr, Cr, and Mn. The composition of the precursor approaches the stoichiometric one at the supersaturation range of 4 ≤ R ≤ 12.5, whereas Sr and Mn components are deficient at R < 4 and excessive at R = 25. The fine and phase-pure LSCM powders are prepared by heat treatment at very low temperature (1000 °C) at R = 7.5 and 12.5. By contrast, the solid-state reaction requires a higher heat-treatment temperature (1400 °C). The catalytic activity of the LSCM electrodes is enhanced by using carbonate-derived powders to manipulate the electrode microstructures.
Air Data Report Improves Flight Safety
NASA Technical Reports Server (NTRS)
2007-01-01
NASA's Aviation Safety Program in the NASA Aeronautics Research Mission Directorate, which seeks to make aviation safer by developing tools for flight data analysis and interpretation and then by transferring these tools to the aviation industry, sponsored the development of Morning Report software. The software, created at Ames Research Center with the assistance of the Pacific Northwest National Laboratory, seeks to detect atypicalities without any predefined parameters-it spots deviations and highlights them. In 2004, Sagem Avionics Inc. entered a licensing agreement with NASA for the commercialization of the Morning Report software, and also licensed the NASA Aviation Data Integration System (ADIS) tool, which allows for the integration of data from disparate sources into the flight data analysis process. Sagem Avionics incorporated the Morning Report tool into its AGS product, a comprehensive flight operations monitoring system that helps users detect irregular or divergent practices, technical flaws, and problems that might develop when aircraft operate outside of normal procedures. Sagem developed AGS in collaboration with airlines, so that the system takes into account their technical evolutions and needs, and each airline is able to easily perform specific treatments and to build its own flight data analysis system. Further, the AGS is designed to support any aircraft and flight data recorders.
Clinical effectiveness of secondary interventions for restenosis after renal artery stenting
Simone, Thomas A.; Brooke, Benjamin S.; Goodney, Philip P.; Walsh, Daniel B.; Stone, David H.; Powell, Richard J.; Cronenwett, Jack L.; Nolan, Brian W.
2013-01-01
Objective Secondary interventions for renal artery restenosis (RAS) after renal artery stenting are common, despite limited data about their effectiveness. This study was designed to evaluate the outcomes of endovascular treatment of recurrent RAS. Methods We conducted a retrospective review of patients who underwent renal artery stenting between 2001 and 2011 at Dartmouth-Hitchcock Medical Center. Patients who required secondary interventions were compared with control patients who underwent only primary interventions for RAS. Multivariate regression models were used to identify factors associated with successful outcomes, as measured by changes in blood pressure, estimated glomerular filtration rate, and number of antihypertensive medications required. Results Sixty-five secondary (57 patients) renal interventions were undertaken for recurrent RAS associated with progressive hypertension or renal dysfunction and compared with outcomes after 216 primary (180 patients) renal artery stenting procedures. Patients undergoing primary vs secondary interventions did not differ significantly in the number of preoperative antihypertensive medications used, comorbid conditions, or blood pressure. All primary and secondary interventions were performed with stents and showed no difference in procedural complications. At a mean follow-up of 23 months (range, 1–128 months), similar improvements in renal function and blood pressure were found between patients undergoing primary and secondary interventions, and there was no difference in rates of restenosis or survival between cohorts. Regression models showed that the use of embolic protection devices was associated with improved renal function after primary (odds ratio [OR], 2.0; 95% confidence interval [CI], 1.1–3.8; P < .05) and secondary (OR, 4.7; 95% CI, 1.7–12.5; P < .05) interventions, whereas statin therapy was associated with improved renal (OR, 2.0; 95% CI, 1.3–3.2; P < .05) and blood pressure response (OR, 4
Dinga, Jerome Nyhalah; Wamalwa, Mark; Njimoh, Dieudonné Lemuh; Njahira, Moses N.; Djikeng, Appolinaire; Skilton, Rob; Titanji, Vincent Pryde Kehdingha; Pellé, Roger
2015-01-01
Introduction East Coast fever, a devastating disease of cattle, can be controlled partially by vaccination with live T. parva sporozoites. The antigens responsible for conferring immunity are not fully characterized. Recently it was shown that the P. falciparum immunodominant protein UB05 is highly conserved in T. parva, the causative agent of East Coast fever. The aim of the present investigation was to determine the role of the homologue TpUB05 in protective immunity to East Coast fever. Methods The cloning, sequencing and expression of TpUB05 were done according to standard protocols. Bioinformatics analysis of TpUB05 gene was carried out using algorithms found in the public domain. Polyclonal antiserum against recombinant TpUB05 were raised in rabbits and used for further analysis by Western blotting, ELISA, immunolocalization and in vitro infection neutralization assay. The ability of recombinant TpUB05 (r-TpUB05) to stimulate bovine PBMCs ex-vivo to produce IFN-γ or to proliferate was tested using ELISpot and [3H]-thymidine incorporation assays, respectively. Results All the 20 cattle immunised by the infection and treatment method (ITM) developed significantly higher levels of TpUB05 specific antibodies (p<0.0001) compared to the non-vaccinated ones. Similarly, r-TpUB05 highly stimulated bovine PMBCs from 8/12 (67%) of ITM-immunized cattle tested to produce IFN-γ and proliferate (p< 0.029) as compared to the 04 naїve cattle included as controls. Polyclonal TpUB05 antiserum raised against r-TpUB05 also marginally inhibited infection (p < 0.046) of bovine PBMCs by T. parva sporozoites. In further experiments RT-PCR showed that the TpUB05 gene is expressed by the parasite. This was confirmed by immunolocalization studies which revealed TpUB05 expression by schizonts and piroplasms. Bioinformatics analysis also revealed that this antigen possesses two transmembrane domains, a N-glycosylation site and several O-glycosylation sites. Conclusion It was concluded
Learning Strategies: Secondary LD Students in the Mainstream.
ERIC Educational Resources Information Center
D'Antoni, Alice; And Others
The paper presents four learning strategy techniques--the SQ3R method of study, the Multipass Strategy, the Advanced Study Guide Technique, and Cognitive Mapping--for use with secondary level learning disabled students. The SQ3R method involves the five steps of survey, question, read, recite, and review. An adaption of the SQ3R method, the…
Contributions of tidal lung inflation to human R-R interval and arterial pressure fluctuations
NASA Technical Reports Server (NTRS)
Koh, J.; Brown, T. E.; Beightol, L. A.; Eckberg, D. L.
1998-01-01
We studied the effects of mechanical lung inflation on respiratory frequency R-R interval and arterial pressure fluctuations in nine healthy young adults undergoing elective orthopedic surgery. We conducted this research to define the contribution of pulmonary and thoracic stretch receptor input to respiratory sinus arrhythmia. We compared fast Fourier transform spectral power during three modes of ventilation: (1) spontaneous, frequency-controlled (0.25 Hz) breathing, (2) intermittent positive pressure ventilation (0.25 Hz, with a tidal volume of 8 ml/kg) and (3) high frequency jet ventilation (5.0 Hz, 2.5 kg/cm2), after sedation and vecuronium paralysis. Mean R-R intervals, arterial pressures and arterial blood gas levels were comparable during all three breathing conditions. Respiratory frequency systolic pressure spectral power was comparable during spontaneous breathing and conventional mechanical ventilation, but was significantly reduced during high frequency jet ventilation (P < 0.05). Respiratory frequency R-R interval spectral power (used as an index of respiratory sinus arrhythmia) declined dramatically with sedation and muscle paralysis (P < 0.05), but was greater during conventional mechanical, than high frequency jet ventilation (P < 0.05). These results suggest that although phasic inputs from pulmonary and thoracic stretch receptors make a statistically significant contribution to respiratory sinus arrhythmia, that contribution is small.
1-Hz rTMS in the treatment of tinnitus: A sham-controlled, randomized multicenter trial.
Landgrebe, Michael; Hajak, Göran; Wolf, Stefan; Padberg, Frank; Klupp, Philipp; Fallgatter, Andreas J; Polak, Thomas; Höppner, Jacqueline; Haker, Rene; Cordes, Joachim; Klenzner, Thomas; Schönfeldt-Lecuona, Carlos; Kammer, Thomas; Graf, Erika; Koller, Michael; Kleinjung, Tobias; Lehner, Astrid; Schecklmann, Martin; Pöppl, Timm B; Kreuzer, Peter; Frank, Elmar; Langguth, Berthold
Chronic tinnitus is a frequent, difficult to treat disease with high morbidity. This multicenter randomized, sham-controlled trial investigated the efficacy and safety of 1-Hz repetitive transcranial magnetic stimulation (rTMS) applied to the left temporal cortex in patients with chronic tinnitus. Tinnitus patients were randomized to receive 10 sessions of either real or sham 1-Hz-rTMS (2000 stimuli, 110% motor threshold) to the left temporal cortex. The primary outcome was the change in the sum score of the tinnitus questionnaire (TQ) of Goebel and Hiller from baseline to end of treatment. A total of 163 patients were enrolled in the study (real rTMS: 75; sham rTMS: 78). At day 12, the baseline mean of 43.1 TQ points in 71 patients assigned to real rTMS changed by -0.5 points; it changed by 0.5 points from a baseline of 42.1 in 75 patients randomized to sham rTMS (adjusted mean difference between groups: -1.0; 95.19% confidence interval: -3.2 to 1.2; p = 0.36). All secondary outcome measures including measures of depression and quality of life showed no significant differences either (p > 0.11). The number of participants with side-effects or adverse events did not differ between groups. Real 1-Hz-rTMS over the left temporal cortex was well tolerated but not superior compared with sham rTMS in improving tinnitus severity. These findings are in contrast to results from studies with smaller sample sizes and put the efficacy of this rTMS protocol for treatment of chronic tinnitus into question. Controlled Trials: http://www.isrctn.com/ISRCTN89848288. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Fox, G. E.
1985-01-01
Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.
MRI assessment of pituitary iron accumulation by using pituitary-R2 in β-thalassemia patients.
Bozdağ, Mustafa; Bayraktaroğlu, Selen; Aydınok, Yeşim; Çallı, Mehmet Cem
2018-06-01
Background Patients with thalassemia major (TM) require repeated blood transfusions, which leads to accumulation of iron in a wide variety of tissues. Accumulation of iron in the pituitary gland can lead to irreversible hypogonadotropic hypogonadism (HH) in this group of patients. Purpose To investigate the reliability of pituitary-R2 as a marker to estimate the extent of pituitary iron load by comparing the pituitary magnetic resonance imaging (MRI) findings with hepatic iron load and serum ferritin levels. Material and Methods A total of 38 β-TM patients were classified into HH (group A, n = 18) and non-HH (group B, n = 17) groups. A third group, group C, consisted of 17 healthy participants. Each participant underwent 1.5-T MRI examinations. Pituitary gland heights (PGH), pituitary-R2 values, and liver-R2 values were measured by using multi-echo spin-echo sequences. Results Pituitary-R2 values were significantly higher in group A compared with group B ( P < 0.05). A positive correlation was detected between the pituitary-R2 values and serum ferritin levels in TM patients ( P < 0.01). A threshold value of 14.1 Hz for pituitary-R2 was found to give a high specificity and sensitivity in distinguishing the TM patients with HH from those with normal pituitary functions. PGH measurements were significantly lower in group A compared with group B ( P < 0.05). Conclusion MRI-assessed pituitary-R2 seems to be a reliable marker for differentiating the TM patients with normal pituitary function from those with secondary hypogonadism due to iron toxicity.
NASA Astrophysics Data System (ADS)
Dubinin, S. F.; Sokolov, V. I.; Parkhomenko, V. D.; Teploukhov, S. G.; Gruzdev, N. B.
2008-12-01
The magnetic state and the structure of a Zn1 - x Ni x Se ( x = 0.0025) bulk crystal were studied at low temperatures. It is revealed that the magnetic and crystal structures below T ≅ 15 K are dependent on the cooling rate of this dilute semiconductor. For example, on fast cooling to 4.2 K, about 10% hexagonal ferromagnetic phase is formed in the crystal. During heating, the phase disappears at T ≅ 15 K. The results obtained are discussed with allowance for the specific features of the Jahn-Teller distortions in this compound.
Sabri, Ahmed; Leroy, Pascal; Haubruge, Eric; Hance, Thierry; Frère, Isabelle; Destain, Jacqueline; Thonart, Philippe
2011-09-01
An intracellular symbiotic bacterium was isolated from the flora of a natural clone of the black bean aphid Aphis fabae. The strain was able to grow freely in aerobic conditions on a rich medium containing 1 % of each of the following substrates: glucose, yeast extract and casein peptone. Pure culture was achieved through the use of solid-phase culture on the same medium and the strain was designated CWBI-2.3(T). 16S rRNA gene sequence analysis revealed that strain CWBI-2.3(T) was a member of the class Gammaproteobacteria, having high sequence similarity (>99 %) with 'Candidatus Serratia symbiotica', the R-type of secondary endosymbiont that is found in several aphid species. As strain CWBI-2.3(T) ( = LMG 25624(T) = DSM 23270(T)) was the first R-type symbiont to be isolated and characterized, it was designated as the type strain of Serratia symbiotica sp. nov.
Nanocrystalline (U0.5Ce0.5)O2±x solid solutions through citrate gel-combustion
NASA Astrophysics Data System (ADS)
Maji, D.; Ananthasivan, K.; Venkata Krishnan, R.; Balakrishnan, S.; Amirthapandian, S.; Joseph, Kitheri; Dasgupta, Arup
2018-04-01
Nanocrystalline powders of (U0.5Ce0.5)O2±x solid solutions were synthesized in bulk (100-200 g) through the citrate gel combustion. The fuel (citric acid) to oxidant (nitrate) mole ratio (R) was varied from 0.1 to 1.0. Two independent lots of the products obtained through the gel-combustion were calcined at 973 K in air and in a mixture of argon containing 8% H2 respectively. All these powders were characterized for their bulk density, X-ray crystallite size, specific surface area, size distribution of the particles, porosity as well as residual carbon. The morphology and microstructures of these powders were studied by using scanning electron microscopy (SEM) and transmission electron microscopy (TEM) respectively. Nanocrystalline single phase fluorite solid solutions having a typical crystallite size of about (7-15 nm) were obtained. These powders were highly porous comprising cuboidal flaky agglomerates. The combustion mixture with an 'R' value of 0.25 was found to undergo volume combustion and was found to yield a product that was distinctly different. The systematic investigation on synthesis and characterization of nanocrystalline UCeO2 is reported for the first time.
Martino, Francesco; Carlomosti, Fabrizio; Avitabile, Daniele; Persico, Luca; Picozza, Mario; Barillà, Francesco; Arca, Marcello; Montali, Anna; Martino, Eliana; Zanoni, Cristina; Parrotto, Sandro; Magenta, Alessandra
2015-12-01
Hypercholesterolaemia is one of the major causes of CVD (cardiovascular disease). It is associated with enhanced oxidative stress, leading to increased lipid peroxidation which in turn determines endothelial dysfunction and susceptibility to coronary vasoconstriction and atherosclerosis. Different miRNAs are involved in the pathogenesis of CVD and play an important role in inflammatory process control, therefore, together with atherogenic factors, they can stimulate atherosclerotic degeneration of the vessel walls of arteries. miR-33a and miR-33b play a pivotal role in a variety of biological processes including cholesterol homoeostasis, HDL (high-density lipoprotein)-cholesterol formation, fatty acid oxidation and insulin signalling. Our study aimed to determine whether circulating miR-33a and miR-33b expression was altered in familial hypercholesterolaemic children. Total RNA was extracted from plasma, and miR-33a and miR-33b were measured by quantitative real-time PCR. We found that miR-33a and miR-33b were significantly up-regulated in the plasma of 28 hypercholesterolaemic children compared with 25 healthy subjects (4.49±0.27-fold increase, P<0.001, and 3.21±0.39-fold increase, P<0.05 respectively), and for both miRNAs, a positive correlation with total cholesterol, LDL (low-density lipoprotein)-cholesterol, LDL-cholesterol/HDL-cholesterol ratio, apolipoprotein B, CRP (C-reactive protein) and glycaemia was found. OLS (ordinary least squares) regression analysis revealed that miR-33a was significantly affected by the presence of FH (familial hypercholesterolaemia), glycaemia and CRP (P<0.001, P<0.05 and P<0.05 respectively). The same analysis showed that miR-33b was significantly related to FH and CRP (P<0.05 and P<0.05 respectively). Although it is only explorative, the present study could be the first to point to the use of miR-33a and miR-33b as early biomarkers for cholesterol levels in childhood, once validated in independent larger cohorts. © 2015
1SWASP J200503.05-343726.5: A high mass ratio eclipsing binary near the period limit
NASA Astrophysics Data System (ADS)
Bin, Zhang; Shengbang, Qian; Zejda, Miloslav; Liying, Zhu; Nianping, Liu
2017-07-01
First CCD photometric light curves of the eclipsing binary system 1SWASP J200503.05-343726.5 are presented. Our complete light curves in V, R and I bands using the Bessell filter show an out-of-eclipsing distortion, which means that the components of the system may be active. The preliminary photometric solutions with a cool star-spot are derived by using the 2013 version of the Wilson-Devinney (W-D) code. The photometric solutions suggest that 1SWASP J200503.05-343726.5 is a shallow-contact eclipsing binary(f = 9.0 %) with a mass ratio of q = 1.0705 , which is very high for late-type binary systems near the period limit. The primary component is about 230 K hotter than the secondary component. Based on our new CCD eclipse times, the orbital period change was analyzed. According to O - C diagram, the orbital period of the 1SWASP J200503.05-343726.5 shows an increase at a rate of P˙ = + 5.43 ×10-8 days year-1. The period increase may be caused by mass transfer from the less massive component to the more massive one. This shallow-contact system may be formed from a detached short-period binary via orbital shrinkage because of dynamical interactions with a third component or by magnetic braking.
Code of Federal Regulations, 2011 CFR
2011-07-01
... (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS FERTILIZER MANUFACTURING POINT SOURCE CATEGORY Ammonia...— Metric units (kilograms per 1,000 kg of product) Ammonia (as N) 0.05 0.025 English units (pounds per 1,000 lb of product) Ammonia (as N) 0.05 0.025 [51 FR 24999, July 9, 1986] ...
Code of Federal Regulations, 2014 CFR
2014-07-01
... (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS FERTILIZER MANUFACTURING POINT SOURCE CATEGORY Ammonia...— Metric units (kilograms per 1,000 kg of product) Ammonia (as N) 0.05 0.025 English units (pounds per 1,000 lb of product) Ammonia (as N) 0.05 0.025 [51 FR 24999, July 9, 1986] ...
Code of Federal Regulations, 2013 CFR
2013-07-01
... (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS FERTILIZER MANUFACTURING POINT SOURCE CATEGORY Ammonia...— Metric units (kilograms per 1,000 kg of product) Ammonia (as N) 0.05 0.025 English units (pounds per 1,000 lb of product) Ammonia (as N) 0.05 0.025 [51 FR 24999, July 9, 1986] ...
Code of Federal Regulations, 2010 CFR
2010-07-01
... (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS FERTILIZER MANUFACTURING POINT SOURCE CATEGORY Ammonia...— Metric units (kilograms per 1,000 kg of product) Ammonia (as N) 0.05 0.025 English units (pounds per 1,000 lb of product) Ammonia (as N) 0.05 0.025 [51 FR 24999, July 9, 1986] ...
Code of Federal Regulations, 2012 CFR
2012-07-01
... (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS FERTILIZER MANUFACTURING POINT SOURCE CATEGORY Ammonia...— Metric units (kilograms per 1,000 kg of product) Ammonia (as N) 0.05 0.025 English units (pounds per 1,000 lb of product) Ammonia (as N) 0.05 0.025 [51 FR 24999, July 9, 1986] ...
Guo, Q L; Liang, B L; Wang, Y; Deng, G Y; Jiang, Y H; Zhang, S H; Fu, G S; Simmonds, P J
2014-10-01
The propagation characteristics of a focused laser beam in a SBN:75 photorefractive crystal strongly depend on the signal-to-background intensity ratio (R=Is/Ib) under reverse external electric field. In the range 20>R>0.05, the laser beam shows enhanced self-defocusing behavior with increasing external electric field, while it shows self-focusing in the range 0.03>R>0.01. Spatial solitons are observed under a suitable reverse external electric field for R=0.025. A theoretical model is proposed to explain the experimental observations, which suggest a new type of soliton formation due to "enhancement" not "screening" of the external electrical field.
Freeman, Scott A; Moon, Summer D; Spencer, James M
2012-12-01
Rosacea is a common, chronic, and poorly understood dermatological condition characterized by an inflammatory component composed of papules and pustules and a vascular component composed of flushing and erythema. Current treatment options include topical, systemic, and light-based methods, each of which focuses on either the inflammatory or the vascular component. Retinoids are not routinely indicated as treatment because of the common conception that they would be too inflammatory for the sensitive rosacea patient. However, photodamage may play a role in rosacea and tretinoin is well-known to repair photodamage. Thirty rosacea subjects were enrolled to assess their response to the use of clindamycin phosphate 1.2% and tretinoin 0.025% gel (ZIANA; Medicis Pharmaceutical Corporation, Scottsdale, AZ) for a period of 12 weeks. The results showed a dramatic decrease in pustules and papules without any significant inflammation or overall intolerance. No improvement in facial redness was achieved. Based on our results, more investigation of topical retinoids for rosacea treatment is prudent.
Zhao, Qiao; Zeng, Yining; Yin, Yanbin; ...
2014-08-05
In this paper, pinoresinol reductase (PrR) catalyzes the conversion of the lignan (-)-pinoresinol to (-)-lariciresinol in Arabidopsis thaliana, where it is encoded by two genes, PrR1 and PrR2, that appear to act redundantly. PrR1 is highly expressed in lignified inflorescence stem tissue, whereas PrR2 expression is barely detectable in stems. Co-expression analysis has indicated that PrR1 is co-expressed with many characterized genes involved in secondary cell wall biosynthesis, whereas PrR2 expression clusters with a different set of genes. The promoter of the PrR1 gene is regulated by the secondary cell wall related transcription factors SND1 and MYB46. The loss-of-function mutantmore » of PrR1 shows, in addition to elevated levels of pinoresinol, significantly decreased lignin content and a slightly altered lignin structure with lower abundance of cinnamyl alcohol end groups. Stimulated Raman scattering (SRS) microscopy analysis indicated that the lignin content of the prr1-1 loss-of-function mutant is similar to that of wild-type plants in xylem cells, which exhibit a normal phenotype, but is reduced in the fiber cells. Finally, together, these data suggest an association of the lignan biosynthetic enzyme encoded by PrR1 with secondary cell wall biosynthesis in fiber cells.« less
Manufacturing of glassy thin shell for adaptive optics: results achieved
NASA Astrophysics Data System (ADS)
Poutriquet, F.; Rinchet, A.; Carel, J.-L.; Leplan, H.; Ruch, E.; Geyl, R.; Marque, G.
2012-07-01
Glassy thin shells are key components for the development of adaptive optics and are part of future & innovative projects such as ELT. However, manufacturing thin shells is a real challenge. Even though optical requirements for the front face - or optical face - are relaxed compared to conventional passive mirrors, requirements concerning thickness uniformity are difficult to achieve. In addition, process has to be completely re-defined as thin mirror generates new manufacturing issues. In particular, scratches and digs requirement is more difficult as this could weaken the shell, handling is also an important issue due to the fragility of the mirror. Sagem, through REOSC program, has recently manufactured different types of thin shells in the frame of European projects: E-ELT M4 prototypes and VLT Deformable Secondary Mirror (VLT DSM).
Microstructural, optical and electrical properties of LaFe0.5Cr0.5O3 perovskite nanostructures
NASA Astrophysics Data System (ADS)
Ali, S. Asad; Naseem, Swaleha; Khan, Wasi; Sharma, A.; Naqvi, A. H.
2016-05-01
Perovskite nanocrystalline powder of LaFe0.5Cr0.5O3 was synthesized by sol-gel combustion route and characterized by x-ray diffractometer (XRD), scanning electron microscopy (SEM) equipped with EDS, UV-visible and LCR meter at room temperature Rietveld refinement of the XRD data confirms that the sample is in single phase-rhombohedral structure with space group R-3C. SEM micrograph shows clear nanostructure of the sample and EDS ensures the presence of all elements in good stoichiometric. The optical absorption indicates the maximum absorption at 315 nm and optical band gap of 2.94 eV was estimated using Tauc's relation. Dielectric constant (ɛ') and loss were found to decrease with increase in frequencies. The dielectric behavior was explained on the basis of Maxwell-Wagner's two layer model.
Muto, Mario; Frauenfelder, Giulia; Senese, Rossana; Zeccolini, Fabio; Schena, Emiliano; Giurazza, Francesco; Jäger, Hans Rolf
2018-07-01
Distinction between treatment-related changes and tumour recurrence in patients who have received radiation treatment for brain metastases can be difficult on conventional MRI. In this study, we investigated the ability of dynamic susceptibility contrast (DSC) perfusion in differentiating necrotic changes from pathological angiogenesis and compared measurements of relative cerebral blood volume (rCBV), relative cerebral blood flow (rCBF) and K2, using a dedicated software. Twenty-nine patients with secondary brain tumors were included in this retrospective study and underwent DSC perfusion MRI with a 3-month follow-up imaging after chemo- or radiation-therapy. Region-of-interests were drawn around the contrast enhancing lesions and measurements of rCBV, rCBF and K2 were performed in all patients. Based on subsequent histological examination or clinico-radiological follow-up, the cohort was divided in two groups: recurrent disease and stable disease. Differences between the two groups were analyzed using the Student's t test. Sensitivity, specificity and diagnostic accuracy of rCBV measurements were analyzed considering three different cut-off values. Between patients with and without disease, only rCBV and rCBF values were significant (p < 0.05). The only cut-off value giving the best diagnostic accuracy of 100% was rCBV = 2.1 (sensitivity = 100%; specificity = 100%). Patients with tumor recurrence showed a higher mean value of rCBV (mean = 4.28, standard deviation = 2.09) than patients with necrotic-related changes (mean = 0.77, standard deviation = 0.44). DSC-MRI appears a clinically useful method to differentiate between tumor recurrence, tumor necrosis and pseudoprogression in patients treated for cerebral metastases. Relative CBV using a cut-off value of 2.1 proved to be the most accurate and reliable parameter.
Chen, Chang-Qing; Yi, Qing-Tong; Chen, Chu-Hong; Gong, Min
2016-08-01
Objective To evaluate the effect of interventions for premature ejaculation (PE) in the management of patients with chronic prostatitis and secondary premature ejaculation. Methods Totally 90 patients diagnosed as chronic prostatitis with PE were randomly divided into control group (n=45) and interventional group (n=45). Control group received a conventional therapy consisted of oral administration of antibiotics,α-receptor blocker,and proprietary Chinese medicine for clearing away heat and promoting diuresis. Interventional group received a conventional therapy combined with treatment for ameliorating the PE symptom (oral dapoxetine on-demand and ejaculation control exercise).National Institutes of Health Chronic Prostatitis Symptom Index (NIH-CPSI),Chinese Index of Sexual Function for Premature Ejaculation (CIPE)-5 questionnaires,intravaginal ejaculatory latency time,and the number of coituses per week were applied for evaluating the treatment outcomes. Results Follow-up was accomplished in 35 and 38 patients in the control and interventional group.The CIPE-5 score,intravaginal ejaculatory latency time,and the number of coituses per week were significantly improved in both two groups but more significantly in interventional group (all P<0.05). The NIH-CPSI pain,urination,and quality of life subscores and total score were improved significantly in both two groups after treatment,but the NIH-CPSI pain and quality of life subscores had been improved more significantly in the interventional group (all P<0.05). The variation of NIH-CPSI was negatively correlated with that of CIPE-5 in both two groups (r=-0.362,P=0.016;r=-0.330,P=0.021). Conclusions For CP with secondary PE patients,the interventions for PE can not only improve the quality of sexual life but also help improve the NIH-CPSI pain and quality of life subscores. PE should be routinely screened and treated during the management of CP.p.
NASA Technical Reports Server (NTRS)
Chen, C. L.; Feng, H. H.; Zhang, Z.; Brazdeikis, A.; Miranda, F. A.; VanKeuls, F. W.; Romanofsky, R. R.; Huang, Z. J.; Liou, Y.; Chu, W. K.;
1999-01-01
Perovskite Ba(0.5)SR(0.5)TiO3 thin films have been synthesized on (001) LaAl03 substrates by pulsed laser ablation. Extensive X-ray diffraction, rocking curve, and pole-figure studies suggest that the films are c-axis oriented and exhibit good in-plane relationship of <100>(sub BSTO)//<100>(sub LAO). Rutherford Backscattering Spectrometry studies indicate that the epitaxial films have excellent crystalline quality with an ion beam minimum yield chi(sub min) Of only 2.6 %. The dielectric property measurements by the interdigital technique at 1 MHz show room temperature values of the relative dielectric constant, epsilon(sub r), and loss tangent, tan(sub delta), of 1430 and 0.007 with no bias, and 960 and 0.001 with 35 V bias, respectively. The obtained data suggest that the as-grown Ba(0.5)SR(0.5)TiO3 films can be used for development of room-temperature high-frequency tunable elements.
High P-T Raman study of transitions in relaxor multiferroic Pb(Fe 0.5Nb 0.5)O 3
Wilfong, Brandon; Ahart, Muhtar; Gramsch, Stephen A.; ...
2015-09-02
The vibrational and structural properties of Pb(Fe 0.5Nb 0.5)O 3 have been investigated using Raman spectroscopy up to 40 GPa at 300 K and from 300 to 415 K at selected pressures. The measurements reveal three phase transitions at 5.5, 8.7 and 24 GPa at room temperature. The temperature dependences of the spectra indicated transitions at 1.5 GPa, at 335 and 365 K. The results support the appearance of an intermediate tetragonal P4mm phase between ferroelectric R3m and paraelectric Pm-3m phases. Furthermore, a P-T phase diagram is proposed that allows further insight into the magnetoelectric coupling present in this material.
Longhurst, John C.; Tjen-A-Looi, Stephanie C.; Fu, Liang-Wu
2016-01-01
The external lateral parabrachial nucleus (elPBN) within the pons and rostral ventrolateral medulla (rVLM) contributes to central processing of excitatory cardiovascular reflexes during stimulation of cardiac sympathetic afferent nerves (CSAN). However, the importance of elPBN cardiovascular neurons in regulation of rVLM activity during CSAN activation remains unclear. We hypothesized that CSAN stimulation excites the elPBN cardiovascular neurons and, in turn, increases rVLM activity through elPBN-rVLM projections. Compared with controls, in rats subjected to microinjection of retrograde tracer into the rVLM, the numbers of elPBN neurons double-labeled with c-Fos (an immediate early gene) and the tracer were increased after CSAN stimulation (P < 0.05). The majority of these elPBN neurons contain vesicular glutamate transporter 3. In cats, epicardial bradykinin and electrical stimulation of CSAN increased the activity of elPBN cardiovascular neurons, which was attenuated (n = 6, P < 0.05) after blockade of glutamate receptors with iontophoresis of kynurenic acid (Kyn, 25 mM). In separate cats, microinjection of Kyn (1.25 nmol/50 nl) into the elPBN reduced rVLM activity evoked by both bradykinin and electrical stimulation (n = 5, P < 0.05). Excitation of the elPBN with microinjection of dl-homocysteic acid (2 nmol/50 nl) significantly increased basal and CSAN-evoked rVLM activity. However, the enhanced rVLM activity induced by dl-homocysteic acid injected into the elPBN was reversed following iontophoresis of Kyn into the rVLM (n = 7, P < 0.05). These data suggest that cardiac sympathetic afferent stimulation activates cardiovascular neurons in the elPBN and rVLM sequentially through a monosynaptic (glutamatergic) excitatory elPBN-rVLM pathway. PMID:27225950
Onyeaso, C O
2003-04-01
To ascertain the correlation between self-esteem, orthodontic concern and orthodontic status using DAI scores in a group of Nigerian potential orthodontic patients. A cross-sectional analytical study. Secondary schools reflecting a good socio-economic spread of adolescents in the town. Randomly selected 520 junior and senior students 276 (53.1%) males and 244 (46.9%) females with mean age of 15.02 +/- 3.26 (SD) years participated in the study. Each student was asked to fill in the questionnaire on orthodontic concern and Global Negative Self-Evaluation scale (GSE) with subsequent assessment of the occlusion according to the DAI by one orthodontist. After obtaining consent, thirty students were re-examined to test intra-examiner reliability which was good (r = 0.98, P < 0.001). The correlations between self-esteem, orthodontic concern and DAI scores were tested using Spearman rank order correlation coefficient. Significant positive correlations were observed between self-esteem and orthodontic concern according to DAI treatment category needs (r = 0.274, p<0.01; r = 0.396, p<0.01; r = 0.347, p<0.05) except for the severe malocclusion group which was positive but not statistically significant (r = 0.136, p> 0.05). Significant correlation was equally noted between DAI scores and orthodontic concern (r = 0.191, p<0.01). Significant positive correlation existed between self-esteem in a group of Nigerian adolescents and their orthodontic concern as well as between their DAI scores and orthodontic concern. DAI should be a relevant and useful occlusal index for the Nigerian orthodontic population.
[Colonization of Porphyromonas endodontalis in primary and secondary endodontic infections].
Hong, Li; Hai, Ji; Yan-Yan, He; Shenghui, Yang; Benxiang, Hou
2015-02-01
This study aims to assess and compare the prevalence of Porphyromonas endodontalis (P. endodontalis) in root canals associated with primary and secondary endodontic infections by using 16s rDNA PCR and real-time fluorescence quantitative polymerase chain reaction (RTFQ-PCR). A total of 120 adult patients with one radiographically documented periapical lesion were included. Sixty teeth presented with primary endodontic infections and 60 with secondary endodontic infections requiring retreatment. P. endodontalis was identified by using 16s rDNA PCR techniques. The positive DNA expression of P. endodontalis in two types of infected root canals were quantitatively compared by using SYBR GREEN I RTFQ-PCR. The prevalence of P. endodontalis in the root canals with primary endodontic infections was significantly higher than that in root canals with secondary endodontic infections (P = 0.001). However, RTFQ-PCR results showed no significant difference in DNA expression quantities between the primary and secondary endodontic infections root canals (P = 0.303). P. endodontalis is more highly associated with root canals having primary endodontic infections, although P. endodontalis colonize in both root canals with primary and secondary chronic apical periodontitis.
Enhancement in electrical and magnetic properties with Ti-doping in Bi0.5La0.5Fe0.5Mn0.5O3
NASA Astrophysics Data System (ADS)
Singh, Rahul; Gupta, Prince Kumar; Kumar, Shiv; Joshi, Amish G.; Ghosh, A. K.; Patil, S.; Chatterjee, Sandip
2017-04-01
In this investigation, we have synthesized Bi0.5La0.5Fe0.5Mn0.5-xTixO3 (where x = 0 and 0.05) samples. The Rietveld refinement of X-ray diffraction (XRD) patterns shows that the systems crystallize in the orthorhombic phase with the Pnma space group. The observed Raman modes support the XRD results. The appearance of prominent A1-3 and weak E-2 modes in Bi0.5La0.5Fe0.5Mn0.45Ti0.05O3 indicates the presence of chemically more active Bi-O covalent bonds. Ferromagnetism of Bi0.5La0.5Fe0.5Mn0.5O3 is enhanced by Ti doping at the Mn-site, indicating that these particular samples might be interesting for device applications.
NASA Astrophysics Data System (ADS)
Murali, N.; Margarette, S. J.; Madhuri Sailaja, J.; Kondala Rao, V.; Himakar, P.; Kishore Babu, B.; Veeraiah, V.
2018-02-01
Layered Mg doped LiNi0.5Mn0.5O2 materials have been synthesized by sol-gel method. The physical properties of these materials were examined by XRD, FESEM and FT-IR studies. From XRD patterns, the phase formation of α-NaFeO2 layered structure with R\\bar 3m space group is confirmed. The surface morphology of the synthesized materials has been examined by FESEM analysis in which the average particle size is found to be about 2 - 2.5 µm. These materials show some changes in the local ion environment, as examined by FT-IR studies.
Salonia, Andrea; Clementi, Maria Chiara; Graziottin, Alessandra; Nappi, Rossella E; Castiglione, Fabio; Ferrari, Matteo; Capitanio, Umberto; Damiano, Rocco; Montorsi, Francesco
2013-09-01
Uncomplicated recurrent urinary tract infections (rUTIs) associated with uropathogenic Escherichia coli (UPEC) are common among healthy, reproductive-aged women. Provoked vestibulodynia (PVD) is a major reason of sexual pain in premenopausal women. The aim of this paper is to assess prevalence and predictors of secondary PVD in a cohort of Caucasian-European, heterosexual, sexually active, reproductive-aged women seeking medical help for rUTIs as their primary complaint. Clinical and psychometric variables for 60 consecutive patients with rUTIs were considered. Patients were assessed with a thorough medical and sexual history, a number of psychometric instruments, and a specific physical examination. Urinalysis and self-collected urine cultures from the previous 12 months were also examined. Descriptive statistics and logistic regression models were used to test the associations between secondary PVD and sociodemographic and clinical variables. Mean age was 34.2 years (median 33 years; range 21-42). Secondary PVD was found in 36 of 60 patients (60%). Women with PVD had a higher prevalence of urinary tract infections (UTIs) over the previous 12 months (χ(2) : 4.54; P = 0.03) and suffered more frequently from UPEC-related rUTIs (χ(2) : 5.92; P = 0.01) than those without PVD. Moreover, women with PVD showed significantly lower scores on Female Sexual Function Index domains (all P ≤ 0.01), as compared with PVD-negative women. UPEC-related rUTIs (odds ratio [OR]: 3.1; P = 0.01), six or more UTIs over the previous 12 months (OR: 2.8; P = 0.01), and treatment with three or more antibiotics throughout the same period (OR: 2.1; P = 0.04) emerged as independent predictors of PVD. Three of five Caucasian-European, heterosexual, sexually active women of reproductive age complaining of rUTIs as their primary disorder also suffer from secondary PVD. Uncomplicated UPEC-related rUTIs are more frequently associated with secondary PVD than are UTIs caused
Stevens, R Brian; Lane, James T; Boerner, Brian P; Miles, Clifford D; Rigley, Theodore H; Sandoz, John P; Nielsen, Kathleen J; Skorupa, Jill Y; Skorupa, Anna J; Kaplan, Bruce; Wrenshall, Lucile E
2012-01-01
Rabbit anti-thymocyte globulin (rATG) induction reduces reperfusion injury and improves renal function in kidney recipients by means of properties unrelated to T-cell lysis. Here, we analyze intensive rATG induction (single dose, rATG(S) , vs. divided dose, rATG(D) ) for improved renal function and protection against hyperglycemia. Patients without diabetes (n = 98 of 180) in a prospective randomized trial of intensive rATG induction were followed for six months for the major secondary composite end point of impaired glucose regulation (hyperglycemia and new-onset diabetes after transplantation, NODAT). Prospectively collected data included fasting blood glucose and HbA(1c). Serum Mg(++) was routinely collected and retrospectively analyzed. Induction with rATG(S) produced less impaired glucose regulation (p = 0.05), delayed NODAT development (p = 0.02), less hyperglycemia (p = 0.02), better renal function (p = 0.04), and less hypomagnesemia (p = 0.02), a factor associated with a lower incidence of NODAT. Generalized linear modeling confirmed that rATG(S) protects against a synergistic interaction between tacrolimus and sirolimus that otherwise increased hypomagnesemia (p = 0.008) and hyperglycemia (p = 0.03). rATG(S) initiated before renal reperfusion improved early renal function and reduced impaired glucose regulation, an injury by diabetogenic maintenance agents (tacrolimus and sirolimus). © 2011 John Wiley & Sons A/S.
CYCLOPE remote sensing: a multipurpose optronic payload and the associated subsystem
NASA Astrophysics Data System (ADS)
Hamon, Christian H.
1996-10-01
The SAGEM Group has been involved for more than 30 years in the field of remote sensing, especially via line-scanning sensors. Today, the SAGEM Group develops and manufactures optronic sensors with spectral bandwidths ranging from ultraviolet up to long-wave infrared (LWIR). Their name is CYCLOPE. Twenty five years ago, a four-channel infrared linescanner was delivered to the French Space Agency, CNES, for remote sensing evaluation and future specification of related spaceborne system. At the same time, a version was delivered to the French Administration for maritime oil pollution monitoring. This equipment is still in use and second-generation equipment was purchased in 1995 by the French Customs. The payload is described as well as the feasibility of such payload for spaceborne applications. Design-driving parameters and technologies are discussed. Emerging technologies make it possible now to propose such systems.
NASA Astrophysics Data System (ADS)
Dupuy, Pascal; Harter, Jean
1995-09-01
Iris is a modular infrared thermal image developed by SAGEM since 1988, based on a 288 by 4 IRCCD detector. The first section of the presentation gives a description of the different modules of the IRIS thermal imager and their evolution in recent years. The second section covers the description of the major evolution, namely the integrated detector cooler assembly (IDCA), using a SOFRADIR 288 by 4 detector and a SAGEM microcooler, now integrated in the IRIS thermal imagers. The third section gives the description of two functions integrated in the IRIS thermal imager: (1) image enhancement, using a digital convolution filter, and (2) automatic hot points detection and tracking, offering an assistance to surveillance and automatic detection. The last section presents several programs for navy, air forces, and land applications for which IRIS has already been selected and achieved.
Laser megajoule 1.06-μm mirror production with very high laser damage threshold
NASA Astrophysics Data System (ADS)
Pinot, B.; Leplan, Herve; Houbre, Francois; Lavastre, Eric; Poncetta, Jean-Christophe; Chabassier, Genevieve
2002-03-01
As part of the LMJ (Laser Megajoule) program, CEA is building the LIL laser with full size optics and LMJ requirements. SAGEM has been selected as the supplier of large optical components and coatings with very high laser- induced damage threshold. Including spare parts, about 100 mirrors 610*430 mm2 with LIDT-3ns>25 J/cm2 have to be produced. Using a 5 m3 vacuum chamber and the 100 J/cm2 mirror coating process developed at CEA-LETI, with Hafnium and SiO2 materials, we are now typically in a serial production phase. To date, about thirty mirrors have been delivered. This paper focuses on the acceptance tests performed after coating, at SAGEM then CEA: LIDT measurement and Raster-Scan on samples; reflectance mapping on CEA automatic photometer; reflected wavefront deformation with \
High-laser-damage-threshold HfO2/SiO2 mirrors manufactured by sputtering process
NASA Astrophysics Data System (ADS)
Fornier, Anne; Bernardino, D.; Lam, Odile; Neauport, Jerome; Dufour, Francois; Schmitt, Bernard R.; Mackowski, Jean-Marie
1999-07-01
A major preoccupation for the design of the LMJ laser is the mirrors laser damage threshold. SAGEM SA, in collaboration with the CEA, has conducted a study in order to improve the laser induced damage threshold under operational conditions.
Characterization of microRNAs Expressed during Secondary Wall Biosynthesis in Acacia mangium
Ong, Seong Siang; Wickneswari, Ratnam
2012-01-01
MicroRNAs (miRNAs) play critical regulatory roles by acting as sequence specific guide during secondary wall formation in woody and non-woody species. Although thousands of plant miRNAs have been sequenced, there is no comprehensive view of miRNA mediated gene regulatory network to provide profound biological insights into the regulation of xylem development. Herein, we report the involvement of six highly conserved amg-miRNA families (amg-miR166, amg-miR172, amg-miR168, amg-miR159, amg-miR394, and amg-miR156) as the potential regulatory sequences of secondary cell wall biosynthesis. Within this highly conserved amg-miRNA family, only amg-miR166 exhibited strong differences in expression between phloem and xylem tissue. The functional characterization of amg-miR166 targets in various tissues revealed three groups of HD-ZIP III: ATHB8, ATHB15, and REVOLUTA which play pivotal roles in xylem development. Although these three groups vary in their functions, -psRNA target analysis indicated that miRNA target sequences of the nine different members of HD-ZIP III are always conserved. We found that precursor structures of amg-miR166 undergo exhaustive sequence variation even within members of the same family. Gene expression analysis showed three key lignin pathway genes: C4H, CAD, and CCoAOMT were upregulated in compression wood where a cascade of miRNAs was downregulated. This study offers a comprehensive analysis on the involvement of highly conserved miRNAs implicated in the secondary wall formation of woody plants. PMID:23251324
High level bacterial contamination of secondary school students' mobile phones.
Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet
2017-06-01
While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students' mobile phones. Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline ( tet A, tet B, tet M), erythromycin ( erm B) and sulphonamide ( sul 1) resistance genes was assessed. We found a high median bacterial count on secondary school students' mobile phones (10.5 CFU/cm 2 ) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes ( Staphylococcus aureus , Acinetobacter spp. , Pseudomonas spp., Bacillus cereus and Neisseria flavescens ) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner's gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Quantitative study methods revealed high level bacterial contamination of secondary school students' mobile phones.
Intraindividual Crossover Comparison of Gadoxetic Acid Dose for Liver MRI in Normal Volunteers.
Motosugi, Utaroh; Bannas, Peter; Hernando, Diego; Salmani Rahimi, Mahdi; Holmes, James H; Reeder, Scott B
2016-01-01
We performed a quantitative intraindividual comparison of the performance of 0.025- and 0.05-mmol/kg doses for gadoxetic acid-enhanced liver magnetic resonance (MR) imaging. Eleven healthy volunteers underwent liver MR imaging twice, once with a 0.025- and once with a 0.05-mmol/kg dose of gadoxetic acid. MR spectroscopy and 3-dimensional gradient-echo T1-weighted images (3D-GRE) were obtained before and 3, 10, and 20 min after injection of the contrast medium to measure T1 and T2 values and signal-to-noise ratio (SNR) and contrast-to-noise ratio (CNR) performance. During the dynamic phase, highly time-resolved 3D-GRE was used to estimate the relative CNR (CNRrel) of the hepatic artery and portal vein (PV) to the liver. We used paired t-tests to compare the results of different doses. During the hepatobiliary phase, we observed shorter T1 values and higher SNRs of the liver (P < 0.001) and higher liver-to-PV and liver-to-muscle CNRs (P < 0.002) using 0.05 mmol/kg compared to 0.025 mmol/kg. Increasing the dose to 0.05 mmol/kg yielded a greater T1-shortening effect at 10 min delay even compared with 0.025 mmol/kg at 20 min (P < 0.001). During the dynamic phase, the peak CNRrel for the hepatic artery and portal vein were higher using 0.05 mmol/kg (P = 0.007 to 0.035). Use of gadoxetic acid at a dose of 0.05 mmol/kg leads to significantly higher SNR and CNR performance than with 0.025 mmol/kg. Quantitatively, a 10-min delay may be feasible for hepatobiliary-phase imaging when using 0.05 mmol/kg of gadoxetic acid.
Harper, Julie; Pillai, Radhakrishnan; Moore, Robert
2012-01-01
Background: Various formulations of tretinoin (gel, liquid, cream) have been reported to be unstable on the skin under bright artificial light or sunlight. This photodegradation can potentially influence treatment regimens and possibly modify efficacy. The maximum light energy absorption of tretinoin is in the ultraviolet A region. Objective: To compare the photostability of a micronized formulation of tretinoin (0.05%) aqueos gel with tretinoin (0.025%) gel following exposure to ultraviolet A light for eight hours. Methods: Micronized tretinoin (0.05%) gel and tretinoin (0.025%) gel were then exposed to ultraviolet A light with an integrated intensity from 315 to 400nm of 22watt/m2. Samples of both products were prepared and analyzed for tretinoin and its degradation products using a high-performance liquid chromatography method. Additional duplicate samples were similarly prepared and analyzed after 2,4,6, and 8 hours. Results: There was a nine-percent degradation of micronized tretinoin in the 0.05% aqueous gel compared to 72-percent degradation of tretinoin in the 0.025% gel following eight-hour ultraviolet A light exposure. The small increase in tretinoin degradation products with micronized tretinoin (0.05%) aqueous gel remained below six percent of the labeled concentration compared to a marked increase in tretinoin degradation products with tretinoin 0.025% gel at two hours that increased to over 66-percent labeled concentration at eight hours. Conclusion: Micronized tretinoin (0.05%) aqueous gel showed less than 10-percent degradation when exposed to eight hours of ultraviolet A light, while tretinoin (0.025%) gel showed significant tretinoin degradation. PMID:22328956
NASA Astrophysics Data System (ADS)
Torres, Guillermo; Mader, Jeff A.; Marschall, Laurence A.; Neuhäuser, Ralph; Duffy, Alaine S.
2003-06-01
We present new photometric observations in the BVRI bands of the double-lined eclipsing binary BD +05°706 conducted over three observing seasons, as well as new X-ray observations obtained with ROSAT covering a full orbital cycle (P=18.9 days). A detailed light-curve analysis of the optical data shows the system to be semidetached, confirming indications from an earlier analysis by Torres et al. (published in 1998), with the less massive and cooler star filling its Roche lobe. The system is a member of the rare class of cool Algol systems, which are different from the ``classical'' Algol systems in that the mass-gaining component is also a late-type star rather than a B- or A-type star. By combining the new photometry with a reanalysis of the spectroscopic observations reported by Torres et al., we derive accurate absolute masses for the components of M1=2.633+/-0.028 Msolar and M2=0.5412+/-0.0093 Msolar, radii of R1=7.55+/-0.20 Rsolar and R2=11.02+/-0.21 Rsolar, as well as effective temperatures of 5000+/-100 and 4640+/-150 K, for the primary and secondary, respectively. There are obvious signs of activity (spottedness) in the optical light curve of the binary. Our X-ray light curve clearly shows the primary eclipse but not the secondary eclipse, suggesting that the primary star is the dominant source of the activity in the system. The depth and duration of the eclipse allow us to infer some of the properties of the X-ray-emitting region around that star.
Is obstructive sleep apnoea syndrome really one of the causes of secondary polycythaemia?
Solmaz, Soner; Duksal, Faysal; Ganidağlı, Sencer
2015-03-01
It is widely believed that sleep apnoea syndrome leads to polycythaemia, but the evidence is largely anecdotal. We believe that polycythaemia is not commonly seen in patients with sleep apnoea syndrome. Therefore, we aimed to determine the relationship between polycythaemia and sleep apnoea syndrome. The study included 335 patients diagnosed with obstructive sleep apnoea (OSA) syndrome, all of whom underwent standard nocturnal polysomnography. There were no significant differences in haemoglobin levels or haematocrit (P > 0.05) between the OSA groups in all patients. Of the 335 patients, only 1 male patient with severe OSA (0.3%) had clinically significant polycythaemia. According to regression analysis, there was a weak linear correlation between haemoglobin levels and lowest oxygen saturation levels in female patients (r = -0.242, P = 0.021). We think that OSA is very rarely the reason for secondary polycythaemia.
Circular dichroism and DNA secondary structure.
Baase, W A; Johnson, W C
1979-01-01
The change in average rotation of the DNA helix has been determined for the transfer from 0.05 M NaCl to 3.0 M CsCl, 6.2 M LiCl and 5.4 M NH4Cl. This work, combined with data at lower salt from other laboratories, allows us to relate the intensity of the CD of DNA at 275 nm directly to the change in the number of base pairs per turn. The change in secondary structure for the transfer of DNA from 0.05 M NaCl (where it is presumably in the B-form) to high salt (where the characteristic CD has been interpreted as corresponding to C-form geometry) is found to be -0.22 (+/- 0.02) base pairs per turn. In the case of mononucleosomes, where the CD indicates the "C-form", the change in secondary structure (including temperature effects) would add -0.31 (+/- 0.03) turns about the histone core to the -1.25 turns estimated from work on SV40 chromatin. Accurate winding angles and molar extinction coefficients were determined for ethidium. PMID:424316
Quantifying the benefits to the national economy from secondary applications of NASA technology
NASA Technical Reports Server (NTRS)
1976-01-01
The feasibility of systematically quantifying the economic benefits of secondary applications of NASA related R and D is investigated. Based upon the tools of economic theory and econometric analysis, it develops a set of empirical methods and makes selected applications to demonstrate their workability. Analyses of the technological developments related to integrated circuits, cryogenic insulation, gas turbines, and computer programs for structural analysis indicated substantial secondary benefits accruing from NASA's R and D in these areas.
Hotchkiss, Jason T
2018-01-01
Effective self-care in hospice is anecdotally proclaimed to reduce burnout risk. Yet, the topic has received little empirical attention. This study developed a model for predicting burnout risk from compassion satisfaction (CS), secondary traumatic stress (STS), and mindful self-care. Hospice care professionals (n = 324). Cross-sectional self-report survey. Mindful self-care was correlated with CS ( r = 0.497, p < .01), Burnout ( r = -0.726, p < .01), and STS ( r = -0.276, p < .01). A multiple regression model indicated that the combined effect of CS, STS, and mindful self-care explained 73.7% of the variance in Burnout. Mindful self-care and STS mediated a relationship between CS and Burnout. Each self-care category was statistically significant protective factors against burnout risk ( p < .01). Associations with Burnout in order of strength were self-compassion and purpose (SC; r = -0.673), supportive structure (SS; r = -0.650), mindful self-awareness (MS; r = -0.642), mindful relaxation (MR; r = -0.531), supportive relationships (SR; r = -0.503), and physical care (PC; r = -0.435). However, for STS, only SS ( r = -0.407, p < .01) and MR ( r = -0.285, p < .05) were statistically significant protective factors. Hospice care professional had higher self-care, CS, lower STS, and Burnout compared to published norms. Those who engaged in multiple and frequent self-care strategies experienced higher professional quality of life. Implications for hospice providers and suggestions for future research are discussed.
Li, Shasha; Liu, Qifeng; Lu, Rongzhu; Wu, Xiaoyang; Chen, Jian
2018-07-01
Magnetic Ni0.5Zn0.5Fe2O4 nanoparticles were prepared via the methanol combustion process, the morphology, chemical composition, microstructure and magnetic properties of them were investigated by SEM, EDX, TEM, XRD, VSM, and BET. The experimental data revealed that the solution concentration was a key factor to the Ni0.5Zn0.5Fe2O4 nanoparticles, with the solution concentration of ferric nitrate decreasing from 3.37 to 1.12 mol/L, the saturation magnetization decreased from 69.3 Am2/kg to 37.2 Am2/kg, and the average crystalline size of Ni0.5Zn0.5Fe2O4 nanoparticles decreased from 32 to 25 nm. While, with the solution concentration of ferric nitrate decreasing from 1.12 to 0.56 mol/L, the saturation magnetization increased from 37.2 Am2/kg to 104.6 Am2/kg, and the average crystalline size increased from 25 to 44 nm. The adsorption behavior of neutral red (NR) onto magnetic Ni0.5Zn0.5Fe2O4 nanoparticles was investigated by UV spectroscopy at room temperature; the adsorption kinetics data related to the adsorption of NR from aqueous solutions were in good agreement with the pseudo-second-order kinetic model in a range of initial concentration of 50-300 mg/L. By comparison of the Langmuir and Freundlich models for adsorption isotherm of NR, the Langmuir model (correlation coefficient R2 = 0.9918) could be used to evaluate the adsorption isotherm of NR onto magnetic Ni0.5Zn0.5Fe2O4 nanoparticles at room temperature, which suggested that the adsorption of NR onto magnetic Ni0.5Zn0.5Fe2O4 nanoparticles was monolayer, and the adsorption energy was constant.
Silva, Mara Thais de Oliveira; Bezerra, Francisco Silvestre Brilhante; de Pinho, Rodrigo Barros; Begnini, Karine Rech; Seixas, Fabiana Kommling; Collares, Tiago; Portela, Ricardo Dias; Azevedo, Vasco; Dellagostin, Odir; Borsuk, Sibele
2018-01-02
Caseous lymphadenitis (CLA) is a chronic disease responsible for significant economic losses in sheep and goat breeding worldwide. The treatment for this disease is not effective, and an intense vaccination schedule would be the best control strategy. In this study, we evaluated the associations of rCP09720 or rCP01850 proteins from Corynebacterium pseudotuberculosis with recombinant exotoxin phospholipase D (rPLD) as subunit vaccines in mice. Four experimental groups (10 animals each) were immunized with a sterile 0.9% saline solution (G1), rPLD (G2), rPLD + rCP09720 (G3), and rPLD + rCP01850 (G4). The mice received two doses of each vaccine at a 21-day interval and were challenged 21 days after the last immunization. The animals were evaluated daily for 40 days after the challenge, and mortality rate was recorded. The total IgG production level increased significantly in the experimental groups on day 42 after the first vaccination. Similarly, higher levels of specific IgG2a were observed in experimental groups G2, G3, and G4 compared to the IgG1 levels on day 42. G4 showed a significant (p < .05) humoral response against both antigens of the antigenic formulations. The cellular immune response induced by immunization was characterized by a significant (p < .05) production of interferon-γ compared to that in the control, while the concentrations of interleukin (IL)-4 and IL-12 were not significant in any group. A significant increase of tumor necrosis factor was observed only in G4. The survival rates after the challenge were 30% (rPLD), 40% (rPLD + rCP09720), and 50% (rPLD + rCP01850). Thus, the association of rCP01850 with rPLD resulted in the best protection against the challenge with C. pseudotuberculosis and induced a more intense type 1 T-helper cell immune response. Copyright © 2017 Elsevier Ltd. All rights reserved.
ERIC Educational Resources Information Center
Hood, Paul D.
This document reports an attempt to examine the content and structure of the domain of research and development (R&D) training resources. The project began by locating instructional materials within a larger matrix that classified R&D resources by structure (primary/secondary, oral/written, documentary/non-document) and level of formalization…
Structural, dielectric and magnetic properties of ZnFe2O4-Na0.5Bi0.5TiO3 multiferroic composites
NASA Astrophysics Data System (ADS)
Bhasin, Tanvi; Agarwal, Ashish; Sanghi, Sujata; Yadav, Manisha; Tuteja, Muskaan; Singh, Jogender; Rani, Sonia
2018-04-01
Multiferroic xNa0.5Bi0.5TiO3-(1-x)ZnFe2O4 (x=0.10, 0.20) composites were prepared by conventional solid state reaction method. Rietveld analysis of XRD data shows that samples exhibit both cubic (Fd-3m) and rhombohedral (R3c) crystal structure. Structural parameters and unit cell volume of samples vary with composition. The dielectric constant and dielectric loss (tanδ) display dispersion at low frequency due to space charge polarization and inhomogeneity in the composites. Magnetic analysis depicts the antiferromagnetic behavior of composites and magnetization is enhanced with the introduction of ferrite (ZnFe2O4) phase.
Blood pressure variability in children with primary vs secondary hypertension.
Leisman, Daniel; Meyers, Melissa; Schnall, Jeremy; Chorny, Nataliya; Frank, Rachel; Infante, Lulette; Sethna, Christine B
2014-06-01
Increased blood pressure variability (BPV) is correlated with adverse cardiovascular (CV) events in adults. However, there has been limited research on its effect in the pediatric population. Additionally, BPV differences between primary and secondary hypertension (HTN) are not known. Children with primary and secondary HTN underwent 24-hour ambulatory blood pressure monitoring and echocardiography studies. BPV measures of standard deviation (SD), average real variability (ARV), and range were calculated for the 24-hour, daytime, and nighttime periods. Seventy-four patients (median age, 13.5 years; 74% boys) were examined, 40 of whom had primary HTN. Body mass index z score and age were independent predictors of systolic ARV (R(2) =0.14) and SD (R(2) =0.39). There were no statistically significant differences in overall or wake period BPV measures between secondary or primary HTN groups, but sleep period diastolic SD was significantly greater in the secondary HTN group (9.26±3.8 vs 7.1±2.8, P=.039). On multiple regression analysis, secondary HTN was associated with increased sleep period diastolic SD (P=.025). No metrics of BPV in the overall, wake, and sleep periods were found to be significantly associated with left ventricular hypertrophy (LVH). The results of this study do not show a strong relationship between overall or wake BPV with primary vs secondary HTN, but the association of secondary HTN with sleep period diastolic BPV deserves further exploration. Contrary to expectation, the findings of this study failed to indicate a relationship between BPV and LVH for all patients as well for primary hypertensive and secondary hypertensive patients. ©2014 Wiley Periodicals, Inc.
ACTN3 R577X polymorphism and performance phenotypes in young Chinese male soldiers.
Shang, Xuya; Zhang, Fu; Zhang, Li; Huang, Changlin
2012-01-01
Alpha-actinin-3 (ACTN3) is absent in 18% of healthy Caucasian individuals owing to homozygosity for a premature stop codon (X) at amino acid 577 (rs1815739). Previous studies have shown a strong association between ACTN3 genotype and human athletic performance. In a study of 452 young Chinese male soldiers, we examined the distribution of ACTN3 genotypes and alleles and analysed the association between ACTN3 genotypes and athletic performance. We found that the frequencies of the ACTN3 R577X genotype (RR 39.8%, RX 43.4%, and XX 16.8%) and R577X allele (R 61.5%, X 38.5%) in young Chinese males were not significantly different from those in Caucasians. We only observed a significant association (P = 0.025) between ACTN3 R577X genotypes and grip strength. Participants with the XX genotype displayed significantly lower handgrip strength than individuals with the RR genotype (P = 0.021), but the difference between XX and RX means (P = 0.258) and that between RR and RX means (P = 0.42) was not significant. We did not observe a strong association between the ACTN3 R577X genotypes and sprint phenotypes or endurance phenotypes. In conclusion, our results indicate that the ACTN3 R577X polymorphism is most strongly associated with grip strength in young Chinese male soldiers.
Samuvel, K; Ramachandran, K
2015-02-05
A comparative study of the surface morphology, dielectric and magnetic properties of the BaTi0.5Fe0.5O3 (BTFO) ceramics materials. This has been carried out by synthesizing the samples in different routes. BTFO samples have shown single phased 12R type hexagonal structure with R3m, P4mm space group. Interfacial effects on the dielectric properties of the samples have been understood by Cole-Cole plots in complex impedance and modulus formalism. It has been identified that huge dielectric constant (10(3)-10(6)) at lower frequencies is largely contributed by the heterogeneous electronic microstructure at the interfaces of grains. Modulus formalism has identified the effects of both grain and grain boundary microstructure on the dielectric properties, particularly in chemical routed samples. The order of grain boundary resistivity suggests the semiconductor/insulator class of the material. The grain boundary resistivity of the mechanical alloyed samples is remarkably lower than the solid state and chemical routed samples. Few samples have of the samples have exhibited signature of ferromagnetism at the room temperature. Copyright © 2014 Elsevier B.V. All rights reserved.
Wu, Si-ying; Wang, Mian-zhen; Li, Jian; Zhang, Xue-feng
2006-03-01
To study the status of the occupational stress and the work ability of the teachers in the primary and secondary schools, then take some integrated intervention measures to reduce the occupational stress and improve their work ability, and evaluate the intervening efficacy. The levels of stressor and strain was measured with the occupation stress inventory revised edition (OSI-R) and the work ability was measured with the work ability index (WAI) for the teachers in nine primary and secondary schools in Sichuan Province, then health educations about occupational stress were taken to the teachers in the study group, the same test was carried out after one year for the teachers in the nine schools to evaluate the effect of intervention measures. (1) After intervening, among the six items of occupational role questionnaire, the scores of role overload, role boundary, responsibility and physical environment of the teachers in the study group significantly decreased, compared with the teachers in the control group, the scores of the role overload, role boundary and physical environment were significantly lower (P < 0.05). (2) Among the four items of personal strain questionnaire, only the scores of interpersonal strain of the teachers in the study group significantly decreased (P < 0.05), compared with the teachers in the control group, the scores of the vocational strain and interpersonal strain were significantly lower (P < 0.05). (3) Among the four items of personal resources questionnaire, the scores of the recreation, self-care and rational cognitive coping of the teachers in the study group significantly raised and were significantly higher than those of the teachers in the control group (P < 0.05). (4) The score of WAI of the teachers in the study group significantly raised and was significantly higher than that of the teachers in the control group (P < 0.05). The intervention measures are efficient to reduce the occupational stress of teachers, strengthen their
Silvestre, Rafaele T; Delmonico, Lucas; Bravo, Maryah; Santiago, Fábio; Scherrer, Luciano R; Moreira, Aline Dos Santos; Tabalipa, Marianne; Otero, Ubirani; Ornellas, Maria Helena F; Alves, Gilda
2017-12-01
Gas station workers are exposed to chemicals known to be carcinogenic, especially benzene. The objective was to analyze the health problems of female gas station workers by means of sociodemographic and clinical questionnaires, and laboratorial exams. We performed the genotyping of the polymorphisms BRCA1/P871L and BRCA1/Q356R by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism, and of variant allele BRCA2/N372H through direct sequencing. The female workers showed a higher concentration of monocytes (P = 0.039); a greater number of spontaneous abortions (P = 0.025, OR = 4.977, 95% CI = 1.135-30.669); higher tobacco consumption (P = 0.013); and higher alcohol consumption (P = 0.05). The statistical analysis of the polymorphisms associated with the variables monocyte concentration and miscarriage number did not reveal a significant relationship, and smoking and spontaneous abortion were not statistically associated either. Environ. Mol. Mutagen. 58:730-734, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
The Prevalence and Predictors of Cigarette Smoking among Secondary School Students in Nigeria.
Odeyemi, K A; Osibogun, A; Akinsete, A O; Sadiq, L
2009-03-01
This study was carried out to determine the prevalence of smoking among secondary school students and identify factors that influence smoking amongst them. This descriptive and explorative study was conducted among 1,183 secondary school students, selected by multistage sampling from each of the 6 geopolitical zones in Nigeria. Data was collected by using interviewer administered structured questionnaires. This study recorded a lifetime smoking prevalence of 26.4% and current smoking prevalence of 17.1% among secondary school students in Nigeria. Most (82%) of the students had seen warnings against smoking and most of them were aware that it is possible for cigarette smoking to damage body organs. Unfortunately, however, seeing such warnings had no significant effect on their decision to smoke or not. The students who smoke were introduced to smoking mainly by their friends (67.4 %), and the television (13.4%). Smoking habits of the respondents were influenced by parents' educational status (p<0.05), having friends who smoke (p<0.05) and living with a smoker (p<0.05). Over a quarter of secondary school students had ever smoked. Peer pressure was the main reason cited by respondents for initiating smoking. It is suggested that our smoking prevention programmes be reviewed and appropriate health education and smoking cessation programmes be developed and implemented in order to prevent and control smoking among Nigerian students.
Hydrothermal synthesis of a photovoltaic material based on CuIn0.5Ga0.5Se2
NASA Astrophysics Data System (ADS)
Castellanos Báez, Y. T.; Fuquen Peña, D. A.; Gómez-Cuaspud, J. A.; Vera-López, E.; Pineda-Triana, Y.
2017-12-01
The present work report, the synthesis and characterization of the CuIn0.5Ga0.5Se2 system (abbreviated CIGS), by the implementation of a hydrothermal route, in order to obtain a solid with appropriate properties in terms of surface, morphological and texture properties for potential applications in the design of photovoltaic cells. The synthesis was carried out using the corresponding stoichiometric quantities (Cu:In:Ga:Se 1:0.5:0.5:2), which were mixed in a Teflon vessel under stirring conditions. The homogeneous solution was treated in a steel autoclave at 300°C for 72 hours at the end of which the resulting material was characterized by X-Ray Diffraction (XRD) and Rietveld refinement. The results of the structural characterization allowed to confirm the obtaining of a chalcopyrite type structure, with a I-42 d (122) structure and cell parameters a=0.570, b=0.570, c=1.140nm, α=90, β=90, γ=90° oriented along (1 0 4) facet, detecting the presence of a secondary phases, related with CuInSe and CuIn metallic selenides, derived from synthesis process. The structural refinement allowing to validate the obtaining of a nanometric crystalline material (10-20nm) for potential applications in field of photovoltaic technology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ikhtiar,; Mitani, S.; Hono, K., E-mail: kazuhiro.hono@nims.go.jp
Heusler alloy-based lateral spin valves with ohmic contacts are prepared for the Co{sub 2}Fe(Ga{sub 0.5}Ge{sub 0.5})/Cu system by means of the top-down microfabrication process. The magneto-transport and microstructure are characterized to investigate the influence of the microfabrication route on the spin dependent transport of lateral spin valves systematically. A large non-local spin signal (△R{sub S}) of 17.3 mΩ is observed at room temperature, which is attributed to the highly spin-polarized Co{sub 2}Fe(Ga{sub 0.5}Ge{sub 0.5}) ferromagnet and the clean Co{sub 2}Fe(Ga{sub 0.5}Ge{sub 0.5})/Cu interfaces confirmed by transmission electron microscopy. Based on the general expression of one-dimensional spin diffusion model, we discuss themore » importance of interfacial spin polarization in Heusler alloy-based lateral spin valves.« less
Pressure effect on ferroelectricity of multiferroic Ho0.5Nd0.5Fe3(BO3)4
NASA Astrophysics Data System (ADS)
Poudel, Narayan; Gooch, Melissa; Lorenz, Bernd; Bezmaternykh, L. N.; Temerov, V. L.; Chu, C. W.
Ho0.5Nd0.5Fe3(BO3)4 becomes multiferroic below 33 K where it enters into the AFM1 phase and gives rise to a ferroelectric polarization along the a-axis. At 9.5 K, the polarization drops sharply and remains finite value of 40 μC/m2. This is due to the spin rotation from the a-b plane into the c-axis and gives rise to the AFM2 phase. The application of pressure suppresses the AFM2 phase and moves the spin rotation transition from 9.5 K to 4.8 K up to pressure of 18.8 kbar which is observed in both dielectric and pyroelectric measurements. The change in magnetic anisotropy of rare-earth moments and Fe ions under pressure drives the spin rotation transition of rare-earth at lower temperature. DOE, the AFOSR, the T.L.L Temple Foundation, the J.J. and R. Moores Endowment, and the State of Texas (TCSUH).
Secondary osteons scale allometrically in mammalian humerus and femur
Phillips, C.; Cornish, H.; Cooke, M.; Hutchinson, J. R.; Doube, M.
2017-01-01
Intra-cortical bone remodelling is a cell-driven process that replaces existing bone tissue with new bone tissue in the bone cortex, leaving behind histological features called secondary osteons. While the scaling of bone dimensions on a macroscopic scale is well known, less is known about how the spatial dimensions of secondary osteons vary in relation to the adult body size of the species. We measured the cross-sectional area of individual intact secondary osteons and their central Haversian canals in transverse sections from 40 stylopodal bones of 39 mammalian species (body mass 0.3–21 000 kg). Scaling analysis of our data shows that mean osteonal resorption area (negative allometry, exponent 0.23,R2 0.54,p<0.005) and Haversian canal area (negative allometry, exponent 0.31,R2 0.45,p<0.005) are significantly related to body mass, independent of phylogeny. This study is the most comprehensive of its kind to date, and allows us to describe overall trends in the scaling behaviour of secondary osteon dimensions, supporting the inference that the osteonal resorption area may be limited by the need to avoid fracture in smaller mammalian species, but the need to maintain osteocyte viability in larger mammalian species. PMID:29291052
Detection of the secondary star in HT Cassiopeiae
NASA Technical Reports Server (NTRS)
Marsh, T. R.
1990-01-01
Low-resolution spectra of the eclipsing dwarf nova HT Cas, taken over the range 5000-9800 A show TiO bands and Na I absorption lines from the secondary star. From the TiO band ratio at mid-eclipse it is estimated that the secondary star contributes about 37 percent of the light at 7500 A during the eclipse, and that it has a Boeshaar spectral type M5.4 + or - 0.3. The mass, radius, and luminosity of the secondary star are all consistent with main-sequence values. The TiO band strength diminishes greatly near phase 0.5, but an eclipse by the disk is not sufficient to explain this. The radial velocity is measured from the Na line near 8200 A for most of the spectra and (after a correction for the asymmetric distribution of absorption over the secondary star) its radial velocity semiamplitude K2 = 430 + or - 25 km/sec.
Mechanism of blood pressure and R-R variability: insights from ganglion blockade in humans
NASA Technical Reports Server (NTRS)
Zhang, Rong; Iwasaki, Kenichi; Zuckerman, Julie H.; Behbehani, Khosrow; Crandall, Craig G.; Levine, Benjamin D.; Blomqvist, C. G. (Principal Investigator)
2002-01-01
Spontaneous blood pressure (BP) and R-R variability are used frequently as 'windows' into cardiovascular control mechanisms. However, the origin of these rhythmic fluctuations is not completely understood. In this study, with ganglion blockade, we evaluated the role of autonomic neural activity versus other 'non-neural' factors in the origin of BP and R-R variability in humans. Beat-to-beat BP, R-R interval and respiratory excursions were recorded in ten healthy subjects (aged 30 +/- 6 years) before and after ganglion blockade with trimethaphan. The spectral power of these variables was calculated in the very low (0.0078-0.05 Hz), low (0.05-0.15 Hz) and high (0.15-0.35 Hz) frequency ranges. The relationship between systolic BP and R-R variability was examined by cross-spectral analysis. After blockade, R-R variability was virtually abolished at all frequencies; however, respiration and high frequency BP variability remained unchanged. Very low and low frequency BP variability was reduced substantially by 84 and 69 %, respectively, but still persisted. Transfer function gain between systolic BP and R-R interval variability decreased by 92 and 88 % at low and high frequencies, respectively, while the phase changed from negative to positive values at the high frequencies. These data suggest that under supine resting conditions with spontaneous breathing: (1) R-R variability at all measured frequencies is predominantly controlled by autonomic neural activity; (2) BP variability at high frequencies (> 0.15 Hz) is mediated largely, if not exclusively, by mechanical effects of respiration on intrathoracic pressure and/or cardiac filling; (3) BP variability at very low and low frequencies (< 0.15 Hz) is probably mediated by both sympathetic nerve activity and intrinsic vasomotor rhythmicity; and (4) the dynamic relationship between BP and R-R variability as quantified by transfer function analysis is determined predominantly by autonomic neural activity rather than other
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Juan; Liu, Xiao Qiang, E-mail: xqliu@zju.edu.cn, E-mail: xmchen59@zju.edu.cn; Chen, Xiang Ming, E-mail: xqliu@zju.edu.cn, E-mail: xmchen59@zju.edu.cn
2015-05-07
BiFeO{sub 3} multiferroic ceramics were modified by introducing (Sr{sub 0.5}Ca{sub 0.5})TiO{sub 3} to form solid solutions. The single phase structure was easy to be obtained in Bi{sub 1−x}(Sr{sub 0.5}Ca{sub 0.5}){sub x}Fe{sub 1−x}Ti{sub x}O{sub 3} (x = 0.2, 0.25, 0.3, and 0.4) solid solutions. Rietveld refinement of X-ray diffraction data revealed a transition from rhombohedral R3c (x = 0.2, 0.25, and 0.3) to orthorhombic Pnma (x = 0.4). Current density-field (J-E) characteristics indicated that the leakage current density was reduced by three orders of magnitude in Bi{sub 1−x}(Sr{sub 0.5}Ca{sub 0.5}){sub x}Fe{sub 1−x}Ti{sub x}O{sub 3} ceramics. Both the ferroelectricity and magnetic properties were significantly enhanced in the presentmore » solid solutions. P-E hysteresis loop measurements with dynamic leakage current compensation methods showed the significantly enhanced ferroelectric properties for x = 0.25 and 0.3 and the paraelectric behavior for x = 0.4. The best ferromagnetic characteristics were achieved in the composition of x = 0.25, where the saturated M-H loop was determined with M{sub r} = 34.8 emu/mol. The improvement of ferroelectricity was mainly due to the suppressed leakage current, and the enhanced magnetism originated from the partial substitution of Fe{sup 3+} by Ti{sup 4+}, which destroyed its previous spiral structure to allow the appearance of a macroscopic magnetization.« less
ERIC Educational Resources Information Center
Congress of the U.S., Washington, DC. House.
Presented are proceedings from the Congressional hearing on H.R. 15 (a bill to extend certain elementary and secondary education programs for 5 years), with particular emphasis on Title I programs run by state agencies for handicapped, neglected and delinquent, and migrant children. Statements, prepared statements, and letters are given for such…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Han Joon; Park, Min Hyuk; Kim, Yu Jin
2014-11-10
The degradation of ferroelectric (FE) properties of atomic layer deposited Hf{sub 0.5}Zr{sub 0.5}O{sub 2} films with increasing thickness was mitigated by inserting 1 nm-thick Al{sub 2}O{sub 3} interlayer at middle position of the thickness of the FE film. The large P{sub r} of 10 μC/cm{sup 2}, which is 11 times larger than that of single layer Hf{sub 0.5}Zr{sub 0.5}O{sub 2} film with equivalent thickness, was achieved from the films as thick as 40 nm. The Al{sub 2}O{sub 3} interlayer could interrupt the continual growth of Hf{sub 0.5}Zr{sub 0.5}O{sub 2} films, and the resulting decrease of grain size prevented the formation of non-ferroelectricmore » monoclinic phase. The Al{sub 2}O{sub 3} interlayer also largely decreased the leakage current of the Hf{sub 0.5}Zr{sub 0.5}O{sub 2} films.« less
High level bacterial contamination of secondary school students’ mobile phones
Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet
2017-01-01
Introduction While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students’ mobile phones. Methods Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline (tetA, tetB, tetM), erythromycin (ermB) and sulphonamide (sul1) resistance genes was assessed. Results We found a high median bacterial count on secondary school students’ mobile phones (10.5 CFU/cm2) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes (Staphylococcus aureus, Acinetobacter spp., Pseudomonas spp., Bacillus cereus and Neisseria flavescens) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner’s gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Conclusion Quantitative study methods revealed high level bacterial contamination of secondary school students’ mobile phones. PMID:28626737
Helicity of short E-R/K peptides.
Sommese, Ruth F; Sivaramakrishnan, Sivaraj; Baldwin, Robert L; Spudich, James A
2010-10-01
Understanding the secondary structure of peptides is important in protein folding, enzyme function, and peptide-based drug design. Previous studies of synthetic Ala-based peptides (>12 a.a.) have demonstrated the role for charged side chain interactions involving Glu/Lys or Glu/Arg spaced three (i, i + 3) or four (i, i + 4) residues apart. The secondary structure of short peptides (<9 a.a.), however, has not been investigated. In this study, the effect of repetitive Glu/Lys or Glu/Arg side chain interactions, giving rise to E-R/K helices, on the helicity of short peptides was examined using circular dichroism. Short E-R/K-based peptides show significant helix content. Peptides containing one or more E-R interactions display greater helicity than those with similar E-K interactions. Significant helicity is achieved in Arg-based E-R/K peptides eight, six, and five amino acids long. In these short peptides, each additional i + 3 and i + 4 salt bridge has substantial contribution to fractional helix content. The E-R/K peptides exhibit a strongly linear melt curve indicative of noncooperative folding. The significant helicity of these short peptides with predictable dependence on number, position, and type of side chain interactions makes them an important consideration in peptide design.
Shakoor, Rana A; Park, Chan Sun; Raja, Arsalan A; Shin, Jaeho; Kahraman, Ramazan
2016-02-07
The development of secondary batteries based on abundant and cheap elements is vital. Among various alternatives to conventional lithium-ion batteries, sodium-ion batteries (SIBs) are promising due to the abundant resources and low cost of sodium. While there are many challenges associated with the SIB system, cathode is an important factor in determining the electrochemical performance of this battery system. Accordingly, ongoing research in the field of SIBs is inclined towards the development of safe, cost effective cathode materials having improved performance. In particular, pyrophosphate cathodes have recently demonstrated decent electrochemical performance and thermal stability. Herein, we report the synthesis, electrochemical properties, and thermal behavior of a novel Na2Fe0.5Mn0.5P2O7 cathode for SIBs. The material was synthesized through a solid state process. The structural analysis reveals that the mixed substitution of manganese and iron has resulted in a triclinic crystal structure (P1[combining macron] space group). Galvanostatic charge/discharge measurements indicate that Na2Fe0.5Mn0.5P2O7 is electrochemically active with a reversible capacity of ∼80 mA h g(-1) at a C/20 rate with an average redox potential of 3.2 V. (vs. Na/Na(+)). It is noticed that 84% of initial capacity is preserved over 90 cycles showing promising cyclability. It is also noticed that the rate capability of Na2Fe0.5Mn0.5P2O7 is better than Na2MnP2O7. Ex situ and CV analyses indicate that Na2Fe0.5Mn0.5P2O7 undergoes a single phase reaction rather than a biphasic reaction due to different Na coordination environment and different Na site occupancy when compared to other pyrophosphate materials (Na2FeP2O7 and Na2MnP2O7). Thermogravimetric analysis (25-550 °C) confirms good thermal stability of Na2Fe0.5Mn0.5P2O7 with only 2% weight loss. Owing to promising electrochemical properties and decent thermal stability, Na2Fe0.5Mn0.5P2O7, can be an attractive cathode for SIBs.
Kieling-Rubio, M A; Droste, A; Windisch, P G
2010-12-01
Regnellidium diphyllum Lindman is a heterosporous fern, growing in aquatic environments and surrounding wetlands, which is assumed to be threatened by increasing water pollution and disappearance of its natural habitats. Among contaminants, hexavalent chromium - Cr(VI) - is known to be present in effluents from some leather tanning factories. Megaspore germination tests were performed using Meyer's solution, at concentrations 0 (control), 0.1, 0.5, 1, 5, 10, 15, 20, 30, 50, and 80 mg.L⁻¹, from a standard solution of Titrisol® 1000 mg.L⁻¹. The primary development of apomictic sporophytes was studied using solutions containing 0.025 to 4.8 mg.L⁻¹ of Cr(VI). The experiments were conducted in a growth chamber at 24 ± 1 ºC and for a 12-hour photoperiod under fluorescent lights, providing a nominal irradiance of 77 µmol.m⁻²/s. Significant differences in megaspore germination, with subsequent sporophytic development, were verified from 0.5 mg.L⁻¹ Cr(VI) concentration onwards. Growth of primary root and primary and secondary leaves was significantly reduced at 3.2 mg.L⁻¹ Cr(VI) concentration or higher. Considering the pollution from Cr(VI) in some areas of R. diphyllum natural occurrence, these data indicate that low reproductive rates and disappearance of populations are likely to occur in these situations.
ERIC Educational Resources Information Center
Congress of the U.S., Washington, DC. House Committee on Education and Labor.
The full text of the U.S. House of Representatives subcommittee hearings on H.R. 11023 is presented--a bill to assist States and local educational agencies in increasing job awareness, exploration, decisionmaking, and planning activities in elementary and secondary schools. Statements to the subcommittee members, as well as prepared statements,…
Analysis of Air Force Secondary Power Logistics Solution Contract
2010-05-21
IL 62225 SUBJECT: Audit. Analysis of Air Force Secondary Power Logistics Solution Contract, 748th Supply Chain Management Group, Hill Air Fon:r... Power Logis.tics Solution Contnict. 748111 Supply Ch.,in Management Group. !-lill Air FOfC! BII.SI!, UT (Project 02009· DOOOCH·0213.000) I. AUlIctlcd...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Analysis of Air Force Secondary Power Logistics Solution Contract 5a. CONTRACT NUMBER 5b. GRANT
Lin, Wen-Wei; Chen, I-Ju; Cheng, Ta-Chun; Tung, Yi-Ching; Chu, Pei-Yu; Chuang, Chih-Hung; Hsieh, Yuan-Chin; Huang, Chien-Chiao; Wang, Yeng-Tseng; Kao, Chien-Han; Roffler, Steve R; Cheng, Tian-Lu
2016-01-01
Molecular weight markers that can tolerate denaturing conditions and be auto-detected by secondary antibodies offer great efficacy and convenience for Western Blotting. Here, we describe M&R LE protein markers which contain linear epitopes derived from the heavy chain constant regions of mouse and rabbit immunoglobulin G (IgG Fc LE). These markers can be directly recognized and stained by a wide range of anti-mouse and anti-rabbit secondary antibodies. We selected three mouse (M1, M2 and M3) linear IgG1 and three rabbit (R1, R2 and R3) linear IgG heavy chain epitope candidates based on their respective crystal structures. Western blot analysis indicated that M2 and R2 linear epitopes are effectively recognized by anti-mouse and anti-rabbit secondary antibodies, respectively. We fused the M2 and R2 epitopes (M&R LE) and incorporated the polypeptide in a range of 15-120 kDa auto-detecting markers (M&R LE protein marker). The M&R LE protein marker can be auto-detected by anti-mouse and anti-rabbit IgG secondary antibodies in standard immunoblots. Linear regression analysis of the M&R LE protein marker plotted as gel mobility versus the log of the marker molecular weights revealed good linearity with a correlation coefficient R2 value of 0.9965, indicating that the M&R LE protein marker displays high accuracy for determining protein molecular weights. This accurate, regular and auto-detected M&R LE protein marker may provide a simple, efficient and economical tool for protein analysis.
SECONDARY DEUTERIUM ISOTOPE EFFECTS IN SOME SN1 AND E$sub 2$ REACTIONS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Asperger, S.; Illakovac, N.; Pavlovic, D.
1962-01-01
The reaction rate of 0.025 M solution of PhCH/sub 2/CD/sub 2/Br(I) with NaOEt (0.019 M) in anh. EtOH was measured at 59.8 deg C by extinction at 248 m mu . A k/sub H//k/sub D/ value of 1.17 was found. k/sub H//k/sub D/ = 1 was measured potentiometrically for the reaction of 0.05 M solutions of PhCH/sub 2/CD/ sub a/SMe/sub 2/Br(II) and NaOH in H/sub 2/O at 79.55 deg C. With II, about 75% D exchanged during reaction in 2 to 5 M solutions k/sub H//k/sub D/ = 1.25 was determined potentiometrically for the hydrolysis of MeCD/sub 2/C(CD/sub 3/)/sub 2/more » SMe/sub 2 /I (0.05 M solution) at 59.75 deg C. The smaller isotope effects in reactions of sulfonium salts vs halides are explained by larger electron transfer in the transition state of the latter reactions. k/sub H//k/sub D/> 1 in the E/ sub 2/ reaction of I is ascribed to partial rehybridization of C-D bonds in the rate-determining step. (auth)« less
Parlesak, A; Bode, J C; Bode, C
1994-11-01
Polyethylene glycol has been in use for a number of years for the assessment of gut permeability. The methods so far employed are usually limited to polyethylene glycols in the low relative molecular mass range (up to M(r) 1300). We developed a method for the simultaneous determination of gut permeability to M(r) 400, M(r) 1500, M(r) 4000 and M(r) 10,000 polyethylene glycol, by applying a single oral dose of an appropriate mixture of these polyethylene glycols. After extraction from 24 h-urine, M(r) 1500, M(r) 4000 and M(r) 10,000 polyethylene glycol were quantified by size exclusion chromatography, while M(r) 400 polyethylene glycol was determined by reversed phase chromatography. The detection limit of polyethylene glycol in the relative molecular mass range between M(r) 1500 and M(r) 10,000 was found to be 0.2 mg/l urine, and the detection limit of M(r) 400 polyethylene glycol 5 mg/l urine. Recovery of the polyethylene glycols (N = 6) were 86.6% (CV: 4.8%) for M(r) 400, 94.1% (CV: 7.2%) for M(r) 1500, 97.1% (CV: 5.5%) for M(r) 4000 and 97.4% (CV: 5.6%) for M(r) 10,000. No significant difference was found between the excretion rates in 24 h-urine of M(r) 400 and M(r) 1500 polyethylene glycols in patients with Crohn's disease (M(r) 400: 34.4 +/- 5.5%; M(r) 1500: 5.22 +/- 2.27%; mean +/- SEM, N = 10) and healthy controls (M(r) 400: 33.6 +/- 3.2%, M(r) 1500: 1.09 +/- 0.26%; N = 21). The excretion rate of M(r) 4000 polyethylene glycol was markedly higher in patients with Crohn's disease (0.462 +/- 0.177%) than in healthy controls (0.049 +/- 0.012%, p < 0.05).(ABSTRACT TRUNCATED AT 250 WORDS)
Effect of Pressure on the Stability and Electronic Structure of ZnO0.5S0.5 and ZnO0.5Se0.5
NASA Astrophysics Data System (ADS)
Manotum, R.; Klinkla, R.; Phaisangittisakul, N.; Pinsook, U.; Bovornratanaraks, T.
2017-12-01
Structures and high-pressure phase transitions in ZnO0.5S0.5 and ZnO0.5Se0.5 have been investigated using density functional theory calculations. The previously proposed structures of ZnO0.5S0.5 and ZnO0.5Se0.5 which are chalcopyrite ( I\\bar{4}2d ), rocksalt ( Fm3m ), wurtzite ( P63 mc ) and CuAu-I ( P\\bar{4}m2 ) have been fully investigated. Stabilities of these materials have been systematically studied up to 40 GPa using various approaches. We have confirmed the stability of the chalcopyrite structure up to 30 GPa for which the CuAu-I structure has been previously proposed. However, our calculation revealed that CuAu-I is not a stable structure under 32 GPa and 33 GPa for both ZnO0.5S0.5 and ZnO0.5Se0.5, respectively, which could explain the failure in several attempts to fabricate these materials under such conditions. We have also examined the pressure-dependence of the bandgap and electronic structure up to 30 GPa. We can conclude from our PDOS analysis that the applied pressure does not change the atomic state characters of electronic states near the top of valence and the bottom of conduction bands, but mainly modifies the dominant Zn-3d atomic state of the deep Bloch state at -1 eV below Fermi level.
Secondary Amine Functional Disiloxanes as CO2 Sorbents
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Brien, MJ; Farnum, RL; Perry, RJ
2014-05-01
A series of two different types of secondary amine functional disiloxanes were prepared and screened as CO2 capture solvents. The first group of materials contained RNHCH2CH2CH2 side chains where the R groups were C1-6 alkyls. When R was a primary alkyl group, these materials exhibited CO2 uptake values slightly in excess of theoretical. As the alkyl groups were changed to more sterically hindered secondary or tertiary alkyls, the uptake was less efficient. Heats of absorption values for these materials were generally in the range 2000-2200 kJ/kg of CO2, values significantly lower than those obtained for primary amine functional disiloxanes (2500-2700more » kJ/kg of CO2). Also explored were a series of secondary amine functional disiloxanes with X-CH2CH2NH-CH2CH2CH2 - substituents. When X was an electron-donating group (RO-, R2N-, RO-CH2-) the CO2 uptake was also in excess of theoretical. Interestingly, these compounds were generally found to produce carbamate salts that were flowable, low-viscosity oils. Furthermore, the heat of absorption values determined for these materials were even lower. Most compounds gave values below 2000 kJ/kg of CO2. Overall the most promising results were obtained with a methoxyethylaminopropyl derivative, an ethoxyethylaminopropyl-containing material, and a dimethylaminoethylaminopropyl-based compound. These materials showed excellent CO2 uptake, had low heats of absorption, and produced carbamate salts that were flowable liquids even at room temperature.« less
Randomized trials are frequently fragmented in multiple secondary publications.
Ebrahim, Shanil; Montoya, Luis; Kamal El Din, Mostafa; Sohani, Zahra N; Agarwal, Arnav; Bance, Sheena; Saquib, Juliann; Saquib, Nazmus; Ioannidis, John P A
2016-11-01
To assess the frequency and features of secondary publications of randomized controlled trials (RCTs). For 191 RCTs published in high-impact journals in 2009, we searched for secondary publications coauthored by at least one same author of the primary trial publication. We evaluated the probability of having secondary publications, characteristics of the primary trial publication that predict having secondary publications, types of secondary analyses conducted, and statistical significance of those analyses. Of 191 primary trials, 88 (46%) had a total of 475 secondary publications by 2/2014. Eight trials had >10 (up to 51) secondary publications each. In multivariable modeling, the risk of having subsequent secondary publications increased 1.32-fold (95% CI 1.05-1.68) per 10-fold increase in sample size, and 1.71-fold (95% CI 1.19-2.45) in the presence of a design article. In a sample of 197 secondary publications examined in depth, 193 tested different hypotheses than the primary publication. Of the 193, 43 tested differences between subgroups, 85 assessed predictive factors associated with an outcome of interest, 118 evaluated different outcomes than the original article, 71 had differences in eligibility criteria, and 21 assessed different durations of follow-up; 176 (91%) presented at least one analysis with statistically significant results. Approximately half of randomized trials in high-impact journals have secondary publications published with a few trials followed by numerous secondary publications. Almost all of these publications report some statistically significant results. Copyright © 2016 Elsevier Inc. All rights reserved.
Painful nipple hyperkeratosis secondary to vemurafenib.
Carr, Emily S; Brown, Shannon C; Fiala, Katherine H
2017-05-01
Vemurafenib is a selected BRAF kinase inhibitor approved for treating metastatic or unresectable melanoma, which has numerous cutaneous side effects unfortunately, including three previously reported cases of asymptomatic areola and/or nipple hyperkeratosis. We present the first case of painful bilateral nipple hyperkeratosis secondary to vemurafenib in an 84-year-old woman. She was successfully treated with tretinoin 0.05% cream that allowed her to comfortably continue treatment. With increased awareness of this condition, we found a second case of asymptomatic nipple hyperkeratosis secondary to vemurafenib in our clinic. As this medication gains acceptance for treatment of metastatic melanoma, it is imperative that dermatologists are aware of this potentially uncomfortable side effect that can result in decreased compliance and impaired quality of life. © 2017 Wiley Periodicals, Inc.
Messaoudi, Michaël; Lalonde, Robert; Violle, Nicolas; Javelot, Hervé; Desor, Didier; Nejdi, Amine; Bisson, Jean-François; Rougeot, Catherine; Pichelin, Matthieu; Cazaubiel, Murielle; Cazaubiel, Jean-Marc
2011-03-01
In a previous clinical study, a probiotic formulation (PF) consisting of Lactobacillus helveticus R0052 and Bifidobacterium longum R0175 (PF) decreased stress-induced gastrointestinal discomfort. Emerging evidence of a role for gut microbiota on central nervous system functions therefore suggests that oral intake of probiotics may have beneficial consequences on mood and psychological distress. The aim of the present study was to investigate the anxiolytic-like activity of PF in rats, and its possible effects on anxiety, depression, stress and coping strategies in healthy human volunteers. In the preclinical study, rats were daily administered PF for 2 weeks and subsequently tested in the conditioned defensive burying test, a screening model for anti-anxiety agents. In the clinical trial, volunteers participated in a double-blind, placebo-controlled, randomised parallel group study with PF administered for 30 d and assessed with the Hopkins Symptom Checklist (HSCL-90), the Hospital Anxiety and Depression Scale (HADS), the Perceived Stress Scale, the Coping Checklist (CCL) and 24 h urinary free cortisol (UFC). Daily subchronic administration of PF significantly reduced anxiety-like behaviour in rats (P < 0·05) and alleviated psychological distress in volunteers, as measured particularly by the HSCL-90 scale (global severity index, P < 0·05; somatisation, P < 0·05; depression, P < 0·05; and anger-hostility, P < 0·05), the HADS (HADS global score, P < 0·05; and HADS-anxiety, P < 0·06), and by the CCL (problem solving, P < 0·05) and the UFC level (P < 0·05). L. helveticus R0052 and B. longum R0175 taken in combination display anxiolytic-like activity in rats and beneficial psychological effects in healthy human volunteers.
NASA Technical Reports Server (NTRS)
1976-01-01
The feasibility of systematically quantifying the economic benefits of secondary applications of NASA related R and D was investigated. Based upon the tools of economic theory and econometric analysis, a set of empirical methods was developed and selected applications were made to demonstrate their workability. Analyses of the technological developments related to integrated circuits, cryogenic insulation, gas turbines, and computer programs for structural analysis indicated substantial secondary benefits accruing from NASA's R and D in these areas.
Noda, Isao; Roy, Anjan; Carriere, James; Sobieski, Brian J; Chase, D Bruce; Rabolt, John F
2017-07-01
Two-dimensional correlation analysis was applied to the time-dependent evolution of Raman spectra during the isothermal crystallization of bioplastic, poly[(R)-3-hydroxybutyrate- co-(R)-3-hydroxyhexanoate] or PHBHx copolymer. Simultaneous Raman measurement of both carbonyl stretching and low-frequency crystalline lattice mode regions made it possible to carry out the highly informative hetero-mode correlation analysis. The crystallization process of PHBHx involves: (1) the early nucleation stage; (2) the primary growth of well-ordered crystals of PHBHx; and (3) the secondary crystal growth phase. The latter stage probably occurs in the inter-lamellar region, with an accompanying reduction of the amorphous component, which occurs most dominantly during the primary crystal growth. The development of a fully formed lamellar structure comprising the 2 1 helices occurs after the primary growth of crystals. In the later stage, secondary inter lamellar space crystallization occurs after the full formation of packed helices comprising the lamellae.
ERIC Educational Resources Information Center
Schenke, Wouter; van Driel, Jan H.; Geijsel, Femke P.; Sligte, Henk W.; Volman, Monique L. L.
2016-01-01
Collaboration between practitioners and researchers can increasingly be observed in research and development (R&D) projects in secondary schools. This article presents an analysis of cross-professional collaboration between teachers, school leaders and educational researchers and/or advisers as part of R&D projects in terms of three…
Rosso, James Del; Harper, Julie; Pillai, Radhakrishnan; Moore, Robert
2013-01-01
Background: Various formulations of tretinoin have been reported to be unstable after exposure to artificial light or sunlight. The observation that tretinoin is photolabile in the presence of light led to the recommendation that tretinoin be applied in the evening in order to avoid photodegradation, which could potentially reduce efficacy. More recently, the development of innovative vehicle formulations has led, in some cases, to a marked decrease in the photodegradation of tretinoin. Objective: To compare the photostability of a micronized aqueous-based formulation of tretinoin gel 0.05% with tretinoin gel 0.025% following exposure to fluorescent and simulated solar light conditions in vitro. Methods: Micronized tretinoin gel 0.05% and tretinoin gel 0.025% were exposed to fluorescent light over eight hours or simulated solar light up to 600mJ/cm2 (equivalent to 30 minimal erythemal dose). Product samples were prepared and analyzed for tretinoin concentration using high-performance liquid chromatography. Additional duplicate samples were similarly prepared and analyzed after 2, 4, 6, and 8 hours. Results: There was an 11-percent degradation of tretinoin 0.05% formulated as the micronized gel compared to an 86-percent degradation of tretinoin 0.025% formulated as the conventional gel following eight hours of exposure to fluorescent light in vitro. The degradation of tretinoin 0.025% in the conventional gel was greater than 83 percent within two hours. In the second light exposure study, in vitro exposure to simulated solar light provided a gradual dose-response effect with tretinoin 0.05% formulated as the micronized tretinoin gel. The photodegradation of tretinoin 0.025% in the conventional gel was more immediate and of substantial magnitude (>85%) after exposures at all minimal erythemal dose levels. Conclusion: Tretinoin 0.05% formulated as a micronized gel 0.05% showed minimal degradation when exposed to fluorescent light over eight hours. This same
Cheng, Ta-Chun; Tung, Yi-Ching; Chu, Pei-Yu; Chuang, Chih-Hung; Hsieh, Yuan-Chin; Huang, Chien-Chiao; Wang, Yeng-Tseng; Kao, Chien-Han; Roffler, Steve R.; Cheng, Tian-Lu
2016-01-01
Molecular weight markers that can tolerate denaturing conditions and be auto-detected by secondary antibodies offer great efficacy and convenience for Western Blotting. Here, we describe M&R LE protein markers which contain linear epitopes derived from the heavy chain constant regions of mouse and rabbit immunoglobulin G (IgG Fc LE). These markers can be directly recognized and stained by a wide range of anti-mouse and anti-rabbit secondary antibodies. We selected three mouse (M1, M2 and M3) linear IgG1 and three rabbit (R1, R2 and R3) linear IgG heavy chain epitope candidates based on their respective crystal structures. Western blot analysis indicated that M2 and R2 linear epitopes are effectively recognized by anti-mouse and anti-rabbit secondary antibodies, respectively. We fused the M2 and R2 epitopes (M&R LE) and incorporated the polypeptide in a range of 15–120 kDa auto-detecting markers (M&R LE protein marker). The M&R LE protein marker can be auto-detected by anti-mouse and anti-rabbit IgG secondary antibodies in standard immunoblots. Linear regression analysis of the M&R LE protein marker plotted as gel mobility versus the log of the marker molecular weights revealed good linearity with a correlation coefficient R2 value of 0.9965, indicating that the M&R LE protein marker displays high accuracy for determining protein molecular weights. This accurate, regular and auto-detected M&R LE protein marker may provide a simple, efficient and economical tool for protein analysis. PMID:27494183
Research in Secondary Special Education and Transitional Employment.
ERIC Educational Resources Information Center
Rusch, Frank R., Comp.
This compilation of eight research papers covers various aspects of secondary-level special education and transitional employment involving individuals with mild to profound disabilities. Titles and authors of the papers are: "Parent Involvement in Transition Programs" (Jeff McNair and Frank R. Rusch); "Using a Cognitive-Process…
Intensive Treatment of Dysarthria Secondary to Stroke
ERIC Educational Resources Information Center
Mahler, Leslie A.; Ramig, Lorraine O.
2012-01-01
This study investigated the impact of a well-defined behavioral dysarthria treatment on acoustic and perceptual measures of speech in four adults with dysarthria secondary to stroke. A single-subject A-B-A experimental design was used to measure the effects of the Lee Silverman Voice Treatment (LSVT[R]LOUD) on the speech of individual…
SOFIA primary mirror fabrication and testing
NASA Astrophysics Data System (ADS)
Geyl, Roland; Tarreau, Michel; Plainchamp, Patrick
2001-12-01
The Stratospheric Observatory for Infrared Astronomy (SOFIA) is a joint American-German project dedicated to performing IR astronomy on board a Boeing Aircraft, in near space condition. First flight of the Observatory is planned for 2003. The REOSC Products Unit of SAGEM SA (France) has been contracted by Kayser Threde (Germany) for the design and fabrication of the 2.7-meter diameter, F/1.19 parabolic lightweight SOFIA primary mirror as well as the M3 dichroic and folding mirror assembly. This paper will report the design, fabrication and test of the lightweight primary mirror. The mirror structure has been obtained by machining it out from a solid Zerodur blank. It is the world's largest of this type today. Axial and lateral mirror support system has been conceptually designed and engineered by SAGEM-REOSC engineers in relation with Kayser Threde team. The optical surface is an F/1.19 parabola polished to a high level of quality.
Ochsendorf, F
2015-06-01
The Global Alliance to Improve Outcomes in Acne Group recommends retinoid-based combination therapy as first-line therapy and the preferred treatment approach for almost all acne patients except those with the most severe disease. Clindamycin 1% (as clindamycin phosphate 1.2%)/tretinoin 0.025% (Clin-RA) is a new fixed-dose retinoid-based combination therapy. The aqueous-based gel formulation of Clin-RA was designed to minimize skin irritation and optimize adherence with the therapy. It contains both solubilized and crystalline tretinoin which allows the retinoid to be slowly released onto the skin surface and decreases the potential for cutaneous irritation. A pooled analysis of three pivotal studies involving 4550 acne patients showed that Clin-RA is well tolerated and effective at treating both inflammatory and non-inflammatory acne lesions. The onset of action of Clin-RA is rapid occurring within 2 weeks of treatment initiation. It is not associated with acne flaring or an increase in clindamycin-resistant Propionibacterium acnes counts. Clin-RA is considered as effective as adapalene 0.1%/benzoyl peroxide (BPO) 2.5%, whereas Clin-RA has a more favourable tolerability profile. Clin-RA may be more effective than clindamycin 1%/BPO 5% at treating non-inflammatory acne lesions since the latter does not contain a retinoid to target comedones. Clin-RA is also easy for patients to handle and apply, and has the advantage of not containing BPO which can bleach hair and fabrics. Taken together, the profile of Clin-RA suggests Clin-RA to be a first-line treatment for patients with facial acne. © 2015 European Academy of Dermatology and Venereology.
Abubakar, Abdulazeez
2012-04-01
Students are pivotal to manpower development and technological advancement of any nation. Nigerian nation was recently ranked third human immunodeficiency virus (HIV) most endemic nation in the world The study was designed to determine the frequency of HIV infection among Nigerian tertiary and secondary institution students. A HIV screening test was conducted on 1,978 apparently healthy students composed of 981 males and 997 females aged 11-35 years, randomly selected from some Nigerian tertiary and secondary institutions Overall, the sero-prevalence rate of 13.7% was recorded consisting 9.9% in the tertiary and 3.8% in secondary institutions. The distribution of the infection showed no significant difference by age (χ(2)=1.07, P>0.05) and by gender (χ(2)=0.85, P>0.05). Also, the prevalence had no significant association with the settlement of students (χ(2)=0.96, P>0.05) and the status of educational institutions (χ(2)=1.42, P>0.05). The findings indicate a high HIV prevalence rate among students in this part of the globe. General behavioral changes about sex among the students are suggested.
Sweet, Shane N; Noreau, Luc; Leblond, Jean; Dumont, Frédéric S
2014-01-01
Understanding the factors that can predict greater quality of life (QoL) is important for adults with spinal cord injury (SCI), given that they report lower levels of QoL than the general population. To build a conceptual model linking SCI-related needs, secondary complications, and QoL in adults with SCI. Prior to testing the conceptual model, we aimed to develop and evaluate the factor structure for both SCI-related needs and secondary complications. Individuals with a traumatic SCI (N = 1,137) responded to an online survey measuring 13 SCI-related needs, 13 secondary complications, and the Life Satisfaction Questionnaire to assess QoL. The SCI-related needs and secondary complications were conceptualized into factors, tested with a confirmatory factor analysis, and subsequently evaluated in a structural equation model to predict QoL. The confirmatory factor analysis supported a 2-factor model for SCI related needs, χ(2)(61, N = 1,137) = 250.40, P <.001, comparative fit index (CFI) = .93, root mean square error of approximation (RMSEA) = .05, standardized root mean square residual (SRMR) = .04, and for 11 of the 13 secondary complications, χ(2)(44, N = 1,137) = 305.67, P < .001, CFI = .91, RMSEA = .060, SRMR = .033. The final 2 secondary complications were kept as observed constructs. In the structural model, both vital and personal development unmet SCI-related needs (β = -.22 and -.20, P < .05, respectively) and the neuro-physiological systems factor (β = -.45, P < .05) were negatively related with QoL. Identifying unmet SCI-related needs of individuals with SCI and preventing or managing secondary complications are essential to their QoL.
Kyriazis, Thomas A; Terzis, Gerasimos; Boudolos, Konstantinos; Georgiadis, Georgios
2009-09-01
The aim of this study was to investigate changes in shot put performance, muscular power, and neuromuscular activation of the lower extremities, between the preseason and the competition period, in skilled shot put athletes using the rotational technique. Shot put performance was assessed at the start of the pre-season period as well as after 12 weeks, at the competition period, in nine shot putters. Electromyographic (EMG) activity of the right vastus lateralis muscle was recorded during all shot put trials. Maximum squat strength (1RM) and mechanical parameters during the countermovement jump (CMJ) on a force platform were also determined at pre-season and at competition period. Shot put performance increased 4.7% (p < 0.05), while 1RM squat increased 6.5% (p < 0.025). EMG activity during the delivery phase was increased significantly (p < 0.025) after the training period. Shot put performance was significantly related with muscular power and takeoff velocity during the CMJ, at competition period (r = 0.66, p < 0.05 and 0.70, p < 0.05), but not with maximum vertical force. One RM squat was not related significantly with shot put performance. These results suggest that muscular power of the lower extremities is a better predictor of rotational shot put performance than absolute muscular strength in skilled athletes, at least during the competition period.
Do male secondary sexual characters signal ejaculate quality? A meta-analysis.
Mautz, Brian S; Møller, Anders P; Jennions, Michael D
2013-08-01
There are two reasons why researchers are interested in the phenotypic relationship between the expression of male secondary sexual characters (SSCs) and 'ejaculate quality' (defined as sperm/ejaculate traits that are widely assumed to increase female fertility and/or sperm competitiveness). First, if the relationship is positive then females could gain a direct benefit by choosing more attractive males for fertility assurance reasons ('the phenotype-linked fertility' hypothesis). Second, there is much interest in the direction of the correlation between traits favoured by pre-copulatory sexual selection (i.e. affecting mating success) and those favoured by post-copulatory sexual selection (i.e. increasing sperm competitiveness). If the relationship is negative this could lead to the two forms of selection counteracting each other. Theory predicts that the direction of the relationship could be either positive or negative depending on the underlying genetic variance and covariance in each trait, the extent of variation among males in condition (resources available to allocate to reproductive traits), and variation among males in the cost or rate of mating. We conducted a meta-analysis to determine the average relationship between the expression of behavioural and morphological male secondary sexual characters and four assays of ejaculate quality (sperm number, viability, swimming speed and size). Regardless of how the data were partitioned the mean relationship was consistently positive, but always statistically non-significant. The only exception was that secondary sexual character expression was weakly but significantly positively correlated with sperm viability (r = 0.07, P < 0.05). There was no significant difference in the strength or direction of the relationship between behavioural and morphological SSCs, nor among relationships using the four ejaculate quality assays. The implications of our findings are discussed. © 2013 The Authors. Biological Reviews
A B-52H, tail number 61-0025, arrives at NASA's Dryden Flight Research Center after landing July 30,
NASA Technical Reports Server (NTRS)
2001-01-01
NASA Dryden Flight Research Center, Edwards, California, received an 'H' model B-52 Stratofortress aircraft on July 30, 2001. The B-52H will be used as an air-launch aircraft supporting NASA's flight research and advanced technology demonstration efforts. Dryden received the B-52H from the U.S. Air Force's (USAF) 23rd Bomb Squadron, 5th Bombardment Wing (Air Combat Command), located at Minot AFB, N.D. A USAF crew flew the aircraft to Dryden. The aircraft, USAF tail number 61-0025, will be loaned initially, then later transferred from the USAF to NASA. The B-52H is scheduled to leave Dryden Aug. 2 for de-militarization and Programmed Depot Maintenance (PDM) at Tinker Air Force Base (AFB), Oklahoma. The depot-level maintenance is scheduled to last about six months and includes a thorough maintenance and inspection process. The newly arrived B-52H is slated to replace Dryden's famous B-52B '008,' in the 2003-2004 timeframe. It will take about one year for the B-52H to be ready for flight research duties. This time includes PDM, construction of the new pylon, installation of the flight research instrumentation equipment, and aircraft envelope clearance flights.
Stem-Loop RNA Hairpins in Giant Viruses: Invading rRNA-Like Repeats and a Template Free RNA
Seligmann, Hervé; Raoult, Didier
2018-01-01
We examine the hypothesis that de novo template-free RNAs still form spontaneously, as they did at the origins of life, invade modern genomes, contribute new genetic material. Previously, analyses of RNA secondary structures suggested that some RNAs resembling ancestral (t)RNAs formed recently de novo, other parasitic sequences cluster with rRNAs. Here positive control analyses of additional RNA secondary structures confirm ancestral and de novo statuses of RNA grouped according to secondary structure. Viroids with branched stems resemble de novo RNAs, rod-shaped viroids resemble rRNA secondary structures, independently of GC contents. 5′ UTR leading regions of West Nile and Dengue flavivirid viruses resemble de novo and rRNA structures, respectively. An RNA homologous with Megavirus, Dengue and West Nile genomes, copperhead snake microsatellites and levant cotton repeats, not templated by Mimivirus' genome, persists throughout Mimivirus' infection. Its secondary structure clusters with candidate de novo RNAs. The saltatory phyletic distribution and secondary structure of Mimivirus' peculiar RNA suggest occasional template-free polymerization of this sequence, rather than noncanonical transcriptions (swinger polymerization, posttranscriptional editing). PMID:29449833
Backpack-related musculoskeletal symptoms among Nigerian secondary school students.
Hamzat, T K; Abdulkareem, T A; Akinyinka, O O; Fatoye, F A
2014-09-01
Musculoskeletal discomfort in schoolchildren is significantly related to the weight and mode of carrying backpack to school. Prevalence and patterns of musculoskeletal discomfort among Nigerian secondary school students carrying backpack was investigated. Systematic sampling technique was used in the selection of the participating junior secondary schools for this study. Participants comprised 1,785 students aged 10-15 years. Standardised Nordic musculoskeletal questionnaire was used to collect information on musculoskeletal pain. Backpack weight and participants' body weight were measured using a weighing scale. The visual analogue scale was used to assess pain intensity. Gender differences in backpack weight, backpack percentage and musculoskeletal discomfort were studied using Mann-Whitney U test; Kruskal-Wallis test was used to study the influence of backpack carrying style on musculoskeletal discomfort; and Spearman rho correlation to determine the relationships between backpack weight, backpack to body weight ratio, age and pain intensity. There were 882 boys and 903 girls recruited into the study. Shoulder pain was the most prevalent discomfort (63.5 %), and pain was significantly higher in girls (p = 0.013). There were weak relationships between pain intensity, body weight and backpack to body weight ratio (r range 0.433-0.442; p < 0.001), and a weak negative relationship between pain intensity and age [r = -0.135; p < 0.001; 95 % confidence interval (CI) -0.168, -0.075]. There was a strong relationship between backpack weight and age (r = 0.892; p < 0.001; 95 % CI -0.129, -0.013); however, there was a weak relationship between backpack weight and body weight (r = 0.136; p < 0.001). Prevalence of shoulder pain was high, particularly among the girls, in this sample. We suggest that factors other than the weight of backpack may predispose to musculoskeletal pain. Parents, teachers and clinicians can influence the mode of carrying backpack by secondary school
Li, Jing; Blakeley, Daniel; Smith?, Robert J.
2011-01-01
The basic reproductive ratio, R 0, is one of the fundamental concepts in mathematical biology. It is a threshold parameter, intended to quantify the spread of disease by estimating the average number of secondary infections in a wholly susceptible population, giving an indication of the invasion strength of an epidemic: if R 0 < 1, the disease dies out, whereas if R 0 > 1, the disease persists. R 0 has been widely used as a measure of disease strength to estimate the effectiveness of control measures and to form the backbone of disease-management policy. However, in almost every aspect that matters, R 0 is flawed. Diseases can persist with R 0 < 1, while diseases with R 0 > 1 can die out. We show that the same model of malaria gives many different values of R 0, depending on the method used, with the sole common property that they have a threshold at 1. We also survey estimated values of R 0 for a variety of diseases, and examine some of the alternatives that have been proposed. If R 0 is to be used, it must be accompanied by caveats about the method of calculation, underlying model assumptions and evidence that it is actually a threshold. Otherwise, the concept is meaningless. PMID:21860658
ERIC Educational Resources Information Center
Kennedy, Angela
2012-01-01
The purpose of this study was to investigate sources of resistance to burnout in secondary teachers. For the purpose of this study secondary teachers were defined as teachers employed in grades 9-12 with 0-5 years of teaching experience employed in north Louisiana schools. Sources of resistance to burnout was researched in three investigative…
NASA Astrophysics Data System (ADS)
Jong, Chao-An; Gan, Jon-Yiew
2000-02-01
Strontium barium niobium (Sr0.5Ba0.5Nb2O6) (SBN) thin films are prepared on conductive-oxide LNO (LaNiO3) electrodes by the rf magnetron sputtering system. Instead of conventional furnace annealing, SBN thin films are crystallized by rapid thermal annealing (RTA) above 700°C for 5 min. The textured SBN films are crystallized with two orientations: one is the (001) or (310) direction, and the other is the (002) or (620) direction. Films compositions measured by the electron spectroscopy of chemical analysis (ESCA) quantitative analysis method show nearly the same stoichiometric ratio as the target. The depth profiles of SBN films and the target are examined by secondary ion mass spectrometer (SIMS). The concentrations of the films are quite uniform. After being heat treated at 800°C for 5 min by RTA, La and Ni diffuse into the SBN film. The diffusion coefficient of La in SBN films is also calculated.
Perin, Luana Martins; Dal Bello, Barbara; Belviso, Simona; Zeppa, Giuseppe; Carvalho, Antônio Fernandes de; Cocolin, Luca; Nero, Luís Augusto
2015-12-02
Minas cheese is a popular dairy product in Brazil that is traditionally produced using raw or pasteurized cow milk. This study proposed an alternative production of Minas cheese using raw goat milk added of a nisin producer Lactococcus lactis subsp. lactis GLc05. An in situ investigation was carried on to evaluate the interactions between the L. lactis subsp. lactis GLc05 and the autochthonous microbiota of a Minas cheese during the ripening; production of biogenic amines (BAs) was assessed as a safety aspect. Minas cheese was produced in two treatments (A, by adding L. lactis subsp. lactis GLc05, and B, without adding this strain), in three independent repetitions (R1, R2, and R3). Culture dependent (direct plating) and independent (rep-PCR and PCR-DGGE) methods were employed to characterize the microbiota and to assess the possible interferences caused by L. lactis subsp. lactis GLc05. BA amounts were measured using HPLC. A significant decrease in coagulase-positive cocci was observed in the cheeses produced by adding L. lactis subsp. lactis GLc05 (cheese A). The rep-PCR and PCR-DGGE highlighted the differences in the microbiota of both cheeses, separating them into two different clusters. Lactococcus sp. was found as the main microorganism in both cheeses, and the microbiota of cheese A presented a higher number of species. High concentrations of tyramine were found in both cheeses and, at specific ripening times, the BA amounts in cheese B were significantly higher than in cheese A (p<0.05). The interaction of nisin producer L. lactis subsp. lactis GLc05 was demonstrated in situ, by demonstration of its influence in the complex microbiota naturally present in a raw goat milk cheese and by controlling the growth of coagulase-positive cocci. L. lactis subsp. lactis GLc05 influenced also the production of BA determining that their amounts in the cheeses were maintained at acceptable levels for human consumption. Copyright © 2015 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Kabata, Yasuo; Higashi, Yukihiro; Uematsu, Masahiko; Watanabe, Koichi
Measurements of the vapor-liquid coexistence curve in the critical region for the refrigerant mixture of R152a (CH3CHF2: 1, l-difluoroethane) +R 114 (CCIF2CCIF2 :1, 2-dichloro-1, 1, 2, 2-tetrafluoroethane) system were made by visual observation of the disappearance of the meniscus at the vapor-liquid interface within an optical cell. Forty-eight saturated densities along the vapor-liquid coexistence curve between 204 and 861 kg·m-3 for five different compositions of 10, 20, 50, 80 and 90 wt% R 152a were obtained in the temperature range 370 to 409 K. The experimental errors of temperature, density, and mass fraction were estimated within ±10mK, ±0.5% and +0.05 %, respectively. On the basis of these measurements, the critical parameters of five different compositions for the R 152a +R 114 system were determined in consideration of the meniscus disappearance level as well as intensity of the critical opalescence. In accordance with the previous results of three other refrigerant mixtures, i.e., R 12 +R 22 system, R 22 +R 114 system and R 13B1 + R 114 system, the coexistence curve and critical curve on the temperature-density diagram for binary refrigerant mixtures were discussed. In addition, correlations of its composition dependence for this system were proposed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rabinowitz, David; Schwamb, Megan E.; Hadjiyska, Elena
2013-07-01
We present long-term BVRI observations of 2010 WG9, an {approx}100 km diameter trans-Neptunian object (TNO) with an extremely high inclination of 70 Degree-Sign discovered by the La Silla-QUEST southern sky survey. Most of the observations were obtained with ANDICAM on the SMARTS 1.3 m at Cerro Tololo, Chile from 2010 December to 2012 November. Additional observations were made with EFOSC2 on the 3.5 m NTT telescope of the European Southern Observatory at La Silla, Chile in 2011 February. The observations reveal a sinusoidal light curve with amplitude 0.14 mag and period 5.4955 {+-} 0.0025 days, which is likely half themore » true rotation period. Such long rotation periods have previously been observed only for tidally evolved binary TNOs, suggesting that 2010 WG9 may be such a system. We predict a nominal separation of at least 790 km, resolvable with the Hubble Space Telescope and ground-based systems. We measure B - R = 1.318 {+-} 0.029 and V - R = 0.520 {+-} 0.018, consistent with the colors of modestly red Centaurs and Damocloids. At I-band wavelengths, we observe an unusually large variation of color with rotational phase, with R - I ranging from 0.394 {+-} 0.025 to 0.571 {+-} 0.044. We also measure an absolute R-band absolute magnitude of 7.93 {+-} 0.05 and solar phase coefficient of 0.049 {+-} 0.019 mag deg{sup -1}.« less
Zeichner, Joshua A; Wong, Vicky; Linkner, Rita V; Haddican, Madelaine
2013-03-01
Combination therapy using medications with complementary mechanisms of action is the standard of care in treating acne. We report results of a clinical trial evaluating the use of a fixed-dose tretinoin 0.025%/clindamycin phosphate 1.2% (T/CP) gel in combination with a benzoyl peroxide 6% foaming cloth compared with T/CP alone for facial acne. At week 12, the combination therapy group showed a trend toward greater efficacy compared with T/CP alone. There was a high success rate observed in the study, which may be attributable to the large percentage of adult female acne patients enrolled. Cutaneous adverse events were not statistically different in using combination therapy compared with T/CP alone.
MicroRNA857 Is Involved in the Regulation of Secondary Growth of Vascular Tissues in Arabidopsis1
Zhao, Yuanyuan; Lin, Sen; Qiu, Zongbo; Cao, Dechang; Wen, Jialong; Deng, Xin; Wang, Xiaohua; Lin, Jinxing; Li, Xiaojuan
2015-01-01
MicroRNAs (miRNAs) are endogenous small RNAs that repress target gene expression posttranscriptionally, and are critically involved in various developmental processes and responses to environmental stresses in eukaryotes. MiRNA857 is not widely distributed in plants and is encoded by a single gene, AtMIR857, in Arabidopsis (Arabidopsis thaliana). The functions of miR857 and its mechanisms in regulating plant growth and development are still unclear. Here, by means of genetic analysis coupled with cytological studies, we investigated the expression pattern and regulation mechanism of miR857 and its biological functions in Arabidopsis development. We found that miR857 regulates its target gene, Arabidopsis LACCASE7, at the transcriptional level, thereby reducing laccase activity. Using stimulated Raman scattering and x-ray microtomography three-dimensional analyses, we showed that miR857 was involved in the regulation of lignin content and consequently morphogenesis of the secondary xylem. In addition, miR857 was activated by SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 in response to low copper conditions. Collectively, these findings demonstrate the role of miR857 in the regulation of secondary growth of vascular tissues in Arabidopsis and reveal a unique control mechanism for secondary growth based on the miR857 expression in response to copper deficiency. PMID:26511915
Using secondary structure to identify ribosomal numts: cautionary examples from the human genome.
Olson, Link E; Yoder, Anne D
2002-01-01
The identification of inadvertently sequenced mitochondrial pseudogenes (numts) is critical to any study employing mitochondrial DNA sequence data. Failure to discriminate numts correctly can confound phylogenetic reconstruction and studies of molecular evolution. This is especially problematic for ribosomal mtDNA genes. Unlike protein-coding loci, whose pseudogenes tend to accumulate diagnostic frameshift or premature stop mutations, functional ribosomal genes are not constrained to maintain a reading frame and can accumulate insertion-deletion events of varying length, particularly in nonpairing regions. Several authors have advocated using structural features of the transcribed rRNA molecule to differentiate functional mitochondrial rRNA genes from their nuclear paralogs. We explored this approach using the mitochondrial 12S rRNA gene and three known 12S numts from the human genome in the context of anthropoid phylogeny and the inferred secondary structure of primate 12S rRNA. Contrary to expectation, each of the three human numts exhibits striking concordance with secondary structure models, with little, if any, indication of their pseudogene status, and would likely escape detection based on structural criteria alone. Furthermore, we show that the unwitting inclusion of a particularly ancient (18-25 Myr old) and surprisingly cryptic human numt in a phylogenetic analysis would yield a well-supported but dramatically incorrect conclusion regarding anthropoid relationships. Though we endorse the use of secondary structure models for inferring positional homology wholeheartedly, we caution against reliance on structural criteria for the discrimination of rRNA numts, given the potential fallibility of this approach.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Glick, A; Diffenderfer, E
2016-06-15
Proton radiation therapy can deliver high radiation doses to tumors while sparing normal tissue. However, protons yield secondary neutron and gamma radiation that is difficult to detect, small in comparison to the prescribed dose, and not accounted for in most treatment planning systems. The risk for secondary malignancies after proton therapy may be dependent on the quality of this dose. Consequently, there is interest in characterizing the secondary radiation. Previously, we used the dual ionization chamber method to measure the separate absorbed dose from gamma-rays and neutrons secondary to the proton beam1, relying on characterization of ionization chamber response inmore » the unknown neutron spectrum from Monte Carlo simulation. We developed a procedure to use Shieldwerx activation foils, with neutron activation energies ranging from 0.025 eV to 13.5 MeV, to measure the neutron energy spectrum from double scattering (DS) and pencil beam scanning (PBS) protons outside of the treatment volume in a water tank. The activated foils are transferred to a NaI well chamber for gamma-ray spectroscopy and activity measurement. Since PBS treats in layers, the switching time between layers is used to correct for the decay of the activated foils and the relative dose per layer is assumed to be proportional to the neutron fluence per layer. MATLAB code was developed to incorporate the layer delivery and switching time into a calculation of foil activity, which is then used to determine the neutron energy fluence from tabulated foil activation energy thresholds.1. Diffenderfer et. al., Med. Phys., 38(11) 2011.« less
Chen, Xin; Guo, Jia; Xi, Ru-Xing; Chang, Yu-Wei; Pan, Fei-Yang; Zhang, Xiao-Zhi
2014-01-01
AIM: To investigate the expression of miR-210 and the role it plays in the cell cycle to regulate radioresistance in oesophageal squamous cell carcinoma (ESCC). METHODS: MiR-210 expression was evaluated in 37 pairs of ESCC tissues and matched para-tumorous normal oesophageal tissues from surgical patients who had not received neoadjuvant therapy, and in the cells of two novel radioresistant cell lines, TE-1R and Eca-109R, using quantitative reverse transcription-polymerase chain reaction (qRT-PCR). The transient up-regulation of miR-210 expression in TE-1R and Eca-109R cells was studied using liposomes and was confirmed using qRT-PCR. The rate of cell survival after a series of radio-treatment doses was evaluated using the clone formation assay. Flow cytometry was used to detect the changes to the cell cycle patterns due to radiation treatment. RT-PCR and Western blot were used to detect the expression of ataxia telangiectasia mutated (ATM) and DNA dependent protein kinase (DNA-PKcs) after irradiation, and the cell sphere formation assay was used to evaluate the proliferative ability of the cancer stem-like cells. RESULTS: The level of miR-210 expression was significantly decreased, by 21.3% to 97.2%, with the average being 39.2% ± 16.1%, in the ESCC tissues of most patients (81.1%, 30 of 37 vs patients with high miR-210 expression, P < 0.05). A low level of expression of miR-210 was correlated with a poorly differentiated pathological type (P < 0.01) but was not correlated with the T-stage or lymph node infiltration (both P > 0.05). Early local recurrences (< 18 mo, n = 19) after radiotherapy were significantly related with low miR-210 expression (n = 13, P < 0.05). The level of miR-210 was decreased by approximately 73% (vs TE-1, 0.27 ± 0.10, P < 0.01) in the established radioresistant TE-IR cell line and by 52% (vs Eca-109, 0.48 ± 0.17, P < 0.05) in the corresponding Eca-109R line. Transient transfection with a miR-210 precursor increased the level of miR-210
ERIC Educational Resources Information Center
Ning, Hoi Kwan
2017-01-01
This study examined the psychometric properties of the Achievement Goal Questionnaire-Revised (AGQ-R) in a sample of Singapore secondary students (N = 1,171). Confirmatory factor analyses provided support for the AGQ-R in measuring the four achievements goals delineated in the 2 × 2 framework. Measurement invariance across ethnic groups was…
Longitudinal T1 relaxation rate (R1) captures changes in short-term Mn exposure in welders
Lewis, Mechelle M.; Flynn, Michael R.; Lee, Eun-Young; Van Buren, Scott; Van Buren, Eric; Du, Guangwei; Fry, Rebecca C.; Herring, Amy H.; Kong, Lan; Mailman, Richard B.; Huang, Xuemei
2016-01-01
Objectives We demonstrated recently that the T1 relaxation rate (R1) captured short-term Mn exposure in welders with chronic, relatively low exposure levels in a cross-sectional study. In the current study, we used a longitudinal design to examine whether R1 values reflect the short-term dynamics of Mn exposure. Methods Twenty-nine welders were evaluated at baseline and 12 months. Occupational questionnaires estimated short-term welding exposure using welding hours in the 90 days prior to each study visit (HrsW90). In addition, blood Mn levels, the pallidal index (PI; globus pallidus T1-weighted intensity (T1WI)/frontal white matter T1WI), and R1 values in brain regions of interest (ROIs) were determined as Mn biomarkers at each visit. Associations between changes in estimated welding exposure and changes in purported Mn biomarkers were assessed by Spearman’s correlations with adjustment for age and baseline R1, HrsW90, and blood Mn values. Results Changes in welding hours (HrsW90: the short-term welding exposure estimate), was associated significantly with changes in R1 values in the putamen (r=0.541, p=0.005), caudate (R=0.453, p=0.023), globus pallidus (R=0.430, p=0.032), amygdala (R=0.461, p=0.020), and hippocampus (R=0.447, p=0.025), but not with changes in blood Mn levels or the PI. Discussion Changes in R1 values correlated with changes in the short-term welding exposure estimate, but not with more traditional measures of Mn exposure (blood Mn levels or PI). These results suggest that R1 may serve as a useful marker to capture the short-term dynamics in Mn brain accumulation related to welding exposure. PMID:27567731
Thromboxane Mediation of Cardiopulmonary Effects of Embolism
Utsunomiya, Takayoshi; Krausz, Michael M.; Levine, Lawrence; Shepro, David; Hechtman, Herbert B.
1982-01-01
Humoral factors released from platelets during pulmonary embolism may be the cause of several attendant cardiopulmonary abnormalities. This study examines the role of thromboxanes (Tx) after experimental embolism induced with 0.5 g/kg autologous clot in four groups of five dogs: (a) untreated embolized controls; (b) pretreatment with the Tx synthetase inhibitor, imidazole 25 mg/kg · h i.v., starting 30 min before embolization; (c) pretreatment with the cyclooxygenase inhibitor indomethacin, 5 mg/kg, 12 h per os and 1 mg/kg, 1 h i.v. before the experiment; (d) treatment with prostacyclin (PGI2) 100 ηg/kg · min i.v. for 1 h, 1 h after embolization. Within 30 min, embolization led to increases of 6-keto-PGF1α, the stable hydrolysis product of PGI2, from 0.11±0.08 ηg/ml (mean±SD) to 0.33±0.10 ηg/ml (P < 0.005) and TxB2, the stable product of TxA2, from 0.10±0.04 ηg/ml to 0.38±0.06 ηg/ml (P < 0.001). Increases were observed in total dead space (VD/VT) from 0.46±0.03 to 0.61±0.08 (P < 0.025, physiologic shunting (Q̇S/Q̇T) from 16±4% to 38±9% (P < 0.01), pulmonary vascular resistance (PVR) from 2.27±0.59 mm Hg·min/liter to 9.21±1.90 mm Hg·min/liter (P < 0.005) and mean pulmonary arterial pressure from 14±6 mm Hg to 34±1 mm Hg (P < 0.001). Cardiac index (CI) fell from 139±11 ml/kg·min to 95±17 ml/kg·min in 4 h (P < 0.025). Imidazole pretreatment prevented a rise of TxB2, but not 6-keto-PGF1α; indomethacin blocked both. Both agents maintained VD/VT at base line and limited increases in Q̇S/Q̇T and PVR. CI was higher after imidazole pretreatment compared with controls (P < 0.025). Indomethacin led to intermediate levels of CI. PGI2 lowered TxB2 (P < 0.025), VD/VT (P < 0.025), Q̇S/Q̇T (P < 0.025) and PVR (P < 0.05) within 30 min. During PGI2 infusion, CI was higher than controls. Concentrations of TxB2 correlated with VD/VT, r = 0.79 and Q̇S/Q̇T, r = 0.69 (P < 0.001). Treatment of three dogs with the imidazole derivative ketoconazole, 10 mg
Mazzone, Annette L; Baker, Robert A; McNicholas, Kym; Woodman, Richard J; Michael, Michael Z; Gleadle, Jonathan M
2018-03-01
A pilot study to measure and compare blood and urine microRNAs miR-210 and miR-16 in patients undergoing cardiac surgery with cardiopulmonary bypass (CPB) and off-pump coronary artery bypass grafting surgery. Frequent serial blood and urine samples were taken from patients undergoing cardiac surgery with CPB (n = 10) and undergoing off-pump cardiac surgery (n = 5) before, during, and after surgery. Circulating miR-210 and miR-16 levels were determined by relative quantification real-time polymerase chain reaction. Levels of plasma-free haemoglobin (fHb), troponin-T, creatine kinase, and creatinine were measured. Perioperative serum miR-210 and miR-16 were elevated significantly compared to preoperative levels in patients undergoing cardiac surgery with CPB (CPB vs. Pre Op and Rewarm vs. Pre Op; p < .05 for both). There were increases of greater than 200% in miR-210 levels during rewarming and immediately postoperatively and a 3,000% increase in miR-16 levels immediately postoperatively in urine normalized to urinary creatinine concentration. Serum levels of miR-16 were relatively constant during off-pump surgery. miR-210 levels increased significantly in off-pump patients perioperatively ( p < .05 Octopus on vs. Pre Op); however, the release was less marked when compared to cardiac surgery with CPB. A significant association was observed between both miR-16 and miR-210 and plasma fHb when CPB was used ( r = -.549, p < .0001 and r = -.463, p < .0001 respectively). Serum and urine concentrations of hypoxically regulated miR-210 and hemolysis-associated miR-16 increased in cardiac surgery using CPB compared to off-pump surgery. These molecules may have utility in indicating severity of cardiac, red cell, and renal injury during cardiac surgery.
Choi, Y G; Kim, D H; Im, J S; Kang, J W; Kim, E J; Kim, J
2008-10-01
Li[Ni(1-x-y)Co(x)Mn(y)]O2 (0.025 < or = x < or = 0.4, 0.015 < or = y < or = 0.25) electrode powders were prepared by a solid-state reaction. The phase purity and R-3m layered structure of the synthesized Li[Ni(1-x-y)Co(x)Mn(y)]O2 materials were confirmed by X-ray diffraction analysis. The particle size of the powder/compounds was decreased with increasing Co and Mn contents to a minimum average particle size of 0.2 approximately 0.3 microm for the LiNi0.35Co0.4Mn0.25O2 powder. A specific capacity of 187 mAh/g was obtained for the LiNi0.35Co0.4Mn0.25O2 electrode with good capacity retention when cycled in the potential region of 3.0-4.6 V with a current density of 20 mA/g at room temperature. Although the structural parameters of the LiNi0.35Co0.4Mn0.25O2 cathode material were similar to those of the LiNil/3CO1/3Mn1/3O2 powder, its specific capacity was higher due to the higher Co contents.
miR-155 modulates the progression of neuropathic pain through targeting SGK3
Liu, Shaoxing; Zhu, Bo; Sun, Yan; Xie, Xianfeng
2015-01-01
This study aimed to illustrate the potential effects of miR-155 in neuropathic pain and its potential mechanism. Spragure-Dawley (SD) rats were used for neuropathic pain model of bilateral chronic constriction injury (bCCI) construction. Effects of miR-155 expression on pain threshold of mechanical stimuli (MWT), paw withdrawal threshold latency (PMTL) and cold threshold were analyzed. Target for miR-155 was analyzed using bioinformatics methods. Moreover, effects of miR-155 target gene expression on pain thresholds were also assessed. Compared with the controls and sham group, miR-155 was overexpressed in neuropathic pain rats (P<0.05), but miR-155 slicing could significantly decreased the pain thresholds (P<0.05). Serum and glucocorticoid regulated protein kinase 3 (SGK3) was predicted as the target gene for miR-155, and miR-155 expression was negatively correlated to SGK3 expression. Furthermore, SGK3 overexpression could significantly decreased the pain thresholds which was the same as miR-155 (P<0.05). Moreover, miR-155 slicing and SGK3 overexpression could significantly decrease the painthreshold. The data presented in this study suggested that miR-155 slicing could excellently alleviate neuropathic pain in rats through targeting SGK3 expression. miR-155 may be a potential therapeutic target for neuropathic pain treatment. PMID:26823753
MiR-155 modulates the progression of neuropathic pain through targeting SGK3.
Liu, Shaoxing; Zhu, Bo; Sun, Yan; Xie, Xianfeng
2015-01-01
This study aimed to illustrate the potential effects of miR-155 in neuropathic pain and its potential mechanism. Spragure-Dawley (SD) rats were used for neuropathic pain model of bilateral chronic constriction injury (bCCI) construction. Effects of miR-155 expression on pain threshold of mechanical stimuli (MWT), paw withdrawal threshold latency (PMTL) and cold threshold were analyzed. Target for miR-155 was analyzed using bioinformatics methods. Moreover, effects of miR-155 target gene expression on pain thresholds were also assessed. Compared with the controls and sham group, miR-155 was overexpressed in neuropathic pain rats (P<0.05), but miR-155 slicing could significantly decreased the pain thresholds (P<0.05). Serum and glucocorticoid regulated protein kinase 3 (SGK3) was predicted as the target gene for miR-155, and miR-155 expression was negatively correlated to SGK3 expression. Furthermore, SGK3 overexpression could significantly decreased the pain thresholds which was the same as miR-155 (P<0.05). Moreover, miR-155 slicing and SGK3 overexpression could significantly decrease the painthreshold. The data presented in this study suggested that miR-155 slicing could excellently alleviate neuropathic pain in rats through targeting SGK3 expression. miR-155 may be a potential therapeutic target for neuropathic pain treatment.
The effect of secondary impurities on solar cell performance
NASA Technical Reports Server (NTRS)
Hill, D. E.; Gutsche, H. W.; Wang, M. S.; Gupta, K. P.; Tucker, W. F.; Dowdy, J. D.; Crepin, R. J.
1976-01-01
Czochralski and float zone sigle crystals of silicon were doped with the primary impurities B or P so that a resistivity of 0.5 ohm cm resulted, and in addition doped with certain secondary impurities including Al, C, Cr, Cu, Fe, Mg, Mn, Na, Ni, O, Ti, V, and Zr. The actual presence of these impurities was confirmed by analysis of the crystals. Solar cell performance was evaluated and found to be degraded most significantly by Ti, V, and Zr and to some extent by most of the secondary impurities considered. These results are of significance to the low cost silicon program, since any such process would have to yield at least tolerable levels of these impurities.
Detection and Assessment of Secondary Sonic Booms in New England.
1980-05-01
MEASUREMENT DATA During the period May 3, 1979 to September 14, 1979, infra - sonic measurements were made at Malden MA, at six other sites in the Greater...D-AO8O 160 TRANSPORTATION SYSTEMS CENTER CAMBRIDGE MA F/ 20/1 DETECTION AND ASSESSMENT OF SECONDARY SONIC BOOMS IN NEW ENGLAN--ETC(U) MAY 80 E J...CHART F AA-AEE-8O-22 DETECTION AND ASSESSMENT OF SECONDARY SONIC BOOMS IN NEW ENGLAND AD A088 160 MAY 1980 Q4 = Ci OF T R, 4 This document has been
Ren, Lili; Chen, Fang; Feng, Yuqian
2016-01-01
Ginkgo biloba is a typical relic plant that rarely suffers from pest hazards. This study analyzed the pattern of G. biloba pest hazards in Beijing; tested the antifeedant activity of G. biloba extracts, including ginkgo flavonoids, ginkgolide, and bilobalide, against Hyphantria cunea larvae; determined the activities of glutathione transferase (GSTs), acetylcholinesterase (AChE), carboxylesterase (CarE) and mixed-functional oxidase (MFO), in larvae after feeding on these G. biloba secondary metabolites; and screened for effective botanical antifeedants in the field. In this study, no indicators of insect infestation were found for any of the examined leaves of G. biloba; all tested secondary metabolites showed significant antifeedant activity and affected the activity of the four larval detoxifying enzymes. Ginkgolide had the highest antifeedant activity and the most significant effect on the detoxifying enzymes (P<0.05). Spraying leaves with G. biloba extracts or ginkgolide both significantly repelled H. cunea larvae in the field (P<0.05), although the former is more economical and practical. This study investigated the antifeedant activity of G. biloba secondary metabolites against H. cunea larvae, and the results provide new insights into the mechanism of G. biloba pest resistance. This study also developed new applications of G. biloba secondary metabolites for effective pest control. PMID:27214257
Pan, Long; Ren, Lili; Chen, Fang; Feng, Yuqian; Luo, Youqing
2016-01-01
Ginkgo biloba is a typical relic plant that rarely suffers from pest hazards. This study analyzed the pattern of G. biloba pest hazards in Beijing; tested the antifeedant activity of G. biloba extracts, including ginkgo flavonoids, ginkgolide, and bilobalide, against Hyphantria cunea larvae; determined the activities of glutathione transferase (GSTs), acetylcholinesterase (AChE), carboxylesterase (CarE) and mixed-functional oxidase (MFO), in larvae after feeding on these G. biloba secondary metabolites; and screened for effective botanical antifeedants in the field. In this study, no indicators of insect infestation were found for any of the examined leaves of G. biloba; all tested secondary metabolites showed significant antifeedant activity and affected the activity of the four larval detoxifying enzymes. Ginkgolide had the highest antifeedant activity and the most significant effect on the detoxifying enzymes (P<0.05). Spraying leaves with G. biloba extracts or ginkgolide both significantly repelled H. cunea larvae in the field (P<0.05), although the former is more economical and practical. This study investigated the antifeedant activity of G. biloba secondary metabolites against H. cunea larvae, and the results provide new insights into the mechanism of G. biloba pest resistance. This study also developed new applications of G. biloba secondary metabolites for effective pest control.
Secondary metabolites produced by Sardiniella urbana, a new emerging pathogen on European hackberry.
Cimmino, Alessio; Maddau, Lucia; Masi, Marco; Linaldeddu, Benedetto Teodoro; Evidente, Antonio
2018-05-30
In this study the production of secondary metabolites by a virulent strain of Sardiniella urbana, a recently described pathogen originally found on declining European hackberry trees in Italy, was investigated for the first time. Chemical analysis of the culture filtrate extracts led to the isolation of three well known compounds as R-(-)-mellein and (3R,4R)-and (3R,4S)-4-hydroxy melleins which were identified by spectroscopic methods (essentially NMR and ESIMS). The isolated compounds were tested for their phytotoxic, antifungal and zootoxic activities. Among them, only R-(-)-mellein was found to be active.
Secondary Traumatization of Wives of War Veterans with Posttraumatic Stress Disorder
Frančišković, Tanja; Stevanović, Aleksandra; Jelušić, Ilijana; Roganović, Branka; Klarić, Miro; Grković, Jasna
2007-01-01
Aim To determine the symptoms of secondary traumatic stress and possible influences of demographic and socioeconomic factors on the occurrence of secondary traumatic stress in wives of war veterans with posttraumatic stress disorder (PTSD). Method The study included 56 wives of war veterans diagnosed with PTSD and treated at the Center for Psychotrauma in Rijeka, Croatia. A short structured interview was conducted with each woman to collect demographic and socioeconomic data. The women independently completed an adapted 16-item version of Indirect Traumatization Questionnaire to determine the presence of secondary traumatic stress symptoms, which corresponded with PTSD symptoms as defined by the fourth edition of the Diagnostic and Statistical Manual for Mental Disorders. Results Out of 56 veterans’ wives included in the study, 32 had six or more symptoms of secondary traumatic stress, whereas only 3 had none of the symptoms. Twenty-two women met the diagnostic criteria for secondary traumatic stress. Women with secondary traumatic stress were married longer than those without it (mean ± standard deviation, 19.1 ± 9.1 vs 13.2 ± 7.8 years, respectively; P = 0.016). Eleven of 22 women with secondary traumatic stress and 8 of 34 women without secondary traumatic stress were unemployed (P = 0.05). Conclusion As more than a third of war veterans wives met the criteria for secondary traumatic stress, any treatment offered to veterans with PTSD must address the traumatization of their family. PMID:17436382
Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective
NASA Technical Reports Server (NTRS)
Gutell, R. R.; Larsen, N.; Woese, C. R.
1994-01-01
The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical
2002-01-17
KENNEDY SPACE CENTER, FLA. -- Workers in the Vertical Processing Facility wheel a container with the NICMOS II across the floor. The Near Infrared Camera and Multi-Object Spectrometer (NICMOS) Cooling System is part of the payload on mission STS-109, the Hubble Servicing Telescope Mission. NICMOS is a new experimental cooling system consisting of a compressor and tiny turbines. With the experimental cryogenic system, NASA hopes to re-cool the infrared detectors to below -315 degrees F (-193 degrees Celsius). NICMOS II was previously tested aboard STS-95 in 1998. It could extend the life of the Hubble Space Telescope by several years. Astronauts aboard Columbia on mission STS-109 will be replacing the original NICMOS with the newer version. Launch of mission STS-109 is scheduled for Feb. 28, 2002
2003-01-05
KENNEDY SPACE CENTER, FLA. -- In the Multi-Purpose Processing Facility, NASA's Solar Radiation and Climate Experiment (SORCE) closes in on the Pegasus XL Expendable Launch Vehicle for mating. SORCE will study and measure solar irradiance as a source of energy in the Earth's atmosphere. The launch of SORCE is scheduled for Jan. 25 at 3:14 p.m. from Cape Canaveral Air Force Station, Fla.
Zhang, Yong; Zhao, Ming; Yano, Shuya; Uehara, Fuminari; Yamamoto, Mako; Hiroshima, Yukihiko; Toneri, Makoto; Bouvet, Michael; Matsubara, Hisahiro; Tsuchiya, Hiroyuki; Hoffman, Robert M.
2015-01-01
Peritoneal disseminated cancer is highly treatment resistant. We here report the efficacy of intraperitoneal (i.p.) administration of tumor-targeting Salmonella typhimurium A1-R in a nude mouse model of disseminated human ovarian cancer. The mouse model was established by intraperitoneal injection of the human ovarian cancer cell line SKOV3-GFP. Seven days after implantation, mice were treated with S. typhimurium A1-R via intravenous (i.v.) or i.p. administration at the same dose, 5×107 CFU, once per week. Both i.v. and i.p. treatments effected prolonged survival compared with the untreated control group (P=0.025 and P<0.001, respectively). However, i.p. treatment was less toxic than i.v. treatment. Tumor-specific targeting of S. typhimurium A1-R was confirmed with bacterial culture from tumors and various organs and tumor or organ colony formation after i.v. or i.p. injection. Selective tumor targeting was most effective with i.p. administration. The results of the present study show S. typhimurium A1-R has promising clinical potential for disseminated ovarian cancer, especially via i.p. administration. PMID:25957417
Laboratory spectra of C-13 ethane
NASA Technical Reports Server (NTRS)
Kurtz, Joe; Reuter, Dennis C.; Jennings, Donald E.; Hillman, John J.
1991-01-01
The laboratory infrared spectrum of C-13 monosubstituted ethane has been obtained at high resolution (0.0025/cm) using the McMath Fourier transform spectrometer at Kitt Peak National Observatory in May 1990. A preliminary analysis of the nu12 rQ0 branch (substituted species) suggests that its intensity is 1.15 + or - 0.05 times stronger than the equivalent nu9 branch in the normal (C-12)2H6 species. This result leads to a correction of a previously published estimate for the C-12/C-13 ratio in the atmosphere of Jupiter from about 94 to about 106.
Large aspheric optics for high-power, high-energy laser
NASA Astrophysics Data System (ADS)
Geyl, Roland; Houbre, Francois
2001-12-01
SAGEM, within its REOSC high performance optics product line, has developed through the years a specific knowledge in large plano, spherical and aspherical optics for high energy or high power laser. This paper is aimed to illustrate the application of aspheric optics for such laser application with several examples of increasing optical surface complexity.
Abboud, M; Benzerroug, M; Milazzo, S
2017-02-01
The occurrence of a subretinal hematoma in age-related macular degeneration (AMD) is a serious complication that can impact the visual prognosis with a poor functional recovery. The management of this complication remains controversial. Several therapeutic methods have been described. We report the results of four patients treated with a protocol combining: vitrectomy, subretinal injection of r-TPA 0.025mg/0.3ml, intravitreal injection of 0.05ml of bevacizumab and retinal tamponade with 20% SF6 gas. Our series consists of four patients with a submacular hematoma complicating AMD, included in succession between October 2013 and October 2014 and treated with the same treatment protocol and by the same surgeon. All patients underwent surgery within eight days after the onset of the macular hematoma. Patients with a consultation period longer than eight days did not undergo this treatment. Face down postoperative positioning was then carried out for seven days by the patients. We observed a shift in the macular hematoma in the four patients, which allowed the identification of secondary neovascularization responsible for the bleeding. The visual acuity improved in three patients from hand motion (HM) preoperatively to 2/10 at one month postoperatively. One patient maintained visual acuity 1/20 during the entire follow-up despite almost complete resorption of the subretinal hematoma. These visual acuities were stable at 6 months postoperatively. Macular subretinal hematoma can cause severe visual loss by several mechanisms. The blood accumulates between the neurosensory retina and the retinal pigment epithelium, which causes a toxic effect on the surrounding tissues, thus resulting in a loss of photoreceptors and cellular destruction in the pigment epithelium and choriocapillaris, evolving into a fibroglial scar. The therapeutic evaluation of this protocol in our series of four patients gives a favorable result. We observed an improvement in visual acuity in 3/4 of
NASA Astrophysics Data System (ADS)
Nhalil, Hariharan; Elizabeth, Suja
2016-12-01
Highly non-linear I-V characteristics and apparent colossal electro-resistance were observed in non-charge ordered manganite Tb0.5Sr0.5MnO3 single crystal in low temperature transport measurements. Significant changes were noticed in top surface temperature of the sample as compared to its base while passing current at low temperature. By analyzing these variations, we realize that the change in surface temperature (ΔTsur) is too small to have caused by the strong negative differential resistance. A more accurate estimation of change in the sample temperature was made by back-calculating the sample temperature from the temperature variation of resistance (R-T) data (ΔTcal), which was found to be higher than ΔTsur. This result indicates that there are large thermal gradients across the sample. The experimentally derived ΔTcal is validated with the help of a simple theoretical model and estimation of Joule heating. Pulse measurements realize substantial reduction in Joule heating. With decrease in sample thickness, Joule heating effect is found to be reduced. Our studies reveal that Joule heating plays a major role in the nonlinear electrical response of Tb0.5Sr0.5MnO3. By careful management of the duty cycle and pulse current I-V measurements, Joule heating can be mitigated to a large extent.
Wang, Wei; Li, Eryang; Porth, Ilga; ...
2016-02-02
Among the R2R3 MYB transcription factors that involve in the regulation of secondary cell wall formation in Arabidopsis, MYB46 alone is sufficient to induce the entire secondary cell wall biosynthesis program. PtrMYB021, the poplar homolog of MYB46, has been reported to regulate secondary cell wall formation when expressed in Arabidopsis. We report here that spatially and temporally restricted expression of PtrMYB021 is critical for its function in regulating secondary cell wall formation. By using quantitative RT-PCR, we found that PtrMYB021 was expressed primarily in xylem tissues. When expressed in Arabidopsis under the control of PtrCesA8, but not the 35S promoter,more » PtrMYB021 increased secondary cell wall thickness, which is likely caused by increased lignification as well as changes in cell wall carbohydrate composition. Consistent with this, elevated expression of lignin and cellulose biosynthetic genes were observed in the transgenic plants. Finally, when expressed in Arabidopsis protoplasts as fusion proteins to the Gal4 DNA binding domain, PtrMYB021 activated the reporter gene Gal4-GUS. In summary, our results suggest that PtrMYB021 is a transcriptional activator, and spatially and temporally restricted expression of PtrMYB021 in Arabidopsis regulates secondary cell wall formation by activating a subset of secondary cell wall biosynthesis genes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Wei; Li, Eryang; Porth, Ilga
Among the R2R3 MYB transcription factors that involve in the regulation of secondary cell wall formation in Arabidopsis, MYB46 alone is sufficient to induce the entire secondary cell wall biosynthesis program. PtrMYB021, the poplar homolog of MYB46, has been reported to regulate secondary cell wall formation when expressed in Arabidopsis. We report here that spatially and temporally restricted expression of PtrMYB021 is critical for its function in regulating secondary cell wall formation. By using quantitative RT-PCR, we found that PtrMYB021 was expressed primarily in xylem tissues. When expressed in Arabidopsis under the control of PtrCesA8, but not the 35S promoter,more » PtrMYB021 increased secondary cell wall thickness, which is likely caused by increased lignification as well as changes in cell wall carbohydrate composition. Consistent with this, elevated expression of lignin and cellulose biosynthetic genes were observed in the transgenic plants. Finally, when expressed in Arabidopsis protoplasts as fusion proteins to the Gal4 DNA binding domain, PtrMYB021 activated the reporter gene Gal4-GUS. In summary, our results suggest that PtrMYB021 is a transcriptional activator, and spatially and temporally restricted expression of PtrMYB021 in Arabidopsis regulates secondary cell wall formation by activating a subset of secondary cell wall biosynthesis genes.« less
Integrated receiver for heterodyne detection dedicated to space applications
NASA Astrophysics Data System (ADS)
Fleury, Joel; Girard, Olivier; Royer, Michel; Bidaud, Michel
1998-10-01
This paper is devoted to the presentation of an Integrator Dewar Cooling Assembly dedicated to high frequency space applications. SAGEM SA has been a manufacturer of IR InSb and HgCdTe detectors for a long time. These detectors cover a large spectral range. The capability to use HgCdTe photovoltaic detectors for heterodyne applications at 10.6 micrometers has been demonstrated in the frame of ESA and CNES contracts. SAGEM SA has recently developed a new concept of heterodyne receiver, totally integrated, operating at variable temperatures down to 77K, using HgCdTe or InSb photovoltaic detectors. This receiver is an innovative product due to its small volume, its low weight and its low electrical consumption. The miniaturization of this product the latter to be used in space applications, specially for the earth observation missions. The performance of such a receiver with respect of the electrical bandwidth is presented in order to compare it with a receiver for terrestrial or airborne applications based on the use of a laboratory HF dewar.
Polishing, coating and integration of SiC mirrors for space telescopes
NASA Astrophysics Data System (ADS)
Rodolfo, Jacques
2017-11-01
In the last years, the technology of SiC mirrors took an increasingly significant part in the field of space telescopes. Sagem is involved in the JWST program to manufacture and test the optical components of the NIRSpec instrument. The instrument is made of 3 TMAs and 4 plane mirrors made of SiC. Sagem is in charge of the CVD cladding, the polishing, the coating of the mirrors and the integration and testing of the TMAs. The qualification of the process has been performed through the manufacturing and testing of the qualification model of the FOR TMA. This TMA has shown very good performances both at ambient and during the cryo test. The polishing process has been improved for the manufacturing of the flight model. This improvement has been driven by the BRDF performance of the mirror. This parameter has been deeply analysed and a model has been built to predict the performance of the mirrors. The existing Dittman model have been analysed and found to be optimistic.
SOFIA secondary mirror Hindle test analysis
NASA Astrophysics Data System (ADS)
Davis, Paul K.
2003-02-01
The Stratospheric Observatory for Infrared Astronomy (SOFIA) is a NASA facility, nearing completion, consisting of an infrared telescope of 2.5 meter system aperture flying in a modified Boeing 747. Its Cassegrain secondary mirror has recently completed polishing. The SOFIA Project Office at Ames Research Center considered it important to perform an independent analysis of secondary mirror figure. The polishing was controlled by the standard test for a convex hyperboloid, the Hindle test, in a modified form with a meniscus lens partially reflecting on the concave face, rather than a fully reflecting mirror with a central hole. The spacing between this meniscus lens and the secondary mirror was controlled by three peripherally located spacing spheres. This necessitated special analysis to determine what the resulting curvature and conic constant of the mirror would be, if manufacturing imprecisions of the test set-up components were to be taken into account. This set-up was specially programmed, and the resulting hyperboloid calculated for the nominal case, and all extreme cases from the reported error limits on the manufacturing of the components. The results were then verified using the standard program CODE-V of Optical Research Associates. The conclusion is that the secondary mirror has a vertex radius of curvature of 954.05 mm +/- .1 mm (design value: 954.13), and a conic constant of -1.2965 +/- .001 (dimensionless, design value: -1.298). Such small divergences from design are to be expected, and these are within the refocusing ability of SOFIA, and would result in an acceptably small amount of spherical aberration in the image.
22 CFR 196.3 - Grants to post-secondary education institutions.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Grants to post-secondary education institutions. 196.3 Section 196.3 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.3 Grants to post...
22 CFR 196.3 - Grants to post-secondary education institutions.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Grants to post-secondary education institutions. 196.3 Section 196.3 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.3 Grants to post...
22 CFR 196.3 - Grants to post-secondary education institutions.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Grants to post-secondary education institutions. 196.3 Section 196.3 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.3 Grants to post...
22 CFR 196.3 - Grants to post-secondary education institutions.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Grants to post-secondary education institutions. 196.3 Section 196.3 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.3 Grants to post...
Electric Field-Induced Large Strain in Ni/Sb-co Doped (Bi0.5Na0.5) TiO3-Based Lead-Free Ceramics
NASA Astrophysics Data System (ADS)
Li, Liangliang; Hao, Jigong; Xu, Zhijun; Li, Wei; Chu, Ruiqing
2018-02-01
Lead-free piezoelectric ceramics (Bi0.5Na0.5)0.935Ba0.065Ti1- x (Ni0.5Sb0.5) x O3 (BNBT6.5- xNS) have been fabricated using conventional solid sintering technique. The effect of (Ni, Sb) doping on the phase structure and electrical properties of BNBT6.5 ceramics were systematically investigated. Results show that the addition of (Ni, Sb) destroyed the ferroelectric long-range order of BNBT6.5 and shifted the ferroelectric-relaxor transition temperature ( T F-R) down to room temperature. Thus, this process induced an ergodic relaxor phase at zero field in samples with x = 0.005. Under the electric field, the ergodic relaxor phase could reversibly transform to ferroelectric phase, which promotes the strain response with peak value of 0.38% (at 80 kV/cm, corresponding to d 33 * = 479 pm/V) at x = 0.005. Temperature-dependent measurements of both polarization and strain confirmed that the large strain originated from a reversible field-induced ergodic relaxor to ferroelectric phase transformation. The proposed material exhibits potential for nonlinear actuators.
FIRE Spectroscopy Of The Ultracool Brown Dwarf, UGPS 0722-05
NASA Astrophysics Data System (ADS)
Bochanski, John J.; Burgasser, A. J.; Simcoe, R. A.
2011-05-01
We present FIRE spectroscopic observations of the ultracool (T ˜ 520 K) brown dwarf, UGPS 0722-05, obtained during instrument commissioning on the 6.5m Baade Magellan Telescope at Las Campanas Observatory. At a distance of 4.1 pc, this cool brown dwarf is well-suited for detailed followup, and represents a keystone at the transition between the lowest-mass brown dwarfs and exoplanets. Our spectrum of UGPS 0722-05 covers the 0.8-2.5 micron bandpasses at a resolution of R ˜ 6,000, and is measured to high signal-to-noise, peaking at 80 near 1.27 microns. We derive radial and rotational velocities for the isolated brown dwarf, and examine its space motion and Galactic orbit. The spectrum of UGPS 0722-05 is also compared to theoretical spectral models to constrain its atmospheric parameters. Finally, we comment on the presence of unidentified absorption features reported in the discovery spectrum of Lucas et al. (2010). We thank Mauricio Martinez and the entire Magellan staff for assistance during FIRE commissioning and observations. JJB acknowledges the support of Kevin Luhman.
Ngugi, Benjamin M.; Hemmerling, Anke; Bukusi, Elizabeth A.; Kikuvi, Gideon; Gikunju, Joseph; Shiboski, Stephen; Fredricks, David N.; Cohen, Craig R.
2011-01-01
Objective Several fastidious bacteria have been associated with bacterial vaginosis (BV), but their role in lactobacilli recolonization failure is unknown. We studied the effect of seven BV-associated bacterial species and two Lactobacillus species on vaginal colonization with L. crispatus CTV-05 (LACTIN-V). Methods Twenty four women with BV were given a 5-day course of metronidazole vaginal gel and then randomized 3:1 to receive either LACTIN-V or placebo applied vaginally once daily for 5 initial consecutive days, followed by a weekly application over 2 weeks. Vaginal swabs for L. crispatus CTV-05 culture and 9-bacterium specific 16S rRNA gene quantitative PCR assays were analyzed on several study visits for the 18 women receiving LACTIN-V. Results Vaginal colonization with CTV-05 was achieved in 61% of the participants receiving LACTIN-V at either the day 10 or the 28 visit and 44% at day 28. Participants not colonized with CTV-05 had generally higher median concentrations of BV-associated bacteria compared to those who colonized. Between enrollment and day 28, the median concentration of Gardnerella vaginalis minimally reduced from 104.5 to 104.3 16S rRNA gene copies per swab in women who colonized with CTV-05 but increased from 105.7 to 107.3 in those who failed to colonize (p=0.19). Similarly, the median concentration of Atopobium spp. reduced from 102.7 16S rRNA gene copies per swab to below limit of detection in women who colonized with CTV-05 but increased from 102.7 to 106.6 in those who failed to colonize (p=0.04). The presence of endogenous L. crispatus at enrollment was found to be significantly associated with a reduced odds of colonization with CTV-05 on day 28 (p=0.003) and vaginal intercourse during the study significantly impaired successful CTV-05 colonization (p=0.018). Conclusion Vaginal concentration of certain BV-associated bacteria, vaginal intercourse during treatment and presence of endogenous L. crispatus at enrollment predict
Secondary hypertension Overview Secondary hypertension (secondary high blood pressure) is high blood pressure that's caused by another medical condition. Secondary hypertension can be caused by conditions that affect your kidneys, ...
Onyeaso, C O; Aderinokun, G A
2003-09-01
The purpose of the study was to investigate the relationship between a professionally derived index, the Dental Aesthetic Index, and some indications for orthodontic treatment as perceived by potential patients. An epidemiological survey of 614 secondary school students, 327 males (53.3%) and 287 females (46.7%) was carried out in Ibadan, Nigeria. Children aged 12-18 years (mean age, 14.9+/-2.9 SD) were randomly selected, none of them had received previous orthodontic treatment. One examiner assessed the students using the Dental Aesthetic Index (DAI). Subjects were also asked to complete a questionnaire consisting of three questions concerning appearance, function, and speech, using a 5-point Likert scale. Weak but statistically significant correlations were found for subjective assessments of appearance of teeth and the DAI (r=0.174; P<0.01) and between biting/chewing and appearance of teeth (r=0.095; P<0.05). Statistically significant correlations were found between appearance of teeth and speech (r=0.148; P<0.01) and biting/chewing and speech. The last showed the strongest correlation (r=0.268; P<0.01). The study has shown weak but significant correlation between DAI and children's perceptions of the appearance of their teeth. We recommend further study involving both DAI and Index of Orthodontic Treatment Need (IOTN) for comparison in the Nigerian population.
Beigi, Farideh; Bertucci, Carlo; Zhu, Weizhong; Chakir, Khalid; Wainer, Irving W; Xiao, Rui-Ping; Abernethy, Darrell R
2006-11-01
rac-Fenoterol is a beta2-adrenoceptor agonist (beta2-AR) used in the treatment of asthma. It has two chiral centers and is marketed as a racemic mixture of R,R'- and S,S'-fenoterol (R-F and S-F). Here we report the separation of the R-F and S-F enantiomers and the evaluation of their binding to and activation of the beta2-AR. R-F and S-F were separated from the enantiomeric mixture by chiral chromatography and absolute configuration determined by circular dichroism. Beta2-AR binding was evaluated using frontal affinity chromatography with a stationary phase containing immobilized membranes from HEK-293 cells that express human beta2-AR and standard membrane binding studies using the same membranes. The effect of R-F and S-F on cardiomyocyte contractility was also investigated using freshly isolated adult rat cardiomyocytes. Chiral chromatography of rac-fenoterol yielded separated peaks with an enantioselectivity factor of 1.21. The less retained peak was assigned the absolute configuration of S-F and the more retained peak R-F. Frontal chromatography using membrane-bound beta2-AR as the stationary phase and rac-3H-fenoterol as a marker ligand showed that addition of increasing concentrations of R-F to the mobile phase produced concentration-dependent decreases in rac-3H-fenoterol retention, while similar addition of S-F produced no change in rac-3H-fenoterol retention. The calculated dissociation constant of R-F was 472 nM and the number of available binding sites 176 pmol/column, which was consistent with the results from the membrane binding study 460 +/- 55 nM (R-F) and 109,000 +/- 10,400 nM (S-F). In the cardiomyocytes, R-F increased maximum contractile response from (265 +/- 11.6)% to (306 +/- 11.8)% of resting cell length (P < 0.05) and reduced EC50 from -7.0 +/- 0.270 to -7.1 +/- 0.2 log[M] (P < 0.05), while S-F had no significant effect. Previous studies have shown that rac-fenoterol acts as an apparent beta2-AR/G(s) selective agonist and fully restores
OZONE-ISOPRENE REACTION: RE-EXAMINATION OF THE FORMATION OF SECONDARY ORGANIC AEROSOL
The reaction of ozone and isoprene has been studied to examine physical and chemical characteristics of the secondary organic aerosol formed. Using a scanning mobility particle sizer, the volume distribution of the aerosol was found in the range 0.05 - 0.2 µm. The aerosol yield w...
NASA Astrophysics Data System (ADS)
Vineetha, P.; Shanmuga Priya, B.; Venkata Saravanan, K.
2018-04-01
Ferroelectric ceramics are the key components in piezoelectric devices used today, thus long term reliability is a major industrial concern. The two important things that have to be considered in the ferroelectric material based device are aging and fatigue. The first one describes degradation with time whereas the later one is characterized by the change of material property during electrical loading. In the present work ferroelectric polarization and bipolar fatigue properties of undoped and ZnO doped lead free (K0.5Na0.5)(Nb0.7Ta0.3)O3 (KNNT) ceramics prepared by solid state reaction method were investigated. X-ray diffraction analysis of the samples reveal perovskite monoclinic phase along with the secondary phase of K2Nb4O11. The ferroelectric studies indicate that ZnO addition reduce fatigue as well as a well saturated hysteresis loop is obtained. The results reveal that addition of ZnO enhances the ferroelectric properties of KNNT ceramics.
NASA Astrophysics Data System (ADS)
Goutham, Cilaveni; Kandula, Kumara Raja; Raavi, Sai Santhosh Kumar; Asthana, Saket
2018-04-01
Nanocrystalline Pr3+ substituted NBT was synthesized using hydrothermal technique. Pr3+ modifies the ferroelectric NBT optically active and enhances the electrical properties with small structural changes. Aiming to the development of the bottom up optoelectronic devices this optimized nanoscale Na0.5Bi0.5-xPrxTiO3(x = 0.005) compound is synthesized hydrothermally. X-ray diffraction pattern shows that the system is stabilized in the Rhombohedral (space groupR3c) phase indicating the local strain inhomogeneity. PE loop shows that there is a decrement in the Ec value compared with compounds synthesized using conventional methods. The strong red emission assigned to prominent transition of the Pr3+ ions at 610nm was observed along with weak blue-green emission, indicating the potential use of the system. Energy transfer from host system to Pr3+ ions is responsible for red emission while blue green emission is due to quenching of 3P0 induced by intervalence charge transfer state.
Li, Qinghai; Zhou, Shuangliu; Wang, Shaowu; Zhu, Xiancui; Zhang, Lijun; Feng, Zhijun; Guo, Liping; Wang, Fenhua; Wei, Yun
2013-02-28
The dehydrogenation of pyrrolyl-functionalized secondary amines initiated by rare-earth metal amides was systematically studied. Reactions of the rare-earth metal amides [(Me(3)Si)(2)N](3)RE(μ-Cl)Li(THF)(3) with pyrrolyl-functionalized secondary amines 2-(t)BuNHCH(2)-5-R-C(4)H(2)NH (R = H (1), R = (t)Bu (2)) led to dehydrogenation of the secondary amines with isolation of imino-functionalized pyrrolyl rare-earth metal complexes [2-(t)BuN=CH-5-R-C(4)H(2)N](2)REN(SiMe(3))(2) (R = H, RE = Y (3a), Dy (3b), Yb (3c), Eu (3d); R = (t)Bu, RE = Y (4a), Dy (4b), Er (4c)). The mixed ligands erbium complex [2-(t)BuNCH(2)-5-(t)Bu-C(4)H(2)N]Er[2-(t)BuN=CH-5-(t)BuC(4)H(2)N](2)ClLi(2)(THF) (4c') was isolated in a short reaction time for the synthesis of complex 4c. Reaction of the deuterated pyrrolyl-functionalized secondary amine 2-((t)BuNHCHD)C(4)H(3)NH with yttrium amide [(Me(3)Si)(2)N](3)Y(μ-Cl)Li(THF)(3) further proved that pyrrolyl-amino ligands were transferred to pyrrolyl-imino ligands. Treatment of 2-((t)BuNHCH(2))C(4)H(3)NH (1) with excess (Me(3)Si)(2)NLi gave the only pyrrole deprotonated product {[η(5):η(2):η(1)-2-((t)BuNHCH(2))C(4)H(3)N]Li(2)N(SiMe(3))(2)}(2) (5), indicating that LiN(SiMe(3))(2) could not dehydrogenate the secondary amines to imines and rare-earth metal ions had a decisive effect on the dehydrogenation. The reaction of the rare-earth metal amides [(Me(3)Si)(2)N](3)RE(μ-Cl)Li(THF)(3) with 1 equiv. of more bulky pyrrolyl-functionalized secondary amine 2-[(2,6-(i)Pr(2)C(6)H(3))NHCH(2)](C(4)H(3)NH) (6) in toluene afforded the only amine and pyrrole deprotonated dinuclear rare-earth metal amido complexes {(μ-η(5):η(1)):η(1)-2-[(2,6-(i)Pr(2)C(6)H(3))NCH(2)]C(4)H(3)N]LnN(SiMe(3))(2)}(2) (RE = Nd (7a), Sm (7b), Er (7c)), no dehydrogenation of secondary amine to imine products were observed. On the basis of experimental results, a plausible mechanism for the dehydrogenation of secondary amines to imines was proposed.
TOWER STAIRHALL; SOUTH SOFFIT, SOUTH WEST (R). Glass plate stereopair ...
TOWER STAIRHALL; SOUTH SOFFIT, SOUTH WEST (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-TS-D-26 (R) 157.4815. Left (printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
Lu, Yi; Zhang, Xiao-Ling; Guo, Zhi-Shun; Jian, Chuan; Zhu, Ming-Ji; Deng, Li; Sun, Jing; Zhang, Qin
2014-01-01
Five secondary aluminum metallurgy enterprises in the southwest area of China were measured for emissions of PCDD/Fs. The results indicated that the emission levels of PCDD/Fs (as TEQ) were 0.015-0.16 ng x m(-3), and the average was 0.093 ng x m(-3) from secondary aluminum metallurgy enterprises. Emission factors of PCDD/Fs (as TEQ) from the five secondary aluminum metallurgy enterprises varied between 0.041 and 4.68 microg x t(-1) aluminum, and the average was 2.01 microg x t(-1) aluminum; among them, PCDD/Fs emission factors from the crucible smelting furnace was the highest. Congener distribution of PCDD/F in stack gas from the five secondary aluminum metallurgies was very different from each other. Moreover, the R(PCDF/PCDD) was the lowest in the enterprise which was installed only with bag filters; the R(PCDF/PCDD) were 3.8-12.6 (the average, 7.7) in the others which were installed with water scrubbers. The results above indicated that the mechanism of PCDD/Fs formation was related to the types of exhaust gas treatment device. The results of this study can provide technical support for the formulation of PCDD/Fs emission standards and the best available techniques in the secondary aluminum metallurgy industry.
Albertsen, Andi Eie; Nielsen, Jens Cosedis; Poulsen, Steen Hvitfeldt; Mortensen, Peter Thomas; Pedersen, Anders Kirstein; Hansen, Peter Steen; Jensen, Henrik Kjaerulf; Egeblad, Henrik
2008-02-01
Increasing evidence from randomized trials and experimental studies indicates that right ventricular (RV) pacing may induce congestive heart failure. We studied regional left ventricular (LV) dyssynchrony and global LV function in 50 consecutive patients with sick sinus syndrome (SSS) randomized to either atrial pacing [AAI(R)] or dual chamber RV-pacing [DDD(R)]. Fifty consecutive patients were randomized to AAI(R) or DDD(R)-pacing. Tissue-Doppler imaging was used to quantify LV dyssynchrony in terms of number of segments with delayed longitudinal contraction (DLC). Left ventricular ejection fraction (LVEF) was measured using three-dimensional echocardiography. Dyssynchrony was more pronounced in the DDD(R)-group than in the AAI(R)-group at the 12 months follow-up (P < 0.05). This reflected a significant increase of dyssynchrony in the DDD(R)-group from baseline to the 12 months follow-up (1.3 +/- 1 to 2.1 +/- 1 segments displaying DLC per patient), P < 0.05. No change was observed in the AAI(R)-group (1.6 +/- 2 to 1.3 +/- 2 segments displaying DLC per patient, NS). No difference in LVEF, NYHA or NT-proBNP was observed between AAI(R)- and DDD(R)-mode after 12 months of pacing although LVEF decreased significantly in the DDD(R)-group from baseline (63.1 +/- 8%) to the 12 months follow-up (59.3 +/- 8%, P < 0.05), while LVEF remained unchanged in the AAI(R)-group (61.5 +/- 11% at baseline vs. 62.3 +/- 7% after 12 months, NS. In patients with SSS, DDD(R)-pacing but not AAI(R)-pacing induces significant LV desynchronization and reduction of LVEF.
Academy of Reading® (AoR) 2008-09 and 2009-10 Evaluation. E&R Report No. 10.23
ERIC Educational Resources Information Center
Baenen, Nancy; Lougee, Aimee
2011-01-01
Academy of READING (AoR) is designed to improve students' foundational reading skills; it is used in almost all Wake County Public Schools (WCPSS) secondary schools. Central staff recommended students with prior End of Grade/Course (EOG/EOC) scale scores placing them high in Level II or low in Level III have first priority for service; many…
TOWER STAIRHALL; SOUTH SOFFIT, SOUTH WEST (R). Glass plate stereopair ...
TOWER STAIRHALL; SOUTH SOFFIT, SOUTH WEST (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-TS-D-26 (R) 157.4815. Right (not printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
Mental Health and Adjustment of Higher Secondary School Students
ERIC Educational Resources Information Center
Murugan, P. Vel
2017-01-01
The main objective of this study is to find out the relationship between mental health and adjustment of higher secondary school students. Mental Health Scale developed by Sakthimani (2010) and Adjustment Inventory developed by A.K.P. Sinha and R.P. Singh (2007) were used to collect the relevant data. The sample consists of 103 higher secondary…
NASA Astrophysics Data System (ADS)
Hwang, Hyeon Gyu; Lee, Jae Hwa
2017-11-01
Direct numerical simulations of turbulent boundary layers (TBLs) over spanwise heterogeneous surface roughness are performed to investigate the characteristics of secondary flow. The longitudinal surface roughness, which features lateral change in bed elevation, is described by immersed boundary method. The Reynolds number based on the momentum thickness is varied in the range of Reθ = 300-900. As the TBLs over the roughness elements spatially develop in the streamwise direction, a secondary flow emerges in a form of counter-rotating vortex pair. As the spanwise spacing between the roughness elements and roughness width vary, it is shown that the size of the secondary flow is determined by the valley width between the roughness elements. In addition, the strength of the secondary flow is mostly affected by the spanwise distance between the cores of the secondary flow. Analysis of the Reynolds-averaged turbulent kinetic energy transport equation reveals that the energy redistribution terms in the TBLs over-the ridge type roughness play an important role to derive low-momentum pathways with upward motion over the roughness crest, contrary to the previous observation with the strip-type roughness. This research was supported by the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2017R1D1A1A09000537) and the Ministry of Science, ICT & Future Planning (NRF-2017R1A5A1015311).
Song, Ju Yeon; Yoo, Young Ji; Lim, Si-Kyu; Cha, Sun Ho; Kim, Ji-Eun; Roe, Jung-Hye; Kim, Jihyun F; Yoon, Yeo Joon
2016-02-10
Streptomyces venezuelae ATCC 15439, which produces 12- and 14-membered ring macrolide antibiotics, is a platform strain for heterologous expression of secondary metabolites. Its 9.05-Mb genome sequence revealed an abundance of genes involved in the biosynthesis of secondary metabolites and their precursors, which should be useful for the production of bioactive compounds. Copyright © 2015 Elsevier B.V. All rights reserved.
40 CFR 180.352 - Terbufos; tolerances for residues.
Code of Federal Regulations, 2010 CFR
2010-07-01
... million Banana 0.025 Beet, sugar, roots 0.05 Beet, sugar, tops 0.1 Coffee, green bean 1 0.05 Corn, field, forage 0.5 Corn, field, grain 0.5 Corn, field, stover 0.5 Corn, pop, grain 0.5 Corn, pop, stover 0.5 Corn, sweet, kernel plus cob with husks removed 0.05 Corn, sweet, forage 0.5 Corn, sweet, stover 0.5 Sorghum...
40 CFR 180.352 - Terbufos; tolerances for residues.
Code of Federal Regulations, 2012 CFR
2012-07-01
... million Banana 0.025 Beet, sugar, roots 0.05 Beet, sugar, tops 0.1 Coffee, green bean 1 0.05 Corn, field, forage 0.5 Corn, field, grain 0.5 Corn, field, stover 0.5 Corn, pop, grain 0.5 Corn, pop, stover 0.5 Corn, sweet, kernel plus cob with husks removed 0.05 Corn, sweet, forage 0.5 Corn, sweet, stover 0.5 Sorghum...
40 CFR 180.352 - Terbufos; tolerances for residues.
Code of Federal Regulations, 2014 CFR
2014-07-01
... million Banana 0.025 Beet, sugar, roots 0.05 Beet, sugar, tops 0.1 Coffee, green bean 1 0.05 Corn, field, forage 0.5 Corn, field, grain 0.5 Corn, field, stover 0.5 Corn, pop, grain 0.5 Corn, pop, stover 0.5 Corn, sweet, kernel plus cob with husks removed 0.05 Corn, sweet, forage 0.5 Corn, sweet, stover 0.5 Sorghum...
40 CFR 180.352 - Terbufos; tolerances for residues.
Code of Federal Regulations, 2011 CFR
2011-07-01
... million Banana 0.025 Beet, sugar, roots 0.05 Beet, sugar, tops 0.1 Coffee, green bean 1 0.05 Corn, field, forage 0.5 Corn, field, grain 0.5 Corn, field, stover 0.5 Corn, pop, grain 0.5 Corn, pop, stover 0.5 Corn, sweet, kernel plus cob with husks removed 0.05 Corn, sweet, forage 0.5 Corn, sweet, stover 0.5 Sorghum...
40 CFR 180.352 - Terbufos; tolerances for residues.
Code of Federal Regulations, 2013 CFR
2013-07-01
... million Banana 0.025 Beet, sugar, roots 0.05 Beet, sugar, tops 0.1 Coffee, green bean 1 0.05 Corn, field, forage 0.5 Corn, field, grain 0.5 Corn, field, stover 0.5 Corn, pop, grain 0.5 Corn, pop, stover 0.5 Corn, sweet, kernel plus cob with husks removed 0.05 Corn, sweet, forage 0.5 Corn, sweet, stover 0.5 Sorghum...
He, Quan; Wang, Fangfei; Honda, Takashi; Lindquist, Diana M; Dillman, Jonathan R; Timchenko, Nikolai A; Redington, Andrew N
2017-10-01
Previous in vitro studies have demonstrated that miR-144 inhibits hepatocellular carcinoma cell proliferation, invasion, and migration. We have shown that miR-144, injected intravenously, is taken up by the liver and induces endogenous hepatic synthesis of miR-144. We hypothesized that administered miR-144 has tumor-suppressive effects on liver tumor development in vivo. The effects of miR-144 on tumorigenesis and tumor growth were tested in a diethylnitrosamine-induced hepatocellular carcinoma mouse model. MiR-144 injection had no effect on body weight but significantly reduced diethylnitrosamine-induced liver enlargement compared with scrambled microRNA. MiR-144 had no effect on diethylnitrosamine-induced liver tumor number but reduced the tumor size above 50%, as evaluated by magnetic resonance imaging (scrambled microRNA 23.07 ± 5.67 vs miR-144 10.38 ± 2.62, p < 0.05) and histological analysis (scrambled microRNA 30.75 ± 5.41 vs miR-144 15.20 ± 3.41, p < 0.05). The levels of miR-144 was suppressed in tumor tissue compared with non-tumor tissue in all treatment groups (diethylnitrosamine-phosphate-buffered saline non-tumor 1.05 ± 0.09 vs tumor 0.54 ± 0.08, p < 0.01; diethylnitrosamine-scrambled microRNA non-tumor 1.23 ± 0.33 vs tumor 0.44 ± 0.10, p < 0.05; diethylnitrosamine-miR-144 non-tumor 54.72 ± 11.80 vs tumor 11.66 ± 2.75, p < 0.01), but injection of miR-144 greatly increased miR-144 levels both in tumor and non-tumor tissues. Mechanistic studies showed that miR-144 targets epidermal growth factor receptor and inhibits the downstream Src/AKT signaling pathway which has previously been implicated in hepatocellular carcinoma tumorigenesis. Exogenously delivered miR-144 may be a therapeutic strategy to suppress tumor growth in hepatocellular carcinoma.
SECOND FLOOR LOBBY; EAST WALL, UPPER LEFT (R). Glass plate ...
SECOND FLOOR LOBBY; EAST WALL, UPPER LEFT (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-2L-E-2 (R) 157.4825. Right (not printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
SECOND FLOOR LOBBY; EAST WALL, UPPER LEFT (R). Glass plate ...
SECOND FLOOR LOBBY; EAST WALL, UPPER LEFT (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-2L-E-2 (R) 157.4825. Left (printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
SECOND FLOOR LOBBY; EAST WALL, LOWER LEFT (R). Glass plate ...
SECOND FLOOR LOBBY; EAST WALL, LOWER LEFT (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-2L-E-1 (R) 157.4824. Left (printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
SECOND FLOOR LOBBY; EAST WALL, LOWER LEFT (R). Glass plate ...
SECOND FLOOR LOBBY; EAST WALL, LOWER LEFT (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-2L-E-1 (R) 157.4824. Right (not printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
SECOND FLOOR LOBBY; EAST WALL, LOWER RIGHT (R). Glass plate ...
SECOND FLOOR LOBBY; EAST WALL, LOWER RIGHT (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-2L-E-3 (R) 157.4826. Left (printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
SECOND FLOOR LOBBY; EAST WALL, LOWER RIGHT (R). Glass plate ...
SECOND FLOOR LOBBY; EAST WALL, LOWER RIGHT (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-2L-E-3 (R) 157.4826. Right (not printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
SECOND FLOOR LOBBY; EAST WALL, UPPER RIGHT (R). Glass plate ...
SECOND FLOOR LOBBY; EAST WALL, UPPER RIGHT (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-2L-E-4 (R) 157.4827. Right (not printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
SECOND FLOOR LOBBY; EAST WALL, UPPER RIGHT (R). Glass plate ...
SECOND FLOOR LOBBY; EAST WALL, UPPER RIGHT (R). Glass plate stereopair number PA-1430-139 LC-HABS-GS05-2L-E-4 (R) 157.4827. Left (printed) - Independence Hall Complex, Independence Hall, 500 Chestnut Street, Philadelphia, Philadelphia County, PA
Decoy receptor 3 (DcR3) overexpression predicts the prognosis and pN2 in pancreatic head carcinoma.
Zhou, Jian; Song, Shiduo; Li, Dechun; He, Songbing; Zhang, Bing; Wang, Zhenxin; Zhu, Xinguo
2014-03-05
This study was carried out to examine decoy receptor 3 (DcR3) expression and investigate its clinical and prognostic significance in patients with pancreatic head carcinoma. Tissue samples were obtained from 50 patients with pancreatic head carcinoma. DcR3 protein expression in tissues and sera was assessed by immunohistochemistry and ELISA. Correlations between DcR3 and clinicopathologic features and prognoses were analyzed statistically. Serum DcR3 levels were significantly elevated in patients with pancreatic head carcinoma compared with patients with cystadenoma and healthy individuals (P < 0.01 and P < 0.01, respectively). DcR3 overexpression correlated with lymph node metastases and TNM stages (P < 0.05 and P < 0.05, respectively). Median overall survival for the high DcR3 group was 16.3 months, compared to 21.6 months for the low DcR3 group (P < 0.05). In the low DcR3 group, no significant difference was found in the overall survival between patients who underwent standard pancreatoduodenectomy (SPD) and those who had radical pancreatoduodenectomy (RPD) (P > 0.05). In the high DcR3 group, the median overall survival rates were 16.8 months in the RPD group and 13.5 months in the SPD group (P < 0.05). We found that DcR3 was overexpressed in pancreatic head carcinoma. The patients with high DcR3 levels had higher pN2 stages than those with low DcR3 levels. Detecting serum DcR3 level preoperatively might be an additional approach for evaluating pN2 stage and guiding the range of lymphadenectomy.
Early diagnostic role of PSA combined miR-155 detection in prostate cancer.
Guo, T; Wang, X-X; Fu, H; Tang, Y-C; Meng, B-Q; Chen, C-H
2018-03-01
As a kind of malignant tumor in the male genitourinary system, prostate cancer exhibits significantly increased occurrence. Prostate-specific antigen (PSA) expression can be seen in the prostate cancer, prostatitis, and other diseases, therefore, lack of diagnostic specificity. The miR-155 expression is abnormally increased in the tumors. Therefore, this study aims to explore the clinical significance of PSA combined miR-155 detection in the early diagnosis of prostate cancer. A total of 86 patients diagnosed with prostate cancer were enrolled in this study. PSA and miR-155 gene expression in tumor tissue were detected by using Real-time PCR. The serum levels of PSA were measured by using enzyme-linked immunosorbent assay (ELISA). The correlation of PSA and miR-155 expression with age, body mass index (BMI), tumor volume, tumor-node-metastasis (TNM) stage, lymph node metastasis (LNM), and other clinicopathological features were analyzed, respectively. Serum PSA expression and PSA gene in tumor tissue were significantly higher compared to that in adjacent tissues (p<0.05). PSA gene and protein increased significantly with the clinical stage of TNM and decreased following the increase of grade (p<0.05). The miR-155 level was significantly elevated in the tumor tissue compared with para-carcinoma tissue (p<0.05). PSA and miR-155 expressions were positively correlated with TNM stage, tumor volume, and LNM, and negatively correlated with grade (p<0.05). PSA and miR-155 were closely related to the clinicopathological features of prostate cancer. Combined detection is helpful for the early diagnosis of prostate cancer.
Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M
2009-10-19
Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.
NASA Astrophysics Data System (ADS)
Chen, Xiuli; Li, Xiaoxia; Yan, Xiao; Liu, Gaofeng; Zhou, Huanfu
2018-06-01
Perovskite solid solution ceramics of (Ba1- x Bi0.33 x Sr0.67 x )(Ti1- x Bi0.67 x V0.33 x )O3 and (Ba1- x Bi0.5 x Sr0.5 x )(Ti1- x Bi0.5 x Ti0.5 x )O3 (BBSTBV, BBSTBT, 0.02 ≤ x ≤ 0.2) were prepared by the traditional solid state reaction technique. The phase evolution, microstructure and dielectric properties of BBSTBV and BBSTBT ceramics were researched. X-Ray diffraction results illustrated that both BBSTBV and BBSTBT could form a homogenous solid solution which has a similar structure with BaTiO3. The optimized properties of (Ba0.8Bi0.1Sr0.1)(Ti0.8Bi0.1Ti0.1)O3 ceramics with stable ɛ r ( 1769-2293), small Δ ɛ/ ɛ 25 °C values (± 15%) over a broad temperature range from - 58 to 151 °C and low tan δ ≤ 0.03 from - 11 to 131 °C were obtained. In the high-temperature region, the relaxation and conduction process are attributed to the thermal activation and the oxygen vacancies may be the ionic charge carriers in perovskite ferroelectrics.
Hwang, Ui Wook
2007-04-01
Phylogenetic position of a diplomonad protist Giardia, a principle cause of diarrhea, among eukaryotes has been vigorously debated so far. Through the comparisons of primary and secondary structures of SSU rRNAs of G. intestinalis, G. microti, G. ardeae, and G. muris, I found two major indel regions (a 6-nt indel and a 22-26-nt indel), which correspond to the helix 10 of the V2 region and helices E23-8 to E23-9 of the V4 region, respectively. As generally shown in eukaryotes, G. intestinalis and G. microti have commonly a relatively longer helix 10 (a 7-bp stem and a 4-nt loop), and also the eukaryote-specific helices E23-6 to E23-9. On the other hand, G. muris and G. ardeae have a shorter helix 10: a 2-bp stem and a 6-nt loop in G. ardeae and a 3-bp stem and a 6-nt loop in G. muris. In the V4, they have a single long helix (like the P23-1 helix in prokaryotes) instead of the helices E23-6 to E23-9. Among the four Giardia species, co-appearance of prokaryote- and eukaryote-typical features might be significant evidence to suggest that Giardia (Archezoa) is a living fossil showing an "intermediate stage" during the evolution from prokaryotes to eukaryotes.
Rao, J. C.; Diao, H. Y.; Ocelík, V.; ...
2017-03-27
Secondary phases, either introduced by alloying or heat treatment, are commonly present in most high-entropy alloys (HEAs). Understanding the formation of secondary phases at high temperatures, and their effect on mechanical properties, is a critical issue that is undertaken in the present paper, using the Al xCoCrFeNi (x = 0.3, 0.5, and 0.7) as a model alloy. The in-situ transmission-electron-microscopy (TEM) heating observation, an atom-probe-tomography (APT) study for the reference starting materials (Al 0.3 and Al 0.5 alloys), and thermodynamic calculations for all three alloys, are performed to investigate (1) the aluminum effect on the secondary-phase fractions, (2) the annealing-twinningmore » formation in the face-centered-cubic (FCC) matrix, (3) the strengthening effect of the secondary ordered body-centered-cubic (B2) phase, and (4) the nucleation path of the σ secondary phase thoroughly. Finally, the present work will substantially optimize the alloy design of HEAs and facilitate applications of HEAs to a wide temperature range.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rao, J. C.; Diao, H. Y.; Ocelík, V.
Secondary phases, either introduced by alloying or heat treatment, are commonly present in most high-entropy alloys (HEAs). Understanding the formation of secondary phases at high temperatures, and their effect on mechanical properties, is a critical issue that is undertaken in the present paper, using the Al xCoCrFeNi (x = 0.3, 0.5, and 0.7) as a model alloy. The in-situ transmission-electron-microscopy (TEM) heating observation, an atom-probe-tomography (APT) study for the reference starting materials (Al 0.3 and Al 0.5 alloys), and thermodynamic calculations for all three alloys, are performed to investigate (1) the aluminum effect on the secondary-phase fractions, (2) the annealing-twinningmore » formation in the face-centered-cubic (FCC) matrix, (3) the strengthening effect of the secondary ordered body-centered-cubic (B2) phase, and (4) the nucleation path of the σ secondary phase thoroughly. Finally, the present work will substantially optimize the alloy design of HEAs and facilitate applications of HEAs to a wide temperature range.« less
Zhou, Yalin; Wang, Yi; Liu, Peipei; Wang, Zhiying; Zhu, Weiming
2010-08-01
To explore the secondary metabolites of fungus Aspergillus ochraceus LCJ11-102 associated with the coral Dichotella gemmacea under environmental stress and to obtain characteristic compounds with biological activities. A nutrient-deprived culture medium (biomimetic culture) and a high salt culture medium were used for fermentation. Fingerprints of HPLC of the fermentation broth were used to investigate the diversity of secondary metabolites. Compounds were isolated by column chromatography on silica gel, Sephadex LH-20, and preparative HPLC. Their structures were identified by spectroscopic analyses and the modified Mosher's method. Different secondary metabolites were produced by A. ochraceus LCJ11-102 under two different culture conditions. (R)-mellein (1), (5,6-trans, 8,9-threo-) -9-chloro-8-hydroxy-8, 9-deoxyaspyrone (2), (5,6-erythro-, 8,9-threo-) -9-chloro-8-hydroxy-8, 9-deoxyasperlactone (3), and (5S, 6R, 9S)-dihydroaspyrone (4) were identified from the biomimetic cultures, and R (+) -semi-vioxanthin (5) was identified from the high salt cultures, respectively. Environmental stress obviously induces microbes to produce different secondary metabolites. And biomimetic culture is an effective approach to obtain active chloro compounds from marine microorganisms.
A staining protocol for identifying secondary compounds in Myrtaceae1
Retamales, Hernan A.; Scharaschkin, Tanya
2014-01-01
• Premise of the study: Here we propose a staining protocol using toluidine blue (TBO) and ruthenium red to reliably identify secondary compounds in the leaves of some species of Myrtaceae. • Methods and Results: Leaves of 10 species representing 10 different genera of Myrtaceae were processed and stained using five different combinations of ruthenium red and TBO. Optimal staining conditions were determined as 1 min of ruthenium red (0.05% aqueous) and 45 s of TBO (0.1% aqueous). Secondary compounds clearly identified under this treatment include mucilage in the mesophyll, polyphenols in the cuticle, lignin in fibers and xylem, tannins and carboxylated polysaccharides in the epidermis, and pectic substances in the primary cell walls. • Conclusions: Potential applications of this protocol include systematic, phytochemical, and ecological investigations in Myrtaceae. It might be applicable to other plant families rich in secondary compounds and could be used as a preliminary screening method for extraction of these elements. PMID:25309840
School Dropout Pattern among Senior Secondary Schools in Delta State, Nigeria
ERIC Educational Resources Information Center
Ajaja, O. Patrick
2012-01-01
The major purpose of this study was to determine the pattern of dropout among secondary school students in Delta State. To guide this study, 7 research questions were asked and answered, 3 hypotheses stated and tested at 0.05 level of significance. The design of study was ex post facto using the past school attendance registers as the major…
Singh, Noopur; Sharma, Ashok
Turmeric has been used as a therapeutic herb over centuries in traditional medicinal systems due to the presence of several secondary metabolite compounds. microRNAs are known to regulate gene expression at the post-transcriptional level by transcriptional cleavage or translation repression. miRNAs have been demonstrated to play an active role in secondary metabolism regulation. The present work was focused on the identification of the miRNAs involved in the regulation of secondary metabolite and development process of turmeric. Eighteen miRNA families were identified for turmeric. Sixteen miRNA families were observed to regulate 238 target transcripts. LncRNAs targets of the putative miRNA candidates were also predicted. Our results indicated their role in binding, reproduction, stress, and other developmental processes. Gene annotation and pathway analysis illustrated the biological function of the targets regulated by the putative miRNAs. The miRNA-mediated gene regulatory network also revealed co-regulated targets that were regulated by two or more miRNA families. miR156 and miR5015 were observed to be involved in rhizome development. miR5021 showed regulation for terpenoid backbone biosynthesis and isoquinoline alkaloid biosynthesis pathways. The flavonoid biosynthesis pathway was observed to be regulated by miR2919. The analysis revealed the probable involvement of three miRNAs (miR1168.2, miR156b and miR1858) in curcumin biosynthesis. Other miRNAs were found to be involved in the growth and developmental process of turmeric. Phylogenetic analysis of selective miRNAs was also performed. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.
Extreme [O III] Emitters at z ∼ 0.5
NASA Astrophysics Data System (ADS)
Li, Zhihui; Malkan, Matthew A.
2018-06-01
We have found a sample of extreme emission-line galaxies (EELGs) with strong [O III]λ5007 emission at z ∼ 0.5. Using broadband photometric selection and requiring small uncertainties in photometry, we searched the 14th Data Release of the Sloan Digital Sky Survey (SDSS) and found 2658 candidates with strong i-band excess (i – z ≤ r – i – 0.7). We further obtained 649 SDSS spectra of these objects, and visually identified 22 [O III] emitters lying at 0.40 < z < 0.63. Having constructed their ultraviolet–infrared spectral energy distributions, we found that they have fairly blue r – W2 and red W1 – W4 colors, indicative of strong, warm dust emission. Their rest-frame [O III]λ5007 equivalent widths are mostly 200–600 Å, and their high [O III]λ5007/Hβ ratios put them at the boundary of star-forming galaxies and active galactic nuclei on line ratio classification diagrams. The typical E(B–V) and electron temperature of [O III] emitters are ∼0.1–0.3 mag and ∼104 K, respectively. The lowest metallicity of our [O III] emitters with S/N[O III]λ4363 > 3 is 12 + log(O/H) = {7.98}-0.02+0.12, with a median value of {8.24}-0.04+0.05. Our [O III] emitters exhibit remarkably high line luminosity—18/22 have L [O III]λ5007 > 5 × 1042 erg s‑1 and 5/22 have L [O III]λ5007 > 1043 erg s‑1. Their estimated volume number density at z ∼ 0.5 is ∼2 × 10‑8 Mpc‑3, with L [O III]λ5007 down to ∼3 × 1042 erg s‑1. The cumulative number distribution of EELGs across different redshifts is indicative of a strong redshift evolution at the bright end of the [O III] luminosity function.
González, N J D; Borg-Karlson, A-K; Artaxo, P; Guenther, A; Krejci, R; Nozière, B; Noone, K
2014-05-01
This work presents the application of a new method to facilitate the distinction between biologically produced (primary) and atmospherically produced (secondary) organic compounds in ambient aerosols based on their chirality. The compounds chosen for this analysis were the stereomers of 2-methyltetraols, (2R,3S)- and (2S,3R)-methylerythritol, (l- and d-form, respectively), and (2S,3S)- and (2R,3R)-methylthreitol (l- and d-form), shown previously to display some enantiomeric excesses in atmospheric aerosols, thus to have at least a partial biological origin. In this work PM10 aerosol fractions were collected in a remote tropical rainforest environment near Manaus, Brazil, between June 2008 and June 2009 and analysed. Both 2-methylerythritol and 2-methylthreitol displayed a net excess of one enantiomer (either the l- or the d-form) in 60 to 72% of these samples. These net enantiomeric excesses corresponded to compounds entirely biological but accounted for only about 5% of the total 2-methyltetrol mass in all the samples. Further analysis showed that, in addition, a large mass of the racemic fractions (equal mixtures of d- and l-forms) was also biological. Estimating the contribution of secondary reactions from the isomeric ratios measured in the samples (=ratios 2-methylthreitol over 2-methylerythritol), the mass fraction of secondary methyltetrols in these samples was estimated to a maximum of 31% and their primary fraction to a minimum of 69%. Such large primary fractions could have been expected in PM10 aerosols, largely influenced by biological emissions, and would now need to be investigated in finer aerosols. This work demonstrates the effectiveness of chiral and isomeric analyses as the first direct tool to assess the primary and secondary fractions of organic aerosols.
García-Díaz, Diego F; Pizarro, Carolina; Camacho-Guillén, Patricia; Codner, Ethel; Soto, Néstor; Pérez-Bravo, Francisco
2018-02-01
Objective The aim of this research was to analyze the expression profile of miR-155, miR-146a, and miR-326 in peripheral blood mononuclear cells (PBMC) of 47 patients with type 1 diabetes mellitus (T1D) and 39 control subjects, as well as the possible association with autoimmune or inflammatory markers. Subjects and methods Expression profile of miRs by means of qPCR using TaqMan probes. Autoantibodies and inflammatory markers by ELISA. Statistical analysis using bivariate correlation. Results The analysis of the results shows an increase in the expression of miR-155 in T1D patients in basal conditions compared to the controls (p < 0.001) and a decreased expression level of miR-326 (p < 0.01) and miR-146a (p < 0.05) compared T1D patients to the controls. miR-155 was the only miRs associated with autoinmmunity (ZnT8) and inflammatory status (vCAM). Conclusion Our data show a possible role of miR-155 related to autoimmunity and inflammation in Chilean patients with T1D.
Study on the Control of Cleanliness for X90 Pipeline in the Secondary Refining Process
NASA Astrophysics Data System (ADS)
Chu, Ren Sheng; Liu, Jin Gang; Li, Zhan Jun
X90 pipeline steel requires ultra low for sulfur content and gas content in the smelting process. The secondary refining process is very important for X90 pipeline in smelting process and the control of cleanliness is the key for the secondary refining process in the steelmaking process for Pretreatment of hot metal → LD → LF refining → RH refining → Calcium treatment → CC. In the current paper, the cleanliness control method of secondary refining was analyzed for the evolution of non-metallic inclusions in the secondary refining prcess and related changes for composition in steel. The size, composition and the type of the non-metallic inclusions were analyzed by aspex explorer automated scanning electron microscope in X90 pipeline samples for 20mm * 25mm * 25mm by the line cutting. The results show that the number of non-metallic inclusions in steel decrease from the beginning of the LF refining to the RH refining. In the composition of the Non-metallic inclusions, the initial non-metallic inclusions of alumina is converted to two comple-type non-metallic inclusions. Most of them, the non-metallic inclusions were composed by the calcium aluminate and CaS. The others are that the spinel is the core, peripheral parcels calcium aluminate nonmetallic inclusions for complex-type non-metallic inclusions. For the size of the non-metallic inclusions, the non-metallic inclusions for size larger than 100µm is converted to 5 20µm based small size non-metallic inclusions. While the S content of the steel decreased from 0.012% to 0.0012% or less, Al content is kept at between 0.025% to 0.035% and the quality for the casting slab satisfies the requirement of the steel. The ratings for various types of the non-metallic inclusions are 1.5 or less. The control strategy for the inclusions in 90 pipeline is small size, diffuse distribution and little amount of the deformation after rolling. On the contrary, the specific chemical composition of the inclusions is not
Garcia-Diaz, D F; Camacho-Guillén, P; Codner, E; Pérez-Bravo, F
2018-01-31
Type 1 diabetes mellitus (T1D) is an autoimmune disease characterized by the progressive destruction of β cells, mediated by the interaction between T cells and several cytokines. The pathogenesis of T1D has established its possible relationship with miRNAs. In this study, we analyze the expression profile of miR-15a and miR-16 in peripheral blood mononuclear cells (PBMCs) and their possible association with apoptosis, inflammation, or autoimmunity markers. 38 T1D patients and 41 control subjects were recruited. mRNAs were analyzed by means of qPCR and TaqMan probes. PBMCs were treated with different concentrations of glucose (baseline, 11 and 25 mM) with or without an inflammatory stimulus as TNF-α (10 ng/ml). A decrease in the levels of the miR-15a expression in basal conditions is observed in T1D patients compared to healthy control subjects (relative units 0.5 vs. 1.8, p < 0.05). This change in miR-15a and miR-16 is not affected by the addition of TNF-α. No association is observed with inflammatory markers (IL-6, TNF-α, vCAM) or apoptosis (bcl2 expression). The relationship with immunological markers shows an interaction effect between miR16 and IA-2 (p < 0.03). TNF-α does not affect the expression profile of miR-15a and miR16 in PBMCs. A weak correlation is observed between miR-16 and with the autoimmunity profile (IA-2 autoantibody).
Garcia-Diaz, D F; Camacho-Guillén, P; Codner, E; Pérez-Bravo, F
2018-01-30
Type 1 diabetes mellitus (T1D) is an autoimmune disease characterized by the progressive destruction of β cells, mediated by the interaction between T cells and several cytokines. The pathogenesis of T1D has established its possible relationship with miRNAs. In this study, we analyze the expression profile of miR-15a and miR-16 in peripheral blood mononuclear cells (PBMCs) and their possible association with apoptosis, inflammation, or autoimmunity markers. 38 T1D patients and 41 control subjects were recruited. mRNAs were analyzed by means of qPCR and TaqMan probes. PBMCs were treated with different concentrations of glucose (baseline, 11 and 25 mM) with or without an inflammatory stimulus as TNF-α (10 ng/ml). A decrease in the levels of the miR-15a expression in basal conditions is observed in T1D patients compared to healthy control subjects (relative units 0.5 vs. 1.8, p < 0.05). This change in miR-15a and miR-16 is not affected by the addition of TNF-α. No association is observed with inflammatory markers (IL-6, TNF-α, vCAM) or apoptosis (bcl2 expression). The relationship with immunological markers shows an interaction effect between miR16 and IA-2 (p < 0.03). TNF-α does not affect the expression profile of miR-15a and miR16 in PBMCs. A weak correlation is observed between miR-16 and with the autoimmunity profile (IA-2 autoantibody).
NASA Astrophysics Data System (ADS)
Rousselot, Steeve; Guay, Daniel; Roué, Lionel
MgTi, Mg 0.5Ni 0.5Ti and MgTi 0.5Ni 0.5 alloys doped with 10 wt.% Pd were prepared by high energy ball milling and evaluated as hydrogen storage electrodes for Ni-MH batteries. X-ray diffraction analyses indicated that the Mg 0.5Ni 0.5Ti and MgTi 0.5Ni 0.5 alloys could be monophased or composed of a nanoscale mixture of MgTi + NiTi and MgTi + MgNi phases, respectively. Their hydrogen storage characteristics were investigated electrochemically in KOH electrolyte. No activation step was observed during the cycling of the Mg-Ti-Ni electrodes in contrast to that observed with the MgTi electrode. The highest hydrogen discharge capacity was obtained with the MgTi 0.5Ni 0.5 electrode (536 mAh g -1) compared to 401 and 475 mAh g -1 for the Mg 0.5Ni 0.5Ti and MgTi electrodes, respectively. The ternary Mg-Ti-Ni alloys showed a better cycle life with an average capacity decay rate per cycle lower than 1.5% compared to ∼7% for the binary MgTi electrode. The Mg-Ni-Ti electrodes also displayed a much higher discharge rate capability than the binary MgTi electrode, especially with the Mg 0.5Ni 0.5Ti electrode. The origin of this was established on the basis of the anodic polarization curves, where a substantial decrease of the concentration overpotential (reflecting a higher hydrogen diffusivity) was observed for the Mg 0.5Ni 0.5Ti electrode.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mallesham, B.; Ranjith, R., E-mail: ranjith@iith.ac.in; Manivelraja, M.
2014-07-21
The current study explores non-magnetic Sc{sup 3+} induced structural transformation, evolution of local B-site cation ordering and associated effect on ferroelectric phase transition temperature T{sub max} (temperature corresponding to dielectric maxima) on increasing the atom percent of Sc substitution in [Pb(Fe{sub 0.5}Nb{sub 0.5})O{sub 3} (PFN)] ceramics. In this regard, the phase pure Pb[(Fe{sub 0.5−x}Sc{sub x})Nb{sub 0.5}]O{sub 3} ceramics with x varying from 0 to 0.5 were synthesized through solid state reaction route. The detailed structural analysis through Rietveld refinement confirms the room temperature transformation from a monoclinic Cm to rhombohedral R3m structure at x = 0.3 mol. % of Sc. Absorption spectra studies showmore » that there is a considerable increment in the bandgap at higher scandium content. Most interestingly, the T{sub max} exhibited an increment for lower scandium contents (x = 0.1 to 0.25) followed by a drop in T{sub max} (x = 0.3 to 0.5). Such anomalous behavior in T{sub max} is expected to arise due to the onset of B′, B″ local cation ordering beyond Sc content x = 0.25. The B-site cation ordering at and beyond x = 0.3 was also confirmed by the evolution of cation order induced Pb-O coupled vibrational mode in Raman scattering studies. In addition, the Mössbauer spectra of PFN (x = 0) and Pb(Fe{sub 0.4}Sc{sub 0.1}Nb{sub 0.5})O{sub 3} (x = 0.1) are reported to verify the spin state and oxidation state of iron. The lattice distortion due to the radius ratio difference between a Sc{sup 3+} cation and Fe{sup 3+} cation in low spin state is responsible for the structural transformation, which in turn facilitates a B′:B″ cation ordering.« less
Tokuda, K; Yahata, Y; Sunagawa, T
2016-10-01
Prevention of secondary household transmission of Shiga toxin-producing Escherichia coli (STEC) is important in outbreak settings. We examined factors contributing to secondary household transmission during STEC outbreaks in daycare centres in Japan. Suspected STEC outbreaks in daycare centres were identified by the National Epidemiological Surveillance of Infectious Diseases. Questionnaires were sent to local health centres that responded to outbreaks. Secondary household transmission rates were calculated, and factors affecting secondary household transmission rate were analysed by multilevel analysis. The secondary household transmission rates in 16 outbreaks ranged from 0% to 34·4% (median 4·4%). The highest rate (23·0%) was observed in siblings aged 6-9 years, and the infection rate was significantly higher for mothers than for fathers and grandparents (P < 0·05). Using multilevel analysis, the following variables were selected in the best model: information provided face-to-face (vs. letter or telephone) to families of children in daycare centres (at initial response), STEC type and lag time (days) between onset and providing information. Early response and hygiene education by visiting local health centre staff may be effective measures to prevent secondary household transmission in STEC outbreaks. Hygiene education should be emphasized for children aged 6-9 years, as well as for younger children.
Bofill-De Ros, Xavier; Gironella, Meritxell; Fillat, Cristina
2014-09-01
Oncolytic virotherapy shows promise for pancreatic ductal adenocarcinoma (PDAC) treatment, but there is the need to minimize associated-toxicities. In the current work, we engineered artificial target sites recognized by miR-216a and/or miR-148a to provide pancreatic tumor-selectivity to replication-competent adenoviruses (Ad-miRTs) and improve their safety profile. Expression analysis in PDAC patients identified miR-148a and miR-216a downregulated in resectable (FC(miR-148a) = 0.044, P < 0.05; FC(miR-216a) = 0.017, P < 0.05), locally advanced (FC(miR-148a) = 0.038, P < 0.001; FC(miR-216a) = 0.001, P < 0.001) and metastatic tumors (FC(miR-148a) = 0.041, P < 0.01; FC(miR-216a) = 0.002, P < 0.001). In mouse tissues, miR-216a was highly specific of the exocrine pancreas whereas miR-148a was abundant in the exocrine pancreas, Langerhans islets, and the liver. In line with the miRNA content and the miRNA target site design, we show E1A gene expression and viral propagation efficiently controlled in Ad-miRT-infected cells. Consequently, Ad-miRT-infected mice presented reduced pancreatic and liver damage without perturbation of the endogenous miRNAs and their targets. Interestingly, the 8-miR148aT design showed repressing activity by all miR-148/152 family members with significant detargeting effects in the pancreas and liver. Ad-miRTs preserved their oncolytic activity and triggered strong antitumoral responses. This study provides preclinical evidences of miR-148a and miR-216a target site insertions to confer adenoviral selectivity and proposes 8-miR148aT as an optimal detargeting strategy for genetically-engineered therapies against PDAC.
Case-finding for coeliac disease in secondary care: a prospective multicentre UK study.
Mooney, Peter D; Leeds, John S; Libzo, Nafan; Sidhu, Reina; Evans, Kate E; Hall, Emma J; Jandu, Veerinder S; Hopper, Andrew D; Basumani, Pandurangan; Dear, Keith L; McAlindon, Mark E; Sanders, David S
2014-01-01
Coeliac disease affects 1% of the population. Despite this high prevalence, the majority of individuals are undetected. Many patients present with subtle symptoms which may also contribute to under diagnosis. Our aim was to determine the relative importance of different presenting characteristics. Unselected gastroenterology patients referred to 4 hospitals in South Yorkshire were investigated for coeliac disease. Diagnosis was based on positive serology and the presence of villous atrophy. Odds ratios were calculated for presenting characteristics and multivariate analysis performed to identify independent risk factors. 4089 patients were assessed (41.5% male, mean age 55.8 ± 18.2 years); 129 had coeliac disease (3.2%, 95% CI 2.6-3.7%). Multivariate analysis of patients referred to secondary care showed family history of coeliac disease (OR 1.26, p < 0.0001), anaemia (OR 1.03, p < 0.0001) and osteoporosis (OR 1.1, p = 0.006) were independent risk factors for diagnosis of coeliac disease. When compared to population controls, diarrhoea (OR 4.1, p < 0.0001), weight loss (OR 2.7, p = 0.02), irritable bowel syndrome symptoms (OR 3.2, p = 0.005) thyroid disease (OR 4.4, p = 0.01) and diabetes (OR 3.0, p = 0.05) were also associated with increased coeliac disease risk. Coeliac disease accounts for 1 in 31 referrals in secondary care to unselected gastroenterology clinics. A low threshold for coeliac disease testing should be adopted. Copyright © 2013 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.
Change in Glutenin Macropolymer Secondary Structure in Wheat Sourdough Fermentation by FTIR.
Wang, Jinshui; Yue, Yuanyuan; Liu, Tiantian; Zhang, Bin; Wang, Zhenlei; Zhang, Changfu
2017-06-01
Wheat sourdough was prepared by fermentation with Lactobacillus plantarum M616 and yeast in the present study. The change in secondary structure of glutenin macropolymer (GMP) in wheat sourdough fermentation for 4 and 12 h was determined using Fourier transform infrared spectroscopy, and then the resultant spectra were Fourier self-deconvoluted of the amide I band in the region from 1600 to 1700 cm -1 . Significant different spectra especially in the amide I band for GMP from sourdough fermented with L. plantarum M616 (SL) and with L. plantarum M616 and yeast (SLY) were found in respect of control dough (CK), dough with acids (SA), and sourdough fermented with yeast (SY) at 4 and 12 h of fermentation. The loss of α-helix structure in SL, SLY, and SA samples was noticed during fermentation. Compared with CK and SY, SL, SLY, and SA samples showed significant decrease (p < 0.05) in the relative areas of α-helix at the same stage of fermentation. In addition, β-turns in SL sourdough decrease, and the relative areas of random coil increase significantly (p < 0.05). These changes in the secondary structure mean that the flexibility of glutenin macropolymer in sourdough increases and it makes GMP degradation easier during fermentation. The modified secondary structure of GMP makes more sensitive to proteolysis by means of cereal enzymes.
Word Criticality Analysis. MOS: 05H. Skill Levels 1 & 2.
1981-09-01
HEADQUARTERS gall CoN.tR N111I UNITED STATES ARMY TRAING AnD DOCTRINE COULIIAND FORT MONROE, 7IRGIfIA 23651 . JCI b FE 8 131 ""-’-- ± 0it 1 Am . 0...5. I CHANE 021 I COOS A -"-- ’s.1 9~ 02 51 9,-~2-1%-101 111105-- I rPLP3Tl0 9S.l .5 I7.M CO0,25 A’Tt 99 - 131 -162 492 :1 ComN9T4T --- 1 I CnThm. 92,s...144.2 25,1 I TRAFFIC t- 13,2 131 . 1 * I T5 A’ISRe ISS I (N 152.1 148,1 147, 1 I us SID 154,7 333 152,4 150.5 148,2 14.,2 144,2 25.2 2 ACTIV~ V 5, * 2
Li, Yang; Yuan, Xinxin; Sha, Shifu; Liu, Zhen; Zhu, Weiguo; Qiu, Yong; Wang, Bin; Yu, Yang; Zhu, Zezhang
2017-10-01
OBJECTIVE The aim of this study was to investigate how implant density affects radiographic results and clinical outcomes in patients with dystrophic scoliosis secondary to neurofibromatosis Type 1 (NF1). METHODS A total of 41 patients with dystrophic scoliosis secondary to NF1 who underwent 1-stage posterior correction between June 2011 and December 2013 were included. General information about patients was recorded, as were preoperative and postoperative scores from Scoliosis Research Society (SRS)-22 questionnaires. Pearson correlation analysis was used to analyze the associations among implant density, coronal Cobb angle correction rate and correction loss at last follow-up, change of sagittal curve, and apical vertebral translation. Patients were then divided into 2 groups: those with low-density and those with high-density implants. Independent-sample t-tests were used to compare demographic data, radiographic findings, and clinical outcomes before surgery and at last follow-up between the groups. RESULTS Significant correlations were found between the implant density and the coronal correction rate of the main curve (r = 0.505, p < 0.01) and the coronal correction loss at final follow-up (r = -0.379, p = 0.015). There was no significant correlation between implant density and change of sagittal profile (p = 0.662) or apical vertebral translation (p = 0.062). The SRS-22 scores improved in the appearance, activity, and mental health domains within both groups, but there was no difference between the groups in any of the SRS-22 domains at final follow-up (p > 0.05 for all). CONCLUSIONS Although no significant differences between the high- and low-density groups were found in any of the SRS-22 domains at final follow-up, higher implant density was correlated with superior coronal correction and less postoperative correction loss in patients with dystrophic NF1-associated scoliosis.
Upregulation of miR-98 Inhibits Apoptosis in Cartilage Cells in Osteoarthritis.
Wang, Gui-Long; Wu, Yu-Bo; Liu, Jia-Tian; Li, Cui-Yun
2016-11-01
We aimed to investigate the effects of microRNA-98 (miR-98) on apoptosis in cartilage cells of osteoarthritis (OA) patients. Knee cartilage tissue samples were collected from 31 OA patients, 21 autopsies, and 26 amputation patients due to trauma. The clinicopathological data were recorded. Quantitative real-time polymerase chain reaction was performed to compare the miR-98 expression levels from cartilage cells obtained from the OA and non-OA patients. Clinicopathological characteristics of the patients were also analyzed. Primary chondrocytes were separated from cartilage tissues and transfected with plasmids or siRNA to overexpress or inhibit miR-98. Annexin V-PI double staining and TUNEL assays were used to examine apoptosis in the primary chondrocytes after transfection. Finally, a rat OA model was used to confirm the effects of miR-98 on apoptosis in cartilage cells in vivo. Compared with the normal cartilage tissues, miR-98 expression was reduced in the OA cartilage tissues (p < 0.01). The miR-98 expression levels were also significantly correlated with the OA stage (p < 0.05). In vitro, transfection with the miR-98 inhibitor increased apoptosis in the cartilage cells (p < 0.05), and transfection with a miR-98 mimic inhibited apoptosis in cartilage cells (p < 0.05). In the OA rat model, exogenous injection of the miR-98 mimic inhibited apoptosis in the rat cartilage cells thus alleviating OA. MiR-98 expression is reduced in the cartilage cells of OA patients and the overexpression of miR-98 inhibits cartilage cell apoptosis, while inhibition of microRNA-98 leads to cartilage cell apoptosis. These findings provide a theoretical basis for the development of novel targeted therapies for OA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tirupathi, Patri; Raju, K.; Peetla, Naresh
A pervoskite (Bi{sub 0.5}La{sub 0.5})(Fe{sub 0.5}Cr{sub 0.5})O{sub 3} (BLFC) nanoparticles were synthesized by high energy ball milling. Rietveld refined X-ray diffraction studies revealed that this compound shows orthorhombic structure with Pbnm space group. The dielectric studies were investigated in wide frequency (10{sup 2}-10{sup 6}) range indicating giant dielectric permittivity behavior similar to LaFeO{sub 3} ceramic. The noted dielectric loss relaxation frequency dependent is as following the Arrhenius law can be ascribed as polaronic conduction. Further, magnetic transition at around 337 K and coexistence of weak ferromagnetic and antiferromagnetic behavior is observed below magnetic transition.
NASA Astrophysics Data System (ADS)
Iverson, Paul; Hazan, Valerie; Bannister, Kerry
2005-11-01
Recent work [Iverson et al. (2003) Cognition, 87, B47-57] has suggested that Japanese adults have difficulty learning English /r/ and /l/ because they are overly sensitive to acoustic cues that are not reliable for /r/-/l/ categorization (e.g., F2 frequency). This study investigated whether cue weightings are altered by auditory training, and compared the effectiveness of different training techniques. Separate groups of subjects received High Variability Phonetic Training (natural words from multiple talkers), and 3 techniques in which the natural recordings were altered via signal processing (All Enhancement, with F3 contrast maximized and closure duration lengthened; Perceptual Fading, with F3 enhancement reduced during training; and Secondary Cue Variability, with variation in F2 and durations increased during training). The results demonstrated that all of the training techniques improved /r/-/l/ identification by Japanese listeners, but there were no differences between the techniques. Training also altered the use of secondary acoustic cues; listeners became biased to identify stimuli as English /l/ when the cues made them similar to the Japanese /r/ category, and reduced their use of secondary acoustic cues for stimuli that were dissimilar to Japanese /r/. The results suggest that both category assimilation and perceptual interference affect English /r/ and /l/ acquisition.
Formation of secondary organic aerosol coating on black carbon particles near vehicular emissions
NASA Astrophysics Data System (ADS)
Lee, Alex K. Y.; Chen, Chia-Li; Liu, Jun; Price, Derek J.; Betha, Raghu; Russell, Lynn M.; Zhang, Xiaolu; Cappa, Christopher D.
2017-12-01
Black carbon (BC) emitted from incomplete combustion can result in significant impacts on air quality and climate. Understanding the mixing state of ambient BC and the chemical characteristics of its associated coatings is particularly important to evaluate BC fate and environmental impacts. In this study, we investigate the formation of organic coatings on BC particles in an urban environment (Fontana, California) under hot and dry conditions using a soot-particle aerosol mass spectrometer (SP-AMS). The SP-AMS was operated in a configuration that can exclusively detect refractory BC (rBC) particles and their coatings. Using the -log(NOx / NOy) ratio as a proxy for photochemical age of air masses, substantial formation of secondary organic aerosol (SOA) coatings on rBC particles was observed due to active photochemistry in the afternoon, whereas primary organic aerosol (POA) components were strongly associated with rBC from fresh vehicular emissions in the morning rush hours. There is also evidence that cooking-related organic aerosols were externally mixed from rBC. Positive matrix factorization and elemental analysis illustrate that most of the observed SOA coatings were freshly formed, providing an opportunity to examine SOA coating formation on rBCs near vehicular emissions. Approximately 7-20 wt % of secondary organic and inorganic species were estimated to be internally mixed with rBC on average, implying that rBC is unlikely the major condensation sink of SOA in this study. Comparison of our results to a co-located standard high-resolution time-of-flight aerosol mass spectrometer (HR-ToF-AMS) measurement suggests that at least a portion of SOA materials condensed on rBC surfaces were chemically different from oxygenated organic aerosol (OOA) particles that were externally mixed with rBC, although they could both be generated from local photochemistry.
Jung, SeungWoo; Bohan, Amy
2018-02-01
OBJECTIVE To characterize expression profiles of circulating microRNAs via genome-wide sequencing for dogs with congestive heart failure (CHF) secondary to myxomatous mitral valve degeneration (MMVD). ANIMALS 9 healthy client-owned dogs and 8 age-matched client-owned dogs with CHF secondary to MMVD. PROCEDURES Blood samples were collected before administering cardiac medications for the management of CHF. Isolated microRNAs from plasma were classified into microRNA libraries and subjected to next-generation sequencing (NGS) for genome-wide sequencing analysis and quantification of circulating microRNAs. Quantitative reverse transcription PCR (qRT-PCR) assays were used to validate expression profiles of differentially expressed circulating microRNAs identified from NGS analysis of dogs with CHF. RESULTS 326 microRNAs were identified with NGS analysis. Hierarchical analysis revealed distinct expression patterns of circulating microRNAs between healthy dogs and dogs with CHF. Results of qRT-PCR assays confirmed upregulation of 4 microRNAs (miR-133, miR-1, miR-let-7e, and miR-125) and downregulation of 4 selected microRNAs (miR-30c, miR-128, miR-142, and miR-423). Results of qRT-PCR assays were highly correlated with NGS data and supported the specificity of circulating microRNA expression profiles in dogs with CHF secondary to MMVD. CONCLUSIONS AND CLINICAL RELEVANCE These results suggested that circulating microRNA expression patterns were unique and could serve as molecular biomarkers of CHF in dogs with MMVD.
Yoshida, Yuichi; Shibata, Hirotaka
2015-11-01
Hypertension is a common disease and a crucial predisposing factor of cardiovascular diseases. Approximately 10% of hypertensive patients are secondary hypertension, a pathogenetic factor of which can be identified. Secondary hypertension consists of endocrine, renal, and other diseases. Primary aldosteronism, Cushing's syndrome, pheochromocytoma, hyperthyroidism, and hypothyroidism result in endocrine hypertension. Renal parenchymal hypertension and renovascular hypertension result in renal hypertension. Other diseases such as obstructive sleep apnea syndrome are also very prevalent in secondary hypertension. It is very crucial to find and treat secondary hypertension at earlier stages since most secondary hypertension is curable or can be dramatically improved by specific treatment. One should keep in mind that screening of secondary hypertension should be done at least once in a daily clinical practice.
NASA Astrophysics Data System (ADS)
Manikandan, Palanisamy; Heo, Seongwoo; Kim, Hyun Woo; Jeong, Hu Young; Lee, Eungje; Kim, Youngsik
2017-09-01
Layered Na0.5Co0.5Mn0.5O2 material is synthesized through a facile mixed hydroxy-carbonate route using (Co0.5Mn0.5)2(OH)2CO3 precursor and well characterized as a hexagonal layered structure under P63/mmc space group. The lattice parameters and unit cell volume (a = 2.8363 Å, c = 11.3152 Å and V = 78.83 Å3) are calculated by Rietveld refinement analysis. A flaky-bundle morphology is obtained to the layered Na0.5Co0.5Mn0.5O2 material with the hexagonal flake size ∼30 nm. Advanced transmission electron microscopic images are revealed the local structure of the layered Na0.5Co0.5Mn0.5O2 material with contrasting bright dots and faint dark dots corresponding to the Co/Mn and Na atoms. Two oxidation and reduction peaks are occurred in a cyclic voltammetric analysis corresponding to Co3+/Co4+ and Mn3+/Mn4+ redox processes. These reversible processes are attributed to the intercalation/de-intercalation of Na+ ions into the host structure of layered Na0.5Co0.5Mn0.5O2 material. Accordingly, the sodium cell is delivered the initial charge-discharge capacity 53/144 mAh g-1 at 0.5 C, which cycling studies are extended to rate capability test at 1 C, 3 C and 5C. Eventually, the Na-ion full-cell is yielded cathode charge-discharge capacity 55/52 mAh g-1 at 0.212 mA and exhibited as a high voltage cathode for Na-ion batteries.
Jia, Xia; Zhao, Yonghua; Liu, Tuo; Huang, Shuping
2016-10-01
Secondary metabolites play important roles in plant interactions with the environment. The co-occurrence of heavy metal contamination of soils and rising atmospheric CO2 has important effects on plant. It is important to explore the ways in which production of plant secondary metabolites is affected by heavy metals under elevated atmospheric CO2. We examined the effects of elevated CO2 on secondary metabolite contents in Robinia pseudoacacia seedlings grown in Cd- and lead (Pb)-contaminated soils. The increase in secondary metabolites was greater under Cd + Pb exposure than under exposure to individual metals regardless of elevated CO2 with the exception of condensed tannins in leaves and total alkaloids in stems. Except for phenolic compounds and condensed tannins, elevated CO2 was associated with increased secondary metabolite contents in leaves and stems of plants exposed to Cd, Pb, and Cd + Pb compared to plants exposed to ambient CO2 + metals. Changes in saponins in leaves and alkaloids in stems were greater than changes in the other secondary metabolites. Significant interactive effects of CO2, Cd, and Pb on secondary metabolites were observed. Saponins in leaves and alkaloids in stems were more sensitive than other secondary metabolites to elevated CO2 + Cd + Pb. Elevated CO2 could modulate plant protection and defense mechanisms in R. pseudoacacia seedlings exposed to heavy metals by altering the production of secondary metabolites. The increased Cd and Pb uptake under elevated CO2 suggested that R. pseudoacacia may be used in the phytoremediation of heavy metal-contaminated soils under global environmental scenarios. Copyright © 2016 Elsevier Ltd. All rights reserved.
Evaluation of the Friction of Self-Ligating and Conventional Bracket Systems
Tecco, Simona; Di Iorio, Donato; Nucera, Riccardo; Di Bisceglie, Beatrice; Cordasco, Giancarlo; Festa, Felice
2011-01-01
Objectives: This in vitro study evaluated the friction (F) generated by aligned stainless steel (SS) conventional brackets, self-ligating Damon MX© brackets (SDS Ormco, Glendora, California, USA), Time3© brackets (American Orthodontics, Sheboygan, Wisconsin, USA), Vision LP© brackets (American Orthodontics), and low-friction Slide© ligatures (Leone, Firenze, Italy) coupled with various SS, nickel-titanium (NiTi), and beta-titanium (TMA) archwires. Methods: All brackets had a 0.022-inch slot, and the orthodontic archwires were 0.014-inch, 0.016-inch, 0.014×0.025-inch, 0.018×0.025-inch, and 0.019×0.025-inch NiTi; 0.017×0.025-inch TMA; and 0.019×0.025-inch SS. Each bracket-archwire combination was tested 10 times. In the test, 10 brackets of the same group were mounted in alignment on a metal bar. The archwires moved through all the 10 brackets at a crosshead speed of 0.5 mm/min (each run lasted approximately 5 min). The differences among 5 groups of brackets were analyzed through the Kruskal-Wallis test, and a Mann-Whitney test was calculated as post hoc analysis. The P value was set at 0.05. Results: Coupled with 0.014-inch NiTi and 0.016-inch NiTi, Victory Series© brackets generated the greatest F, while Damon MX© and Vision LP© brackets generated the lowest (P<.05); no significant differences were observed between Time3© brackets and Slide© ligatures. Coupled with all the rectangular archwires, Victory Series© brackets, Slide© ligatures, and Vision LP© self-ligating brackets generated significantly lower F than did Time3© and Damon MX© self-ligating brackets (P<.05). Conclusions: These findings suggest that self-ligating brackets are a family of brackets that, in vitro, can generate different levels of F when coupled with thin or thick, rectangular, or round archwires. Clinical conclusions based on our results are not possible due to the limitations of the experimental conditions. PMID:21769273
Biomass resilience of Neotropical secondary forests.
Poorter, Lourens; Bongers, Frans; Aide, T Mitchell; Almeyda Zambrano, Angélica M; Balvanera, Patricia; Becknell, Justin M; Boukili, Vanessa; Brancalion, Pedro H S; Broadbent, Eben N; Chazdon, Robin L; Craven, Dylan; de Almeida-Cortez, Jarcilene S; Cabral, George A L; de Jong, Ben H J; Denslow, Julie S; Dent, Daisy H; DeWalt, Saara J; Dupuy, Juan M; Durán, Sandra M; Espírito-Santo, Mario M; Fandino, María C; César, Ricardo G; Hall, Jefferson S; Hernandez-Stefanoni, José Luis; Jakovac, Catarina C; Junqueira, André B; Kennard, Deborah; Letcher, Susan G; Licona, Juan-Carlos; Lohbeck, Madelon; Marín-Spiotta, Erika; Martínez-Ramos, Miguel; Massoca, Paulo; Meave, Jorge A; Mesquita, Rita; Mora, Francisco; Muñoz, Rodrigo; Muscarella, Robert; Nunes, Yule R F; Ochoa-Gaona, Susana; de Oliveira, Alexandre A; Orihuela-Belmonte, Edith; Peña-Claros, Marielos; Pérez-García, Eduardo A; Piotto, Daniel; Powers, Jennifer S; Rodríguez-Velázquez, Jorge; Romero-Pérez, I Eunice; Ruíz, Jorge; Saldarriaga, Juan G; Sanchez-Azofeifa, Arturo; Schwartz, Naomi B; Steininger, Marc K; Swenson, Nathan G; Toledo, Marisol; Uriarte, Maria; van Breugel, Michiel; van der Wal, Hans; Veloso, Maria D M; Vester, Hans F M; Vicentini, Alberto; Vieira, Ima C G; Bentos, Tony Vizcarra; Williamson, G Bruce; Rozendaal, Danaë M A
2016-02-11
Land-use change occurs nowhere more rapidly than in the tropics, where the imbalance between deforestation and forest regrowth has large consequences for the global carbon cycle. However, considerable uncertainty remains about the rate of biomass recovery in secondary forests, and how these rates are influenced by climate, landscape, and prior land use. Here we analyse aboveground biomass recovery during secondary succession in 45 forest sites and about 1,500 forest plots covering the major environmental gradients in the Neotropics. The studied secondary forests are highly productive and resilient. Aboveground biomass recovery after 20 years was on average 122 megagrams per hectare (Mg ha(-1)), corresponding to a net carbon uptake of 3.05 Mg C ha(-1) yr(-1), 11 times the uptake rate of old-growth forests. Aboveground biomass stocks took a median time of 66 years to recover to 90% of old-growth values. Aboveground biomass recovery after 20 years varied 11.3-fold (from 20 to 225 Mg ha(-1)) across sites, and this recovery increased with water availability (higher local rainfall and lower climatic water deficit). We present a biomass recovery map of Latin America, which illustrates geographical and climatic variation in carbon sequestration potential during forest regrowth. The map will support policies to minimize forest loss in areas where biomass resilience is naturally low (such as seasonally dry forest regions) and promote forest regeneration and restoration in humid tropical lowland areas with high biomass resilience.
Growth of Cu 0.5Tl 0.5Ba 2Ca 3Cu 4-yZn yO 12-δ superconductor with optimum carriers
NASA Astrophysics Data System (ADS)
Mumtaz, M.; Khan, Nawazish A.; Khan, E. U.
2010-05-01
We have tried to vary the carriers concentration in Cu 0.5Tl 0.5Ba 2Ca 3Cu 4-yZn yO 12-δ ( y = 0, 1, 1.5, 2, 2.5) superconductor with the help of post-annealing experiments carried out in nitrogen, oxygen and air and to investigate its effects on the superconductivity parameters. The zero resistivity critical temperature [ T c( R = 0)], the magnitude of diamagnetism and critical current [ I c( H = 0)] are found to increase in Zn free samples after post-annealing in oxygen and air, while these superconducting properties have been suppressed after post-annealing in nitrogen at 550 °C for 6 h. The post-annealing of Zn-doped samples in air has marginally increased the superconducting properties, while these properties have been suppressed after post-annealing in nitrogen and oxygen. These studies have led us to the definite conclusion that the Zn-doped material has grown with optimum carriers concentration.
Characterization of Novel Operation Modes for Secondary Emission Ionization Calorimetry
NASA Astrophysics Data System (ADS)
Tiras, Emrah; Dilsiz, Kamuran; Ogul, Hasan; Snyder, Christina; Bilki, Burak; Onel, Yasar; Winn, David
2017-01-01
Secondary Emission (SE) Ionization Calorimetry is a novel technique to measure electromagnetic showers in high radiation environments. We have developed new operation modes by modifying the bias of the conventional PMT circuits. Hamamatsu single anode R7761 and multi-anode R5900-00-M16 Photomultiplier Tubes (PMTs) with modified bases are used as SE detector modules in our SE calorimetry prototype. In this detector module, the first dynode is used as the active media as opposed to photocathode. Here, we report the technical design of new modes and characterization measurements for both SE and PMT modes.
Selective Etching of Silicon in Preference to Germanium and Si0.5Ge0.5.
Ahles, Christopher F; Choi, Jong Youn; Wolf, Steven; Kummel, Andrew C
2017-06-21
The selective etching characteristics of silicon, germanium, and Si 0.5 Ge 0.5 subjected to a downstream H 2 /CF 4 /Ar plasma have been studied using a pair of in situ quartz crystal microbalances (QCMs) and X-ray photoelectron spectroscopy (XPS). At 50 °C and 760 mTorr, Si can be etched in preference to Ge and Si 0.5 Ge 0.5 , with an essentially infinite Si/Ge etch-rate ratio (ERR), whereas for Si/Si 0.5 Ge 0.5 , the ERR is infinite at 22 °C and 760 mTorr. XPS data showed that the selectivity is due to the differential suppression of etching by a ∼2 ML thick C x H y F z layer formed by the H 2 /CF 4 /Ar plasma on Si, Ge, and Si 0.5 Ge 0.5 . The data are consistent with the less exothermic reaction of fluorine radicals with Ge or Si 0.5 Ge 0.5 being strongly suppressed by the C x H y F z layer, whereas, on Si, the C x H y F z layer is not sufficient to completely suppress etching. Replacing H 2 with D 2 in the feed gas resulted in an inverse kinetic isotope effect (IKIE) where the Si and Si 0.5 Ge 0.5 etch rates were increased by ∼30 times with retention of significant etch selectivity. The use of D 2 /CF 4 /Ar instead of H 2 /CF 4 /Ar resulted in less total carbon deposition on Si and Si 0.5 Ge 0.5 and gave less Ge enrichment of Si 0.5 Ge 0.5 . These results are consistent with the selectivity being due to the differential suppression of etching by an angstrom-scale carbon layer.
Magnetic and magnetocaloric properties of the alloys Mn2-xFexP0.5As0.5 (0⩽x⩽0.5)
NASA Astrophysics Data System (ADS)
Gribanov, I. F.; Golovchan, A. V.; Varyukhin, D. V.; Val'kov, V. I.; Kamenev, V. I.; Sivachenko, A. P.; Sidorov, S. L.; Mityuk, V. I.
2009-10-01
The results of investigations of the magnetic and magnetocaloric properties of alloys from the system Mn2-xFexP0.5As0.5 (0⩽x⩽0.5) are presented. The magnetization measurements are performed in the temperature interval 4.2-700K in magnetic fields up to 8T. The entropy changes ΔS with the magnetic field changing from 0 to 2, 4, 5, and 8T are determined from the magnetization isotherms obtained near temperatures of the spontaneous appearance of the ferromagnetic state (TC,TAF -FM1), and the curves ΔS(T0) are constructed. It is found that TC and TAF-FM1 decrease monotonically with increasing manganese concentration and that the ferromagnetic phase is completely suppressed in Mn1.5Fe0.5P0.5As0.5. It is found that the concentration dependences of the maximum entropy jump (and the corresponding cold-storage capacity) and the magnitudes of the ferromagnetic moment of the unit cell with maxima for x =0.9 and 0.8 show extremal behavior. The data obtained are compared with the ferromagnetic moments calculated from first principles by the Korringa-Kohn-Rostoker method using the coherent-potential approximation (KKR-CPA)—the discrepancy for 0.5⩽x⩽0.7 is attributed to the appearance of an antiferromagnetic component of the magnetic structure. It is concluded that the alloys Mn2-xFexP0.5As0.5 have promise for use in magnetic refrigerators operating at room temperature.
Characteristics and generation of secondary jets and secondary gigantic jets
NASA Astrophysics Data System (ADS)
Lee, Li-Jou; Huang, Sung-Ming; Chou, Jung-Kung; Kuo, Cheng-Ling; Chen, Alfred B.; Su, Han-Tzong; Hsu, Rue-Rou; Frey, Harald U.; Takahashi, Yukihiro; Lee, Lou-Chuang
2012-06-01
Secondary transient luminous events (TLEs) recorded by the ISUAL-FORMOSAT2 mission can either be secondary jets or secondary gigantic jets (GJs), depending on their terminal altitudes. The secondary jets emerge from the cloud top beneath the preceding sprites and extend upward to the base of the sprites at ˜50 km. The secondary jets likely are negative electric discharges with vertically straight luminous columns, morphologically resembling the trailing jet of the type-I GJs. The number of luminous columns in a secondary jet seems to be affected by the size of the effective capacitor plate formed near the base of the preceding sprites and the charge distribution left behind by the sprite-inducing positive cloud-to-ground discharges. The secondary GJs originate from the cloud top under the shielding area of the preceding sprites, and develop upward to reach the lower ionosphere at ˜90 km. The observed morphology of the secondary GJs can either be the curvy shifted secondary GJs extending outside the region occupied by the preceding sprites or the straight pop-through secondary GJs developing through the center of the preceding circular sprites. A key factor in determining the terminal height of the secondary TLEs appears to be the local ionosphere boundary height that established by the preceding sprites. The abundance and the distribution of the negative charge in the thundercloud following the sprite-inducing positive cloud-to-ground discharges may play important role in the generation of the secondary TLEs.
REOSC Delivers the Best Astronomical Mirror in the World to ESO
NASA Astrophysics Data System (ADS)
1999-12-01
On December 14, 1999, REOSC , the Optical Department of the SAGEM Group , finished the polishing of the fourth 8.2-m main mirror for the Very Large Telescope (VLT) of the European Southern Observatory. The mirror was today delivered to ESO at a ceremony at the REOSC factory in Saint Pierre du Perray, just south of Paris. The precision of the form of the mirror that was achieved during the polishing process is 8.5 nanometer (1 nanometer = 1 millionth of a millimetre) over the optical surface. This exceptional value corresponds to an optical resolution (theoretical image sharpness) of 0.03 arcseconds in the visible spectrum. This corresponds to distinguishing two objects separated by only 15 cm at a distance of 1000 km and will allow to detect astronomical objects that are 10,000 million times fainter than what can be perceived with the unaided eye. This impressive measure of quality, achieved by the REOSC teams during much painstaking work, implies that this VLT mirror is the most accurate in the world. In fact, all four 8.2-m VLT main mirrors polished by REOSC are well within the very strict specifications set by ESO, but this is the best of them all. The celebration today is the successful highlight of a contract initiated more than ten years ago, during which REOSC has perfected new polishing and control techniques - innovations improved and developed in a unique workshop dedicated to these giant mirrors. These methods and means are directly applicable to the new generations of segmented mirrors that are now being developed for astronomy and space observations. They are, in this sense, at the foremost front of optical technology. REOSC, the Optical Department of the SAGEM Group , is specialised in the study and realisation of high-precision optics for astronomy, space, defence, science and industry. For earlier information about the work on the VLT mirrors, cf. ESO Press Release 15/95 (13 November 1995). The SAGEM Group is a French high-technology group. It
Secondary Forest Age and Tropical Forest Biomass Estimation Using TM
NASA Technical Reports Server (NTRS)
Nelson, R. F.; Kimes, D. S.; Salas, W. A.; Routhier, M.
1999-01-01
The age of secondary forests in the Amazon will become more critical with respect to the estimation of biomass and carbon budgets as tropical forest conversion continues. Multitemporal Thematic Mapper data were used to develop land cover histories for a 33,000 Square kM area near Ariquemes, Rondonia over a 7 year period from 1989-1995. The age of the secondary forest, a surrogate for the amount of biomass (or carbon) stored above-ground, was found to be unimportant in terms of biomass budget error rates in a forested TM scene which had undergone a 20% conversion to nonforest/agricultural cover types. In such a situation, the 80% of the scene still covered by primary forest accounted for over 98% of the scene biomass. The difference between secondary forest biomass estimates developed with and without age information were inconsequential relative to the estimate of biomass for the entire scene. However, in futuristic scenarios where all of the primary forest has been converted to agriculture and secondary forest (55% and 42% respectively), the ability to age secondary forest becomes critical. Depending on biomass accumulation rate assumptions, scene biomass budget errors on the order of -10% to +30% are likely if the age of the secondary forests are not taken into account. Single-date TM imagery cannot be used to accurately age secondary forests into single-year classes. A neural network utilizing TM band 2 and three TM spectral-texture measures (bands 3 and 5) predicted secondary forest age over a range of 0-7 years with an RMSE of 1.59 years and an R(Squared) (sub actual vs predicted) = 0.37. A proposal is made, based on a literature review, to use satellite imagery to identify general secondary forest age groups which, within group, exhibit relatively constant biomass accumulation rates.
Evidence of secondary consumption of invertebrate prey by Double-crested Cormorants
Johnson, J. H.; Ross, R.M.; Smith, D.R.
1997-01-01
The piscivorous nature of the Double-crested Cormorant (Phalacrocorax auritus) is well documented. However, many researchers who have used regurgitated pellets to describe the diet of cormorants report that invertebrates compose a small but consistent portion of the diet. We examined the hypothesis that invertebrates found in pellets are primarily the result of secondary consumption. We used odds ratio analysis to examine associations in 2,846 individual pellets between the presence of specific invertebrate prey and the presence of fish species known to consume those invertebrate taxa. Significant (P < 0.05) relationships occurred between gastropods and pumpkinseed (Lepomis gibbosus) and ictalurids, and between decapods and rock bass (Ambloplites rupestris) and smallmouth bass (Micropterus dolomieu). Significant (P < 0.05) relationships were also found between pelecypods and pumpkinseed and ictalurids. We suggest that the invertebrate prey we observed in pellets were present in the digestive tracts of fish that were consumed by Double-crested Cormorants and hence represent secondary consumption by cormorants. We conclude that consumption of invertebrates by Double-crested Cormorants may be overestimated in the literature in instances where the diet was described using pellets.
Becoming Teacher: A/r/tographical Inquiry and Visualising Metaphor
ERIC Educational Resources Information Center
Boulton, Adrienne; Grauer, Kit; L. Irwin, Rita
2017-01-01
A great deal has been written about the representational use of metaphor to understand teacher candidates'/new teachers' conceptions of teacher practice. This article will discuss recent research that explored secondary visual art teacher candidates'/new teachers' "visualising" of visual metaphors to provoke their a/r/tographical inquiry…
Selebalo-Bereng, Lebohang; Patel, Cynthia Joan
2018-01-17
This study focused on the relationship between religion, religiosity/spirituality (R/S), and attitudes of a sample of South African male secondary school youth toward women's rights to legal abortion in different situations. We distributed 400 self-administered questionnaires assessing the main variables (attitudes toward reasons for abortion and R/S) to the target sample in six different secondary schools in KwaZulu-Natal, South Africa. The responses of a final sample of 327 learners were then analyzed using the Statistical Package for the Social Sciences (SPSS) software. The findings revealed that religion and R/S play a role in the youths' attitudes toward abortion. While the Hindu subsample indicated higher overall support across the different scenarios, the Muslim subsample reported greater disapproval than the other groups on 'Elective reasons' and in instances of 'Objection by significant others.' The Christian youth had the most negative attitudes to abortion for 'Traumatic reasons' and 'When women's health/life' was threatened. Across the sample, higher R/S levels were linked with more negative attitudes toward reasons for abortion.
Does the design of self-ligating brackets show different behavior in terms of friction?
Tecco, Simona; Marzo, Giuseppe; Di Bisceglie, Beatrice; Crincoli, Vito; Tetè, Stefano; Festa, Felice
2011-01-01
This in vitro study evaluated the friction generated by aligned stainless steel conventional brackets, self-ligating Damon MX brackets, Time3 brackets, Vision LP brackets, and low-friction Slide ligatures coupled with various stainless steel, nickel-titanium (Ni-Ti), and beta-titanium (TMA) archwires. All brackets had a 0.022-inch slot; the orthodontic archwires were 0.014-inch Ni-Ti, 0.016-inch Ni-Ti, 0.014 x 0.025-inch Ni-Ti, 0.018 x 0.025-inch Ni-Ti, 0.017 x 0.025-inch TMA, 0.019 x 0.025-inch stainless steel, and 0.019 x 0.025-inch Ni-Ti. Each bracket-archwire combination was tested 10 times. Coupled with 0.014-inch Ni-Ti and 0.016-inch Ni-Ti archwire, conventional brackets generated the greatest friction, while Damon MX and Vision LP brackets generated the lowest (P < .05). No significant difference was observed between Time3 brackets and Slide ligatures. Coupled with all the rectangular archwires, Victory Series brackets, Slide ligatures, and Vision LP self-ligating brackets generated significantly lower friction than Time3 and Damon MX self-ligating brackets (P < .05). These findings suggest that self-ligating brackets are a great family of brackets that, in vitro, can generate different levels of friction when coupled with thin, thick, rectangular, or round archwires. Clinical conclusions based on our results are not possible, due to the limitations of the experimental conditions.
Song, Dawei; Meng, Bin; Gan, Minfeng; Niu, Junjie; Li, Shiyan; Chen, Hao; Yuan, Chenxi; Yang, Huilin
2015-08-01
Percutaneous vertebroplasty (PVP) and balloon kyphoplasty (BKP) are minimally invasive and effective vertebral augmentation techniques for managing osteoporotic vertebral compression fractures (OVCFs). Recent meta-analyses have compared the incidence of secondary vertebral fractures between patients treated with vertebral augmentation techniques or conservative treatment; however, the inclusions were not thorough and rigorous enough, and the effects of each technique on the incidence of secondary vertebral fractures remain unclear. To perform an updated systematic review and meta-analysis of the studies with more rigorous inclusion criteria on the effects of vertebral augmentation techniques and conservative treatment for OVCF on the incidence of secondary vertebral fractures. PubMed, MEDLINE, EMBASE, SpringerLink, Web of Science, and the Cochrane Library database were searched for relevant original articles comparing the incidence of secondary vertebral fractures between vertebral augmentation techniques and conservative treatment for patients with OVCFs. Randomized controlled trials (RCTs) and prospective non-randomized controlled trials (NRCTs) were identified. The methodological qualities of the studies were evaluated, relevant data were extracted and recorded, and an appropriate meta-analysis was conducted. A total of 13 articles were included. The pooled results from included studies showed no statistically significant differences in the incidence of secondary vertebral fractures between patients treated with vertebral augmentation techniques and conservative treatment. Subgroup analysis comparing different study designs, durations of symptoms, follow-up times, races of patients, and techniques were conducted, and no significant differences in the incidence of secondary fractures were identified (P > 0.05). No obvious publication bias was detected by either Begg's test (P = 0.360 > 0.05) or Egger's test (P = 0.373 > 0.05). Despite current thinking in the
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bharathi, K. Kamala, E-mail: kkamalabharathi@gmail.com; Ramesh, G.; Patro, L.N.
2015-02-15
Graphical abstract: Temperature variation of dielectric constant of Bi{sub 0.9}Ca{sub 0.05}Sm{sub 0.05}FeO{sub 3} at various frequencies as a function of temperature indicating anomalies at 420 and 540 K. - Highlights: • Substitution of Sm ions for Bi enhances the saturation magnetization of BiFeO{sub 3}. • XPS studies indicate the creation of oxygen vacancies upon Ca substitution. • Dielectric measurements show dielectric anomalies at high temperatures. • Raman spectra at high temperatures confirm the dielectric anomaly temperatures. - Abstract: Enhanced ferromagnetic properties and high temperature dielectric anomalies in the temperature range of 300–873 K in Bi{sub 0.9}Ca{sub 0.05}Sm{sub 0.05}FeO{sub 3} (BCSFO)more » prepared by hydrothermal method are reported. BiFeO{sub 3} is seen to crystallize in rhombohedrally distorted perovskite structure without any impurity phase. Substitution of small amount of Ca and Sm (Bi{sub 0.9}Ca{sub 0.05}Sm{sub 0.05}FeO{sub 3}) leads to increase in the lattice constant values and formation of small amount of secondary phase. Magnetization curve of pure BFO indicates very weak ferromagnetism combined with antiferromagnetic nature of the samples. Whereas, BCSFO sample shows very clear and enhanced ferromagnetic nature. Saturation magnetization and Neel’s temperature values are found to be 4.36 emu/g and 664 K, respectively. X-ray photoelectron spectroscopy indicates the creation of oxygen vacancies upon Ca substitution in Bi site. Dielectric anomalies at 420 and 540 K were observed for Bi{sub 0.9}Ca{sub 0.05}Sm{sub 0.05}FeO{sub 3} from the temperature variation of dielectric constant and specific heat capacity measurements. Observation of dielectric anomalies in pure BiFeO{sub 3} sample reveals that the origin of dielectric peaks is purely from the primary phase. Raman spectroscopy study indicates a clear shift and broadening of A modes (between 100 and 200 cm{sup −1}) at the dielectric anomaly temperatures
Synthesis and characterization of (Bi{sub 0.5}Ba{sub 0.5}) (Fe{sub 0.5}Ti{sub 0.5}) O{sub 3} ceramic
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parida, B.N., E-mail: bichitra_mama@rediffmail.com; Das, Piyush R., E-mail: prdas63@gmail.com; Padhee, R.
2015-01-15
Graphical abstract: Temperature variation of (a) dielectric constant (b) dielectric loss of the sample. - Highlights: • The high values of dielectric permittivity and low value of tangent loss. • It used for microwave applications. • The impedance and dielectric relaxation in the material is non exponential and non Debye-type. • Its ac conductivity obeys Jonscher universal power law. - Abstract: The polycrystalline sample of (Bi{sub 0.5}Ba{sub 0.5}) (Fe{sub 0.5}Ti{sub 0.5}) O{sub 3} (BF–BT) was prepared by a standard mixed oxide method. Analysis of room temperature XRD pattern and Raman/FTIR spectra of the compound does not exhibit any change inmore » its crystal structure of BaTiO{sub 3} on addition of BiFeO{sub 3} in equal ratio. The surface morphology of the gold-plated sintered pellet sample recorded by SEM (scanning electron microscope) exhibits a uniform distribution of grains with less porosity. Detailed studies of nature and quantity of variation of dielectric constant, tangent loss, and polarization with temperature and frequency indicate the existence of ferroelectric phase transition at high-temperature. There is a low-temperature anti-ferromagnetic phase transition below 375 °C in the material. Detailed studies of electrical properties (impedance, modulus, etc.) of the material confirmed a strong correlation between micro-structure and properties.« less
Han, Pengfei; Keast, Russell S J; Roura, Eugeni
2017-11-01
The influence of sweet taste sensitivity on food intake is not well understood. We investigated the involvement of salivary leptin and SNP of the sweet taste receptor genes (TAS1R2/TAS1R3) on sweet taste sensitivity, sensory-specific satiety (SSS) and macronutrient intake in healthy human adults. In all, nineteen high sweet sensitivity (HS) and eleven low sweet sensitivity (LS) subjects were classified based on the sweetness perception of one solution (9 mm sucrose) forced-choice triangle test. All participants completed a randomised crossover design experiment where they consumed one of three iso-energetic soup preloads differing in primary taste quality (sweet, non-sweet taste-control or no-taste energy-control). A period of 1 h after the preload, participants were offered a buffet meal consisting of foods varying in taste (sweet or non-sweet) and fat content. Subjective measures included hunger/fullness and SSS for sweetness. Saliva and buccal cells were collected to measure leptin level and to study the TAS1R2/TAS1R3 specific SNP, respectively. Salivary leptin concentrations were significantly higher in LS than HS participants (P<0·05). In addition, HS showed stronger sweet SSS compared with LH participants (P<0·05), and consumed less carbohydrate (% energy) and more non-sweet foods than LS (P<0·01 and P<0·05, respectively). Alleles from each TAS1R2 locus (GG compared with AA alleles of rs12033832, and CT/CC compared with TT alleles of rs35874116) were related to higher consumption of carbohydrates (% energy) and higher amount of sweet foods, respectively (P<0·05). In contrast, no associations were found for the TAS1R3 alleles. These results contribute to understand the links between taste sensitivity, macronutrient appetite and food consumption.
Identification of the feature that causes the I-band secondary maximum of a Type Ia supernova
NASA Astrophysics Data System (ADS)
Jack, D.; Baron, E.; Hauschildt, P. H.
2015-06-01
We obtained a time series of spectra covering the secondary maximum in the I band of the bright Type Ia supernova 2014J in M82 with the TIGRE telescope. Comparing the observations with theoretical models calculated with the time dependent extension of the PHOENIX code, we identify the feature that causes the secondary maximum in the I-band light curve. Fe II 3d6(3D)4s-3d6(5D)4p and similar high-excitation transitions produce a blended feature at ˜7500 Å, which causes the rise of the light curve towards the secondary maximum. The series of observed spectra of SN 2014J and archival data of SN 2011fe confirm this conclusion. We further studied the plateau phase of the R-band light curve of SN 2014J and searched for features which contribute to the flux. The theoretical models do not clearly indicate a new feature that may cause the R-band plateau phase. However, Co II features in the range of 6500-7000 Å and the Fe II feature of the I band are clearly seen in the theoretical spectra, but do not appear to provide all of the flux necessary for the R-band plateau.
Wen, Miao; Jetter, Reinhard
2009-01-01
Arabidopsis wax components containing secondary functional groups were examined (i) to test the biosynthetic relationship between secondary alcohols and ketols and (ii) to determine the regiospecificity and substrate preference of the enzyme involved in ketol biosynthesis. The stem wax of Arabidopsis wild type contained homologous series of C27 to C31 secondary alcohols (2.4 μg cm−2) and C28 to C30 ketones (6.0 μg cm−2) dominated by C29 homologues. In addition, compound classes containing two secondary functional groups were identified as C29 diols (∼0.05 μg cm−2) and ketols (∼0.16 μg cm−2). All four compound classes showed characteristic isomer distributions, with functional groups located between C-14 and C-16. In the mah1 mutant stem wax, diols and ketols could not be detected, while the amounts of secondary alcohols and ketones were drastically reduced. In two MAH1-overexpressing lines, equal amounts of C29 and C31 secondary alcohols were detected. Based on the comparison of homologue and isomer compositions between the different genotypes, it can be concluded that biosynthetic pathways lead from alkanes to secondary alcohols, and via ketones or diols to ketols. It seems plausible that MAH1 is the hydroxylase enzyme involved in all these conversions in Arabidopsis thaliana. PMID:19346242
A Survey of Open Clusters in the u'g'r'i'z' Filter System. 3. Results for the Cluster NGC 188
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fornal, Bartosz; Tucker, Douglas L.; Smith, J.Allyn
2006-11-01
The authors continue the series of papers describing the results of a photometric survey of open star clusters, primarily in the southern hemisphere, taken in the u'g'r'i'z' filter system. The entire observed sample covered more than 100 clusters, but here they present data only on NGC 188, which is one of the oldest open clusters known in the Milky Way. They fit the Padova theoretical isochrones to the data. Assuming a solar metallicity for NGC 188, they find a distance of 1700 {+-} 100 pc, an age of 7.5 {+-} 0.7 Gyr, and a reddening E(B-V) of 0.025 {+-} 0.005.more » This yields a distance modulus of 11.23 {+-} 0.14.« less
NASA Astrophysics Data System (ADS)
Yan, Tianxiang; Han, Feifei; Ren, Shaokai; Ma, Xing; Fang, Liang; Liu, Laijun; Kuang, Xiaojun; Elouadi, Brahim
2018-04-01
(1 - x)K0.5Na0.5NbO3- x(Bi0.5Li0.5)ZrO3 (labeled as (1 - x)KNN- xBLZ) lead-free ceramics were fabricated by a solid-state reaction method. A research was conducted on the effects of BLZ content on structure, dielectric properties and relaxation behavior of KNN ceramics. By combining the X-ray diffraction patterns with the temperature dependence of dielectric properties, an orthorhombic-tetragonal phase coexistence was identified for x = 0.03, a tetragonal phase was determined for x = 0.05, and a single rhombohedral structure occurred at x = 0.08. The 0.92KNN-0.08BLZ ceramic exhibits a high and stable permittivity ( 1317, ± 15% variation) from 55 to 445 °C and low dielectric loss (≤ 6%) from 120 to 400 °C, which is hugely attractive for high-temperature capacitors. Activation energies of both high-temperature dielectric relaxation and dc conductivity first increase and then decline with the increase of BLZ, which might be attributed to the lattice distortion and concentration of oxygen vacancies.
Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong
2015-01-01
MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.
Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong
2015-01-01
MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5′- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions. PMID
Photometric, Spectroscopic, and X-ray Analysis of the Cool Algol BD+05 706
NASA Astrophysics Data System (ADS)
Torres, G.; Mader, J.; Marschall, L. A.; Neuhaeuser, R.; Duffy, A. S.
2000-12-01
BD+05 706 is an example of a rare class of a dozen or so interacting binaries called ``cool Algols", in which both components of the system are late-type stars. By contrast, the ``classical Algols" are systems in which the star transfering mass is of late spectral type, but the mass gainer is much hotter. BD+05 706 was shown previously to be eclipsing (Marschall, Torres & Neuhaeuser 1998, BAAS, 30, 835). In this paper we report our complete analysis of BVRI light curves for the system obtained at Gettysburg College Observatory, together with spectroscopy from the Harvard-Smithsonian Center for Astrophysics reported previously (Torres, Neuhaeuser & Wichmann 1998, AJ, 115, 2028), and X-ray observations obtained with the ROSAT satellite. Our light curve analysis indicates the presence of spots, most likely on the more massive, active component (primary), which change from season to season. Our results confirm the semi-detached nature of the system, and combined with the spectroscopy they have allowed us to obtain the most precise absolute masses and radii for any object of this class. Our X-ray light curve for BD+05 706 shows the primary eclipse clearly, but no sign of a secondary eclipse, confirming that the primary is the active star. Strong X-ray flares are also visible.
Hu, Xin; Zhu, Xiuqin; Gao, Lei
2014-01-01
To investigate the effectiveness of an intensive nursing care electronic followup system for cardiovascular risk management after percutaneous coronary intervention (PCI). In total, 840 subjects who underwent PCI in a single hospital in Beijing between January 2010 and January 2012 were enrolled. All subjects were randomized into the control and intensive nursing care groups (n = 420 each group). Both groups received standard secondary prevention according to guidelines. The control group received regular followup while the intensive nursing care group was closely monitored and followed by specific nursing staff with the electronic followup system. In total, 807 subjects were followed up for 1 year. Compared with subjects in the control group, those in the intensive group had decreased levels of total cholesterol (3.99 ± 1.08 vs 3.76 ± 0.98; P < .05), systolic blood pressure (142.41 ± 11.53 vs 135.71 ± 14.57 mm Hg; P < .05), low-density lipoprotein cholesterol (LDL-C) (2.72 ± 1.01 vs 2.42 ± 0.81; P < .05), and body mass index (25.13 ± 5.12 vs 24.23 ± 6.22; P < .05); a higher percentage with target LDL-C < 2.6 mmol/L (66.99% vs 47.88%; P < .05); increased use of medication including aspirin (96.51% vs 99.26%; P < .05), clopidogrel (87.53% vs 98.77%; P < .05), statins (52.62% vs 93.10%; P < .05), β-blockers (48.63% vs 61.33%; P < .05), and angiotensin-converting enzyme inhibitors (32.92% vs 61.82%; P < .05); and better dietary control and physical exercise (55.66% vs 26.18%, P < .05; 62.56% vs 38.65%, P < .05). Intensive nursing care by the electronic followup system may lead to an improvement in quality of secondary prevention after PCI, including risk factor control, the use of medication, and self-management abilities.
Characterization of FaDu-R, a radioresistant head and neck cancer cell line, and cancer stem cells.
Cho, Kwang-Jae; Park, Eun-Ji; Kim, Min-Sik; Joo, Young-Hoon
2018-06-01
The aim of this study was to evaluate the impact of CSC on insensitivity to radiotherapy in HNSCC. A radioresistant cell line, FaDu-R, was established using fractionated ionizing radiation. Cells with high and low CD44/ALDH activity were isolated. FaDu-R cells demonstrated significantly increased cell viability after radiation exposure compared with parental cells. CD44 high /ALDH high FaDu-R cells demonstrated significantly faster wound closure (p<0.05) and more efficient invasion (p<0.05) compared to the CD44 high /ALDH high FaDu cells or the CD44 low /ALDH low FaDu-R cells. There was a significant difference in tumor volume between the CD44 high /ALDH high FaDu-R cells and the CD44 high /ALDH high FaDu cells (p<0.05) as well as the CD44 low /ALDH low FaDu-R cells (p<0.05). Cancer stem cells (CSC) were associated with invasion and tumorigenesis in a radioresistant head and neck squamous cell carcinoma (HNSCC) cell line. This concept might help to improve the understanding of these mechanisms and to develop drugs that can overcome radioresistance during radiotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Ajeigbe, Taiwo Oluwafemi; Afolabi, Eyitayo Rufus Ifedayo
2017-01-01
This study assessed unidimensionality and occurrence of Differential Item Functioning (DIF) in Mathematics and English Language items of Osun State Qualifying Examination. The study made use of secondary data. The results showed that OSQ Mathematics (-0.094 = r = 0.236) and English Language items (-0.095 = r = 0.228) were unidimensional. Also,…
Gonzalez, Patrice; Labarère, Jacques
1998-01-01
A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The
Gonzalez, P; Labarère, J
1998-11-01
A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The
Use of secondary-treated wastewater for the production of Muriellopsis sp.
Gómez, C; Escudero, R; Morales, M M; Figueroa, F L; Fernández-Sevilla, J M; Acién, F G
2013-03-01
In this paper, the use of secondary-treated wastewater as the culture medium for the production of Muriellopsis sp. microalgal biomass is analyzed. Using this wastewater, a maximum biomass productivity of 0.5 g l(-1) day(-1) was measured, it being only 38 % lower than that achieved using the standard culture medium. Due to the low nitrogen content of secondary-treated wastewater, cultures produced in a medium containing a high percentage of it become nitrate-limited, thus the quantum yield reduces by up to 0.38 g E(-1)--this compares to 0.67 g E(-1) when using a standard culture medium. On the other hand, nitrate limitation enhances the accumulation of lipids and carbohydrates, with values measured at 33 and 66 % dry weight, respectively. It was also demonstrated that secondary-treated wastewater does not have any toxic effect on the growth of Muriellopsis sp. in spite of nitrogen being in the form of ammonium rather than in nitrate. Moreover, the secondary-treated wastewater was depurated when used to produce Muriellopsis sp., with the outlet biological oxygen demand and chemical oxygen demand being lower than at the inlet; the nitrate and phosphate concentrations were zero. Therefore, Muriellopsis sp. production using secondary-treated wastewater allows a reduction in the process cost by decreasing freshwater and fertilizer use, as well as by depurating the water, thus greatly enhancing process sustainability.
Progress on SOFIA primary mirror
NASA Astrophysics Data System (ADS)
Geyl, Roland; Tarreau, Michel
2000-06-01
REOSC, SAGEM Group, has a significant contribution to the SOFIA project with the design and fabrication of the 2.7-m primary mirror and its fixtures as well as the M3 mirror tower assembly. This paper will primarily report the progress made on the primary mirror design and the first important manufacturing step: its lightweighting by machining pockets from the rear side of the blank.
ERIC Educational Resources Information Center
Domingos-Grilo, Paula; Reis-Grilo, Carlos; Ruiz, Constantino; Mellado, Vicente
2012-01-01
We describe part of an action-research programme in Spain which was based on metacognitive reflection. The participants were four science teachers in a secondary school during the 2004-05 and 2005-06 academic years. During the study, they each analysed their own pupils' alternative ideas on photosynthesis and their teaching methods as recorded in…
Primary and secondary exercise dependence in a community-based sample of road race runners.
Cook, Brian; Karr, Trisha M; Zunker, Christie; Mitchell, James E; Thompson, Ron; Sherman, Roberta; Crosby, Ross D; Cao, Li; Erickson, Ann; Wonderlich, Stephen A
2013-10-01
The purpose of our study was to examine exercise dependence (EXD) in a large community-based sample of runners. The secondary purpose of this study was to examine differences in EXD symptoms between primary and secondary EXD. Our sample included 2660 runners recruited from a local road race (M age = 38.78 years, SD = 10.80; 66.39% women; 91.62% Caucasian) who completed all study measures online within 3 weeks of the race. In this study, EXD prevalence was lower than most previously reported rates (gamma = .248, p < .001) and individuals in the at-risk for EXD category participated in longer distance races, F(8,1) = 14.13, p = .01, partial eta squared = .05. Group differences were found for gender, F(1,1921) 8.08, p = .01, partial eta squared = .004, and primary or secondary group status, F(1,1921) 159.53, p = .01, partial eta squared = .077. Implications of primary and secondary EXD differences and future research are discussed.
Robert-Seilaniantz, Alexandre; MacLean, Dan; Jikumaru, Yusuke; Hill, Lionel; Yamaguchi, Shinjiro; Kamiya, Yuji; Jones, Jonathan D G
2011-07-01
flg22 treatment increases levels of miR393, a microRNA that targets auxin receptors. Over-expression of miR393 renders plants more resistant to biotroph pathogens and more susceptible to necrotroph pathogens. In contrast, over-expression of AFB1, an auxin receptor whose mRNA is partially resistant to miR393 degradation, renders the plant more susceptible to biotroph pathogens. Here we investigate the mechanism by which auxin signalling and miR393 influence plant defence. We show that auxin signalling represses SA levels and signalling. We also show that miR393 represses auxin signalling, preventing it from antagonizing SA signalling. In addition, over-expression of miR393 increases glucosinolate levels and decreases the levels of camalexin. Further studies on pathogen interactions in auxin signalling mutants revealed that ARF1 and ARF9 negatively regulate glucosinolate accumulation, and that ARF9 positively regulates camalexin accumulation. We propose that the action of miR393 on auxin signalling triggers two complementary responses. First, it prevents suppression of SA levels by auxin. Second, it stabilizes ARF1 and ARF9 in inactive complexes. As a result, the plant is able to mount a full SA response and to re-direct metabolic flow toward the most effective anti-microbial compounds for biotroph resistance. We propose that miR393 levels can fine-tune plant defences and prioritize resources. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.
Screening for secondary endocrine hypertension in young patients.
Trifanescu, Raluca; Carsote, Mara; Caragheorgheopol, Andra; Hortopan, Dan; Dumitrascu, Anda; Dobrescu, Mariana; Poiana, Catalina
2013-06-01
Secondary endocrine hypertension accounts for 5-12% of hypertension's causes. In selected patients (type 2 diabetes mellitus, sleep apnea syndrome with resistant hypertension, sudden deterioration in hypertension control), prevalence could be higher. To present etiology of endocrine secondary hypertension in a series of patients younger than 40 years at hypertension's onset. Medical records of 80 patients (39M/41F), aged 30.1 ± 8.2 years (range: 12-40 years), with maximum systolic blood pressure=190.4 ± 29.2 mm Hg, range: 145-300 mm Hg, maximum diastolic blood pressure=107.7 ± 16.9 mm Hg, range: 80-170 mm Hg) referred by cardiologists for endocrine hypertension screening were retrospectively reviewed. Cardiac and renal causes of secondary hypertension were previously excluded. In all patients, plasma catecholamines were measured by ELISA and plasma cortisol by immunochemiluminescence. Orthostatic aldosterone (ELISA) and direct renin (chemiluminescence) were measured in 48 patients. Secondary endocrine hypertension was confirmed in 16 out of 80 patients (20%). Primary hyperaldosteronism was diagnosed in 7 (4M/3F) out of 48 screened patients (14.6%). i.e. 8.75% from whole group: 5 patients with adrenal tumors (3 left/2 right), 2 patients with bilateral adrenal hyperplasia; all patients were hypokalemic at diagnostic (average nadir K+ levels = 2.5 ± 0.5 mmol/L); four patients were hypokalaemic on diuretic therapy (indapamidum); other 3 patients were hypokalaemic in the absence of diuretic therapy. Cushing's syndrome was diagnosed in 6 patients (7.5%): subclinical Cushing due to 4 cm right adrenal tumour - n = 1, overt ACTH-independent Cushing's syndrome due to: macronodular adrenal hyperplasia associated with primary hyperparathyroidism - n = 1; due to adrenal carcinoma - n = 1; due to adrenal adenomas - n = 2; Cushing's disease - n = 1). Pheochromocytomas were diagnosed in 3 patients (3.75%). Primary hyperaldosteronism was the most frequent cause of secondary
Rtools: a web server for various secondary structural analyses on single RNA sequences.
Hamada, Michiaki; Ono, Yukiteru; Kiryu, Hisanori; Sato, Kengo; Kato, Yuki; Fukunaga, Tsukasa; Mori, Ryota; Asai, Kiyoshi
2016-07-08
The secondary structures, as well as the nucleotide sequences, are the important features of RNA molecules to characterize their functions. According to the thermodynamic model, however, the probability of any secondary structure is very small. As a consequence, any tool to predict the secondary structures of RNAs has limited accuracy. On the other hand, there are a few tools to compensate the imperfect predictions by calculating and visualizing the secondary structural information from RNA sequences. It is desirable to obtain the rich information from those tools through a friendly interface. We implemented a web server of the tools to predict secondary structures and to calculate various structural features based on the energy models of secondary structures. By just giving an RNA sequence to the web server, the user can get the different types of solutions of the secondary structures, the marginal probabilities such as base-paring probabilities, loop probabilities and accessibilities of the local bases, the energy changes by arbitrary base mutations as well as the measures for validations of the predicted secondary structures. The web server is available at http://rtools.cbrc.jp, which integrates software tools, CentroidFold, CentroidHomfold, IPKnot, CapR, Raccess, Rchange and RintD. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Species specificity of symbiosis and secondary metabolism in ascidians.
Tianero, Ma Diarey B; Kwan, Jason C; Wyche, Thomas P; Presson, Angela P; Koch, Michael; Barrows, Louis R; Bugni, Tim S; Schmidt, Eric W
2015-03-01
Ascidians contain abundant, diverse secondary metabolites, which are thought to serve a defensive role and which have been applied to drug discovery. It is known that bacteria in symbiosis with ascidians produce several of these metabolites, but very little is known about factors governing these 'chemical symbioses'. To examine this phenomenon across a wide geographical and species scale, we performed bacterial and chemical analyses of 32 different ascidians, mostly from the didemnid family from Florida, Southern California and a broad expanse of the tropical Pacific Ocean. Bacterial diversity analysis showed that ascidian microbiomes are highly diverse, and this diversity does not correlate with geographical location or latitude. Within a subset of species, ascidian microbiomes are also stable over time (R=-0.037, P-value=0.499). Ascidian microbiomes and metabolomes contain species-specific and location-specific components. Location-specific bacteria are found in low abundance in the ascidians and mostly represent strains that are widespread. Location-specific metabolites consist largely of lipids, which may reflect differences in water temperature. By contrast, species-specific bacteria are mostly abundant sequenced components of the microbiomes and include secondary metabolite producers as major components. Species-specific chemicals are dominated by secondary metabolites. Together with previous analyses that focused on single ascidian species or symbiont type, these results reveal fundamental properties of secondary metabolic symbiosis. Different ascidian species have established associations with many different bacterial symbionts, including those known to produce toxic chemicals. This implies a strong selection for this property and the independent origin of secondary metabolite-based associations in different ascidian species. The analysis here streamlines the connection of secondary metabolite to producing bacterium, enabling further biological and
Torres, A; Chagas e Silva, J; Deloche, M C; Humblot, P; Horta, A E M; Lopes-da-Costa, L
2013-08-01
Using a novel in vivo model considering a low developmental competence embryo (demi-embryo) and a subnormal fertility recipient (lactating high-yielding dairy cow), this experiment evaluated the effect of human chorionic gonadotrophin (hCG) treatment at embryo transfer (ET) on embryonic size at implantation, embryonic survival and recipient plasma progesterone (P4 ) and bovine pregnancy-specific protein B (PSPB) concentrations until day 63 of pregnancy. Embryos were bisected and each pair of demi-embryos was bilaterally transferred to recipients (n = 61) on day 7 of the oestrous cycle. At ET recipients were randomly assigned to treatment with 1500 IU hCG or to untreated controls. Higher (p < 0.01) pregnancy rates on days 25, 42 and 63, and embryo survival rate on day 63 were observed in hCG-treated cows with secondary CL than in hCG-treated cows without secondary CL and in untreated cows. Pregnancy rates and embryo survival rate were similar in hCG-treated cows without secondary CL and untreated cows. Embryonic size on day 42 was not affected by treatment with hCG, presence of secondary CL and type of pregnancy (single vs twin). Presence of secondary CL increased (p < 0.05) plasma P4 concentrations of pregnant cows on days 14, 19 and 25 but not thereafter and of non-pregnant cows on days 14-21. Treatment with hCG and presence of secondary CL had no effect on plasma PSPB concentrations, which were higher (p < 0.05) in twin than in single pregnancies. In conclusion, secondary CL induced by hCG treatment at ET significantly increased plasma P4 concentrations, the survival rate of demi-embryos and the pregnancy rate of high-yielding lactating dairy cows. Embryos were rescued beyond maternal recognition of pregnancy, but later embryonic survival, growth until implantation and placental PSPB secretion until day 63 of pregnancy were not affected by treatment or presence of secondary CL. © 2013 Blackwell Verlag GmbH.
Incorporation of zinc in MOCVD growth of Ga 0.5In 0.5P
NASA Astrophysics Data System (ADS)
Kurtz, Sarah R.; Olson, J. M.; Kibbler, A. E.; Bertness, K. A.
1992-11-01
Data are presented for the Zn doping of Ga 0.5In 0.5P, showing that the hole and zinc concentrations increase almost linearly with zinc flow, and also increase with the V/III ratio and with growth rate at a fixed V/III ratio. These observations are consistent with other reports that show the incorporation of zinc to increase with V/III ratio for both GaAs and Ga 0.5In 0.5P deposition by metalorganic chemical vapor deposition (MOCVD). The growth-rate dependence of the zinc incorporation in Ga 0.5In 0.5P has not previously been reported. A model based on varying group V coverage of the step where zinc is most strongly bound is presented and compared with the data. The model predicts that the zinc incorporation increases with increasing phosphorus overpressure, but should be independent of group III overpressure in the parameter space investigated here.
Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite
NASA Astrophysics Data System (ADS)
Yu, Wen; Fang, Pengfei; Wang, Shaojie
2014-12-01
Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.
Approaches to R education in Canadian universities
Carson, Michael A.; Basiliko, Nathan
2016-01-01
Introduction: R language is a powerful tool used in a wide array of research disciplines and owes a large amount of its success to its open source and adaptable nature. The popularity of R has grown rapidly over the past two decades and the number of users and packages is increasing at a near exponential rate. This rapid growth has prompted a number of formal and informal online and text resources, the volume of which is beginning to present challenges to novices learning R. Students are often first exposed to R in upper division undergraduate classes or during their graduate studies. The way R is presented likely has consequences for the fundamental understanding of the program and language itself; user comprehension of R may be better if learning the language itself followed by conducting analyses, compared to someone who is learning another subject (e.g. statistics) using R for the first time. Consequently, an understanding of the approaches to R education is critical. Methods: To establish how students are exposed to R, we used a survey to evaluate the current use in Canadian university courses, including the context in which R is presented and the types of uses of R in the classroom. Additionally, we looked at the reasons professors either do or don’t use/teach R. Results: We found that R is used in a broad range of course disciplines beyond statistics (e.g. ecology) and just over one half of Canadian universities have at least one course that uses R. Discussion and Conclusions: Developing programming-literate students is of utmost importance and our hope is that this benchmark study will influence how post-secondary educators, as well as other programmers, approach R, specifically when developing educational and supplemental content in online, text, and package-specific formats aiding in student’s comprehension of the R language. PMID:28003881
Approaches to R education in Canadian universities.
Carson, Michael A; Basiliko, Nathan
2016-01-01
Introduction: R language is a powerful tool used in a wide array of research disciplines and owes a large amount of its success to its open source and adaptable nature. The popularity of R has grown rapidly over the past two decades and the number of users and packages is increasing at a near exponential rate. This rapid growth has prompted a number of formal and informal online and text resources, the volume of which is beginning to present challenges to novices learning R. Students are often first exposed to R in upper division undergraduate classes or during their graduate studies. The way R is presented likely has consequences for the fundamental understanding of the program and language itself; user comprehension of R may be better if learning the language itself followed by conducting analyses, compared to someone who is learning another subject (e.g. statistics) using R for the first time. Consequently, an understanding of the approaches to R education is critical. Methods: To establish how students are exposed to R, we used a survey to evaluate the current use in Canadian university courses, including the context in which R is presented and the types of uses of R in the classroom. Additionally, we looked at the reasons professors either do or don't use/teach R. Results: We found that R is used in a broad range of course disciplines beyond statistics (e.g. ecology) and just over one half of Canadian universities have at least one course that uses R. Discussion and Conclusions: Developing programming-literate students is of utmost importance and our hope is that this benchmark study will influence how post-secondary educators, as well as other programmers, approach R, specifically when developing educational and supplemental content in online, text, and package-specific formats aiding in student's comprehension of the R language.
Vinale, F; Marra, R; Scala, F; Ghisalberti, E L; Lorito, M; Sivasithamparam, K
2006-08-01
Trichoderma harzianum strains T22 and T39 are two micro-organisms used as active agents in a variety of commercial biopesticides and biofertilizers and widely applied amongst field and greenhouse crops. The production, isolation, biological and chemical characterization of the main secondary metabolites produced by these strains are investigated. Of the three major compounds produced by strain T22, one is a new azaphilone that shows marked in vitro inhibition of Rhizoctonia solani, Pythium ultimum and Gaeumannomyces graminis var. tritici. In turn, filtrates from strain T39 were demonstrated to contain two compounds previously isolated from other T. harzianum strains and a new butenolide. The production of the isolated metabolites was also monitored by liquid chromatography/mass spectrometry during in vitro interaction with R. solani. This paper reports the isolation and characterization of the main secondary metabolites obtained from culture filtrates of two T. harzianum strains and their production during antagonistic interaction with the pathogen R. solani. This is the first work on secondary metabolites produced by the commercially applied strains T22 and T39. Our results provide a better understanding of the metabolism of these fungi, which are both widely used as biopesticides and/or biofertilizers in biocontrol.
Gómez-Rodríguez, Elida Yazmín; Uresti-Rivera, Edith Elena; Patrón-Soberano, Olga Araceli; Islas-Osuna, María Auxiliadora; Flores-Martínez, Alberto; Riego-Ruiz, Lina; Rosales-Saavedra, María Teresa; Casas-Flores, Sergio
2018-01-01
Some filamentous fungi of the Trichoderma genus are used as biocontrol agents against airborne and soilborne phytopathogens. The proposed mechanism by which Trichoderma spp. antagonizes phytopathogens is through the release of lytic enzymes, antimicrobial compounds, mycoparasitism, and the induction of systemic disease-resistance in plants. Here we analyzed the role of TGF-1 (Trichoderma Gcn Five-1), a histone acetyltransferase of Trichoderma atroviride, in mycoparasitism and antibiosis against the phytopathogen Rhizoctonia solani. Trichostatin A (TSA), a histone deacetylase inhibitor that promotes histone acetylation, slightly affected T. atroviride and R. solani growth, but not the growth of the mycoparasite over R. solani. Application of TSA to the liquid medium induced synthesis of antimicrobial compounds. Expression analysis of the mycoparasitism-related genes ech-42 and prb-1, which encode an endochitinase and a proteinase, as well as the secondary metabolism-related genes pbs-1 and tps-1, which encode a peptaibol synthetase and a terpene synthase, respectively, showed that they were regulated by TSA. A T. atroviride strain harboring a deletion of tgf-1 gene showed slow growth, thinner and less branched hyphae than the wild-type strain, whereas its ability to coil around the R. solani hyphae was not affected. Δtgf-1 presented a diminished capacity to grow over R. solani, but the ability of its mycelium -free culture filtrates (MFCF) to inhibit the phytopathogen growth was enhanced. Intriguingly, addition of TSA to the culture medium reverted the enhanced inhibition growth of Δtgf-1 MFCF on R. solani at levels compared to the wild-type MFCF grown in medium amended with TSA. The presence of R. solani mycelium in the culture medium induced similar proteinase activity in a Δtgf-1 compared to the wild-type, whereas the chitinolytic activity was higher in a Δtgf-1 mutant in the absence of R. solani, compared to the parental strain. Expression of mycoparasitism
Patrón-Soberano, Olga Araceli; Islas-Osuna, María Auxiliadora; Flores-Martínez, Alberto; Riego-Ruiz, Lina; Rosales-Saavedra, María Teresa
2018-01-01
Some filamentous fungi of the Trichoderma genus are used as biocontrol agents against airborne and soilborne phytopathogens. The proposed mechanism by which Trichoderma spp. antagonizes phytopathogens is through the release of lytic enzymes, antimicrobial compounds, mycoparasitism, and the induction of systemic disease-resistance in plants. Here we analyzed the role of TGF-1 (Trichoderma Gcn Five-1), a histone acetyltransferase of Trichoderma atroviride, in mycoparasitism and antibiosis against the phytopathogen Rhizoctonia solani. Trichostatin A (TSA), a histone deacetylase inhibitor that promotes histone acetylation, slightly affected T. atroviride and R. solani growth, but not the growth of the mycoparasite over R. solani. Application of TSA to the liquid medium induced synthesis of antimicrobial compounds. Expression analysis of the mycoparasitism-related genes ech-42 and prb-1, which encode an endochitinase and a proteinase, as well as the secondary metabolism-related genes pbs-1 and tps-1, which encode a peptaibol synthetase and a terpene synthase, respectively, showed that they were regulated by TSA. A T. atroviride strain harboring a deletion of tgf-1 gene showed slow growth, thinner and less branched hyphae than the wild-type strain, whereas its ability to coil around the R. solani hyphae was not affected. Δtgf-1 presented a diminished capacity to grow over R. solani, but the ability of its mycelium -free culture filtrates (MFCF) to inhibit the phytopathogen growth was enhanced. Intriguingly, addition of TSA to the culture medium reverted the enhanced inhibition growth of Δtgf-1 MFCF on R. solani at levels compared to the wild-type MFCF grown in medium amended with TSA. The presence of R. solani mycelium in the culture medium induced similar proteinase activity in a Δtgf-1 compared to the wild-type, whereas the chitinolytic activity was higher in a Δtgf-1 mutant in the absence of R. solani, compared to the parental strain. Expression of mycoparasitism
Concept of Operations for Deploying a Lander on the Secondary Body of Binary Asteroid 1996 FG3
NASA Astrophysics Data System (ADS)
Tardivel, Simon; Michel, P.; Scheeres, D.
2012-10-01
The European Space Agency is currently performing an assessment study of the MarcoPolo-R space mission, in the framework of the M3 class competition of its Cosmic Vision Program. MarcoPolo-R is a sample return mission to a primitive asteroid, whose baseline target is the binary asteroid 1996FG3. The baseline mission, including the sample, is focused on the primary of the binary system. To date, little has yet been considered for the investigation of the secondary, apart from remote observations from the spacecraft. However, MarcoPolo-R may carry an optional lander, and if such a lander could be accommodated it may be relevant to use it for a more detailed investigation of the secondary. This poster presents a strategy for deploying a lander using an unpowered trajectory towards the secondary. This ballistic deployment allows for the design of a light lander with minimum platform overhead and maximum payload. The deployment operations are shown to be very simple and require minimum preparation. The main spacecraft is set on an orbit that reaches a specific point near the binary system L2 Lagrange Point facing the far side of the secondary, about 220 meters from the secondary surface, with a relative speed of about 10cm/s. The lander is then jettisoned using a spring-release mechanism that sets it on an impact trajectory that robustly intersects with the secondary surface. On impact, the lander only needs to dissipate a small amount of kinetic energy in order to ensure that it is energetically and dynamically trapped on the surface. Considering errors on spacecraft GNC and on the spring-release mechanism, and very large uncertainties on the gravity field of the asteroids, the strategy presented here yields a successful landing in more than 99.9% of cases, while ensuring the absolute safety of the spacecraft before, during and after deployment operations.
NASA Astrophysics Data System (ADS)
Zhang, Haiwu; Chen, Chao; Zhao, Xiangyong; Deng, Hao; Li, Long; Lin, Di; Li, Xiaobing; Ren, Bo; Luo, Haosu; Yan, Jun
2013-11-01
Bi deficient, Mn doped 0.92(Na0.5Bi0.5)TiO3-0.08(K0.5Bi0.5)TiO3 single crystals were grown by carefully controlled top-seeded solution growth method. Local structures were investigated by transmission electron microscopy. The site occupation and valence state of manganese were characterized by electron paramagnetic resonance spectrum. The leakage current density in the as-grown single crystals is effectively depressed. The introduced defect complexes suppress the temperature induced phase transformation, increasing the depolarization temperature (165 °C) and thermal stability of ferroelectric properties.
Wong, Kah Keng; Ch'ng, Ewe Seng; Loo, Suet Kee; Husin, Azlan; Muruzabal, María Arestin; Møller, Michael B; Pedersen, Lars M; Pomposo, María Puente; Gaafar, Ayman; Banham, Alison H; Green, Tina M; Lawrie, Charles H
2015-12-01
Huntingtin-interacting protein 1-related (HIP1R) is an endocytic protein involved in receptor trafficking, including regulating cell surface expression of receptor tyrosine kinases. We have previously shown that low HIP1R protein expression was associated with poorer survival in diffuse large B-cell lymphoma (DLBCL) patients from Denmark treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, prednisone). In this multicenter study, we extend these findings and validate the prognostic and subtyping utility of HIP1R expression at both transcript and protein level. Using data mining on three independent transcriptomic datasets of DLBCL, HIP1R transcript was preferentially expressed in germinal center B-cell (GCB)-like DLBCL subtype (P<0.01 in all three datasets), and lower expression was correlated with worse overall survival (OS; P<0.01) and progression-free survival (PFS; P<0.05) in a microarray-profiled DLBCL dataset. At the protein level examined by immunohistochemistry, HIP1R expression at 30% cut-off was associated with GCB-DLBCL molecular subtype (P=0.0004; n=42), and predictive of OS (P=0.0006) and PFS (P=0.0230) in de novo DLBCL patients treated with R-CHOP (n=73). Cases with high FOXP1 and low HIP1R expression frequency (FOXP1(hi)/HIP1R(lo) phenotype) exhibited poorer OS (P=0.0038) and PFS (P=0.0134). Multivariate analysis showed that HIP1R<30% or FOXP1(hi)/HIP1R(lo) subgroup of patients exhibited inferior OS and PFS (P<0.05) independently of the International Prognostic Index. We conclude that HIP1R expression is strongly indicative of survival when utilized on its own or in combination with FOXP1, and the molecule is potentially applicable for subtyping of DLBCL cases. Copyright © 2015 Elsevier Inc. All rights reserved.
Díaz-Beyá, M; Brunet, S; Nomdedéu, J; Cordeiro, A; Tormo, M; Escoda, L; Ribera, J M; Arnan, M; Heras, I; Gallardo, D; Bargay, J; Queipo de Llano, M P; Salamero, O; Martí, J M; Sampol, A; Pedro, C; Hoyos, M; Pratcorona, M; Castellano, J J; Nomdedeu, M; Risueño, R M; Sierra, J; Monzó, M; Navarro, A; Esteve, J
2015-01-01
Acute myeloid leukemia (AML) is a heterogeneous disease whose prognosis is mainly related to the biological risk conferred by cytogenetics and molecular profiling. In elderly patients (⩾60 years) with normal karyotype AML miR-3151 have been identified as a prognostic factor. However, miR-3151 prognostic value has not been examined in younger AML patients. In the present work, we have studied miR-3151 alone and in combination with BAALC, its host gene, in a cohort of 181 younger intermediate-risk AML (IR-AML) patients. Patients with higher expression of miR-3151 had shorter overall survival (P=0.0025), shorter leukemia-free survival (P=0.026) and higher cumulative incidence of relapse (P=0.082). Moreover, in the multivariate analysis miR-3151 emerged as independent prognostic marker in both the overall series and within the unfavorable molecular prognostic category. Interestingly, the combined determination of both miR-3151 and BAALC improved this prognostic stratification, with patients with low levels of both parameters showing a better outcome compared with those patients harboring increased levels of one or both markers (P=0.003). In addition, we studied the microRNA expression profile associated with miR-3151 identifying a six-microRNA signature. In conclusion, the analysis of miR-3151 and BAALC expression may well contribute to an improved prognostic stratification of younger patients with IR-AML. PMID:26430723
Loganathan, Gopalakrishnan; Subhashree, Venugopal; Breite, Andrew G; Tucker, William W; Narayanan, Siddharth; Dhanasekaran, Maheswaran; Mokshagundam, SriPrakash; Green, Michael L; Hughes, Michael G; Williams, Stuart K; Dwulet, Francis E; McCarthy, Robert C; Balamurugan, Appakalai N
2018-02-01
A high number of human islets can be isolated by using modern purified tissue dissociation enzymes; however, this requires the use of >20 Wunsch units (WU)/g of pancreas for digestion. Attempts to reduce this dose have resulted in pancreas underdigestion and poor islet recovery but improved islet function. In this study, we achieved a high number of functional islets using a low dose of recombinant collagenase enzyme mixture (RCEM-1200 WU rC2 and 10 million collagen-degrading activity [CDA] U of rC1 containing about 209 mg of collagenase to digest a 100-g pancreas). The collagenase dose used in these isolations is about 42% of the natural collagenase enzyme mixture (NCEM) dose commonly used to digest a 100-g pancreas. Low-dose RCEM was efficient in digesting entire pancreases to obtain higher yield (5535 ± 830 and 2582 ± 925 islet equivalent/g, P < .05) and less undigested tissue (16.7 ± 5% and 37.8 ± 3%, P < .05) compared with low-dose NCEM (12WU/g). Additionally, low-dose RCEM islets retained better morphology (confirmed with scanning electron microscopy) and higher in vitro basal insulin release (2391 ± 1342 and 1778 ± 978 μU/mL; P < .05) compared with standard-dose NCEM. Nude mouse bioassay demonstrated better islet function for low-dose RCEM (area under the curve [AUC] 24 968) compared with low-dose (AUC-38 225) or standard-dose NCEM (AUC-38 685), P < .05. This is the first report indicating that islet function can be improved by using low-dose rC1rC2 (RCEM). © 2017 The American Society of Transplantation and the American Society of Transplant Surgeons.
NASA Astrophysics Data System (ADS)
Hao, Jigong; Ye, Chenggen; Shen, Bo; Zhai, Jiwei
2013-08-01
Textured 0.92(Bi0.5Na0.5)TiO3-0.06BaTiO3-0.02(K0.5Na0.5)NbO3 (BNT-BT-KNN) ceramics have been produced by tape casting with pure-phase (Bi0.5Na0.5)TiO3 templates. Through the approach of texture construction, enhanced electrostrictive response was obtained with an electrostrictive coefficient Q33 (˜0.024 m4/C2 at 60 kV/cm) and good thermostability comparable with that of traditional Pb-based electrostrictors. Even at an electric-field as low as 35 kV/cm or at a temperature as high as 180 °C, samples still possess a large electrostrictive response with Q33 > 0.022 m4/C2, suggesting it is very promising for practical applications as a lead-free electrostrictive material owning to its wide usage range. Moreover, reducing the applied electric-filed or increasing temperature can both induce the predominant to pure electrostriction transition due to the little contributions of electrostriction strain from ferroelectric domain switching. Our work may provide a new recipe for designing high-performance BNT-based lead-free electrostrictive materials by means of texture construction.
Zheng, Yao; Wu, Wei; Hu, Gengdong; Zhao, Zhixiang; Meng, Shunlong; Fan, Limin; Song, Chao; Qiu, Liping; Chen, Jiazhang
2018-01-01
The GIFT (Genetically Improved Farmed Tilapia) tilapia, Oreochromis niloticus, is cultured widely for the production of freshwater fish in China. Streptococcosis, which is related to pathogenic infections, occurs frequently in juvenile and adult female GIFT individuals. Resveratrol (RES) has been used in feed to control these infections in freshwater tilapia. To address the effects of RES on tilapia, we used high-throughput RNA sequencing technology (RNA-Seq, HiSeq. 2500) to explore the global transcriptomic response and specific involvement of hepatic mRNA of juvenile O. niloticus fed with diets containing different concentrations of (0, 0.025, 0.05, and 0.1g/kg) RES. A total of > 24,513,018 clean reads were generated and then assembled into 23,244 unigenes. The unigenes were annotated by comparing them against non-redundant protein sequence (Nr), non-redundant nucleotide (Nt), Swiss-Prot, Pfam, Gene Ontology database (GO), Clusters of Orthologous Groups (COG) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, and 12,578 unigenes were annotated to the GO database. A total of 1444 (0.025g/kg RES), 1526 (0.05g/kg RES), and 3135 (0.1g/kg RES) genes were detected as significant differentially expressed genes (DEGs), when compared with the controls. A total of 6 (0.025 vs 0.05g/kg RES), 19 (0.025 vs 0.1g/kg RES), and 124 (0.05 vs 0.1g/kg RES) genes were detected as significant DEGs. Six genes, including dnah7x1, sox4, fam46a, hsp90a, ddit4, and nmrk2, were associated with an immune response. These findings provide information on the innate immunity of GIFT and might contribute to the development of strategies for the effective management of diseases and long-term sustainability of O. niloticus culture. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Wu, Zhengcui; Wu, Yaqin; Pei, Tonghui; Wang, Huan; Geng, Baoyou
2014-02-01
Novel hierarchical heteronanostructures of ZnO nanorods/ZnS.(HDA)0.5 (HDA = 1,6-hexanediamine) hybrid nanoplates on a zinc substrate are successfully synthesized on a large scale by combining hydrothermal growth (for ZnO nanorods) and liquid chemical conversion (for ZnS.(HDA)0.5 nanoplates) techniques. The formation of ZnS.(HDA)0.5 hybrid nanoplates branches takes advantage of the preferential binding of 1,6-hexanediamine on specific facets of ZnS, which makes the thickening rate much lower than the lateral growth rate. The ZnS.(HDA)0.5 hybrid nanoplates have a layered structure with 1,6-hexanediamine inserted into interlayers of wurtzite ZnS through the bonding of nitrogen. The number density and thickness of the secondary ZnS.(HDA)0.5 nanoplates can be conveniently engineered by variation of the sulfur source and straightforward adjustment of reactant concentrations such as 1,6-hexanediamine and the sulfur source. The fabricated ZnO/ZnS.(HDA)0.5 heteronanostructures show improved electrochemical catalytic properties for hydrazine compared with the primary ZnO nanorods. Due to its simplicity and efficiency, this approach could be similarly used to fabricate varieties of hybrid heterostructures made of materials with an intrinsic large lattice mismatch.Novel hierarchical heteronanostructures of ZnO nanorods/ZnS.(HDA)0.5 (HDA = 1,6-hexanediamine) hybrid nanoplates on a zinc substrate are successfully synthesized on a large scale by combining hydrothermal growth (for ZnO nanorods) and liquid chemical conversion (for ZnS.(HDA)0.5 nanoplates) techniques. The formation of ZnS.(HDA)0.5 hybrid nanoplates branches takes advantage of the preferential binding of 1,6-hexanediamine on specific facets of ZnS, which makes the thickening rate much lower than the lateral growth rate. The ZnS.(HDA)0.5 hybrid nanoplates have a layered structure with 1,6-hexanediamine inserted into interlayers of wurtzite ZnS through the bonding of nitrogen. The number density and thickness of the
322-R2U2 Engineering Assessment - August 2015
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abri, M.; Griffin, D.
This Engineering Assessment and Certification of Integrity of retention tank system 322-R2 has been prepared for tank systems that store and neutralizes hazardous waste and have secondary containment. The regulations require that this assessment be completed periodically and certified by an independent, qualified, California-registered professional engineer. Abri Environmental Engineering performed an inspection of the 322-R2 Tank system at the Lawrence Livermore National Laboratory (LLNL) in Livermore, CA. Mr. William W. Moore, P.E., conducted this inspection on March 16, 2015. Mr. Moore is a California Registered Civil Engineer, with extensive experience in civil engineering, and hazardous waste management.
Morini, Gabriella; Bassoli, Angela; Temussi, Piero A
2005-08-25
The sweet taste receptor, a heterodimeric G protein coupled receptor (GPCR) protein, formed by the T1R2 and T1R3 subunits, recognizes several sweet compounds including carbohydrates, amino acids, peptides, proteins, and synthetic sweeteners. Its similarity with the metabotropic glutamate mGluR1 receptor allowed us to build homology models. All possible dimers formed by combinations of the human T1R2 and T1R3 subunits, modeled on the A (closed) or B (open) chains of the extracellular ligand binding domain of the mGluR1 template, yield four ligand binding sites for low-molecular-weight sweeteners. These sites were probed by docking a set of molecules representative of all classes of sweet compounds and calculating the free energy of ligand binding. These sites are not easily accessible to sweet proteins, but docking experiments in silico showed that sweet proteins can bind to a secondary site without entering the deep cleft. Our models account for many experimental observations on the tastes of sweeteners, including sweetness synergy, and can help to design new sweeteners.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-20
... DEPARTMENT OF EDUCATION [Docket No.: ED-2013-ICCD-0025] Agency Information Collection Activities... Elementary and Secondary Education (OESE), Department of Education (ED). ACTION: Notice. SUMMARY: In... Director of the Information Collection Clearance Division, U.S. Department of Education, 400 Maryland...
Modeling of reduced effective secondary electron emission yield from a velvet surface
Swanson, Charles; Kaganovich, Igor D.
2016-12-05
Complex structures on a material surface can significantly reduce total secondary electron emission from that surface. A velvet is a surface that consists of an array of vertically standing whiskers. The reduction occurs due to the capture of low-energy, true secondary electrons emitted at the bottom of the structure and on the sides of the velvet whiskers. We performed numerical simulations and developed an approximate analytical model that calculates the net secondary electron emission yield from a velvet surface as a function of the velvet whisker length and packing density, and the angle of incidence of primary electrons. We foundmore » that to suppress secondary electrons, the following condition on dimensionless parameters must be met: (π/2) DΑ tan θ >> 1, where theta is the angle of incidence of the primary electron from the normal, D is the fraction of surface area taken up by the velvet whisker bases, and A is the aspect ratio, A = h/r, the ratio of height to radius of the velvet whiskers. We find that velvets available today can reduce the secondary electron yield by 90% from the value of a flat surface. As a result, the values of optimal velvet whisker packing density that maximally suppresses the secondary electron emission yield are determined as a function of velvet aspect ratio and the electron angle of incidence.« less
Yu, Yang; Sun, Xiaolin; Guan, Xiaozhen; Zhang, Xiaojuan; Ma, Chunya; Chen, Linfeng; Wang, Deqing
2014-06-01
To evaluate the effects of hydroformylation treatment on the storage time and blood group antigen expressions of reagent red blood cells (RBCs). RBCs from healthy donors were treated by using various final concentrations of paraformaldehyde (0.01%, 0.02%, 0.05%, 0.1%, 0.2%, 0.5% and 1.0%) and glutaraldehyde (0.01%, 0.025%, 0.05%, 0.1%, 0.2%, 0.5% and 1.0%), and one aliquot was used as control (untreated with aldehydes). Supernatant free hemoglobin (FHb) levels in all groups stored at 4 °C were detected every week, and the optimal procedure was selected. Expression of blood group antigens on RBCs treated by the optimal procedure was determined, and the total scores of blood group antigens were calculated. 0.2%, 0.5% and 1.0% Glutaraldehyde groups were ruled out directly due to serious crosslinking and aggregation of RBCs. As the extension of time, FHb levels in other 11 groups gradually increased (p<0.01 or p<0.05). FHb level in 0.025% glutaraldehyde group was significantly lower than that in other groups after 13 weeks (p<0.01), and the antigen strength of Fy(b), Jk(b), and Le(b) decreased slightly compared with those before treatment and storage (p<0.05), and there was no significant change for antigen strength of A, B, D, C, E, c, e, M, N, S, s, k, P1, Fy(a), Jk(a), and Le(a) (p>0.05). 0.025% Glutaraldehyde treatment can provide optimal protection for the membrane of RBCs and keep hemolysis at a low level after 13 weeks storage, and the majority of blood group antigen systems are not significantly affected, and the slight decline of Fy(b), Jk(b), and Le(b) antigen strength was acceptable for classical serological tests. Copyright © 2014 Elsevier Ltd. All rights reserved.
Religion, coping and outcome in out-patients with depression or diabetes mellitus.
Amadi, K U; Uwakwe, R; Odinka, P C; Ndukuba, A C; Muomah, C R; Ohaeri, J U
2016-06-01
The study assesses the association between religiosity and coping style with the outcome of depression and diabetes. Using a simple random sampling, we recruited 112 participants with diabetes and an equal number with depression consecutively, matching for gender. Religiosity was determined using Religious Orientation Scale (revised) (ROS-R), coping styles with Brief Religious Coping (Brief RCOPE) scale and Mental Adjustment to Cancer (MAC) scale (adapted). Primary and secondary outcomes were evaluated using Sheehan's Disability Scale (SDS) and Becks Depression Inventory-II (BDI-II) respectively. Among participants with diabetes, BDI-II total scores correlated negatively with ROS-R Extrinsic Social (r = -0.2, P < 0.05) and Fighting Spirit (r = -0.3, P < 0.05) but correlated positively with Helplessness/Hopelessness (r = 0.3, P < 0.05) and Brief RCOPE Negative (r = 0.4, P < 0.05). SDS global scores correlated positively with Helplessness/Hopelessness (r = 0.3, P < 0.05) and Brief RCOPE Negative (r = 0.4, P < 0.05). Among participants with depression, BDI-II total scores correlated negatively with Intrinsic religiosity (r = -0.2, P < 0.05) and Fighting Spirit (r = -0.4, P < 0.05) but correlated positively with Helplessness/Hopelessness (r = 0.6, P < 0.05) and Brief RCOPE Negative (r = 0.7, P < 0.05). SDS global scores correlated negatively with Intrinsic religiosity (r = -0.2, P < 0.05) and Fighting Spirit (r = -0.3, P < 0.05) but correlated positively with Helplessness/Hopelessness (r = 0.5, P < 0.05) and Brief RCOPE Negative (r = 0.4, P < 0.05). High intrinsic and extrinsic religiosities are likely to be associated with positive coping skills and better treatment outcome in patients with depression or diabetes. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Genotype-Specific Regulation of Oral Innate Immunity by T2R38 Taste Receptor
Gil, Sucheol; Coldwell, Susan; Drury, Jeanie L.; Arroyo, Fabiola; Phi, Tran; Saadat, Sanaz; Kwong, Danny; Chung, Whasun Oh
2015-01-01
The bitter taste receptor T2R38 has been shown to regulate mucosal innate immune responses in the upper airway epithelium. Furthermore, SNPs in T2R38 influence the sensitivity to 6-n-propylthiouracil (PROP) and are associated with caries risk/protection. However, no study has been reported on the role of T2R38 in the innate immune responses to oral bacteria. We hypothesize that T2R38 regulates oral innate immunity and that this regulation is genotype-specific. Primary gingival epithelial cells carrying three common genotypes, PAV/PAV (PROP super-taster), AVI/PAV (intermediate) and AVI/AVI (non-taster) were stimulated with cariogenic bacteria Streptococcus mutans, periodontal pathogen Porphyromonas gingivalis or non-pathogen Fusobacterium nucleatum. QRT-PCR analyzed T2R38 mRNA, and T2R38-specific siRNA and ELISA were utilized to evaluate induction of hBD-2 (antimicrobial peptide), IL-1α and IL-8 in various donor-lines. Experiments were set up in duplicate and repeated three times. T2R38 mRNA induction in response to S. mutans was highest in PAV/PAV (4.3-fold above the unstimulated controls; p<0.05), while lowest in AVI/AVI (1.2-fold). In PAV/PAV, hBD-2 secretion in response to S. mutans was decreased by 77% when T2R38 was silenced. IL-1α secretion was higher in PAV/PAV compared to AVI/PAV or AVI/AVI with S. mutans stimulation, but it was reduced by half when T2R38 was silenced (p<0.05). In response to P. gingivalis, AVI/AVI showed 4.4-fold increase (p<0.05) in T2R38 expression, whereas the levels in PAV/PAV and AVI/PAV remained close to that of the controls. Secretion levels of IL-1α and IL-8 decreased in AVI/AVI in response to P. gingivalis when T2R38 was silenced (p<0.05), while the changes were not significant in PAV/PAV. Our data suggest that the regulation of gingival innate immunity by T2R38 is genotype-dependent and that the ability to induce a high level of hBD-2 by PAV/PAV carriers may be a reason for protection against caries in this group. PMID
MiR-146a polymorphism correlates with lung cancer risk in Chinese nonsmoking females
Yin, Zhihua; Cui, Zhigang; Ren, Yangwu; Xia, Lingzi; Li, Hang; Zhou, Baosen
2017-01-01
This study provides evidence that the common rs2910164 polymorphism in miR-146a strongly correlates with lung cancer risk in nonsmoking females in northeast China. The genotypes of miR-146a rs2910164 were determined in 1131 patients with lung cancer and 1003 healthy control subjects. Tissue samples were used to evaluate the association between miRNA expression and lung cancer risk as well as the correlation between rs2910164 genotypes and miR-146a expression. The secondary structures of the wild-type and variant miR-146a sequences were predicted, and luciferase-based target assays were used to test whether miR-146a bound to tumor necrosis factor receptor associated factor 6 (TRAF6) mRNA. Individuals carrying heterozygous CG genotype of miR-146a rs2910164 had less risk of lung cancer than those carrying homozygous wild CC genotype (OR = 0.76, 95% CI = 0.60-0.98, P = 0.032). We found no significant association between miR-146a expression and lung cancer risk. MiR-146a expression differed in those carrying the CC genotype as compared with the CG or the GG genotype (P = 0.032 and 0.001), and the secondary structure of the C allele differed slightly from the G allele. Significantly lower levels of luciferase activity were observed when the TRAF6 3′UTR was cotransfected with miR-146a-3p carrying the rs2910164 C allele (P = 0.001). Thus, miR-146a rs2910164 polymorphism may influence susceptibility to lung cancer in Chinese nonsmoking females through targeting TRAF6. PMID:27911870
Martínez, Carmen; García-Martín, Elena; Blanco, Gerardo; Gamito, Francisco J G; Ladero, José M; Agúndez, José A G
2005-01-01
Aims To study the effect of CYP2C8*3, the most common CYP2C8 variant allele on the dis-position of (R)-ibuprofen and the association of CYP2C8*3 with variant CYP2C9 alleles. Methods Three hundred and fifty-five randomly selected Spanish Caucasians were screened for the common CYP2C8 and CYP2C9 mutations. The pharmacokinetics of (R)-ibuprofen were studied in 25 individuals grouped into different CYP2C8 genotypes. Results The allele frequency of CYP2C8*3 (0.17) was found to be higher than that reported for other Caucasian populations (P = 0.0001). The frequencies of CYP2C9*2 and CYP2C9*3 were 0.19 (0.16–0.21) and 0.10 (0.08–0.12), respectively. An association between CYP2C8*3 and CYP2C9*2 alleles was observed, occurring together at a frequency 2.4-fold higher than expected for a random association of alleles (P = 0.0001). The presence of the CYP2C8*3 allele was found to influence the pharmacokinetics of (R)-ibuprofen in a gene–dose effect manner. Thus, after administration of 400 mg ibuprofen, the plasma half-life (95% confidence intervals) for individuals with genotypes CYP2C8*1/*1, CYP2C8*1/*3 and CYP2C8*3/*3, was 2.0 h (1.8–2.2), 4.2 h (1.9–6.5; P < 0.05) and 9.0 h (7.8–10.2; P < 0.002), respectively. A statistically significant trend with respect to the number of variant CYP2C8*3 alleles was also observed for the area under the concentration-time curve (P < 0.025), and drug clearance (P < 0.03). Conclusion Polymorphism of the CYP2C8 gene was found to be common, with nearly 30% of the population studied carrying the variant CYP2C8*3 allele. The presence of the latter caused a significant effect on the disposition of (R)-ibuprofen. This suggests that a substantial proportion of Caucasian subjects may show alterations in the disposition of drugs that are CYP2C8 substrates. PMID:15606441
Evaluation of miR-182/miR-100 Ratio for Diagnosis and Survival Prediction in Bladder Cancer.
Chen, Zhanguo; Wu, Lili; Lin, Qi; Shi, Jing; Lin, Xiangyang; Shi, Liang
2016-09-01
Abnormal expression of microRNAs (miRNAs) plays an important role in development of several cancer types, including bladder cancer (BCa). However, the relationship between the ratio of miR-181/miR-100 and the prognosis of BCa has not been studied yet. The aim of this study was to evaluate the expression of miR-182, miR-100 and their clinical significance in BCa. Upregulation of miR-182 and down-regulation of miR-100 were validated in tissue specimens of 134 BCa cases compared with 148 normal bladder epithelia (NBE) specimens using TaqMan-based real-time reverse transcription quantitative PCR (RT-qPCR). The diagnostic and prognostic evaluation of miR-182, miR-100, and miR-182/miR-100 ratio was also performed. miR-182 was upregulated in BCa and miR-100 was down-regulated in BCa compared with NBE (P < 0.001). The areas under receiver operating characteristic curves (AUCs-ROC) for miR-182 and miR-100 were 0.913 and 0.810, respectively. However, miR-182/miR-100 ratio increased the diagnostic performance, yielding an AUC of 0.981 (97.01% sensitivity and 90.54% specificity). Moreover, miR-182/miR-100 ratio was associated with pT-stage, histological grade, BCa recurrence and carcinoma in situ (P < 0.05 for all). Multivariate Cox regression analysis indicated that miR-182/miR-100 ratio was an independent prognostic factor for overall survival (Hazard ratio: 7.142; 95% CI: 2.106 - 9.891; P < 0.01). Furthermore, Kaplan-Meier curve analysis revealed that high-level of miR-182/miR-100 ratio was significantly correlated with shortened survival time for BCa patients (P < 0.01). The miR-182/miR-100 ratio may serve as a novel promising biomarker for diagnosis and survival prediction in BCa. Further studies are needed to elucidate the role of miR-182/miR-100 ratio as a non‑invasive diagnostic tool for BCa.
Low CTE glass, SiC & Beryllium for lightweight mirror substrates
NASA Astrophysics Data System (ADS)
Geyl, Roland; Cayrel, Marc
2005-10-01
This paper is intended to analyze the relative merits of low CTE glass, SiC and Beryllium as candidates for lightweight mirror substrates in connection with real practical experience and example or three major projects using these three materials and running presently at SAGEM-REOSC. Beryllium and SiC have nice thermal and mechanical properties but machined glass ceramic can still well compete technically or economically in some cases.
JPRS report: Science and Technology. Europe and Latin America
NASA Astrophysics Data System (ADS)
1988-01-01
Articles from the popular and trade press are included on the following subjects: advanced materials, aerospace industry, automotive industry, biotechnology, computers, factory automation and robotics, microelectronics, and science and technology policy. The aerospace articles discuss briefly and in a nontechnical way the SAGEM bubble memories for space applications, Ariane V new testing facilities, innovative technologies of TDF-1 satellite, and the restructuring of the Aviation Division at France's Aerospatiale.
Coating of large-sized optics for the instruments of observation
NASA Astrophysics Data System (ADS)
Mouricaud, Daniel
2008-07-01
SAGEM has developed a line of product specific to the large-sized parts. The means available make it possible today to coat substrates of dimensions going until 1m50. Current developments address coating of substrate up to 2m20. A specific focus has been held on the wavefront deformation due to the coating. Principle contributors of this deformation are introduced and analyzed as well as some experimental results.
Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR
Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.
2001-01-01
The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695
NASA Technical Reports Server (NTRS)
Robertson, S. J.
1979-01-01
The thermal convective velocities during the 4-21/2R and 74-21/3R flight tests were calculated. The 74-21/2R and 74-21/3R ground tests were analyzed using a convection formula. Thermal convection velocities of 0.1 to 0.5 cm/sec were calculated for the 74-21/2R and 74-21/3R ground tests which were two to four orders of magnitude greater than for the flight tests. For the 74-21/2R flight test, solutal effects do not produce any convective motion. For the 74-21/3R flight test closed form convection equations estimated the solutal convective velocities on the order of 1/0.003 cm/sec.
40 CFR 50.5 - National secondary ambient air quality standard for sulfur oxides (sulfur dioxide).
Code of Federal Regulations, 2014 CFR
2014-07-01
... standard for sulfur oxides (sulfur dioxide). 50.5 Section 50.5 Protection of Environment ENVIRONMENTAL....5 National secondary ambient air quality standard for sulfur oxides (sulfur dioxide). (a) The level... than 0.05 ppm shall be rounded up). (b) Sulfur oxides shall be measured in the ambient air as sulfur...
40 CFR 50.5 - National secondary ambient air quality standard for sulfur oxides (sulfur dioxide).
Code of Federal Regulations, 2013 CFR
2013-07-01
... standard for sulfur oxides (sulfur dioxide). 50.5 Section 50.5 Protection of Environment ENVIRONMENTAL....5 National secondary ambient air quality standard for sulfur oxides (sulfur dioxide). (a) The level... than 0.05 ppm shall be rounded up). (b) Sulfur oxides shall be measured in the ambient air as sulfur...
40 CFR 50.5 - National secondary ambient air quality standard for sulfur oxides (sulfur dioxide).
Code of Federal Regulations, 2012 CFR
2012-07-01
... standard for sulfur oxides (sulfur dioxide). 50.5 Section 50.5 Protection of Environment ENVIRONMENTAL....5 National secondary ambient air quality standard for sulfur oxides (sulfur dioxide). (a) The level... than 0.05 ppm shall be rounded up). (b) Sulfur oxides shall be measured in the ambient air as sulfur...
Abd El-Rehim, Dalia M; Fath El-Bab, Hanaa K; Kamal, Enas M
2015-10-01
Data are limited regarding the role of proteinase-activated receptor-2 (PAR-2) in the esophageal mucosa in gastroesophageal reflux disease (GERD) patients. Our aim was to study PAR-2 expression and its relationship with different GERD-related clinical and pathologic parameters. Histomorphologic alterations in eosophageal mucosa in nonerosive reflux disease (NERD) and erosive reflux disease (ERD) were also, evaluated. Endoscopic biopsies of the esophageal mucosa were obtained from 94 GERD patients and 20 participants for histopathologic analysis and PAR-2 immunohistochemical staining. The present study demonstrated significantly higher PAR-2 expression in GERD patients compared with control, whereas no significant differences were seen between NERD and ERD groups. PAR-2 expression significantly correlated with histologic score (r=0.572, P<0.001) and severity of heartburn (r=0.541, P<0.001). PAR-2 expression was significantly associated with basal cell hyperplasia, and dilated intercellular spaces and inflammatory cell count (P<0.05). Histologic analysis revealed GERD-related histomorphologic alterations in the esophageal mucosa of GERD patients with significant differences (P<0.05) among groups. Total histologic score was significantly correlated with heartburn (r=0.299, P=0.025) and endoscopic severity (r=0.359, P=0.027) in NERD and ERD patients, respectively. Taken together, this study provides evidence for the major role of PAR-2 in the pathogenesis of GERD and GERD-associated mucosal alterations.
Analytical dose evaluation of neutron and secondary gamma-ray skyshine from nuclear facilities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hayashi, K.; Nakamura, T.
1985-11-01
The skyshine dose distributions of neutron and secondary gamma rays were calculated systematically using the Monte Carlo method for distances up to 2 km from the source. The energy of source neutrons ranged from thermal to 400 MeV; their emission angle from 0 to 90 deg from the ver tical was treated with a distribution of the direction cosine containing five equal intervals. Calculated dose distributions D(r) were fitted to the formula; D(r) = Q exp (-r/lambda)/r. The value of Q and lambda are slowly varied functions of energy. This formula was applied to the benchmark problems of neutron skyshinemore » from fission, fusion, and accelerator facilities, and good agreement was achieved. This formula will be quite useful for shielding designs of various nuclear facilities.« less
Chimba, Deo; Kutela, Boniphace
2014-09-01
Extent of secondary crashes derived from primary incidents involving abandoned and disabled vehicles are presented in this paper. Using years 2004 to 2010 incident and crash data on selected Tennessee freeways, the study identified secondary crashes that resulted from disabled and abandoned vehicle primary incidents. The relationship between time and distance gaps before the secondary crash with respect to individual incident characteristics were evaluated through descriptive statistics and linear regression. The time and distance gap analysis indicated that a large portion of secondary crashes occurred within 20 min after the primary incidents and within a distance of 0.5 miles upstream. While 76% of incidents involved shoulder, most secondary crashes were related to the closing of right lanes. Overall, 58% of the secondary crashes occurred within 30 min after the occurrence of the primary incidents. Most of the vehicles in the incidents that involved towing and caused secondary crashes were towed or removed out of the travel way within 60 min from the time of occurrence. The study found that most (95%) secondary crashes were property damage only (PDO), while 49% were rear-end crashes. The negative binomial model was used to evaluate the impact of roadway geometry and traffic factors associated with frequency of these secondary crashes. It was found that the posted speed limit, congested segments, segments with high percentages of trucks, and peak hour volumes increased the likelihood of secondary crash occurrence. Roadway segments with wider medians, shoulders, and multilanes decrease the likelihood of secondary crashes caused by abandoned and disabled vehicles as the primary incidents. Practical applications The paper recommends that wider shoulders be provided on any section of freeway to accommodate abandoned or disabled vehicles to avoid blocking of travel lane(s). Copyright © 2014 National Safety Council and Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warneck, Julie B.; Cheng, Frankie H.M.; Barnes, Matthew J.
2008-11-01
The chemotherapeutic drug cisplatin is associated with severe gastrointestinal toxicity that can last for several days. A recent strategy to treat the nausea and emesis includes the combination of a 5-HT{sub 3} receptor antagonist, a glucocorticoid, and an NK{sub 1} receptor antagonist. The present studies explore the use of the selective noradrenaline reuptake inhibitors, (R)-sila-venlafaxine, (R,R)-reboxetine and (S,S)-reboxetine to prevent cisplatin (5 mg/kg, i.p.)-induced acute (0-24 h) and delayed (24-72 h) emesis in ferrets. The positive control regimen of ondansetron and dexamethasone, both at 1 mg/kg/8 h, reduced acute and delayed emesis by 100 (P < 0.001) and 61% (Pmore » < 0.05). (R)-sila-venlafaxine at 5 and 15 mg/kg/4 h reduced acute emesis by 86 (P < 0.01) and 66% (P < 0.05), respectively and both enantiomers of reboxetine at 1 mg/kg/12 h also reduced the response by {approx} 70-90% (P < 0.05). Out of the reuptake inhibitors, only (R)-sila-venlafaxine at 15 mg/kg/4 h was active to reduce delayed emesis (a 57% reduction was observed (P < 0.05)); its terminal plasma levels were positively correlated with an inhibition of emesis during the delayed phase (P < 0.05). (R)-sila-venlafaxine was also examined against a higher dose of cisplatin 10 mg/kg, i.p. (3 h test) and it dose-dependently antagonized the response (maximum reduction was 94% at 10 mg/kg, p.o.; P < 0.01) but it was ineffective against apomorphine (0.125 mg/kg, s.c.) and ipecacuanha (2 mg/kg, p.o.)-induced emesis (P > 0.05). In conclusion, the studies provide the first evidence for an anti-emetic potential of noradrenaline reuptake inhibitors to reduce chemotherapy-induced acute and delayed emesis.« less
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Entry. 1316.05 Section 1316.05 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE ADMINISTRATIVE FUNCTIONS, PRACTICES, AND PROCEDURES Administrative Inspections § 1316.05 Entry. An inspection shall be carried out by an inspector. Any such...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Organization. 5.05 Section 5.05 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY GENERAL COAST GUARD AUXILIARY § 5.05 Organization. The Auxiliary is a nonmilitary organization administered by the Commandant, under...
Superthermal (0.5- 100 keV) Electrons near the ICME-driven shocks
NASA Astrophysics Data System (ADS)
Yang, L.; Wang, L.; Li, G.; Tao, J.; He, J.; Tu, C.
2016-12-01
We present a survey of the 0.5 - 100 keV electrons associated with ICME-driven shocks at 1 AU, using the WIND/3DP electron measurements from 1995 to 2014. We select 66 good ICME-driven shocks, and use the "Rankine-Hugoniot" shock fitting technique to obtain the shock normal, shock velocity Vs, shock compression ratio r and magnetosonic Mach number Ms. We average the electron data in the 1-hour interval immediately after the shock front to obtain the sheath electron fluxes and in the 4-hour quiet-time interval before the shock to obtain the pre-event electron fluxes. Then we subtract the pre-event electron fluxes from the sheath electron fluxes to obtain the enhanced electron fluxes at the shock. We find that the enhanced electron fluxes are positively correlated with Vs and Ms, and generally fit well to a double power-law spectrum, J E-β. At 0.5 - 2 keV, the fitted spectral index β1 ranges from 2.1 to 5.9, negatively correlated with r and Ms. At 2 - 100 keV, the fitted index β2 is smaller than β1, with values ( 1.9 to 3.4) similar to the spectral indexes of quiet-time superhalo electrons in the solar wind. β2 shows no obvious correlation with r and Ms. Neither of β1 or β2 is in agreement with the diffusive shock theoretical predication. These results suggest that electron acceleration by interplanetary shocks may be more significant at a few keVs and the interplanetary shock acceleration can contribute to the production of solar wind superhalo electrons. However, a revision of the diffusive shock acceleration theory would be needed for the electron acceleration.
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
Grinspoon, S K; Friedman, A J; Miller, K K; Lippman, J; Olson, W H; Warren, M P
2003-08-01
This multicenter, double-blind, placebo-controlled, randomized study of 45 patients evaluated the short-term effects of an oral contraceptive [Ortho Tri-Cyclen, 180-250 micro g of norgestimate (NGM) and 35 microg of ethinyl estradiol (EE)] on biochemical markers of bone resorption, formation, and osteoprotegerin in young women (mean age +/- SD, 26.5 +/- 6.3 yr) with hypothalamic amenorrhea and osteopenia. Body fat, endocrine, and cognitive function were evaluated as secondary endpoints. Biomarkers of bone metabolism were measured at baseline and after three cycles of NGM/EE or placebo. There were significant decreases in mean values of N-telopeptide [mean (SD), -13.4 (13.4) vs. 1.2 (23.8) nmol bone collagen equivalents (BCE)/mmol creatinine (Cr); P = 0.001] and deoxypyridinoline [-1.2 (2.9) vs. -0.5 (1.5) nmol deoxypyridinoline/mmol Cr; P = 0.021] as well as significant decreases in bone specific alkaline phosphatase [-5.1 (3.5) vs. 0.4 (3.1) ng/ml; P < 0.001], osteocalcin [-5.9 (3.6) vs. -2.9 (3.7); P = 0.016], and procollagen of type I propeptide [-35.2 (44.6) vs. -0.2 (30.0) ng/ml; P = 0.025], but not osteoprotegerin [0.39 (1.46) vs. -0.2 (0.49) pmol/liter; P = 0.397] in the NGM/EE vs. placebo group. There were no significant differences between groups with respect to changes in cognitive function, mood, body weight, body mass index, body fat, percentage of body fat, and all endocrine levels except FSH, [-3.7 (3.8) vs. -0.6 (2.1) IU/liter; P < 0.001, NGM/EE vs. placebo]. No serious adverse events were reported in either group. These results suggest that NGM/EE decreases bone turnover in osteopenic premenopausal women with hypothalamic amenorrhea. Further studies are needed to determine whether estrogen will increase bone density in this population.
Chen, Min; Wang, Panning; Xie, Zhixiong
2018-04-23
7-Hydroxytropolone (7-HT) is a symmetrical, seven-membered heteroatomic ring with a carboxyl group and two hydroxyl groups and was recently reported to be an iron scavenger of Pseudomonas donghuensis HYS. Cluster 1 encodes 12 genes related to the synthesis of 7-HT; among these genes, two regulators, ORF1 and ORF12, were predicted to regulate 7-HT biosynthesis and to be LysR-type transcriptional regulators (LTTRs) and TetR/AcrR family transcriptional regulators, respectively. Data from real-time quantitative PCR, β-galactosidase and classical siderophore assays indicated that the transcription levels of orf1 and orf12, as well as those of crucial genes orf6-orf9, were repressed under high-iron conditions. The deletion of orf1 and orf12 led to an absence of 7-HT and a decrease in orf6-orf9 expression. ORF1 and ORF12 were essential for the production of 7-HT through orf6-orf9 These two regulators are regulated by the Gac/Rsm system; ORF1 facilitates the expression of ORF12, and ORF12 concomitantly stimulates the expression of orf6-orf9 to synthesize 7-HT. Overexpression of ORF12 decreased 7-HT yields possibly through decreased orf6-orf9 expression. This work thus outlines a complex mechanism regulating the biosynthesis of the iron scavenger 7-HT in P. donghuensis HYS. The synergy between ORF1 and ORF12 ensures that 7-HT acts as an iron chelator despite being toxic to bacteria and provides new ideas for the novel regulation of dual-functional secondary metabolism and research on 7-HT and its derivates in other bacteria. IMPORTANCE A complex regulation mechanism including two regulators, LysR and TetR/AcrR, of the biosynthesis of the novel iron scavenger 7-HT was verified in Pseudomonas donghuensis HYS. The coaction of LysR ORF1 and TetR/AcrR ORF12 may balance the toxicity and iron chelation of 7-HT in P. donghuensis HYS to overcome iron deficiency, as well as improve the bacterial competitiveness in iron-scarce conditions because of the toxicity of 7-HT toward other
Fully gapped superconductivity in In-doped topological crystalline insulator Pb 0.5Sn 0.5Te
Du, Guan; Gu, G. D.; Du, Zengyi; ...
2015-07-27
In this study, superconductors derived from topological insulators and topological crystalline insulators by chemical doping have long been considered to be candidates as topological superconductors. Pb 0.5Sn 0.5Te is a topological crystalline insulator with mirror symmetry protected surface states on (001)-, (011)-, and (111)-oriented surfaces. The superconductor (Pb 0.5Sn 0.5) 0.7In 0.3Te is produced by In doping in Pb 0.5Sn 0.5Te, and is thought to be a topological superconductor. Here we report scanning tunneling spectroscopy measurements of the superconducting state as well as the superconducting energy gap in (Pb 0.5Sn 0.5) 0.7In 0.3Te on a (001)-oriented surface. The spectrum canmore » be well fitted by an anisotropic s-wave gap function of Δ = 0.72 + 0.18cos4θ meV using Dynes model. The results show that the superconductor seems to be a fully gapped one without any in-gap states, in contradiction with the expectation of a topological superconductor.« less
An analysis of 1150 cases of abortions from the Government R.S.R.M. Lying-in Hospital, Madras.
Francis, O
1959-09-01
The Government R.S.R.M. Lying-in Hospital is located in one of the poorest sections of Madras, India, where the abortion rate is very high. The total number of complete abortions during the period, October 1957-November 1958, is 1150; the total number of deliveries including abortions is 10,367, an incidence rate of 11.09%. Of the 1150 cases, 789 (68.61%) were early abortions, up to 12 weeks; 361 (31.39%) were late, from the 13th to 28th week. An analysis of 1000 spontaneous abortions by Simons found that about 75% occurred before the 12th week. 758 abortions were performed on women aged 21-30; 204 occurred among those 31-40. 253 (22%) were primary abortions, i.e. the first pregnancy ended in an abortion and 897 (78%) were secondary abortions, i.e. there were 1 or more viable pregnancies before the abortion. Fetal death may be caused by abnormalities of the ovum, genital tract, or general maternal causes, or rare paternal causes. No cause could be found in 549 (47.74%) cases, but an associated abnormality was found in 601 (52.25%) cases. In 518 cases a single factor caused the abortion; in 83 cases more than a single etiological factor was found. There were 89 habitual aborters (7.74%). 19 of these were primary and 70 were secondary abortions.
Superconducting properties and μSR study of the noncentrosymmetric superconductor Nb0.5Os0.5.
Singh, D; Barker, J A T; Thamizhavel, A; Hillier, A D; Paul, D McK; Singh, R P
2018-01-22
The properties of the noncentrosymmetric superconductor (α-[Formula: see text] structure) Nb 0.5 Os 0.5 have been investigated using resistivity, magnetization, specific heat, and muon spin relaxation and rotation (μSR) measurements. These measurements suggest that Nb 0.5 Os 0.5 is a weakly coupled ([Formula: see text]) type-II superconductor ([Formula: see text]), having a bulk superconducting transition temperature T c = 3.07 K. The specific heat data fits well with the single-gap BCS model indicating nodeless s-wave superconductivity in Nb 0.5 Os 0.5 . The μSR measurements also confirm [Formula: see text]-wave superconductivity with the preserved time-reversal symmetry.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 9 2011-04-01 2011-04-01 false Reports. 1310.05 Section 1310.05 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE RECORDS AND REPORTS OF LISTED CHEMICALS AND CERTAIN MACHINES § 1310.05 Reports. (a) Each regulated person shall report to the Special Agent in Charge...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Reports. 1310.05 Section 1310.05 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE RECORDS AND REPORTS OF LISTED CHEMICALS AND CERTAIN MACHINES § 1310.05 Reports. (a) Each regulated person shall report to the Special Agent in Charge...
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 9 2014-04-01 2014-04-01 false Reports. 1310.05 Section 1310.05 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE RECORDS AND REPORTS OF LISTED CHEMICALS AND CERTAIN MACHINES § 1310.05 Reports. (a) Each regulated person shall report to the Special Agent in Charge...
Yan, Fei; Yang, Haibo; Lin, Ying; Wang, Tong
2017-11-06
Pulsed capacitors require high-recoverable energy-storage density (W rec ) and high energy-storage efficiency (η), which can be realized through the selection and adjustment of the composition. In this work, (1 - x)SrTiO 3 -x(0.95Bi 0.5 Na 0.5 TiO 3 -0.05BaAl 0.5 Nb 0.5 O 3 ) [(1 - x)ST-x(BNT-BAN)] ceramics were successfully prepared via the pressureless solid-state reaction method. The dielectric constant increases gradually with the introduction of BNT-BAN and obtains a maximum value of 3430 with the composition of 0.4ST-0.6(BNT-BAN) at 100 Hz, which is 10.39 times higher than that of the pure ST sample (∼330). Dispersive relaxor behaviors and ferroelectric performances can be enhanced with the introduction of BNT-BAN. The composition of 0.5ST-0.5(BNT-BAN) exhibits a high W rec of 1.89 J/cm 3 as well as a high η of 77%. Therefore, the (1 - x)ST-x(BNT-BAN) systems are candidate materials for pulsed capacitor applications.
Electrocatalytic Oxidation of Formate by [Ni(P R 2 N R' 2 ) 2 (CH 3 CN)] 2+ Complexes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Galan, Brandon R.; Schöffel, Julia; Linehan, John C.
2011-08-17
New [Ni(P R 2N R` 2) 2+(CH 3CN)] 2+ complexes with R = Ph, R` = 4-MeOPh; R = Cy, R` = Ph and a mixed ligand [Ni(P R 2N R` 2)(P R`` 2N R` 2)] 2+ with R = Cy, R` = Ph, R`` = Ph have been synthesized and characterized by single crystal X-ray crystallography. These complexes are shown to be electrocatalysts for the oxidation of formate in solution to produce CO 2, protons, and electrons with rates which are first order in catalyst and in formate at formate concentrations below approximately 0.05 M. For the catalysts studied,more » maximum observed turnover frequencies vary from <1.1 s -1 to 12.5 s -1 at room temperature, which are the highest rates yet reported for formate oxidation by homogeneous catalysts. A mechanistic scheme is proposed which involves an initial nickel complex bound <1-OC(O)H followed by a rate limiting hydride transfer step. An acetate complex demonstrating the η 1-OC(O)CH 3 binding mode to nickel has also been synthesized and characterized by single crystal X-ray crystallography. The pendant amines have been demonstrated to be essential for this electrocatalytic activity as no activity toward formate was found for the similar [Ni(depe) 2][BF 4] 2+ (depe = diethylphosphinoethane) complex. This work was supported by the US Department of Energy Basic Energy Sciences' Chemical Sciences, Geosciences & Biosciences Division. Pacific Northwest National Laboratory is operated by Battelle for the US Department of Energy.« less
NASA Astrophysics Data System (ADS)
Dul'kin, E.; Mihailova, B.; Gospodinov, M.; Roth, M.
2012-09-01
The structural transitions in Pb1-xLaxSc(1+x)/2Ta(1-x)/2O3, x = 0.08 (PLST) relaxor crystals were studied by means of acoustic emission (AE) under an external electric field (E) and compared with those observed in pure PbSc0.5Ta0.5O3 (PST) and Pb0.78Ba0.22Sc0.5Ta0.5O3 (PBST) [E. Dul'kin et al., EPL 94, 57002 (2011)]. Similar to both the PST and PBST compounds, in zero field PLST exhibits AE corresponding to a para-to-antiferroelectric incommensurate phase transition at Tn = 276 K, lying in the vicinity of dielectric temperature maximum (Tm). This AE signal exhibits a nontrivial behavior when applying E resembling the electric-field-dependence of Tn previously observed for both the PST and PBST, namely, Tn initially decreases with the increase of E, attains a minimum at a threshold field Eth = 0.5 kV/cm, accompanied by a pronounced maximum of the AE count rate Ṅ = 12 s-1, and then starts increasing as E enhances. The similarities and difference between PST, PLST, and PBST with respect to Tn, Eth, and Ṅ are discussed from the viewpoint of three mechanisms: (i) chemically induced random local electric field due to the extra charge on the A-site ion, (ii) disturbance of the system of stereochemically active lone-pair electrons of Pb2+ by the isotropic outermost electron shell of substituting ion, and (iii) change in the tolerance factor and elastic field to the larger ionic radius of the substituting A-site ion due to the different radius of the substituting ion. The first two mechanisms influence the actual values of Tn and Eth, whereas the latter is shown to affect the normalized Ṅ, indicating the fractions undergoing a field-induced crossover from a modulated antiferroelectric to a ferroelectric state. Creation of secondary random electric field, caused by doping-induced A-site-O ionic chemical bonding, is discussed.
Friction between various self-ligating brackets and archwire couples during sliding mechanics.
Stefanos, Sennay; Secchi, Antonino G; Coby, Guy; Tanna, Nipul; Mante, Francis K
2010-10-01
The aim of this study was to evaluate the frictional resistance between active and passive self-ligating brackets and 0.019 × 0.025-in stainless steel archwire during sliding mechanics by using an orthodontic sliding simulation device. Maxillary right first premolar active self-ligating brackets In-Ovation R, In-Ovation C (both, GAC International, Bohemia, NY), and SPEED (Strite Industries, Cambridge, Ontario, Canada), and passive self-ligating brackets SmartClip (3M Unitek, Monrovia, Calif), Synergy R (Rocky Mountain Orthodontics, Denver, Colo), and Damon 3mx (Ormco, Orange, Calif) with 0.022-in slots were used. Frictional force was measured by using an orthodontic sliding simulation device attached to a universal testing machine. Each bracket-archwire combination was tested 30 times at 0° angulation relative to the sliding direction. Statistical comparisons were performed with 1-way analysis of variance (ANOVA) followed by Dunn multiple comparisons. The level of statistical significance was set at P <0.05. The Damon 3mx brackets had significantly the lowest mean static frictional force (8.6 g). The highest mean static frictional force was shown by the SPEED brackets (83.1 g). The other brackets were ranked as follows, from highest to lowest, In-Ovation R, In-Ovation C, SmartClip, and Synergy R. The mean static frictional forces were all statistically different. The ranking of the kinetic frictional forces of bracket-archwire combinations was the same as that for static frictional forces. All bracket-archwire combinations showed significantly different kinetic frictional forces except SmartClip and In-Ovation C, which were not significantly different from each other. Passive self-ligating brackets have lower static and kinetic frictional resistance than do active self-ligating brackets with 0.019 × 0.025-in stainless steel wire. Copyright © 2010 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
ERIC Educational Resources Information Center
Okoye, Namdi N. S.
2009-01-01
The study tried to examine the interaction between two independent variables of selective attention and cognitive development on Achievement in Genetics at the Secondary School level. In looking at the problem of this study three null hypotheses were generated for testing at 0.05 level of significance. Factorial Analysis of Variance design with…
Qasim, Mohd; Asghar, Khushnuma; Singh, Braj Raj; Prathapani, Sateesh; Khan, Wasi; Naqvi, A H; Das, Dibakar
2015-02-25
A novel visible light active and magnetically separable nanophotocatalyst, Ni0.5Zn0.5Fe2O4/Zn0.95Ni0.05O (denoted as NZF@Z), with varying amount of Ni0.5Zn0.5Fe2O4, has been synthesized by egg albumen assisted sol gel technique. The structural, optical, magnetic, and photocatalytic properties have been studied by powder X-ray diffraction (XRD), transmission electron microscopy (TEM), field emission scanning electron microscopy (FESEM), fourier transform infrared spectroscopy (FTIR), UV-visible (UV-Vis) spectroscopy, and vibrating sample magnetometry (VSM) techniques. Powder XRD, TEM, FTIR and energy dispersive spectroscopic (EDS) analyses confirm coexistence of Ni0.5Zn0.5Fe2O4 and Zn0.95Ni0.05O phases in the catalyst. Crystallite sizes of Ni0.5Zn0.5Fe2O4 and Zn0.95Ni0.05O in pure phases and nanocomposites, estimated from Debye-Scherrer equation, are found to be around 15-25 nm. The estimated particle sizes from TEM and FESEM data are ∼(22±6) nm. The calculated energy band gaps, obtained by Tauc relation from UV-Vis absorption spectra, of Zn0.95Ni0.05O, 15%NZF@Z, 40%NZF@Z and 60%NZF@Z are 2.95, 2.72, 2.64, and 2.54 eV respectively. Magnetic measurements (field (H) dependent magnetization (M)) show all samples to be super-paramagnetic in nature and saturation magnetizations (Ms) decrease with decreasing ferrite content in the nanocomposites. These novel nanocomposites show excellent photocatalytic activities on Rhodamin Dye. Copyright © 2014 Elsevier B.V. All rights reserved.
Asghar, Mohammad Sohail; Pereira, Manuel Pedro; Werner, Mads Utke; Mårtensson, Johan; Larsson, Henrik B W; Dahl, Jørgen Berg
2015-01-01
Noxious stimulation of the skin with either chemical, electrical or heat stimuli leads to the development of primary hyperalgesia at the site of injury, and to secondary hyperalgesia in normal skin surrounding the injury. Secondary hyperalgesia is inducible in most individuals and is attributed to central neuronal sensitization. Some individuals develop large areas of secondary hyperalgesia (high-sensitization responders), while others develop small areas (low-sensitization responders). The magnitude of each area is reproducible within individuals, and can be regarded as a phenotypic characteristic. To study differences in the propensity to develop central sensitization we examined differences in brain activity and anatomy according to individual phenotypical expression of secondary hyperalgesia by magnetic resonance imaging. Forty healthy volunteers received a first-degree burn-injury (47 °C, 7 min, 9 cm(2)) on the non-dominant lower-leg. Areas of secondary hyperalgesia were assessed 100 min after the injury. We measured neuronal activation by recording blood-oxygen-level-dependent-signals (BOLD-signals) during mechanical noxious stimulation before burn injury and in both primary and secondary hyperalgesia areas after burn-injury. In addition, T1-weighted images were used to measure differences in gray-matter density in cortical and subcortical regions of the brain. We found significant differences in neuronal activity between high- and low-sensitization responders at baseline (before application of the burn-injury) (p < 0.05). After the burn-injury, we found significant differences between responders during noxious stimulation of both primary (p < 0.01) and secondary hyperalgesia (p ≤ 0.04) skin areas. A decreased volume of the right (p = 0.001) and left caudate nucleus (p = 0.01) was detected in high-sensitization responders in comparison to low-sensitization responders. These findings suggest that brain-structure and neuronal activation to noxious
Screening for Secondary Endocrine Hypertension in Young Patients
TRIFANESCU, Raluca; CARSOTE, Mara; CARAGHEORGHEOPOL, Andra; HORTOPAN, Dan; DUMITRASCU, Anda; DOBRESCU, Mariana; POIANA, Catalina
2013-01-01
ABSTRACT Background: Secondary endocrine hypertension accounts for 5-12% of hypertension's causes. In selected patients (type 2 diabetes mellitus, sleep apnea syndrome with resistant hypertension, sudden deterioration in hypertension control), prevalence could be higher. Objectives: To present etiology of endocrine secondary hypertension in a series of patients younger than 40 years at hypertension's onset. Material and methods: Medical records of 80 patients (39M/41F), aged 30.1 ± 8.2 years (range: 12-40 years), with maximum systolic blood pressure=190.4 ± 29.2 mm Hg, range: 145-300 mm Hg, maximum diastolic blood pressure=107.7 ± 16.9 mm Hg, range: 80-170 mm Hg) referred by cardiologists for endocrine hypertension screening were retrospectively reviewed. Cardiac and renal causes of secondary hypertension were previously excluded. In all patients, plasma catecholamines were measured by ELISA and plasma cortisol by immunochemiluminescence. Orthostatic aldosterone (ELISA) and direct renin (chemiluminescence) were measured in 48 patients. Results: Secondary endocrine hypertension was confirmed in 16 out of 80 patients (20%). Primary hyperaldosteronism was diagnosed in 7 (4M/3F) out of 48 screened patients (14.6%). i.e. 8.75% from whole group: 5 patients with adrenal tumors (3 left/2 right), 2 patients with bilateral adrenal hyperplasia; all patients were hypokalemic at diagnostic (average nadir K+ levels = 2.5 ± 0.5 mmol/L); four patients were hypokalaemic on diuretic therapy (indapamidum); other 3 patients were hypokalaemic in the absence of diuretic therapy. Cushing's syndrome was diagnosed in 6 patients (7.5%): subclinical Cushing due to 4 cm right adrenal tumour – n = 1, overt ACTH-independent Cushing's syndrome due to: macronodular adrenal hyperplasia associated with primary hyperparathyroidism – n = 1; due to adrenal carcinoma – n = 1; due to adrenal adenomas – n = 2; Cushing's disease – n = 1). Pheochromocytomas were diagnosed in 3 patients (3
Code of Federal Regulations, 2013 CFR
2013-10-01
... 50 Wildlife and Fisheries 11 2013-10-01 2013-10-01 false Hearings. 452.05 Section 452.05 Wildlife... APPLICATION BY THE SECRETARY § 452.05 Hearings. (a) Hearings. (1) To develop the record for the report under § 452.04, the Secretary, in consultation with the members of the Committee, shall hold a hearing in...
Code of Federal Regulations, 2011 CFR
2011-10-01
... 50 Wildlife and Fisheries 9 2011-10-01 2011-10-01 false Hearings. 452.05 Section 452.05 Wildlife... APPLICATION BY THE SECRETARY § 452.05 Hearings. (a) Hearings. (1) To develop the record for the report under § 452.04, the Secretary, in consultation with the members of the Committee, shall hold a hearing in...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Hearings. 452.05 Section 452.05 Wildlife... APPLICATION BY THE SECRETARY § 452.05 Hearings. (a) Hearings. (1) To develop the record for the report under § 452.04, the Secretary, in consultation with the members of the Committee, shall hold a hearing in...
Qin, H X; Cui, H K; Pan, Y; Hu, R L; Zhu, L H; Wang, S J
2016-12-23
Objective: To explore the effect of microRNA miR-143 on the proliferation of cervical cancer HeLa cells through targeted regulating the expression of K-ras gene. Methods: The luciferase report carrier containing wild type 3'-UTR of K-ras gene (K-ras-wt) or mutated 3'-UTR of the K-ras (K-ras-mut) were co-transfected with iR-143 mimic into the HeLa cells respectively, and the targeting effect of miR-143 in the transfectants was verified by the dual luciferase report system. HeLa cells were also transfected with miR-143 mimic (miR-143 mimic group), mimic control (negative control group), and miR-143 mimic plus K-ras gene (miR-143 mimic+ K-ras group), respectively. The expression of miR-143 in the transfected HeLa cells was detected by real-time PCR (RT-PCR), and the expression of K-ras protein was detected by Western blot. The cell proliferation activity of each group was examined by MTT assay. In addition, human cervical cancer tissue samples ( n =5) and cervical intraepithelial neoplasia tissue samples ( n =5) were also examined for the expression of miR-143 and K-ras protein by RT-PCR and Western blot, respectively. Results: The luciferase report assay showed that co-transfection with miR-143 mimic decreased the luciferase activity of the K-ras-wt significantly, but did not inhibit the luciferase activity of the K-ras-mut. The expression of miR-143 in the HeLa cells transfected with miR-143 mimic was significantly higher than that in the HeLa cells transfected with the mimic control (3.31±0.45 vs 0.97±0.22, P <0.05). The MTT assay revealed that the cell proliferative activity of the miR-143 mimic group was significantly lower than that of the negative control group ( P <0.05), and the cell proliferative activity of the miR-143 mimic+ K-ras group was also significantly lower than the control group ( P <0.05) but higher than the miR-143 mimic group significantly ( P <0.05). The expression levels of K-ras protein in the miR-143 mimic group, the negative control
Dielectric properties of PVDF/0.5(Ba0.7Ca0.3)TiO3-0.5Ba(Zr0.2Ti0.8)O3 composites
NASA Astrophysics Data System (ADS)
Pandey, Bablu K.; Chandra, K. P.; Kolte, Jayant; Kulkarni, A. R.; Jayaswal, S. K.; Prasad, K.
2018-05-01
Ceramic powder of 0.50(Ba0.7Ca0.3)TiO3-0.50Ba(Zr0.2Ti0.8)O3(BCZT50) at morphotropic phase boundary composition was prepared usingsolid-statesynthesis technique followed by extensive high energy ball milling. The crystal symmetry, space group and unit cell dimensions were determined from the X-raydiffraction data of BCZT50 using FullProf software andthe average crystallite size was estimated using Williamson-Hall approach. FTIR spectra confirmed the formation of perovskite type solid solutions. The prepared ceramic powder was utilized to prepare lead-free (1- x)PVDF/xBCZT50 ceramic-polymer composites with x = 0.025, 0.05, 0.10, 0.15, 0.20, 0.25 were prepared using melt- mixing technique. The distribution of BCZT50 particles in the PVDF matrix were examined using anoptical microscope. Filler concentration dependent real and imaginary parts of dielectric constant data followed exponential growth types of variation. The low value of tanδ(˜10-2) can be advantageous forsensing/detectionapplications.
Electronic structure of stoichiometric and oxygen-deficient ferroelectric Hf0.5Zr0.5O2.
Perevalov, T V; Islamov, D R; Gritsenko, V A; Prosvirin, I P
2018-05-11
The electronic structure of oxygen-deficient Hf 0.5 Zr 0.5 O 2 in the non-centrosymmetric orthorhombic (ferroelectric) phase was investigated by means of x-ray photoelectron spectroscopy and first-principle density functional theory calculations. It was established that a peak in the photoelectron spectra observed at an energy above the valence band top of ferroelectric Hf 0.5 Zr 0.5 O 2 in ion-etched samples was due to oxygen vacancies. A method for evaluating the oxygen vacancies concentration in the material from the comparison of experimental and theoretical photoelectron spectra of the valence band is proposed. It is found that oxygen polyvacancies are not formed in ferroelectric Hf 0.5 Zr 0.5 O 2 : an energy-favorable spatial arrangement of several oxygen vacancies in the crystal corresponds to the configuration formed by noninteracting vacancies distant from each other. The oxygen vacancies in five charged states were simulated. The electron levels in the bandgap caused by charged oxygen vacancies indicate that any type of oxygen vacancies in ferroelectric Hf 0.5 Zr 0.5 O 2 can capture both electrons and holes, i.e. can act as an amphoteric localization center for charge carriers.
Electronic structure of stoichiometric and oxygen-deficient ferroelectric Hf0.5Zr0.5O2
NASA Astrophysics Data System (ADS)
Perevalov, T. V.; Islamov, D. R.; Gritsenko, V. A.; Prosvirin, I. P.
2018-05-01
The electronic structure of oxygen-deficient Hf0.5Zr0.5O2 in the non-centrosymmetric orthorhombic (ferroelectric) phase was investigated by means of x-ray photoelectron spectroscopy and first-principle density functional theory calculations. It was established that a peak in the photoelectron spectra observed at an energy above the valence band top of ferroelectric Hf0.5Zr0.5O2 in ion-etched samples was due to oxygen vacancies. A method for evaluating the oxygen vacancies concentration in the material from the comparison of experimental and theoretical photoelectron spectra of the valence band is proposed. It is found that oxygen polyvacancies are not formed in ferroelectric Hf0.5Zr0.5O2: an energy-favorable spatial arrangement of several oxygen vacancies in the crystal corresponds to the configuration formed by noninteracting vacancies distant from each other. The oxygen vacancies in five charged states were simulated. The electron levels in the bandgap caused by charged oxygen vacancies indicate that any type of oxygen vacancies in ferroelectric Hf0.5Zr0.5O2 can capture both electrons and holes, i.e. can act as an amphoteric localization center for charge carriers.
Vocational Cosmetology: An Integrated Secondary-Post Secondary Curriculum Guide (Tentative).
ERIC Educational Resources Information Center
Utah State Board for Vocational Education, Salt Lake City.
This guide for Cosmetology is part of a public school effort to articulate secondary and post-secondary vocational education programs. It is organized in a pattern of behavioral objectives so that students may enter and complete the program in high school, or in a post-secondary program, or may transfer and continue without loss of time. Of the…
NASA Astrophysics Data System (ADS)
Hu, HengBin; Chen, XiangYi; Deng, Song; Cai, Feng; Sun, YanQiong; Chen, YiPing
2012-02-01
By employing hydrothermal method, we identify a new organically templated aluminoborate [NH0.5C4H4NH0.5][AlB12O14(OH)12] which is structurally determined by single crystal X-ray diffraction and characterized by simulated and experimental IR, 2D IR COS (two-dimensional infrared correlation spectroscopy), NICS (nucleus-independent chemical shifts) and Mulliken charges calculations. Although the cluster anions [AlB12O14(OH)12]- is identical to the counterpart of compound reported by Lin et al. at 2008, we firstly bring up its quasi-aromaticity, discuss and confirm it by NICS, Mulliken charges calculations and magnetic-induced 2D IR COS, and conclude that three isolated and non-coplanar four-center six-electron π bonds of cluster could cooperate and interact with each other to form a closed conjugated large π orbital system, endowing the cluster anions with quasi-aromaticity. Thus, a one-dimensional chain is constructed by π-π stacked interaction between quasi-aromatic clusters and aromatic pyrazine along [1 0¯ 1] direction. The title compound crystallizes in monoclinic space group C2/c with a = 18.397(4), b = 12.0670(16), c = 11.075(2) Å, α = 90.00, β = 116.483(11), γ = 90.00°, Z = 4, V = 2200.6(7) Å, R = 0.0442 and wR = 0.1128 for 2689 observed reflections.
Time change of perceptual reversal of ambiguous figures by rTMS.
Nojima, K; Ge, S; Katayama, Y; Iramina, K
2010-01-01
The aim of this study was to investigate the effect of stimulus frequency and number of pulses during rTMS (repetitive transcranial magnetic stimulation) on the phenomenon of perceptual reversal. Particularly, we focused on the temporal dynamics of perceptual reversal in the right SPL (superior parietal lobule), using the spinning wheel illusion. We measured the IRT (inter-reversal time) of perceptual reversal. To investigate whether stimulus frequency or the number of pulses is critical for the rTMS effect, we applied the following schedules over the right SPL and the right PTL (posterior temporal lobe): 0.25Hz 60 pulses, 0.25Hz 120pulses, 0.5Hz 120 pulses, and 1Hz 120 pulses biphasic rTMS at 90% of the resting motor threshold. As a control, we included a No-TMS condition. The results showed that rTMS with 0.25Hz 60 pulses over the right SPL caused shorter IRT. There were no significant differences between IRTs for rTMS with 0.25Hz 120 pulses, 0.5Hz 120 pulses or 1Hz 120 pulses over the right SPL. Comparing these results with those of a previous study, we found that an rTMS condition with 60 pulses causes shorter IRT; 240 pulses causes longer IRT; and 120 pulses does not change IRT. Therefore, when applying rTMS over the right SPL, the IRT of perceptual reversal is primarily affected by the number of pulses.
Lu, Michael T; Hallett, Travis R; Hemingway, Jennifer; Hughes, Danny R; Hoffmann, Udo; Duszak, Richard
2016-09-01
Secondary interpretation of diagnostic imaging examinations (providing a second formal interpretation for imaging performed at another institution) may reduce repeat imaging after transfer of care. Recently, CMS requested information to guide payment policy. We aimed to study historic trends in submitted claims and payments for secondary interpretation services in the Medicare fee-for-service population. Applying current procedural terminology codes by body part to Medicare Part B aggregate claims files, we identified all CT interpretation services rendered between 1999 and 2012. Secondary interpretation services were identified using combined code modifiers 26 and 77, in accordance with CMS billing guidelines. The frequencies of billed and denied services were extracted for primary and secondary CT interpretation services. Primary versus secondary interpretation denial rates were calculated and compared. Of all 227 million Medicare Part B claims for CT services, 299,468 (0.13%) were for secondary interpretation services. From 1999 to 2012, growth in secondary interpretation claims outpaced that in primary interpretation claims (+811% versus +56%; compound annual growth rate 17% versus 3.2%). As a percentage of all services, secondary interpretations increased from 0.05% in 1999 to 0.30% in 2012. Denial rates for second interpretations decreased from 1999 to 2012 (12.7% to 7.0%), and now approach those for primary interpretations (5.4% in 2012). Medicare claims for secondary interpretation of CT examinations are growing but account for less than 1% of all billed CT interpretation services. Denial rates are similar to those of primary interpretation services. Copyright © 2016 American College of Radiology. Published by Elsevier Inc. All rights reserved.
Tuning of photodetection properties of V0.5Sn0.5Se2 ternary alloy
NASA Astrophysics Data System (ADS)
Zankat, Chetan K.; Pataniya, Pratik; Solanki, G. K.; Patel, K. D.; Pathak, V. M.
2018-05-01
In present article, we report the tuning of photodetection properties of V0.5Sn0.5Se2 ternary crystals grown by direct vapour transport technique. The comparison of photodetection under 485 nm, 532 nm and 670 nm periodic illumination is carried out for 0.3 mW cm‑2 power intensity and 5 mV bias voltage. The fast response time of 200 ms is realised due to effective absorption of light and device configuration. The detector parameters such as photo-responsivity, specific detectivity and external quantum efficiency are also evaluated. The V0.5Sn0.5Se2 photodetector has shown effective light–matter interaction. The V0.5Sn0.5Se2 photodetector was examined under 670 nm illumination of different power intensity. Besides these, the photo-responsivity is enhanced from 77.67 mA W‑1 to 99.67 mA W‑1 on increasing bias voltage from 1 mV to 5 mV. The present work on tuning of photodetection can provide novel path for future optoelectronics.
Is Mathematics T.I.R.E.D.? A Profile of Quiet Disaffection in the Secondary Mathematics Classroom.
ERIC Educational Resources Information Center
Nardi, Elena; Steward, Susan
2003-01-01
Reports on a one-year study of quiet disaffection conducted in three Year 9 mathematics classrooms in Norfolk (England). Constructs a profile of quiet disaffection from secondary mathematics through extensive observation and interviews with 13-14 year-old pupils (n=70). Proposes that its characteristics include tedium, isolation, rote learning,…
NASA Astrophysics Data System (ADS)
Lahmann, B.; Frenje, J. A.; Gatu Johnson, M.; Sio, H.; Kabadi, N. V.; Sutcliffe, G.; Seguin, F. H.; Li, C. K.; Petrasso, R. D.; Hartouni, E. P.; Rinderknecht, H. G.; Sayre, D. B.; Yeamans, C. B.; Khan, S. F.; Kyrala, G. A.; Lepape, S.; Berzak-Hopkins, L.; Meezan, N.; Bionta, R.; Ma, T.
2016-10-01
In deuterium-filled inertial confinement fusion implosions, 0.82 MeV 3He and 1.01 MeV T born from the primary DD reaction branches can undergo fusion reactions with the thermal deuterium plasma to create secondary D3He protons and DT neutrons respectively. In regimes of moderate fuel areal density (ρR 5 - 100 mg/cm2) the ratio of both of these secondary yields to the primary yield can be used to infer the fuel ρR, convergence, and an electron temperature (Te) simultaneously. This technique has been used on a myriad of deuterium filled implosion experiments on the NIF using the nuclear time of flight (NTOF) diagnostics to measure the secondary DT neutrons and CR-39 based wedge range filters (WRFs) to measure the secondary D3He protons. Additionally, a comparative study is conducted between the nuclear inferred convergence and x-ray inferred convergence obtained on these experiments. This work was supported in part by LLE, the U.S. DoE (NNSA, NLUF) and LLNL.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jeong, Jihoon; Department of Mechanical Engineering, The University of Texas at Austin, Austin, TX 78712; Azad, Abul K.
2015-03-15
The Ti and Mn replaced complex perovskites, Ln{sub 0.5}Sr{sub 0.5}Ti{sub 0.5}Mn{sub 0.5}O{sub 3±d} (Ln: La, Nd and Sm), were reported as potential anode materials for high temperature-operating solid oxide fuel cells (HT-SOFCs). For the present research study, synthesis, crystallographic, thermal and electrical conductivity properties of Ln{sub 0.5}Sr{sub 0.5}Ti{sub 0.5}Mn{sub 0.5}O{sub 3±d} complex perovskites were investigated using X-ray diffraction (XRD), Rietveld method, thermogravimetric analysis (TGA) and electrical conductivity to apply these oxide materials for the HT-SOFC anode materials. XRD results showed that Ln{sub 0.5}Sr{sub 0.5}Ti{sub 0.5}Mn{sub 0.5}O{sub 3±d} oxide systems synthesized as single phases did not react with 8 mol% yttriamore » stabilized zirconia (8YSZ) and 10 mol% Gd-doped cerium oxide (CGO91) up to 1500 °C and did not decompose under dry 3.9% hydrogen at 850 °C. The crystal structures of La{sub 0.5}Sr{sub 0.5}Ti{sub 0.5}Mn{sub 0.5}O{sub 3±d} (LSTM), Nd{sub 0.5}Sr{sub 0.5}Ti{sub 0.5}Mn{sub 0.5}O{sub 3±d} (NSTM) and Sm{sub 0.5}Sr{sub 0.5}Ti{sub 0.5}Mn{sub 0.5}O{sub 3±d} (SSTM) showed orthorhombic symmetry with the space group Pbnm and SSTM showed a more distorted structure. Thermogravimetric analysis (TGA) proved weight gains in these three sample occurred under oxidizing conditions and weight loss under reducing conditions. Electrical conductivity values of NSTM were higher than those of LSTM and SSTM under oxidizing and reducing conditions. - Graphical abstract: The B-site cations (Ti/Mn) are surrounded by regular octahedra of oxygen in Nd{sub 0.5}Sr{sub 0.5}Ti{sub 0.5}Mn{sub 0.5}O{sub 3±d}(NSTM). These octahedra are linked together in a corner sharing three dimensional framework, while Nd/Sr ion occupies 12-coordinated A-site between these octahedra. The Ti/Mn–O{sub 6} octahedra are elongated along the c-axis. The crystal structure distortion was due to the smaller ionic radius of the A-site cations, which force the (Ti
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
Spin stability of sounding rocket secondary payloads following high velocity ejections
NASA Astrophysics Data System (ADS)
Nelson, Weston M.
The Auroral Spatial Structures Probe (ASSP) mission is a sounding rocket mission studying solar energy input to space weather. ASSP requires the high velocity ejection (up to 50 m/s) of 6 secondary payloads, spin stabilized perpendicular to the ejection velocity. The proposed scientific instrumentation depends on a high degree of spin stability, requiring a maximum coning angle of less than 5°. It also requires that the spin axis be aligned within 25° of the local magnetic field lines. The maximum velocities of current ejection methods are typically less than 10m/s, and often produce coning angles in excess of 20°. Because of this they do not meet the ASSP mission requirements. To meet these requirements a new ejection method is being developed by NASA Wallops Flight Facility. Success of the technique in meeting coning angle and B-field alignment requirements is evaluated herein by modeling secondary payload dynamic behavior using a 6-DOF dynamic simulation employing state space integration written in MATLAB. Simulation results showed that secondary payload mass balancing is the most important factor in meeting stability requirements. Secondary mass payload properties will be measured using an inverted torsion pendulum. If moment of inertia measurement errors can be reduced to 0.5%, it is possible to achieve mean coning and B-field alignment angles of 2.16° and 2.71°, respectively.
Adebayo, G I; Coker, H A; Fagbure, F
1988-01-01
Renal effects of nifedipine were assessed in 3 groups of healthy normotensive volunteers. In the first group (N = 10), a single 20-mg dose of the slow-release formulation caused an increase in 8-h sodium excretion (P less than 0.025) and urine volume (P less than 0.005). Natriuresis (P less than 0.05) and diuresis (P less than 0.05) were still evident after 1 wk of pretreatment, but were significantly attenuated (P less than 0.05), in each case, compared to levels after a single dose. Natriuresis and diuresis after 2 wk of intake were indistinguishable from control levels. In another group of 8, a single 10 mg dose of the conventional formulation (capsule) effected natriuresis (P less than 0.01) and diuresis (P less than 0.001) similar to those associated with intake of a single 20-mg dose of the slow-release formulation. Natriuresis and diuresis associated with a 20-mg single dose of the conventional formulation were not different from control but were less than those following intake of the 10-mg dose (P less than 0.025 in each case). In the third group of 6, nifedipine, though weaker than chlorothiazide, promoted natriuresis (P less than 0.025) and diuresis (P less than 0.025) of the thiazide without augmenting its kaliuresis. In all the groups, there were no changes in creatinine clearance, and nifedipine did not alter kaliuresis. It is suggested that natriuretic and diuretic effects of nifedipine in healthy normotensive individuals are dependent on the dose employed, the formulation used, and the duration of treatment.(ABSTRACT TRUNCATED AT 250 WORDS)
NASA Technical Reports Server (NTRS)
1975-01-01
Preliminary estimates were prepared of the economic benefits to the U.S. economy from secondary applications of NASA technology. Technology is defined as the body of knowledge concerning how society's resources can be combined to yield economic goods and services, and NASA technology represents NASA's contribution to this body of technical knowledge. Secondary applications refer to uses of NASA generated knowledge for purposes other than those primary mission-oriented ones for which the original R&D was done. Case studies in cryogenics, integrated circuits, gas turbines, and NASTRAN are presented.
NASA Astrophysics Data System (ADS)
Chen, Xiuli; Li, Xiaoxia; Yan, Xiao; Liu, Gaofeng; Zhou, Huanfu
2018-02-01
(Ba1-x Bi x )(Ti1-x Ni0.5x Sn0.5x )O3 (BBTNS, 0.02 ≤ x ≤ 0.1) samples have been synthesized by traditional solid-state reaction technique and their structural transformation and dielectric properties investigated. X-ray diffraction (XRD) analysis revealed that BBTNS could form a homogeneous solid solution, and the transformation from tetragonal to pseudocubic phase occurred at 0.04 ≤ &!nbsp;x ≤ 0.06. Optimized properties with stable ɛ r (˜ 1829 to 1838), small Δɛ/ɛ 25°C values (± 15%) over a broad temperature range from -60°C to 140°C, and low tan Δ (≤ 0.02) from 4°C to 194°C were obtained at x = 0.1. The relaxation and conduction process in the high-temperature region are attributed to thermal activation, and oxygen vacancies may be the ionic charge carriers in perovskite ferroelectrics.
The secondary release of mercury in coal fly ash-based flue-gas mercury removal technology.
He, Jingfeng; Duan, Chenlong; Lei, Mingzhe; Zhu, Xuemei
2016-01-01
The secondary release of mercury from coal fly ash is a negative by-product from coal-fired power plants, and requires effective control to reduce environmental pollution. Analysing particle size distribution and composition of the coal fly ash produced by different mercury removing technologies indicates that the particles are generally less than 0.5 mm in size and are composed mainly of SiO2, Al2O3, and Fe2O3. The relationships between mercury concentration in the coal fly ash, its particle size, and loss of ignition were studied using different mercury removing approaches. The research indicates that the coal fly ash's mercury levels are significantly higher after injecting activated carbon or brominating activated carbon when compared to regular cooperating-pollution control technology. This is particularly true for particle size ranges of >0.125, 0.075-0.125, and 0.05-0.075 mm. Leaching experiments revealed the secondary release of mercury in discarded coal fly ash. The concentration of mercury in the coal fly ash increases as the quantity of injecting activated carbon or brominating activated carbon increases. The leached concentrations of mercury increase as the particle size of the coal fly ash increases. Therefore, the secondary release of mercury can be controlled by adding suitable activated carbon or brominating activated carbon when disposing of coal fly ash. Adding CaBr2 before coal combustion in the boiler also helps control the secondary release of mercury, by increasing the Hg(2+) concentration in the leachate. This work provides a theoretical foundation for controlling and removing mercury in coal fly ash disposal.
2016-12-21
This image of a southern mid-latitude crater was intended to investigate the lineated material on the crater floor. At the higher resolution of HiRISE, the image reveals a landscape peppered by small impact craters. These craters range from about 30 meters in diameter down to the resolution limit (about 2 meter diameter in this image acquired by averaging 2x2 picture elements). Such dense clusters of small craters are frequently formed by secondary craters, caused by the impact of material that was excavated and ejected from the surface of Mars during the creation of a larger nearby crater by the impact of a comet or an asteroid. Secondary impact craters are both interesting and vexing. They are interesting because they show the trajectories of the material that was ejected from the primary impact with the greatest speeds, typically material from near the surface of the blast zone. Secondary craters are often found along the traces of crater rays, linear features that extend radially from fresh impact craters and can reach many crater diameters in length. Secondary craters can be useful when crater rays are visible and the small craters can be associated with a particular primary impact crater. They can be used to constrain the age of the surface where they fell, since the surface must be older than the impact event. The age of the crater can be approximately estimated from the probability of an impact that produced a crater of such a size within a given area of Mars over a given time period. But these secondary craters can also be perplexing when no crater rays are preserved and a source crater is not easily identifiable, as is the case here. The impact that formed these secondary craters took place long enough ago that their association with a particular crater has been erased. They do not appear along the trace of a crater ray that is still apparent in visible or thermal infrared observations. These secondary craters complicate the task of estimating the age of
NASA Technical Reports Server (NTRS)
Choi, Michael K.
2016-01-01
The Swift BAT LHP #0 primary heater controller failed on March 31, 2010. It has been disabled. On October 31, 2015, the secondary heater controller of this LHP failed. On November 1, 2015, the LHP #0 CC temperature increased to as 18.6 C, despite that the secondary heater controller set point was 8.8 C. It caused the average DM XA1 temperature to increase to 25.9 C, which was 5 C warmer than nominal. As a result, the detectors became noisy. To solve this problem, the LHP #1 secondary heater controller set point was decreased in 0.5 C decrements to 2.2 C. The set-point decrease restored the average DM XA1 temperature to a nominal value of 19.7 C on November 21.
R-loops: targets for nuclease cleavage and repeat instability.
Freudenreich, Catherine H
2018-01-11
R-loops form when transcribed RNA remains bound to its DNA template to form a stable RNA:DNA hybrid. Stable R-loops form when the RNA is purine-rich, and are further stabilized by DNA secondary structures on the non-template strand. Interestingly, many expandable and disease-causing repeat sequences form stable R-loops, and R-loops can contribute to repeat instability. Repeat expansions are responsible for multiple neurodegenerative diseases, including Huntington's disease, myotonic dystrophy, and several types of ataxias. Recently, it was found that R-loops at an expanded CAG/CTG repeat tract cause DNA breaks as well as repeat instability (Su and Freudenreich, Proc Natl Acad Sci USA 114, E8392-E8401, 2017). Two factors were identified as causing R-loop-dependent breaks at CAG/CTG tracts: deamination of cytosines and the MutLγ (Mlh1-Mlh3) endonuclease, defining two new mechanisms for how R-loops can generate DNA breaks (Su and Freudenreich, Proc Natl Acad Sci USA 114, E8392-E8401, 2017). Following R-loop-dependent nicking, base excision repair resulted in repeat instability. These results have implications for human repeat expansion diseases and provide a paradigm for how RNA:DNA hybrids can cause genome instability at structure-forming DNA sequences. This perspective summarizes mechanisms of R-loop-induced fragility at G-rich repeats and new links between DNA breaks and repeat instability.
Nutritional Status of Adolescents Attending the Iranian Secondary School in Kuala Lumpur, Malaysia
Zarei, Maryam; MSL, Huang; Taib, Mohd Nasir Mohd; Zarei, Fatemeh
2014-01-01
Introduction: The aim or this study was to determine factors associated with body weight status among Iranian adolescents in the two Secondary Schools run by the Embassy in Kuala Lumpur. Methods: A self administered questionnaire was used to assess socio demographic characteristics, physical activity, and body image. Dietary intake was recorded through individual interviews with the researcher. The Physical Activity Questionnaire for children (PAQ-C) was used to evaluate levels of physical activity of the adolescents. Results: One-third (32.2%) of respondents were of normal weight, 14.5% and 11.1% were overweight and obese respectively, while 18.6% and 23.6% were severe thinness and thinness respectively. While the distribution of obese respondents by gender was almost the same, overweight females (16.4%) exceeded overweight males (12.7%) and although more females were in the thinness category (24.7% compared to 22.7%), more males were severely thin (20.0%) compared to 17.1% of the females. Body weight status was significantly associated with age (p < 0.05), gender (p < 0.05) and grade (p < 0.05). Males had significantly higher physically activity scores than females (p < 0.05). Intake of all micronutrients were higher than Dietary Reference Intake (DRI), except for vitamins B1, B2, C, D and E, Folate, Zinc, Magnesium, Potassium, Calcium and Phosphorus. There was a tendency for the females to overestimate their weight and 72.6% of them expressed their desire to lose weight while 60% of the males wanted to gain weight. There was also significant association between body weight status and perception of ideal body size (p = 0.000) and healthy body size (p = 0.000). Conclusion: This study provides some information for the Iranian Secondary school to design intervention programs to improve the body weight status of their students. PMID:25363094
Nutritional status of adolescents attending the Iranian secondary school in Kuala Lumpur, Malaysia.
Zarei, Maryam; Msl, Huang; Mohd Taib, Mohd Nasir; Zarei, Fatemeh
2014-07-29
The aim or this study was to determine factors associated with body weight status among Iranian adolescents in the two Secondary Schools run by the Embassy in Kuala Lumpur. A self administered questionnaire was used to assess socio demographic characteristics, physical activity, and body image. Dietary intake was recorded through individual interviews with the researcher. The Physical Activity Questionnaire for children (PAQ-C) was used to evaluate levels of physical activity of the adolescents. One-third (32.2%) of respondents were of normal weight, 14.5% and 11.1% were overweight and obese respectively, while 18.6% and 23.6% were severe thinness and thinness respectively. While the distribution of obese respondents by gender was almost the same, overweight females (16.4%) exceeded overweight males (12.7%) and although more females were in the thinness category (24.7% compared to 22.7%), more males were severely thin (20.0%) compared to 17.1% of the females. Body weight status was significantly associated with age (p < 0.05), gender (p < 0.05) and grade (p < 0.05). Males had significantly higher physically activity scores than females (p < 0.05). Intake of all micronutrients were higher than Dietary Reference Intake (DRI), except for vitamins B1, B2, C, D and E, Folate, Zinc, Magnesium, Potassium, Calcium and Phosphorus. There was a tendency for the females to overestimate their weight and 72.6% of them expressed their desire to lose weight while 60% of the males wanted to gain weight. There was also significant association between body weight status and perception of ideal body size (p = 0.000) and healthy body size (p = 0.000). This study provides some information for the Iranian Secondary school to design intervention programs to improve the body weight status of their students.
Sun, Chao; Tian, Jiwei; Liu, Xinhui; Guan, Guoping
2017-08-26
The molecular mechanism underlying the fibrosis of ligamentum flavum(LF) in patients with lumbar spinal canal stenosis(LSCS) remains unknown. MicroRNAs are reported to play important roles in regulating fibrosis in different organs. The present study aimed to identify fibrosis related miR-21 expression profile and investigate the pathological process of miR-21 in the fibrosis of LF hypertrophy and associated regulatory mechanisms. 15 patients with LSCS underwent surgical treatment were enrolled in this study. For the control group, 11 patients with lumbar disc herniation(LDH) was included. The LF thickness was measured on MRI. LF samples were obtained during the surgery. Fibrosis score was assessed by Masson's trichrome staining. The expression of miR-21 in LF tissues were determined by RT-PCR. Correlation among LF thickness, fibrosis score, and miR-21 expression was analyzed. In addition, Lentiviral vectors for miR-21 mimic were constructed and transfected into LF cells to examine the role of miR-21 in LF fibrosis. Types I and III collagen were used as indicators of fibrosis. IL-6 expression in LF cells after transfection was investigated by RT-PCR and ELISA. Patients in two groups showed similar outcomes regarding age, gender, level of LF tissue. The thickness and fibrosis score of LF in the LSCS group were significantly greater than those in LDH group (all P < 0.05). Similarly, the expression of miR-21 in LSCS group was substantially higher than that in LDH group(P < 0.05). Furthermore, the miR-21 expression exhibited positive correlations with the LF thickness (r = 0.595, P < 0.05) and fibrosis score (r = 0.608, P < 0.05). Of note, miR-21 over-expression increased the expression levels of collagen I and III (P < 0.05). Also, IL-6 expression and secretion in LF cells was elevated after transfection of miR-21 mimic. MiR-21 is a fibrosis-associated miRNA and promotes inflammation in LF tissue by activating IL-6 expression, leading to LF fibrosis and
The Depiction of Native Americans in Recent (1991-1998) Secondary American History Textbooks.
ERIC Educational Resources Information Center
Sanchez, Antonio R.
As a follow-up to studies by R. Costo and J. Henry (1970) and J. Loewen (1995), this study examined 12 current secondary level U.S. history textbooks to evaluate their accuracy in depicting Native Americans. The criteria embodied an authenticity guideline based upon the "Five Great Values" (generosity and sharing, respect for elders and…
[miR-497 suppresses proliferation of human cervical carcinoma HeLa cells by targeting cyclin E1].
Han, Jiming; Huo, Manpeng; Mu, Mingtao; Liu, Junjun; Zhang, Jing
2014-06-01
To evaluate the effect of miR-497 on proliferation of human cervical carcinoma HeLa cells and target relationship between miR-497 and cyclin E1 (CCNE1). Pre-miR-497 sequences were synthesized and cloned into pcDNATM6.2-GW to construct recombinant plasmid pcDNATM6.2-GW-pre-miR-497 and identified by real-time quantitative PCR (qRT-PCR). In addition, sequences of the wild-type CCNE1 (WT-CCNE1) and mutant CCNE1 (MT-CCNE1) were respectively cloned into pmirGLO vectors. MTT assay was used to explore the impact of miR-497 on the proliferation of HeLa cells. Furthermore, the target effect of miR-497 on the CCNE1 was identified by dual-luciferase reporter assay system, qRT-PCR and Western blotting. The recombinant plasmids pcDNATM6.2-GW-pre-miR-497 and pmirGLO-WT-CCNE1, pmirGLO-MT-CCNE1 were successfully constructed, and the miR-497 expression level in HeLa cells transfected with pre-miR-497 was significantly higher than that in the neg-miR group (P<0.05). MTT assay showed that miR-497 could significantly inhibit the proliferation of HeLa cells (P<0.05). A remarkable reduction of luciferase activities of WT-CCNE1 reporter was observed in HeLa cells with pre-miR-497 transfection (P<0.01), and the mRNA and protein expression levels of CCNE1 were down-regulated in HeLa cells transfected with pre-miR-497 (P<0.05). Over-expressed miR-497 in HeLa cells could suppress cell proliferation by targeting CCNE1.
Condom use among Hispanic men with secondary female sexual partners.
Marin, B V; Gomez, C A; Tschann, J M
1993-01-01
Greater understanding of psychosocial predictors of the use of condoms among Hispanics is needed in prevention efforts related to the human immunodeficiency virus and sexually transmitted disease epidemics among Hispanics in the United States. A telephone survey was carried out in nine States that have large populations of Hispanics, using a stratified clustered random digit dialing sampling strategy. The survey yielded interviews with 968 Hispanic men ages 18-49 years. Of them, 361 (37.8 percent) reported at least one secondary female sexual partner in the 12 months prior to the interview. Predictors were identified of condom use by those men with their secondary sex partners. Key predictors of the subjects' condom use with secondary partners included carrying condoms; self-efficacy, or a measure of the subject's perceived ability to use condoms under difficult circumstances; positive attitude toward condom use; having friends who used condoms; and lack of symptoms of depression in the week before the interview (R2 = 0.35). Significant predictors of condom carrying were being comfortable in sexual situations, positive attitude toward condom use, and self-efficacy to use condoms. Less acculturated men had more positive attitudes toward condom use and carried them more than did more acculturated men. The researchers found encouraging levels of condom use with secondary sexual partners among Hispanic men with multiple partners.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8265759
ERIC Educational Resources Information Center
Pugh, Geoff; Telhaj, Shqiponje
2008-01-01
Social capital theory, recent developments in the theory of identity and a small econometric literature all suggest positive attainment effects from faith schooling. To test this hypothesis, the authors use a unique data set on Flemish secondary school students from the 1999 repeat of the Third International Mathematics and Science Study to…
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-11
...-0117; Airspace Docket No. 09-AGL-31] RIN 2120-AI92 Proposed Establishment of Restricted Areas R-5402, R-5403A, R- 5403B, R-5403C, R-5403D, R-5403E, R-5403F; Devils Lake, ND AGENCY: Federal Aviation... Restricted Areas R-5402, R-5403A, R-5403B, R- 5403C, R-5403D, R-5403E, R-5403F; Devils Lake, ND (76 FR 72869...
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-06
... DEPARTMENT OF EDUCATION [Docket No. ED-2013-ICCD-0025] Agency Information Collection Activities...-School Youth AGENCY: Office of Elementary and Secondary Education (OESE), Department of Education (ED.... Department of Education, 400 Maryland Avenue SW., LBJ, Room 2E117, Washington, DC 20202-4537. FOR FURTHER...
NASA Technical Reports Server (NTRS)
Wells, Mark
2017-01-01
Active positioning of the GHAPS secondary telescope mirror is desired to correct for rigid body deflections due to temperature variations and gravity sag in the telescope structure that may impact optical performance. The current design concept for the secondary mirror mount uses a Commercial-Off -the-Shelf hexapod for mirror positioning and fine adjustment. The Hexapod specification states that motions as small as 0.1 microns along the optical axis and 2 microns perpendicular to the optical axis will cause optical aberrations that will require correction by repositioning the secondary mirror. In addition, the secondary mirror mount and positioning system must survive a 15g shock of parachute opening and landing during the instrument recovery operation. The secondary mirror positioning system must operate at a minimum specified temperature of -50 C. The telescope operates in the IR and the secondary mirror mount and positioning device is in the metering path between the primary and secondary mirrors. I2R losses in positioning system actuator devices, which may cause heating of the positioning system and secondary mirror, must be minimized due to the previously mentioned alignment sensitivity and the viewing spectrum of interest. The GHAPs project was cancelled on June 30, 2017. The purpose of this study is to address some of the issues identified with the hexapod secondary mirror positioning system and identify alternative approaches. This information may be used if the project is re-started at a later date.
NASA Astrophysics Data System (ADS)
Jha, Pardeep K.; Jha, Priyanka A.; Singh, Vikash; Kumar, Pawan; Asokan, K.; Dwivedi, R. K.
2015-01-01
Investigations on the solid solutions (1-x) BiFeO3 - (x) Ba Zr0.025Ti0.975O3 (0.1 ≤ x ≤ 0.3) in the temperature range 300-750 K show colossal permittivity behavior and the occurrence of diffuse phase ferroelectric transition along with frequency dependent anomaly which disappears at temperature ˜450 K. For x = 0.3, these anomalies have been verified through differential scanning calorimetry and dielectric/impedance/conductivity measurements. The occurrence of peak in pyrocurrent (dPs/dT) vs. T plots also supports phase transition. With the increasing x, transition temperature decreases and diffusivity increases. This anomaly is absent at high frequencies (>100 kHz) in conductivity plots, indicating Polomska like surface phase transition, which is supported by modulus study.
Spin-phonon coupling and exchange interaction in Gd substituted YFe0.5Cr0.5O3
NASA Astrophysics Data System (ADS)
Singh, Karan; Sharma, Mohit K.; Mukherjee, K.
2018-02-01
We report the evolution of physical properties due to partial substitution of Gd on the Y site in a mixed metal oxide YFe0.5Cr0.5O3. This compound exhibits negative magnetization at low applied fields. Our investigations on Y1-xGdxFe0.5Cr0.5O3 (x = 0.0, 0.2, 0.4 and 0.6) compounds is carried out through magnetization and Raman spectroscopy studies. It is observed that even with 20% Gd substitution, the negative magnetization observed in YFe0.5Cr0.5O3 is suppressed. Due to magnetic rare earth ion Gd3+, additional exchange interaction of the form Gd-O-Fe/Cr dominates the magnetic interaction arising due to the transition metal ions. This results in positive magnetization in Gd-substituted compounds. Temperature dependent Raman spectroscopy along with magnetization studies revealed that the observed shifts of Raman mode is due to spin-phonon coupling. Hardening of Raman mode observed below 240 K in YFe0.5Cr0.5O3 weakens and softening of phonon modes was observed for Y0.4Gd0.6Fe0.5Cr0.5O3 compound. This implies that additional magnetic interactions due to Gd ions play a dominating role in dictating the behavior of the Gd-substituted compounds.
ERIC Educational Resources Information Center
Carlson, David Lee; Clay, Tracy
2010-01-01
Current research on the teaching of writing puts some secondary English teachers in a bind. While many teachers understand that the best ways for students to develop into strong writers is to encourage them to select personally relevant topics, de-emphasize mechanics, and provide opportunities to take risks, the message they receive from state and…
ERIC Educational Resources Information Center
Congress of the U.S., Washington, DC. House Committee on Education and Labor.
These congressional hearings contain testimony given in Washington, D.C. at nine hearings pertinent to the H.R. 6711 (Youth Act of 1980) and H.R. 6897 (Amendments to the Elementary Secondary Education Act of 1965). (These are bills to extend the authorization and improve youth training and employment programs, to extend the authorization of the…
Structural Transformations in High-Capacity Li 2 Cu 0.5 Ni 0.5 O 2 Cathodes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruther, Rose E.; Samuthira Pandian, Amaresh; Yan, Pengfei
2017-03-21
Cathode materials that can cycle > 1 Li+ per transition metal are of substantial interest to increase the overall energy density of lithium-ion batteries. Li2Cu0.5Ni0.5O2 has a very high theoretical capacity of ~ 500 mAh/g assuming both Li+ are cycled reversibly. The Cu2+/3+ and Ni2+/3+/4+ redox couples are also at high voltage, which could further boost the energy density of this system. Despite such promise, Li2Cu0.5Ni0.5O2 undergoes irreversible phase changes during charge (delithiation) that result in large first-cycle irreversible loss and poor long-term cycling stability. Oxygen is evolved before the Cu2+/3+ or Ni3+/4+ transitions are accessed. In this contribution, XRD,more » TEM, and TXM-XANES are used to follow the chemical and structural changes that occur in Li2Cu0.5Ni0.5O2 during electrochemical cycling. Li2Cu0.5Ni0.5O2 is a solid solution of orthorhombic Li2CuO2 and Li2NiO2, but the structural changes more closely mimic the Li2NiO2 endmember. Li2Cu0.5Ni0.5O2 loses long-range order during charge, but TEM analysis provides clear evidence for particle exfoliation and the transformation from orthorhombic to a partially layered structure. Linear combination fitting and principal component analysis of TXM-XANES are used to map the different phases that emerge during cycling ex situ and in situ. Significant changes in the XANES at the Cu and Ni K-edges correlate with the onset of oxygen evolution.« less
Structural transformations in high-capacity Li 2Cu 0.5Ni 0.5O 2 cathodes
Ruther, Rose E.; Pandian, Amaresh Samuthira; Yan, Pengfei; ...
2017-03-09
Cathode materials that can cycle >1 Li + per transition metal are of substantial interest for increasing the overall energy density of lithium-ion batteries. Li 2Cu 0.5Ni 0.5O 2 has a very high theoretical capacity of ~500 mAh/g assuming both Li+ ions are cycled reversibly. The Cu 2+/3+ and Ni 2+/3+/4+ redox couples are also at high voltage, which could further boost the energy density of this system. Despite such promise, Li 2Cu 0.5Ni 0.5O 2 undergoes irreversible phase changes during charge (delithiation) that result in large first-cycle irreversible loss and poor long-term cycling stability. Oxygen evolves before the Cumore » 2+/3+ or Ni 3+/4+ transitions are accessed. In this contribution, X-ray diffraction, transmission electron microscopy (TEM), and transmission X-ray microscopy combined with X-ray absorption near edge structure (TXM–XANES) are used to follow the chemical and structural changes that occur in Li 2Cu 0.5Ni 0.5O 2 during electrochemical cycling. Li 2Cu 0.5Ni 0.5O 2 is a solid solution of orthorhombic Li2CuO2 and Li2NiO2, but the structural changes more closely mimic the changes that the Li 2NiO 2 endmember undergoes. Li 2Cu 0.5Ni 0.5O 2 loses long-range order during charge, but TEM analysis provides clear evidence of particle exfoliation and the transformation from orthorhombic to a partially layered structure. Linear combination fitting and principal component analysis of TXM–XANES are used to map the different phases that emerge during cycling ex situ and in situ. Lastly, significant changes in the XANES at the Cu and Ni K-edges correlate with the onset of oxygen evolution.« less
Varsos, Constantinos; Patkos, Theodore; Pavloudi, Christina; Gougousis, Alexandros; Ijaz, Umer Zeeshan; Filiopoulou, Irene; Pattakos, Nikolaos; Vanden Berghe, Edward; Fernández-Guerra, Antonio; Faulwetter, Sarah; Chatzinikolaou, Eva; Pafilis, Evangelos; Bekiari, Chryssoula; Doerr, Martin; Arvanitidis, Christos
2016-01-01
Abstract Background Parallel data manipulation using R has previously been addressed by members of the R community, however most of these studies produce ad hoc solutions that are not readily available to the average R user. Our targeted users, ranging from the expert ecologist/microbiologists to computational biologists, often experience difficulties in finding optimal ways to exploit the full capacity of their computational resources. In addition, improving performance of commonly used R scripts becomes increasingly difficult especially with large datasets. Furthermore, the implementations described here can be of significant interest to expert bioinformaticians or R developers. Therefore, our goals can be summarized as: (i) description of a complete methodology for the analysis of large datasets by combining capabilities of diverse R packages, (ii) presentation of their application through a virtual R laboratory (RvLab) that makes execution of complex functions and visualization of results easy and readily available to the end-user. New information In this paper, the novelty stems from implementations of parallel methodologies which rely on the processing of data on different levels of abstraction and the availability of these processes through an integrated portal. Parallel implementation R packages, such as the pbdMPI (Programming with Big Data – Interface to MPI) package, are used to implement Single Program Multiple Data (SPMD) parallelization on primitive mathematical operations, allowing for interplay with functions of the vegan package. The dplyr and RPostgreSQL R packages are further integrated offering connections to dataframe like objects (databases) as secondary storage solutions whenever memory demands exceed available RAM resources. The RvLab is running on a PC cluster, using version 3.1.2 (2014-10-31) on a x86_64-pc-linux-gnu (64-bit) platform, and offers an intuitive virtual environmet interface enabling users to perform analysis of ecological
Varsos, Constantinos; Patkos, Theodore; Oulas, Anastasis; Pavloudi, Christina; Gougousis, Alexandros; Ijaz, Umer Zeeshan; Filiopoulou, Irene; Pattakos, Nikolaos; Vanden Berghe, Edward; Fernández-Guerra, Antonio; Faulwetter, Sarah; Chatzinikolaou, Eva; Pafilis, Evangelos; Bekiari, Chryssoula; Doerr, Martin; Arvanitidis, Christos
2016-01-01
Parallel data manipulation using R has previously been addressed by members of the R community, however most of these studies produce ad hoc solutions that are not readily available to the average R user. Our targeted users, ranging from the expert ecologist/microbiologists to computational biologists, often experience difficulties in finding optimal ways to exploit the full capacity of their computational resources. In addition, improving performance of commonly used R scripts becomes increasingly difficult especially with large datasets. Furthermore, the implementations described here can be of significant interest to expert bioinformaticians or R developers. Therefore, our goals can be summarized as: (i) description of a complete methodology for the analysis of large datasets by combining capabilities of diverse R packages, (ii) presentation of their application through a virtual R laboratory (RvLab) that makes execution of complex functions and visualization of results easy and readily available to the end-user. In this paper, the novelty stems from implementations of parallel methodologies which rely on the processing of data on different levels of abstraction and the availability of these processes through an integrated portal. Parallel implementation R packages, such as the pbdMPI (Programming with Big Data - Interface to MPI) package, are used to implement Single Program Multiple Data (SPMD) parallelization on primitive mathematical operations, allowing for interplay with functions of the vegan package. The dplyr and RPostgreSQL R packages are further integrated offering connections to dataframe like objects (databases) as secondary storage solutions whenever memory demands exceed available RAM resources. The RvLab is running on a PC cluster, using version 3.1.2 (2014-10-31) on a x86_64-pc-linux-gnu (64-bit) platform, and offers an intuitive virtual environmet interface enabling users to perform analysis of ecological and microbial communities based on
NASA Astrophysics Data System (ADS)
Sheets, Holly A.; Deming, Drake
2017-10-01
We present the results of our work to determine the average albedo for small, close-in planets in the Kepler candidate catalog. We have adapted our method of averaging short-cadence light curves of multiple Kepler planet candidates to long-cadence data, in order to detect an average albedo for the group of candidates. Long-cadence data exist for many more candidates than the short-cadence data, and so we separate the candidates into smaller radius bins than in our previous work: 1-2 {R}\\oplus , 2-4 {R}\\oplus , and 4-6 {R}\\oplus . We find that, on average, all three groups appear darker than suggested by the short-cadence results, but not as dark as many hot Jupiters. The average geometric albedos for the three groups are 0.11 ± 0.06, 0.05 ± 0.04, and 0.23 ± 0.11, respectively, for the case where heat is uniformly distributed about the planet. If heat redistribution is inefficient, the albedos are even lower, since there will be a greater thermal contribution to the total light from the planet. We confirm that newly identified false-positive Kepler Object of Interest (KOI) 1662.01 is indeed an eclipsing binary at twice the period listed in the planet candidate catalog. We also newly identify planet candidate KOI 4351.01 as an eclipsing binary, and we report a secondary eclipse measurement for Kepler-4b (KOI 7.01) of ˜7.50 ppm at a phase of ˜0.7, indicating that the planet is on an eccentric orbit.
Gu, Dongyu; Lazo-Portugal, Rodrigo; Fang, Chen; Wang, Zhantong; Ma, Ying; Knight, Martha; Ito, Yoichiro
2018-06-15
Centrifugal precipitation chromatography (CpC) is a powerful chromatographic technique invented in the year 2000 but so far very little applied. The method combines dialysis, counter-current and salting out processes. The separation rotor consists of two identical spiral channels separated by a dialysis membrane (6-8 K MW cut-off) in which the upper channel is eluted with an ammonium sulfate gradient and the lower channel with water, and the mixtures are separated according to their solubility in ammonium sulfate as a chromatographic technique. In the present study, the method was successfully applied for separation and purification of R-phycoerythrin (R-PE), a protein widely used as a fluorescent probe, from the red alga Gracilaria lemaneiformis. The separation was performed with the elution of ammonium sulfate from 50% to 0% in 21.5 h at a flow rate of 0.5 ml/min, while the lower channel was eluted with water at a flow rate of 0.05 ml/min after sample charge, and the column was rotated at 200 rpm. After a single run, the absorbance ratio A 565 /A 280 (a criterion for the purity of R-PE) was increased from 0.5 of the crude to 6.5. The purified R-PE exhibited a typical "three peaks" spectrum with absorbance maximum at 497, 538 and 565 nm. The Native-PAGE showed one single protein band and 20 kDa (subunits α and β) and 30 kDa (subunit γ) can be observed in SDS-PAGE analysis which were consistent with the (αβ) 6 γ subunit composition of R-PE. The results indicated that CpC is an efficient method to obtain protein with the high purity from a complex source. Copyright © 2018 Elsevier B.V. All rights reserved.
Chatrchyan, Serguei
2014-10-16
Measurements of the inclusive jet cross section with the anti-kt clustering algorithm are presented for two radius parameters, R=0.5 and 0.7. They are based on data from LHC proton-proton collisions atmore » $$\\sqrt{s}$$ = 7 TeV corresponding to an integrated luminosity of 5.0 inverse femtobarns collected with the CMS detector in 2011. The ratio of these two measurements is obtained as a function of the rapidity and transverse momentum of the jets. Significant discrepancies are found comparing the data to leading-order simulations and to fixed-order calculations at next-to-leading order, corrected for nonperturbative effects, whereas simulations with next-to-leading-order matrix elements matched to parton showers describe the data best.« less
Sancho-Puchades, Manuel; Vílchez-Pérez, Miguel A.; Paredes-García, Jordi; Berini-Aytés, Leonardo; Gay-Escoda, Cosme
2012-01-01
Objective: To compare the anesthetic action of 0.5% bupivacaine in relation to 4% articaine, both with 1:200,000 epinephrine, in the surgical removal of lower third molars. As a secondary objective hemodynamic changes using both anesthetics were analyzed. Study Design: Triple-blind crossover randomized clinical trial. Eighteen patients underwent bilateral removal of impacted lower third molars using 0.5% bupivacaine or 4% articaine in two different appointments. Preoperative, intraoperative and postoperative variables were recorded. Differences were assessed with McNemar tests and repeated measures ANOVA tests. Results: Both solutions exhibited similar latency times and intraoperative efficacy. Statistical significant lower pain levels were observed with bupivacaine between the fifth (p=0.011) and the ninth (p=0.007) postoperative hours. Bupivacaine provided significantly longer lasting soft tissue anesthesia (p<0.05). Systolic blood pressure and heart rate values were significantly higher with articaine. Conclusions: Bupivacaine could be a valid alternative to articaine especially due to its early postoperative pain prevention ability. Key words:Bupivacaine, articaine, third molar, anesthesia, postoperative pain. PMID:22143739
Atorvastatin Protects Myocardium Against Ischemia-Reperfusion Injury Through Inhibiting miR-199a-5p.
Zuo, YaBei; Wang, YuZhao; Hu, HaiJuan; Cui, Wei
2016-01-01
This study aimed to evaluate the protective effects of atorvastatin against myocardial ischemia/reperfusion (I/R) injury in cardiomyocytes and its possible underlying mechanism. Direct cytotoxic effect of OGD/R on cardiomyocytes with and without atorvastatin pretreatment was evaluated. Effects of atorvastatin on expression of GSK-3β and miR-199a-5p were determined using RT-PCR and Western blot. In addition, GSK-3β expression with miR-199a-5p upregulation and downregulation was detected using RT-PCR, Western blot, and immunohistochemistry. Pretreatment with atorvastatin significantly improved the recovery of cells viability from OGD/R (p<0.05). In addition, the atorvastatin pretreatment significantly increased GSK-3β expression both in mRNA level and protein level and decreased miR-199a-5p expression in mRNA level (p<0.05). Upregulation and downregulation of miR-199a-5p respectively decreased and increased GSK-3β expression both in mRNA level and protein level. These results suggested that atorvastatin provides the cardioprotective effects against I/R injury via increasing GSK-3β through inhibition of miR-199a-5p. © 2016 The Author(s) Published by S. Karger AG, Basel.
Schneiders, T.; Amyes, S. G. B.; Levy, S. B.
2003-01-01
The MICs of ciprofloxacin for 33 clinical isolates of K. pneumoniae resistant to extended-spectrum cephalosporins from three hospitals in Singapore ranged from 0.25 to >128 μg/ml. Nineteen of the isolates were fluoroquinolone resistant according to the NCCLS guidelines. Strains for which the ciprofloxacin MIC was ≥0.5 μg/ml harbored a mutation in DNA gyrase A (Ser83→Tyr, Leu, or IIe), and some had a secondary Asp87→Asn mutation. Isolates for which the MIC was 16 μg/ml possessed an additional alteration in ParC (Ser80→IIe, Trp, or Arg). Tolerance of the organic solvent cyclohexane was observed in 10 of the 19 fluoroquinolone-resistant strains; 3 of these were also pentane tolerant. Five of the 10 organic solvent-tolerant isolates overexpressed AcrA and also showed deletions within the acrR gene. Complementation of the mutated acrR gene with the wild-type gene decreased AcrA levels and produced a two- to fourfold reduction in the fluoroquinolone MICs. None of the organic solvent-tolerant clinical isolates overexpressed another efflux-related gene, acrE. While marA and soxS were not overexpressed, another marA homologue, ramA, was overexpressed in 3 of 10 organic solvent-tolerant isolates. These findings indicate that multiple target and nontarget gene changes contribute to fluoroquinolone resistance in K. pneumoniae. Besides AcrR mutations, ramA overexpression (but not marA or soxS overexpression) was related to increased AcrAB efflux pump expression in this collection of isolates. PMID:12936981
Gurajala, Indira; Thipparampall, Anil Kumar; Durga, Padmaja; Gopinath, R
2015-02-01
The effect of perineural dexmedetomidine on the time to onset, quality and duration of motor block with ropivacaine has been equivocal and its interaction with general anaesthesia (GA) has not been reported. We assessed the influence of dexmedetomidine added to 0.5% ropivacaine on the characteristics of supraclavicular brachial plexus block and its interaction with GA. In a randomised, double blind study, 36 patients scheduled for orthopaedic surgery on the upper limb under supraclavicular block and GA were divided into either R group (35 ml of 0.5% ropivacaine with 0.5 ml of normal saline [n - 18]) or RD group (35 mL of 0.5% ropivacaine with 50 μg dexmedetomidine [n - 18]). The onset time and duration of motor and sensory blockade were noted. The requirement of general anaesthetics was recorded. Both the groups were comparable in demographic characteristics. The time of onset of sensory block was not significantly different. The proportion of patients who achieved complete motor blockade was more in the RD group. The onset of motor block was earlier in group RD than group R (P < 0.05). The durations of analgesia, sensory and motor blockade were significantly prolonged in group RD (P < 0.00). The requirement of entropy guided anaesthetic agents was not different in both groups. The addition of dexmedetomidine to 0.5% ropivacaine improved the time of onset, quality and duration of supraclavicular brachial plexus block but did not decrease the requirement of anaesthetic agents during GA.
NASA Astrophysics Data System (ADS)
Waagen, Elizabeth O.
2016-01-01
Dr. George Wallerstein (University of Washington) has requested AAVSO coverage of the long period/symbiotic variable R Aquarii beginning immediately in support of high resolution spectroscopic observations planned for 2016 January 19 and 21. Several other astronomers, including Drs. Lee Anne Willson (Iowa State University), Ulisse Munari (INAF, Astronomical Observatory of Padua, Italy), and Fred Walter (Stony Brook University) are studying R Aqr closely and additional spectroscopic and other observations are planned for the near future. R Aqr is both a Mira (M) and a symbiotic (ZAND) - it is a close binary system consisting of a hot star and a late-type star (the Mira), both enveloped in nebulosity. As a result, the very interesting light curve shows not only the Mira pulsation but also complex eclipse behavior as the two stars interact. The period of Mira variation is 387.0 days; the eclipse period is 43.6-44 years. The cause of the eclipse is unknown; several theories h! ave been proposed, including a focused accretion stream, a disk or cloud around the secondary, and a triggered mass loss that produces an opaque cloud. Careful investigation of this upcoming event should help to resolve this question. The last eclipse of R Aqr was in 1978. The next eclipse is predicted for 2022, but may be early. The current behavior of R Aqr suggests that the eclipse, which lasts for several years, may either be beginning or its beginning may be imminent. R Aqr was at minimum in early December 2015 at magnitude V=11.4, and is currently at visual magnitude 11.0. During this phase of the approximately 44-year eclipse cycle, at maximum it may be as bright as V 6.0-6.5 but is not expected to become brighter. Beginning immediately, nightly BVRI CCD and DSLR photometry and visual observations are requested. As R Aqr brightens towards maximum and is in range, PEP observations are also requested. Ongoing spectroscopy over the next several years will be interesting to see as the system
Wu, Zhengcui; Wu, Yaqin; Pei, Tonghui; Wang, Huan; Geng, Baoyou
2014-03-07
Novel hierarchical heteronanostructures of ZnO nanorods/ZnS·(HDA)0.5 (HDA = 1,6-hexanediamine) hybrid nanoplates on a zinc substrate are successfully synthesized on a large scale by combining hydrothermal growth (for ZnO nanorods) and liquid chemical conversion (for ZnS·(HDA)0.5 nanoplates) techniques. The formation of ZnS·(HDA)0.5 hybrid nanoplates branches takes advantage of the preferential binding of 1,6-hexanediamine on specific facets of ZnS, which makes the thickening rate much lower than the lateral growth rate. The ZnS·(HDA)0.5 hybrid nanoplates have a layered structure with 1,6-hexanediamine inserted into interlayers of wurtzite ZnS through the bonding of nitrogen. The number density and thickness of the secondary ZnS·(HDA)0.5 nanoplates can be conveniently engineered by variation of the sulfur source and straightforward adjustment of reactant concentrations such as 1,6-hexanediamine and the sulfur source. The fabricated ZnO/ZnS·(HDA)0.5 heteronanostructures show improved electrochemical catalytic properties for hydrazine compared with the primary ZnO nanorods. Due to its simplicity and efficiency, this approach could be similarly used to fabricate varieties of hybrid heterostructures made of materials with an intrinsic large lattice mismatch.
VizieR Online Data Catalog: HST photometry in R136 (Hunter+ 1995)
NASA Astrophysics Data System (ADS)
Hunter, D. A.; Shaya, E. J.; Holtzman, J. A.; Light, R. M.; Oneil, Earl J., Jr.
1996-01-01
We have analyzed Hubble Space Telescope (HST) images of the compact, luminous star cluster R136 in the LMC that were taken with the refurbished HST and new Wide Field/Planetary Camera. These images allow us to examine the stellar population in a region of unusually intense star formation at a scale of 0.01pc. We have detected stars to 23.5 in F555W and have quantified the stellar population to an M_555.0 of 0.9 or a mass of 2.8M⊙. Comparisons of HR diagrams with isochrones that were constructed for the HST flight filter system from theoretical stellar evolutionary tracks reveal massive stars, a main sequence to at least 2.8M⊙, and stars with M_555.0>=0.5 still on pre-main sequence tracks. The average stellar population is fit with a 3-4Myr isochrone. Contrary to expectations from star formation models, however, the formation period for the massive stars and lower mass stars appear to largely overlap. We have measured the IMF for stars 2.8-15M⊙ in three annuli from 0.5-4.7pc from the center of the cluster. The slopes of the IMF in all three annuli are the same within the uncertainties, thus, showing no evidence for mass segregation beyond 0.5pc. Furthermore, the combined IMF slope, -1.22+/-0.06, is close to a normal Salpeter IMF. The lower mass limit must be lower than the limits of our measurements: <=2.8M⊙ beyond 0.5pc and <=7M⊙ within 0.1pc. This is contrary to some predictions that the lower mass limit could be as high as 10M⊙ in regions of intense massive star formation. Integrated properties of R136 are consistent with its being comparable to a rather small globular cluster when such clusters were the same age as R136. From the surface brightness profile, an upper limit for core radius of 0.02pc is set. Within a radius of 0.4pc we estimate that there have been roughly 20 crossing times and relaxation should be well along. Within 0.5pc crowding prevents us from detecting the intermediate mass population, but there is a hint of an excess of stars
Diuretics, calciuria and secondary hyperparathyroidism in the Chronic Renal Insufficiency Cohort.
Isakova, Tamara; Anderson, Cheryl A M; Leonard, Mary B; Xie, Dawei; Gutiérrez, Orlando M; Rosen, Leigh K; Theurer, Jacquie; Bellovich, Keith; Steigerwalt, Susan P; Tang, Ignatius; Anderson, Amanda Hyre; Townsend, Raymond R; He, Jiang; Feldman, Harold I; Wolf, Myles
2011-04-01
Secondary hyperparathyroidism is a common complication of chronic kidney disease (CKD) that is associated with bone disease, cardiovascular disease and death. Pathophysiological factors that maintain secondary hyperparathyroidism in advanced CKD are well-known, but early mechanisms of the disease that can be targeted for its primary prevention are poorly understood. Diuretics are widely used to control volume status and blood pressure in CKD patients but are also known to have important effects on renal calcium handling, which we hypothesized could alter the risk of secondary hyperparathyroidism. We examined the relationship of diuretic treatment with urinary calcium excretion, parathyroid hormone (PTH) levels and prevalence of secondary hyperparathyroidism (PTH ≥ 65 pg/mL) in a cross-sectional study of 3616 CKD patients in the Chronic Renal Insufficiency Cohort. Compared with no diuretics, treatment with loop diuretics was independently associated with higher adjusted urinary calcium (55.0 versus 39.6 mg/day; P < 0.001), higher adjusted PTH [67.9, 95% confidence interval (CI) 65.2-70.7 pg/mL, versus 52.8, 95% CI 51.1-54.6 pg/mL, P < 0.001] and greater odds of secondary hyperparathyroidism (odds ratio 2.1; 95% CI 1.7-2.6). Thiazide monotherapy was associated with lower calciuria (25.5 versus 39.6 mg/day; P < 0.001) but only modestly lower PTH levels (50.0, 95% CI 47.8-52.3, versus 520.8, 95% CI 51.1-54.6 pg/mL, P = 0.04) compared with no diuretics. However, coadministration of thiazide and loop diuretics was associated with blunted urinary calcium (30.3 versus 55.0 mg/day; P <0.001) and odds of hyperparathyroidism (odds ratio 1.3 versus 2.1; P for interaction = 0.05) compared with loop diuretics alone. Loop diuretic use was associated with greater calciuria, PTH levels and odds of secondary hyperparathyroidism compared to no treatment. These associations were attenuated in patients who were coadministered thiazides. Diuretic choice is a potentially modifiable
Chen, Qi-Fen; Zhang, Yi-Wei
2018-02-01
To investigate the clinical effect of Saccharomyces boulardii powder combined with azithromycin sequential therapy in the treatment of children with diarrhea secondary to Mycoplasma pneumoniae pneumonia. A total of 88 children with diarrhea secondary to Mycoplasma pneumoniae pneumonia between June 2015 and March 2017 were divided into control group and study group using a random number table, with 44 children in each group. The children in the control group were given routine treatment combined with azithromycin sequential therapy, and those in the study group were given oral Saccharomyces boulardii powder in addition to the treatment in the control group until the end of azithromycin sequential therapy. After the treatment ended, the two groups were compared in terms of time to improvement of clinical symptoms, length of hospital stay, clinical outcome, defecation frequency before and after treatment, condition of intestinal dysbacteriosis, and incidence of adverse events. Compared with the control group, the study group had significantly shorter time to improvement of clinical symptoms and length of hospital stay (P<0.05). The study group had a significantly higher response rate than the control group (P<0.05). On days 3 and 5 of treatment, the study group had a significant reduction in defecation frequency compared with the control group (P<0.05). The study group had a significantly lower rate of intestinal dysbacteriosis than the control group (P<0.05). There was no significant difference in the incidence of adverse events between the two groups (P>0.05). In the treatment of children with diarrhea secondary to Mycoplasma pneumoniae pneumonia, Saccharomyces boulardii powder combined with azithromycin sequential therapy can improve clinical symptoms, shorten the length of hospital stay, reduce defecation frequency and the incidence of intestinal dysbacteriosis, and improve clinical outcomes, and does not increase the risk of adverse events.
NASA Astrophysics Data System (ADS)
Ha, Jooyeon; Ryu, Jiseung; Lee, Heesoo
2014-06-01
The doping effect of (Na0.5K0.5)NbO3 (NKN) as alternatives for rare-earth elements on the electrical properties of BaTiO3 has been investigated, in terms of their substitution behavior. The dielectric constant of a specimen with x = 0.05 was about 79% higher than that of pure BaTiO3, and the temperature coefficient of capacitance was satisfied by the X7R specification. The specimen with x = 0.05 showed the lowest tetragonality among the four compositions and had a fine grain size of <2 μm. Although the addition of NKN decreased the specimen's tetragonality, the electrical properties were enhanced by the formation of defect dipoles and conduction electrons, which resulted from an acceptor and donor substitution behavior. Through O K-edge near edge x-ray absorption fine structure spectroscopy, the practical substitution behavior was defined by the change in Ti 3d orbital states. The energy separation of the Ti 3d orbitals was more apparent with the specimen of x = 0.05, which is related to the donor level from the donor substitution of Nb5+ ion for Ti-sites. Therefore, the simultaneous substitution of Na+/K+ and Nb5+ ions into BaTiO3 can improve dielectric properties, based on the charge-transfer process.
Seasonality of primary and secondary production in an Arctic river
NASA Astrophysics Data System (ADS)
Kendrick, M.; Huryn, A.; Deegan, L.
2011-12-01
Rivers and streams that freeze solid for 8-9 months each year provide excellent examples of the extreme seasonality of arctic habitats. The communities of organisms inhabiting these rivers must complete growth and development during summer, resulting in a rapid ramp-up and down of production over the short ice-free period. The effects of recent shifts in the timing of the spring thaw and autumn freeze-up on the duration and pattern of the period of active production are poorly understood. We are currently investigating: 1) the response of the biotic community of the Kuparuk River (Arctic Alaska) to shifts in the seasonality of the ice-free period, and 2) the community response to increases in phosphorous (P) supply anticipated as the volume of the permafrost active-layer increases in response to climate warming. Here algal production supports a 2-tier web of consumers. We tracked primary and secondary production from the spring thaw through mid-August in a reference reach and one receiving low-level P fertilization. Gross primary production/community respiration (GPP/R) ratios for both reaches were increasing through mid-July, with higher GPP/R in response to the P addition. Understanding the degree of synchrony between primary and secondary production in this Arctic river system will enhance further understanding of how shifts in seasonality affect trophic dynamics.
Dar, M Abdullah; Majid, Kowsar; Hanief Najar, Mohd; Kotnala, R K; Shah, Jyoti; Dhawan, S K; Farukh, M
2017-04-19
This work reports the exploitation of nanocrystalline Ni 0.5 Zn 0.5 Fe 2-x Ce x O 4 ferrite for potential application by designing quasi-spherical shaped polythiophene (PTH) composites via in situ emulsion polymerization. The structural, electronic, dielectric, magnetic, and electromagnetic interference (EMI) shielding properties of PTH/Ni 0.5 Zn 0.5 Fe 2-x Ce x O 4 composites were investigated. Our results suggest that these properties could be optimized by modulating the concentration of x (composition) in the polymer matrix. Higher values of ε' and ε'' were obtained on composite formation, and could be due to the heterogeneity developed in the material. An enhancement in the value of saturation magnetization (123 emu g -1 for x = 0.04) and Curie temperature was obtained with Ce concentration, which is useful for high density recording purposes. A low value of saturation magnetization was obtained for the PTH/Ni 0.5 Zn 0.5 Fe 2-x Ce x O 4 composite (36 emu g -1 for x = 0.04). This could be attributed to the non-magnetic nature of the polymer. A total shielding effectiveness (SE T = SE A + SE R ) up to 34 dB (≈99.9% attenuation) was recorded for PTH/Ni 0.5 Zn 0.5 Fe 2-x Ce x O 4 composites (x = 0.04) in a frequency range of 8.2-12.4 GHz (X-band), which surpasses the shielding criteria of SE T > 30 dB for commercial purposes. Such a material with high SE identifies its potential for making electromagnetic shields. The effect of Ce substitution on the microstructure, dielectric, impedance and magnetic properties of PTH/Ni 0.5 Zn 0.5 Fe 2-x Ce x O 4 ferrite composites was also investigated. X-ray diffraction analysis confirmed cubic spinel phase formation, and the broad reflection peaks indicated the formation of smaller sized particles. The smaller energy band gap (2.53 eV) of the composite indicated that this material could be used for photocatalysis in the visible region. Dielectric and impedance measurements were carried out in a frequency range of 8
NASA Astrophysics Data System (ADS)
Ginting, M.; Aryanto, D.; Kurniawan, C.; Sari, A. Y.; Subhan, A.; Sudiro, T.; Sebayang, P.; Tarigan, E. R.; Nasruddin, M. N.; Sebayang, K.
2017-05-01
Zn0.95Ni0.05O has been synthesized by mixing 5% mol of NiO into ZnO using solid state reaction and high-speed shaker mill method. The samples were sintered at 900 °C with holding time for 2, 4 and 8 hours. Crystal structure, electrical and magnetic properties of Zn0.95Ni0.05O were characterized by using XRD, I-V, C-V and VSM. XRD results showed that variation of holding time does not change the structure of ZnO and no other secondary phase observed. The value of lattice parameters (a and c) tends to decrease proportionally to the holding time. The Intensity value changes and the peak shifted to a higher 2θ angle due to holding time variation. In general, the conductance of Zn0.95Ni0.05O decreases and the magnetic properties decrease also as the holding time is increased.
MiR146a and MiR499 gene polymorphisms in Iranian periodontitis and peri-implantitis patients.
Kadkhodazadeh, Mahdi; Jafari, Ali Reza; Amid, Reza; Ebadian, Ahmad Reza; Alipour, Marjan Mohammad; Mollaverdi, Fatemeh; Lafzi, Ardeshir
2013-01-01
MicroRNAs (MiRs) are small noncoding RNAs that are involved in protein translation, osteoclastogenesis, and immunoregulation. Peri-implantitis and chronic periodontitis are multifactorial diseases. They are the consequence of complex interactions among host response, genetics, and environment. In the present study, we aimed to investigate the possible association between MiR146a/MiR499 gene polymorphisms and periodontitis/peri-implantitis as a first report in oral implantology. From 197 individuals referred to Periodontology Department of Shahid Beheshti Dental School, three groups were enrolled in the assessment: 75 patients in the chronic periodontitis (CP) group, 38 patients in the peri-implantitis (PI) group, and 84 healthy subjects. DNA was extracted from fresh blood samples from the arm veins of participants and transferred to KBiosience Institute (Hoddesdon, United Kingdom) for genotyping. Chi-squared and Kruskal-Wallis tests were performed using SPSS software v.19 for statistical analyses. P-value < 0.05 was considered significant. The genotype frequencies in MiR 146a and MiR 499 were significantly different among the three groups. MiR146a (rs2910146) and MiR499 (rs3746444) gene polymorphisms may be genetic determinants for increased risk of chronic periodontitis and peri-implantitis in Iranians. More studies with larger sample sizes in different populations are necessary for determining the effect of these SNPs.
NASA Astrophysics Data System (ADS)
Yin, Zhu-Hua; Zhang, Jian-Min
2016-10-01
The structural stability, electronic, magnetic and optical properties of zincblende Zn0.5V0.5Te under pressures 0-5 GPa are investigated by the spin-polarized first-principles calculation. Under pressure, the Zn0.5V0.5Te is always half-metal with the total magnetic moment μtot of 3μB / cell mainly contributed by V2+ ion, but the spin-down channel opens a band gap. The Zn0.5V0.5Te also behaves in a ductile manner and is mechanical stable until 3.78 GPa pressure. The static dielectric function ε1 (0) and refractive index n (0) increase with pressure. The two absorption peaks located in energy regions 0-20 eV and 35-50 eV not only increase but also shift to the higher energy region (blue shift) with pressure. So the electronic and optical properties of Zn0.5V0.5Te could be tuned through external pressure, which is beneficial to the electronic and optical applications.
Oh, So-Young; Shin, Jung-Ho; Roe, Jung-Hye
2007-01-01
Organic hydroperoxide resistance in bacteria is achieved primarily through reducing oxidized membrane lipids. The soil-inhabiting aerobic bacterium Streptomyces coelicolor contains three paralogous genes for organic hydroperoxide resistance: ohrA, ohrB, and ohrC. The ohrA gene is transcribed divergently from ohrR, which encodes a putative regulator of MarR family. Both the ohrA and ohrR genes were induced highly by various organic hydroperoxides. The ohrA gene was induced through removal of repression by OhrR, whereas the ohrR gene was induced through activation by OhrR. Reduced OhrR bound to the ohrA-ohrR intergenic region, which contains a central (primary) and two adjacent (secondary) inverted-repeat motifs that overlap with promoter elements. Organic peroxide decreased the binding affinity of OhrR for the primary site, with a concomitant decrease in cooperative binding to the adjacent secondary sites. The single cysteine C28 in OhrR was involved in sensing oxidants, as determined by substitution mutagenesis. The C28S mutant of OhrR bound to the intergenic region without any change in binding affinity in response to organic peroxides. These results lead us to propose a model for the dual action of OhrR as a repressor and an activator in S. coelicolor. Under reduced conditions, OhrR binds cooperatively to the intergenic region, repressing transcription from both genes. Upon oxidation, the binding affinity of OhrR decreases, with a concomitant loss of cooperative binding, which allows RNA polymerase to bind to both the ohrA and ohrR promoters. The loosely bound oxidized OhrR can further activate transcription from the ohrR promoter. PMID:17586628
Babcock, Michael; Mehta, Rahul C; Makino, Elizabeth T
2015-01-01
Retinol, has been shown to improve the appearance of photodamaged skin when applied topically, and is generally considered to be approximately ten times less potent than tretinoin. To assess this theory, three cosmetic formulations containing 0.25%, 0.5%, and 1.0% retinol were developed to correspond to the three commonly prescribed concentrations of tretinoin (0.025%, 0.05%, and 0.1%). A randomized, double-blind, split-face comparison study was conducted to compare the three concentrations retinol (Ret) including 0.25%, 0.5%, and 1.0%, against the respective three strengths of tretinoin (Tret) 0.025%, 0.05%, and 0.1% in subjects with moderate to severe facial photodamage. Subjects were randomized into three groups: Group 1 (Ret 0.25% vs. Tret 0.025%); Group 2 (Ret 0.5% vs. Tret 0.05%); and Group 3 (Ret 1.0% vs. Tret 0.1%). Within each group, subjects were randomized to apply Ret on one half of the face (left or right) and Tret on the other facial side, for a duration of twelve weeks. Clinical evaluations for efficacy and tolerability, as well as standardized digital photographs were conducted at baseline and at weeks 4, 8, and 12. Sixty-five subjects completed the twelve-week study (Group 1: n=24, Group 2: n=20, and Group 3: n=21). At week 12 in all treatment groups, both Ret and Tret produced statistically significant improvements from baseline in all efficacy parameters, including overall photodamage, fine lines/wrinkles, coarse lines/wrinkles, skin tone brightness, mottled pigmentation, and tactile roughness (all P<0.001). There were no significant differences in efficacy between Ret and Tret in these efficacy parameters. Results from this comparison study suggest that this sustained-release retinol complex containing multiple agents for optimal irritation control provides comparable improvements to tretinoin in the appearance of photodamage.
Wu, Guan Xuan; Huang, Han Hsiang; Chang, Huoy Rou; Kuo, Shyh Ming
2018-04-01
Farnesol, a natural 15-carbon organic compound, has various microbiological and cellular activities. It has been found to exert apoptosis-inducing effects against carcinoma cells as well as antiallergic and anti-inflammatory effects in vivo. In the current study, a series of formulations composed of various concentrations of hydroxypropyl methylcellulose (HPMC) with the addition of hyaluronan (HA) and xanthan gum (XG) was designed to evaluate the UVB-screening and H 2 O 2 -eliminating effects of farnesol in normal fibroblasts. Farnesol at 0.005, 0.0075, and 0.01% exhibited significant capacity for H 2 O 2 scavenging; at 0.0025%, it showed insignificant effects. Under 120-min UVB exposure, screening with plural gel composed of 0.0025% farnesol, 0.5% HA, and 0.5% XG containing 1.5% or 2% HPMC retained normal fibroblast viability. After 60-min exposure to UVB, screening with plural gel composed of farnesol, HA, XG, and 0.5%, 1.0%, 1.5%, or 2% HPMC decreased the ratio of the G1 phase and increased ratio of the S phase in comparison with the accumulated cell cycle of the normal fibroblasts without screening. The gel with 2% HPMC displayed the strongest cell cycle-reversal ability. In vivo histopathological results showed that the prepared plural gels with 0.5% or 2% HPMC and farnesol, HA, and XG had greater antiphotoaging and reparative effects against UVB-induced changes and damage in the skin. In conclusion, the current in vitro and in vivo results demonstrated that the prepared plural composed of 0.0025% farnesol, 0.5% HA, 0.5% XG, and 2% HPMC possessed the greatest UVB-screening capacity and the strongest restorative effects on UVB-induced sunburned skin. © 2018 Wiley Periodicals, Inc.
[The replacement therapy of rPTH(1-84) in established rat model of hypothyroidism].
Ding, Zhiwei; Li, Tiancheng; Liu, Yuhe; Xiao, Shuifang
2015-12-01
To investigate the replacement therapy of rPTH(1-84) (recombinant human parathyroid hormone (1-84)) to hypothyroidism in established rat model. Rat model of hypothyroidism was established by resecting parathyroids. A total of 30 rats with removal of parathyroids were divided into 6 groups randomly, 5 in each group, and applied respectively with saline injection (negative control group), calcitriol treatment (positive control group) and quadripartite PTH administration with dose of 20, 40, 80 and 160 µg/kg (experimental groups). Saline and rPTH(1-84) were injected subcutaneously daily. Calcitriol was gavaged once a day. Sham-operation was conducted in 5 rats of negative control group. To verify the authenticity of the rat model with hypothyroidism, the serum was insolated centrifugally from rat blood that was obtained from angular vein at specific time to measure calcium and phosphorus concentration. Urine in 12 hours was collected by metabolic cages and the calcium concentration was measured. After 10-week drug treatment, the experiment was terminated and bilateral femoral bone and L2-5 lumbar vertebra were removed from rats. Bone mineral density (BMD)of bilateral femoral bone and lumbar vertebra was analyzed by dual X-ray absorptiometry (DXA). The concentration of bone alkaline phosphatase (BALP) in serum was determined by radioimmunoassay. The rat model with hypothyroidism was obtained by excising parathyroid gland and was verified by monitoring calcium and phosphorus concentration subsequently. Administration of rPTH(1-84) in the dose of 80 or 160 µg/kg made serum calcium and phosphorus back to normal levels, with no significant difference between the doses (P>0.05). The BMD in each group of rats with rPTH(1-84) administration was increased significantly (P<0.05). The levels of urinary calcium and serum BALP in rats of maximum rPTH(1-84) injection group (160 µg/kg) were higher than those of normal control group (P<0.05). The rats treated with calcitriol had
Matsuzaka, Yasunari; Kishi, Soichiro; Aoki, Yoshitsugu; Komaki, Hirofumi; Oya, Yasushi; Takeda, Shin-Ichi; Hashido, Kazuo
2014-11-01
Muscular dystrophies are a clinically and genetically heterogeneous group of inherited myogenic disorders. In clinical tests for these diseases, creatine kinase (CK) is generally used as diagnostic blood-based biomarker. However, because CK levels can be altered by various other factors, such as vigorous exercise, etc., false positive is observed. Therefore, three microRNAs (miRNAs), miR-1, miR-133a, and miR-206, were previously reported as alternative biomarkers for duchenne muscular dystrophy (DMD). However, no alternative biomarkers have been established for the other muscular dystrophies. We, therefore, evaluated whether these miR-1, miR-133a, and miR-206 can be used as powerful biomarkers using the serum from muscular dystrophy patients including DMD, myotonic dystrophy 1 (DM1), limb-girdle muscular dystrophy (LGMD), facioscapulohumeral muscular dystrophy (FSHD), becker muscular dystrophy (BMD), and distal myopathy with rimmed vacuoles (DMRV) by qualitative polymerase chain reaction (PCR) amplification assay. Statistical analysis indicated that all these miRNA levels in serum represented no significant differences between all muscle disorders examined in this study and controls by Bonferroni correction. However, some of these indicated significant differences without correction for testing multiple diseases (P < 0.05). The median values of miR-1 levels in the serum of patients with LGMD, FSHD, and BMD were approximately 5.5, 3.3 and 1.7 compared to that in controls, 0.68, respectively. Similarly, those of miR-133a and miR-206 levels in the serum of BMD patients were about 2.5 and 2.1 compared to those in controls, 1.03 and 1.32, respectively. Taken together, our data demonstrate that levels of miR-1, miR-133a, and miR-206 in serum of BMD and miR-1 in sera of LGMD and FSHD patients showed no significant differences compared with those of controls by Bonferroni correction. However, the results might need increase in sample sizes to evaluate these three miRNAs as
Prospects for future very high-energy gamma-ray sky survey: Impact of secondary gamma rays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inoue, Yoshiyuki; Kalashev, Oleg E.; Kusenko, Alexander
2014-02-01
Very high-energy gamma-ray measurements of distant blazars can be well explained by secondary gamma rays emitted by cascades induced by ultra-high-energy cosmic rays. The secondary gamma rays will enable one to detect a large number of blazars with future ground based gamma-ray telescopes such as Cherenkov Telescope Array (CTA). We show that the secondary emission process will allow CTA to detect 100, 130, 150, 87, and 8 blazars above 30 GeV, 100 GeV, 300 GeV, 1 TeV, and 10 TeV, respectively, up to z~8 assuming the intergalactic magnetic field (IGMF) strength B=10-17 G and an unbiased all sky survey withmore » 0.5 h exposure at each field of view, where total observing time is ~540 h. These numbers will be 79, 96, 110, 63, and 6 up to z~5 in the case of B=10-15 G. This large statistics of sources will be a clear evidence of the secondary gamma-ray scenarios and a new key to studying the IGMF statistically. We also find that a wider and shallower survey is favored to detect more and higher redshift sources even if we take into account secondary gamma rays.« less
Owens, Rebecca A.; Hammel, Stephen; Sheridan, Kevin J.; Jones, Gary W.; Doyle, Sean
2014-01-01
A combined proteomics and metabolomics approach was utilised to advance the identification and characterisation of secondary metabolites in Aspergillus fumigatus. Here, implementation of a shotgun proteomic strategy led to the identification of non-redundant mycelial proteins (n = 414) from A. fumigatus including proteins typically under-represented in 2-D proteome maps: proteins with multiple transmembrane regions, hydrophobic proteins and proteins with extremes of molecular mass and pI. Indirect identification of secondary metabolite cluster expression was also achieved, with proteins (n = 18) from LaeA-regulated clusters detected, including GliT encoded within the gliotoxin biosynthetic cluster. Biochemical analysis then revealed that gliotoxin significantly attenuates H2O2-induced oxidative stress in A. fumigatus (p>0.0001), confirming observations from proteomics data. A complementary 2-D/LC-MS/MS approach further elucidated significantly increased abundance (p<0.05) of proliferating cell nuclear antigen (PCNA), NADH-quinone oxidoreductase and the gliotoxin oxidoreductase GliT, along with significantly attenuated abundance (p<0.05) of a heat shock protein, an oxidative stress protein and an autolysis-associated chitinase, when gliotoxin and H2O2 were present, compared to H2O2 alone. Moreover, gliotoxin exposure significantly reduced the abundance of selected proteins (p<0.05) involved in de novo purine biosynthesis. Significantly elevated abundance (p<0.05) of a key enzyme, xanthine-guanine phosphoribosyl transferase Xpt1, utilised in purine salvage, was observed in the presence of H2O2 and gliotoxin. This work provides new insights into the A. fumigatus proteome and experimental strategies, plus mechanistic data pertaining to gliotoxin functionality in the organism. PMID:25198175
PARTS: Probabilistic Alignment for RNA joinT Secondary structure prediction
Harmanci, Arif Ozgun; Sharma, Gaurav; Mathews, David H.
2008-01-01
A novel method is presented for joint prediction of alignment and common secondary structures of two RNA sequences. The joint consideration of common secondary structures and alignment is accomplished by structural alignment over a search space defined by the newly introduced motif called matched helical regions. The matched helical region formulation generalizes previously employed constraints for structural alignment and thereby better accommodates the structural variability within RNA families. A probabilistic model based on pseudo free energies obtained from precomputed base pairing and alignment probabilities is utilized for scoring structural alignments. Maximum a posteriori (MAP) common secondary structures, sequence alignment and joint posterior probabilities of base pairing are obtained from the model via a dynamic programming algorithm called PARTS. The advantage of the more general structural alignment of PARTS is seen in secondary structure predictions for the RNase P family. For this family, the PARTS MAP predictions of secondary structures and alignment perform significantly better than prior methods that utilize a more restrictive structural alignment model. For the tRNA and 5S rRNA families, the richer structural alignment model of PARTS does not offer a benefit and the method therefore performs comparably with existing alternatives. For all RNA families studied, the posterior probability estimates obtained from PARTS offer an improvement over posterior probability estimates from a single sequence prediction. When considering the base pairings predicted over a threshold value of confidence, the combination of sensitivity and positive predictive value is superior for PARTS than for the single sequence prediction. PARTS source code is available for download under the GNU public license at http://rna.urmc.rochester.edu. PMID:18304945
Lunardi, Franciele Osmarini; de Aguiar, Francisco Leo Nascimento; Duarte, Ana Beatriz Graça; Araújo, Valdevane Rocha; de Lima, Laritza Ferreira; Ribeiro de Sá, Naiza Arcângela; Vieira Correia, Hudson Henrique; Domingues, Sheyla Farhayldes Souza; Campello, Cláudio Cabral; Smitz, Johan; de Figueiredo, José Ricardo; Ribeiro Rodrigues, Ana Paula
2016-04-15
Cryopreservation of preantral follicles is a promising technique to preserve female fertility. The aim of this study was to evaluate the effect of vitrification on the development of secondary follicles included in ovarian tissue or isolated after microdissection. An important end point included is the capacity of grown oocytes to resume meiosis. Sheep ovarian cortexes were cut into fragments and split into three different groups: (1) fresh (control): secondary follicles isolated without any previous vitrification; (2) follicle-vitrification (follicle-vit): secondary follicles vitrified in isolated form; and (3) tissue-vitrification (tissue-vit): secondary follicles vitrified within fragments of ovarian tissue (in situ former) and subsequently subjected to isolation. From the three groups, isolated secondary follicles were submitted to IVC for 18 days. After IVC, cumulus-oocyte complexes (COCs) were harvested from follicles. As an additional control group, in vivo grown, in vivo-grown COCs were collected from antral ovarian follicles. All, recovered COCs were matured and the chromatin configuration was evaluated. Data were analyzed by ANOVA, and the means were compared by Student-Newman-Keuls test, and by chi-square. Differences were considered to be significant when P < 0.05. Isolated preantral follicles from all treatments had normal morphology, antrum formation, and low follicle degeneration after IVC. The growth rate between control and follicle-vit did not differ (P > 0.05), and was higher (P < 0.05) than for tissue-vit. The percentage of follicles that decreased diameter during IVC was significantly higher in tissue-vit than the in follicle-vit. Recovery rate of oocytes from normal follicles was higher in follicle-vit than in tissue-vit. Furthermore, oocyte viability was lower in tissue-vit than other treatments, and follicle-vit did not differ from control and in vivo grown. The percentage of oocytes meiosis resuming was not different between
Sedentary behaviour across the primary-secondary school transition: A systematic review.
Pearson, Natalie; Haycraft, Emma; P Johnston, Julie; Atkin, Andrew J
2017-01-01
The transition from primary/middle school to secondary/high school is likely to be a key period in children's development, characterised by significant changes in their social and physical environment. However, little is known about the changes in sedentary behaviour that accompany this transition. This review aimed to identify, critically appraise and summarise the evidence on changes in sedentary behaviour across the primary - secondary school transition. Published English language studies were located from computerised and manual searches in 2015. Inclusion criteria specified a longitudinal design, baseline assessment when children were in primary/middle school with at least one follow-up during secondary/high school and a measure of sedentary behaviour at both (or all) points of assessment. Based on data from 11 articles (19 independent samples), tracking coefficients were typically in the range of 0.3 to 0.5 and relatively consistent across the different sedentary behaviours examined and durations of follow-up. Both screen-based sedentary behaviour and overall sedentary time increased during the school transition. Overall there was an increase of approximately 10-20min per day per year in accelerometer-assessed sedentary time. Consistent with the broader age-related changes in behaviour observed during this period, sedentary behaviour increases during the transition from primary/middle to secondary/high school. Investigating features of the social and physical environment that might exacerbate or attenuate this trend would be a valuable next step. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
FIB Secondary Etching Method for Fabrication of Fine CNT Forest Metamaterials
NASA Astrophysics Data System (ADS)
Pander, Adam; Hatta, Akimitsu; Furuta, Hiroshi
2017-10-01
Anisotropic materials, like carbon nanotubes (CNTs), are the perfect substitutes to overcome the limitations of conventional metamaterials; however, the successful fabrication of CNT forest metamaterial structures is still very challenging. In this study, a new method utilizing a focused ion beam (FIB) with additional secondary etching is presented, which can obtain uniform and fine patterning of CNT forest nanostructures for metamaterials and ranging in sizes from hundreds of nanometers to several micrometers. The influence of the FIB processing parameters on the morphology of the catalyst surface and the growth of the CNT forest was investigated, including the removal of redeposited material, decreasing the average surface roughness (from 0.45 to 0.15 nm), and a decrease in the thickness of the Fe catalyst. The results showed that the combination of FIB patterning and secondary etching enabled the growth of highly aligned, high-density CNT forest metamaterials. The improvement in the quality of single-walled CNTs (SWNTs), defined by the very high G/D peak ratio intensity of 10.47, demonstrated successful fine patterning of CNT forest for the first time. With a FIB patterning depth of 10 nm and a secondary etching of 0.5 nm, a minimum size of 150 nm of CNT forest metamaterials was achieved. The development of the FIB secondary etching method enabled for the first time, the fabrication of SWNT forest metamaterials for the optical and infrared regime, for future applications, e.g., in superlenses, antennas, or thermal metamaterials.
Preparation and Thermoelectric Properties of the Skutterudite-Related Phase Ru(0.5)Pd(0.5)Sb3
NASA Technical Reports Server (NTRS)
Caillat, T.; Kulleck, J.; Borshchevsky, A.; Fleurial, J.-P.
1996-01-01
A new skutterudite phase Ru(0.5)Pd(0.5)Sb3 was prepared. This new phase adds to a large number of already known materials with the skutterudite structure which have shown good potential for thermoelectric applications. Single phase, polycrystalline samples were prepared and characterized by x-ray analysis, electron probe microanalysis, density, sound velocity, thermal-expansion coefficient, and differential thermal analysis measurements. Ru(0.5)Pd(0.5)Sb3 has a cubic lattice, space group Im3 (T(sup 5, sub h)), with a = 9.298 A and decomposes at about 920 K. The Seebeck coefficient, the electrical resistivity, the Hall effect, and the thermal conductivity were measured on hot-pressed samples over a wide range of temperatures. Preliminary results show that Ru(0.5)Pd(0.5)Sb3 behaves as a heavily doped semiconductor with an estimated band gap of about 0.6 eV. The lattice thermal conductivity of Ru(0.5)Pd(0.5)Sb3 is substantially lower than that of the binary isostructural compounds CoSb3 and IrSb3. The unusually low thermal conductivity might be explained by additional hole and charge transfer phonon scattering in this material. The potential of this material for thermoelectric applications is discussed.
NASA Astrophysics Data System (ADS)
Sharma, R.; Raghuvanshi, S.; Satalkar, M.; Kane, S. N.; Tatarchuk, T. R.; Mazaleyrat, F.
2018-05-01
NiFe2O4, Ni0.5Zn0.5Fe2O4 samples were synthesized using sol-gel auto combustion method, and irradiated by using 120 MeV 28Si9+ ion with ion fluence of 1×1012 ions/cm2. Characterization of pristine, irradiated samples were done using X-Ray Diffraction (XRD), Field Emission Scanning Microscopy (FE-SEM), Energy Dispersive X-ray Analysis (EDAX) and Vibrating Sample Magnetometer (VSM). XRD validates the single phase nature of pristine, irradiated Ni- Zn nano ferrite except for Ni ferrite (pristine, irradiated) where secondary phases of α-Fe2O3 and Ni is observed. FE- SEM images of pristine Ni, Ni-Zn ferrite show inhomogeneous nano-range particle size distribution. Presence of diamagnetic ion (Zn2+) in NiFe2O4 increases oxygen positional parameter (u 4¯3m ), experimental, theoretical saturation magnetization (Msexp., Msth.), while decreases the grain size (Ds) and coercivity (Hc). With irradiation Msexp., Msth. increases but not much change are observed in Hc. New antistructure modeling for the pristine, irradiated Ni and Ni-Zn ferrite samples was used for describing the surface active centers.
40 CFR 425.05 - Compliance dates.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Compliance dates. 425.05 Section 425.05 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS LEATHER TANNING AND FINISHING POINT SOURCE CATEGORY General Provisions § 425.05 Compliance dates...
Robotic high-intensity focused ultrasound (rHIFU) for the prostate cancer treatment
NASA Astrophysics Data System (ADS)
Solovov, Vyacheslav; Shaplygin, Leonid; Vozdvizhenskiy, Mikhail
2012-11-01
Introduction & Objectives: rHIFU shows a successful treatment for localized prostate cancer (PC). Here we explored the effectiveness of the rHIFU treatment for the prostate cancer, hormone-resistant prostate cancer (HRPC) and failure after external beam radiotherapy (EBRT) and radical prostatectomy (RPE). Materials & Methods: 748 patients were treated in our center between Sep 2007 - February 2012: 137 - hormone-resistance (median time before hormone-resistance 25 months), 286 - received neoadjuvant hormone therapy 6 months, 293 - no treatment before HIFU, 32 - after the EBRT failure. 667 patients underwent TURP+rHIFU, 81 only rHIFU (volume prostate <40cc). Mean follow-up is 38 months (range 3-52). All patients were divided into 3 groups: low risk progression (Gleason <7, stage T1-2N0M0, PSA<20, n= 465), high risk progression - (Gleason ≤9, stage T2-3N0M0, PSA <60, n= 251), after EBRT and RPE failure (n= 39). The mean age of the whole group of patients were 70 (52-89) years, mean prostate volume - 39 (5,5-108) cc. Results: Median PSA level 12 months after rHIFU treatment were 0,04 (0-2,24) ng/ml - low risk group, for high risk group - 0,5 (0-48,4) ng/ml, with failure after EBRT and RPE- 0,5 (0-3,2) ng/ml; 36 months after rHIFU treatment were 0,5 (0,02-3,6) ng/ml - low risk group, for high risk group - 3,2 (0-21,38) ng/ml, with failure after EBRT and RPE - 1,7 (0-9,8) ng/ml. Patients with low risk had 4,5% of progression, with high risk PC - 25%, with failure after EBRT and RPE - 19,6%. Kaplan-Meir analyses of the total group indicated that the risk of progression after 1 year follow-up was 10%, the risk of progression was 23% after 4 years of follow-up. Complications: incontinence I - 17,5%, incontinence II - 7,7%, stricture - 18,2%, fistula - 0,3 %. Conclusions: Our experience shows that rHIFU ablation is safe, minimally invasive, effective treatment with moderate side effects for the PC, hormone-resistant prostate cancer, rHIFU also may be used as a salvage
Secondary medical diagnosis in fragile X syndrome with and without autism spectrum disorder.
García-Nonell, Catalina; Ratera, Eugenia Rigau; Harris, Susan; Hessl, David; Ono, Michele Y; Tartaglia, Nicole; Marvin, Emily; Tassone, Flora; Hagerman, Randi J
2008-08-01
This study examined whether secondary medical diagnoses that affect CNS function (i.e., seizures, malformations, or genetic disorders), are more likely to occur in individuals with fragile X syndrome (FXS) and autism spectrum disorder (FXS + ASD) or FXS alone. Ninety males (3-25 years) with FXS or FXS + ASD were evaluated for secondary medical diagnoses by medical history and examination. A significant difference in the incidence of medical problems was found between patients with FXS + ASD (38.6%) and FXS alone (18.2%, P < 0.05). Medical problems that affect the CNS are more likely to occur in those with FXS + ASD and it is probable that additional brain dysfunction associated with these medical problems enhance the risk of autism in those with FXS. Copyright 2008 Wiley-Liss, Inc.
rCAD: A Novel Database Schema for the Comparative Analysis of RNA.
Ozer, Stuart; Doshi, Kishore J; Xu, Weijia; Gutell, Robin R
2011-12-31
Beyond its direct involvement in protein synthesis with mRNA, tRNA, and rRNA, RNA is now being appreciated for its significance in the overall metabolism and regulation of the cell. Comparative analysis has been very effective in the identification and characterization of RNA molecules, including the accurate prediction of their secondary structure. We are developing an integrative scalable data management and analysis system, the RNA Comparative Analysis Database (rCAD), implemented with SQL Server to support RNA comparative analysis. The platformagnostic database schema of rCAD captures the essential relationships between the different dimensions of information for RNA comparative analysis datasets. The rCAD implementation enables a variety of comparative analysis manipulations with multiple integrated data dimensions for advanced RNA comparative analysis workflows. In this paper, we describe details of the rCAD schema design and illustrate its usefulness with two usage scenarios.
rCAD: A Novel Database Schema for the Comparative Analysis of RNA
Ozer, Stuart; Doshi, Kishore J.; Xu, Weijia; Gutell, Robin R.
2013-01-01
Beyond its direct involvement in protein synthesis with mRNA, tRNA, and rRNA, RNA is now being appreciated for its significance in the overall metabolism and regulation of the cell. Comparative analysis has been very effective in the identification and characterization of RNA molecules, including the accurate prediction of their secondary structure. We are developing an integrative scalable data management and analysis system, the RNA Comparative Analysis Database (rCAD), implemented with SQL Server to support RNA comparative analysis. The platformagnostic database schema of rCAD captures the essential relationships between the different dimensions of information for RNA comparative analysis datasets. The rCAD implementation enables a variety of comparative analysis manipulations with multiple integrated data dimensions for advanced RNA comparative analysis workflows. In this paper, we describe details of the rCAD schema design and illustrate its usefulness with two usage scenarios. PMID:24772454
Milićević, Novica M; Nohroudi, Klaus; Schmidt, Friederike; Schmidt, Hendrik; Ringer, Cornelia; Sorensen, Grith Lykke; Milićević, Živana; Westermann, Jürgen
2016-01-01
Development and maintenance of secondary lymphoid organs such as lymph nodes and spleen essentially depend on lymphotoxin β-receptor (LTβR) signaling. It is unclear, however, by which molecular mechanism their size is limited. Here, we investigate whether the LTβR pathway is also growth suppressing. By using splenic tissue transplantation it is possible to analyze a potential contribution of LTβR signaling inside and outside of the implanted tissue. We show that LTβR signaling within the endogenous spleen and within non-splenic tissues both significantly suppressed the regeneration of implanted splenic tissue. The suppressive activity positively correlated with the total number of LTβR expressing cells in the animal (regenerate weights of 115 ± 8 mg in LTβR deficient recipients and of 12 ± 9 mg in wild-type recipients), affected also developed splenic tissue, and was induced but not executed via LTβR signaling. Two-dimensional differential gel electrophoresis and subsequent mass spectrometry of stromal splenic tissue was applied to screen for potential factors mediating the LTβR dependent suppressive activity. Thus, LTβR dependent growth suppression is involved in regulating the size of secondary lymphoid organs, and might be therapeutically used to eradicate tertiary lymphoid tissues during autoimmune diseases.
Schmidt, Friederike; Schmidt, Hendrik; Ringer, Cornelia; Sorensen, Grith Lykke; Milićević, Živana; Westermann, Jürgen
2016-01-01
Development and maintenance of secondary lymphoid organs such as lymph nodes and spleen essentially depend on lymphotoxin β-receptor (LTβR) signaling. It is unclear, however, by which molecular mechanism their size is limited. Here, we investigate whether the LTβR pathway is also growth suppressing. By using splenic tissue transplantation it is possible to analyze a potential contribution of LTβR signaling inside and outside of the implanted tissue. We show that LTβR signaling within the endogenous spleen and within non-splenic tissues both significantly suppressed the regeneration of implanted splenic tissue. The suppressive activity positively correlated with the total number of LTβR expressing cells in the animal (regenerate weights of 115 ± 8 mg in LTβR deficient recipients and of 12 ± 9 mg in wild-type recipients), affected also developed splenic tissue, and was induced but not executed via LTβR signaling. Two-dimensional differential gel electrophoresis and subsequent mass spectrometry of stromal splenic tissue was applied to screen for potential factors mediating the LTβR dependent suppressive activity. Thus, LTβR dependent growth suppression is involved in regulating the size of secondary lymphoid organs, and might be therapeutically used to eradicate tertiary lymphoid tissues during autoimmune diseases. PMID:27936003
Roy, R S
1972-01-01
Strains of enterobacteria (nine Escherichia coli and two Salmonella) isolated from primary or secondary infections in the dog, cat, pig, calf and kangaroo were studied for the presence of extrachromosomal drug resistance factors (R factors). Seven strains of E. coli and two strains of Salmonella transferred resistance involving the following antibiotics: streptomycin, ampicillin, chloramphenicol, neomycin and tetracycline. All strains harboring R factors transferred streptomycin resistance and the identified resistance patterns were as follows: Sm Am, Sm Te, Sm Neo, Sm Am Te, Sm CI Neo and Sm Am CI Te. The levels of resistance observed were comparable for all donor strains and their converted recipients. Strains of E. coli harboring R factors were isolated from three dogs that had died of either otitis (followed by a generalized infection), enteritis or bronchopneumonia - secondary to distemper. The bacteria isolated from cats were recovered at the necropsy of animals that had died of purulent pleuresy and feline panleukopenia. The other strains (two Salmonella and one E. coli were isolated from fatal enteric diseases in the pig, calf and kangaroo.
NASA Astrophysics Data System (ADS)
Eder, Erich; Turic, Katharina; Milasowszky, Norbert; van Adzin, Katherine; Hergovich, Andreas
2011-05-01
The present study is the first to investigate the relationships between a multiple set of paranormal beliefs and the acceptance of evolution, creationism, and intelligent design, respectively, in Europe. Using a questionnaire, 2,129 students at secondary schools in Vienna (Austria) answered the 26 statements of the Revised Paranormal Belief Scale (R-PBS) and three statements about naturalistic evolution, creationism and intelligent design (ID). The investigated Austrian students showed an average R-PBS score of 82.08, more than 50% of them agreed with naturalistic evolution, 28% with creationism, and more than a third agreed with ID, the latter two closely correlated with each other. Females generally showed higher belief scores in the paranormal, creationism and ID. The agreement with naturalistic evolution correlated negatively with religious belief, but not with other paranormal beliefs, whereas the two non-scientific alternatives to evolution significantly correlated with both traditional and paranormal beliefs. Religious belief showed a significant positive correlation with other paranormal beliefs. All subscales of paranormal belief decreased during the eight grades of secondary school, as did acceptance of creationism and ID. However, the acceptance of naturalistic evolution did not correlate with age or grade. Possible reasons and implications for science education and the biology curriculum at Austrian secondary schools are discussed.
ERIC Educational Resources Information Center
Cook, Thomas D.
Secondary evaluations, in which an investigator takes a body of evaluation data collected by a primary evaluation researcher and examines the data to see if the original conclusions about the program correspond with his own, are discussed. The different kinds of secondary evaluations and the advantages and disadvantages of each are pointed out,…
Acute effect of essential oil of Eugenia caryophyllata on cognition and pain in mice.
Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K
2012-06-01
The essential oil of Eugenia caryophyllata (clove oil; Family: Myrtaceae) is used in dental care as an antiseptic and analgesic. The study aims to evaluate the effect of clove oil on experimental models of pain and cognition in mice. To observe the acute effects of clove oil at different doses, the elevated plus maze was used for the assessment of cognition, and the tail flick and formalin tests were used for the study of pain. The formalin test showed that clove oil (0.1 ml/kg, i.p.) demonstrated significantly reduced pain response in both the phases. The lower doses (0.025 and 0.05 ml/kg, i.p.) reduced the formalin-induced pain response significantly in the second phase only. The tail-flick test showed variable response. The dose 0.1 ml/kg, clove oil, significantly decreased the tail-flick latency at 30 min and this effect was reversed by naloxone (1 mg/kg). On the contrary, the dose 0.025 ml/kg of clove oil, at 30 and 60 min increased the mean tail-flick latency compared to control group, but this effect was not statistically significant. Yet naloxone significantly (p < 0.05) reversed the effect of clove oil 0.025 ml/kg at 30 min. Clove oil (0.025 and 0.05 ml/kg, i.p.) significantly reversed the scopolamine-induced retention memory deficit induced by scopolamine, but clove oil (0.1 ml/kg, i.p.) significantly reversed both acquisition as well as retention deficits in elevated plus maze induced by the scopolamine. Clove oil exhibits reduced pain response by a predominantly peripheral action as evidenced by formalin test and the tail flick test showed the involvement of opioid receptors. Clove oil also significantly improved scopolamine-induced retention memory deficit at all doses.
2004-02-01
also referred to as a Foucault pendulum gyroscope. Rate about the z-axis (i.e., about the vertical post) is detected by the Coriolis acceleration...paper, DGA/STTC/DTGN: Eric PLESKA MBDA F: Jacky GROSSET SAGEM SA: Jean Michel CARON THALES Avionics; Charles DUSSURGEY CEA-LETI...Gilles DELAPIERRE CEM2/Montpellier: André BOYER IEF: Alain BOSSEBOEUF LPMO: Michel de la BACHELERIE ONERA: Pierre TOUBOUL ²²²²²²²²²²²² RTO
Reform of general education and vocational training in the U.S.S.R.
NASA Technical Reports Server (NTRS)
Spearman, M. L.
1986-01-01
Extensive school reform measures were initiated in the U.S.S.R. in 1984. The essence of the reform is to improve the quality of instruction, improve the content of education, strengthen the Marxist-Leninist world view, and ensure that all secondary school graduates master an occupation.
ERIC Educational Resources Information Center
Opini, Bathseba M.
2008-01-01
This paper examines the strengths and limitations of the Ontarians with Disabilities Act (ODA) accessibility plan prepared by one post-secondary education institution in Ontario, Canada, during the 2004/05 academic year. The paper focuses on ways the intersectionality between disability and gender is not voiced in the plan and its implications for…
Novel variants of the 5S rRNA genes in Eruca sativa.
Singh, K; Bhatia, S; Lakshmikumaran, M
1994-02-01
The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)
46 CFR 190.05-1 - Application.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Application. 190.05-1 Section 190.05-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS CONSTRUCTION AND ARRANGEMENT General Fire Protection § 190.05-1 Application. (a) The provisions of this subpart shall apply to...
Gristwood, Tamzin; Fineran, Peter C; Everson, Lee; Salmond, George P C
2008-07-01
The Gram-negative enterobacterium, Serratia sp. ATCC 39006 synthesizes several secondary metabolites, including prodigiosin (Pig) and a carbapenem antibiotic (Car). A complex hierarchical network of regulatory proteins control Pig and Car production. In this study we characterize a TetR family regulator, PigZ, which represses transcription of a divergently transcribed putative resistance-nodulation-cell-division (RND) efflux pump, encoded by zrp (PigZ repressed pump) ADBC, via direct binding to the zrpA-pigZ intergenic region. Unusually, this putative RND pump contains two predicted membrane fusion proteins (MFPs), ZrpA and ZrpD. A mutation in pigZ resulted in multiple phenotypic changes, including exoenzyme production, motility and differential regulation of Pig and Car production. A polar suppressor mutation, within zrpA, restored all tested phenotypes to parental strain levels, indicating that the changes observed are due to the increase in expression of ZrpADBC in the absence of the repressor, PigZ. Genomic deletions of zrpA and zrpD indicate that the MFP ZrpD, but not ZrpA, is essential for activity of the putative pump. Bioinformatic analysis revealed that putative RND efflux pumps encoding two MFP components are not uncommon, particularly among plant-associated, Gram-negative bacteria. In addition, based on phylogenetic analysis, we propose that these pairs of MFPs consist of two distinct subtypes.