A direct immersion solid-phase microextraction gas chromatography/mass spectrometry method for the simultaneous detection of levamisole and minor cocaine congeners in hair samples from chronic abusers.

PubMed

Fucci, Nadia; Gambelunghe, Cristiana; Aroni, Kyriaki; Rossi, Riccardo

2014-12-01

Because levamisole has been increasingly found as a component of illicit drugs, a robust method to detect its presence in hair samples is needed. However, no systematic research on the detection of levamisole in hair samples has been published. The method presented here uses direct immersion solid-phase microextraction coupled with gas chromatography and mass spectrometry (DI-SPME-GC/MS) to detect levamisole and minor cocaine congeners in hair samples using a single-extraction method. Fifty hair samples taken in the last 4 years were obtained from cocaine abusers, along with controls taken from drug-free volunteers. Sampling was performed using direct immersion with a 30-μm polydimethylsiloxane fused silica/stainless steel fiber. Calibration curves were prepared by adding known amounts of analytes and deuterated internal standards to the hair samples taken from drug-free volunteers. This study focused on the adulterant levamisole and some minor cocaine congeners (tropococaine, norcocaine, and cocaethylene). Levamisole was detected in 38% of the hair samples analyzed; its concentration ranged from 0.2 to 0.8 ng/mg. The limit of quantification and limit of detection for levamisole, tropococaine, norcocaine, and cocaine were 0.2 and 0.1 ng/mg, respectively. DI-SPME-GC/MS is a sensitive and specific method to detect the presence of levamisole and cocaine congeners in hair samples.

Longitudinal study of Escherichia coli O157 shedding and super shedding in dairy heifers.

PubMed

Williams, K J; Ward, M P; Dhungyel, O P

2015-04-01

A longitudinal study was conducted to assess the methods available for detection of Escherichia coli O157 and to investigate the prevalence and occurrence of long-term shedding and super shedding in a cohort of Australian dairy heifers. Samples were obtained at approximately weekly intervals from heifers at pasture under normal management systems. Selective sampling techniques were used with the aim of identifying heifers with a higher probability of shedding or super shedding. Rectoanal mucosal swabs (RAMS) and fecal samples were obtained from each heifer. Direct culture of feces was used for detection and enumeration. Feces and RAMS were tested by enrichment culture. Selected samples were further tested retrospectively by immunomagnetic separation of enriched samples. Of 784 samples obtained, 154 (19.6%) were detected as positive using culture methods. Adjusting for selective sampling, the prevalence was 71 (15.6%) of 454. In total, 66 samples were detected as positive at >10(2) CFU/g of which 8 were >10(4) CFU/g and classed as super shedding. A significant difference was observed in detection by enriched culture of RAMS and feces. Dairy heifers within this cohort exhibited variable E. coli O157 shedding, consistent with previous estimates of shedding. Super shedding was detected at a low frequency and inconsistently from individual heifers. All detection methods identified some samples as positive that were not detected by any other method, indicating that the testing methods used will influence survey results.

Comparison of methods for the detection of coliphages in recreational water at two California, United States beaches.

PubMed

Rodríguez, Roberto A; Love, David C; Stewart, Jill R; Tajuba, Julianne; Knee, Jacqueline; Dickerson, Jerold W; Webster, Laura F; Sobsey, Mark D

2012-04-01

Methods for detection of two fecal indicator viruses, F+ and somatic coliphages, were evaluated for application to recreational marine water. Marine water samples were collected during the summer of 2007 in Southern California, United States from transects along Avalon Beach (n=186 samples) and Doheny Beach (n=101 samples). Coliphage detection methods included EPA method 1601 - two-step enrichment (ENR), EPA method 1602 - single agar layer (SAL), and variations of ENR. Variations included comparison of two incubation times (overnight and 5-h incubation) and two final detection steps (lysis zone assay and a rapid latex agglutination assay). A greater number of samples were positive for somatic and F+ coliphages by ENR than by SAL (p<0.01). The standard ENR with overnight incubation and detection by lysis zone assay was the most sensitive method for the detection of F+ and somatic coliphages from marine water, although the method takes up to three days to obtain results. A rapid 5-h enrichment version of ENR also performed well, with more positive samples than SAL, and could be performed in roughly 24h. Latex agglutination-based detection methods require the least amount of time to perform, although the sensitivity was less than lysis zone-based detection methods. Rapid culture-based enrichment of coliphages in marine water may be possible by further optimizing culture-based methods for saline water conditions to generate higher viral titers than currently available, as well as increasing the sensitivity of latex agglutination detection methods. Copyright © 2012 Elsevier B.V. All rights reserved.

Comparison of Membrane Filtration and Multiple-Tube Fermentation by the Colilert and Enterolert Methods for Detection of Waterborne Coliform Bacteria, Escherichia coli, and Enterococci Used in Drinking and Bathing Water Quality Monitoring in Southern Sweden

PubMed Central

Eckner, Karl F.

1998-01-01

A total of 338 water samples, 261 drinking water samples and 77 bathing water samples, obtained for routine testing were analyzed in duplicate by Swedish standard methods using multiple-tube fermentation or membrane filtration and by the Colilert and/or Enterolert methods. Water samples came from a wide variety of sources in southern Sweden (Skåne). The Colilert method was found to be more sensitive than Swedish standard methods for detecting coliform bacteria and of equal sensitivity for detecting Escherichia coli when all drinking water samples were grouped together. Based on these results, Swedac, the Swedish laboratory accreditation body, approved for the first time in Sweden use of the Colilert method at this laboratory for the analysis of all water sources not falling under public water regulations (A-krav). The coliform detection study of bathing water yielded anomalous results due to confirmation difficulties. E. coli detection in bathing water was similar by both the Colilert and Swedish standard methods as was fecal streptococcus and enterococcus detection by both the Enterolert and Swedish standard methods. PMID:9687478

Molecular detection of airborne Coccidioides in Tucson, Arizona

USGS Publications Warehouse

Chow, Nancy A.; Griffin, Dale W.; Barker, Bridget M.; Loparev, Vladimir N.; Litvintseva, Anastasia P.

2016-01-01

Environmental surveillance of the soil-dwelling fungus Coccidioides is essential for the prevention of Valley fever, a disease primarily caused by inhalation of the arthroconidia. Methods for collecting and detectingCoccidioides in soil samples are currently in use by several laboratories; however, a method utilizing current air sampling technologies has not been formally demonstrated for the capture of airborne arthroconidia. In this study, we collected air/dust samples at two sites (Site A and Site B) in the endemic region of Tucson, Arizona, and tested a variety of air samplers and membrane matrices. We then employed a single-tube nested qPCR assay for molecular detection. At both sites, numerous soil samples (n = 10 at Site A and n = 24 at Site B) were collected and Coccidioides was detected in two samples (20%) at Site A and in eight samples (33%) at Site B. Of the 25 air/dust samples collected at both sites using five different air sampling methods, we detected Coccidioides in three samples from site B. All three samples were collected using a high-volume sampler with glass-fiber filters. In this report, we describe these methods and propose the use of these air sampling and molecular detection strategies for environmental surveillance of Coccidioides.

Validation of the 3M molecular detection system for the detection of listeria in meat, seafood, dairy, and retail environments.

PubMed

Fortes, Esther D; David, John; Koeritzer, Bob; Wiedmann, Martin

2013-05-01

There is a continued need to develop improved rapid methods for detection of foodborne pathogens. The aim of this project was to evaluate the 3M Molecular Detection System (3M MDS), which uses isothermal DNA amplification, and the 3M Molecular Detection Assay Listeria using environmental samples obtained from retail delicatessens and meat, seafood, and dairy processing plants. Environmental sponge samples were tested for Listeria with the 3M MDS after 22 and 48 h of enrichment in 3M Modified Listeria Recovery Broth (3M mLRB); enrichments were also used for cultural detection of Listeria spp. Among 391 samples tested for Listeria, 74 were positive by both the 3M MDS and the cultural method, 310 were negative by both methods, 2 were positive by the 3M MDS and negative by the cultural method, and one sample was negative by the 3M MDS and positive by the cultural method. Four samples were removed from the sample set, prior to statistical analyses, due to potential cross-contamination during testing. Listeria isolates from positive samples represented L. monocytogenes, L. innocua, L. welshimeri, and L. seeligeri. Overall, the 3M MDS and culture-based detection after enrichment in 3M mLRB did not differ significantly (P < 0.05) with regard to the number of positive samples, when chi-square analyses were performed for (i) number of positive samples after 22 h, (ii) number of positive samples after 48 h, and (iii) number of positive samples after 22 and/or 48 h of enrichment in 3M mLRB. Among 288 sampling sites that were tested with duplicate sponges, 67 each tested positive with the 3M MDS and the traditional U.S. Food and Drug Administration Bacteriological Analytical Manual method, further supporting that the 3M MDS performs equivalently to traditional methods when used with environmental sponge samples.

Comparison of traditional and molecular analytical methods for detecting biological agents in raw and drinking water following ultrafiltration

USGS Publications Warehouse

Francy, D.S.; Bushon, R.N.; Brady, A.M.G.; Bertke, E.E.; Kephart, C.M.; Likirdopulos, C.A.; Mailot, B.E.; Schaefer, F. W.; Lindquist, H.D. Alan

2009-01-01

Aims: To compare the performance of traditional methods to quantitative polymerase chain reaction (qPCR) for detecting five biological agents in large-volume drinking-water samples concentrated by ultrafiltration (UF). Methods and Results: Drinking-water samples (100 l) were seeded with Bacillus anthracis, Cryptospordium parvum, Francisella tularensis, Salmonella Typhi, and Vibrio cholerae and concentrated by UF. Recoveries by traditional methods were variable between samples and between some replicates; recoveries were not determined by qPCR. Francisella tularensis and V. cholerae were detected in all 14 samples after UF, B. anthracis was detected in 13, and C. parvum was detected in 9 out of 14 samples. Numbers found by qPCR after UF were significantly or nearly related to those found by traditional methods for all organisms except for C. parvum. A qPCR assay for S. Typhi was not available. Conclusions: qPCR can be used to rapidly detect biological agents after UF as well as traditional methods, but additional work is needed to improve qPCR assays for several biological agents, determine recoveries by qPCR, and expand the study to other areas. Significance and Impact of the Study: To our knowledge, this is the first study to compare the use of traditional and qPCR methods to detect biological agents in large-volume drinking-water samples. ?? 2009 The Society for Applied Microbiology.

Sensitivity of bhk-21 cells supplemented with diethylaminoethyl-dextran for detection of street rabies virus in saliva samples.

PubMed Central

Larghi, O P; Nebel, A E; Lazaro, L; Savy, V L

1975-01-01

A tissue culture system for detecting rabies virus from saliva samples of suspected animals was developed and compared to suckling mouse inoculation. Swab samples were obtained from the mouth of the animal heads received for rabies diagnosis; these swabs were submerged in maintenance medium. The maintenance medium was inoculated intracerebrally into suckling mice and onto BHK-21 cells with diethylaminoethyl (DEAE)-dextran (BHK/DEAE) and without (BHK). Rabies immunofluorescence was performed on the brain of the mice dying during the observation period and also on both tissue culture systems every day after infection. The BHK-DEAE system detected 28 positive samples obtained from 48 rabid animals and the BHK system detected 18. By suckling mouse inoculation only 11 of the same positive samples were detected. A total of 90 samples was studied by the three methods. Rabies virus was detected by the tissue culture methods earlier than by suckling mouse inoculation. The BHK-DEAE method was an economic and fast method for rabies virus detection in saliva samples, which could be used for ecological and pathogenesis studies, as well for rabies diagnosis before the death of the suspected animal. PMID:1100655

Rapid detection of Naegleria fowleri in water distribution pipeline biofilms and drinking water samples.

PubMed

Puzon, Geoffrey J; Lancaster, James A; Wylie, Jason T; Plumb, Iason J

2009-09-01

Rapid detection of pathogenic Naegleria fowler in water distribution networks is critical for water utilities. Current detection methods rely on sampling drinking water followed by culturing and molecular identification of purified strains. This culture-based method takes an extended amount of time (days), detects both nonpathogenic and pathogenic species, and does not account for N. fowleri cells associated with pipe wall biofilms. In this study, a total DNA extraction technique coupled with a real-time PCR method using primers specific for N. fowleri was developed and validated. The method readily detected N. fowleri without preculturing with the lowest detection limit for N. fowleri cells spiked in biofilm being one cell (66% detection rate) and five cells (100% detection rate). For drinking water, the detection limit was five cells (66% detection rate) and 10 cells (100% detection rate). By comparison, culture-based methods were less sensitive for detection of cells spiked into both biofilm (66% detection for <10 cells) and drinking water (0% detection for <10 cells). In mixed cultures of N. fowleri and nonpathogenic Naegleria, the method identified N. fowleri in 100% of all replicates, whereastests with the current consensus primers detected N. fowleri in only 5% of all replicates. Application of the new method to drinking water and pipe wall biofilm samples obtained from a distribution network enabled the detection of N. fowleri in under 6 h, versus 3+ daysforthe culture based method. Further, comparison of the real-time PCR data from the field samples and the standard curves enabled an approximation of N. fowleri cells in the biofilm and drinking water. The use of such a method will further aid water utilities in detecting and managing the persistence of N. fowleri in water distribution networks.

Method and apparatus for data sampling

DOEpatents

Odell, Daniel M. C.

1994-01-01

A method and apparatus for sampling radiation detector outputs and determining event data from the collected samples. The method uses high speed sampling of the detector output, the conversion of the samples to digital values, and the discrimination of the digital values so that digital values representing detected events are determined. The high speed sampling and digital conversion is performed by an A/D sampler that samples the detector output at a rate high enough to produce numerous digital samples for each detected event. The digital discrimination identifies those digital samples that are not representative of detected events. The sampling and discrimination also provides for temporary or permanent storage, either serially or in parallel, to a digital storage medium.

[Detection of KRAS mutation in colorectal cancer patients' cfDNA with droplet digital PCR].

PubMed

Luo, Yuwen; Li, Yao

2018-03-25

This study aims to develop a new method for the detection of KRAS mutations related to colorectal cancer in cfDNA, and to evaluate the sensitivity and accuracy of the detection. We designed a method of cfDNA based KRAS detection by droplets digital PCR (ddPCR). The theoretical performance of the method is evaluated by reference standard and compared to the ARMS PCR method. Two methods, ddPCR and qPCR, were successfully established to detect KRAS wild type and 7 mutants. Both methods were validated using plasmid standards and actual samples. The results were evaluated by false positive rate, linearity, and limit of detection. Finally, 52 plasma cfDNA samples from patients and 20 samples from healthy people were tested, the clinical sensitivity is 97.64%, clinical specificity is 81.43%. ddPCR method shows higher performance than qPCR. The LOD of ddPCR method reached single digits of cfDNA copies, it can detect as low as 0.01% to 0.04% mutation abundance.

Detection of Adulterated Vegetable Oils Containing Waste Cooking Oils Based on the Contents and Ratios of Cholesterol, β-Sitosterol, and Campesterol by Gas Chromatography/Mass Spectrometry.

PubMed

Zhao, Haixiang; Wang, Yongli; Xu, Xiuli; Ren, Heling; Li, Li; Xiang, Li; Zhong, Weike

2015-01-01

A simple and accurate authentication method for the detection of adulterated vegetable oils that contain waste cooking oil (WCO) was developed. This method is based on the determination of cholesterol, β-sitosterol, and campesterol in vegetable oils and WCO by GC/MS without any derivatization. A total of 148 samples involving 12 types of vegetable oil and WCO were analyzed. According to the results, the contents and ratios of cholesterol, β-sitosterol, and campesterol were found to be criteria for detecting vegetable oils adulterated with WCO. This method could accurately detect adulterated vegetable oils containing 5% refined WCO. The developed method has been successfully applied to multilaboratory analysis of 81 oil samples. Seventy-five samples were analyzed correctly, and only six adulterated samples could not be detected. This method could not yet be used for detection of vegetable oils adulterated with WCO that are used for frying non-animal foods. It provides a quick method for detecting adulterated edible vegetable oils containing WCO.

Efficient method of image edge detection based on FSVM

NASA Astrophysics Data System (ADS)

Cai, Aiping; Xiong, Xiaomei

2013-07-01

For efficient object cover edge detection in digital images, this paper studied traditional methods and algorithm based on SVM. It analyzed Canny edge detection algorithm existed some pseudo-edge and poor anti-noise capability. In order to provide a reliable edge extraction method, propose a new detection algorithm based on FSVM. Which contains several steps: first, trains classify sample and gives the different membership function to different samples. Then, a new training sample is formed by increase the punishment some wrong sub-sample, and use the new FSVM classification model for train and test them. Finally the edges are extracted of the object image by using the model. Experimental result shows that good edge detection image will be obtained and adding noise experiments results show that this method has good anti-noise.

Sourcing faecal pollution: a combination of library-dependent and library-independent methods to identify human faecal pollution in non-sewered catchments.

PubMed

Ahmed, W; Stewart, J; Gardner, T; Powell, D; Brooks, P; Sullivan, D; Tindale, N

2007-08-01

Library-dependent (LD) (biochemical fingerprinting of Escherichia coli and enterococci) and library-independent (LI) (PCR detection of human-specific biomarkers) methods were used to detect human faecal pollution in three non-sewered catchments. In all, 550 E. coli isolates and 700 enterococci isolates were biochemically fingerprinted from 18 water samples and compared with metabolic fingerprint libraries of 4508 E. coli and 4833 enterococci isolates. E. coli fingerprints identified human unique biochemical phenotypes (BPTs) in nine out of 18 water samples; similarly, enterococci fingerprints identified human faecal pollution in 10 water samples. Seven samples were tested by PCR for the detection of biomarkers. Human-specific HF134 Bacteroides and enterococci surface protein (esp) biomarkers were detected in five samples. Four samples were also positive for HF183 Bacteroides biomarker. The combination of biomarkers detected human faecal pollution in six out of seven water samples. Of the seven samples analysed for both the indicators/markers, at least one indicator/marker was detected in every sample. Four of the seven PCR-positive samples were also positive for one of the human-specific E. coli or enterococci BPTs. The results indicated human faecal pollution in the studied sub-catchments after storm events. LD and LI methods used in this study complimented each other and provided additional information regarding the polluting sources when one method failed to detect human faecal pollution. Therefore, it is recommended that a combination of methods should be used to identify the source(s) of faecal pollution where possible.

Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

PubMed

Kageyama, A; Benno, Y

2001-01-01

PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

How do we know if plants in our nursery have Phytophthora? Detection methods and an integrated approach to monitoring

Treesearch

Christa Conforti

2017-01-01

A Phytophthora cactorum-infected nursery crop of Ceanothus thyrsiflorus was used to evaluate three Phytophthora monitoring methods. The Phytophthora detection level of three non-destructive sampling methods was quantified and compared to the detection level of destructive sampling. Non-...

Rapid detection of mecA and spa by the loop-mediated isothermal amplification (LAMP) method.

PubMed

Koide, Y; Maeda, H; Yamabe, K; Naruishi, K; Yamamoto, T; Kokeguchi, S; Takashiba, S

2010-04-01

To develop a detection assay for staphylococcal mecA and spa by using loop-mediated isothermal amplification (LAMP) method. Staphylococcus aureus and other related species were subjected to the detection of mecA and spa by both PCR and LAMP methods. The LAMP successfully amplified the genes under isothermal conditions at 64 degrees C within 60 min, and demonstrated identical results with the conventional PCR methods. The detection limits of the LAMP for mecA and spa, by gel electrophoresis, were 10(2) and 10 cells per tube, respectively. The naked-eye inspections were possible with 10(3) and 10 cells for detection of mecA and spa, respectively. The LAMP method was then applied to sputum and dental plaque samples. The LAMP and PCR demonstrated identical results for the plaque samples, although frequency in detection of mecA and spa by the LAMP was relatively lower for the sputum samples when compared to the PCR methods. Application of the LAMP enabled a rapid detection assay for mecA and spa. The assay may be applicable to clinical plaque samples. The LAMP offers an alternative detection assay for mecA and spa with a great advantage of the rapidity.

System and method for detecting cells or components thereof

DOEpatents

Porter, Marc D [Ames, IA; Lipert, Robert J [Ames, IA; Doyle, Robert T [Ames, IA; Grubisha, Desiree S [Corona, CA; Rahman, Salma [Ames, IA

2009-01-06

A system and method for detecting a detectably labeled cell or component thereof in a sample comprising one or more cells or components thereof, at least one cell or component thereof of which is detectably labeled with at least two detectable labels. In one embodiment, the method comprises: (i) introducing the sample into one or more flow cells of a flow cytometer, (ii) irradiating the sample with one or more light sources that are absorbed by the at least two detectable labels, the absorption of which is to be detected, and (iii) detecting simultaneously the absorption of light by the at least two detectable labels on the detectably labeled cell or component thereof with an array of photomultiplier tubes, which are operably linked to two or more filters that selectively transmit detectable emissions from the at least two detectable labels.

Comparison of four sampling methods for the detection of Salmonella in broiler litter.

PubMed

Buhr, R J; Richardson, L J; Cason, J A; Cox, N A; Fairchild, B D

2007-01-01

Experiments were conducted to compare litter sampling methods for the detection of Salmonella. In experiment 1, chicks were challenged orally with a suspension of naladixic acid-resistant Salmonella and wing banded, and additional nonchallenged chicks were placed into each of 2 challenge pens. Nonchallenged chicks were placed into each nonchallenge pen located adjacent to the challenge pens. At 7, 8, 10, and 11 wk of age the litter was sampled using 4 methods: fecal droppings, litter grab, drag swab, and sock. For the challenge pens, Salmonella-positive samples were detected in 3 of 16 fecal samples, 6 of 16 litter grab samples, 7 of 16 drag swabs samples, and 7 of 16 sock samples. Samples from the nonchallenge pens were Salmonella positive in 2 of 16 litter grab samples, 9 of 16 drag swab samples, and 9 of 16 sock samples. In experiment 2, chicks were challenged with Salmonella, and the litter in the challenge and adjacent nonchallenge pens were sampled at 4, 6, and 8 wk of age with broilers remaining in all pens. For the challenge pens, Salmonella was detected in 10 of 36 fecal samples, 20 of 36 litter grab samples, 14 of 36 drag swab samples, and 26 of 36 sock samples. Samples from the adjacent nonchallenge pens were positive for Salmonella in 6 of 36 fecal droppings samples, 4 of 36 litter grab samples, 7 of 36 drag swab samples, and 19 of 36 sock samples. Sock samples had the highest rates of Salmonella detection. In experiment 3, the litter from a Salmonella-challenged flock was sampled at 7, 8, and 9 wk by socks and drag swabs. In addition, comparisons with drag swabs that were stepped on during sampling were made. Both socks (24 of 36, 67%) and drag swabs that were stepped on (25 of 36, 69%) showed significantly more Salmonella-positive samples than the traditional drag swab method (16 of 36, 44%). Drag swabs that were stepped on had comparable Salmonella detection level to that for socks. Litter sampling methods that incorporate stepping on the sample material while in contact with the litter appear to detect Salmonella in greater incidence than traditional sampling methods of dragging swabs over the litter surface.

Method and apparatus for data sampling

DOEpatents

Odell, D.M.C.

1994-04-19

A method and apparatus for sampling radiation detector outputs and determining event data from the collected samples is described. The method uses high speed sampling of the detector output, the conversion of the samples to digital values, and the discrimination of the digital values so that digital values representing detected events are determined. The high speed sampling and digital conversion is performed by an A/D sampler that samples the detector output at a rate high enough to produce numerous digital samples for each detected event. The digital discrimination identifies those digital samples that are not representative of detected events. The sampling and discrimination also provides for temporary or permanent storage, either serially or in parallel, to a digital storage medium. 6 figures.

A method for detecting fungal contaminants in wall cavities.

PubMed

Spurgeon, Joe C

2003-01-01

This article describes a practical method for detecting the presence of both fungal spores and culturable fungi in wall cavities. Culturable fungi were collected in 25 mm cassettes containing 0.8 microm mixed cellulose ester filters using aggressive sampling conditions. Both culturable fungi and fungal spores were collected in modified slotted-disk cassettes. The sample volume was 4 L. The filters were examined microscopically and dilution plated onto multiple culture media. Collecting airborne samples in filter cassettes was an effective method for assessing wall cavities for fungal contaminants, especially because this method allowed the sample to be analyzed by both microscopy and culture media. Assessment criteria were developed that allowed the sample results to be used to classify wall cavities as either uncontaminated or contaminated. As a criterion, wall cavities with concentrations of culturable fungi below the limit of detection (LOD) were classified as uncontaminated, whereas those cavities with detectable concentrations of culturable fungi were classified as contaminated. A total of 150 wall cavities was sampled as part of a field project. The concentrations of culturable fungi were below the LOD in 34% of the samples, whereas Aspergillus and/or Penicillium were the only fungal genera detected in 69% of the samples in which culturable fungi were detected. Spore counting resulted in the detection of Stachybotrys-like spores in 25% of the samples that were analyzed, whereas Stachybotrys chartarum colonies were only detected on 2% of malt extract agar plates and on 6% of corn meal agar plates.

Pharmaceutical compounds in shallow groundwater in non-agricultural areas of Minnesota: study design, methods, and data, 2013

USGS Publications Warehouse

Elliott, Sarah M.; Erickson, Melinda L.

2014-01-01

The U.S. Geological Survey, in cooperation with the Minnesota Pollution Control Agency, completed a study on the occurrence of pharmaceutical compounds and other contaminants of emerging concern in shallow groundwater in non-agricultural areas of Minnesota during 2013. This report describes the study design and methods for the study on the occurrence of pharmaceuticals and other contaminants of emerging concern, and presents the data collected on pharmaceutical compounds. Samples were analyzed by the U.S. Geological Survey National Water Quality Laboratory for 110 pharmaceutical compounds using research method 9017. Samples from 21 of 45 wells had detectable concentrations of at least one of the 110 compounds analyzed. One sample contained detectable concentrations of nine compounds, which was the most detected in a single sample. Fewer than five compounds were detected in most samples. Among all samples, 27 of the 110 compounds were detected in groundwater from at least one well. Desmethyldiltiazem and nicotine were the most frequently detected compounds, each detected in 5 of 46 environmental samples (one well was sampled twice so a total of 46 environmental samples were collected from 45 wells). Caffeine had the highest detectable concentration of all the compounds at 2,060 nanograms per liter.

Evaluation of seven aquatic sampling methods for amphibians and other aquatic fauna

USGS Publications Warehouse

Gunzburger, M.S.

2007-01-01

To design effective and efficient research and monitoring programs researchers must have a thorough understanding of the capabilities and limitations of their sampling methods. Few direct comparative studies exist for aquatic sampling methods for amphibians. The objective of this study was to simultaneously employ seven aquatic sampling methods in 10 wetlands to compare amphibian species richness and number of individuals detected with each method. Four sampling methods allowed counts of individuals (metal dipnet, D-frame dipnet, box trap, crayfish trap), whereas the other three methods allowed detection of species (visual encounter, aural, and froglogger). Amphibian species richness was greatest with froglogger, box trap, and aural samples. For anuran species, the sampling methods by which each life stage was detected was related to relative length of larval and breeding periods and tadpole size. Detection probability of amphibians varied across sampling methods. Box trap sampling resulted in the most precise amphibian count, but the precision of all four count-based methods was low (coefficient of variation > 145 for all methods). The efficacy of the four count sampling methods at sampling fish and aquatic invertebrates was also analyzed because these predatory taxa are known to be important predictors of amphibian habitat distribution. Species richness and counts were similar for fish with the four methods, whereas invertebrate species richness and counts were greatest in box traps. An effective wetland amphibian monitoring program in the southeastern United States should include multiple sampling methods to obtain the most accurate assessment of species community composition at each site. The combined use of frogloggers, crayfish traps, and dipnets may be the most efficient and effective amphibian monitoring protocol. ?? 2007 Brill Academic Publishers.

Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

PubMed

Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

2011-09-01

In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

Methods for the selective detection of alkyne-presenting molecules and related compositions and systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valdez, Carlos A.; Vu, Alexander K.

Provided herein are methods for selectively detecting an alkyne-presenting molecule in a sample and related detection reagents, compositions, methods and systems. The methods include contacting a detection reagent with the sample for a time and under a condition to allow binding of the detection reagent to the one or more alkyne-presenting molecules possibly present in the matrix to the detection reagent. The detection reagent includes an organic label moiety presenting an azide group. The binding of the azide group to the alkyne-presenting molecules results in emission of a signal from the organic label moiety.

Validated method for quantification of genetically modified organisms in samples of maize flour.

PubMed

Kunert, Renate; Gach, Johannes S; Vorauer-Uhl, Karola; Engel, Edwin; Katinger, Hermann

2006-02-08

Sensitive and accurate testing for trace amounts of biotechnology-derived DNA from plant material is the prerequisite for detection of 1% or 0.5% genetically modified ingredients in food products or raw materials thereof. Compared to ELISA detection of expressed proteins, real-time PCR (RT-PCR) amplification has easier sample preparation and detection limits are lower. Of the different methods of DNA preparation CTAB method with high flexibility in starting material and generation of sufficient DNA with relevant quality was chosen. Previous RT-PCR data generated with the SYBR green detection method showed that the method is highly sensitive to sample matrices and genomic DNA content influencing the interpretation of results. Therefore, this paper describes a real-time DNA quantification based on the TaqMan probe method, indicating high accuracy and sensitivity with detection limits of lower than 18 copies per sample applicable and comparable to highly purified plasmid standards as well as complex matrices of genomic DNA samples. The results were evaluated with ValiData for homology of variance, linearity, accuracy of the standard curve, and standard deviation.

Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

PubMed Central

Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

2014-01-01

The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using the standard culture method. PMID:24849624

Multiplex real-time PCR for detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) genes from selective enrichments from animals and retail meat.

PubMed

Velasco, Valeria; Sherwood, Julie S; Rojas-García, Pedro P; Logue, Catherine M

2014-01-01

The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement) and 0.29-0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using the standard culture method.

Evaluation of a polymerase chain reaction-based system for detection of Salmonella enteritidis, Escherichia coli O157:H7, Listeria spp., and Listeria monocytogenes on fresh fruits and vegetables.

PubMed

Shearer, A E; Strapp, C M; Joerger, R D

2001-06-01

A polymerase chain reaction (PCR)-based detection system, BAX, was evaluated for its sensitivity in detecting Salmonella Enteritidis, Escherichia coli O157:H7, Listeria sp., and Listeria monocytogenes on fresh produce. Fifteen different types of produce (alfalfa sprouts, green peppers, parsley, white cabbage, radishes, onions, carrots, mushrooms, leaf lettuce, tomatoes, strawberries, cantaloupe, mango, apples, and oranges) were inoculated, in separate studies, with Salmonella Enteritidis, E. coli O157:H7, and L. monocytogenes down to the predicted level of 1 CFU per 25-g sample. Detection by BAX was compared to recovery of the inoculated bacteria by culture methods according to the Food and Drug Administration's (FDA) Bacteriological Analytical Manual (BAM). BAX was essentially as sensitive as the culture-based method in detecting Salmonella Enteritidis and L. monocytogenes and more sensitive than the culture-based method for the detection of E. coli O157:H7 on green pepper, carrot, radish, and sprout samples. Detection of the pathogenic bacteria in samples spiked with a predicted number of less than 10 CFU was possible for most produce samples, but both methods failed to detect L. monocytogenes on carrot samples and one of two mushroom and onion samples spiked with less than 100 CFU. Both BAX and the culture method were also unable to consistently recover low numbers of E. coli O157:H7 from alfalfa sprouts. The PCR method allowed detection of Salmonella Enteritidis, E. coli O157:H7, and L. monocytogenes at least 2 days earlier than the conventional culture methods.

A simple, rapid, cost-effective and sensitive method for detection of Salmonella in environmental and pecan samples.

PubMed

Dobhal, S; Zhang, G; Rohla, C; Smith, M W; Ma, L M

2014-10-01

PCR is widely used in the routine detection of foodborne human pathogens; however, challenges remain in overcoming PCR inhibitors present in some sample matrices. The objective of this study was to develop a simple, sensitive, cost-effective and rapid method for processing large numbers of environmental and pecan samples for Salmonella detection. This study was also aimed at validation of a new protocol for the detection of Salmonella from in-shell pecans. Different DNA template preparation methods, including direct boiling, prespin, multiple washing and commercial DNA extraction kits, were evaluated with pure cultures of Salmonella Typhimurium and with enriched soil, cattle feces and in-shell pecan each spiked individually with Salmonella Typhimurium. PCR detection of Salmonella was conducted using invA and 16S rRNA gene (internal amplification control) specific primers. The effect of amplification facilitators, including bovine serum albumin (BSA), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) and gelatin on PCR sensitivity, was also evaluated. Conducting a prespin of sample matrices in combination with the addition of 0·4% (w/v) BSA and 1% (w/v) PVP in PCR mix was the simplest, most rapid, cost-effective and sensitive method for PCR detection of Salmonella, with up to 40 CFU Salmonella per reaction detectable in the presence of over 10(9 ) CFU ml(-1) of background micro-organisms from enriched feces soil or pecan samples. The developed method is rapid, cost-effective and sensitive for detection of Salmonella from different matrices. This study provides a method with broad applicability for PCR detection of Salmonella in complex sample matrices. This method has a potential for its application in different research arenas and diagnostic laboratories. © 2014 The Society for Applied Microbiology.

Seasonal distribution of Legionella spp. and L. pneumophila in a river in Taiwan evaluated with culture-confirmed and direct DNA extraction methods

NASA Astrophysics Data System (ADS)

Tung, Min-Che; Chang, Tien-Yu; Hsu, Bing-Mu; Shen, Shu-Min; Huang, Jen-Te; Kao, Po-Min; Chiu, Yi-Chou; Fan, Cheng-Wei; Huang, Yu-Li

2013-07-01

In this study, we evaluated the presence and amount of Legionella in along a river in Taiwan, and the relations between seasonal distribution of Legionella spp. and geographic characteristics in the watershed were also evaluated. Water samples were pre-treated and analyzed with culture-confirmed and direct DNA extraction methods. For culture-confirmed method, water samples were cultivated through a series of selective media, and candidate colonies were confirmed by PCR. For direct DNA extraction method, direct DNA extraction was performed from pre-treated water samples. The DNA extracts were analyzed with PCR and DNA sequence analysis for species determination, quantitative PCR (qPCR) was performed to quantify Legionella concentration in the water sample. In all, 150 water samples were included in this study, with 73 (48.6%) water samples detected with Legionella spp., and 17 with L. pneumophila. Over 80% Legionella spp. detections were through direct DNA extraction method, but more than 80% L. pneumophila detections were through culture-confirmed method. While detection of Legionella spp. was done with two methods, positive results were found through only one method. Legionella spp. was detected in all seasons with detection rate ranging between 34.3-58.8% and seasonal average concentration from 1.9 × 102 to 7.1 × 103 CFU/L. Most of the L. pneumophila detections were from samples collected in fall (38.2%) and summer (6.0%), which also coincided with increased cases of Legionellosis reported through Center of Disease Control in Taiwan. The high prevalence and concentration of Legionella spp. and L. pneumophila in the surface waters should be further evaluated for potential health risks.

Validation of High Resolution Melting Analysis (HRM) of the Amplified ITS2 Region for the Detection and Identification of Yeasts from Clinical Samples: Comparison with Culture and MALDI-TOF Based Identification.

PubMed

Duyvejonck, Hans; Cools, Piet; Decruyenaere, Johan; Roelens, Kristien; Noens, Lucien; Vermeulen, Stefan; Claeys, Geert; Decat, Ellen; Van Mechelen, Els; Vaneechoutte, Mario

2015-01-01

Candida species are known as opportunistic pathogens, and a possible cause of invasive infections. Because of their species-specific antimycotic resistance patterns, reliable techniques for their detection, quantification and identification are needed. We validated a DNA amplification method for direct detection of Candida spp. from clinical samples, namely the ITS2-High Resolution Melting Analysis (direct method), by comparing it with a culture and MALDI-TOF Mass Spectrometry based method (indirect method) to establish the presence of Candida species in three different types of clinical samples. A total of 347 clinical samples, i.e. throat swabs, rectal swabs and vaginal swabs, were collected from the gynaecology/obstetrics, intensive care and haematology wards at the Ghent University Hospital, Belgium. For the direct method, ITS2-HRM was preceded by NucliSENS easyMAG DNA extraction, directly on the clinical samples. For the indirect method, clinical samples were cultured on Candida ID and individual colonies were identified by MALDI-TOF. For 83.9% of the samples there was complete concordance between both techniques, i.e. the same Candida species were detected in 31.1% of the samples or no Candida species were detected in 52.8% of the samples. In 16.1% of the clinical samples, discrepant results were obtained, of which only 6.01% were considered as major discrepancies. Discrepancies occurred mostly when overall numbers of Candida cells in the samples were low and/or when multiple species were present in the sample. Most of the discrepancies could be decided in the advantage of the direct method. This is due to samples in which no yeast could be cultured whereas low amounts could be detected by the direct method and to samples in which high quantities of Candida robusta according to ITS2-HRM were missed by culture on Candida ID agar. It remains to be decided whether the diagnostic advantages of the direct method compensate for its disadvantages.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Differences in Movement Pattern and Detectability between Males and Females Influence How Common Sampling Methods Estimate Sex Ratio.

PubMed

Rodrigues, João Fabrício Mota; Coelho, Marco Túlio Pacheco

2016-01-01

Sampling the biodiversity is an essential step for conservation, and understanding the efficiency of sampling methods allows us to estimate the quality of our biodiversity data. Sex ratio is an important population characteristic, but until now, no study has evaluated how efficient are the sampling methods commonly used in biodiversity surveys in estimating the sex ratio of populations. We used a virtual ecologist approach to investigate whether active and passive capture methods are able to accurately sample a population's sex ratio and whether differences in movement pattern and detectability between males and females produce biased estimates of sex-ratios when using these methods. Our simulation allowed the recognition of individuals, similar to mark-recapture studies. We found that differences in both movement patterns and detectability between males and females produce biased estimates of sex ratios. However, increasing the sampling effort or the number of sampling days improves the ability of passive or active capture methods to properly sample sex ratio. Thus, prior knowledge regarding movement patterns and detectability for species is important information to guide field studies aiming to understand sex ratio related patterns.

Differences in Movement Pattern and Detectability between Males and Females Influence How Common Sampling Methods Estimate Sex Ratio

PubMed Central

Rodrigues, João Fabrício Mota; Coelho, Marco Túlio Pacheco

2016-01-01

Sampling the biodiversity is an essential step for conservation, and understanding the efficiency of sampling methods allows us to estimate the quality of our biodiversity data. Sex ratio is an important population characteristic, but until now, no study has evaluated how efficient are the sampling methods commonly used in biodiversity surveys in estimating the sex ratio of populations. We used a virtual ecologist approach to investigate whether active and passive capture methods are able to accurately sample a population’s sex ratio and whether differences in movement pattern and detectability between males and females produce biased estimates of sex-ratios when using these methods. Our simulation allowed the recognition of individuals, similar to mark-recapture studies. We found that differences in both movement patterns and detectability between males and females produce biased estimates of sex ratios. However, increasing the sampling effort or the number of sampling days improves the ability of passive or active capture methods to properly sample sex ratio. Thus, prior knowledge regarding movement patterns and detectability for species is important information to guide field studies aiming to understand sex ratio related patterns. PMID:27441554

The comparison of detection methods of asymptomatic malaria in hypoendemic areas

NASA Astrophysics Data System (ADS)

Siahaan, L.; Panggabean, M.; Panggabean, Y. C.

2018-03-01

Malaria is still a problem that disrupts public health in North Sumatera. Late diagnosis will increase the chances of increased morbidity and mortality due to malaria. The early detection of asymptomatic malaria is one of the best efforts to reduce the transmission of the disease. Early detection is certainly must be done on suspect patients who have no malaria complaints. Passive Case Detection (PCD) methods seem hard to find asymptomatic malaria. This study was conducted to compare ACD (Active Case Detection) and PCD methods in asymptomatic malaria detection in the hypoendemic areas of malaria. ACD method is done by going to the sample based on secondary data. Meanwhile, PCD is done on samples that come to health services. Samples were taken randomly and diagnosis was confirmed by microscopic examination with 3% Giemsa staining, as gold standard of malaria diagnostics. There was a significant difference between ACD and PCD detection methods (p = 0.034), where ACD method was seen superior in detecting malaria patients in all categories, such as: clinical malaria (65.2%), asymptomatic malaria (65.1%) and submicroscopic malaria (58.5%). ACD detection methods are superior in detecting malaria sufferers, especially asymptomatic malaria sufferers.

Monoclonal antibodies to synthetic pyrethroids and method for detecting the same

DOEpatents

Stanker, Larry H.; Vanderlaan, Martin; Watkins, Bruce E.; Van Emon, Jeanette M.; Bigbee, Carolyn L.

1992-01-01

Methods are described for making specific monoclonal antibodies which may be used in a sensitive immunoassay for detection of synthetic pyrethroids in foods and environmental samples. Appropriate sample preparation and enzyme amplification of the immunoassay for this widely-used class of pesticides permits detection at low levels in laboratory and field tested samples.

Monoclonal antibodies to synthetic pyrethroids and method for detecting the same

DOEpatents

Stanker, L.H.; Vanderlaan, M.; Watkins, B.E.; Van Emon, J.M.; Bigbee, C.L.

1992-04-28

Methods are described for making specific monoclonal antibodies which may be used in a sensitive immunoassay for detection of synthetic pyrethroids in foods and environmental samples. Appropriate sample preparation and enzyme amplification of the immunoassay for this widely-used class of pesticides permits detection at low levels in laboratory and field tested samples. 6 figs.

Detection of Circulating Paracoccidioides brasiliensis Antigen in Urine of Paracoccidioidomycosis Patients before and during Treatment

PubMed Central

Salina, Margarete Aparecida; Shikanai-Yasuda, Maria Aparecida; Mendes, Rinaldo Poncio; Barraviera, Benedito; Mendes Giannini, Maria José Soares

1998-01-01

For the diagnosis and follow-up of paracoccidioidomycosis patients undergoing therapy, we evaluated two methods (immunoblotting and competition enzyme immunoassay) for the detection of circulating antigen in urine samples. A complex pattern of reactivity was observed in the immunoblot test. Bands of 70 and 43 kDa were detected more often in urine samples from patients before treatment. The immunoblot method detected gp43 and gp70 separately or concurrently in 11 (91.7%) of 12 patients, whereas the competition enzyme immunoassay detected antigenuria in 9 (75%) of 12 patients. Both tests appeared to be highly specific (100%), considering that neither fraction detectable by immunoblotting was present in urine samples from the control group. gp43 remained present in the urine samples collected during the treatment period, with a significant decrease in reactivity in samples collected during clinical recovery and increased reactivity in samples collected during relapses. Reactivity of some bands was also detected in urine specimens from patients with “apparent cure.” The detection of Paracoccidioides brasiliensis antigens in urine appears to be a promising method for diagnosing infection, for evaluating the efficacy of treatment, and for detecting relapse. PMID:9620407

[Development of sample pretreatment techniques-rapid detection coupling methods for food security analysis].

PubMed

Huang, Yichun; Ding, Weiwei; Zhang, Zhuomin; Li, Gongke

2013-07-01

This paper summarizes the recent developments of the rapid detection methods for food security, such as sensors, optical techniques, portable spectral analysis, enzyme-linked immunosorbent assay, portable gas chromatograph, etc. Additionally, the applications of these rapid detection methods coupled with sample pretreatment techniques in real food security analysis are reviewed. The coupling technique has the potential to provide references to establish the selective, precise and quantitative rapid detection methods in food security analysis.

Performance of two alternative methods for Listeria detection throughout Serro Minas cheese ripening.

PubMed

Mata, Gardênia Márcia Silva Campos; Martins, Evandro; Machado, Solimar Gonçalves; Pinto, Maximiliano Soares; de Carvalho, Antônio Fernandes; Vanetti, Maria Cristina Dantas

2016-01-01

The ability of pathogens to survive cheese ripening is a food-security concern. Therefore, this study aimed to evaluate the performance of two alternative methods of analysis of Listeria during the ripening of artisanal Minas cheese. These methods were tested and compared with the conventional method: Lateral Flow System™, in cheeses produced on laboratory scale using raw milk collected from different farms and inoculated with Listeria innocua; and VIDAS(®)-LMO, in cheese samples collected from different manufacturers in Serro, Minas Gerais, Brazil. These samples were also characterized in terms of lactic acid bacteria, coliforms and physical-chemical analysis. In the inoculated samples, L. innocua was detected by Lateral Flow System™ method with 33% false-negative and 68% accuracy results. L. innocua was only detected in the inoculated samples by the conventional method at 60-days of cheese ripening. L. monocytogenes was not detected by the conventional and the VIDAS(®)-LMO methods in cheese samples collected from different manufacturers, which impairs evaluating the performance of this alternative method. We concluded that the conventional method provided a better recovery of L. innocua throughout cheese ripening, being able to detect L. innocua at 60-day, aging period which is required by the current legislation. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

[Identification of hepatitis B virus YMDD point mutation using peptide nucleic acid clamping PCR].

PubMed

Zhang, Yingying; He, Haitang; Yang, Jie; Hou, Jinlin

2013-06-01

To establish a peptide nucleic acid clamping PCR assay for detecting hepatitis B virus (HBV) drug resistance mutation. RtM204I (ATT) mutant, rtM204V (GTG) mutant and rtM204 (ATG) wild-type plasmids mixed at different ratios were detected for mutations by PNA clamping PCR assay and direct sequencing, and the sensitivity and specificity of the two methods were compared. Serum samples from 85 patients with chronic HBV infection were detected for drug resistance using the two methods. The sensitivity of PNA-PCR assay was 0.001% in a 10(5)-fold excess of wild-type HBV DNA with a detection limit of 10(1) copies. The sensitivity of direct sequencing was 10% with a detection limit of 10(4) copies. Mutants were detected in 73 of the 85 serum samples (85.9%), including YIDD in 40 samples, YVDD in 23 samples, and YIDD+YVDD in 10 samples. The agreement of PNA-PCR assay with direct sequencing was only 40% (34/85, YIDD in 21 samples, YVDD in 11 samples, and YIDD+YVDD in 2 samples). Neither of the two methods yielded positive results for the negative control samples, suggesting their good specificity. PNA-PCR assay appears to be a more sensitive and rapid assay for detection of HBV genotypic resistance.

Comparison of soil sampling and analytical methods for asbestos at the Sumas Mountain Asbestos Site-Working towards a toolbox for better assessment.

PubMed

Wroble, Julie; Frederick, Timothy; Frame, Alicia; Vallero, Daniel

2017-01-01

Established soil sampling methods for asbestos are inadequate to support risk assessment and risk-based decision making at Superfund sites due to difficulties in detecting asbestos at low concentrations and difficulty in extrapolating soil concentrations to air concentrations. Environmental Protection Agency (EPA)'s Office of Land and Emergency Management (OLEM) currently recommends the rigorous process of Activity Based Sampling (ABS) to characterize site exposures. The purpose of this study was to compare three soil analytical methods and two soil sampling methods to determine whether one method, or combination of methods, would yield more reliable soil asbestos data than other methods. Samples were collected using both traditional discrete ("grab") samples and incremental sampling methodology (ISM). Analyses were conducted using polarized light microscopy (PLM), transmission electron microscopy (TEM) methods or a combination of these two methods. Data show that the fluidized bed asbestos segregator (FBAS) followed by TEM analysis could detect asbestos at locations that were not detected using other analytical methods; however, this method exhibited high relative standard deviations, indicating the results may be more variable than other soil asbestos methods. The comparison of samples collected using ISM versus discrete techniques for asbestos resulted in no clear conclusions regarding preferred sampling method. However, analytical results for metals clearly showed that measured concentrations in ISM samples were less variable than discrete samples.

Comparison of soil sampling and analytical methods for asbestos at the Sumas Mountain Asbestos Site—Working towards a toolbox for better assessment

PubMed Central

2017-01-01

Established soil sampling methods for asbestos are inadequate to support risk assessment and risk-based decision making at Superfund sites due to difficulties in detecting asbestos at low concentrations and difficulty in extrapolating soil concentrations to air concentrations. Environmental Protection Agency (EPA)’s Office of Land and Emergency Management (OLEM) currently recommends the rigorous process of Activity Based Sampling (ABS) to characterize site exposures. The purpose of this study was to compare three soil analytical methods and two soil sampling methods to determine whether one method, or combination of methods, would yield more reliable soil asbestos data than other methods. Samples were collected using both traditional discrete (“grab”) samples and incremental sampling methodology (ISM). Analyses were conducted using polarized light microscopy (PLM), transmission electron microscopy (TEM) methods or a combination of these two methods. Data show that the fluidized bed asbestos segregator (FBAS) followed by TEM analysis could detect asbestos at locations that were not detected using other analytical methods; however, this method exhibited high relative standard deviations, indicating the results may be more variable than other soil asbestos methods. The comparison of samples collected using ISM versus discrete techniques for asbestos resulted in no clear conclusions regarding preferred sampling method. However, analytical results for metals clearly showed that measured concentrations in ISM samples were less variable than discrete samples. PMID:28759607

Evaluation of two outlier-detection-based methods for detecting tissue-selective genes from microarray data.

PubMed

Kadota, Koji; Konishi, Tomokazu; Shimizu, Kentaro

2007-05-01

Large-scale expression profiling using DNA microarrays enables identification of tissue-selective genes for which expression is considerably higher and/or lower in some tissues than in others. Among numerous possible methods, only two outlier-detection-based methods (an AIC-based method and Sprent's non-parametric method) can treat equally various types of selective patterns, but they produce substantially different results. We investigated the performance of these two methods for different parameter settings and for a reduced number of samples. We focused on their ability to detect selective expression patterns robustly. We applied them to public microarray data collected from 36 normal human tissue samples and analyzed the effects of both changing the parameter settings and reducing the number of samples. The AIC-based method was more robust in both cases. The findings confirm that the use of the AIC-based method in the recently proposed ROKU method for detecting tissue-selective expression patterns is correct and that Sprent's method is not suitable for ROKU.

Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

PubMed Central

Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

2011-01-01

In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples. PMID:21764960

Detection of genetically modified organisms in foreign-made processed foods containing corn and potato.

PubMed

Monma, Kimio; Araki, Rie; Sagi, Naoki; Satoh, Masaki; Ichikawa, Hisatsugu; Satoh, Kazue; Tobe, Takashi; Kamata, Kunihiro; Hino, Akihiro; Saito, Kazuo

2005-06-01

Investigations of the validity of labeling regarding genetically modified (GM) products were conducted using polymerase chain reaction (PCR) methods for foreign-made processed foods made from corn and potato purchased in the Tokyo area and in the USA. Several kinds of GM crops were detected in 12 of 32 samples of processed corn samples. More than two GM events for which safety reviews have been completed in Japan were simultaneously detected in 10 samples. GM events MON810 and Bt11 were most frequently detected in the samples by qualitative PCR methods. MON810 was detected in 11 of the 12 samples, and Bt11 was detected in 6 of the 12 samples. In addition, Roundup Ready soy was detected in one of the 12 samples. On the other hand, CBH351, for which the safety assessment was withdrawn in Japan, was not detected in any of the 12 samples. A trial quantitative analysis was performed on six of the GM maize qualitatively positive samples. The estimated amounts of GM maize in these samples ranged from 0.2 to 2.8%, except for one sample, which contained 24.1%. For this sample, the total amount found by event-specific quantitative analysis was 23.8%. Additionally, Roundup Ready soy was detected in one sample of 21 potato-processed foods, although GM potatoes were not detected in any sample.

Application of tetraplex PCR for detection of Vibrio cholerae, V. parahaemolyticus, V. vulnificus and V. mimicus in cockle.

PubMed

Senachai, Pachara; Chomvarin, Chariya; Namwat, Wises; Wongboot, Warawan; Wongwajana, Suwin; Tangkanakul, Waraluk

2013-03-01

A tetraplex PCR method was developed for simultaneous detection of Vibrio cholerae, V. parahaemolyticus, V. vulnificus and V. mimicus in cockle samples in comparison with conventional culture method. Specific primers targeting ompW of V. cholerae, tl of V. parahaemolyticus, hsp60 of V. vulnificus and sodB of V. mimicus were employed in the same PCR. Detection limit of the tetraplex PCR assay was 104 cfu/ml (400 cfu/PCR reaction) for pure cultures of all four species of Vibrio. In Vibrio spiked cockle samples, the limit of detection after 6 hours enrichment in alkaline peptone water was 1 cfu/10 g of cockle tissue for three Vibrio spp, except for V. mimicus that was 102 cfu/10 g of cockle tissue. When the tetraplex PCR and culture methods were applied to 100 cockle samples, V. parahaemolyticus, V. vulnificus, V. cholerae and V. mimicus were detected in 100, 98, 80 and 9% of the samples by tetraplex PCR and in 76, 42, 0 and 0% by the culture method, respectively. This developed tetraplex PCR method should be suitable for simultaneous and rapid detection of Vibrio species in food samples and for food safety assessment.

Effects of Linking Methods on Detection of DIF.

ERIC Educational Resources Information Center

Kim, Seock-Ho; Cohen, Allan S.

1992-01-01

Effects of the following methods for linking metrics on detection of differential item functioning (DIF) were compared: (1) test characteristic curve method (TCC); (2) weighted mean and sigma method; and (3) minimum chi-square method. With large samples, results were essentially the same. With small samples, TCC was most accurate. (SLD)

Detecting and Estimating Contamination of Human DNA Samples in Sequencing and Array-Based Genotype Data

PubMed Central

Jun, Goo; Flickinger, Matthew; Hetrick, Kurt N.; Romm, Jane M.; Doheny, Kimberly F.; Abecasis, Gonçalo R.; Boehnke, Michael; Kang, Hyun Min

2012-01-01

DNA sample contamination is a serious problem in DNA sequencing studies and may result in systematic genotype misclassification and false positive associations. Although methods exist to detect and filter out cross-species contamination, few methods to detect within-species sample contamination are available. In this paper, we describe methods to identify within-species DNA sample contamination based on (1) a combination of sequencing reads and array-based genotype data, (2) sequence reads alone, and (3) array-based genotype data alone. Analysis of sequencing reads allows contamination detection after sequence data is generated but prior to variant calling; analysis of array-based genotype data allows contamination detection prior to generation of costly sequence data. Through a combination of analysis of in silico and experimentally contaminated samples, we show that our methods can reliably detect and estimate levels of contamination as low as 1%. We evaluate the impact of DNA contamination on genotype accuracy and propose effective strategies to screen for and prevent DNA contamination in sequencing studies. PMID:23103226

Residual Agar Determination in Bacterial Spores by Electrospray Ionization Mass Spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahl, Karen L.; Colburn, Heather A.; Wunschel, David S.

2010-02-15

Presented here is an analytical method to detect residual agar from a bacterial spore sample as an indication of culturing on an agar plate. This method is based on the resolubilization of agar polysaccharide from a bacterial spore sample, enzymatic digestion, followed by electrospray ionization tandem mass spectrometry (ESI-MSn) analysis for detection of a specific agar fragment ion. A range of Bacillus species and strains were selected to demonstrate the effectiveness of this approach. The characteristic agar fragment ion was detected in the spores grown on agar that were washed from 1 to 5 times, irradiated or non-irradiated and notmore » in the spores grown in broth. A sample containing approximately 108 spores is currently needed for confident detection of residual agar from culture on agar plates in the presence of bacterial spores with a limit of detection of approximately 1 ppm agar spiked into a broth-grown spore sample. The results of a proficiency test with 42 blinded samples are presented demonstrating the utility of this method with no false positives and only 3 false negatives for samples that were below the detection level of the method as documented.« less

Use of the ecf1 gene to detect Shiga toxin-producing Escherichia coli in beef samples.

PubMed

Livezey, Kristin W; Groschel, Bettina; Becker, Michael M

2015-04-01

Escherichia coli O157:H7 and six serovars (O26, O103, O121, O111, O145, and O45) are frequently implicated in severe clinical illness worldwide. Standard testing methods using stx, eae, and O serogroup-specific gene sequences for detecting the top six non-O157 STEC bear the disadvantage that these genes may reside, independently, in different nonpathogenic organisms, leading to false-positive results. The ecf operon has previously been identified in the large enterohemolysin-encoding plasmid of eae-positive Shiga toxin-producing E. coli (STEC). Here, we explored the utility of the ecf operon as a single marker to detect eae-positive STEC from pure broth and primary meat enrichments. Analysis of 501 E. coli isolates demonstrated a strong correlation (99.6%) between the presence of the ecf1 gene and the combined presence of stx, eae, and ehxA genes. Two large studies were carried out to determine the utility of an ecf1 detection assay to detect non-O157 STEC strains in enriched meat samples in comparison to the results using the U. S. Department of Agriculture Food Safety and Inspection Service (FSIS) method that detects stx and eae genes. In ground beef samples (n = 1,065), the top six non-O157 STEC were detected in 4.0% of samples by an ecf1 detection assay and in 5.0% of samples by the stx- and eae-based method. In contrast, in beef samples composed largely of trim (n = 1,097), the top six non-O157 STEC were detected at 1.1% by both methods. Estimation of false-positive rates among the top six non-O157 STEC revealed a lower rate using the ecf1 detection method (0.5%) than using the eae and stx screening method (1.1%). Additionally, the ecf1 detection assay detected STEC strains associated with severe illness that are not included in the FSIS regulatory definition of adulterant STEC.

[Optimized application of nested PCR method for detection of malaria].

PubMed

Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

2017-04-28

Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P < 0.05). Conclusion The optimized PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

Analysis of methods commonly used in biomedicine for treatment versus control comparison of very small samples.

PubMed

Ristić-Djurović, Jasna L; Ćirković, Saša; Mladenović, Pavle; Romčević, Nebojša; Trbovich, Alexander M

2018-04-01

A rough estimate indicated that use of samples of size not larger than ten is not uncommon in biomedical research and that many of such studies are limited to strong effects due to sample sizes smaller than six. For data collected from biomedical experiments it is also often unknown if mathematical requirements incorporated in the sample comparison methods are satisfied. Computer simulated experiments were used to examine performance of methods for qualitative sample comparison and its dependence on the effectiveness of exposure, effect intensity, distribution of studied parameter values in the population, and sample size. The Type I and Type II errors, their average, as well as the maximal errors were considered. The sample size 9 and the t-test method with p = 5% ensured error smaller than 5% even for weak effects. For sample sizes 6-8 the same method enabled detection of weak effects with errors smaller than 20%. If the sample sizes were 3-5, weak effects could not be detected with an acceptable error; however, the smallest maximal error in the most general case that includes weak effects is granted by the standard error of the mean method. The increase of sample size from 5 to 9 led to seven times more accurate detection of weak effects. Strong effects were detected regardless of the sample size and method used. The minimal recommended sample size for biomedical experiments is 9. Use of smaller sizes and the method of their comparison should be justified by the objective of the experiment. Copyright © 2018 Elsevier B.V. All rights reserved.

Development and validation of a FISH-based method for the detection and quantification of E. coli and coliform bacteria in water samples.

PubMed

Hügler, Michael; Böckle, Karin; Eberhagen, Ingrid; Thelen, Karin; Beimfohr, Claudia; Hambsch, Beate

2011-01-01

Monitoring of microbiological contaminants in water supplies requires fast and sensitive methods for the specific detection of indicator organisms or pathogens. We developed a protocol for the simultaneous detection of E. coli and coliform bacteria based on the Fluorescence in situ Hybridization (FISH) technology. This protocol consists of two approaches. The first allows the direct detection of single E. coli and coliform bacterial cells on the filter membranes. The second approach includes incubation of the filter membranes on a nutrient agar plate and subsequent detection of the grown micro-colonies. Both approaches were validated using drinking water samples spiked with pure cultures and naturally contaminated water samples. The effects of heat, chlorine and UV disinfection were also investigated. The micro-colony approach yielded very good results for all samples and conditions tested, and thus can be thoroughly recommended for usage as an alternative method to detect E. coli and coliform bacteria in water samples. However, during this study, some limitations became visible for the single cell approach. The method cannot be applied for water samples which have been disinfected by UV irradiation. In addition, our results indicated that green fluorescent dyes are not suitable to be used with chlorine disinfected samples.

Calculating Confidence, Uncertainty, and Numbers of Samples When Using Statistical Sampling Approaches to Characterize and Clear Contaminated Areas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piepel, Gregory F.; Matzke, Brett D.; Sego, Landon H.

2013-04-27

This report discusses the methodology, formulas, and inputs needed to make characterization and clearance decisions for Bacillus anthracis-contaminated and uncontaminated (or decontaminated) areas using a statistical sampling approach. Specifically, the report includes the methods and formulas for calculating the • number of samples required to achieve a specified confidence in characterization and clearance decisions • confidence in making characterization and clearance decisions for a specified number of samples for two common statistically based environmental sampling approaches. In particular, the report addresses an issue raised by the Government Accountability Office by providing methods and formulas to calculate the confidence that amore » decision area is uncontaminated (or successfully decontaminated) if all samples collected according to a statistical sampling approach have negative results. Key to addressing this topic is the probability that an individual sample result is a false negative, which is commonly referred to as the false negative rate (FNR). The two statistical sampling approaches currently discussed in this report are 1) hotspot sampling to detect small isolated contaminated locations during the characterization phase, and 2) combined judgment and random (CJR) sampling during the clearance phase. Typically if contamination is widely distributed in a decision area, it will be detectable via judgment sampling during the characterization phrase. Hotspot sampling is appropriate for characterization situations where contamination is not widely distributed and may not be detected by judgment sampling. CJR sampling is appropriate during the clearance phase when it is desired to augment judgment samples with statistical (random) samples. The hotspot and CJR statistical sampling approaches are discussed in the report for four situations: 1. qualitative data (detect and non-detect) when the FNR = 0 or when using statistical sampling methods that account for FNR > 0 2. qualitative data when the FNR > 0 but statistical sampling methods are used that assume the FNR = 0 3. quantitative data (e.g., contaminant concentrations expressed as CFU/cm2) when the FNR = 0 or when using statistical sampling methods that account for FNR > 0 4. quantitative data when the FNR > 0 but statistical sampling methods are used that assume the FNR = 0. For Situation 2, the hotspot sampling approach provides for stating with Z% confidence that a hotspot of specified shape and size with detectable contamination will be found. Also for Situation 2, the CJR approach provides for stating with X% confidence that at least Y% of the decision area does not contain detectable contamination. Forms of these statements for the other three situations are discussed in Section 2.2. Statistical methods that account for FNR > 0 currently only exist for the hotspot sampling approach with qualitative data (or quantitative data converted to qualitative data). This report documents the current status of methods and formulas for the hotspot and CJR sampling approaches. Limitations of these methods are identified. Extensions of the methods that are applicable when FNR = 0 to account for FNR > 0, or to address other limitations, will be documented in future revisions of this report if future funding supports the development of such extensions. For quantitative data, this report also presents statistical methods and formulas for 1. quantifying the uncertainty in measured sample results 2. estimating the true surface concentration corresponding to a surface sample 3. quantifying the uncertainty of the estimate of the true surface concentration. All of the methods and formulas discussed in the report were applied to example situations to illustrate application of the methods and interpretation of the results.« less

[Development of a SPA-ELISA method for detecting anti-coronavirus IgG antibodies in serum samples from fulvous fruit bats].

PubMed

Zhou, Jie; Liao, Yu-xue; Chen, Zhong; Li, Yu-chun; Gao, Lu-Lu; Chen, Yi-xiong; Cai, Lian-gong; Chen, Qing; Yu, Shou-yi

2008-05-01

To develop an simple and sensitive method for detecting anti-coronavirus IgG antibodies in bat sera based on enzyme-linked immunosorbent assay (ELISA). A commercial ELISA kit for detecting SARS-CoV antibody was modified for detecting coronavirus antibodies in bat serum samples. The second antibody in the kit was replaced with horseradish peroxidase-conjugated protein-A (HRP-SPA) based on the characteristics of binding between Staphylococcus aureus protein A (SPA) and mammal IgG Fc fragment. The sera of 55 fulvous fruit bats (Rousettus dasymallus) were tested using the SPA-ELISA. The test results of the positive and negative controls in the kit and the serum samples from convalescent ;patient were consistent with expectation. Coronavirus antibody was detected in 2 out of the 55 bat serum samples. Serum neutralization test confirmed the validity of the SPA-ELISA method. This SPA-ELISA method is applicable for detecting coronavirus antibody in bat sera.

The DNA isolation method has effect on allele drop-out and on the results of fluorescent PCR and DNA fragment analysis.

PubMed

Nagy, Bálint; Bán, Zoltán; Papp, Zoltán

2005-10-01

The quality and the quantity of isolated DNA have an effect on PCR amplifications. The authors studied three DNA isolation protocols (resin binding method using fresh and frozen amniotic fluid samples, and silica adsorption method using fresh samples) on the quantity and on the quality of the isolated DNA. Amniotic fluid samples were obtained from 20 pregnant women. The isolated DNA concentrations were determined by real-time fluorimeter using SYBRGreen I method. Each sample was studied for the presence of 8 STR markers. The authors compared the number of the detected alleles, electrophoretograms and peak areas. There was a significant difference between the concentration of the obtained DNA and in the peak areas between the three isolation protocols. The numbers of detected alleles were different, we observed the most allele drop outs in the resin type DNA isolation protocol from the fresh sample (detected allele numbers 182), followed by resin binding protocol from the frozen samples (detected allele number 243) and by the silica adsorption method (detected allele number 264). The authors demonstrated that the DNA isolation method has an effect on the quantity and quality of the isolated DNA, and on further PCR amplifications.

Development and validation of a 48-target analytical method for high-throughput monitoring of genetically modified organisms.

PubMed

Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang

2015-01-05

The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection.

Development and Validation of A 48-Target Analytical Method for High-throughput Monitoring of Genetically Modified Organisms

PubMed Central

Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang

2015-01-01

The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection. PMID:25556930

Evaluation of beef trim sampling methods for detection of Shiga toxin-producing Escherichia coli (STEC)

USDA-ARS?s Scientific Manuscript database

Presence of Shiga toxin-producing Escherichia coli (STEC) is a major concern in ground beef. Several methods for sampling beef trim prior to grinding are currently used in the beef industry. The purpose of this study was to determine the efficacy of the sampling methods for detecting STEC in beef ...

Sampling Methods for Detection and Monitoring of the Asian Citrus Psyllid (Hemiptera: Psyllidae).

PubMed

Monzo, C; Arevalo, H A; Jones, M M; Vanaclocha, P; Croxton, S D; Qureshi, J A; Stansly, P A

2015-06-01

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama is a key pest of citrus due to its role as vector of citrus greening disease or "huanglongbing." ACP monitoring is considered an indispensable tool for management of vector and disease. In the present study, datasets collected between 2009 and 2013 from 245 citrus blocks were used to evaluate precision, sensitivity for detection, and efficiency of five sampling methods. The number of samples needed to reach a 0.25 standard error-mean ratio was estimated using Taylor's power law and used to compare precision among sampling methods. Comparison of detection sensitivity and time expenditure (cost) between stem-tap and other sampling methodologies conducted consecutively at the same location were also assessed. Stem-tap sampling was the most efficient sampling method when ACP densities were moderate to high and served as the basis for comparison with all other methods. Protocols that grouped trees near randomly selected locations across the block were more efficient than sampling trees at random across the block. Sweep net sampling was similar to stem-taps in number of captures per sampled unit, but less precise at any ACP density. Yellow sticky traps were 14 times more sensitive than stem-taps but much more time consuming and thus less efficient except at very low population densities. Visual sampling was efficient for detecting and monitoring ACP at low densities. Suction sampling was time consuming and taxing but the most sensitive of all methods for detection of sparse populations. This information can be used to optimize ACP monitoring efforts. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Chemicals of emerging concern in water and bottom sediment in the Great Lakes Basin, 2012: collection methods, analytical methods, quality assurance, and study data

USGS Publications Warehouse

Lee, Kathy E.; Langer, Susan K.; Menheer, Michael A.; Hansen, Donald S.; Foreman, William T.; Furlong, Edward T.; Jorgenson, Zachary G.; Choy, Steven J.; Moore, Jeremy N.; Banda, JoAnn; Gefell, Daniel J.

2015-01-01

During this study, 53 environmental samples, 4 field duplicate samples, and 8 field spike samples of bottom sediment and laboratory matrix-spike samples were analyzed for a wide variety of CECs at the USGS National Water Quality Laboratory using laboratory schedule 5433 for wastewater indicators; research method 6434 for steroid hormones, sterols, and bisphenol A; and research method 9008 for human-use pharmaceuticals and antidepressants. Forty of the 57 chemicals analyzed using laboratory schedule 5433 had detectable concentrations ranging from 1 to 49,000 micrograms per kilogram. Fourteen of the 20 chemicals analyzed using research method 6434 had detectable concentrations ranging from 0.04 to 24,940 nanograms per gram. Ten of the 20 chemicals analyzed using research method 9008 had detectable concentrations ranging from 0.59 to 197.5 micrograms per kilogram. Five of the 11 chemicals analyzed using research method 9008 had detectable concentrations ranging from 1.16 to 25.0 micrograms per kilogram.

Molecular detection of Toxoplasma gondii in water samples from Scotland and a comparison between the 529bp real-time PCR and ITS1 nested PCR.

PubMed

Wells, Beth; Shaw, Hannah; Innocent, Giles; Guido, Stefano; Hotchkiss, Emily; Parigi, Maria; Opsteegh, Marieke; Green, James; Gillespie, Simon; Innes, Elisabeth A; Katzer, Frank

2015-12-15

Waterborne transmission of Toxoplasma gondii is a potential public health risk and there are currently no agreed optimised methods for the recovery, processing and detection of T. gondii oocysts in water samples. In this study modified methods of T. gondii oocyst recovery and DNA extraction were applied to 1427 samples collected from 147 public water supplies throughout Scotland. T. gondii DNA was detected, using real time PCR (qPCR) targeting the 529bp repeat element, in 8.79% of interpretable samples (124 out of 1411 samples). The samples which were positive for T. gondii DNA originated from a third of the sampled water sources. The samples which were positive by qPCR and some of the negative samples were reanalysed using ITS1 nested PCR (nPCR) and results compared. The 529bp qPCR was the more sensitive technique and a full analysis of assay performance, by Bayesian analysis using a Markov Chain Monte Carlo method, was completed which demonstrated the efficacy of this method for the detection of T. gondii in water samples. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Near real time vapor detection and enhancement using aerosol adsorption

DOEpatents

Novick, Vincent J.; Johnson, Stanley A.

1999-01-01

A vapor sample detection method where the vapor sample contains vapor and ambient air and surrounding natural background particles. The vapor sample detection method includes the steps of generating a supply of aerosol that have a particular effective median particle size, mixing the aerosol with the vapor sample forming aerosol and adsorbed vapor suspended in an air stream, impacting the suspended aerosol and adsorbed vapor upon a reflecting element, alternatively directing infrared light to the impacted aerosol and adsorbed vapor, detecting and analyzing the alternatively directed infrared light in essentially real time using a spectrometer and a microcomputer and identifying the vapor sample.

Near real time vapor detection and enhancement using aerosol adsorption

DOEpatents

Novick, V.J.; Johnson, S.A.

1999-08-03

A vapor sample detection method is described where the vapor sample contains vapor and ambient air and surrounding natural background particles. The vapor sample detection method includes the steps of generating a supply of aerosol that have a particular effective median particle size, mixing the aerosol with the vapor sample forming aerosol and adsorbed vapor suspended in an air stream, impacting the suspended aerosol and adsorbed vapor upon a reflecting element, alternatively directing infrared light to the impacted aerosol and adsorbed vapor, detecting and analyzing the alternatively directed infrared light in essentially real time using a spectrometer and a microcomputer and identifying the vapor sample. 13 figs.

Comparison of Immunohistochemistry and Direct Sanger Sequencing for Detection of the BRAFV600E Mutation in Thyroid Neoplasm

PubMed Central

Oh, Hye-Seon; Kwon, Hyemi; Park, Suyeon; Kim, Mijin; Jeon, Min Ji; Kim, Tae Yong; Shong, Young Kee; Kim, Won Bae; Choi, Jene

2018-01-01

Background The BRAFV600E mutation is the most common genetic alteration identified in papillary thyroid carcinoma (PTC). Because of its costs effectiveness and sensitivity, direct Sanger sequencing has several limitations. The aim of this study was to evaluate the efficiency of immunohistochemistry (IHC) as an alternative method to detect the BRAFV600E mutation in preoperative and postoperative tissue samples. Methods We evaluated 71 patients who underwent thyroid surgery with the result of direct sequencing of the BRAFV600E mutation. IHC staining of the BRAFV600E mutation was performed in 49 preoperative and 23 postoperative thyroid specimens. Results Sixty-two patients (87.3%) had PTC, and of these, BRAFV600E was confirmed by direct sequencing in 57 patients (91.9%). In 23 postoperative tissue samples, the BRAFV600E mutation was detected in 16 samples (70%) by direct sequencing and 18 samples (78%) by IHC. In 24 fine needle aspiration (FNA) samples, BRAFV600E was detected in 18 samples (75%) by direct sequencing and 16 samples (67%) by IHC. In 25 core needle biopsy (CNB) samples, the BRAFV600E mutation was detected in 15 samples (60%) by direct sequencing and 16 samples (64%) by IHC. The sensitivity and specificity of IHC for detecting the BRAFV600E mutation were 77.8% and 66.7% in FNA samples and 99.3% and 80.0% in CNB samples. Conclusion IHC could be an alternative method to direct Sanger sequencing for BRAFV600E mutation detection both in postoperative and preoperative samples. However, application of IHC to detect the BRAFV600E mutation in FNA samples is of limited value compared with direct sequencing. PMID:29388401

Screening Test for Shed Skin Cells by Measuring the Ratio of Human DNA to Staphylococcus epidermidis DNA.

PubMed

Nakanishi, Hiroaki; Ohmori, Takeshi; Hara, Masaaki; Takahashi, Shirushi; Kurosu, Akira; Takada, Aya; Saito, Kazuyuki

2016-05-01

A novel screening method for shed skin cells by detecting Staphylococcus epidermidis (S. epidermidis), which is a resident bacterium on skin, was developed. Staphylococcus epidermidis was detected using real-time PCR. Staphylococcus epidermidis was detected in all 20 human skin surface samples. Although not present in blood and urine samples, S. epidermidis was detected in 6 of 20 saliva samples, and 5 of 18 semen samples. The ratio of human DNA to S. epidermidisDNA was significantly smaller in human skin surface samples than in saliva and semen samples in which S. epidermidis was detected. Therefore, although skin cells could not be identified by detecting only S. epidermidis, they could be distinguished by measuring the S. epidermidis to human DNA ratio. This method could be applied to casework touch samples, which suggests that it is useful for screening whether skin cells and human DNA are present on potential evidentiary touch samples. © 2016 American Academy of Forensic Sciences.

Specific detection of viable Listeria monocytogenes in Spanish wastewater treatment plants by Fluorescent In Situ Hybridization and PCR.

PubMed

Moreno, Yolanda; Ballesteros, Lorena; García-Hernández, Jorge; Santiago, Paula; González, Ana; Ferrús, M Antonia

2011-10-01

Listeria monocytogenes detection in wastewater can be difficult because of the large amount of background microbiota and the presence of viable but non-culturable forms in this environment. The aim of this study was to evaluate a Fluorescent In Situ Hybridization (FISH) assay combined with Direct Viable Count (DVC) method for detecting viable L. monocytogenes in wastewater samples, as an alternative to conventional culture methods. 16S rRNA sequence data were used to design a specific oligonucleotide probe. In order to assess the suitability of the method, the assays were performed on naturally (n=87) and artificially (n=14) contaminated samples and results were compared to those obtained with the isolation of cells on selective media and with a PCR method. The detection limit of FISH and PCR assays was 10(4) cells/mL without enrichment and 10 cells/mL after enrichment. A total of 47 samples, including 3 samples from effluent sites, yielded FISH positive results for L. monocytogenes. Using DVC-FISH technique, the presence of viable L. monocytogenes cells was detected in 23 out of these 47 FISH positive wastewater samples. PCR and culture methods yielded 27 and 23 positive results, respectively. According to these results, FISH technique has the potential to be used as a sensitive method for the detection and enumeration of L. monocytogenes in environmental wastewater samples. Copyright © 2011 Elsevier Ltd. All rights reserved.

Rapid and Sensitive Salmonella Typhi Detection in Blood and Fecal Samples Using Reverse Transcription Loop-Mediated Isothermal Amplification.

PubMed

Fan, Fenxia; Yan, Meiying; Du, Pengcheng; Chen, Chen; Kan, Biao

2015-09-01

Typhoid fever caused by Salmonella enterica serovar Typhi remains a significant public health problem in developing countries. Although the main method for diagnosing typhoid fever is blood culture, the test is time consuming and not always able to detect infections. Thus, it is very difficult to distinguish typhoid from other infections in patients with nonspecific symptoms. A simple and sensitive laboratory detection method remains necessary. The purpose of this study is to establish and evaluate a rapid and sensitive reverse transcription-based loop-mediated isothermal amplification (RT-LAMP) method to detect Salmonella Typhi infection. In this study, a new specific gene marker, STY1607, was selected to develop a STY1607-RT-LAMP assay; this is the first report of specific RT-LAMP detection assay for typhoid. Human-simulated and clinical blood/stool samples were used to evaluate the performance of STY1607-RT-LAMP for RNA detection; this method was compared with STY1607-LAMP, reverse transcription real-time polymerase chain reaction (rRT-PCR), and bacterial culture methods for Salmonella Typhi detection. Using mRNA as the template, STY1607-RT-LAMP exhibited 50-fold greater sensitivity than STY1607-LAMP for DNA detection. The STY1607-RT-LAMP detection limit is 3 colony-forming units (CFU)/mL for both the pure Salmonella Typhi samples and Salmonella Typhi-simulated blood samples and was 30 CFU/g for the simulated stool samples, all of which were 10-fold more sensitive than the rRT-PCR method. RT-LAMP exhibited improved Salmonella Typhi detection sensitivity compared to culture methods and to rRT-PCR of clinical blood and stool specimens from suspected typhoid fever patients. Because it can be performed without sophisticated equipment or skilled personnel, RT-LAMP is a valuable tool for clinical laboratories in developing countries. This method can be applied in the clinical diagnosis and care of typhoid fever patients as well as for a quick public health response.

Development of an Efficient Entire-Capsid-Coding-Region Amplification Method for Direct Detection of Poliovirus from Stool Extracts

PubMed Central

Kilpatrick, David R.; Nakamura, Tomofumi; Burns, Cara C.; Bukbuk, David; Oderinde, Soji B.; Oberste, M. Steven; Kew, Olen M.; Pallansch, Mark A.; Shimizu, Hiroyuki

2014-01-01

Laboratory diagnosis has played a critical role in the Global Polio Eradication Initiative since 1988, by isolating and identifying poliovirus (PV) from stool specimens by using cell culture as a highly sensitive system to detect PV. In the present study, we aimed to develop a molecular method to detect PV directly from stool extracts, with a high efficiency comparable to that of cell culture. We developed a method to efficiently amplify the entire capsid coding region of human enteroviruses (EVs) including PV. cDNAs of the entire capsid coding region (3.9 kb) were obtained from as few as 50 copies of PV genomes. PV was detected from the cDNAs with an improved PV-specific real-time reverse transcription-PCR system and nucleotide sequence analysis of the VP1 coding region. For assay validation, we analyzed 84 stool extracts that were positive for PV in cell culture and detected PV genomes from 100% of the extracts (84/84 samples) with this method in combination with a PV-specific extraction method. PV could be detected in 2/4 stool extract samples that were negative for PV in cell culture. In PV-positive samples, EV species C viruses were also detected with high frequency (27% [23/86 samples]). This method would be useful for direct detection of PV from stool extracts without using cell culture. PMID:25339406

Direct detection of Mycobacterium avium in environmental water and scale samples by loop-mediated isothermal amplification.

PubMed

Nishiuchi, Yukiko; Tamaru, Aki; Suzuki, Yasuhiko; Kitada, Seigo; Maekura, Ryoji; Tateishi, Yoshitaka; Niki, Mamiko; Ogura, Hisashi; Matsumoto, Sohkichi

2014-06-01

We previously demonstrated the colonization of Mycobacterium avium complex in bathrooms by the conventional culture method. In the present study, we aimed to directly detect M. avium organisms in the environment using loop-mediated isothermal amplification (LAMP), and to demonstrate the efficacy of LAMP by comparing the results with those obtained by culture. Our data showed that LAMP analysis has detection limits of 100 fg DNA/reaction for M. avium. Using an FTA(®) elute card, DNA templates were extracted from environmental samples from bathrooms in the residences of 29 patients with pulmonary M. avium disease. Of the 162 environmental samples examined, 143 (88%) showed identical results by both methods; 20 (12%) and 123 (76%) samples were positive and negative, respectively, for M. avium. Of the remaining 19 samples (12%), seven (5%) and 12 (7%) samples were positive by the LAMP and culture methods, respectively. All samples that contained over 20 colony forming units/primary isolation plate, as measured by the culture method, were also positive by the LAMP method. Our data demonstrate that the combination of the FTA elute card and LAMP can facilitate prompt detection of M. avium in the environment.

Limitation in the detection of Listeria monocytogenes in food in the presence of competing Listeria innocua.

PubMed

Oravcová, K; Trncíková, T; Kuchta, T; Kaclíková, E

2008-02-01

Detectability of Listeria monocytogenes at 10(0) CFU per food sample in the presence of Listeria innocua using standard microbiological detection was evaluated and compared with the real-time PCR-based method. Enrichment in half-Fraser broth followed by subculture in Fraser broth according to EN ISO 11290-1 was used. False-negative detection of 10(0) CFU L. monocytogenes was obtained in the presence of 10(1) CFU L. innocua per sample using the standard detection method in contrast to more than 10(5) CFU L. innocua per sample using real-time PCR. Identification of L. monocytogenes on the chromogenic medium by the standard procedure was impossible if L. innocua was able to overgrow L. monocytogenes by more than three orders of magnitude after the enrichment in model samples. These results were confirmed using naturally contaminated food samples. Standard microbiological method was insufficient for the reliable detection of 10(0) CFU L. monocytogenes in the presence of more than 10(0) CFU of L. innocua per sample. On the other hand, if the growth of L. monocytogenes was sufficient to reach the concentration equal to the detection limit of PCR, the amount of the other microflora present in the food sample including L. innocua was not relevant for success of the PCR detection of L. monocytogenes. After the enrichment, the PCR detection is more convenient than the standard one as PCR detection is not compromised by other present microflora.

Quantitative detection of pathogens in centrifugal microfluidic disks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon

A system and methods for detection of a nucleic acid including forming a plurality of nucleic acid detection complexes are described, each of the complexes including a nucleic acid analyte, a detection agent and a functionalized probe. The method further including binding the nucleic acid detection complexes to a plurality of functionalized particles in a fluid sample and separating the functionalized particles having the nucleic acid detection complexes bound thereto from the fluid sample using a density media. The nucleic acid analyte is detected by detecting the detection agent.

Estimation of the sensitivity of various environmental sampling methods for detection of Salmonella in duck flocks.

PubMed

Arnold, Mark E; Mueller-Doblies, Doris; Gosling, Rebecca J; Martelli, Francesca; Davies, Robert H

2015-01-01

Reports of Salmonella in ducks in the UK currently rely upon voluntary submissions from the industry, and as there is no harmonized statutory monitoring and control programme, it is difficult to compare data from different years in order to evaluate any trends in Salmonella prevalence in relation to sampling methodology. Therefore, the aim of this project was to assess the sensitivity of a selection of environmental sampling methods, including the sampling of faeces, dust and water troughs or bowls for the detection of Salmonella in duck flocks, and a range of sampling methods were applied to 67 duck flocks. Bayesian methods in the absence of a gold standard were used to provide estimates of the sensitivity of each of the sampling methods relative to the within-flock prevalence. There was a large influence of the within-flock prevalence on the sensitivity of all sample types, with sensitivity reducing as the within-flock prevalence reduced. Boot swabs (individual and pool of four), swabs of faecally contaminated areas and whole house hand-held fabric swabs showed the overall highest sensitivity for low-prevalence flocks and are recommended for use to detect Salmonella in duck flocks. The sample type with the highest proportion positive was a pool of four hair nets used as boot swabs, but this was not the most sensitive sample for low-prevalence flocks. All the environmental sampling types (faeces swabs, litter pinches, drag swabs, water trough samples and dust) had higher sensitivity than individual faeces sampling. None of the methods consistently identified all the positive flocks, and at least 10 samples would be required for even the most sensitive method (pool of four boot swabs) to detect a 5% prevalence. The sampling of dust had a low sensitivity and is not recommended for ducks.

Unsupervised Ensemble Anomaly Detection Using Time-Periodic Packet Sampling

NASA Astrophysics Data System (ADS)

Uchida, Masato; Nawata, Shuichi; Gu, Yu; Tsuru, Masato; Oie, Yuji

We propose an anomaly detection method for finding patterns in network traffic that do not conform to legitimate (i.e., normal) behavior. The proposed method trains a baseline model describing the normal behavior of network traffic without using manually labeled traffic data. The trained baseline model is used as the basis for comparison with the audit network traffic. This anomaly detection works in an unsupervised manner through the use of time-periodic packet sampling, which is used in a manner that differs from its intended purpose — the lossy nature of packet sampling is used to extract normal packets from the unlabeled original traffic data. Evaluation using actual traffic traces showed that the proposed method has false positive and false negative rates in the detection of anomalies regarding TCP SYN packets comparable to those of a conventional method that uses manually labeled traffic data to train the baseline model. Performance variation due to the probabilistic nature of sampled traffic data is mitigated by using ensemble anomaly detection that collectively exploits multiple baseline models in parallel. Alarm sensitivity is adjusted for the intended use by using maximum- and minimum-based anomaly detection that effectively take advantage of the performance variations among the multiple baseline models. Testing using actual traffic traces showed that the proposed anomaly detection method performs as well as one using manually labeled traffic data and better than one using randomly sampled (unlabeled) traffic data.

Efficient and Specific Detection of Salmonella in Food Samples Using a stn-Based Loop-Mediated Isothermal Amplification Method

PubMed Central

2015-01-01

The Salmonella enterotoxin (stn) gene exhibits high homology among S. enterica serovars and S. bongori. A set of 6 specific primers targeting the stn gene were designed for detection of Salmonella spp. using the loop-mediated isothermal amplification (LAMP) method. The primers amplified target sequences in all 102 strains of 87 serovars of Salmonella tested and no products were detected in 57 non-Salmonella strains. The detection limit in pure cultures was 5 fg DNA/reaction when amplified at 65°C for 25 min. The LAMP assay could detect Salmonella in artificially contaminated food samples as low as 220 cells/g of food without a preenrichment step. However, the sensitivity was increased 100-fold (~2 cells/g) following 5 hr preenrichment at 35°C. The LAMP technique, with a preenrichment step for 5 and 16 hr, was shown to give 100% specificity with food samples compared to the reference culture method in which 67 out of 90 food samples gave positive results. Different food matrixes did not interfere with LAMP detection which employed a simple boiling method for DNA template preparation. The results indicate that the LAMP method, targeting the stn gene, has great potential for detection of Salmonella in food samples with both high specificity and high sensitivity. PMID:26543859

High-Resolution Detection of Identity by Descent in Unrelated Individuals

PubMed Central

Browning, Sharon R.; Browning, Brian L.

2010-01-01

Detection of recent identity by descent (IBD) in population samples is important for population-based linkage mapping and for highly accurate genotype imputation and haplotype-phase inference. We present a method for detection of recent IBD in population samples. Our method accounts for linkage disequilibrium between SNPs to enable full use of high-density SNP data. We find that our method can detect segments of a length of 2 cM with moderate power and negligible false discovery rate in Illumina 550K data in Northwestern Europeans. We compare our method with GERMLINE and PLINK, and we show that our method has a level of resolution that is significantly better than these existing methods, thus extending the usefulness of recent IBD in analysis of high-density SNP data. We survey four genomic regions in a sample of UK individuals of European descent and find that on average, at a given location, our method detects IBD in 2.7 per 10,000 pairs of individuals in Illumina 550K data. We also present methodology and results for detection of homozygosity by descent (HBD) and survey the whole genome in a sample of 1373 UK individuals of European descent. We detect HBD in 4.7 individuals per 10,000 on average at a given location. Our methodology is implemented in the freely available BEAGLE software package. PMID:20303063

Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

PubMed

Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

2016-12-20

Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

Rapid detection of Salmonella spp. in food by use of the ISO-GRID hydrophobic grid membrane filter.

PubMed Central

Entis, P; Brodsky, M H; Sharpe, A N; Jarvis, G A

1982-01-01

A rapid hydrophobic grid-membrane filter (HGMF) method was developed and compared with the Health Protection Branch cultural method for the detection of Salmonella spp. in 798 spiked samples and 265 naturally contaminated samples of food. With the HGMF method, Salmonella spp. were isolated from 618 of the spiked samples and 190 of the naturally contaminated samples. The conventional method recovered Salmonella spp. from 622 spiked samples and 204 unspiked samples. The isolation rates from Salmonella-positive samples for the two methods were not significantly different (94.6% overall for the HGMF method and 96.7% for the conventional approach), but the HGMF results were available in only 2 to 3 days after sample receipt compared with 3 to 4 days by the conventional method. Images PMID:7059168

Self-similarity Clustering Event Detection Based on Triggers Guidance

NASA Astrophysics Data System (ADS)

Zhang, Xianfei; Li, Bicheng; Tian, Yuxuan

Traditional method of Event Detection and Characterization (EDC) regards event detection task as classification problem. It makes words as samples to train classifier, which can lead to positive and negative samples of classifier imbalance. Meanwhile, there is data sparseness problem of this method when the corpus is small. This paper doesn't classify event using word as samples, but cluster event in judging event types. It adopts self-similarity to convergence the value of K in K-means algorithm by the guidance of event triggers, and optimizes clustering algorithm. Then, combining with named entity and its comparative position information, the new method further make sure the pinpoint type of event. The new method avoids depending on template of event in tradition methods, and its result of event detection can well be used in automatic text summarization, text retrieval, and topic detection and tracking.

Evaluation of Two Outlier-Detection-Based Methods for Detecting Tissue-Selective Genes from Microarray Data

PubMed Central

Kadota, Koji; Konishi, Tomokazu; Shimizu, Kentaro

2007-01-01

Large-scale expression profiling using DNA microarrays enables identification of tissue-selective genes for which expression is considerably higher and/or lower in some tissues than in others. Among numerous possible methods, only two outlier-detection-based methods (an AIC-based method and Sprent’s non-parametric method) can treat equally various types of selective patterns, but they produce substantially different results. We investigated the performance of these two methods for different parameter settings and for a reduced number of samples. We focused on their ability to detect selective expression patterns robustly. We applied them to public microarray data collected from 36 normal human tissue samples and analyzed the effects of both changing the parameter settings and reducing the number of samples. The AIC-based method was more robust in both cases. The findings confirm that the use of the AIC-based method in the recently proposed ROKU method for detecting tissue-selective expression patterns is correct and that Sprent’s method is not suitable for ROKU. PMID:19936074

Malaria PCR Detection in Cambodian Low-Transmission Settings: Dried Blood Spots versus Venous Blood Samples

PubMed Central

Canier, Lydie; Khim, Nimol; Kim, Saorin; Eam, Rotha; Khean, Chanra; Loch, Kaknika; Ken, Malen; Pannus, Pieter; Bosman, Philippe; Stassijns, Jorgen; Nackers, Fabienne; Alipon, SweetC; Char, Meng Chuor; Chea, Nguon; Etienne, William; De Smet, Martin; Kindermans, Jean-Marie; Ménard, Didier

2015-01-01

In the context of malaria elimination, novel strategies for detecting very low malaria parasite densities in asymptomatic individuals are needed. One of the major limitations of the malaria parasite detection methods is the volume of blood samples being analyzed. The objective of the study was to compare the diagnostic accuracy of a malaria polymerase chain reaction assay, from dried blood spots (DBS, 5 μL) and different volumes of venous blood (50 μL, 200 μL, and 1 mL). The limit of detection of the polymerase chain reaction assay, using calibrated Plasmodium falciparum blood dilutions, showed that venous blood samples (50 μL, 200 μL, 1 mL) combined with Qiagen extraction methods gave a similar threshold of 100 parasites/mL, ∼100-fold lower than 5 μL DBS/Instagene method. On a set of 521 field samples, collected in two different transmission areas in northern Cambodia, no significant difference in the proportion of parasite carriers, regardless of the methods used was found. The 5 μL DBS method missed 27% of the samples detected by the 1 mL venous blood method, but most of the missed parasites carriers were infected by Plasmodium vivax (84%). The remaining missed P. falciparum parasite carriers (N = 3) were only detected in high-transmission areas. PMID:25561570

Device and nondestructive method to determine subsurface micro-structure in dense materials

DOEpatents

Sun, Jiangang [Westmont, IL

2006-05-09

A method and a device to detect subsurface three-dimensional micro-structure in a sample by illuminating the sample with light of a given polarization and detecting light emanating from the sample that has a different direction of polarization by means of a confocal optical system.

Aqueous nitrite ion determination by selective reduction and gas phase nitric oxide chemiluminescence

NASA Technical Reports Server (NTRS)

Dunham, A. J.; Barkley, R. M.; Sievers, R. E.; Clarkson, T. W. (Principal Investigator)

1995-01-01

An improved method of flow injection analysis for aqueous nitrite ion exploits the sensitivity and selectivity of the nitric oxide (NO) chemilluminescence detector. Trace analysis of nitrite ion in a small sample (5-160 microL) is accomplished by conversion of nitrite ion to NO by aqueous iodide in acid. The resulting NO is transported to the gas phase through a semipermeable membrane and subsequently detected by monitoring the photoemission of the reaction between NO and ozone (O3). Chemiluminescence detection is selective for measurement of NO, and, since the detection occurs in the gas-phase, neither sample coloration nor turbidity interfere. The detection limit for a 100-microL sample is 0.04 ppb of nitrite ion. The precision at the 10 ppb level is 2% relative standard deviation, and 60-180 samples can be analyzed per hour. Samples of human saliva and food extracts were analyzed; the results from a standard colorimetric measurement are compared with those from the new chemiluminescence method in order to further validate the latter method. A high degree of selectivity is obtained due to the three discriminating steps in the process: (1) the nitrite ion to NO conversion conditions are virtually specific for nitrite ion, (2) only volatile products of the conversion will be swept to the gas phase (avoiding turbidity or color in spectrophotometric methods), and (3) the NO chemiluminescence detector selectively detects the emission from the NO + O3 reaction. The method is free of interferences, offers detection limits of low parts per billion of nitrite ion, and allows the analysis of up to 180 microL-sized samples per hour, with little sample preparation and no chromatographic separation. Much smaller samples can be analyzed by this method than in previously reported batch analysis methods, which typically require 5 mL or more of sample and often need chromatographic separations as well.

Method for predicting peptide detection in mass spectrometry

DOEpatents

Kangas, Lars [West Richland, WA; Smith, Richard D [Richland, WA; Petritis, Konstantinos [Richland, WA

2010-07-13

A method of predicting whether a peptide present in a biological sample will be detected by analysis with a mass spectrometer. The method uses at least one mass spectrometer to perform repeated analysis of a sample containing peptides from proteins with known amino acids. The method then generates a data set of peptides identified as contained within the sample by the repeated analysis. The method then calculates the probability that a specific peptide in the data set was detected in the repeated analysis. The method then creates a plurality of vectors, where each vector has a plurality of dimensions, and each dimension represents a property of one or more of the amino acids present in each peptide and adjacent peptides in the data set. Using these vectors, the method then generates an algorithm from the plurality of vectors and the calculated probabilities that specific peptides in the data set were detected in the repeated analysis. The algorithm is thus capable of calculating the probability that a hypothetical peptide represented as a vector will be detected by a mass spectrometry based proteomic platform, given that the peptide is present in a sample introduced into a mass spectrometer.

Rapid diagnosis of common deletional α-thalassemia in the Chinese population by qPCR based on identical primer homologous fragments.

PubMed

Long, Ju

2016-05-01

In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.

Detection of sex chromosome aneuploidies using quantitative fluorescent PCR in the Hungarian population.

PubMed

Nagy, Balint; Nagy, Richard Gyula; Lazar, Levente; Schonleber, Julianna; Papp, Csaba; Rigo, Janos

2015-05-20

Aneuploidies are the most frequent chromosomal abnormalities at birth. Autosomal aneuploidies cause serious malformations like trisomy 21, trisomy 18 and trisomy 13. However sex chromosome aneuploidies are causing less severe syndromes. For the detection of these aneuploidies, the "gold standard" method is the cytogenetic analysis of fetal cells, karyograms show all numerical and structural abnormalities, but it takes 2-4 weeks to get the reports. Molecular biological methods were developed to overcome the long culture time, thus, FISH and quantitative fluorescent PCR were introduced. In this work we show our experience with a commercial kit for the detection of sex chromosome aneuploidies. We analyzed 20.173 amniotic fluid samples for the period of 2006-2013 in our department. A conventional cytogenetic analysis was performed on the samples. We checked the reliability of quantitative fluorescent PCR and DNA fragment analysis on those samples where sex chromosomal aneuploidy was diagnosed. From the 20.173 amniotic fluid samples we found 50 samples with sex chromosome aneuploidy. There were 19 samples showing 46, XO, 17 samples with 46, XXY, 9 samples with 47, XXX and 5 samples with 47, XYY karyotypes. The applied quantitative fluorescent PCR and DNA fragment analyses method are suitable to detect all abnormal sex chromosome aneuploidies. Quantitative fluorescent PCR is a fast and reliable method for detection of sex chromosome aneuploidies. Copyright © 2015. Published by Elsevier B.V.

Pairing field methods to improve inference in wildlife surveys while accommodating detection covariance

USGS Publications Warehouse

Clare, John; McKinney, Shawn T.; DePue, John E.; Loftin, Cynthia S.

2017-01-01

It is common to use multiple field sampling methods when implementing wildlife surveys to compare method efficacy or cost efficiency, integrate distinct pieces of information provided by separate methods, or evaluate method-specific biases and misclassification error. Existing models that combine information from multiple field methods or sampling devices permit rigorous comparison of method-specific detection parameters, enable estimation of additional parameters such as false-positive detection probability, and improve occurrence or abundance estimates, but with the assumption that the separate sampling methods produce detections independently of one another. This assumption is tenuous if methods are paired or deployed in close proximity simultaneously, a common practice that reduces the additional effort required to implement multiple methods and reduces the risk that differences between method-specific detection parameters are confounded by other environmental factors. We develop occupancy and spatial capture–recapture models that permit covariance between the detections produced by different methods, use simulation to compare estimator performance of the new models to models assuming independence, and provide an empirical application based on American marten (Martes americana) surveys using paired remote cameras, hair catches, and snow tracking. Simulation results indicate existing models that assume that methods independently detect organisms produce biased parameter estimates and substantially understate estimate uncertainty when this assumption is violated, while our reformulated models are robust to either methodological independence or covariance. Empirical results suggested that remote cameras and snow tracking had comparable probability of detecting present martens, but that snow tracking also produced false-positive marten detections that could potentially substantially bias distribution estimates if not corrected for. Remote cameras detected marten individuals more readily than passive hair catches. Inability to photographically distinguish individual sex did not appear to induce negative bias in camera density estimates; instead, hair catches appeared to produce detection competition between individuals that may have been a source of negative bias. Our model reformulations broaden the range of circumstances in which analyses incorporating multiple sources of information can be robustly used, and our empirical results demonstrate that using multiple field-methods can enhance inferences regarding ecological parameters of interest and improve understanding of how reliably survey methods sample these parameters.

DuPont Qualicon BAX System polymerase chain reaction assay. Performance Tested Method 100201.

PubMed

Tice, George; Andaloro, Bridget; Fallon, Dawn; Wallace, F Morgan

2009-01-01

A recent outbreak of Salmonella in peanut butter has highlighted the need for validation of rapid detection methods. A multilaboratory study for detecting Salmonella in peanut butter was conducted as part of the AOAC Research Institute Emergency Response Validation program for methods that detect outbreak threats to food safety. Three sites tested spiked samples from the same master mix according to the U.S. Food and Drug Administration's Bacteriological Analytical Manual (FDA-BAM) method and the BAX System method. Salmonella Typhimurium (ATCC 14028) was grown in brain heart infusion for 24 h at 37 degrees C, then diluted to appropriate levels for sample inoculation. Master samples of peanut butter were spiked at high and low target levels, mixed, and allowed to equilibrate at room temperature for 2 weeks. Spike levels were low [1.08 most probable number (MPN)/25 g]; high (11.5 MPN/25 g) and unspiked to serve as negative controls. Each master sample was divided into 25 g portions and coded to blind the samples. Twenty portions of each spiked master sample and five portions of the unspiked sample were tested at each site. At each testing site, samples were blended in 25 g portions with 225 mL prewarmed lactose broth until thoroughly homogenized, then allowed to remain at room temperature for 55-65 min. Samples were adjusted to a pH of 6.8 +/- 0.2, if necessary, and incubated for 22-26 h at 35 degrees C. Across the three reporting laboratories, the BAX System detected Salmonella in 10/60 low-spike samples and 58/60 high-spike samples. The reference FDA-BAM method yielded positive results for 11/60 low-spike and 58/60 high-spike samples. Neither method demonstrated positive results for any of the 15 unspiked samples.

Simple Modification of Karl-Fischer Titration Method for Determination of Water Content in Colored Samples

PubMed Central

Tavčar, Eva; Turk, Erika; Kreft, Samo

2012-01-01

The most commonly used technique for water content determination is Karl-Fischer titration with electrometric detection, requiring specialized equipment. When appropriate equipment is not available, the method can be performed through visual detection of a titration endpoint, which does not enable an analysis of colored samples. Here, we developed a method with spectrophotometric detection of a titration endpoint, appropriate for moisture determination of colored samples. The reaction takes place in a sealed 4 ml cuvette. Detection is performed at 520 nm. Titration endpoint is determined from the graph of absorbance plotted against titration volume. The method has appropriate reproducibility (RSD = 4.3%), accuracy, and linearity (R 2 = 0.997). PMID:22567558

Single-view phase retrieval of an extended sample by exploiting edge detection and sparsity

DOE PAGES

Tripathi, Ashish; McNulty, Ian; Munson, Todd; ...

2016-10-14

We propose a new approach to robustly retrieve the exit wave of an extended sample from its coherent diffraction pattern by exploiting sparsity of the sample's edges. This approach enables imaging of an extended sample with a single view, without ptychography. We introduce nonlinear optimization methods that promote sparsity, and we derive update rules to robustly recover the sample's exit wave. We test these methods on simulated samples by varying the sparsity of the edge-detected representation of the exit wave. Finally, our tests illustrate the strengths and limitations of the proposed method in imaging extended samples.

Evaluation of Rectoanal Mucosal Swab Sampling for Molecular Detection of Enterohemorrhagic Escherichia coli in Beef Cattle.

PubMed

Agga, Getahun E; Arthur, Terrance M; Hinkley, Susanne; Bosilevac, Joseph M

2017-04-01

Cattle are a primary reservoir of enterohemorrhagic Escherichia coli (EHEC), and contaminated beef products are a source of human infections. The U.S. Department of Agriculture Food Safety and Inspection Service declared seven EHEC serogroups (O26, O45, O103, O111, O121, O145, and O157) as adulterants in raw ground beef. Sampling a large number of animals for EHEC surveillance or evaluations of EHEC-focused preharvest interventions requires a convenient and robust sampling method. We evaluated the diagnostic performance of rectoanal mucosal swab (RAMS) for the detection of the top seven EHEC serogroups. Paired fecal grab (FG) and RAMS samples were collected from 176 beef cattle and tested using the NeoSEEK Shiga toxin-producing E. coli (STEC) confirmation method. The prevalence of virulence-associated genes (stx 1 , stx 2 , stx 2c , eae, and nleB) was higher in RAMS than in FG samples. The results of the two methods had poor agreement, as indicated by kappa statistics, for the detection of the seven serogroups. When FG and RAMS results were combined for comparison, RAMS was more sensitive than FG for the detection of serogroups O103 (82% versus 39%), O157 (75% versus 67%), and O45 (79% versus 73%) with similar sensitivity for the detection of serogroup O145 (67%). Serogroups O111 and O121 were detected from one and two samples, respectively, by FG and were not detected by RAMS. Serogroup O26 was not detected with either method. RAMS appears to be equivalent or superior to FG sampling for detection of the top seven EHEC serogroups in the feces of beef cattle with the NeoSEEK STEC confirmation test.

Methods for point-of-care detection of nucleic acid in a sample

DOEpatents

Bearinger, Jane P.; Dugan, Lawrence C.

2015-12-29

Provided herein are methods and apparatus for detecting a target nucleic acid in a sample and related methods and apparatus for diagnosing a condition in an individual. The condition is associated with presence of nucleic acid produced by certain pathogens in the individual.

Discreet passive explosive detection through 2-sided waveguided fluorescence

DOEpatents

Harper, Ross James [Stillwater, OK; la Grone, Marcus [Cushing, OK; Fisher, Mark [Stillwater, OK

2011-10-18

The current invention provides a passive sampling device suitable for collecting and detecting the presence of target analytes. In particular, the passive sampling device is suitable for detecting nitro-aromatic compounds. The current invention further provides a passive sampling device reader suitable for determining the collection of target analytes. Additionally, the current invention provides methods for detecting target analytes using the passive sampling device and the passive sampling device reader.

[Isolation and identification of Cronobacter (Enterobacter sakazakii) strains from food].

PubMed

Dong, Xiaohui; Li, Chengsi; Wu, Qingping; Zhang, Jumei; Mo, Shuping; Guo, Weipeng; Yang, Xiaojuan; Xu, Xiaoke

2013-05-04

This study aimed to detect and quantify Cronobacter in 300 powdered milk samples and 50 non-powdered milk samples. Totally, 24 Cronobacter (formerly Enterobacter sakazakii) strains isolated from powdered milk and other foods were identified and confirmed. Cronobacter strains were detected quantitatively using most probable number (MPN) method and molecular detection method. We identified 24 Cronobacter strains using biochemical patterns, including indole production and dulcitol, malonate, melezitose, turanose, and myo-Inositol utilization. Of the 24 strains, their 16S rRNA genes were sequenced, and constructed phylogenetic tree by N-J (Neighbour-Joining) with the 16S rRNA gene sequences of 17 identified Cronobacter strains and 10 non-Cronobacter strains. Quantitative detection showed that Cronobacter strains were detected in 23 out of 350 samples yielding 6.6% detection rate. Twenty-four Cronobacter strains were isolated from 23 samples and the Cronobacter was more than 100 MPN/100g in 4 samples out of 23 samples. The 24 Cronobacter spp. isolates strains were identified and confirmed, including 19 Cronobacter sakazakii strains, 2 C. malonaticus strains, 2 C. dubliensis subsp. lactaridi strains, and 1 C. muytjensii strain. The combination of molecular detection method and most probable number (MPN) method could be suitable for the detection of Cronobacter in powdered milk, with low rate of contamination and high demand of quantitative detection. 24 isolated strains were confirmed and identified by biochemical patterns and molecular technology, and C. sakazakii could be the dominant species. The problem of Cronobacter in powdered milk should be a hidden danger to nurseling, and should catch the government and consumer's attention.

Methicillin-Resistant Staphylococcus aureus (MRSA) Detection: Comparison of Two Molecular Methods (IDI-MRSA PCR Assay and GenoType MRSA Direct PCR Assay) with Three Selective MRSA Agars (MRSA ID, MRSASelect, and CHROMagar MRSA) for Use with Infection-Control Swabs▿

PubMed Central

van Hal, S. J.; Stark, D.; Lockwood, B.; Marriott, D.; Harkness, J.

2007-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) is an increasing problem. Rapid detection of MRSA-colonized patients has the potential to limit spread of the organism. We evaluated the sensitivities and specificities of MRSA detection by two molecular methods (IDI-MRSA PCR assay and GenoType MRSA Direct PCR assay) and three selective MRSA agars (MRSA ID, MRSASelect, and CHROMagar MRSA), using 205 (101 nasal, 52 groin, and 52 axillary samples) samples from consecutive known MRSA-infected and/or -colonized patients. All detection methods had higher MRSA detection rates for nasal swabs than for axillary and groin swabs. Detection of MRSA by IDI-MRSA was the most sensitive method, independent of the site (94% for nasal samples, 80% for nonnasal samples, and 90% overall). The sensitivities of the GenoType MRSA Direct assay and the MRSA ID, MRSASelect, and CHROMagar MRSA agars with nasal swabs were 70%, 72%, 68%, and 75%, respectively. All detection methods had high specificities (95 to 99%), independent of the swab site. Extended incubation for a further 24 h with selective MRSA agars increased the detection of MRSA, with a corresponding decline in specificity secondary to a significant increase in false-positive results. There was a noticeable difference in test performance of the GenoType MRSA Direct assay in detection of MRSA (28/38 samples [74%]) compared with detection of nonmultiresistant MRSA (17/31 samples [55%]) (susceptible to two or more non-β-lactam antibiotics). This was not observed with selective MRSA agar plates or IDI-MRSA. Although it is more expensive, in addition to rapid turnaround times of 2 to 4 h, IDI-MRSA offers greater detection of MRSA colonization, independent of the swab site, than do conventional selective agars and GenoType MRSA Direct. PMID:17537949

Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

PubMed

Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

2015-10-19

We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

PubMed Central

Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

2015-01-01

We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples. PMID:26492259

Determination of chlorinated insecticides in bottom sediment using an electron-capture gas chromatography screening method, Austin, Texas, 1991 and 1992

USGS Publications Warehouse

Brock, Robert D.; Murtagh, Lucinda K.

1994-01-01

Twenty-two bottom-sediment samples were collected from Town Lake in Austin, Texas, in 1991 and 1992 and analyzed for chlorinated insecticides by a reconnaissance-quality, electron-capture gas chromatography screening method developed by the U.S. Geological Survey (USGS). Four different chlorinated insecticides (aldrin, chlordane, dieldrin, and p,p'-DDT) and two degradation products of p,p'-DDT (p,p'-DDD and p,p'-DDE) were detected in these samples. The most significant insecticides detected were chlordane, which was detected in 20 of the 22 samples at concentrations that ranged from 26 to 140 micrograms per kilogram, and p,p'-DDT, which was detected in all 22 samples at concen- trations that ranged from 5 to 40 micrograms per kilogram. Degradation products of p,p'-DDT were detected in all 22 samples. Concentrations of p,p'-DDD ranged from not detected to 117 micrograms per kilogram and for p,p'-DDE from 9 to 97 micrograms per kilogram. Of the 22 samples collected, 15 also were analyzed by the standard USGS laboratory analytical method for chlorinated insecticides to determine the comparability of the two methods. Correlation coefficients were calculated for chlordane (0.8662), p,p'-DDT (0.6393), p,p'-DDD (0.9401), p,p'-DDE (0.8595), and dieldrin (0.3819). A paired sign test at the 95 percent confidence level showed no significant difference between the screening method and laboratory analytical method for all detected insecticides except aldrin. P-values were calculated from the data for chlordane (l.0000), p,p'-DDT (0.1796), p,p'-DDD (l,0000), p,p'-DDE (0.1796), and dieldrin (0.2891).

Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

PubMed

Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

2014-01-01

The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50 L. monocytogenes strains that encompassed 13 serotypes across the various lineages and none of the 30 exclusive organisms, including seven other Listeria species. The product consistency and kit stability studies revealed no statistical differences between the three lots tested or to the term of the shelf life. Finally, the robustness study demonstrated no statistical differences when samples were incubated at 33 ± 2°C or 37 ± 2°C, when enrichment aliquots were 1.3 mL or 1.7 mL, or when the samples were analyzed the same day or five days later. Overall the Atlas Listeria monocytogenes LmG2 Detection Assay is statistically equivalent to or better than the reference methods and is robust to the tested variations.

Detection of alpha radiation in a beta radiation field

DOEpatents

Mohagheghi, Amir H.; Reese, Robert P.

2001-01-01

An apparatus and method for detecting alpha particles in the presence of high activities of beta particles utilizing an alpha spectrometer. The apparatus of the present invention utilizes a magnetic field applied around the sample in an alpha spectrometer to deflect the beta particles from the sample prior to reaching the detector, thus permitting detection of low concentrations of alpha particles. In the method of the invention, the strength of magnetic field required to adequately deflect the beta particles and permit alpha particle detection is given by an algorithm that controls the field strength as a function of sample beta energy and the distance of the sample to the detector.

Compressive Sensing of Roller Bearing Faults via Harmonic Detection from Under-Sampled Vibration Signals

PubMed Central

Tang, Gang; Hou, Wei; Wang, Huaqing; Luo, Ganggang; Ma, Jianwei

2015-01-01

The Shannon sampling principle requires substantial amounts of data to ensure the accuracy of on-line monitoring of roller bearing fault signals. Challenges are often encountered as a result of the cumbersome data monitoring, thus a novel method focused on compressed vibration signals for detecting roller bearing faults is developed in this study. Considering that harmonics often represent the fault characteristic frequencies in vibration signals, a compressive sensing frame of characteristic harmonics is proposed to detect bearing faults. A compressed vibration signal is first acquired from a sensing matrix with information preserved through a well-designed sampling strategy. A reconstruction process of the under-sampled vibration signal is then pursued as attempts are conducted to detect the characteristic harmonics from sparse measurements through a compressive matching pursuit strategy. In the proposed method bearing fault features depend on the existence of characteristic harmonics, as typically detected directly from compressed data far before reconstruction completion. The process of sampling and detection may then be performed simultaneously without complete recovery of the under-sampled signals. The effectiveness of the proposed method is validated by simulations and experiments. PMID:26473858

Prevalence, quantification and typing of adenoviruses detected in river and treated drinking water in South Africa.

PubMed

van Heerden, J; Ehlers, M M; Heim, A; Grabow, W O K

2005-01-01

Human adenoviruses (HAds), of which there are 51 serotypes, are associated with gastrointestinal, respiratory, urinary tract and eye infections. The importance of water in the transmission of HAds and the potential health risks constituted by HAds in these environments are widely recognized. Adenoviruses have not previously been quantified in river and treated drinking water samples. In this study, HAds in river water and treated drinking water sources in South Africa were detected, quantified and typed. Adenoviruses were recovered from the water samples using a glass wool adsorption-elution method followed by polyethylene glycol/NaCl precipitation for secondary concentration. The sensitivity and specificity of two nested PCR methods were compared for detection of HAds in the water samples. Over a 1-year period (June 2002 to July 2003), HAds were detected in 5.32% (10/188) of the treated drinking water and 22.22% (10/45) of river water samples using the conventional nested PCR method. The HAds detected in the water samples were quantified using a real-time PCR method. The original treated drinking water and river water samples had an estimate of less than one copy per litre of HAd DNA present. The hexon-PCR products used for typing HAds were directly sequenced or cloned into plasmids before sequencing. In treated drinking water samples, species D HAds predominated. In addition, adenovirus serotypes 2, 40 and 41 were each detected in three different treated drinking water samples. Most (70%) of the HAds detected in river water samples analysed were enteric HAds (serotypes 40 and 41). One HAd serotype 2 and two species D HAds were detected in the river water. Adenoviruses detected in river and treated drinking water samples were successfully quantified and typed. The detection of HAds in drinking water supplies treated and disinfected by internationally recommended methods, and which conform to quality limits for indicator bacteria, warrants an investigation of the risk of infection constituted by these viruses. The risk of infection may have implications for the management of drinking water quality. This study is unique as it is the first report on the quantification and typing of HAds in treated drinking water and river water. This baseline data is necessary for the meaningful assessment of the potential risk of infection constituted by these viruses.

Validation of PCR methods for quantitation of genetically modified plants in food.

PubMed

Hübner, P; Waiblinger, H U; Pietsch, K; Brodmann, P

2001-01-01

For enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients, quantitative detection methods such as quantitative competitive (QC-PCR) and real-time PCR are applied by official food control laboratories. The experiences of 3 European food control laboratories in validating such methods were compared to describe realistic performance characteristics of quantitative PCR detection methods. The limit of quantitation (LOQ) of GMO-specific, real-time PCR was experimentally determined to reach 30-50 target molecules, which is close to theoretical prediction. Starting PCR with 200 ng genomic plant DNA, the LOQ depends primarily on the genome size of the target plant and ranges from 0.02% for rice to 0.7% for wheat. The precision of quantitative PCR detection methods, expressed as relative standard deviation (RSD), varied from 10 to 30%. Using Bt176 corn containing test samples and applying Bt176 specific QC-PCR, mean values deviated from true values by -7to 18%, with an average of 2+/-10%. Ruggedness of real-time PCR detection methods was assessed in an interlaboratory study analyzing commercial, homogeneous food samples. Roundup Ready soybean DNA contents were determined in the range of 0.3 to 36%, relative to soybean DNA, with RSDs of about 25%. Taking the precision of quantitative PCR detection methods into account, suitable sample plans and sample sizes for GMO analysis are suggested. Because quantitative GMO detection methods measure GMO contents of samples in relation to reference material (calibrants), high priority must be given to international agreements and standardization on certified reference materials.

Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene.

PubMed

Wang, Jiashun; Li, Yi; Chen, Jia; Hua, Deping; Li, Yi; Deng, Hui; Li, Ying; Liang, Zhixuan; Huang, Jinhai

Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs) to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 10 1 and 10 4 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10h, which is a promising rapid method to detect Salmonella in emergency. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

A flotation/sieving method to detect Echinococcus multilocularis and Toxocara spp. eggs in soil by real-time PCR

PubMed Central

Umhang, Gérald; Bastien, Matthieu; Renault, Camille; Faisse, Marine; Caillot, Christophe; Boucher, Jean-Marc; Hormaz, Vanessa; Poulle, Marie-Lazarine; Boué, Franck

2017-01-01

Soil can be a source of human infection by many zoonotic helminth species including Echinococcus multilocularis and Toxocara spp. The prevention of alveolar echinococcosis could be greatly improved through the identification of at-risk areas. Yet very few data are available about the detection of E. multilocularis in soil, while more studies have been reported for Toxocara spp. Identification of soil contamination by E. multilocularis eggs requires the use of specific methods. This study describes the development of a method for the detection of E. multilocularis in soil samples with the concentration of eggs using a flotation/sieving method and detection by duplex real-time polymerase chain reaction (PCR). Toxocara spp. egg detection was also undertaken due to the widespread presence of this parasite in soil, despite it being considered less pathogenic. Method sensitivity of 100% was reached for the detection of 10 E. multilocularis eggs spiked in 10 g of soil. Concerning Toxocara spp., method sensitivity was lower but assumed to be due to the reduced effectiveness of the DNA extraction protocol. The parasitological status for E. multilocularis and Toxocara spp. of 63 carnivore fecal samples collected in highly endemic rural areas of France and of soil samples collected under and near these fecal samples was compared. The contamination of soil samples collected under positive fecal samples for E. multilocularis (n = 3) or Toxocara spp. (n = 19) confirmed the transfer of eggs from the definitive host to the environment. PMID:28737135

Assessing Environmental Exposure to β-N-Methylamino-L-Alanine (BMAA) in Complex Sample Matrices: a Comparison of the Three Most Popular LC-MS/MS Methods.

PubMed

Baker, Teesha C; Tymm, Fiona J M; Murch, Susan J

2018-01-01

β-N-Methylamino-L-alanine (BMAA) is a naturally occurring non-protein amino acid produced by cyanobacteria, accumulated through natural food webs, found in mammalian brain tissues. Recent evidence indicates an association between BMAA and neurological disease. The accurate detection and quantification of BMAA in food and environmental samples are critical to understanding BMAA metabolism and limiting human exposure. To date, there have been more than 78 reports on BMAA in cyanobacteria and human samples, but different methods give conflicting data and divergent interpretations in the literature. The current work was designed to determine whether orthogonal chromatography and mass spectrometry methods give consistent data interpretation from a single sample matrix using the three most common analytical methods. The methods were recreated as precisely as possible from the literature with optimization of the mass spectrometry parameters specific to the instrument. Four sample matrices, cyanobacteria, human brain, blue crab, and Spirulina, were analyzed as 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC) derivatives, propyl chloroformate (PCF) derivatives separated by reverse phase chromatography, or underivatized extracts separated by HILIC chromatography. The three methods agreed on positive detection of BMAA in cyanobacteria and no detected BMAA in the sample of human brain matrix. Interpretation was less clear for a sample of blue crab which was strongly positive for BMAA by AQC and PCF but negative by HILIC and for four spirulina raw materials that were negative by PCF but positive by AQC and HILIC. Together, these data demonstrate that the methods gave different results and that the choices in interpretation of the methods determined whether BMAA was detected. Failure to detect BMAA cannot be considered proof of absence.

Evaluation of analytical methodology for the detection of hormones and their attenuation during aquifer recharge and recovery cycles.

PubMed

de Lima Stebbins, Daniela; Docs, Jon; Lowe, Paula; Cohen, Jason; Lei, Hongxia

2016-05-18

The hormones listed in the screening survey list 2 of the Unregulated Contaminant Monitoring Rule 3 (estrone, 17-β-estradiol, 17-α-ethynylestradiol, 16-α-hydroxyestradiol (estriol), equilin, testosterone and 4-androstene-3,17-dione) were analyzed by liquid chromatography electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS). Two analytical methods were compared: EPA method 539 and the isotope dilution method. EPA method 539 was successfully utilized in river and drinking water matrices with fortified recoveries of 98.9 to 108.5%. Samples from the Hillsborough River reflected levels below the method detection limit (MDL) for the majority of the analytes, except estrone (E1), which was detected at very low concentrations (<0.5 to 1 ng L(-1)) in the majority of samples. No hormones were detected in drinking water samples. The isotope dilution method was used to analyze reclaimed and aquifer storage and recovery (ASR) water samples as a result of strong matrix/solid phase extraction (SPE) losses observed in these more complex matrices. Most of the compounds were not detected or found at relatively low concentrations in the ASR samples. Attenuation of 50 to 99.1% was observed as a result of the ASR recharge/recovery cycles for most of the hormones, except for estriol (E3). Relatively stable concentrations of E3 were found, with only 10% attenuation at one of the sites and no measureable attenuation at another location. These results have substantiated that while EPA method 539 works well for most environmental samples, the isotope dilution method is more robust when dealing with complex matrices such as reclaimed and ASR samples.

The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis

PubMed Central

Carranza-Rodríguez, Cristina; Pérez-Arellano, José Luis; Vicente, Belén; López-Abán, Julio; Muro, Antonio

2015-01-01

Background Urogenital schistosomiasis due to Schistosoma haematobium is a serious underestimated public health problem affecting 112 million people - particularly in sub-Saharan Africa. Microscopic examination of urine samples to detect parasite eggs still remains as definitive diagnosis. This work was focussed on developing a novel loop-mediated isothermal amplification (LAMP) assay for detection of S. haematobium DNA in human urine samples as a high-throughput, simple, accurate and affordable diagnostic tool to use in diagnosis of urogenital schistosomiasis. Methodology/Principal Findings A LAMP assay targeting a species specific sequence of S. haematobium ribosomal intergenic spacer was designed. The effectiveness of our LAMP was assessed in a number of patients´ urine samples with microscopy confirmed S. haematobium infection. For potentially large-scale application in field conditions, different DNA extraction methods, including a commercial kit, a modified NaOH extraction method and a rapid heating method were tested using small volumes of urine fractions (whole urine, supernatants and pellets). The heating of pellets from clinical samples was the most efficient method to obtain good-quality DNA detectable by LAMP. The detection limit of our LAMP was 1 fg/µL of S. haematobium DNA in urine samples. When testing all patients´ urine samples included in our study, diagnostic parameters for sensitivity and specificity were calculated for LAMP assay, 100% sensitivity (95% CI: 81.32%-100%) and 86.67% specificity (95% CI: 75.40%-94.05%), and also for microscopy detection of eggs in urine samples, 69.23% sensitivity (95% CI: 48.21% -85.63%) and 100% specificity (95% CI: 93.08%-100%). Conclusions/Significance We have developed and evaluated, for the first time, a LAMP assay for detection of S. haematobium DNA in heated pellets from patients´ urine samples using no complicated requirement procedure for DNA extraction. The procedure has been named the Rapid-Heat LAMPellet method and has the potential to be developed further as a field diagnostic tool for use in urogenital schistosomiasis-endemic areas. PMID:26230990

The Detection Method of Escherichia coli in Water Resources: A Review

NASA Astrophysics Data System (ADS)

Nurliyana, M. R.; Sahdan, M. Z.; Wibowo, K. M.; Muslihati, A.; Saim, H.; Ahmad, S. A.; Sari, Y.; Mansor, Z.

2018-04-01

This article reviews several approaches for Escherichia coli (E. coli) bacteria detection from conventional methods, emerging method and goes to biosensor-based techniques. Detection and enumeration of E. coli bacteria usually required long duration of time in obtaining the result since laboratory-based approach is normally used in its assessment. It requires 24 hours to 72 hours after sampling to process the culturing samples before results are available. Although faster technique for detecting E. coli in water such as Polymerase Chain Reaction (PCR) and Enzyme-Linked Immunosorbent Assay (ELISA) have been developed, it still required transporting the samples from water resources to the laboratory, high-cost, complicated equipment usage, complex procedures, as well as the requirement of skilled specialist to cope with the complexity which limit their wide spread practice in water quality detection. Recently, development of biosensor device that is easy to perform, portable, highly sensitive and selective becomes indispensable in detecting extremely lower consolidation of pathogenic E. coli bacteria in water samples.

Validation of DESS as a DNA Preservation Method for the Detection of Strongyloides spp. in Canine Feces.

PubMed

Beknazarova, Meruyert; Millsteed, Shelby; Robertson, Gemma; Whiley, Harriet; Ross, Kirstin

2017-06-09

Strongyloides stercoralis is a gastrointestinal parasitic nematode with a life cycle that includes free-living and parasitic forms. For both clinical (diagnostic) and environmental evaluation, it is important that we can detect Strongyloides spp. in both human and non-human fecal samples. Real-time PCR is the most feasible method for detecting the parasite in both clinical and environmental samples that have been preserved. However, one of the biggest challenges with PCR detection is DNA degradation during the postage time from rural and remote areas to the laboratory. This study included a laboratory assessment and field validation of DESS (dimethyl sulfoxide, disodium EDTA, and saturated NaCl) preservation of Strongyloides spp. DNA in fecal samples. The laboratory study investigated the capacity of 1:1 and 1:3 sample to DESS ratios to preserve Strongyloides ratti in spike canine feces. It was found that both ratios of DESS significantly prevented DNA degradation compared to the untreated sample. This method was then validated by applying it to the field-collected canine feces and detecting Strongyloides DNA using PCR. A total of 37 canine feces samples were collected and preserved in the 1:3 ratio (sample: DESS) and of these, 17 were positive for Strongyloides spp. The study shows that both 1:1 and 1:3 sample to DESS ratios were able to preserve the Strongyloides spp. DNA in canine feces samples stored at room temperature for up to 56 days. This DESS preservation method presents the most applicable and feasible method for the Strongyloides DNA preservation in field-collected feces.

Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

PubMed

Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo

2015-10-01

The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

Discreet passive explosive detection through 2-sided wave guided fluorescence

DOEpatents

Harper, Ross James; la Grone, Marcus; Fisher, Mark

2012-10-16

The current invention provides a passive sampling device suitable for collecting and detecting the presence of target analytes. In particular, the passive sampling device is suitable for detecting nitro-aromatic compounds. The current invention further provides a passive sampling device reader suitable for determining the collection of target analytes. Additionally, the current invention provides methods for detecting target analytes using the passive sampling device and the passive sampling device reader.

Development of an efficient entire-capsid-coding-region amplification method for direct detection of poliovirus from stool extracts.

PubMed

Arita, Minetaro; Kilpatrick, David R; Nakamura, Tomofumi; Burns, Cara C; Bukbuk, David; Oderinde, Soji B; Oberste, M Steven; Kew, Olen M; Pallansch, Mark A; Shimizu, Hiroyuki

2015-01-01

Laboratory diagnosis has played a critical role in the Global Polio Eradication Initiative since 1988, by isolating and identifying poliovirus (PV) from stool specimens by using cell culture as a highly sensitive system to detect PV. In the present study, we aimed to develop a molecular method to detect PV directly from stool extracts, with a high efficiency comparable to that of cell culture. We developed a method to efficiently amplify the entire capsid coding region of human enteroviruses (EVs) including PV. cDNAs of the entire capsid coding region (3.9 kb) were obtained from as few as 50 copies of PV genomes. PV was detected from the cDNAs with an improved PV-specific real-time reverse transcription-PCR system and nucleotide sequence analysis of the VP1 coding region. For assay validation, we analyzed 84 stool extracts that were positive for PV in cell culture and detected PV genomes from 100% of the extracts (84/84 samples) with this method in combination with a PV-specific extraction method. PV could be detected in 2/4 stool extract samples that were negative for PV in cell culture. In PV-positive samples, EV species C viruses were also detected with high frequency (27% [23/86 samples]). This method would be useful for direct detection of PV from stool extracts without using cell culture. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Flow injection trace gas analysis method for on-site determination of organoarsenicals

DOEpatents

Aldstadt, III, Joseph H.

1997-01-01

A method for real-time determination of the concentration of Lewisite in the ambient atmosphere, the method includes separating and collecting a Lewisite sample from the atmosphere in a collection chamber, converting the collected Lewisite to an arsenite ion solution sample, pumping the arsenite ion containing sample to an electrochemical detector connected to the collection chamber, and electrochemically detecting the converted arsenite ions in the sample, whereby the concentration of arsenite ions detected is proportional to the concentration of Lewisite in the atmosphere.

Estimating site occupancy and detection probability parameters for meso- and large mammals in a coastal eosystem

USGS Publications Warehouse

O'Connell, Allan F.; Talancy, Neil W.; Bailey, Larissa L.; Sauer, John R.; Cook, Robert; Gilbert, Andrew T.

2006-01-01

Large-scale, multispecies monitoring programs are widely used to assess changes in wildlife populations but they often assume constant detectability when documenting species occurrence. This assumption is rarely met in practice because animal populations vary across time and space. As a result, detectability of a species can be influenced by a number of physical, biological, or anthropogenic factors (e.g., weather, seasonality, topography, biological rhythms, sampling methods). To evaluate some of these influences, we estimated site occupancy rates using species-specific detection probabilities for meso- and large terrestrial mammal species on Cape Cod, Massachusetts, USA. We used model selection to assess the influence of different sampling methods and major environmental factors on our ability to detect individual species. Remote cameras detected the most species (9), followed by cubby boxes (7) and hair traps (4) over a 13-month period. Estimated site occupancy rates were similar among sampling methods for most species when detection probabilities exceeded 0.15, but we question estimates obtained from methods with detection probabilities between 0.05 and 0.15, and we consider methods with lower probabilities unacceptable for occupancy estimation and inference. Estimated detection probabilities can be used to accommodate variation in sampling methods, which allows for comparison of monitoring programs using different protocols. Vegetation and seasonality produced species-specific differences in detectability and occupancy, but differences were not consistent within or among species, which suggests that our results should be considered in the context of local habitat features and life history traits for the target species. We believe that site occupancy is a useful state variable and suggest that monitoring programs for mammals using occupancy data consider detectability prior to making inferences about species distributions or population change.

Comparison of Relative Bias, Precision, and Efficiency of Sampling Methods for Natural Enemies of Soybean Aphid (Hemiptera: Aphididae).

PubMed

Bannerman, J A; Costamagna, A C; McCornack, B P; Ragsdale, D W

2015-06-01

Generalist natural enemies play an important role in controlling soybean aphid, Aphis glycines (Hemiptera: Aphididae), in North America. Several sampling methods are used to monitor natural enemy populations in soybean, but there has been little work investigating their relative bias, precision, and efficiency. We compare five sampling methods: quadrats, whole-plant counts, sweep-netting, walking transects, and yellow sticky cards to determine the most practical methods for sampling the three most prominent species, which included Harmonia axyridis (Pallas), Coccinella septempunctata L. (Coleoptera: Coccinellidae), and Orius insidiosus (Say) (Hemiptera: Anthocoridae). We show an important time by sampling method interaction indicated by diverging community similarities within and between sampling methods as the growing season progressed. Similarly, correlations between sampling methods for the three most abundant species over multiple time periods indicated differences in relative bias between sampling methods and suggests that bias is not consistent throughout the growing season, particularly for sticky cards and whole-plant samples. Furthermore, we show that sticky cards produce strongly biased capture rates relative to the other four sampling methods. Precision and efficiency differed between sampling methods and sticky cards produced the most precise (but highly biased) results for adult natural enemies, while walking transects and whole-plant counts were the most efficient methods for detecting coccinellids and O. insidiosus, respectively. Based on bias, precision, and efficiency considerations, the most practical sampling methods for monitoring in soybean include walking transects for coccinellid detection and whole-plant counts for detection of small predators like O. insidiosus. Sweep-netting and quadrat samples are also useful for some applications, when efficiency is not paramount. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A rapid, highly sensitive and culture-free detection of pathogens from blood by positive enrichment.

PubMed

Vutukuru, Manjula Ramya; Sharma, Divya Khandige; Ragavendar, M S; Schmolke, Susanne; Huang, Yiwei; Gumbrecht, Walter; Mitra, Nivedita

2016-12-01

Molecular diagnostics is a promising alternative to culture based methods for the detection of bloodstream infections, notably due to its overall lower turnaround time when starting directly from patient samples. Whole blood is usually the starting diagnostic sample in suspected bloodstream infections. The detection of low concentrations of pathogens in blood using a molecular assay necessitates a fairly high starting volume of blood sample in the range of 5-10mL. This large volume of blood sample has a substantial accompanying human genomic content that interferes with pathogen detection. In this study, we have established a workflow using magnetic beads coated with Apolipoprotein H that makes it possible to concentrate pathogens from a 5.0mL whole blood sample, thereby enriching pathogens from whole blood background and also reducing the sample volume to ~200μL or less. We have also demonstrated that this method of enrichment allows detection of 1CFU/mL of Escherichia coli, Enterococcus gallinarum and Candida tropicalis from 5mL blood using quantitative PCR; a detection limit that is not possible in unenriched samples. The enrichment method demonstrated here took 30min to complete and can be easily integrated with various downstream molecular and microbiological techniques. Copyright © 2016 Elsevier B.V. All rights reserved.

Ultraviolet resonance Raman spectroscopy for the detection of cocaine in oral fluid

NASA Astrophysics Data System (ADS)

D'Elia, Valentina; Montalvo, Gemma; Ruiz, Carmen García; Ermolenkov, Vladimir V.; Ahmed, Yasmine; Lednev, Igor K.

2018-01-01

Detecting and quantifying cocaine in oral fluid is of significant importance for practical forensics. Up to date, mainly destructive methods or biochemical tests have been used, while spectroscopic methods were only applied to pretreated samples. In this work, the possibility of using resonance Raman spectroscopy to detect cocaine in oral fluid without pretreating samples was tested. It was found that ultraviolet resonance Raman spectroscopy with 239-nm excitation allows for the detection of cocaine in oral fluid at 10 μg/mL level. Further method development will be needed for reaching the practically useful levels of cocaine detection.

Application of Terahertz Radiation to the Detection of Corrosion Under the Shuttle's Thermal Protection System

NASA Astrophysics Data System (ADS)

Madaras, Eric I.; Anastasi, Robert F.; Smith, Stephen W.; Seebo, Jeffrey P.; Walker, James L.; Lomness, Janice K.; Hintze, Paul E.; Kammerer, Catherine C.; Winfree, William P.; Russell, Richard W.

2008-02-01

There is currently no method for detecting corrosion under Shuttle tiles except for the expensive process of tile removal and replacement; hence NASA is investigating new NDE methods for detecting hidden corrosion. Time domain terahertz radiation has been applied to corrosion detection under tiles in samples ranging from small lab samples to a Shuttle with positive results. Terahertz imaging methods have been able to detect corrosion at thicknesses of 5 mils or greater under 1" thick Shuttle tiles and 7-12 mils or greater under 2" thick Shuttle tiles.

Application of Terahertz Radiation to the Detection of Corrosion under the Shuttle's Thermal Protection System

NASA Technical Reports Server (NTRS)

Madaras, Eric I.; Anastasi, Robert F.; Smith, Stephen W.; Seebo, Jeffrey P.; Walker, James L.; Lomness, Janice K.; Hintze, Paul E.; Kammerer, Catherine C.; Winfree, William P.; Russell, Richard W.

2007-01-01

There is currently no method for detecting corrosion under Shuttle tiles except for the expensive process of tile removal and replacement; hence NASA is investigating new NDE methods for detecting hidden corrosion. Time domain terahertz radiation has been applied to corrosion detection under tiles in samples ranging from small lab samples to a Shuttle with positive results. Terahertz imaging methods have been able to detect corrosion at thicknesses of 5 mils or greater under 1" thick Shuttle tiles and 7-12 mils or greater under 2" thick Shuttle tiles.

A new low-cost procedure for detecting nucleic acids in low-incidence samples: a case study of detecting spores of Paenibacillus larvae from bee debris.

PubMed

Ryba, Stepan; Kindlmann, Pavel; Titera, Dalibor; Haklova, Marcela; Stopka, Pavel

2012-10-01

American foulbrood, because of its virulence and worldwide spread, is currently one of the most dangerous diseases of honey bees. Quick diagnosis of this disease is therefore vitally important. For its successful eradication, however, all the hives in the region must be tested. This is time consuming and costly. Therefore, a fast and sensitive method of detecting American foulbrood is needed. Here we present a method that significantly reduces the number of tests needed by combining batches of samples from different hives. The results of this method were verified by testing each sample. A simulation study was used to compare the efficiency of the new method with testing all the samples and to develop a decision tool for determining when best to use the new method. The method is suitable for testing large numbers of samples (over 100) when the incidence of the disease is low (10% or less).

Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk.

PubMed

Duarte, Carla; Costa, Tiago; Carneiro, Carla; Soares, Rita; Jitariu, Andrei; Cardoso, Susana; Piedade, Moisés; Bexiga, Ricardo; Freitas, Paulo

2016-04-27

Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci) and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody.

Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk

PubMed Central

Duarte, Carla; Costa, Tiago; Carneiro, Carla; Soares, Rita; Jitariu, Andrei; Cardoso, Susana; Piedade, Moisés; Bexiga, Ricardo; Freitas, Paulo

2016-01-01

Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci) and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody. PMID:27128950

A RAPID METHOD FOR THE EXTRACTION OF FUNGAL DNA FROM ENVIRONMENTAL SAMPLES: EVALUATION IN THE QUANTITATIVE ANALYSIS OF MEMNONIELLA ECHINATA CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS

EPA Science Inventory

New technologies are creating the potential for using nucleic acid sequence detection to perform routine microbiological analyses of environmental samples. Our laboratory has recently reported on the development of a method for the quantitative detection of Stachybotrys chartarum...

Microbial Monitoring of Common Opportunistic Pathogens by Comparing Multiple Real-time PCR Platforms for Potential Space Applications

NASA Technical Reports Server (NTRS)

Roman, Monserrate C.; Jones, Kathy U.; Oubre, Cherie M.; Castro, Victoria; Ott, Mark C.; Birmele, Michele; Venkateswaran, Kasthuri J.; Vaishampayan, Parag A.

2013-01-01

Current methods for microbial detection: a) Labor & time intensive cultivation-based approaches that can fail to detect or characterize all cells present. b) Requires collection of samples on orbit and transportation back to ground for analysis. Disadvantages to current detection methods: a) Unable to perform quick and reliable detection on orbit. b) Lengthy sampling intervals. c) No microbe identification.

Method of analyzing multiple sample simultaneously by detecting absorption and systems for use in such a method

DOEpatents

Yeung, Edward S.; Gong, Xiaoyi

2004-09-07

The present invention provides a method of analyzing multiple samples simultaneously by absorption detection. The method comprises: (i) providing a planar array of multiple containers, each of which contains a sample comprising at least one absorbing species, (ii) irradiating the planar array of multiple containers with a light source and (iii) detecting absorption of light with a detetion means that is in line with the light source at a distance of at leaat about 10 times a cross-sectional distance of a container in the planar array of multiple containers. The absorption of light by a sample indicates the presence of an absorbing species in it. The method can further comprise: (iv) measuring the amount of absorption of light detected in (iii) indicating the amount of the absorbing species in the sample. Also provided by the present invention is a system for use in the abov metho.The system comprises; (i) a light source comrnpising or consisting essentially of at leaat one wavelength of light, the absorption of which is to be detected, (ii) a planar array of multiple containers, and (iii) a detection means that is in line with the light source and is positioned in line with and parallel to the planar array of multiple contiainers at a distance of at least about 10 times a cross-sectional distance of a container.

TPH detection in groundwater: Identification and elimination of positive interferences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zemo, D.A.; Synowiec, K.A.

1996-01-01

Groundwater assessment programs frequently require total petroleum hydrocarbon (TPH) analyses (Methods 8015M and 418.1). TPH analyses are often unreliable indicators of water quality because these methods are not constituent-specific and are vulnerable to significant sources of positive interferences. These positive interferences include: (a) non-dissolved petroleum constituents; (b) soluble, non-petroleum hydrocarbons (e.g., biodegradation products); and (c) turbidity, commonly introduced into water samples during sample collection. In this paper, we show that the portion of a TPH concentration not directly the result of water-soluble petroleum constituents can be attributed solely to these positive interferences. To demonstrate the impact of these interferences, wemore » conducted a field experiment at a site affected by degraded crude oil. Although TPH was consistently detected in groundwater samples, BTEX was not detected. PNAs were not detected, except for very low concentrations of fluorene (<5 ug/1). Filtering and silica gel cleanup steps were added to sampling and analyses to remove particulates and biogenic by-products. Results showed that filtering lowered the Method 8015M concentrations and reduced the Method 418.1 concentrations to non-detectable. Silica gel cleanup reduced the Method 8015M concentrations to non-detectable. We conclude from this study that the TPH results from groundwater samples are artifacts of positive interferences caused by both particulates and biogenic materials and do not represent dissolved-phase petroleum constituents.« less

TPH detection in groundwater: Identification and elimination of positive interferences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zemo, D.A.; Synowiec, K.A.

1996-12-31

Groundwater assessment programs frequently require total petroleum hydrocarbon (TPH) analyses (Methods 8015M and 418.1). TPH analyses are often unreliable indicators of water quality because these methods are not constituent-specific and are vulnerable to significant sources of positive interferences. These positive interferences include: (a) non-dissolved petroleum constituents; (b) soluble, non-petroleum hydrocarbons (e.g., biodegradation products); and (c) turbidity, commonly introduced into water samples during sample collection. In this paper, we show that the portion of a TPH concentration not directly the result of water-soluble petroleum constituents can be attributed solely to these positive interferences. To demonstrate the impact of these interferences, wemore » conducted a field experiment at a site affected by degraded crude oil. Although TPH was consistently detected in groundwater samples, BTEX was not detected. PNAs were not detected, except for very low concentrations of fluorene (<5 ug/1). Filtering and silica gel cleanup steps were added to sampling and analyses to remove particulates and biogenic by-products. Results showed that filtering lowered the Method 8015M concentrations and reduced the Method 418.1 concentrations to non-detectable. Silica gel cleanup reduced the Method 8015M concentrations to non-detectable. We conclude from this study that the TPH results from groundwater samples are artifacts of positive interferences caused by both particulates and biogenic materials and do not represent dissolved-phase petroleum constituents.« less

The PneuCarriage Project: A Multi-Centre Comparative Study to Identify the Best Serotyping Methods for Examining Pneumococcal Carriage in Vaccine Evaluation Studies

PubMed Central

Satzke, Catherine; Dunne, Eileen M.; Porter, Barbara D.; Klugman, Keith P.; Mulholland, E. Kim

2015-01-01

Background The pneumococcus is a diverse pathogen whose primary niche is the nasopharynx. Over 90 different serotypes exist, and nasopharyngeal carriage of multiple serotypes is common. Understanding pneumococcal carriage is essential for evaluating the impact of pneumococcal vaccines. Traditional serotyping methods are cumbersome and insufficient for detecting multiple serotype carriage, and there are few data comparing the new methods that have been developed over the past decade. We established the PneuCarriage project, a large, international multi-centre study dedicated to the identification of the best pneumococcal serotyping methods for carriage studies. Methods and Findings Reference sample sets were distributed to 15 research groups for blinded testing. Twenty pneumococcal serotyping methods were used to test 81 laboratory-prepared (spiked) samples. The five top-performing methods were used to test 260 nasopharyngeal (field) samples collected from children in six high-burden countries. Sensitivity and positive predictive value (PPV) were determined for the test methods and the reference method (traditional serotyping of >100 colonies from each sample). For the alternate serotyping methods, the overall sensitivity ranged from 1% to 99% (reference method 98%), and PPV from 8% to 100% (reference method 100%), when testing the spiked samples. Fifteen methods had ≥70% sensitivity to detect the dominant (major) serotype, whilst only eight methods had ≥70% sensitivity to detect minor serotypes. For the field samples, the overall sensitivity ranged from 74.2% to 95.8% (reference method 93.8%), and PPV from 82.2% to 96.4% (reference method 99.6%). The microarray had the highest sensitivity (95.8%) and high PPV (93.7%). The major limitation of this study is that not all of the available alternative serotyping methods were included. Conclusions Most methods were able to detect the dominant serotype in a sample, but many performed poorly in detecting the minor serotype populations. Microarray with a culture amplification step was the top-performing method. Results from this comprehensive evaluation will inform future vaccine evaluation and impact studies, particularly in low-income settings, where pneumococcal disease burden remains high. PMID:26575033

Detection of Toxoplasma gondii oocysts in water: proposition of a strategy and evaluation in Champagne-Ardenne Region, France.

PubMed

Aubert, D; Villena, I

2009-03-01

Water is a vehicle for disseminating human and veterinary toxoplasmosis due to oocyst contamination. Several outbreaks of toxoplasmosis throughout the world have been related to contaminated drinking water. We have developed a method for the detection of Toxoplasma gondii oocysts in water and we propose a strategy for the detection of multiple waterborne parasites, including Cryptosporidium spp. and Giardia. Water samples were filtered to recover Toxoplasma oocysts and, after the detection of Cryptosporidium oocysts and Giardia cysts by immunofluorescence, as recommended by French norm procedure NF T 90-455, the samples were purified on a sucrose density gradient. Detection of Toxoplasma was based on PCR amplification and mouse inoculation to determine the presence and infectivity of recovered oocysts. After experimental seeding assays, we determined that the PCR assay was more sensitive than the bioassay. This strategy was then applied to 482 environmental water samples collected since 2001. We detected Toxoplasma DNA in 37 environmental samples (7.7%), including public drinking water; however, none of them were positive by bioassay. This strategy efficiently detects Toxoplasma oocysts in water and may be suitable as a public health sentinel method. Alternative methods can be used in conjunction with this one to determine the infectivity of parasites that were detected by molecular methods.

Long-term frozen storage of urine samples: a trouble to get PCR results in Schistosoma spp. DNA detection?

PubMed

Fernández-Soto, Pedro; Velasco Tirado, Virginia; Carranza Rodríguez, Cristina; Pérez-Arellano, José Luis; Muro, Antonio

2013-01-01

Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples' storage or conditions for handling and DNA preservation and extraction methods. We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patients urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA method of extraction used.

Automated methods for multiplexed pathogen detection.

PubMed

Straub, Timothy M; Dockendorff, Brian P; Quiñonez-Díaz, Maria D; Valdez, Catherine O; Shutthanandan, Janani I; Tarasevich, Barbara J; Grate, Jay W; Bruckner-Lea, Cynthia J

2005-09-01

Detection of pathogenic microorganisms in environmental samples is a difficult process. Concentration of the organisms of interest also co-concentrates inhibitors of many end-point detection methods, notably, nucleic acid methods. In addition, sensitive, highly multiplexed pathogen detection continues to be problematic. The primary function of the BEADS (Biodetection Enabling Analyte Delivery System) platform is the automated concentration and purification of target analytes from interfering substances, often present in these samples, via a renewable surface column. In one version of BEADS, automated immunomagnetic separation (IMS) is used to separate cells from their samples. Captured cells are transferred to a flow-through thermal cycler where PCR, using labeled primers, is performed. PCR products are then detected by hybridization to a DNA suspension array. In another version of BEADS, cell lysis is performed, and community RNA is purified and directly labeled. Multiplexed detection is accomplished by direct hybridization of the RNA to a planar microarray. The integrated IMS/PCR version of BEADS can successfully purify and amplify 10 E. coli O157:H7 cells from river water samples. Multiplexed PCR assays for the simultaneous detection of E. coli O157:H7, Salmonella, and Shigella on bead suspension arrays was demonstrated for the detection of as few as 100 cells for each organism. Results for the RNA version of BEADS are also showing promising results. Automation yields highly purified RNA, suitable for multiplexed detection on microarrays, with microarray detection specificity equivalent to PCR. Both versions of the BEADS platform show great promise for automated pathogen detection from environmental samples. Highly multiplexed pathogen detection using PCR continues to be problematic, but may be required for trace detection in large volume samples. The RNA approach solves the issues of highly multiplexed PCR and provides "live vs. dead" capabilities. However, sensitivity of the method will need to be improved for RNA analysis to replace PCR.

Automated Methods for Multiplexed Pathogen Detection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Straub, Tim M.; Dockendorff, Brian P.; Quinonez-Diaz, Maria D.

2005-09-01

Detection of pathogenic microorganisms in environmental samples is a difficult process. Concentration of the organisms of interest also co-concentrates inhibitors of many end-point detection methods, notably, nucleic acid methods. In addition, sensitive, highly multiplexed pathogen detection continues to be problematic. The primary function of the BEADS (Biodetection Enabling Analyte Delivery System) platform is the automated concentration and purification of target analytes from interfering substances, often present in these samples, via a renewable surface column. In one version of BEADS, automated immunomagnetic separation (IMS) is used to separate cells from their samples. Captured cells are transferred to a flow-through thermal cyclermore » where PCR, using labeled primers, is performed. PCR products are then detected by hybridization to a DNA suspension array. In another version of BEADS, cell lysis is performed, and community RNA is purified and directly labeled. Multiplexed detection is accomplished by direct hybridization of the RNA to a planar microarray. The integrated IMS/PCR version of BEADS can successfully purify and amplify 10 E. coli O157:H7 cells from river water samples. Multiplexed PCR assays for the simultaneous detection of E. coli O157:H7, Salmonella, and Shigella on bead suspension arrays was demonstrated for the detection of as few as 100 cells for each organism. Results for the RNA version of BEADS are also showing promising results. Automation yields highly purified RNA, suitable for multiplexed detection on microarrays, with microarray detection specificity equivalent to PCR. Both versions of the BEADS platform show great promise for automated pathogen detection from environmental samples. Highly multiplexed pathogen detection using PCR continues to be problematic, but may be required for trace detection in large volume samples. The RNA approach solves the issues of highly multiplexed PCR and provides ''live vs. dead'' capabilities. However, sensitivity of the method will need to be improved for RNA analysis to replace PCR.« less

Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

PubMed

Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

2018-04-27

The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

Evaluation of the performance of the IQ-Check kits and the USDA Microbiology Laboratory Guidebook methods for detection of Shiga toxin-producing Escherichia coli (STEC) and STEC and Salmonella simultaneously in ground beef.

PubMed

Baranzoni, G M; Fratamico, P M; Boccia, F; Bagi, L K; Kim, G-H; Anastasio, A; Pepe, T

2017-03-01

To evaluate the performance of the IQ-Check kits and the USDA Microbiology Laboratory Guidebook (MLG) methods for detection of the top seven Shiga toxin-producing Escherichia coli (STEC) (O157:H7, O26, O45, O103, O111, O121 and O145) in ground beef and both STEC and Salmonella in co-inoculated samples. Ground beef samples inoculated with ~10 CFU of STEC or both STEC and Salmonella Typhimurium were stored at 4°C for 72 h, followed by screening with the IQ-Check and BAX System kit (MLG) methods that employ different enrichment media. STEC and S. Typhimurium were detected after 12 and 18 h and their presence was confirmed by colony isolation. Both methods were able to detect STEC in ground beef after 12 h of enrichment in samples inoculated with low levels of the pathogen. STEC and S. Typhimurium can be detected and isolated in co-inoculated ground beef samples. The IQ-Check methods are comparable to the MLG methods for detection of STEC and simultaneous detection of STEC and S. Typhimurium in seeded ground beef after a short enrichment time, thus the IQ-Check method can be useful for the food industry for rapid detection of these pathogens. Published 2016. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

Hog Charm II tetracycline test screening results compared with a liquid chromatography tandem mass spectrometry 10-μg/kg method.

PubMed

Salter, Robert; Holmes, Steven; Legg, David; Coble, Joel; George, Bruce

2012-02-01

Pork tissue samples that tested positive and negative by the Charm II tetracycline test screening method in the slaughter plant laboratory were tested with the modified AOAC International liquid chromatography tandem mass spectrometry (LC-MS-MS) method 995.09 to determine the predictive value of the screening method at detecting total tetracyclines at 10 μg/kg of tissue, in compliance with Russian import regulations. There were 218 presumptive-positive tetracycline samples of 4,195 randomly tested hogs. Of these screening test positive samples, 83% (182) were positive, >10 μg/kg by LC-MS-MS; 12.8% (28) were false violative, greater than limit of detection (LOD) but <10 μg/kg; and 4.2% (8) were not detected at the LC-MS-MS LOD. The 36 false-violative and not-detected samples represent 1% of the total samples screened. Twenty-seven of 30 randomly selected tetracycline screening negative samples tested below the LC-MS-MS LOD, and 3 samples tested <3 μg/kg chlortetracycline. Results indicate that the Charm II tetracycline test is effective at predicting hogs containing >10 μg/kg total tetracyclines in compliance with Russian import regulations.

Method and apparatus for remote sensing of molecular species at nanoscale utilizing a reverse photoacoustic effect

DOEpatents

Su, Ming [Oviedo, FL; Thundat, Thomas G [Knoxville, TN; Hedden, David [Lenoir City, TN

2010-02-23

A method and apparatus for identifying a sample, involves illuminating the sample with light of varying wavelengths, transmitting an acoustic signal against the sample from one portion and receiving a resulting acoustic signal on another portion, detecting a change of phase in the acoustic signal corresponding to the light of varying wavelengths, and analyzing the change of phase in the acoustic signal for the varying wavelengths of illumination to identify the sample. The apparatus has a controlled source for illuminating the sample with light of varying wavelengths, a transmitter for transmitting an acoustic wave, a receiver for receiving the acoustic wave and converting the acoustic wave to an electronic signal, and an electronic circuit for detecting a change of phase in the acoustic wave corresponding to respective ones of the varying wavelengths and outputting the change of phase for the varying wavelengths to allow identification of the sample. The method and apparatus can be used to detect chemical composition or visual features. A transmission mode and a reflection mode of operation are disclosed. The method and apparatus can be applied at nanoscale to detect molecules in a biological sample.

Comparison of ion chromatographic methods based on conductivity detection, post-column-reaction and on-line-coupling IC-ICP-MS for the determination of bromate.

PubMed

Schminke, G; Seubert, A

2000-02-01

An established method for the determination of the disinfection by-product bromate is ion chromatography (IC). This paper presents a comparison of three IC methods based on either conductivity detection (IC-CD), a post-column-reaction (IC-PCR-VIS) or the on-line-coupling with inductively coupled plasma mass spectrometry (IC-ICP-MS). Main characteristics of the methods such as method detection limits (MDL), time of analysis and sample pretreatment are compared and applicability for routine analysis is critically discussed. The most sensitive and rugged method is IC-ICP-MS, followed by IC-PCR-VIS. The photometric detection is subject to a minor interference in real world samples, presumably caused by carbonate. The lowest sensitivity is shown by the IC-CD method as slowest method compared, which, in addition, requires a sample pretreatment. The highest amount of information is delivered by IC-PCR-VIS, which allows the simultaneous determination of the seven standard anions and bromate.

Methods for simultaneous detection of the cyanotoxins BMAA, DABA, and anatoxin-a in environmental samples.

PubMed

Al-Sammak, Maitham Ahmed; Hoagland, Kyle D; Snow, Daniel D; Cassada, David

2013-12-15

Blue-green algae, also known as cyanobacteria, can produce several different groups of toxins in the environment including hepatotoxins (microcystins), neurotoxic non-protein amino acids β-methylamino-l-alanine (BMAA), and 2,4-diaminobutyric (DABA), as well as the bicyclic amine alkaloid anatoxin-a. Few studies have addressed the methods necessary for an accurate determination of cyanotoxins in environmental samples, and none have been published that can detect these cyanotoxins together in a single sample. Cyanotoxins occur in a wide range of environmental samples including water, fish, and aquatic plant samples. Using polymeric cation exchange solid phase extraction (SPE) coupled with liquid chromatography and fluorescence detection (HPLC/FD), and liquid chromatography ion trap tandem mass spectrometry (LC/MS/MS), these compounds can for the first time be simultaneously quantified in a variety of environmental sample types. The extraction method for biological samples can distinguish bound and free cyanotoxins. Detection limits for water ranged from 5 to 7 μg/L using HPLC/FD, while detection limits for and LC/MS were in the range of 0.8-3.2 μg/L. Copyright © 2013 Elsevier Ltd. All rights reserved.

Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

PubMed

Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

2016-01-01

Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

The PneuCarriage Project: A Multi-Centre Comparative Study to Identify the Best Serotyping Methods for Examining Pneumococcal Carriage in Vaccine Evaluation Studies.

PubMed

Satzke, Catherine; Dunne, Eileen M; Porter, Barbara D; Klugman, Keith P; Mulholland, E Kim

2015-11-01

The pneumococcus is a diverse pathogen whose primary niche is the nasopharynx. Over 90 different serotypes exist, and nasopharyngeal carriage of multiple serotypes is common. Understanding pneumococcal carriage is essential for evaluating the impact of pneumococcal vaccines. Traditional serotyping methods are cumbersome and insufficient for detecting multiple serotype carriage, and there are few data comparing the new methods that have been developed over the past decade. We established the PneuCarriage project, a large, international multi-centre study dedicated to the identification of the best pneumococcal serotyping methods for carriage studies. Reference sample sets were distributed to 15 research groups for blinded testing. Twenty pneumococcal serotyping methods were used to test 81 laboratory-prepared (spiked) samples. The five top-performing methods were used to test 260 nasopharyngeal (field) samples collected from children in six high-burden countries. Sensitivity and positive predictive value (PPV) were determined for the test methods and the reference method (traditional serotyping of >100 colonies from each sample). For the alternate serotyping methods, the overall sensitivity ranged from 1% to 99% (reference method 98%), and PPV from 8% to 100% (reference method 100%), when testing the spiked samples. Fifteen methods had ≥70% sensitivity to detect the dominant (major) serotype, whilst only eight methods had ≥70% sensitivity to detect minor serotypes. For the field samples, the overall sensitivity ranged from 74.2% to 95.8% (reference method 93.8%), and PPV from 82.2% to 96.4% (reference method 99.6%). The microarray had the highest sensitivity (95.8%) and high PPV (93.7%). The major limitation of this study is that not all of the available alternative serotyping methods were included. Most methods were able to detect the dominant serotype in a sample, but many performed poorly in detecting the minor serotype populations. Microarray with a culture amplification step was the top-performing method. Results from this comprehensive evaluation will inform future vaccine evaluation and impact studies, particularly in low-income settings, where pneumococcal disease burden remains high.

Next-Generation Genotyping by Digital PCR to Detect and Quantify the BRAF V600E Mutation in Melanoma Biopsies.

PubMed

Lamy, Pierre-Jean; Castan, Florence; Lozano, Nicolas; Montélion, Cécile; Audran, Patricia; Bibeau, Frédéric; Roques, Sylvie; Montels, Frédéric; Laberenne, Anne-Claire

2015-07-01

The detection of the BRAF V600E mutation in melanoma samples is used to select patients who should respond to BRAF inhibitors. Different techniques are routinely used to determine BRAF status in clinical samples. However, low tumor cellularity and tumor heterogeneity can affect the sensitivity of somatic mutation detection. Digital PCR (dPCR) is a next-generation genotyping method that clonally amplifies nucleic acids and allows the detection and quantification of rare mutations. Our aim was to evaluate the clinical routine performance of a new dPCR-based test to detect and quantify BRAF mutation load in 47 paraffin-embedded cutaneous melanoma biopsies. We compared the results obtained by dPCR with high-resolution melting curve analysis and pyrosequencing or with one of the allele-specific PCR methods available on the market. dPCR showed the lowest limit of detection. dPCR and allele-specific amplification detected the highest number of mutated samples. For the BRAF mutation load quantification both dPCR and pyrosequencing gave similar results with strong disparities in allele frequencies in the 47 tumor samples under study (from 0.7% to 79% of BRAF V600E mutations/sample). In conclusion, the four methods showed a high degree of concordance. dPCR was the more-sensitive method to reliably and easily detect mutations. Both pyrosequencing and dPCR could quantify the mutation load in heterogeneous tumor samples. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Validation of the ANSR Listeria method for detection of Listeria spp. in environmental samples.

PubMed

Wendorf, Michael; Feldpausch, Emily; Pinkava, Lisa; Luplow, Karen; Hosking, Edan; Norton, Paul; Biswas, Preetha; Mozola, Mark; Rice, Jennifer

2013-01-01

ANSR Listeria is a new diagnostic assay for detection of Listeria spp. in sponge or swab samples taken from a variety of environmental surfaces. The method is an isothermal nucleic acid amplification assay based on the nicking enzyme amplification reaction technology. Following single-step sample enrichment for 16-24 h, the assay is completed in 40 min, requiring only simple instrumentation. In inclusivity testing, 48 of 51 Listeria strains tested positive, with only the three strains of L. grayi producing negative results. Further investigation showed that L. grayi is reactive in the ANSR assay, but its ability to grow under the selective enrichment conditions used in the method is variable. In exclusivity testing, 32 species of non-Listeria, Gram-positive bacteria all produced negative ANSR assay results. Performance of the ANSR method was compared to that of the U.S. Department of Agriculture-Food Safety and Inspection Service reference culture procedure for detection of Listeria spp. in sponge or swab samples taken from inoculated stainless steel, plastic, ceramic tile, sealed concrete, and rubber surfaces. Data were analyzed using Chi-square and probability of detection models. Only one surface, stainless steel, showed a significant difference in performance between the methods, with the ANSR method producing more positive results. Results of internal trials were supported by findings from independent laboratory testing. The ANSR Listeria method can be used as an accurate, rapid, and simple alternative to standard culture methods for detection of Listeria spp. in environmental samples.

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

PubMed Central

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Comparison of potentially pathogenic free-living amoeba hosts by Legionella spp. in substrate-associated biofilms and floating biofilms from spring environments.

PubMed

Hsu, Bing-Mu; Huang, Chin-Chun; Chen, Jung-Sheng; Chen, Nai-Hsiung; Huang, Jen-Te

2011-10-15

This study compares five genera of free-living amoebae (FLA) hosts by Legionella spp. in the fixed and floating biofilm samples from spring environments. Detection rate of Legionella spp. was 26.9% for the floating biofilms and 3.1% for the fixed biofilms. Acanthamoeba spp., Hartmanella vermiformis, and Naegleria spp. were more frequently detected in floating biofilm than in fixed biofilm samples. The percentage of pathogenic Acanthamoeba spp. among all the genus Acanthamoeba detected positive samples was 19.6%. The potential pathogenic Naegleria spp. (for example, Naegleria australiensis, Naegleria philippinensis, and Naegleria italica) was 54.2% to all the Naegleria detected positive samples. In the study, 12 serotypes of possible pneumonia causing Legionella spp. were detected, and their percentage in all the Legionella containing samples was 42.4%. The FLA parasitized by Legionella included unnamed Acanthamoeba genotype, Acanthamoeba griffini, Acanthamoeba jacobsi, H. vermiformis, and N. australiensis. Significant differences were also observed between the presence/absence of H. vermiformis and Legionella parasitism in FLA. Comparisons between the culture-confirmed method and the PCR-based detection method for detecting FLA and Legionella in biofilms showed great variation. Therefore, using these analysis methods together to detect FLA and Legionella is recommended. Copyright © 2011 Elsevier Ltd. All rights reserved.

Validation of a near infrared microscopy method for the detection of animal products in feedingstuffs: results of a collaborative study.

PubMed

Boix, A; Fernández Pierna, J A; von Holst, C; Baeten, V

2012-01-01

The performance characteristics of a near infrared microscopy (NIRM) method, when applied to the detection of animal products in feedingstuffs, were determined via a collaborative study. The method delivers qualitative results in terms of the presence or absence of animal particles in feed and differentiates animal from vegetable feed ingredients on the basis of the evaluation of near infrared spectra obtained from individual particles present in the sample. The specificity ranged from 86% to 100%. The limit of detection obtained on the analysis of the sediment fraction, prepared as for the European official method, was 0.1% processed animal proteins (PAPs) in feed, since all laboratories correctly identified the positive samples. This limit has to be increased up to 2% for the analysis of samples which are not sedimented. The required sensitivity for the official control is therefore achieved in the analysis of the sediment fraction of the samples where the method can be applied for the detection of the presence of animal meal. Criteria for the classification of samples, when fewer than five spectra are found, as being of animal origin needs to be set up in order to harmonise the approach taken by the laboratories when applying NIRM for the detection of the presence of animal meal in feed.

Probability of detecting nematode infestations for quarantine sampling with imperfect extraction efficacy

PubMed Central

Chen, Peichen; Liu, Shih-Chia; Liu, Hung-I; Chen, Tse-Wei

2011-01-01

For quarantine sampling, it is of fundamental importance to determine the probability of finding an infestation when a specified number of units are inspected. In general, current sampling procedures assume 100% probability (perfect) of detecting a pest if it is present within a unit. Ideally, a nematode extraction method should remove all stages of all species with 100% efficiency regardless of season, temperature, or other environmental conditions; in practice however, no method approaches these criteria. In this study we determined the probability of detecting nematode infestations for quarantine sampling with imperfect extraction efficacy. Also, the required sample and the risk involved in detecting nematode infestations with imperfect extraction efficacy are presented. Moreover, we developed a computer program to calculate confidence levels for different scenarios with varying proportions of infestation and efficacy of detection. In addition, a case study, presenting the extraction efficacy of the modified Baermann's Funnel method on Aphelenchoides besseyi, is used to exemplify the use of our program to calculate the probability of detecting nematode infestations in quarantine sampling with imperfect extraction efficacy. The result has important implications for quarantine programs and highlights the need for a very large number of samples if perfect extraction efficacy is not achieved in such programs. We believe that the results of the study will be useful for the determination of realistic goals in the implementation of quarantine sampling. PMID:22791911

A Rapid, Presumptive Procedure for the Detection of Salmonella in Foods and Food Ingredients

PubMed Central

Hoben, D. A.; Ashton, D. H.; Peterson, A. C.

1973-01-01

A rapid detection procedure was developed in which a lysine-iron-cystine-neutral red (LICNR) broth medium, originally described by Hargrove et al. in 1971, was modified and used to detect the presence of viable Salmonella organisms in a variety of foods, food ingredients, and feed materials by using a two-step enrichment technique. Tetrathionate broth was used to enrich samples with incubation at 41 C for 20 hr, followed by transfer to LICNR broth and incubation at 37 C for 24 hr for further enrichment and for the detection of Salmonella organisms by color change. One hundred ten samples representing 18 different sample types were evaluated for the presence of viable Salmonella. Ninety-four percent of the samples found to be presumptive positive by this method were confirmed as positive by a culture method. Fluorescent-antibody results also compared closely. A second study was conducted under quality-control laboratory conditions by using procedures currently employed for Salmonella detection. One hundred forty-three samples representing 19 different sample types were evaluated for the presence of viable Salmonella. No false negatives were observed with the rapid-detection method. The usefulness of the LICNR broth procedure as a screening technique to eliminate negative samples rapidly and to identify presumptive positive samples for the presence of viable Salmonella organisms was established in this laboratory. PMID:4568884

Comprehensive Analysis of Secondary Dental Root Canal Infections: A Combination of Culture and Culture-Independent Approaches Reveals New Insights

PubMed Central

Anderson, Annette Carola; Hellwig, Elmar; Vespermann, Robin; Wittmer, Annette; Schmid, Michael; Karygianni, Lamprini; Al-Ahmad, Ali

2012-01-01

Persistence of microorganisms or reinfections are the main reasons for failure of root canal therapy. Very few studies to date have included culture-independent methods to assess the microbiota, including non-cultivable microorganisms. The aim of this study was to combine culture methods with culture-independent cloning methods to analyze the microbial flora of root-filled teeth with periradicular lesions. Twenty-one samples from previously root-filled teeth were collected from patients with periradicular lesions. Microorganisms were cultivated, isolated and biochemically identified. In addition, ribosomal DNA of bacteria, fungi and archaea derived from the same samples was amplified and the PCR products were used to construct clone libraries. DNA of selected clones was sequenced and microbial species were identified, comparing the sequences with public databases. Microorganisms were found in 12 samples with culture-dependent and -independent methods combined. The number of bacterial species ranged from 1 to 12 in one sample. The majority of the 26 taxa belonged to the phylum Firmicutes (14 taxa), followed by Actinobacteria, Proteobacteria and Bacteroidetes. One sample was positive for fungi, and archaea could not be detected. The results obtained with both methods differed. The cloning technique detected several as-yet-uncultivated taxa. Using a combination of both methods 13 taxa were detected that had not been found in root-filled teeth so far. Enterococcus faecalis was only detected in two samples using culture methods. Combining the culture-dependent and –independent approaches revealed new candidate endodontic pathogens and a high diversity of the microbial flora in root-filled teeth with periradicular lesions. Both methods yielded differing results, emphasizing the benefit of combined methods for the detection of the actual microbial diversity in apical periodontitis. PMID:23152922

Method for immunodiagnostic detection of dioxins at low concentrations

DOEpatents

Vanderlaan, Martin; Stanker, Larry H.; Watkins, Bruce E.; Petrovic, Peter; Gorbach, Siegbert

1995-01-01

A method is described for the use of monoclonal antibodies in a sensitive immunoassay for halogenated dioxins and dibenzofurans in industrial samples which contain impurities. Appropriate sample preparation and selective enzyme amplification of the immunoassay sensitivity permits detection of dioxin contaminants in industrial or environmental samples at concentrations in the range of a few parts per trillion.

A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

PubMed

Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

2016-07-01

The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

Balancing precision and risk: should multiple detection methods be analyzed separately in N-mixture models?

USGS Publications Warehouse

Graves, Tabitha A.; Royle, J. Andrew; Kendall, Katherine C.; Beier, Paul; Stetz, Jeffrey B.; Macleod, Amy C.

2012-01-01

Using multiple detection methods can increase the number, kind, and distribution of individuals sampled, which may increase accuracy and precision and reduce cost of population abundance estimates. However, when variables influencing abundance are of interest, if individuals detected via different methods are influenced by the landscape differently, separate analysis of multiple detection methods may be more appropriate. We evaluated the effects of combining two detection methods on the identification of variables important to local abundance using detections of grizzly bears with hair traps (systematic) and bear rubs (opportunistic). We used hierarchical abundance models (N-mixture models) with separate model components for each detection method. If both methods sample the same population, the use of either data set alone should (1) lead to the selection of the same variables as important and (2) provide similar estimates of relative local abundance. We hypothesized that the inclusion of 2 detection methods versus either method alone should (3) yield more support for variables identified in single method analyses (i.e. fewer variables and models with greater weight), and (4) improve precision of covariate estimates for variables selected in both separate and combined analyses because sample size is larger. As expected, joint analysis of both methods increased precision as well as certainty in variable and model selection. However, the single-method analyses identified different variables and the resulting predicted abundances had different spatial distributions. We recommend comparing single-method and jointly modeled results to identify the presence of individual heterogeneity between detection methods in N-mixture models, along with consideration of detection probabilities, correlations among variables, and tolerance to risk of failing to identify variables important to a subset of the population. The benefits of increased precision should be weighed against those risks. The analysis framework presented here will be useful for other species exhibiting heterogeneity by detection method.

Long-Term Frozen Storage of Urine Samples: A Trouble to Get PCR Results in Schistosoma spp. DNA Detection?

PubMed Central

Fernández-Soto, Pedro; Velasco Tirado, Virginia; Carranza Rodríguez, Cristina; Pérez-Arellano, José Luis; Muro, Antonio

2013-01-01

Background Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples’ storage or conditions for handling and DNA preservation and extraction methods. Methodology/Principal Findings We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patientś urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. Conclusions/Significance Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA method of extraction used. PMID:23613907

Optimization of scat detection methods for a social ungulate, the wild pig, and experimental evaluation of factors affecting detection of scat

USGS Publications Warehouse

Keiter, David A.; Cunningham, Fred L.; Rhodes, Olin E.; Irwin, Brian J.; Beasley, James

2016-01-01

Collection of scat samples is common in wildlife research, particularly for genetic capture-mark-recapture applications. Due to high degradation rates of genetic material in scat, large numbers of samples must be collected to generate robust estimates. Optimization of sampling approaches to account for taxa-specific patterns of scat deposition is, therefore, necessary to ensure sufficient sample collection. While scat collection methods have been widely studied in carnivores, research to maximize scat collection and noninvasive sampling efficiency for social ungulates is lacking. Further, environmental factors or scat morphology may influence detection of scat by observers. We contrasted performance of novel radial search protocols with existing adaptive cluster sampling protocols to quantify differences in observed amounts of wild pig (Sus scrofa) scat. We also evaluated the effects of environmental (percentage of vegetative ground cover and occurrence of rain immediately prior to sampling) and scat characteristics (fecal pellet size and number) on the detectability of scat by observers. We found that 15- and 20-m radial search protocols resulted in greater numbers of scats encountered than the previously used adaptive cluster sampling approach across habitat types, and that fecal pellet size, number of fecal pellets, percent vegetative ground cover, and recent rain events were significant predictors of scat detection. Our results suggest that use of a fixed-width radial search protocol may increase the number of scats detected for wild pigs, or other social ungulates, allowing more robust estimation of population metrics using noninvasive genetic sampling methods. Further, as fecal pellet size affected scat detection, juvenile or smaller-sized animals may be less detectable than adult or large animals, which could introduce bias into abundance estimates. Knowledge of relationships between environmental variables and scat detection may allow researchers to optimize sampling protocols to maximize utility of noninvasive sampling for wild pigs and other social ungulates.

An iterative and targeted sampling design informed by habitat suitability models for detecting focal plant species over extensive areas.

PubMed

Wang, Ophelia; Zachmann, Luke J; Sesnie, Steven E; Olsson, Aaryn D; Dickson, Brett G

2014-01-01

Prioritizing areas for management of non-native invasive plants is critical, as invasive plants can negatively impact plant community structure. Extensive and multi-jurisdictional inventories are essential to prioritize actions aimed at mitigating the impact of invasions and changes in disturbance regimes. However, previous work devoted little effort to devising sampling methods sufficient to assess the scope of multi-jurisdictional invasion over extensive areas. Here we describe a large-scale sampling design that used species occurrence data, habitat suitability models, and iterative and targeted sampling efforts to sample five species and satisfy two key management objectives: 1) detecting non-native invasive plants across previously unsampled gradients, and 2) characterizing the distribution of non-native invasive plants at landscape to regional scales. Habitat suitability models of five species were based on occurrence records and predictor variables derived from topography, precipitation, and remotely sensed data. We stratified and established field sampling locations according to predicted habitat suitability and phenological, substrate, and logistical constraints. Across previously unvisited areas, we detected at least one of our focal species on 77% of plots. In turn, we used detections from 2011 to improve habitat suitability models and sampling efforts in 2012, as well as additional spatial constraints to increase detections. These modifications resulted in a 96% detection rate at plots. The range of habitat suitability values that identified highly and less suitable habitats and their environmental conditions corresponded to field detections with mixed levels of agreement. Our study demonstrated that an iterative and targeted sampling framework can address sampling bias, reduce time costs, and increase detections. Other studies can extend the sampling framework to develop methods in other ecosystems to provide detection data. The sampling methods implemented here provide a meaningful tool when understanding the potential distribution and habitat of species over multi-jurisdictional and extensive areas is needed for achieving management objectives.

Optimization of scat detection methods for a social ungulate, the wild pig, and experimental evaluation of factors affecting detection of scat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keiter, David A.; Cunningham, Fred L.; Rhodes, Jr., Olin E.

Collection of scat samples is common in wildlife research, particularly for genetic capture-mark-recapture applications. Due to high degradation rates of genetic material in scat, large numbers of samples must be collected to generate robust estimates. Optimization of sampling approaches to account for taxa-specific patterns of scat deposition is, therefore, necessary to ensure sufficient sample collection. While scat collection methods have been widely studied in carnivores, research to maximize scat collection and noninvasive sampling efficiency for social ungulates is lacking. Further, environmental factors or scat morphology may influence detection of scat by observers. We contrasted performance of novel radial search protocolsmore » with existing adaptive cluster sampling protocols to quantify differences in observed amounts of wild pig ( Sus scrofa) scat. We also evaluated the effects of environmental (percentage of vegetative ground cover and occurrence of rain immediately prior to sampling) and scat characteristics (fecal pellet size and number) on the detectability of scat by observers. We found that 15- and 20-m radial search protocols resulted in greater numbers of scats encountered than the previously used adaptive cluster sampling approach across habitat types, and that fecal pellet size, number of fecal pellets, percent vegetative ground cover, and recent rain events were significant predictors of scat detection. Our results suggest that use of a fixed-width radial search protocol may increase the number of scats detected for wild pigs, or other social ungulates, allowing more robust estimation of population metrics using noninvasive genetic sampling methods. Further, as fecal pellet size affected scat detection, juvenile or smaller-sized animals may be less detectable than adult or large animals, which could introduce bias into abundance estimates. In conclusion, knowledge of relationships between environmental variables and scat detection may allow researchers to optimize sampling protocols to maximize utility of noninvasive sampling for wild pigs and other social ungulates.« less

An Iterative and Targeted Sampling Design Informed by Habitat Suitability Models for Detecting Focal Plant Species over Extensive Areas

PubMed Central

Wang, Ophelia; Zachmann, Luke J.; Sesnie, Steven E.; Olsson, Aaryn D.; Dickson, Brett G.

2014-01-01

Prioritizing areas for management of non-native invasive plants is critical, as invasive plants can negatively impact plant community structure. Extensive and multi-jurisdictional inventories are essential to prioritize actions aimed at mitigating the impact of invasions and changes in disturbance regimes. However, previous work devoted little effort to devising sampling methods sufficient to assess the scope of multi-jurisdictional invasion over extensive areas. Here we describe a large-scale sampling design that used species occurrence data, habitat suitability models, and iterative and targeted sampling efforts to sample five species and satisfy two key management objectives: 1) detecting non-native invasive plants across previously unsampled gradients, and 2) characterizing the distribution of non-native invasive plants at landscape to regional scales. Habitat suitability models of five species were based on occurrence records and predictor variables derived from topography, precipitation, and remotely sensed data. We stratified and established field sampling locations according to predicted habitat suitability and phenological, substrate, and logistical constraints. Across previously unvisited areas, we detected at least one of our focal species on 77% of plots. In turn, we used detections from 2011 to improve habitat suitability models and sampling efforts in 2012, as well as additional spatial constraints to increase detections. These modifications resulted in a 96% detection rate at plots. The range of habitat suitability values that identified highly and less suitable habitats and their environmental conditions corresponded to field detections with mixed levels of agreement. Our study demonstrated that an iterative and targeted sampling framework can address sampling bias, reduce time costs, and increase detections. Other studies can extend the sampling framework to develop methods in other ecosystems to provide detection data. The sampling methods implemented here provide a meaningful tool when understanding the potential distribution and habitat of species over multi-jurisdictional and extensive areas is needed for achieving management objectives. PMID:25019621

Optimization of Scat Detection Methods for a Social Ungulate, the Wild Pig, and Experimental Evaluation of Factors Affecting Detection of Scat.

PubMed

Keiter, David A; Cunningham, Fred L; Rhodes, Olin E; Irwin, Brian J; Beasley, James C

2016-01-01

Collection of scat samples is common in wildlife research, particularly for genetic capture-mark-recapture applications. Due to high degradation rates of genetic material in scat, large numbers of samples must be collected to generate robust estimates. Optimization of sampling approaches to account for taxa-specific patterns of scat deposition is, therefore, necessary to ensure sufficient sample collection. While scat collection methods have been widely studied in carnivores, research to maximize scat collection and noninvasive sampling efficiency for social ungulates is lacking. Further, environmental factors or scat morphology may influence detection of scat by observers. We contrasted performance of novel radial search protocols with existing adaptive cluster sampling protocols to quantify differences in observed amounts of wild pig (Sus scrofa) scat. We also evaluated the effects of environmental (percentage of vegetative ground cover and occurrence of rain immediately prior to sampling) and scat characteristics (fecal pellet size and number) on the detectability of scat by observers. We found that 15- and 20-m radial search protocols resulted in greater numbers of scats encountered than the previously used adaptive cluster sampling approach across habitat types, and that fecal pellet size, number of fecal pellets, percent vegetative ground cover, and recent rain events were significant predictors of scat detection. Our results suggest that use of a fixed-width radial search protocol may increase the number of scats detected for wild pigs, or other social ungulates, allowing more robust estimation of population metrics using noninvasive genetic sampling methods. Further, as fecal pellet size affected scat detection, juvenile or smaller-sized animals may be less detectable than adult or large animals, which could introduce bias into abundance estimates. Knowledge of relationships between environmental variables and scat detection may allow researchers to optimize sampling protocols to maximize utility of noninvasive sampling for wild pigs and other social ungulates.

Optimization of scat detection methods for a social ungulate, the wild pig, and experimental evaluation of factors affecting detection of scat

DOE PAGES

Keiter, David A.; Cunningham, Fred L.; Rhodes, Jr., Olin E.; ...

2016-05-25

Collection of scat samples is common in wildlife research, particularly for genetic capture-mark-recapture applications. Due to high degradation rates of genetic material in scat, large numbers of samples must be collected to generate robust estimates. Optimization of sampling approaches to account for taxa-specific patterns of scat deposition is, therefore, necessary to ensure sufficient sample collection. While scat collection methods have been widely studied in carnivores, research to maximize scat collection and noninvasive sampling efficiency for social ungulates is lacking. Further, environmental factors or scat morphology may influence detection of scat by observers. We contrasted performance of novel radial search protocolsmore » with existing adaptive cluster sampling protocols to quantify differences in observed amounts of wild pig ( Sus scrofa) scat. We also evaluated the effects of environmental (percentage of vegetative ground cover and occurrence of rain immediately prior to sampling) and scat characteristics (fecal pellet size and number) on the detectability of scat by observers. We found that 15- and 20-m radial search protocols resulted in greater numbers of scats encountered than the previously used adaptive cluster sampling approach across habitat types, and that fecal pellet size, number of fecal pellets, percent vegetative ground cover, and recent rain events were significant predictors of scat detection. Our results suggest that use of a fixed-width radial search protocol may increase the number of scats detected for wild pigs, or other social ungulates, allowing more robust estimation of population metrics using noninvasive genetic sampling methods. Further, as fecal pellet size affected scat detection, juvenile or smaller-sized animals may be less detectable than adult or large animals, which could introduce bias into abundance estimates. In conclusion, knowledge of relationships between environmental variables and scat detection may allow researchers to optimize sampling protocols to maximize utility of noninvasive sampling for wild pigs and other social ungulates.« less

Real-time PCR using SYBR Green for the detection of Shigella spp. in food and stool samples.

PubMed

Mokhtari, W; Nsaibia, S; Gharbi, A; Aouni, M

2013-02-01

Shigella spp are exquisitely fastidious Gram negative organisms that frequently get missed in the detection by traditional culture methods. For this reason, this work has adapted a classical PCR for detection of Shigella in food and stool specimens to real-time PCR using the SYBR Green format. This method follows a melting curve analysis to be more rapid and provide both qualitative and quantitative data about the targeted pathogen. A total of 117 stool samples with diarrhea and 102 food samples were analyzed in Public Health Regional Laboratory of Nabeul by traditional culture methods and real-time PCR. To validate the real-time PCR assay, an experiment was conducted with both spiked and naturally contaminated stool samples. All Shigella strains tested were ipaH positive and all non-Shigella strains yielded no amplification products. The melting temperature (T(m) = 81.5 ± 0.5 °C) was consistently specific for the amplicon. Correlation coefficients of standard curves constructed using the quantification cycle (C(q)) versus copy numbers of Shigella showed good linearity (R² = 0.995; slope = 2.952) and the minimum level of detection was 1.5 × 10³ CFU/g feces. All food samples analyzed were negative for Shigella by standard culture methods, whereas ipaH was detected in 8.8% culture negative food products. Moreover, the ipaH specific PCR system increased the detection rate over that by culture alone from 1.7% to 11.1% among patients with diarrhea. The data presented here shows that the SYBR Green I was suitable for use in the real-time PCR assay, which provided a specific, sensitive and efficient method for the detection and quantification of Shigella spp in food and stool samples. Copyright © 2012 Elsevier Ltd. All rights reserved.

Comparison of ZetaPlus 60S and nitrocellulose membrane filters for the simultaneous concentration of F-RNA coliphages, porcine teschovirus and porcine adenovirus from river water.

PubMed

Jones, T H; Muehlhauser, V; Thériault, G

2014-09-01

Increasing attention is being paid to the impact of agricultural activities on water quality to understand the impact on public health. F-RNA coliphages have been proposed as viral indicators of fecal contamination while porcine teschovirus (PTV) and porcine adenovirus (PAdV) are proposed indicators of fecal contamination of swine origin. Viruses and coliphages are present in water in very low concentrations and must be concentrated to permit their detection. There is little information comparing the effectiveness of the methods for concentrating F-RNA coliphages with concentration methods for other viruses and vice versa. The objective of this study was to compare 5 current published methods for recovering F-RNA coliphages, PTV and PAdV from river water samples concentrated by electronegative nitrocellulose membrane filters (methods A and B) or electropositive Zeta Plus 60S filters (methods C-E). Method A is used routinely for the detection of coliphages (Méndez et al., 2004) and method C (Brassard et al., 2005) is the official method in Health Canada's compendium for the detection of viruses in bottled mineral or spring water. When river water was inoculated with stocks of F-RNA MS2, PAdV, and PTV to final concentrations of 1×10(6) PFU/100 mL, 1×10(5) gc/100 mL and 3×10(5) gc/100 mL, respectively, a significantly higher recovery for each virus was consistently obtained for method A with recoveries of 52% for MS2, 95% for PAdV, and 1.5% for PTV. When method A was compared with method C for the detection of F-coliphages, PAdV and PTV in river water samples, viruses were detected with higher frequencies and at higher mean numbers with method A than with method C. With method A, F-coliphages were detected in 11/12 samples (5-154 PFU/100 mL), PTV in 12/12 samples (397-10,951 gc/100 mL), PAdV in 1/12 samples (15 gc/100 mL), and F-RNA GIII in 1/12 samples (750 gc/100 mL) while F-RNA genotypes I, II, and IV were not detected by qRT-PCR. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

Pairing field methods to improve inference in wildlife surveys while accommodating detection covariance.

PubMed

Clare, John; McKinney, Shawn T; DePue, John E; Loftin, Cynthia S

2017-10-01

It is common to use multiple field sampling methods when implementing wildlife surveys to compare method efficacy or cost efficiency, integrate distinct pieces of information provided by separate methods, or evaluate method-specific biases and misclassification error. Existing models that combine information from multiple field methods or sampling devices permit rigorous comparison of method-specific detection parameters, enable estimation of additional parameters such as false-positive detection probability, and improve occurrence or abundance estimates, but with the assumption that the separate sampling methods produce detections independently of one another. This assumption is tenuous if methods are paired or deployed in close proximity simultaneously, a common practice that reduces the additional effort required to implement multiple methods and reduces the risk that differences between method-specific detection parameters are confounded by other environmental factors. We develop occupancy and spatial capture-recapture models that permit covariance between the detections produced by different methods, use simulation to compare estimator performance of the new models to models assuming independence, and provide an empirical application based on American marten (Martes americana) surveys using paired remote cameras, hair catches, and snow tracking. Simulation results indicate existing models that assume that methods independently detect organisms produce biased parameter estimates and substantially understate estimate uncertainty when this assumption is violated, while our reformulated models are robust to either methodological independence or covariance. Empirical results suggested that remote cameras and snow tracking had comparable probability of detecting present martens, but that snow tracking also produced false-positive marten detections that could potentially substantially bias distribution estimates if not corrected for. Remote cameras detected marten individuals more readily than passive hair catches. Inability to photographically distinguish individual sex did not appear to induce negative bias in camera density estimates; instead, hair catches appeared to produce detection competition between individuals that may have been a source of negative bias. Our model reformulations broaden the range of circumstances in which analyses incorporating multiple sources of information can be robustly used, and our empirical results demonstrate that using multiple field-methods can enhance inferences regarding ecological parameters of interest and improve understanding of how reliably survey methods sample these parameters. © 2017 by the Ecological Society of America.

Spectral feature characterization methods for blood stain detection in crime scene backgrounds

NASA Astrophysics Data System (ADS)

Yang, Jie; Mathew, Jobin J.; Dube, Roger R.; Messinger, David W.

2016-05-01

Blood stains are one of the most important types of evidence for forensic investigation. They contain valuable DNA information, and the pattern of the stains can suggest specifics about the nature of the violence that transpired at the scene. Blood spectral signatures containing unique reflectance or absorption features are important both for forensic on-site investigation and laboratory testing. They can be used for target detection and identification applied to crime scene hyperspectral imagery, and also be utilized to analyze the spectral variation of blood on various backgrounds. Non-blood stains often mislead the detection and can generate false alarms at a real crime scene, especially for dark and red backgrounds. This paper measured the reflectance of liquid blood and 9 kinds of non-blood samples in the range of 350 nm - 2500 nm in various crime scene backgrounds, such as pure samples contained in petri dish with various thicknesses, mixed samples with different colors and materials of fabrics, and mixed samples with wood, all of which are examined to provide sub-visual evidence for detecting and recognizing blood from non-blood samples in a realistic crime scene. The spectral difference between blood and non-blood samples are examined and spectral features such as "peaks" and "depths" of reflectance are selected. Two blood stain detection methods are proposed in this paper. The first method uses index to denote the ratio of "depth" minus "peak" over"depth" add"peak" within a wavelength range of the reflectance spectrum. The second method uses relative band depth of the selected wavelength ranges of the reflectance spectrum. Results show that the index method is able to discriminate blood from non-blood samples in most tested crime scene backgrounds, but is not able to detect it from black felt. Whereas the relative band depth method is able to discriminate blood from non-blood samples on all of the tested background material types and colors.

Diagnosis of amphimeriasis by LAMPhimerus assay in human stool samples long-term storage onto filter paper

PubMed Central

Calvopiña, Manuel; Buendía-Sánchez, María; López-Abán, Julio; Vicente, Belén; Muro, Antonio

2018-01-01

Amphimeriasis, a fish-borne zoonotic disease caused by the liver fluke Amphimerus spp., has recently been reported as an emerging disease affecting an indigenous Ameridian group, the Chachi, living in Ecuador. The only method for diagnosing amphimeriasis was the microscopic detection of eggs from the parasite in patients' stool samples with very low sensitivity. Our group developed an ELISA technique for detection of anti-Amphimerus IgG in human sera and a molecular method based on LAMP technology (named LAMPhimerus) for specific and sensitive parasite DNA detection. The LAMPhimerus method showed to be much more sensitive than classical parasitological methods for amphimeriasis diagnosis using human stool samples for analysis. The objective of this work is to demonstrate the feasibility of using dried stool samples on filter paper as source of DNA in combination with the effectiveness of our previously designed LAMPhimerus assay for successfully Amphimerus sp. detection in clinical stool samples. A total of 102 untreated and undiluted stool samples collected from Chachi population were spread as thin layer onto common filter paper for easily transportation to our laboratory and stored at room temperature for one year until DNA extraction. When LAMPhimerus method was applied for Amphimerus sp. DNA detection, a higher number of positive results was detected (61/102; 59.80%) in comparison to parasitological methods (38/102; 37.25%), including 28/61 (45.90%) microscopy-confirmed Amphimerus sp. infections. The diagnostic parameters for the sensitivity and specificity werecalculated for our LAMPhimerus assay, which were 79.17% and 65.98%, respectively. We demonstrate, for the first time, that common filter paper is useful for easy collection and long-term storage of human stool samples for later DNA extraction and molecular analysis of human-parasitic trematode eggs. This simple, economic and easily handling method combined with the specific and sensible LAMPhimerus assay has the potential to beused as an effective molecular large-scale screening test for amphimeriasis-endemic areas. PMID:29444135

A near full-length open reading frame next generation sequencing assay for genotyping and identification of resistance-associated variants in hepatitis C virus.

PubMed

Pedersen, M S; Fahnøe, U; Hansen, T A; Pedersen, A G; Jenssen, H; Bukh, J; Schønning, K

2018-06-01

The current treatment options for hepatitis C virus (HCV), based on direct acting antivirals (DAA), are dependent on virus genotype and previous treatment experience. Treatment failures have been associated with detection of resistance-associated substitutions (RASs) in the DAA targets of HCV, the NS3, NS5A and NS5 B proteins. To develop a next generation sequencing based method that provides genotype and detection of HCV NS3, NS5A, and NS5 B RASs without prior knowledge of sample genotype. In total, 101 residual plasma samples from patients with HCV covering 10 different viral subtypes across 4 genotypes with viral loads of 3.84-7.61 Log IU/mL were included. All samples were de-identified and consequently prior treatment status for patients was unknown. Almost full open reading frame amplicons (∼ 9 kb) were generated using RT-PCR with a single primer set. The resulting amplicons were sequenced with high throughput sequencing and analysed using an in-house developed script for detecting RASs. The method successfully amplified and sequenced 94% (95/101) of samples with an average coverage of 14,035; four of six failed samples were genotype 4a. Samples analysed twice yielded reproducible nucleotide frequencies across all sites. RASs were detected in 21/95 (22%) samples at a 15% threshold. The method identified one patient infected with two genotype 2b variants, and the presence of subgenomic deletion variants in 8 (8.4%) of 95 successfully sequenced samples. The presented method may provide identification of HCV genotype, RASs detection, and detect multiple HCV infection without prior knowledge of sample genotype. Copyright © 2018 Elsevier B.V. All rights reserved.

The Development of DNA Based Methods for the Reliable and Efficient Identification of Nicotiana tabacum in Tobacco and Its Derived Products

PubMed Central

Fan, Wei; Li, Rong; Li, Sifan; Ping, Wenli; Li, Shujun; Naumova, Alexandra; Peelen, Tamara; Yuan, Zheng; Zhang, Dabing

2016-01-01

Reliable methods are needed to detect the presence of tobacco components in tobacco products to effectively control smuggling and classify tariff and excise in tobacco industry to control illegal tobacco trade. In this study, two sensitive and specific DNA based methods, one quantitative real-time PCR (qPCR) assay and the other loop-mediated isothermal amplification (LAMP) assay, were developed for the reliable and efficient detection of the presence of tobacco (Nicotiana tabacum) in various tobacco samples and commodities. Both assays targeted the same sequence of the uridine 5′-monophosphate synthase (UMPS), and their specificities and sensitivities were determined with various plant materials. Both qPCR and LAMP methods were reliable and accurate in the rapid detection of tobacco components in various practical samples, including customs samples, reconstituted tobacco samples, and locally purchased cigarettes, showing high potential for their application in tobacco identification, particularly in the special cases where the morphology or chemical compositions of tobacco have been disrupted. Therefore, combining both methods would facilitate not only the detection of tobacco smuggling control, but also the detection of tariff classification and of excise. PMID:27635142

Analysis of microdialysate monoamines, including noradrenaline, dopamine and serotonin, using capillary ultra-high performance liquid chromatography and electrochemical detection.

PubMed

Ferry, Barbara; Gifu, Elena-Patricia; Sandu, Ioana; Denoroy, Luc; Parrot, Sandrine

2014-03-01

Electrochemical methods are very often used to detect catecholamine and indolamine neurotransmitters separated by conventional reverse-phase high performance liquid chromatography (HPLC). The present paper presents the development of a chromatographic method to detect monoamines present in low-volume brain dialysis samples using a capillary column filled with sub-2μm particles. Several parameters (repeatability, linearity, accuracy, limit of detection) for this new ultrahigh performance liquid chromatography (UHPLC) method with electrochemical detection were examined after optimization of the analytical conditions. Noradrenaline, adrenaline, serotonin, dopamine and its metabolite 3-methoxytyramine were separated in 1μL of injected sample volume; they were detected above concentrations of 0.5-1nmol/L, with 2.1-9.5% accuracy and intra-assay repeatability equal to or less than 6%. The final method was applied to very low volume dialysates from rat brain containing monoamine traces. The study demonstrates that capillary UHPLC with electrochemical detection is suitable for monitoring dialysate monoamines collected at high sampling rate. Copyright © 2014 Elsevier B.V. All rights reserved.

Rapid filtration separation-based sample preparation method for Bacillus spores in powdery and environmental matrices.

PubMed

Isabel, Sandra; Boissinot, Maurice; Charlebois, Isabelle; Fauvel, Chantal M; Shi, Lu-E; Lévesque, Julie-Christine; Paquin, Amélie T; Bastien, Martine; Stewart, Gale; Leblanc, Eric; Sato, Sachiko; Bergeron, Michel G

2012-03-01

Authorities frequently need to analyze suspicious powders and other samples for biothreat agents in order to assess environmental safety. Numerous nucleic acid detection technologies have been developed to detect and identify biowarfare agents in a timely fashion. The extraction of microbial nucleic acids from a wide variety of powdery and environmental samples to obtain a quality level adequate for these technologies still remains a technical challenge. We aimed to develop a rapid and versatile method of separating bacteria from these samples and then extracting their microbial DNA. Bacillus atrophaeus subsp. globigii was used as a simulant of Bacillus anthracis. We studied the effects of a broad variety of powdery and environmental samples on PCR detection and the steps required to alleviate their interference. With a benchmark DNA extraction procedure, 17 of the 23 samples investigated interfered with bacterial lysis and/or PCR-based detection. Therefore, we developed the dual-filter method for applied recovery of microbial particles from environmental and powdery samples (DARE). The DARE procedure allows the separation of bacteria from contaminating matrices that interfere with PCR detection. This procedure required only 2 min, while the DNA extraction process lasted 7 min, for a total of <10 min. This sample preparation procedure allowed the recovery of cleaned bacterial spores and relieved detection interference caused by a wide variety of samples. Our procedure was easily completed in a laboratory facility and is amenable to field application and automation.

Rapid Filtration Separation-Based Sample Preparation Method for Bacillus Spores in Powdery and Environmental Matrices

PubMed Central

Isabel, Sandra; Boissinot, Maurice; Charlebois, Isabelle; Fauvel, Chantal M.; Shi, Lu-E; Lévesque, Julie-Christine; Paquin, Amélie T.; Bastien, Martine; Stewart, Gale; Leblanc, Éric; Sato, Sachiko

2012-01-01

Authorities frequently need to analyze suspicious powders and other samples for biothreat agents in order to assess environmental safety. Numerous nucleic acid detection technologies have been developed to detect and identify biowarfare agents in a timely fashion. The extraction of microbial nucleic acids from a wide variety of powdery and environmental samples to obtain a quality level adequate for these technologies still remains a technical challenge. We aimed to develop a rapid and versatile method of separating bacteria from these samples and then extracting their microbial DNA. Bacillus atrophaeus subsp. globigii was used as a simulant of Bacillus anthracis. We studied the effects of a broad variety of powdery and environmental samples on PCR detection and the steps required to alleviate their interference. With a benchmark DNA extraction procedure, 17 of the 23 samples investigated interfered with bacterial lysis and/or PCR-based detection. Therefore, we developed the dual-filter method for applied recovery of microbial particles from environmental and powdery samples (DARE). The DARE procedure allows the separation of bacteria from contaminating matrices that interfere with PCR detection. This procedure required only 2 min, while the DNA extraction process lasted 7 min, for a total of <10 min. This sample preparation procedure allowed the recovery of cleaned bacterial spores and relieved detection interference caused by a wide variety of samples. Our procedure was easily completed in a laboratory facility and is amenable to field application and automation. PMID:22210204

Ultratrace level determination and quantitative analysis of kidney injury biomarkers in patient samples attained by zinc oxide nanorods

NASA Astrophysics Data System (ADS)

Singh, Manpreet; Alabanza, Anginelle; Gonzalez, Lorelis E.; Wang, Weiwei; Reeves, W. Brian; Hahm, Jong-In

2016-02-01

Determining ultratrace amounts of protein biomarkers in patient samples in a straightforward and quantitative manner is extremely important for early disease diagnosis and treatment. Here, we successfully demonstrate the novel use of zinc oxide nanorods (ZnO NRs) in the ultrasensitive and quantitative detection of two acute kidney injury (AKI)-related protein biomarkers, tumor necrosis factor (TNF)-α and interleukin (IL)-8, directly from patient samples. We first validate the ZnO NRs-based IL-8 results via comparison with those obtained from using a conventional enzyme-linked immunosorbent method in samples from 38 individuals. We further assess the full detection capability of the ZnO NRs-based technique by quantifying TNF-α, whose levels in human urine are often below the detection limits of conventional methods. Using the ZnO NR platforms, we determine the TNF-α concentrations of all 46 patient samples tested, down to the fg per mL level. Subsequently, we screen for TNF-α levels in approximately 50 additional samples collected from different patient groups in order to demonstrate a potential use of the ZnO NRs-based assay in assessing cytokine levels useful for further clinical monitoring. Our research efforts demonstrate that ZnO NRs can be straightforwardly employed in the rapid, ultrasensitive, quantitative, and simultaneous detection of multiple AKI-related biomarkers directly in patient urine samples, providing an unparalleled detection capability beyond those of conventional analysis methods. Additional key advantages of the ZnO NRs-based approach include a fast detection speed, low-volume assay condition, multiplexing ability, and easy automation/integration capability to existing fluorescence instrumentation. Therefore, we anticipate that our ZnO NRs-based detection method will be highly beneficial for overcoming the frequent challenges in early biomarker development and treatment assessment, pertaining to the facile and ultrasensitive quantification of hard-to-trace biomolecules.Determining ultratrace amounts of protein biomarkers in patient samples in a straightforward and quantitative manner is extremely important for early disease diagnosis and treatment. Here, we successfully demonstrate the novel use of zinc oxide nanorods (ZnO NRs) in the ultrasensitive and quantitative detection of two acute kidney injury (AKI)-related protein biomarkers, tumor necrosis factor (TNF)-α and interleukin (IL)-8, directly from patient samples. We first validate the ZnO NRs-based IL-8 results via comparison with those obtained from using a conventional enzyme-linked immunosorbent method in samples from 38 individuals. We further assess the full detection capability of the ZnO NRs-based technique by quantifying TNF-α, whose levels in human urine are often below the detection limits of conventional methods. Using the ZnO NR platforms, we determine the TNF-α concentrations of all 46 patient samples tested, down to the fg per mL level. Subsequently, we screen for TNF-α levels in approximately 50 additional samples collected from different patient groups in order to demonstrate a potential use of the ZnO NRs-based assay in assessing cytokine levels useful for further clinical monitoring. Our research efforts demonstrate that ZnO NRs can be straightforwardly employed in the rapid, ultrasensitive, quantitative, and simultaneous detection of multiple AKI-related biomarkers directly in patient urine samples, providing an unparalleled detection capability beyond those of conventional analysis methods. Additional key advantages of the ZnO NRs-based approach include a fast detection speed, low-volume assay condition, multiplexing ability, and easy automation/integration capability to existing fluorescence instrumentation. Therefore, we anticipate that our ZnO NRs-based detection method will be highly beneficial for overcoming the frequent challenges in early biomarker development and treatment assessment, pertaining to the facile and ultrasensitive quantification of hard-to-trace biomolecules. Electronic supplementary information (ESI) available: Typical SEM images of the ZnO NRs used in the biomarker assays are provided in Fig. S1. See DOI: 10.1039/c5nr08706f

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

PubMed

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

Method- and species-specific detection probabilities of fish occupancy in Arctic lakes: Implications for design and management

USGS Publications Warehouse

Haynes, Trevor B.; Rosenberger, Amanda E.; Lindberg, Mark S.; Whitman, Matthew; Schmutz, Joel A.

2013-01-01

Studies examining species occurrence often fail to account for false absences in field sampling. We investigate detection probabilities of five gear types for six fish species in a sample of lakes on the North Slope, Alaska. We used an occupancy modeling approach to provide estimates of detection probabilities for each method. Variation in gear- and species-specific detection probability was considerable. For example, detection probabilities for the fyke net ranged from 0.82 (SE = 0.05) for least cisco (Coregonus sardinella) to 0.04 (SE = 0.01) for slimy sculpin (Cottus cognatus). Detection probabilities were also affected by site-specific variables such as depth of the lake, year, day of sampling, and lake connection to a stream. With the exception of the dip net and shore minnow traps, each gear type provided the highest detection probability of at least one species. Results suggest that a multimethod approach may be most effective when attempting to sample the entire fish community of Arctic lakes. Detection probability estimates will be useful for designing optimal fish sampling and monitoring protocols in Arctic lakes.

Unsupervised Learning —A Novel Clustering Method for Rolling Bearing Faults Identification

NASA Astrophysics Data System (ADS)

Kai, Li; Bo, Luo; Tao, Ma; Xuefeng, Yang; Guangming, Wang

2017-12-01

To promptly process the massive fault data and automatically provide accurate diagnosis results, numerous studies have been conducted on intelligent fault diagnosis of rolling bearing. Among these studies, such as artificial neural networks, support vector machines, decision trees and other supervised learning methods are used commonly. These methods can detect the failure of rolling bearing effectively, but to achieve better detection results, it often requires a lot of training samples. Based on above, a novel clustering method is proposed in this paper. This novel method is able to find the correct number of clusters automatically the effectiveness of the proposed method is validated using datasets from rolling element bearings. The diagnosis results show that the proposed method can accurately detect the fault types of small samples. Meanwhile, the diagnosis results are also relative high accuracy even for massive samples.

Chemicals of emerging concern in water and bottom sediment in Great Lakes areas of concern, 2010 to 2011-Collection methods, analyses methods, quality assurance, and data

USGS Publications Warehouse

Lee, Kathy E.; Langer, Susan K.; Menheer, Michael A.; Foreman, William T.; Furlong, Edward T.; Smith, Steven G.

2012-01-01

The U.S. Geological Survey (USGS) cooperated with the U.S. Environmental Protection Agency and the U.S. Fish and Wildlife Service on a study to identify the occurrence of chemicals of emerging concern (CECs) in water and bottom-sediment samples collected during 2010–11 at sites in seven areas of concern (AOCs) throughout the Great Lakes. Study sites include tributaries to the Great Lakes in AOCs located near Duluth, Minn.; Green Bay, Wis.; Roches­ter, N.Y.; Detroit, Mich.; Toledo, Ohio; Milwaukee, Wis.; and Ashtabula, Ohio. This report documents the collection meth­ods, analyses methods, quality-assurance data and analyses, and provides the data for this study. Water and bottom-sediment samples were analyzed at the USGS National Water Quality Laboratory in Denver, Colo., for a broad suite of CECs. During this study, 135 environmental and 23 field dupli­cate samples of surface water and wastewater effluent, 10 field blank water samples, and 11 field spike water samples were collected and analyzed. Sixty-one of the 69 wastewater indicator chemicals (laboratory method 4433) analyzed were detected at concentrations ranging from 0.002 to 11.2 micrograms per liter. Twenty-eight of the 48 pharmaceuticals (research method 8244) analyzed were detected at concentrations ranging from 0.0029 to 22.0 micro­grams per liter. Ten of the 20 steroid hormones and sterols analyzed (research method 4434) were detected at concentrations ranging from 0.16 to 10,000 nanograms per liter. During this study, 75 environmental, 13 field duplicate samples, and 9 field spike samples of bottom sediment were collected and analyzed for a wide variety of CECs. Forty-seven of the 57 wastewater indicator chemicals (laboratory method 5433) analyzed were detected at concentrations ranging from 0.921 to 25,800 nanograms per gram. Seventeen of the 20 steroid hormones and sterols (research method 6434) analyzed were detected at concentrations ranging from 0.006 to 8,921 nanograms per gram. Twelve of the 20 pharmaceuticals (research method 8244) analyzed were detected at concentrations ranging from 2.35 to 453.5 nanograms per gram. Six of the 11 antidepressants (research method 9008) analyzed were detected at concentrations ranging from 2.79 to 91.6 nanograms per gram.

Evidence of Mycobacterium tuberculosis complex bacteraemia in intradermal skin test positive cattle detected using phage-RPA.

PubMed

Swift, Benjamin M C; Convery, Thomas W; Rees, Catherine E D

2016-10-02

Bovine tuberculosis is a zoonotic infectious disease caused by Mycobacterium bovis that affects cattle and can cause tuberculosis in a range of wildlife animals. A bacteriophage-based method combined with PCR (phage-PCR) has been recently used to detect and identify viable pathogenic mycobacteria in the peripheral blood mononuclear cells (PBMCs) of animals suffering from paratuberculosis. To adapt this method for the detection of M. bovis in blood, a new isothermal DNA amplification protocol using Recombinase Polymerase Amplification (RPA) was developed and was found to be able to detect M. bovis BCG within 48 h, with a limit of detection of approximately 10 cells per ml of blood for artificially inoculated blood samples. When blood samples (2 ml) from a Single Comparative Cervical Intradermal Tuberculin (SCCIT)- negative beef herd were tested, Mycobacterium tuberculosis complex (MTC) cells were not detected from any (45) of the blood samples. However when blood samples from SCCIT-positive animals were tested, viable MTC bacteria were detected in 66 % (27/41) of samples. Of these 41 animals sampled, 32 % (13) had visible lesions. In the visible lesion (VL) group, 85 % (11/13) had detectable levels of MTC whereas only 57 % (16/28) of animals which had no visible lesions (NVL) were found to have detectable mycobacteraemia. These results indicated that this simple, rapid method can be applied for the study of M. bovis infections. The frequency with which viable mycobacteria were detected in the peripheral blood of SCCIT-positive animals changes the paradigm of this disease.

Analysis of the herbicide diuron, three diuron degradates, and six neonicotinoid insecticides in water-Method details and application to two Georgia streams

USGS Publications Warehouse

Hladik, Michelle; Calhoun, Daniel L.

2012-01-01

A method for the determination of the widely used herbicide diuron, three degradates of diuron, and six neonicotinoid insecticides in environmental water samples is described. Filtered water samples were extracted by using solid-phase extraction (SPE) with no additional cleanup steps. Quantification of the pesticides from the extracted water samples was done by using liquid chromatography with tandem mass spectrometry (LC/MS/MS). Recoveries in test water samples fortified at 20 nanograms per liter (ng/L) for each compound ranged from 75 to 97 percent; relative standard deviations ranged from 5 to 10 percent. Method detection limits (MDLs) in water ranged from 3.0 to 6.2 ng/L using LC/MS/MS. The method was applied to water samples from two streams in Georgia, Sope Creek and the Chattahoochee River. Diuron and 3,4-dichloroaniline (3,4-DCA) were detected in 100 and 80 percent, respectively, of the samples from the Chattahoochee River, whereas Sope creek had detection frequencies of 15 percent for diuron and 31 percent for 3,4-DCA. Detection frequencies for the neonicotinoid insecticide, imidacloprid, were 60 percent for the Chattahoochee River and 85 percent for Sope Creek. Field matrix-spike recoveries for each compound, when averaged over four water samples, ranged from 79 to 100 percent. The average percentage difference between replicate pairs for all compounds detected in the field samples was 10.1 (± 4.5) percent.

Anomaly detection in reconstructed quantum states using a machine-learning technique

NASA Astrophysics Data System (ADS)

Hara, Satoshi; Ono, Takafumi; Okamoto, Ryo; Washio, Takashi; Takeuchi, Shigeki

2014-02-01

The accurate detection of small deviations in given density matrices is important for quantum information processing. Here we propose a method based on the concept of data mining. We demonstrate that the proposed method can more accurately detect small erroneous deviations in reconstructed density matrices, which contain intrinsic fluctuations due to the limited number of samples, than a naive method of checking the trace distance from the average of the given density matrices. This method has the potential to be a key tool in broad areas of physics where the detection of small deviations of quantum states reconstructed using a limited number of samples is essential.

Comparison of diffusion- and pumped-sampling methods to monitor volatile organic compounds in ground water, Massachusetts Military Reservation, Cape Cod, Massachusetts, July 1999-December 2002

USGS Publications Warehouse

Archfield, Stacey A.; LeBlanc, Denis R.

2005-01-01

To evaluate diffusion sampling as an alternative method to monitor volatile organic compound (VOC) concentrations in ground water, concentrations in samples collected by traditional pumped-sampling methods were compared to concentrations in samples collected by diffusion-sampling methods for 89 monitoring wells at or near the Massachusetts Military Reservation, Cape Cod. Samples were analyzed for 36 VOCs. There was no substantial difference between the utility of diffusion and pumped samples to detect the presence or absence of a VOC. In wells where VOCs were detected, diffusion-sample concentrations of tetrachloroethene (PCE) and trichloroethene (TCE) were significantly lower than pumped-sample concentrations. Because PCE and TCE concentrations detected in the wells dominated the calculation of many of the total VOC concentrations, when VOC concentrations were summed and compared by sampling method, visual inspection also showed a downward concentration bias in the diffusion-sample concentration. The degree to which pumped- and diffusion-sample concentrations agreed was not a result of variability inherent within the sampling methods or the diffusion process itself. A comparison of the degree of agreement in the results from the two methods to 13 quantifiable characteristics external to the sampling methods offered only well-screen length as being related to the degree of agreement between the methods; however, there is also evidence to indicate that the flushing rate of water through the well screen affected the agreement between the sampling methods. Despite poor agreement between the concentrations obtained by the two methods at some wells, the degree to which the concentrations agree at a given well is repeatable. A one-time, well-bywell comparison between diffusion- and pumped-sampling methods could determine which wells are good candidates for the use of diffusion samplers. For wells with good method agreement, the diffusion-sampling method is a time-saving and cost-effective alternative to pumped-sampling methods in a long-term monitoring program, such as at the Massachusetts Military Reservation.

Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

PubMed

Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

2016-05-01

For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

Comparison of a real-time PCR method with a culture method for the detection of Salmonella enterica serotype enteritidis in naturally contaminated environmental samples from integrated poultry houses.

PubMed

Lungu, Bwalya; Waltman, W Douglas; Berghaus, Roy D; Hofacre, Charles L

2012-04-01

Conventional culture methods have traditionally been considered the "gold standard" for the isolation and identification of foodborne bacterial pathogens. However, culture methods are labor-intensive and time-consuming. A Salmonella enterica serotype Enteritidis-specific real-time PCR assay that recently received interim approval by the National Poultry Improvement Plan for the detection of Salmonella Enteritidis was evaluated against a culture method that had also received interim National Poultry Improvement Plan approval for the analysis of environmental samples from integrated poultry houses. The method was validated with 422 field samples collected by either the boot sock or drag swab method. The samples were cultured by selective enrichment in tetrathionate broth followed by transfer onto a modified semisolid Rappaport-Vassiliadis medium and then plating onto brilliant green with novobiocin and xylose lysine brilliant Tergitol 4 plates. One-milliliter aliquots of the selective enrichment broths from each sample were collected for DNA extraction by the commercial PrepSEQ nucleic acid extraction assay and analysis by the Salmonella Enteritidis-specific real-time PCR assay. The real-time PCR assay detected no significant differences between the boot sock and drag swab samples. In contrast, the culture method detected a significantly higher number of positive samples from boot socks. The diagnostic sensitivity of the real-time PCR assay for the field samples was significantly higher than that of the culture method. The kappa value obtained was 0.46, indicating moderate agreement between the real-time PCR assay and the culture method. In addition, the real-time PCR method had a turnaround time of 2 days compared with 4 to 8 days for the culture method. The higher sensitivity as well as the reduction in time and labor makes this real-time PCR assay an excellent alternative to conventional culture methods for diagnostic purposes, surveillance, and research studies to improve food safety.

Multi-Frequency Signal Detection Based on Frequency Exchange and Re-Scaling Stochastic Resonance and Its Application to Weak Fault Diagnosis.

PubMed

Liu, Jinjun; Leng, Yonggang; Lai, Zhihui; Fan, Shengbo

2018-04-25

Mechanical fault diagnosis usually requires not only identification of the fault characteristic frequency, but also detection of its second and/or higher harmonics. However, it is difficult to detect a multi-frequency fault signal through the existing Stochastic Resonance (SR) methods, because the characteristic frequency of the fault signal as well as its second and higher harmonics frequencies tend to be large parameters. To solve the problem, this paper proposes a multi-frequency signal detection method based on Frequency Exchange and Re-scaling Stochastic Resonance (FERSR). In the method, frequency exchange is implemented using filtering technique and Single SideBand (SSB) modulation. This new method can overcome the limitation of "sampling ratio" which is the ratio of the sampling frequency to the frequency of target signal. It also ensures that the multi-frequency target signals can be processed to meet the small-parameter conditions. Simulation results demonstrate that the method shows good performance for detecting a multi-frequency signal with low sampling ratio. Two practical cases are employed to further validate the effectiveness and applicability of this method.

Detection of protozoa in water samples by formalin/ether concentration method.

PubMed

Lora-Suarez, Fabiana; Rivera, Raul; Triviño-Valencia, Jessica; Gomez-Marin, Jorge E

2016-09-01

Methods to detect protozoa in water samples are expensive and laborious. We evaluated the formalin/ether concentration method to detect Giardia sp., Cryptosporidium sp. and Toxoplasma in water. In order to test the properties of the method, we spiked water samples with different amounts of each protozoa (0, 10 and 50 cysts or oocysts) in a volume of 10 L of water. Immunofluorescence assay was used for detection of Giardia and Cryptosporidium. Toxoplasma oocysts were identified by morphology. The mean percent of recovery in 10 repetitions of the entire method, in 10 samples spiked with ten parasites and read by three different observers, were for Cryptosporidium 71.3 ± 12, for Giardia 63 ± 10 and for Toxoplasma 91.6 ± 9 and the relative standard deviation of the method was of 17.5, 17.2 and 9.8, respectively. Intraobserver variation as measured by intraclass correlation coefficient, was fair for Toxoplasma, moderate for Cryptosporidium and almost perfect for Giardia. The method was then applied in 77 samples of raw and drinkable water in three different plant of water treatment. Cryptosporidium was found in 28 of 77 samples (36%) and Giardia in 31 of 77 samples (40%). Theses results identified significant differences in treatment process to reduce the presence of Giardia and Cryptosporidium. In conclusion, the formalin ether method to concentrate protozoa in water is a new alternative for low resources countries, where is urgently need to monitor and follow the presence of theses protozoa in drinkable water. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sensitivity of seven PCRs for early detection of koi herpesvirus in experimentally infected carp, Cyprinus carpio L., by lethal and non-lethal sampling methods.

PubMed

Monaghan, S J; Thompson, K D; Adams, A; Bergmann, S M

2015-03-01

Koi herpesvirus (KHV) causes an economically important, highly infectious disease in common carp and koi, Cyprinus carpio L. Since the occurrence of mass mortalities worldwide, highly specific and sensitive molecular diagnostic methods have been developed for KHV detection. The sensitivity and reliability of these assays have essentially focused at the detection of low viral DNA copy numbers during latent or persistent infections. However, the efficacy of these assays has not been investigated with regard to low-level viraemia during acute infection stages. This study was conducted to compare the sensitivity of seven different polymerase chain reaction (PCR) assays to detect KHV during the first hours and days post-infection (hpi; dpi), using lethal and non-lethal sampling methods. The results highlight the limitations of the assays for detecting virus during the first 4 dpi despite rapid mortality in experimentally infected carp. False-negative results were associated with time post-infection and the tissue sampled. Non-lethal sampling appears effective for KHV screening, with efficient detection in mucus samples obtained from external swabs during this early infection period (<5 dpi), while biopsies from gills and kidney were negative using the same PCR assays. Non-lethal sampling may improve the reliability of KHV detection in subclinical, acutely infected carp. © 2014 John Wiley & Sons Ltd.

Thermal imaging measurement of lateral diffusivity and non-invasive material defect detection

DOEpatents

Sun, Jiangang; Deemer, Chris

2003-01-01

A system and method for determining lateral thermal diffusivity of a material sample using a heat pulse; a sample oriented within an orthogonal coordinate system; an infrared camera; and a computer that has a digital frame grabber, and data acquisition and processing software. The mathematical model used within the data processing software is capable of determining the lateral thermal diffusivity of a sample of finite boundaries. The system and method may also be used as a nondestructive method for detecting and locating cracks within the material sample.

Flow injection trace gas analysis method for on-site determination of organoarsenicals

DOEpatents

Aldstadt, J.H. III

1997-06-24

A method is described for real-time determination of the concentration of Lewisite in the ambient atmosphere, the method includes separating and collecting a Lewisite sample from the atmosphere in a collection chamber, converting the collected Lewisite to an arsenite ion solution sample, pumping the arsenite ion containing sample to an electrochemical detector connected to the collection chamber, and electrochemically detecting the converted arsenite ions in the sample, whereby the concentration of arsenite ions detected is proportional to the concentration of Lewisite in the atmosphere. 2 figs.

Comparison of individual and pooled sampling methods for detecting bacterial pathogens of fish

USGS Publications Warehouse

Mumford, Sonia; Patterson, Chris; Evered, J.; Brunson, Ray; Levine, J.; Winton, J.

2005-01-01

Examination of finfish populations for viral and bacterial pathogens is an important component of fish disease control programs worldwide. Two methods are commonly used for collecting tissue samples for bacteriological culture, the currently accepted standards for detection of bacterial fish pathogens. The method specified in the Office International des Epizooties Manual of Diagnostic Tests for Aquatic Animals permits combining renal and splenic tissues from as many as 5 fish into pooled samples. The American Fisheries Society (AFS) Blue Book/US Fish and Wildlife Service (USFWS) Inspection Manual specifies the use of a bacteriological loop for collecting samples from the kidney of individual fish. An alternative would be to more fully utilize the pooled samples taken for virology. If implemented, this approach would provide substantial savings in labor and materials. To compare the relative performance of the AFS/USFWS method and this alternative approach, cultures of Yersinia ruckeri were used to establish low-level infections in groups of rainbow trout (Oncorhynchus mykiss) that were sampled by both methods. Yersinia ruckeri was cultured from 22 of 37 groups by at least 1 method. The loop method yielded 18 positive groups, with 1 group positive in the loop samples but negative in the pooled samples. The pooled samples produced 21 positive groups, with 4 groups positive in the pooled samples but negative in the loop samples. There was statistically significant agreement (Spearman coefficient 0.80, P < 0.001) in the relative ability of the 2 sampling methods to permit detection of low-level bacterial infections of rainbow trout.

An Accurate Framework for Arbitrary View Pedestrian Detection in Images

NASA Astrophysics Data System (ADS)

Fan, Y.; Wen, G.; Qiu, S.

2018-01-01

We consider the problem of detect pedestrian under from images collected under various viewpoints. This paper utilizes a novel framework called locality-constrained affine subspace coding (LASC). Firstly, the positive training samples are clustered into similar entities which represent similar viewpoint. Then Principal Component Analysis (PCA) is used to obtain the shared feature of each viewpoint. Finally, the samples that can be reconstructed by linear approximation using their top- k nearest shared feature with a small error are regarded as a correct detection. No negative samples are required for our method. Histograms of orientated gradient (HOG) features are used as the feature descriptors, and the sliding window scheme is adopted to detect humans in images. The proposed method exploits the sparse property of intrinsic information and the correlations among the multiple-views samples. Experimental results on the INRIA and SDL human datasets show that the proposed method achieves a higher performance than the state-of-the-art methods in form of effect and efficiency.

Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

PubMed

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

2017-04-01

Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Development of gas chromatographic methods for the analyses of organic carbonate-based electrolytes

NASA Astrophysics Data System (ADS)

Terborg, Lydia; Weber, Sascha; Passerini, Stefano; Winter, Martin; Karst, Uwe; Nowak, Sascha

2014-01-01

In this work, novel methods based on gas chromatography (GC) for the investigation of common organic carbonate-based electrolyte systems are presented, which are used in lithium ion batteries. The methods were developed for flame ionization detection (FID), mass spectrometric detection (MS). Further, headspace (HS) sampling for the investigation of solid samples like electrodes is reported. Limits of detection are reported for FID. Finally, the developed methods were applied to the electrolyte system of commercially available lithium ion batteries as well as on in-house assembled cells.

Development of methods to detect "Norwalk-like viruses" (NLVs) and hepatitis A virus in delicatessen foods: application to a food-borne NLV outbreak.

PubMed

Schwab, K J; Neill, F H; Fankhauser, R L; Daniels, N A; Monroe, S S; Bergmire-Sweat, D A; Estes, M K; Atmar, R L

2000-01-01

"Norwalk-like viruses" (NLVs) and hepatitis A virus (HAV) are the most common causes of virus-mediated food-borne illness. Epidemiological investigations of outbreaks associated with these viruses have been hindered by the lack of available methods for the detection of NLVs and HAV in foodstuffs. Although reverse transcription (RT)-PCR methods have been useful in detecting NLVs and HAV in bivalve mollusks implicated in outbreaks, to date such methods have not been available for other foods. To address this need, we developed a method to detect NLVs and HAV recovered from food samples. The method involves washing of food samples with a guanidinium-phenol-based reagent, extraction with chloroform, and precipitation in isopropanol. Recovered viral RNA is amplified with HAV- or NLV-specific primers in RT-PCRs, using a viral RNA internal standard control to identify potential sample inhibition. By this method, 10 to 100 PCR units (estimated to be equivalent to 10(2) to 10(3) viral genome copies) of HAV and Norwalk virus seeded onto ham, turkey, and roast beef were detected. The method was applied to food samples implicated in an NLV-associated outbreak at a university cafeteria. Sliced deli ham was positive for a genogroup II NLV as determined by using both polymerase- and capsid-specific primers and probes. Sequence analysis of the PCR-amplified capsid region of the genome indicated that the sequence was identical to the sequence from virus detected in the stools of ill students. The developed method is rapid, simple, and efficient.

Development of Methods To Detect “Norwalk-Like Viruses” (NLVs) and Hepatitis A Virus in Delicatessen Foods: Application to a Food-Borne NLV Outbreak

PubMed Central

Schwab, Kellogg J.; Neill, Frederick H.; Fankhauser, Rebecca L.; Daniels, Nicholas A.; Monroe, Stephan S.; Bergmire-Sweat, David A.; Estes, Mary K.; Atmar, Robert L.

2000-01-01

“Norwalk-like viruses” (NLVs) and hepatitis A virus (HAV) are the most common causes of virus-mediated food-borne illness. Epidemiological investigations of outbreaks associated with these viruses have been hindered by the lack of available methods for the detection of NLVs and HAV in foodstuffs. Although reverse transcription (RT)-PCR methods have been useful in detecting NLVs and HAV in bivalve mollusks implicated in outbreaks, to date such methods have not been available for other foods. To address this need, we developed a method to detect NLVs and HAV recovered from food samples. The method involves washing of food samples with a guanidinium-phenol-based reagent, extraction with chloroform, and precipitation in isopropanol. Recovered viral RNA is amplified with HAV- or NLV-specific primers in RT-PCRs, using a viral RNA internal standard control to identify potential sample inhibition. By this method, 10 to 100 PCR units (estimated to be equivalent to 102 to 103 viral genome copies) of HAV and Norwalk virus seeded onto ham, turkey, and roast beef were detected. The method was applied to food samples implicated in an NLV-associated outbreak at a university cafeteria. Sliced deli ham was positive for a genogroup II NLV as determined by using both polymerase- and capsid-specific primers and probes. Sequence analysis of the PCR-amplified capsid region of the genome indicated that the sequence was identical to the sequence from virus detected in the stools of ill students. The developed method is rapid, simple, and efficient. PMID:10618226

Presumptive Sources of Fecal Contamination in Four Tributaries to the New River Gorge National River, West Virginia, 2004

USGS Publications Warehouse

Mathes, Melvin V.; O'Brien, Tara L.; Strickler, Kriston M.; Hardy, Joshua J.; Schill, William B.; Lukasik, Jerzy; Scott, Troy M.; Bailey, David E.; Fenger, Terry L.

2007-01-01

Several methods were used to determine the sources of fecal contamination in water samples collected during September and October 2004 from four tributaries to the New River Gorge National River -- Arbuckle Creek, Dunloup Creek, Keeney Creek, and Wolf Creek. All four tributaries historically have had elevated levels of fecal coliform bacteria. The source-tracking methods used yielded various results, possibly because one or more methods failed. Sourcing methods used in this study included the detection of several human-specific and animal-specific biological or molecular markers, and library-dependent pulsed-field gel electrophoresis analysis that attempted to associate Escherichia coli bacteria obtained from water samples with animal sources by matching DNA-fragment banding patterns. Evaluation of the results of quality-control analysis indicated that pulsed-field gel electrophoresis analysis was unable to identify known-source bacteria isolates. Increasing the size of the known-source library did not improve the results for quality-control samples. A number of emerging methods, using markers in Enterococcus, human urine, Bacteroidetes, and host mitochondrial DNA, demonstrated some potential in associating fecal contamination with human or animal sources in a limited analysis of quality-control samples. All four of the human-specific markers were detected in water samples from Keeney Creek, a watershed with no centralized municipal wastewater-treatment facilities, thus indicating human sources of fecal contamination. The human-specific Bacteroidetes and host mitochondrial DNA markers were detected in water samples from Dunloup Creek, Wolf Creek, and to a lesser degree Arbuckle Creek. Results of analysis for wastewater compounds indicate that the September 27 sample from Arbuckle Creek contained numerous human tracer compounds likely from sewage. Dog, horse, chicken, and pig host mitochondrial DNA were detected in some of the water samples with the exception of the October 5 sample from Dunloup Creek. Cow, white-tailed deer, and Canada goose DNA were not detected in any of the samples collected from the four tributaries, despite the presence of these animals in the watersheds. Future studies with more rigorous quality-control analyses are needed to investigate the potential applicability and use of these emerging methods. Because many of the detections for the various methods could vary over time and with flow conditions, repeated sampling during both base flow and storm events would be necessary to more definitively determine the sources of fecal contamination for each watershed.

Diagnostic Accuracy and Cost-Effectiveness of Alternative Methods for Detection of Soil-Transmitted Helminths in a Post-Treatment Setting in Western Kenya

PubMed Central

Kepha, Stella; Kihara, Jimmy H.; Njenga, Sammy M.; Pullan, Rachel L.; Brooker, Simon J.

2014-01-01

Objectives This study evaluates the diagnostic accuracy and cost-effectiveness of the Kato-Katz and Mini-FLOTAC methods for detection of soil-transmitted helminths (STH) in a post-treatment setting in western Kenya. A cost analysis also explores the cost implications of collecting samples during school surveys when compared to household surveys. Methods Stool samples were collected from children (n = 652) attending 18 schools in Bungoma County and diagnosed by the Kato-Katz and Mini-FLOTAC coprological methods. Sensitivity and additional diagnostic performance measures were analyzed using Bayesian latent class modeling. Financial and economic costs were calculated for all survey and diagnostic activities, and cost per child tested, cost per case detected and cost per STH infection correctly classified were estimated. A sensitivity analysis was conducted to assess the impact of various survey parameters on cost estimates. Results Both diagnostic methods exhibited comparable sensitivity for detection of any STH species over single and consecutive day sampling: 52.0% for single day Kato-Katz; 49.1% for single-day Mini-FLOTAC; 76.9% for consecutive day Kato-Katz; and 74.1% for consecutive day Mini-FLOTAC. Diagnostic performance did not differ significantly between methods for the different STH species. Use of Kato-Katz with school-based sampling was the lowest cost scenario for cost per child tested ($10.14) and cost per case correctly classified ($12.84). Cost per case detected was lowest for Kato-Katz used in community-based sampling ($128.24). Sensitivity analysis revealed the cost of case detection for any STH decreased non-linearly as prevalence rates increased and was influenced by the number of samples collected. Conclusions The Kato-Katz method was comparable in diagnostic sensitivity to the Mini-FLOTAC method, but afforded greater cost-effectiveness. Future work is required to evaluate the cost-effectiveness of STH surveillance in different settings. PMID:24810593

Detection and isolation of nucleic acid sequences using a bifunctional hybridization probe

DOEpatents

Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

2000-01-01

A method for detecting and isolating a target sequence in a sample of nucleic acids is provided using a bifunctional hybridization probe capable of hybridizing to the target sequence that includes a detectable marker and a first complexing agent capable of forming a binding pair with a second complexing agent. A kit is also provided for detecting a target sequence in a sample of nucleic acids using a bifunctional hybridization probe according to this method.

Potentiometric detection in UPLC as an easy alternative to determine cocaine in biological samples.

PubMed

Daems, Devin; van Nuijs, Alexander L N; Covaci, Adrian; Hamidi-Asl, Ezat; Van Camp, Guy; Nagels, Luc J

2015-07-01

The analytical methods which are often used for the determination of cocaine in complex biological matrices are a prescreening immunoassay and confirmation by chromatography combined with mass spectrometry. We suggest an ultra-high-pressure liquid chromatography combined with a potentiometric detector, as a fast and practical method to detect and quantify cocaine in biological samples. An adsorption/desorption model was used to investigate the usefulness of the potentiometric detector to determine cocaine in complex matrices. Detection limits of 6.3 ng mL(-1) were obtained in plasma and urine, which is below the maximum residue limit (MRL) of 25 ng mL(-1). A set of seven plasma samples and 10 urine samples were classified identically by both methods as exceeding the MRL or being inferior to it. The results obtained with the UPLC/potentiometric detection method were compared with the results obtained with the UPLC/MS method for samples spiked with varying cocaine concentrations. The intraclass correlation coefficient was 0.997 for serum (n =7) and 0.977 for urine (n =8). As liquid chromatography is an established technique, and as potentiometry is very simple and cost-effective in terms of equipment, we believe that this method is potentially easy, inexpensive, fast and reliable. Copyright © 2014 John Wiley & Sons, Ltd.

High prevalence of Salmonella spp. in wastewater reused for irrigation assessed by molecular methods.

PubMed

Santiago, Paula; Jiménez-Belenguer, Ana; García-Hernández, Jorge; Estellés, Rosa Montes; Hernández Pérez, Manuel; Castillo López, M Angeles; Ferrús, María Antonia; Moreno, Yolanda

2018-01-01

Salmonella spp. is one of the most important causal agents of food-borne illness in developed countries and its presence in irrigation water poses a risk to public health. Its detection in environmental samples is not easy when culture methods are used, and molecular techniques such as PCR or ribosomal rRNA probe hybridization (Fluorescent in situ Hybridization, FISH) are outstanding alternatives. The aim of this work was to determine the environmental risk due to the presence of Salmonella spp. in wastewater by culture, PCR and FISH. A new specific rDNA probe for Salmonella was designed and its efficiency was compared with the rest of methods Serotype and antibiotic resistance of isolated strains were determined. Forty-five wastewater samples (collected from two secondary wastewater treatment plants) were analysed. Salmonella strains were isolated in 24 wastewater samples (53%), two of them after disinfection treatment. Twenty-three Salmonella strains exhibited resistance to one or more antimicrobial agent. Analysis of wastewater samples yielded PCR positive results for Salmonella in 28 out of the 45 wastewater samples (62%). FISH analysis allowed for the detection of Salmonella in 27 (60%) samples. By using molecular methods, Salmonella was detected in four samples after disinfection treatment. These results show the prevalence of Salmonella in reclaimed wastewater even after U.V. disinfection, what is a matter of public health concern, the high rates of resistance to antibiotics and the adequacy of molecular methods for its rapid detection. FISH method, with SA23 probe developed and assayed in this work provides a tool for detecting Salmonella in water within few hours, with a high rate of effectiveness. Copyright © 2017 Elsevier GmbH. All rights reserved.

Comparison of two filtration-elution procedures to improve the standard methods ISO 10705-1 & 2 for bacteriophage detection in groundwater, surface water and finished water samples.

PubMed

Helmi, K; Jacob, P; Charni-Ben-Tabassi, N; Delabre, K; Arnal, C

2011-09-01

To select a reliable method for bacteriophage concentration prior detection by culture from surface water, groundwater and drinking water to enhance the sensitivity of the standard methods ISO 10705-1 & 2. Artificially contaminated (groundwater and drinking water) and naturally contaminated (surface water) 1-litre samples were processed for bacteriophages detection. The spiked samples were inoculated with about 150 PFU of F-specific RNA bacteriophages and somatic coliphages using wastewater. Bacteriophage detection in the water samples was achieved using the standard method without and with a concentration step (electropositive Anodisc membrane or a pretreated electronegative Micro Filtration membrane, MF). For artificially contaminated matrices (drinking and ground waters), recovery rates using the concentration step were superior to 70% whilst analyses without concentration step mainly led to false negative results. Besides, the MF membrane presented higher performances compared with the Anodisc membrane. The concentration of a large volume of water (up to one litre) on a filter membrane avoids false negative results obtained by direct analysis as it allows detecting low number of bacteriophages in water samples. The addition of concentration step before applying the standard method could be useful to enhance the reliability of bacteriophages monitoring in water samples as bio-indicators to highlight faecal pollution. © No claim to French Government works. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

Method and apparatus for time dispersive spectroscopy

DOEpatents

Tarver, III, Edward E.; Siems, William F.

2003-06-17

Methods and apparatus are described for time dispersive spectroscopy. In particular, a modulated flow of ionized molecules of a sample are introduced into a drift region of an ion spectrometer. The ions are subsequently detected by an ion detector to produce an ion detection signal. The ion detection signal can be modulated to obtain a signal useful in assaying the chemical constituents of the sample.

Application of Coamplification at Lower Denaturation Temperature-PCR Sequencing for Early Detection of Antiviral Drug Resistance Mutations of Hepatitis B Virus

PubMed Central

Wong, Danny Ka-Ho; Tsoi, Ottilia; Huang, Fung-Yu; Seto, Wai-Kay; Fung, James; Lai, Ching-Lung

2014-01-01

Nucleoside/nucleotide analogue for the treatment of chronic hepatitis B virus (HBV) infection is hampered by the emergence of drug resistance mutations. Conventional PCR sequencing cannot detect minor variants of <20%. We developed a modified co-amplification at lower denaturation temperature-PCR (COLD-PCR) method for the detection of HBV minority drug resistance mutations. The critical denaturation temperature for COLD-PCR was determined to be 78°C. Sensitivity of COLD-PCR sequencing was determined using serially diluted plasmids containing mixed proportions of HBV reverse transcriptase (rt) wild-type and mutant sequences. Conventional PCR sequencing detected mutations only if they existed in ≥25%, whereas COLD-PCR sequencing detected mutations when they existed in 5 to 10% of the viral population. The performance of COLD-PCR was compared to conventional PCR sequencing and a line probe assay (LiPA) using 215 samples obtained from 136 lamivudine- or telbivudine-treated patients with virological breakthrough. Among these 215 samples, drug resistance mutations were detected in 155 (72%), 148 (69%), and 113 samples (53%) by LiPA, COLD-PCR, and conventional PCR sequencing, respectively. Nineteen (9%) samples had mutations detectable by COLD-PCR but not LiPA, while 26 (12%) samples had mutations detectable by LiPA but not COLD-PCR, indicating both methods were comparable (P = 0.371). COLD-PCR was more sensitive than conventional PCR sequencing. Thirty-five (16%) samples had mutations detectable by COLD-PCR but not conventional PCR sequencing, while none had mutations detected by conventional PCR sequencing but not COLD-PCR (P < 0.0001). COLD-PCR sequencing is a simple method which is comparable to LiPA and superior to conventional PCR sequencing in detecting minor lamivudine/telbivudine resistance mutations. PMID:24951803

Fast IRMS screening of pseudoendogenous steroids in doping analyses.

PubMed

de la Torre, Xavier; Colamonici, Cristiana; Curcio, Davide; Botrè, Francesco

2017-11-01

The detection of the abuse of pseudoendogenous steroids (testosterone and/or its precursors) is currently based, when possible, on the application of the steroid module of the World Anti-Doping Agency (WADA), athlete biological passport (ABP), implemented through the global database, ADAMS. When a suspicious sample is detected, the confirmation by isotope ratio mass spectrometry (IRMS) is required. It is well known that this confirmation procedure is time consuming and expensive and can be only applied on a reduced number of samples. In previous studies we have demonstrated that the longitudinal evaluation of the IRMS data is able to detect positive samples that otherwise will be evaluated as negative, improving the efficacy of the fight against doping in sport. This would require the analysis of a much larger volume of samples by IRMS. The aim of the present work is to describe an IRMS screening method allowing to increase the throughput of samples that can be analyzed by IRMS. The detection efficacy of the method is compared with the confirmation method in use, and to assess its robustness and applicability, all the samples of a major cycling stage competition were analyzed, with the agreement of the testing authority, under routine conditions and response times. The results obtained permit to conclude that the IRMS screening method here proposed has adequate selectivity and produces results that overlap with the already validated method currently in use permitting to analyze a much higher volume of samples even during a major event without compromising the detection capacity. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Detection and differentiation of coxiella burnetii in biological fluids

DOEpatents

Frazier, Marvin E.; Mallavia, Louis P.; Samuel, James E.; Baca, Oswald G.

1990-01-01

Methods for detecting the presence of Coxiella burenetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA (specifically rickettsial DNA) with a C. burnetii-specific labeled DNA probe. Radioisotope and biotin labels are preferred, allowing detection through autoradiography and colorimetric assays, respectively.

Detection and differentiation of coxiella burnetii in biological fluids

DOEpatents

Frazier, Marvin E.; Mallavia, Louis P.; Baca, Oswald G.; Samuel, James E.

1989-01-01

Methods for detecting the presence of Coxiella burnetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA (specifically rickettsial DNA) with a C. burnetii-specific labeled DNA probe. Radioisotope and biotin labels are preferred, allowing detection through autoradiography and colorimetric assays, respectively.

Microplate-reader method for the rapid analysis of copper in natural waters with chemiluminescence detection.

PubMed

Durand, Axel; Chase, Zanna; Remenyi, Tomas; Quéroué, Fabien

2012-01-01

We have developed a method for the determination of copper in natural waters at nanomolar levels. The use of a microplate-reader minimizes sample processing time (~25 s per sample), reagent consumption (~120 μL per sample), and sample volume (~700 μL). Copper is detected by chemiluminescence. This technique is based on the formation of a complex between copper and 1,10-phenanthroline and the subsequent emission of light during the oxidation of the complex by hydrogen peroxide. Samples are acidified to pH 1.7 and then introduced directly into a 24-well plate. Reagents are added during data acquisition via two reagent injectors. When trace metal clean protocols are employed, the reproducibility is generally less than 7% on blanks and the detection limit is 0.7 nM for seawater and 0.4 nM for freshwater. More than 100 samples per hour can be analyzed with this technique, which is simple, robust, and amenable to at-sea analysis. Seawater samples from Storm Bay in Tasmania illustrate the utility of the method for environmental science. Indeed other trace metals for which optical detection methods exist (e.g., chemiluminescence, fluorescence, and absorbance) could be adapted to the microplate-reader.

Apparatus for point-of-care detection of nucleic acid in a sample

DOEpatents

Bearinger, Jane P.; Dugan, Lawrence C.

2016-04-19

Provided herein are methods and apparatus for detecting a target nucleic acid in a sample and related methods and apparatus for diagnosing a condition in an individual. The condition is associated with presence of nucleic acid produced by certain pathogens in the individual.

Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

PubMed

Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

2010-03-01

Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

USGS Publications Warehouse

Wilcox, Taylor M; Mckelvey, Kevin S.; Young, Michael K.; Sepulveda, Adam; Shepard, Bradley B.; Jane, Stephen F; Whiteley, Andrew R.; Lowe, Winsor H.; Schwartz, Michael K.

2016-01-01

Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive independent estimates of eDNA production rates and downstream persistence from brook trout (Salvelinus fontinalis) in streams. We use these estimates to parameterize models comparing the false negative detection rates of eDNA sampling and traditional backpack electrofishing. We find that using the protocols in this study eDNA had reasonable detection probabilities at extremely low animal densities (e.g., probability of detection 0.18 at densities of one fish per stream kilometer) and very high detection probabilities at population-level densities (e.g., probability of detection > 0.99 at densities of ≥ 3 fish per 100 m). This is substantially more sensitive than traditional electrofishing for determining the presence of brook trout and may translate into important cost savings when animals are rare. Our findings are consistent with a growing body of literature showing that eDNA sampling is a powerful tool for the detection of aquatic species, particularly those that are rare and difficult to sample using traditional methods.

Survey of Legionella spp. in Mud Spring Recreation Area

NASA Astrophysics Data System (ADS)

Hsu, B.-M.; Ma, P.-H.; Su, I.-Z.; Chen, N.-S.

2009-04-01

Legionella genera are parasites of FLA, and intracellular bacterial replication within the FLA plays a major role in the transmission of disease. At least 13 FLA species—including Acanthamoeba spp., Naegleria spp., and Hartmannella spp.—support intracellular bacterial replication. In the study, Legionellae were detected with microbial culture or by direct DNA extraction and analysis from concentrated water samples or cultured free-living amoebae, combined with molecular methods that allow the taxonomic identification of these pathogens. The water samples were taken from a mud spring recreation area located in a mud-rock-formation area in southern Taiwan. Legionella were detected in 15 of the 34 samples (44.1%). Four of the 34 samples analyzed by Legionella culture were positive for Legionella, five of 34 were positive for Legionella when analyzed by direct DNA extraction and analysis, and 11 of 34 were positive for amoebae-resistant Legionella when analyzed by FLA culture. Ten samples were shown to be positive for Legionella by one analysis method and five samples were shown to be positive by two analysis methods. However, Legionella was detected in no sample by all three analysis methods. This suggests that the three analysis methods should be used together to detect Legionella in aquatic environments. In this study, L. pneumophila serotype 6 coexisted with A. polyphaga, and two uncultured Legionella spp. coexisted with either H. vermiformis or N. australiensis. Of the unnamed Legionella genotypes detected in six FLA culture samples, three were closely related to L. waltersii and the other three were closely related to L. pneumophila serotype 6. Legionella pneumophila serotype 6, L. drancourtii, and L. waltersii are noted endosymbionts of FLA and are categorized as pathogenic bacteria. This is significant for human health because these Legionella exist within FLA and thus come into contact with typically immunocompromised people.

Comparative analysis of whole mount processing and systematic sampling of radical prostatectomy specimens: pathological outcomes and risk of biochemical recurrence.

PubMed

Salem, Shady; Chang, Sam S; Clark, Peter E; Davis, Rodney; Herrell, S Duke; Kordan, Yakup; Wills, Marcia L; Shappell, Scott B; Baumgartner, Roxelyn; Phillips, Sharon; Smith, Joseph A; Cookson, Michael S; Barocas, Daniel A

2010-10-01

Whole mount processing is more resource intensive than routine systematic sampling of radical retropubic prostatectomy specimens. We compared whole mount and systematic sampling for detecting pathological outcomes, and compared the prognostic value of pathological findings across pathological methods. We included men (608 whole mount and 525 systematic sampling samples) with no prior treatment who underwent radical retropubic prostatectomy at Vanderbilt University Medical Center between January 2000 and June 2008. We used univariate and multivariate analysis to compare the pathological outcome detection rate between pathological methods. Kaplan-Meier curves and the log rank test were used to compare the prognostic value of pathological findings across pathological methods. There were no significant differences between the whole mount and the systematic sampling groups in detecting extraprostatic extension (25% vs 30%), positive surgical margins (31% vs 31%), pathological Gleason score less than 7 (49% vs 43%), 7 (39% vs 43%) or greater than 7 (12% vs 13%), seminal vesicle invasion (8% vs 10%) or lymph node involvement (3% vs 5%). Tumor volume was higher in the systematic sampling group and whole mount detected more multiple surgical margins (each p <0.01). There were no significant differences in the likelihood of biochemical recurrence between the pathological methods when patients were stratified by pathological outcome. Except for estimated tumor volume and multiple margins whole mount and systematic sampling yield similar pathological information. Each method stratifies patients into comparable risk groups for biochemical recurrence. Thus, while whole mount is more resource intensive, it does not appear to result in improved detection of clinically important pathological outcomes or prognostication. Copyright © 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Drinking water test methods in crisis-afflicted areas: comparison of methods under field conditions.

PubMed

Merle, Roswitha; Bleul, Ingo; Schulenburg, Jörg; Kreienbrock, Lothar; Klein, Günter

2011-11-01

To simplify the testing of drinking water in crisis-afflicted areas (as in Kosovo in 2007), rapid test methods were compared with the standard test. For Escherichia coli and coliform pathogens, rapid tests were made available: Colilert(®)-18, P/A test with 4-methylumbelliferyl-β-D-glucoronid, and m-Endo Broth. Biochemical differentiation was carried out by Enterotube™ II. Enterococci were determined following the standard ISO test and by means of Enterolert™. Four hundred ninety-nine water samples were tested for E. coli and coliforms using four methods. Following the standard method, 20.8% (n=104) of the samples contained E. coli, whereas the rapid tests detected between 19.6% (m-Endo Broth, 92.0% concordance) and 20.0% (concordance: 93.6% Colilert-18 and 94.8% P/A-test) positive samples. Regarding coliforms, the percentage of concordant results ranged from 98.4% (P/A-test) to 99.0% (Colilert-18). Colilert-18 and m-Endo Broth detected even more positive samples than the standard method did. Enterococci were detected in 93 of 573 samples by the standard method, but in 92 samples by Enterolert (concordance: 99.5%). Considering the high-quality equipment and time requirements of the standard method, the use of rapid tests in crisis-afflicted areas is sufficiently reliable.

Simultaneous determination of seven multiclass veterinary antibiotics in surface water samples in the Republic of Korea using liquid chromatography with tandem mass spectrometry.

PubMed

Chung, Hyung Suk; Choi, Jeong-Heui; Abd El-Aty, A M; Lee, Young-Jun; Lee, Han Sol; Kim, Sangdon; Jung, Hee-Jung; Kang, Tae-Woo; Shin, Ho-Chul; Shim, Jae-Han

2016-12-01

A simultaneous determination method using solid-phase extraction and liquid chromatography with tandem mass spectrometry was developed to detect and quantify the presence of seven multiclass veterinary antibiotics (13 compounds in total) in surface water samples, which included the effluents of livestock wastewater and sewage treatment plants, as well as the reservoir drainage areas from dense animal farms. The pH of all water samples was adjusted to 2 or 6 before solid-phase extraction using Oasis HLB cartridges. The developed method was fully validated in terms of linearity, method detection limit, method quantitation limit, accuracy, and precision. The linearity of all tested drugs was good, with R 2 determination coefficients ≥ 0.9931. The method detection limits and method quantitation limits were 0.1-74.3 and 0.5-236.6 ng/L, respectively. Accuracy and precision values were 71-120 and 1-17%, respectively. The determination method was successfully applied for monitoring water samples obtained from the Yeongsan River in 2015. The most frequently detected antibiotics were lincomycin (96%), sulfamethazine (90%), sulfamethoxazole (88%), and sulfathiazole (50%); the maximum concentrations of which were 398.9, 1151.3, 533.1, and 307.4 ng/L, respectively. Overall, the greatest numbers and concentrations of detected antibiotics were found in samples from the effluents of livestock wastewater, sewage treatment plants, and reservoir drainage areas. Diverse veterinary antibiotics were present, and their presence was dependent upon the commercial sales and environmental properties of the analytes, the geographical positions of the sampling points, and the origin of the water. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Investigation of Coxiella burnetii contamination in commercial milk and PCR method for the detection of C. burnetii in egg].

PubMed

Hirai, Akihiko; Kaneko, Seiji; Nakama, Akiko; Ishizaki, Naoto; Odagiri, Megumi; Kai, Akemi; Sadamasu, Kenji; Shinkai, Takayuki; Yano, Kazuyoshi; Morozumi, Satoshi

2005-06-01

A total of 244 milk samples collected from supermarkets in Tokyo were examined for contamination with Coxiella burnetii. C. burnetii DNA was detected in 131 (53.7%) of the samples by nested PCR. PCR-positive samples were injected into immunosuppressed A/J strain mice. Of the 22 PCR-positive milk samples tested, none resulted in isolation of C. burnetii from the mice. Heat-treatment was sufficient to inactivate C. burnetii in commercial milk. In addition, a PCR detection method for C. burnetii in chicken egg was developed. Egg yolk was added to an equal volume of 1 mol/L of NaCl phosphate buffer and homogenized for removal of protein and lipid. After centrifugal separation, the supernatant was removed, and template DNA in the precipitate was extracted using SDS, proteinase K and NaI. Using such prepared samples, 3.2 x 10(1) C. burnetii particles in 1 g of egg yolk could be detected by nested PCR. All of 200 chicken egg samples collected from supermarkets in Tokyo were negative for C. burnetii by the nested PCR method.

Comparison of the detection of periodontal pathogens in bacteraemia after tooth brushing by culture and molecular techniques.

PubMed

Marín, M-J; Figuero, E; González, I; O'Connor, A; Diz, P; Álvarez, M; Herrera, D; Sanz, M

2016-05-01

The prevalence and amounts of periodontal pathogens detected in bacteraemia samples after tooth brushing-induced by means of four diagnostic technique, three based on culture and one in a molecular-based technique, have been compared in this study. Blood samples were collected from thirty-six subjects with different periodontal status (17 were healthy, 10 with gingivitis and 9 with periodontitis) at baseline and 2 minutes after tooth brushing. Each sample was analyzed by three culture-based methods [direct anaerobic culturing (DAC), hemo-culture (BACTEC), and lysis-centrifugation (LC)] and one molecular-based technique [quantitative polymerase chain reaction (qPCR)]. With culture any bacterial isolate was detected and quantified, while with qPCR only Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were detected and quantified. Descriptive analyses, ANOVA and Chi-squared tests, were performed. Neither BACTEC nor qPCR detected any type of bacteria in the blood samples. Only LC (2.7%) and DAC (8.3%) detected bacteraemia, although not in the same patients. Fusobacterium nucleatum was the most frequently detected bacterial species. The disparity in the results when the same samples were analyzed with four different microbiological detection methods highlights the need for a proper validation of the methodology to detect periodontal pathogens in bacteraemia samples, mainly when the presence of periodontal pathogens in blood samples after tooth brushing was very seldom.

Detection of Strongylus vulgaris in equine faecal samples by real-time PCR and larval culture - method comparison and occurrence assessment.

PubMed

Kaspar, A; Pfister, K; Nielsen, M K; Silaghi, C; Fink, H; Scheuerle, M C

2017-01-11

Strongylus vulgaris has become a rare parasite in Germany during the past 50 years due to the practice of frequent prophylactic anthelmintic therapy. To date, the emerging development of resistance in Cyathostominae and Parascaris spp. to numerous equine anthelmintics has changed deworming management and the frequency of anthelmintic usage. In this regard, reliable detection of parasitic infections, especially of the highly pathogenic S. vulgaris is essential. In the current study, two diagnostic methods for the detection of infections with S. vulgaris were compared and information on the occurrence of this parasite in German horses was gained. For this purpose, faecal samples of 501 horses were screened for S. vulgaris with real-time PCR and an additional larval culture was performed in samples of 278 horses. A subset of 26 horses underwent multiple follow-up examinations with both methods in order to evaluate both the persistence of S. vulgaris infections and the reproducibility of each diagnostic method. The real-time PCR revealed S. vulgaris-DNA in ten of 501 investigated equine samples (1.9%). The larval culture demonstrated larvae of S. vulgaris in three of the 278 samples (1.1%). A direct comparison of the two methods was possible in 321 samples including 43 follow-up examinations with the result of 11 S. vulgaris-positive samples by real-time PCR and 4 S. vulgaris-positive samples by larval culture. The McNemar's test (p-value = 0.016) revealed a significant difference and the kappa values (0.525) showed a moderate agreement between real-time PCR and larval culture. The real-time PCR detected a significantly higher proportion of positives of S. vulgaris compared to larval culture and should thus be considered as a routine diagnostic method for the detection of S. vulgaris in equine samples.

DEVELOPMENT OF AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR THE DETECTION OF ENTEROVIRUS IN WATER

EPA Science Inventory

Virus contamination in environmental samples is believed to be underestimated due to the limitations in the methods available for detection. A major detection method is based upon the formation of cytopathic effect (CPE) in cell culture. The main limitations to this method are ...

Fast detection and characterization of organic and inorganic gunshot residues on the hands of suspects by CMV-GC-MS and LIBS.

PubMed

Tarifa, Anamary; Almirall, José R

2015-05-01

A rapid method for the characterization of both organic and inorganic components of gunshot residues (GSR) is proposed as an alternative tool to facilitate the identification of a suspected shooter. In this study, two fast screening methods were developed and optimized for the detection of organic compounds and inorganic components indicative of GSR presence on the hands of shooters and non-shooters. The proposed methods consist of headspace extraction of volatile organic compounds using a capillary microextraction of volatiles (CMV) device previously reported as a high-efficiency sampler followed by detection by GC-MS. This novel sampling technique has the potential to yield fast results (<2min sampling) and high sensitivity capable of detecting 3ng of diphenylamine (DPA) and 8ng of nitroglycerine (NG). Direct analysis of the headspace of over 50 swabs collected from the hands of suspected shooters (and non-shooters) provides information regarding VOCs present on their hands. In addition, a fast laser induced breakdown spectroscopy (LIBS) screening method for the detection of the inorganic components indicative of the presence of GSR (Sb, Pb and Ba) is described. The sampling method for the inorganics consists of liquid extraction of the target elements from the same cotton swabs (previously analyzed for VOCs) and an additional 30 swab samples followed by spiking 1μL of the extract solution onto a Teflon disk and then analyzed by LIBS. Advantages of LIBS include fast analysis (~12s per sample) and high selectivity and sensitivity, with expected LODs 0.1-18ng for each of the target elements after sampling. The analytical performance of the LIBS method is also compared to previously reported methods (inductively coupled plasma-optical emission spectroscopy). The combination of fast CMV sampling, unambiguous organic compound identification with GC-MS and fast LIBS analysis provides the basis for a new comprehensive screening method for GSR. Copyright © 2015 Forensic Science Society. Published by Elsevier Ireland Ltd. All rights reserved.

Salmonella spp. contamination in commercial layer hen farms using different types of samples and detection methods.

PubMed

Soria, M C; Soria, M A; Bueno, D J; Godano, E I; Gómez, S C; ViaButron, I A; Padin, V M; Rogé, A D

2017-08-01

The performance of detection methods (culture methods and polymerase chain reaction assay) and plating media used in the same type of samples were determined as well as the specificity of PCR primers to detected Salmonella spp. contamination in layer hen farms. Also, the association of farm characteristics with Salmonella presence was evaluated. Environmental samples (feces, feed, drinking water, air, boot-swabs) and eggs were taken from 40 layer hen houses. Salmonella spp. was most detected in boot-swabs taken around the houses (30% and 35% by isolation and PCR, respectively) follow by fecal samples (15.2% and 13.6% by isolation and PCR, respectively). Eggs, drinking water, and air samples were negative for Salmonella detection. Salmonella Schwarzengrund and S. Enteritidis were the most isolated serotypes. For plating media, relative specificity was 1, and the relative sensitivity was greater for EF-18 agar than XLDT agar in feed and fecal samples. However, relative sensitivity was greater in XLDT agar than EF-18 agar for boot-swab samples. Agreement was between fair to good depending on the sample, and it was good between isolation and PCR (feces and boot-swabs), without agreement for feed samples. Salmonella spp. PCR was positive for all strains, while S. Typhimurium PCR was negative. Salmonella Enteritidis PCR used was not specific. Based in the multiple logistic regression analyses, categorization by counties was significant for Salmonella spp. presence (P-value = 0.010). This study shows the importance of considering different types of samples, plating media and detection methods during a Salmonella spp. monitoring study. In addition, it is important to incorporate the sampling of floors around the layer hen houses to learn if biosecurity measures should be strengthened to minimize the entry and spread of Salmonella in the houses. Also, the performance of some PCR methods and S. Enteritidis PCR should be improved, and biosecurity measures in hen farms must be reinforced in the region of more concentrated layer hen houses to reduce the probability of Salmonella spp. presence. © 2017 Poultry Science Association Inc.

A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

PubMed

Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

2017-11-15

A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

Optimization of fecal cytology in the dog: comparison of three sampling methods.

PubMed

Frezoulis, Petros S; Angelidou, Elisavet; Diakou, Anastasia; Rallis, Timoleon S; Mylonakis, Mathios E

2017-09-01

Dry-mount fecal cytology (FC) is a component of the diagnostic evaluation of gastrointestinal diseases. There is limited information on the possible effect of the sampling method on the cytologic findings of healthy dogs or dogs admitted with diarrhea. We aimed to: (1) establish sampling method-specific expected values of selected cytologic parameters (isolated or clustered epithelial cells, neutrophils, lymphocytes, macrophages, spore-forming rods) in clinically healthy dogs; (2) investigate if the detection of cytologic abnormalities differs among methods in dogs admitted with diarrhea; and (3) investigate if there is any association between FC abnormalities and the anatomic origin (small- or large-bowel diarrhea) or the chronicity of diarrhea. Sampling with digital examination (DE), rectal scraping (RS), and rectal lavage (RL) was prospectively assessed in 37 healthy and 34 diarrheic dogs. The median numbers of isolated ( p = 0.000) or clustered ( p = 0.002) epithelial cells, and of lymphocytes ( p = 0.000), differed among the 3 methods in healthy dogs. In the diarrheic dogs, the RL method was the least sensitive in detecting neutrophils, and isolated or clustered epithelial cells. Cytologic abnormalities were not associated with the origin or the chronicity of diarrhea. Sampling methods differed in their sensitivity to detect abnormalities in FC; DE or RS may be of higher sensitivity compared to RL. Anatomic origin or chronicity of diarrhea do not seem to affect the detection of cytologic abnormalities.

Comparison of Cultivation and PCR-Hybridization for Detection of Salmonella in Porcine Fecal and Water Samples†

PubMed Central

Feder, Ingrid; Nietfeld, Jerome C.; Galland, John; Yeary, Teresa; Sargeant, Jan M.; Oberst, Richard; Tamplin, Mark L.; Luchansky, John B.

2001-01-01

A total of 150 fecal and water samples from four swine farms were tested for the presence of Salmonella enterica using different enrichment techniques as follows: (i) 92 fecal samples from nursery and farrowing barns at three swine farms were preenriched overnight in tryptic soy broth (TSB) at 37°C followed by overnight enrichment in Rappaport-Vassiliadis 10 broth (RV10) at 42°C; (ii) 24 water samples from the third farm were preenriched overnight in 3MC broth at 37°C followed by overnight enrichment in RV10 at 42°C; and (iii) 34 fecal samples from a fourth farm, a finishing farm, were enriched overnight in RV10 at 42°C with no additional enrichment. Following each of the enrichment techniques, samples were subcultured onto modified semisolid Rappaport-Vassiliadis (MSRV) agar prior to transfer to Hektoen Enteric agar plates for the recovery of viable Salmonella bacteria. Presumptive Salmonella isolates were biochemically and serologically confirmed. For the PCR detection of Salmonella, a 1-ml portion was removed from each sample after the first overnight enrichment and the DNA was extracted using a Sepharose CL-6B spin column. Amplicons (457 bp) derived from primers to the invA and invE genes were confirmed as Salmonella specific on ethidium bromide-stained agarose gels by Southern hybridization with a 20-mer oligonucleotide probe specific for the Salmonella invA gene. Neither the standard microbiological method nor the molecular method detected all of the 65 samples that tested positive by both methods or either method alone. Salmonella bacteria were detected by both cultivation and PCR-hybridization in 68% (17 of 25) of the positive samples that were preenriched in TSB, in 73% (11 of 15) of the positive samples preenriched in 3MC broth, and in 24% (6 of 25) of the positive samples enriched in RV10. Agreement between Salmonella detection using cultivation with preenrichment and detection by PCR was 76% using the kappa statistic. However, agreement between Salmonella detection using cultivation without preenrichment and detection by PCR was about 6%; the PCR assay detected 80% (20 of 25) of the 25 positive samples, while Salmonella bacteria were recovered from only 44% (11 of 25) by cultivation. Our results indicate that the PCR-hybridization approach is equivalent to or better than cultivation for detecting Salmonella in swine feces or water samples from swine farms when using the medium combinations evaluated in this study. PMID:11427557

Accuracy of dry vaginal self-sampling for detecting high-risk human papillomavirus infection in cervical cancer screening: a cross-sectional study.

PubMed

Haguenoer, K; Giraudeau, B; Gaudy-Graffin, C; de Pinieux, I; Dubois, F; Trignol-Viguier, N; Viguier, J; Marret, H; Goudeau, A

2014-08-01

Cervical cancer screening coverage remains insufficient in most countries. Testing self-collected samples for high-risk human papillomavirus (HR-HPV) could be an alternative to the Pap smear, but costs, sampling methods and transport issues hamper its wide use. Our objective was to compare diagnostic accuracy of 2 vaginal self-collection methods, a dry swab (vsc-DRY) or swab in liquid medium (vsc-LIQ), for detecting HR-HPV cervical infection assessed by a cervical clinician-collected sample in liquid medium (ccc-LIQ). Women 20 to 65 years attending a Pap smear were recruited between September, 2009 and March, 2011. Each sample (3 per woman) underwent HPV DNA testing. Samples were classified as HR-HPV+ with detection of at least one HR-HPV or probable HR-HPV type. Of 734 women included, 722 had complete HPV data. HR-HPV was detected in 20.9% of ccc-LIQ samples. Estimated sensitivity and specificity to detect HR-HPV in vsc-DRY samples were 88.7% and 92.5%, respectively, and in vsc-LIQ samples, 87.4% and 90.9%. Cytology findings were abnormal for 79 women (10.9%): among 27 samples of low-grade squamous intraepithelial lesions, 25 were HR-HPV+ in vsc-DRY, vsc-LIQ and ccc-LIQ samples. Among 6 samples of high-grade squamous intraepithelial lesions, all were HR-HPV+ in vsc-DRY samples, 1 was HR-HPV- in vsc-LIQ samples and 1 was HR-HPV- in ccc-LIQ samples. Vaginal self-sampling with a dry swab is accurate to detect HR-HPV infection as compared with cervical clinician-collection and accurate as compared with cytology results. This cheap and easy-to-ship sampling method could be widely used in a cervical cancer screening program. Copyright © 2014 Elsevier Inc. All rights reserved.

Method and apparatus for detecting gem-polyhalogenated hydrocarbons

DOEpatents

Anderson, deceased, William G.; Anderson, legal representative, Johanna S.

1990-01-01

A method and optrode for detecting gem polyhalogenated hydrocarbons in a sample fluid based on a single phase Fujiwara reaction as provided. The method comprises contacting a reaction mixture with a sample fluid which contains the gem-polyhalogenated hydrocarbons. The reaction mixture comprises an aqueous solution of pyridine or derivative thereof and a hindered nitrogen base. Upon contact a fluorescent and/or chromgenic reaction product forms whose fluorescence and/or absorbance is related to the concentration of gem-polyhalogenated hydrocarbons in the sample fluid.

Detection of linkage between a quantitative trait and a marker locus by the lod score method: sample size and sampling considerations.

PubMed

Demenais, F; Lathrop, G M; Lalouel, J M

1988-07-01

A simulation study is here conducted to measure the power of the lod score method to detect linkage between a quantitative trait and a marker locus in various situations. The number of families necessary to detect such linkage with 80% power is assessed for different sets of parameters at the trait locus and different values of the recombination fraction. The effects of varying the mode of sampling families and the sibship size are also evaluated.

A New Sampling Strategy for the Detection of Fecal Bacteria Integrated with USEPA Method 1622/1623

EPA Science Inventory

USEPA Method 1622/1623 requires the concentration of Cryptosporidium and Giardia from 10 liters of water samples prior to detection. During this process the supernatant is discarded because it is assumed that most protozoa are retained in the filtration and centrifugation steps....

Method for nucleic acid isolation using supercritical fluids

DOEpatents

Nivens, David E.; Applegate, Bruce M.

1999-01-01

A method for detecting the presence of a microorganism in an environmental sample involves contacting the sample with a supercritical fluid to isolate nucleic acid from the microorganism, then detecting the presence of a particular sequence within the isolated nucleic acid. The nucleic acid may optionally be subjected to further purification.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

Pesticides in Water and Suspended Sediment of the Alamo and New Rivers, Imperial Valley/Salton Sea Basin, California, 2006-2007

USGS Publications Warehouse

Orlando, James L.; Smalling, Kelly L.; Kuivila, Kathryn

2008-01-01

Water and suspended-sediment samples were collected at eight sites on the Alamo and New Rivers in the Imperial Valley/Salton Sea Basin of California and analyzed for both current-use and organochlorine pesticides by the U.S. Geological Survey. Samples were collected in the fall of 2006 and spring of 2007, corresponding to the seasons of greatest pesticide use in the basin. Large-volume water samples (up to 650 liters) were collected at each site and processed using a flow-through centrifuge to isolate suspended sediments. One-liter water samples were collected from the effluent of the centrifuge for the analysis of dissolved pesticides. Additional samples were collected for analysis of dissolved organic carbon and for suspended-sediment concentrations. Water samples were analyzed for a suite of 61 current-use and organochlorine pesticides using gas chromatography/mass spectrometry. A total of 25 pesticides were detected in the water samples, with seven pesticides detected in more than half of the samples. Dissolved concentrations of pesticides observed in this study ranged from below their respective method detection limits to 8,940 nanograms per liter (EPTC). The most frequently detected compounds in the water samples were chlorpyrifos, DCPA, EPTC, and trifluralin, which were observed in more than 75 percent of the samples. The maximum concentrations of most pesticides were detected in samples from the Alamo River. Maximum dissolved concentrations of carbofuran, chlorpyrifos, diazinon, and malathion exceeded aquatic life benchmarks established by the U.S. Environmental Protection Agency for these pesticides. Suspended sediments were analyzed for 87 current-use and organochlorine pesticides using microwave-assisted extraction, gel permeation chromatography for sulfur removal, and either carbon/alumina stacked solid-phase extraction cartridges or deactivated Florisil for removal of matrix interferences. Twenty current-use pesticides were detected in the suspended-sediment samples, including pyrethroid insecticides and fungicides. Fourteen legacy organochlorine pesticides also were detected in the suspended-sediment samples. Greater numbers of current-use and organochlorine pesticides were observed in the Alamo River samples in comparison with the New River samples. Maximum concentrations of current-use pesticides in suspended-sediment samples ranged from below their method detection limits to 174 micrograms per kilogram (pendimethalin). Most organochlorine pesticides were detected at or below their method detection limits, with the exception of p,p'-DDE, which had a maximum concentration of 54.2 micrograms per kilogram. The most frequently detected current-use pesticides in the suspended-sediment samples were chlorpyrifos, permethrin, tetraconazole, and trifluralin, which were observed in more than 83 percent of the samples. The organochlorine degradates p,p'-DDD and p,p'-DDE were detected in all suspended-sediment samples.

Detection of Salmonella enterica in Meat in Less than 5 Hours by a Low-Cost and Noncomplex Sample Preparation Method

PubMed Central

Hoorfar, J.; Hansen, F.; Christensen, J.; Mansdal, S.; Josefsen, M. H.

2016-01-01

ABSTRACT Salmonella is recognized as one of the most important foodborne bacteria and has wide health and socioeconomic impacts worldwide. Fresh pork meat is one of the main sources of Salmonella, and efficient and fast methods for detection are therefore necessary. Current methods for Salmonella detection in fresh meat usually include >16 h of culture enrichment, in a few cases <12 h, thus requiring at least two working shifts. Here, we report a rapid (<5 h) and high-throughput method for screening of Salmonella in samples from fresh pork meat, consisting of a 3-h enrichment in standard buffered peptone water and a real-time PCR-compatible sample preparation method based on filtration, centrifugation, and enzymatic digestion, followed by fast-cycling real-time PCR detection. The method was validated in an unpaired comparative study against the Nordic Committee on Food Analysis (NMKL) reference culture method 187. Pork meat samples (n = 140) were either artificially contaminated with Salmonella at 0, 1 to 10, or 10 to 100 CFU/25 g of meat or naturally contaminated. Cohen's kappa for the degree of agreement between the rapid method and the reference was 0.64, and the relative accuracy, sensitivity, and specificity for the rapid method were 81.4, 95.1, and 97.9%, respectively. The 50% limit of detections (LOD50s) were 8.8 CFU/25 g for the rapid method and 7.7 CFU/25 g for the reference method. Implementation of this method will enable faster release of Salmonella low-risk meat, providing savings for meat producers, and it will help contribute to improved food safety. IMPORTANCE While the cost of analysis and hands-on time of the presented rapid method were comparable to those of reference culture methods, the fast product release by this method can provide the meat industry with a competitive advantage. Not only will the abattoirs save costs for work hours and cold storage, but consumers and retailers will also benefit from fresher meat with a longer shelf life. Furthermore, the presented sample preparation might be adjusted for application in the detection of other pathogenic bacteria in different sample types. PMID:27986726

Detection of Salmonella enterica in Meat in Less than 5 Hours by a Low-Cost and Noncomplex Sample Preparation Method.

PubMed

Fachmann, M S R; Löfström, C; Hoorfar, J; Hansen, F; Christensen, J; Mansdal, S; Josefsen, M H

2017-03-01

Salmonella is recognized as one of the most important foodborne bacteria and has wide health and socioeconomic impacts worldwide. Fresh pork meat is one of the main sources of Salmonella , and efficient and fast methods for detection are therefore necessary. Current methods for Salmonella detection in fresh meat usually include >16 h of culture enrichment, in a few cases <12 h, thus requiring at least two working shifts. Here, we report a rapid (<5 h) and high-throughput method for screening of Salmonella in samples from fresh pork meat, consisting of a 3-h enrichment in standard buffered peptone water and a real-time PCR-compatible sample preparation method based on filtration, centrifugation, and enzymatic digestion, followed by fast-cycling real-time PCR detection. The method was validated in an unpaired comparative study against the Nordic Committee on Food Analysis (NMKL) reference culture method 187. Pork meat samples ( n = 140) were either artificially contaminated with Salmonella at 0, 1 to 10, or 10 to 100 CFU/25 g of meat or naturally contaminated. Cohen's kappa for the degree of agreement between the rapid method and the reference was 0.64, and the relative accuracy, sensitivity, and specificity for the rapid method were 81.4, 95.1, and 97.9%, respectively. The 50% limit of detections (LOD 50 s) were 8.8 CFU/25 g for the rapid method and 7.7 CFU/25 g for the reference method. Implementation of this method will enable faster release of Salmonella low-risk meat, providing savings for meat producers, and it will help contribute to improved food safety. IMPORTANCE While the cost of analysis and hands-on time of the presented rapid method were comparable to those of reference culture methods, the fast product release by this method can provide the meat industry with a competitive advantage. Not only will the abattoirs save costs for work hours and cold storage, but consumers and retailers will also benefit from fresher meat with a longer shelf life. Furthermore, the presented sample preparation might be adjusted for application in the detection of other pathogenic bacteria in different sample types. Copyright © 2017 American Society for Microbiology.

An optical biosensor for detection of pathogen biomarkers from Shiga toxin-producing Escherichia coli in ground beef samples

NASA Astrophysics Data System (ADS)

Lamoureux, Loreen; Adams, Peter; Banisadr, Afsheen; Stromberg, Zachary; Graves, Steven; Montano, Gabriel; Moxley, Rodney; Mukundan, Harshini

2014-03-01

Shiga toxin-producing Escherichia coli (STEC) poses a serious threat to human health through the consumption of contaminated food products, particularly beef and produce. Early detection in the food chain, and discrimination from other non-pathogenic Escherichia coli (E. coli), is critical to preventing human outbreaks, and meeting current agricultural screening standards. These pathogens often present in low concentrations in contaminated samples, making discriminatory detection difficult without the use of costly, time-consuming methods (e.g. culture). Using multiple signal transduction schemes (including novel optical methods designed for amphiphiles), specific recognition antibodies, and a waveguide-based optical biosensor developed at Los Alamos National Laboratory, we have developed ultrasensitive detection methods for lipopolysaccharides (LPS), and protein biomarkers (Shiga toxin) of STEC in complex samples (e.g. beef lysates). Waveguides functionalized with phospholipid bilayers were used to pull down amphiphilic LPS, using methods (membrane insertion) developed by our team. The assay format exploits the amphiphilic biochemistry of lipoglycans, and allows for rapid, sensitive detection with a single fluorescent reporter. We have used a combination of biophysical methods (atomic force and fluorescence microscopy) to characterize the interaction of amphiphiles with lipid bilayers, to efficiently design these assays. Sandwich immunoassays were used for detection of protein toxins. Biomarkers were spiked into homogenated ground beef samples to determine performance and limit of detection. Future work will focus on the development of discriminatory antibodies for STEC serotypes, and using quantum dots as the fluorescence reporter to enable multiplex screening of biomarkers.

Melamine detection in infant formula powder using near- and mid-infrared spectroscopy.

PubMed

Mauer, Lisa J; Chernyshova, Alona A; Hiatt, Ashley; Deering, Amanda; Davis, Reeta

2009-05-27

Near- and mid-infrared spectroscopy methods (NIR, FTIR-ATR, FTIR-DRIFT) were evaluated for the detection and quantification of melamine in infant formula powder. Partial least-squares (PLS) models were established for correlating spectral data to melamine concentration: R(2) > 0.99, RMSECV ≤ 0.9, and RPD ≥ 12. Factorization analysis of spectra was able to differentiate unadulterated infant formula powder from samples containing 1 ppm melamine with no misclassifications, a confidence level of 99.99%, and selectivity > 2. These nondestructive methods require little or no sample preparation. The NIR method has an assay time of 1 min, and a 2 min total time to detection. The FTIR methods require up to 5 min for melamine detection. Therefore, NIR and FTIR methods enable rapid detection of 1 ppm melamine in infant formula powder.

Diagnostic accuracy and cost-effectiveness of alternative methods for detection of soil-transmitted helminths in a post-treatment setting in western Kenya.

PubMed

Assefa, Liya M; Crellen, Thomas; Kepha, Stella; Kihara, Jimmy H; Njenga, Sammy M; Pullan, Rachel L; Brooker, Simon J

2014-05-01

This study evaluates the diagnostic accuracy and cost-effectiveness of the Kato-Katz and Mini-FLOTAC methods for detection of soil-transmitted helminths (STH) in a post-treatment setting in western Kenya. A cost analysis also explores the cost implications of collecting samples during school surveys when compared to household surveys. Stool samples were collected from children (n = 652) attending 18 schools in Bungoma County and diagnosed by the Kato-Katz and Mini-FLOTAC coprological methods. Sensitivity and additional diagnostic performance measures were analyzed using Bayesian latent class modeling. Financial and economic costs were calculated for all survey and diagnostic activities, and cost per child tested, cost per case detected and cost per STH infection correctly classified were estimated. A sensitivity analysis was conducted to assess the impact of various survey parameters on cost estimates. Both diagnostic methods exhibited comparable sensitivity for detection of any STH species over single and consecutive day sampling: 52.0% for single day Kato-Katz; 49.1% for single-day Mini-FLOTAC; 76.9% for consecutive day Kato-Katz; and 74.1% for consecutive day Mini-FLOTAC. Diagnostic performance did not differ significantly between methods for the different STH species. Use of Kato-Katz with school-based sampling was the lowest cost scenario for cost per child tested ($10.14) and cost per case correctly classified ($12.84). Cost per case detected was lowest for Kato-Katz used in community-based sampling ($128.24). Sensitivity analysis revealed the cost of case detection for any STH decreased non-linearly as prevalence rates increased and was influenced by the number of samples collected. The Kato-Katz method was comparable in diagnostic sensitivity to the Mini-FLOTAC method, but afforded greater cost-effectiveness. Future work is required to evaluate the cost-effectiveness of STH surveillance in different settings.

Evaluation of Targeted Next-Generation Sequencing for Detection of Bovine Pathogens in Clinical Samples.

PubMed

Anis, Eman; Hawkins, Ian K; Ilha, Marcia R S; Woldemeskel, Moges W; Saliki, Jeremiah T; Wilkes, Rebecca P

2018-07-01

The laboratory diagnosis of infectious diseases, especially those caused by mixed infections, is challenging. Routinely, it requires submission of multiple samples to separate laboratories. Advances in next-generation sequencing (NGS) have provided the opportunity for development of a comprehensive method to identify infectious agents. This study describes the use of target-specific primers for PCR-mediated amplification with the NGS technology in which pathogen genomic regions of interest are enriched and selectively sequenced from clinical samples. In the study, 198 primers were designed to target 43 common bovine and small-ruminant bacterial, fungal, viral, and parasitic pathogens, and a bioinformatics tool was specifically constructed for the detection of targeted pathogens. The primers were confirmed to detect the intended pathogens by testing reference strains and isolates. The method was then validated using 60 clinical samples (including tissues, feces, and milk) that were also tested with other routine diagnostic techniques. The detection limits of the targeted NGS method were evaluated using 10 representative pathogens that were also tested by quantitative PCR (qPCR), and the NGS method was able to detect the organisms from samples with qPCR threshold cycle ( C T ) values in the 30s. The method was successful for the detection of multiple pathogens in the clinical samples, including some additional pathogens missed by the routine techniques because the specific tests needed for the particular organisms were not performed. The results demonstrate the feasibility of the approach and indicate that it is possible to incorporate NGS as a diagnostic tool in a cost-effective manner into a veterinary diagnostic laboratory. Copyright © 2018 Anis et al.

Surveying drainage culvert use by carnivores: sampling design and cost-benefit analyzes of track-pads vs. video-surveillance methods.

PubMed

Mateus, Ana Rita A; Grilo, Clara; Santos-Reis, Margarida

2011-10-01

Environmental assessment studies often evaluate the effectiveness of drainage culverts as habitat linkages for species, however, the efficiency of the sampling designs and the survey methods are not known. Our main goal was to estimate the most cost-effective monitoring method for sampling carnivore culvert using track-pads and video-surveillance. We estimated the most efficient (lower costs and high detection success) interval between visits (days) when using track-pads and also determined the advantages of using each method. In 2006, we selected two highways in southern Portugal and sampled 15 culverts over two 10-day sampling periods (spring and summer). Using the track-pad method, 90% of the animal tracks were detected using a 2-day interval between visits. We recorded a higher number of crossings for most species using video-surveillance (n = 129) when compared with the track-pad technique (n = 102); however, the detection ability using the video-surveillance method varied with type of structure and species. More crossings were detected in circular culverts (1 m and 1.5 m diameter) than in box culverts (2 m to 4 m width), likely because video cameras had a reduced vision coverage area. On the other hand, carnivore species with small feet such as the common genet Genetta genetta were detected less often using the track-pad surveying method. The cost-benefit analyzes shows that the track-pad technique is the most appropriate technique, but video-surveillance allows year-round surveys as well as the behavior response analyzes of species using crossing structures.

Determination of acaricide residues in saudi arabian honey and beeswax using solid phase extraction and gas chromatography.

PubMed

Kamel, Alaa; Al-Ghamdi, Ahmad

2006-01-01

Determination of acaricide residues of flumethrin, tau-fluvalinate, coumaphos, and amitraz in honey and beeswax was carried out using a rapid extraction method utilizing C-18 SPE cartridges and an analytical method utilizing GC with ECD, NPD, and MSD detectors for the four acaricides. Recovery percentages from the extraction method ranged from 90-102%, while the minimum detection levels ranged from 0.01-0.05 mg/kg for the acaricides. Nine of the 21 analyzed samples were found to be contaminated with the acaricides tau-fluvalinate and coumaphos. Neither flumethrin nor amitraz was detected in any of the honey or wax samples. Coumaphos was found only in honey samples in which two samples exceeded the tolerance levels set by EPA and EC regulations. It has not been detected in beeswax. Five honey samples and eight beeswax samples were found to be contaminated with tau-fluvalinate. One of the wax samples was contaminated with a relatively high residue of tau-fluvalinate and contained above 10 mg/kg.

A critical evaluation of a flow cytometer used for detecting enterococci in recreational waters.

PubMed

King, Dawn N; Brenner, Kristen P; Rodgers, Mark R

2007-06-01

The current U. S. Environmental Protection Agency-approved method for enterococci (Method 1600) in recreational water is a membrane filter (MF) method that takes 24 hours to obtain results. If the recreational water is not in compliance with the standard, the risk of exposure to enteric pathogens may occur before the water is identified as hazardous. Because flow cytometry combined with specific fluorescent antibodies has the potential to be used as a rapid detection method for microorganisms, this technology was evaluated as a rapid, same-day method to detect enterococci in bathing beach waters. The flow cytometer chosen for this study was a laser microbial detection system designed to detect labeled antibodies. A comparison of MF counts with flow cytometry counts of enterococci in phosphate buffer and sterile-filtered recreational water showed good agreement between the two methods. However, when flow cytometry was used, the counts were several orders of magnitude higher than the MF counts with no correlation to Enterococcus spike concentrations. The unspiked sample controls frequently had higher counts than the samples spiked with enterococci. Particles within the spiked water samples were probably counted as target cells by the flow cytometer because of autofluorescence or non-specific adsorption of antibody and carryover to subsequent samples. For these reasons, this technology may not be suitable for enterococci detection in recreational waters. Improvements in research and instrument design that will eliminate high background and carryover may make this a viable technology in the

A validated multianalyte LC-MS/MS method for quantification of 25 mycotoxins in cassava flour, peanut cake and maize samples.

PubMed

Ediage, Emmanuel Njumbe; Di Mavungu, José Diana; Monbaliu, Sofie; Van Peteghem, Carlos; De Saeger, Sarah

2011-05-25

This study was designed to develop a sensitive liquid chromatography tandem mass spectrometry (LC-MS/MS) method for the simultaneous detection and quantification of 25 mycotoxins in cassava flour, peanut cake and maize samples with particular focus on the optimization of the sample preparation protocol and method validation. All 25 mycotoxins were extracted in a single step with a mixture of methanol/ethyl acetate/water (70:20:10, v/v/v). The method limits of quantification (LOQ) varied from 0.3 μg/kg to 106 μg/kg. Good precision and linearity were observed for most of the mycotoxins. The method was applied for the analysis of naturally contaminated peanut cake, cassava flour and maize samples from the Republic of Benin. All samples analyzed (fifteen peanut cakes, four maize flour and four cassava flour samples) tested positive for one or more mycotoxins. Aflatoxins (total aflatoxins; 10-346 μg/kg) and ochratoxin A (

Enhanced Detection of Surface-Associated Bacteria in Indoor Environments by Quantitative PCR

PubMed Central

Buttner, Mark P.; Cruz-Perez, Patricia; Stetzenbach, Linda D.

2001-01-01

Methods for detecting microorganisms on surfaces are needed to locate biocontamination sources and to relate surface and airborne concentrations. Research was conducted in an experimental room to evaluate surface sampling methods and quantitative PCR (QPCR) for enhanced detection of a target biocontaminant present on flooring materials. QPCR and culture analyses were used to quantitate Bacillus subtilis (Bacillus globigii) endospores on vinyl tile, commercial carpet, and new and soiled residential carpet with samples obtained by four surface sampling methods: a swab kit, a sponge swipe, a cotton swab, and a bulk method. The initial data showed that greater overall sensitivity was obtained with the QPCR than with culture analysis; however, the QPCR results for bulk samples from residential carpet were negative. The swab kit and the sponge swipe methods were then tested with two levels of background biological contamination consisting of Penicillium chrysogenum spores. The B. subtilis values obtained by the QPCR method were greater than those obtained by culture analysis. The differences between the QPCR and culture data were significant for the samples obtained with the swab kit for all flooring materials except soiled residential carpet and with the sponge swipe for commercial carpet. The QPCR data showed that there were no significant differences between the swab kit and sponge swipe sampling methods for any of the flooring materials. Inhibition of QPCR due solely to biological contamination of flooring materials was not evident. However, some degree of inhibition was observed with the soiled residential carpet, which may have been caused by the presence of abiotic contaminants, alone or in combination with biological contaminants. The results of this research demonstrate the ability of QPCR to enhance detection and enumeration of biocontaminants on surface materials and provide information concerning the comparability of currently available surface sampling methods. PMID:11375164

Occurrence of pesticides in surface water and sediments from three central California coastal watersheds, 2008-2009

USGS Publications Warehouse

Smalling, Kelly L.; Orlando, James L.

2011-01-01

Water and sediment (bed and suspended) were collected from January 2008 through October 2009 from 12 sites in 3 of the largest watersheds along California's Central Coast (Pajaro, Salinas, and Santa Maria Rivers) and analyzed for a suite of pesticides by the U.S. Geological Survey. Water samples were collected in each watershed from the estuaries and major tributaries during 4 storm events and 11 dry season sampling events in 2008 and 2009. Bed sediments were collected from depositional zones at the tributary sampling sites three times over the course of the study. Suspended sediment samples were collected from the major tributaries during the four storm events and in the tributaries and estuaries during three dry season sampling events in 2009. Water samples were analyzed for 68 pesticides using gas chromatography/mass spectrometry. A total of 38 pesticides were detected in 144 water samples, and 13 pesticides were detected in more than half the samples collected over the course of the study. Dissolved pesticide concentrations ranged from below their method detection limits to 36,000 nanograms per liter (boscalid). The most frequently detected pesticides in water from all the watersheds were azoxystrobin, boscalid, chlorpyrifos, DCPA, diazinon, oxyfluorfen, prometryn, and propyzamide, which were found in more than 80 percent of the samples. On average, detection frequencies and concentrations were higher in samples collected during winter storm events compared to the summer dry season. With the exception of the fungicide, myclobutanil, the Santa Maria estuary watershed exhibited higher pesticide detection frequencies than the Pajaro and Salinas watersheds. Bed and suspended sediment samples were analyzed for 55 pesticides using accelerated solvent extraction, gel permeation chromatography for sulfur removal, and carbon/alumina stacked solid-phase extraction cartridges to remove interfering sediment matrices. In bed sediment samples, 17 pesticides were detected including pyrethroid and organophosphate (OP) insecticides, p,p'-DDT and its degradates, as well as several herbicides. The only pesticides detected more than half the time were p,p'-DDD, p,p'-DDE, and p,p'-DDT. Maximum pesticide concentrations ranged from less than their respective method detection limits to 234 micrograms per kilogram (p,p'-DDE). Four pyrethroids (bifenthrin, &# 955;-cyhalothrin, permethrin, and &# 964;-fluvalinate) were detected in bed sediment samples, though concentrations were relatively low (less than 10 microgram per kilogram). The greatest number of pesticides were detected in samples collected from Lower Orcutt Creek, the major tributary to the Santa Maria estuary. In suspended sediment samples, 19 pesticides were detected, and maximum concentrations ranged from less than the method detection limits to 549 micrograms per kilogram (chlorpyrifos). The most frequently detected pesticides were p,p'-DDE (49 percent), p,p'-DDT (38 percent), and chlorpyrifos (32 percent). During storm events, 19 pesticides were detected in suspended sediment samples compared to 10 detected during the dry season. Pesticide concentrations commonly were higher in suspended sediments during storm events than during the dry season, as well.

Improved Method for the Detection and Quantification of Naegleria fowleri in Water and Sediment Using Immunomagnetic Separation and Real-Time PCR

PubMed Central

Mull, Bonnie J.; Narayanan, Jothikumar; Hill, Vincent R.

2013-01-01

Primary amebic meningoencephalitis (PAM) is a rare and typically fatal infection caused by the thermophilic free-living ameba, Naegleria fowleri. In 2010, the first confirmed case of PAM acquired in Minnesota highlighted the need for improved detection and quantification methods in order to study the changing ecology of N. fowleri and to evaluate potential risk factors for increased exposure. An immunomagnetic separation (IMS) procedure and real-time PCR TaqMan assay were developed to recover and quantify N. fowleri in water and sediment samples. When one liter of lake water was seeded with N. fowleri strain CDC:V212, the method had an average recovery of 46% and detection limit of 14 amebas per liter of water. The method was then applied to sediment and water samples with unknown N. fowleri concentrations, resulting in positive direct detections by real-time PCR in 3 out of 16 samples and confirmation of N. fowleri culture in 6 of 16 samples. This study has resulted in a new method for detection and quantification of N. fowleri in water and sediment that should be a useful tool to facilitate studies of the physical, chemical, and biological factors associated with the presence and dynamics of N. fowleri in environmental systems. PMID:24228172

Effects of sampling strategy, detection probability, and independence of counts on the use of point counts

USGS Publications Warehouse

Pendleton, G.W.; Ralph, C. John; Sauer, John R.; Droege, Sam

1995-01-01

Many factors affect the use of point counts for monitoring bird populations, including sampling strategies, variation in detection rates, and independence of sample points. The most commonly used sampling plans are stratified sampling, cluster sampling, and systematic sampling. Each of these might be most useful for different objectives or field situations. Variation in detection probabilities and lack of independence among sample points can bias estimates and measures of precision. All of these factors should be con-sidered when using point count methods.

IAEA Sampling Plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geist, William H.

2017-09-15

The objectives for this presentation are to describe the method that the IAEA uses to determine a sampling plan for nuclear material measurements; describe the terms detection probability and significant quantity; list the three nuclear materials measurement types; describe the sampling method applied to an item facility; and describe multiple method sampling.

Quantification of Protozoa and Viruses from Small Water Volumes

PubMed Central

Bonilla, J. Alfredo; Bonilla, Tonya D.; Abdelzaher, Amir M.; Scott, Troy M.; Lukasik, Jerzy; Solo-Gabriele, Helena M.; Palmer, Carol J.

2015-01-01

Large sample volumes are traditionally required for the analysis of waterborne pathogens. The need for large volumes greatly limits the number of samples that can be processed. The goals of this study were to compare extraction and detection procedures for quantifying protozoan parasites and viruses from small volumes of marine water. The intent was to evaluate a logistically simpler method of sample collection and processing that would facilitate direct pathogen measures as part of routine monitoring programs. Samples were collected simultaneously using a bilayer device with protozoa capture by size (top filter) and viruses capture by charge (bottom filter). Protozoan detection technologies utilized for recovery of Cryptosporidium spp. and Giardia spp. were qPCR and the more traditional immunomagnetic separation—IFA-microscopy, while virus (poliovirus) detection was based upon qPCR versus plaque assay. Filters were eluted using reagents consistent with the downstream detection technologies. Results showed higher mean recoveries using traditional detection methods over qPCR for Cryptosporidium (91% vs. 45%) and poliovirus (67% vs. 55%) whereas for Giardia the qPCR-based methods were characterized by higher mean recoveries (41% vs. 28%). Overall mean recoveries are considered high for all detection technologies. Results suggest that simultaneous filtration may be suitable for isolating different classes of pathogens from small marine water volumes. More research is needed to evaluate the suitability of this method for detecting pathogens at low ambient concentration levels. PMID:26114244

Quantification of Protozoa and Viruses from Small Water Volumes.

PubMed

Bonilla, J Alfredo; Bonilla, Tonya D; Abdelzaher, Amir M; Scott, Troy M; Lukasik, Jerzy; Solo-Gabriele, Helena M; Palmer, Carol J

2015-06-24

Large sample volumes are traditionally required for the analysis of waterborne pathogens. The need for large volumes greatly limits the number of samples that can be processed. The aims of this study were to compare extraction and detection procedures for quantifying protozoan parasites and viruses from small volumes of marine water. The intent was to evaluate a logistically simpler method of sample collection and processing that would facilitate direct pathogen measures as part of routine monitoring programs. Samples were collected simultaneously using a bilayer device with protozoa capture by size (top filter) and viruses capture by charge (bottom filter). Protozoan detection technologies utilized for recovery of Cryptosporidium spp. and Giardia spp. were qPCR and the more traditional immunomagnetic separation-IFA-microscopy, while virus (poliovirus) detection was based upon qPCR versus plaque assay. Filters were eluted using reagents consistent with the downstream detection technologies. Results showed higher mean recoveries using traditional detection methods over qPCR for Cryptosporidium (91% vs. 45%) and poliovirus (67% vs. 55%) whereas for Giardia the qPCR-based methods were characterized by higher mean recoveries (41% vs. 28%). Overall mean recoveries are considered high for all detection technologies. Results suggest that simultaneous filtration may be suitable for isolating different classes of pathogens from small marine water volumes. More research is needed to evaluate the suitability of this method for detecting pathogens at low ambient concentration levels.

Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori

PubMed Central

Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

2016-01-01

AIM: To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). METHODS: The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. RESULTS: The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. CONCLUSION: The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori. PMID:27433095

Rapid detection methods for viable Mycobacterium avium subspecies paratuberculosis in milk and cheese.

PubMed

Botsaris, George; Slana, Iva; Liapi, Maria; Dodd, Christine; Economides, Constantinos; Rees, Catherine; Pavlik, Ivo

2010-07-31

Mycobacterium avium subsp. paratuberculosis (MAP) may have a role in the development of Crohn's disease in humans via the consumption of contaminated milk and milk products. Detection of MAP from milk and dairy products has been reported from countries on the European continent, Argentina, the UK and Australia. In this study three different methods (quantitative real time PCR, combined phage IS900 PCR and conventional cultivation) were used to detect the presence of MAP in bulk tank milk (BTM) and cheese originating from sheep, goat and mixed milks from farms and products in Cyprus. During the first survey the presence of MAP was detected in 63 (28.6%) of cows' BTM samples by quantitative real time PCR. A second survey of BTM used a new combined phage IS900 PCR assay, and in this case MAP was detected in 50 (22.2%) samples showing a good level of agreement by both methods. None of the herds tested were known to be affected by Johne's disease and the presence of viable MAP was confirmed by conventional culture in only two cases of cows BTM. This suggests that either rapid method used is more sensitive than the conventional culture when testing raw milk samples for MAP. The two isolates recovered from BTM were identified by IS1311 PCR REA as cattle and sheep strains, respectively. In contrast when cheese samples were tested, MAP DNA was detected by quantitative real time PCR in seven (25.0%) samples (n=28). However no viable MAP was detected when either the combined phage IS900 PCR or conventional culture methods were used. Copyright 2010 Elsevier B.V. All rights reserved.

A new comprehensive method for detection of livestock-related pathogenic viruses using a target enrichment system.

PubMed

Oba, Mami; Tsuchiaka, Shinobu; Omatsu, Tsutomu; Katayama, Yukie; Otomaru, Konosuke; Hirata, Teppei; Aoki, Hiroshi; Murata, Yoshiteru; Makino, Shinji; Nagai, Makoto; Mizutani, Tetsuya

2018-01-08

We tested usefulness of a target enrichment system SureSelect, a comprehensive viral nucleic acid detection method, for rapid identification of viral pathogens in feces samples of cattle, pigs and goats. This system enriches nucleic acids of target viruses in clinical/field samples by using a library of biotinylated RNAs with sequences complementary to the target viruses. The enriched nucleic acids are amplified by PCR and subjected to next generation sequencing to identify the target viruses. In many samples, SureSelect target enrichment method increased efficiencies for detection of the viruses listed in the biotinylated RNA library. Furthermore, this method enabled us to determine nearly full-length genome sequence of porcine parainfluenza virus 1 and greatly increased Breadth, a value indicating the ratio of the mapping consensus length in the reference genome, in pig samples. Our data showed usefulness of SureSelect target enrichment system for comprehensive analysis of genomic information of various viruses in field samples. Copyright © 2017 Elsevier Inc. All rights reserved.

Sampling methods, dispersion patterns, and fixed precision sequential sampling plans for western flower thrips (Thysanoptera: Thripidae) and cotton fleahoppers (Hemiptera: Miridae) in cotton.

PubMed

Parajulee, M N; Shrestha, R B; Leser, J F

2006-04-01

A 2-yr field study was conducted to examine the effectiveness of two sampling methods (visual and plant washing techniques) for western flower thrips, Frankliniella occidentalis (Pergande), and five sampling methods (visual, beat bucket, drop cloth, sweep net, and vacuum) for cotton fleahopper, Pseudatomoscelis seriatus (Reuter), in Texas cotton, Gossypium hirsutum (L.), and to develop sequential sampling plans for each pest. The plant washing technique gave similar results to the visual method in detecting adult thrips, but the washing technique detected significantly higher number of thrips larvae compared with the visual sampling. Visual sampling detected the highest number of fleahoppers followed by beat bucket, drop cloth, vacuum, and sweep net sampling, with no significant difference in catch efficiency between vacuum and sweep net methods. However, based on fixed precision cost reliability, the sweep net sampling was the most cost-effective method followed by vacuum, beat bucket, drop cloth, and visual sampling. Taylor's Power Law analysis revealed that the field dispersion patterns of both thrips and fleahoppers were aggregated throughout the crop growing season. For thrips management decision based on visual sampling (0.25 precision), 15 plants were estimated to be the minimum sample size when the estimated population density was one thrips per plant, whereas the minimum sample size was nine plants when thrips density approached 10 thrips per plant. The minimum visual sample size for cotton fleahoppers was 16 plants when the density was one fleahopper per plant, but the sample size decreased rapidly with an increase in fleahopper density, requiring only four plants to be sampled when the density was 10 fleahoppers per plant. Sequential sampling plans were developed and validated with independent data for both thrips and cotton fleahoppers.

Experimental and environmental factors affect spurious detection of ecological thresholds

USGS Publications Warehouse

Daily, Jonathan P.; Hitt, Nathaniel P.; Smith, David; Snyder, Craig D.

2012-01-01

Threshold detection methods are increasingly popular for assessing nonlinear responses to environmental change, but their statistical performance remains poorly understood. We simulated linear change in stream benthic macroinvertebrate communities and evaluated the performance of commonly used threshold detection methods based on model fitting (piecewise quantile regression [PQR]), data partitioning (nonparametric change point analysis [NCPA]), and a hybrid approach (significant zero crossings [SiZer]). We demonstrated that false detection of ecological thresholds (type I errors) and inferences on threshold locations are influenced by sample size, rate of linear change, and frequency of observations across the environmental gradient (i.e., sample-environment distribution, SED). However, the relative importance of these factors varied among statistical methods and between inference types. False detection rates were influenced primarily by user-selected parameters for PQR (τ) and SiZer (bandwidth) and secondarily by sample size (for PQR) and SED (for SiZer). In contrast, the location of reported thresholds was influenced primarily by SED. Bootstrapped confidence intervals for NCPA threshold locations revealed strong correspondence to SED. We conclude that the choice of statistical methods for threshold detection should be matched to experimental and environmental constraints to minimize false detection rates and avoid spurious inferences regarding threshold location.

Comparative Evaluation of Three Methods (Microscopic Examination, Direct Fluorescent Antibody Assay, and Immunochromatographic Method) for the Diagnosis of Giardia intestinalis From Stool Specimens.

PubMed

Karadam, Senem Yaman; Ertuğ, Sema; Ertabaklar, Hatice

2016-03-01

The aim of this study was to compare direct microscopic examination, direct fluorescent antibody assay (DFA), and the immunochromatographic method (IK) and identify the best suitable method for the diagnosis of Giardia intestinalis. In this study, 25 stool samples that had been diagnosed as being infected with G. intestinalis using the native-Lugol and/or formol-ethyl acetate concentration method and 25 non-parasite-infected samples (the control group) were examined. After microscopic examination of stools, they were kept at -20°C for examination using DFA and IK. Stool samples were studied using DFA (CeLLabs, Crypto/Giardia-Cel IF) and IK (RIDA QUICK, Cryptosporidium/Giardia Combi Dipstick), as per the manufacturers' instructions. In our study, using the DFA method, parasites were detected in all 25 stool samples in which G. intestinalis was diagnosed by direct microscopic examination. Using the IK method, a particular band indicative of the parasite was detected in 24 samples. No parasites were detected in all 25 samples in the control group. Thus, when direct microscopic examination is taken as reference, the senstivity and specificity of DFA for the diagnosis of G. intestinalis were found to be 100% each, while those of IK were found to be 96% and 100%, respectively.

[Detection of Cryptospordium spp. in environmental water samples by FTA-PCR].

PubMed

Zhang, Xiao-Ping; Zhu, Qian; He, Yan-Yan; Jiang, Li; Jiang, Shou-Fu

2011-02-01

To establish a FTA-polymeras chain reaction (FTA-PCR) method in detection of Cryptospordium spp. in different sources of water. The semi automated immunomagnetic separation (IMS) of Cryptospordium oocysts in environmental water samples was performed firstly, and then genomic DNA of Cryptospordium oocysts was extracted by FTA filters disk. Oligonucleotide primers were designed based on the DNA fragment of the 18 S rRNA gene from C. parvum. Plate DNA was amplified with primers in PCR. The control DNA samples from Toxoplasma gondii,Sarcocystis suihominis, Echinococcus granulosus, and Clonorchis sinensis were amplified simultaneously. All PCR products were detected by agar electrophoresis dyed with ethidium bromide. The 446 bp fragment of DNA was detected in all samples of C. parvum, C. andersoni, and C. baileyi, while it was not detected in control groups in laboratory. No positive samples were found from 10 samples collected from tape water in 5 districts of Shanghai City by FTA-PCR. Nine positive samples were detected totally from 70 different environmental water samples, there were 0 out of 15 samples from the source of tape water, 2 out of 25 from the Huangpu River, 5 out of 15 from rivers around the animal farmers, 1 out of 9 from output water of contaminating water treatment factory, 1 out of 6 from the out gate of living contaminating water. The 446 bp fragment was detected from all the amplified positive water samples. FTA-PCR is an efficient method for gene detection of Cryptospordium oocysts, which could be used in detection of environmental water samples. The contamination degree of Cryptospordium oocysts in the river water around animal farms is high.

[Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

PubMed

Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

2016-02-01

Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.

Surveying Europe's Only Cave-Dwelling Chordate Species (Proteus anguinus) Using Environmental DNA.

PubMed

Vörös, Judit; Márton, Orsolya; Schmidt, Benedikt R; Gál, Júlia Tünde; Jelić, Dušan

2017-01-01

In surveillance of subterranean fauna, especially in the case of rare or elusive aquatic species, traditional techniques used for epigean species are often not feasible. We developed a non-invasive survey method based on environmental DNA (eDNA) to detect the presence of the red-listed cave-dwelling amphibian, Proteus anguinus, in the caves of the Dinaric Karst. We tested the method in fifteen caves in Croatia, from which the species was previously recorded or expected to occur. We successfully confirmed the presence of P. anguinus from ten caves and detected the species for the first time in five others. Using a hierarchical occupancy model we compared the availability and detection probability of eDNA of two water sampling methods, filtration and precipitation. The statistical analysis showed that both availability and detection probability depended on the method and estimates for both probabilities were higher using filter samples than for precipitation samples. Combining reliable field and laboratory methods with robust statistical modeling will give the best estimates of species occurrence.

Millimeter-Wave Spectroscopy for Analytical Chemistry: Thermal Evolution of Low Volatility Impurities and Detection with a Fourier Transform Molecular Rotational Resonance Spectrometer (tev Ft-Mrr

NASA Astrophysics Data System (ADS)

Harris, Brent; Fields, Shelby S.; Neill, Justin L.; Pulliam, Robin; Muckle, Matt; Pate, Brooks

2016-06-01

Recent advances in Fourier transform millimeter-wave spectroscopy techniques have renewed the application reach of molecular rotational spectroscopy for analytical chemistry. We present a sampling method for sub ppm analysis of low volatility impurities by thermal evolution from solid powders using a millimeter-wave Fourier transform molecular rotational resonance (FT-MRR) spectrometer for detection. This application of FT-MRR is relevant to the manufacturing of safe oral pharmaceuticals. Low volatility impurities can be challenging to detect at 1 ppm levels with chromatographic techniques. One such example of a potentially mutagenic impurity is acetamide (v.p. 1 Torr at 40 C, m.p. 80 C). We measured the pure reference spectrum of acetamide by flowing the sublimated vapor pressure of acetamide crystals through the FT-MRR spectrometer. The spectrometer lower detection level (LDL) for a broadband (> 20 GHz, 10 min.) spectrum is 300 nTorr, 30 pmol, or 2 ng. For a 50 mg powder, perfect sample transfer efficiency can yield a w/w % detection limit of 35 ppb. We extended the sampling method for the acetamide reference measurement to an acetaminophen sample spiked with 5000 ppm acetamide in order to test the sample transfer efficiency when liberated from an pharmaceutical powder. A spectral reference matching algorithm detected the presence of several impurities including acetaldehyde, acetic acid, and acetonitrile that evolved at the melting point of acetaminophen, demonstrating the capability of FT-MRR for identification without a routine chemical standard. The method detection limit (MDL) without further development is less than 10 ppm w/w %. Resolved FT-MRR mixture spectra will be presented with a description of sampling methods.

Environmental DNA method for estimating salamander distribution in headwater streams, and a comparison of water sampling methods.

PubMed

Katano, Izumi; Harada, Ken; Doi, Hideyuki; Souma, Rio; Minamoto, Toshifumi

2017-01-01

Environmental DNA (eDNA) has recently been used for detecting the distribution of macroorganisms in various aquatic habitats. In this study, we applied an eDNA method to estimate the distribution of the Japanese clawed salamander, Onychodactylus japonicus, in headwater streams. Additionally, we compared the detection of eDNA and hand-capturing methods used for determining the distribution of O. japonicus. For eDNA detection, we designed a qPCR primer/probe set for O. japonicus using the 12S rRNA region. We detected the eDNA of O. japonicus at all sites (with the exception of one), where we also observed them by hand-capturing. Additionally, we detected eDNA at two sites where we were unable to observe individuals using the hand-capturing method. Moreover, we found that eDNA concentrations and detection rates of the two water sampling areas (stream surface and under stones) were not significantly different, although the eDNA concentration in the water under stones was more varied than that on the surface. We, therefore, conclude that eDNA methods could be used to determine the distribution of macroorganisms inhabiting headwater systems by using samples collected from the surface of the water.

Detection of tobacco-related biomarkers in urine samples by surface-enhanced Raman spectroscopy coupled with thin-layer chromatography.

PubMed

Huang, Rongfu; Han, Sungyub; Li, Xiao Sheryl

2013-08-01

The nicotine metabolites, cotinine and trans-3'-hydroxycotinine (3HC) are considered as superior biomarkers for identifying tobacco exposure. More importantly, the ratio of 3HC to cotinine is a good indicator to phenotype individuals for cytochrome P450 2A6 activity and to individualize pharmacotherapy for tobacco addiction. In this paper, a simple, robust and novel method based on surface-enhanced Raman spectroscopy coupled with thin-layer chromatography (TLC) was developed to directly quantify the biomarkers in human urine samples. This is the first time surface-enhanced Raman spectroscopy (SERS) was used to detect cotinine and 3HC in urine samples. The linear dynamic range for the detection of cotinine is from 40 nM to 8 μM while that of 3HC is from 1 μM to 15 μM. The detection limits are 10 nM and 0.2 μM for cotinine and 3HC, respectively. The proposed method was further validated by quantifying the concentration of both cotinine and 3HC in smokers' urine samples. This TLC-SERS method allows the direct detection of cotinine in the urine samples of both active and passive smokers and the detection of 3HC in smokers.

A novel method for sex determination by detecting the number of X chromosomes.

PubMed

Nakanishi, Hiroaki; Shojo, Hideki; Ohmori, Takeshi; Hara, Masaaki; Takada, Aya; Adachi, Noboru; Saito, Kazuyuki

2015-01-01

A novel method for sex determination, based on the detection of the number of X chromosomes, was established. Current methods, based on the detection of the Y chromosome, can directly identify an unknown sample as male, but female gender is determined indirectly, by not detecting the Y chromosome. Thus, a direct determination of female gender is important because the quality (e.g., fragmentation and amelogenin-Y null allele) of the Y chromosome DNA may lead to a false result. Thus, we developed a novel sex determination method by analyzing the number of X chromosomes using a copy number variation (CNV) detection technique (the comparative Ct method). In this study, we designed a primer set using the amelogenin-X gene without the CNV region as the target to determine the X chromosome copy number, to exclude the influence of the CNV region from the comparative Ct value. The number of X chromosomes was determined statistically using the CopyCaller software with real-time PCR. All DNA samples from participants (20 males, 20 females) were evaluated correctly using this method with 1-ng template DNA. A minimum of 0.2-ng template DNA was found to be necessary for accurate sex determination with this method. When using ultraviolet-irradiated template DNA, as mock forensic samples, the sex of the samples could not be determined by short tandem repeat (STR) analysis but was correctly determined using our method. Thus, we successfully developed a method of sex determination based on the number of X chromosomes. Our novel method will be useful in forensic practice for sex determination.

Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

PubMed Central

Mellerup, Anders; Ståhl, Marie

2015-01-01

The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same samples, and therefore differences in antibiotic resistance levels between samples were more readily detected. To our knowledge, this is the first study to describe sampling and pooling methods for qPCR quantification of antibiotic resistance genes in total DNA extracted from swine feces. PMID:26114765

Trace Level Determination of Polyether Ionophores in Feed

PubMed Central

Rokka, Mervi; Jestoi, Marika; Peltonen, Kimmo

2013-01-01

A liquid chromatography-mass spectrometric method was developed and validated to determine six polyether ionophores (lasalocid sodium, monensin sodium, salinomycin sodium, narasin, maduramicin ammonium alpha, and semduramicin sodium) in feed samples. The method developed was very straightforward, involving extraction with 84% acetonitrile of the coccidiostats from the feed samples and filtration of the raw extract prior to chromatographic analysis. Method validation included the determination of selectivity, linearity, specificity, repeatability, the limit of detection, limit of quantification, decision limit (CCα), detection capability (CCβ), and recovery. Feed samples from the Finnish national feed control programme and suspected carry-over samples from a feed manufacturer were analysed in parallel with an existing liquid chromatography method coupled with ultraviolet detection. All feed control samples were negative in LC-UV, but with the developed MS method, monensin, salinomycin, and narasin were detected at concentrations of <0.025–0.73 mg/kg, <0.025–0.027 mg/kg, and <0.025–1.6 mg/kg, respectively. In suspected carry-over samples after an output of 2.0 tonnes of unmedicated feed in the pelletizer line, the concentrations of monensin, salinomycin, and narasin varied from undetected to 16 mg/kg. In the mixer line, after 3.2 tonnes of unmedicated feed output, the concentrations of monensin, salinomycin, and narasin varied from undetected to 2.4 mg/kg. PMID:23484082

Traceability of sulfonamide antibiotic treatment by immunochemical analysis of farm animal hair samples.

PubMed

Adrian, Javier; Gratacós-Cubarsí, Marta; Sánchez-Baeza, Francisco; Garcia Regueiro, Jose-Antonio; Castellari, Massimo; Marco, M-Pilar

2009-10-01

The use of hair to trace use of unauthorized substances, therapeutic agents, or their misuse is becoming very attractive since residues can be detected for a long time after treatment. For this purpose, an indirect enzyme-linked immunosorbent assay (ELISA) has been evaluated for its capability to trace sulfonamide antibiotic treatment by analyzing cattle and pig hair samples. Pigmented and nonpigmented hair samples from control and sulfamethazine (SMZ)-treated pigs and calves were collected, extracted under different alkaline conditions, and analyzed by ELISA after just diluting the extracts with the assay buffer. Data analysis following the European recommendations for screening methods demonstrates that the ELISA can detect SMZ in hair samples with a limit of detection (90% of the zero dose (IC(90))) between 30 and 75 ng g(-1). The same samples have been analyzed by HPLC after a dual solid-phase extraction. The ELISA results matched very well those obtained by the chromatographic method, demonstrating that the immunochemical method can be used as a screening tool to trace animal treatments. Between the benefits of this method are the possibility to directly analyze hair extracts with sufficient detectability and its high-throughput capability. Preliminary validation data are reported using an experimental approach inspired on the Commission Decision 2002/657/EC criteria for screening methods.

Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

PubMed Central

Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

2014-01-01

Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727

Coupling corona discharge for ambient extractive ionization mass spectrometry.

PubMed

Hu, Bin; Zhang, Xinglei; Li, Ming; Peng, Xuejiao; Han, Jing; Yang, Shuiping; Ouyang, Yongzhong; Chen, Huanwen

2011-12-07

Unlike the extractive electrospray ionization (EESI) technique described elsewhere, a corona discharge instead of electrospray ionization has been utilized to charge a neutral solvent spray under ambient conditions for the generation of highly charged microdroplets, which impact a neutral sample plume for the extractive ionization of the analytes in raw samples without any sample pretreatment. Using the positive ion mode, molecular radical cations were easily generated for the detection of non-polar compounds (e.g., benzene, cyclohexane, etc.), while protonated molecular ions of polar compounds (e.g., acetonitrile, acetic ether) were readily produced for the detection. By dispensing the matrix in a relatively large space, this method tolerates highly complex matrices. For a given sample such as lily fragrances, more compounds were detected by the method established here than the EESI technique. An acceptable relative standard deviation (RSD 8.9%, n = 11) was obtained for the direct measurement of explosives (10 ppb) in waste water samples. The experimental data demonstrate that this method could simultaneously detect both polar and non-polar analytes with high sensitivity, showing promising applications for the rapid detection of a wide variety of compounds present in complex matrices.

Vapor permeation-stepwise injection simultaneous determination of methanol and ethanol in biodiesel with voltammetric detection.

PubMed

Shishov, Andrey; Penkova, Anastasia; Zabrodin, Andrey; Nikolaev, Konstantin; Dmitrenko, Maria; Ermakov, Sergey; Bulatov, Andrey

2016-02-01

A novel vapor permeation-stepwise injection (VP-SWI) method for the determination of methanol and ethanol in biodiesel samples is discussed. In the current study, stepwise injection analysis was successfully combined with voltammetric detection and vapor permeation. This method is based on the separation of methanol and ethanol from a sample using a vapor permeation module (VPM) with a selective polymer membrane based on poly(phenylene isophtalamide) (PA) containing high amounts of a residual solvent. After the evaporation into the headspace of the VPM, methanol and ethanol were transported, by gas bubbling, through a PA membrane to a mixing chamber equipped with a voltammetric detector. Ethanol was selectively detected at +0.19 V, and both compounds were detected at +1.20 V. Current subtractions (using a correction factor) were used for the selective determination of methanol. A linear range between 0.05 and 0.5% (m/m) was established for each analyte. The limits of detection were estimated at 0.02% (m/m) for ethanol and methanol. The sample throughput was 5 samples h(-1). The method was successfully applied to the analysis of biodiesel samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Teschoviruses as Indicators of Porcine Fecal Contamination of Surface Water

PubMed Central

Jiménez-Clavero, Miguel Angel; Fernández, Carlos; Ortiz, José Antonio; Pro, Javier; Carbonell, Gregoria; Tarazona, José Vicente; Roblas, Neftalí; Ley, Victoria

2003-01-01

Teschoviruses specifically infect pigs and are shed in pig feces. Hence, their presence in water should indicate contamination with pig fecal residues. To assess this hypothesis, we have developed a real-time reverse transcriptase PCR (RT-PCR) method that allows the quantitative detection of pig teschovirus (PTV) RNA. The method is able to detect 92 fg of PTV RNA per ml of sample. Using this method, we have detected the presence of PTV RNA in water and fecal samples from all pig farms examined (n = 5). Feces from other animal species (cattle, sheep, and goats) were negative in this test. To compare the PTV RNA detection method with conventional chemical determinations currently in use for evaluation of water contamination, we analyzed water samples collected downstream from a pig slurry spillage site. We have found a positive correlation within both types of determinations. The sensitivity of the PTV detection assay was similar to that achieved by unspecific organic matter determination and superior to all other conventional chemical analyses performed. Furthermore, the new method is highly specific, revealing the porcine origin of the contamination, a feature that is lacking in currently available methods for the assessment of water contamination. PMID:14532098

Multi-Frequency Signal Detection Based on Frequency Exchange and Re-Scaling Stochastic Resonance and Its Application to Weak Fault Diagnosis

PubMed Central

Leng, Yonggang; Fan, Shengbo

2018-01-01

Mechanical fault diagnosis usually requires not only identification of the fault characteristic frequency, but also detection of its second and/or higher harmonics. However, it is difficult to detect a multi-frequency fault signal through the existing Stochastic Resonance (SR) methods, because the characteristic frequency of the fault signal as well as its second and higher harmonics frequencies tend to be large parameters. To solve the problem, this paper proposes a multi-frequency signal detection method based on Frequency Exchange and Re-scaling Stochastic Resonance (FERSR). In the method, frequency exchange is implemented using filtering technique and Single SideBand (SSB) modulation. This new method can overcome the limitation of "sampling ratio" which is the ratio of the sampling frequency to the frequency of target signal. It also ensures that the multi-frequency target signals can be processed to meet the small-parameter conditions. Simulation results demonstrate that the method shows good performance for detecting a multi-frequency signal with low sampling ratio. Two practical cases are employed to further validate the effectiveness and applicability of this method. PMID:29693577

Determination of phenolic compounds and hydroxymethylfurfural in meads using high performance liquid chromatography with coulometric-array and UV detection.

PubMed

Kahoun, David; Rezková, Sona; Veskrnová, Katerina; Královský, Josef; Holcapek, Michal

2008-08-15

The objective of this study was the determination of 25 phenolic compounds in different mead samples (honeywines) using high performance liquid chromatography (HPLC) with coulometric-array detection and in case of hydroxymethylfurfural with UV detection. Our method was optimized in respect to both the separation selectivity of individual phenolic compounds and the maximum sensitivity with the electrochemical detection. The method development included the optimization of mobile phase composition, the pH value, conditions of the gradient elution and the flow rate using a window-diagram approach. The developed method was used for the determination of limits of detection and limits of quantitation for individual compounds. The linearity of calibration curves, accuracy and precision (intra- and inter-day) at three concentration levels (low, middle and high concentration range) were verified. Mead samples were diluted with the mobile phase at 1:1 to 1:50 ratio depending on the concentration and filtered through a PTFE filter without any other sample pre-treatment. Phenolic compounds concentration was determined in 50 real samples of meads and correlated with meads composition and hydroxymethylfurfural concentration. The most frequently occurred compounds were protocatechuic acid and vanillic acid (both of them were present in 98% samples), the least occurred compounds were (+)-catechin (10% samples) and sinapic acid (12% samples). Vanillin and ethylvanillin, which are used as artificial additives for the taste improvement, were found in 60% and 42% samples, respectively. Hydroxymethylfurfural concentration, as an indicator of honey quality, was in the range from 2.47 to 158 mg/L. Our method is applicable for the determination of 25 phenolic compounds in mead, honey and related natural samples.

Mid-infrared spectroscopy combined with chemometrics to detect Sclerotinia stem rot on oilseed rape (Brassica napus L.) leaves.

PubMed

Zhang, Chu; Feng, Xuping; Wang, Jian; Liu, Fei; He, Yong; Zhou, Weijun

2017-01-01

Detection of plant diseases in a fast and simple way is crucial for timely disease control. Conventionally, plant diseases are accurately identified by DNA, RNA or serology based methods which are time consuming, complex and expensive. Mid-infrared spectroscopy is a promising technique that simplifies the detection procedure for the disease. Mid-infrared spectroscopy was used to identify the spectral differences between healthy and infected oilseed rape leaves. Two different sample sets from two experiments were used to explore and validate the feasibility of using mid-infrared spectroscopy in detecting Sclerotinia stem rot (SSR) on oilseed rape leaves. The average mid-infrared spectra showed differences between healthy and infected leaves, and the differences varied among different sample sets. Optimal wavenumbers for the 2 sample sets selected by the second derivative spectra were similar, indicating the efficacy of selecting optimal wavenumbers. Chemometric methods were further used to quantitatively detect the oilseed rape leaves infected by SSR, including the partial least squares-discriminant analysis, support vector machine and extreme learning machine. The discriminant models using the full spectra and the optimal wavenumbers of the 2 sample sets were effective for classification accuracies over 80%. The discriminant results for the 2 sample sets varied due to variations in the samples. The use of two sample sets proved and validated the feasibility of using mid-infrared spectroscopy and chemometric methods for detecting SSR on oilseed rape leaves. The similarities among the selected optimal wavenumbers in different sample sets made it feasible to simplify the models and build practical models. Mid-infrared spectroscopy is a reliable and promising technique for SSR control. This study helps in developing practical application of using mid-infrared spectroscopy combined with chemometrics to detect plant disease.

Evaluation of Two Surface Sampling Methods for Detection of Erwinia herbicola on a Variety of Materials by Culture and Quantitative PCR▿

PubMed Central

Buttner, Mark P.; Cruz, Patricia; Stetzenbach, Linda D.; Cronin, Tracy

2007-01-01

This research was designed to evaluate surface sampling protocols for use with culture and quantitative PCR (QPCR) amplification assay for detection of the gram-negative bacterial biothreat simulant Erwinia herbicola on a variety of surface materials. Surfaces selected for evaluation were wood laminate, glass and computer monitor screens, metal file cabinets, plastic arena seats, nylon seat cushions, finished concrete flooring, and vinyl tile flooring. Laboratory and test chamber studies were performed to evaluate two sampling methods, a sponge and a macrofoam swab, for detection of E. herbicola on surface materials. In laboratory trials, seven materials were inoculated with a known concentration of E. herbicola cells and samples were collected from the surfaces of the materials to determine sampling efficiencies. Culture analysis was ineffective for assessing E. herbicola collection efficiency because very few culturable cells were obtained from surface samples. QPCR demonstrated that E. herbicola DNA was present in high concentrations on all of the surface samples, and sampling efficiencies ranged from 0.7 to 52.2%, depending on the sampling method and the surface material. The swab was generally more efficient than the sponge for collection of E. herbicola from surfaces. Test chamber trials were also performed in which E. herbicola was aerosolized into the chamber and allowed to settle onto test materials. Surface sampling results supported those obtained in laboratory trials. The results of this study demonstrate the capabilities of QPCR to enhance the detection and enumeration of biocontaminants on surface materials and provide information on the comparability of sampling methods. PMID:17416685

Evaluation of two surface sampling methods for detection of Erwinia herbicola on a variety of materials by culture and quantitative PCR.

PubMed

Buttner, Mark P; Cruz, Patricia; Stetzenbach, Linda D; Cronin, Tracy

2007-06-01

This research was designed to evaluate surface sampling protocols for use with culture and quantitative PCR (QPCR) amplification assay for detection of the gram-negative bacterial biothreat simulant Erwinia herbicola on a variety of surface materials. Surfaces selected for evaluation were wood laminate, glass and computer monitor screens, metal file cabinets, plastic arena seats, nylon seat cushions, finished concrete flooring, and vinyl tile flooring. Laboratory and test chamber studies were performed to evaluate two sampling methods, a sponge and a macrofoam swab, for detection of E. herbicola on surface materials. In laboratory trials, seven materials were inoculated with a known concentration of E. herbicola cells and samples were collected from the surfaces of the materials to determine sampling efficiencies. Culture analysis was ineffective for assessing E. herbicola collection efficiency because very few culturable cells were obtained from surface samples. QPCR demonstrated that E. herbicola DNA was present in high concentrations on all of the surface samples, and sampling efficiencies ranged from 0.7 to 52.2%, depending on the sampling method and the surface material. The swab was generally more efficient than the sponge for collection of E. herbicola from surfaces. Test chamber trials were also performed in which E. herbicola was aerosolized into the chamber and allowed to settle onto test materials. Surface sampling results supported those obtained in laboratory trials. The results of this study demonstrate the capabilities of QPCR to enhance the detection and enumeration of biocontaminants on surface materials and provide information on the comparability of sampling methods.

Comparing real-time and conventional PCR to culture-based methods for detecting and quantifying Escherichia coli O157 in cattle feces.

PubMed

Jacob, M E; Bai, J; Renter, D G; Rogers, A T; Shi, X; Nagaraja, T G

2014-02-01

Detection of Escherichia coli O157 in cattle feces has traditionally used culture-based methods; PCR-based methods have been suggested as an alternative. We aimed to determine if multiplex real-time (mq) or conventional PCR methods could reliably detect cattle naturally shedding high (≥10(4) CFU/g of feces) and low (∼10(2) CFU/g of feces) concentrations of E. coli O157. Feces were collected from pens of feedlot cattle and evaluated for E. coli O157 by culture methods. Samples were categorized as (i) high shedders, (ii) immunomagnetic separation (IMS) positive after enrichment, or (iii) culture negative. DNA was extracted pre- and postenrichment from 100 fecal samples from each category (high shedder, IMS positive, culture negative) and subjected to mqPCR and conventional PCR assays based on detecting three genes, rfbE, stx1, and stx2. In feces from cattle determined to be E. coli O157 high shedders by culture, 37% were positive by mqPCR prior to enrichment; 85% of samples were positive after enrichment. In IMS-positive samples, 4% were positive by mqPCR prior to enrichment, while 43% were positive after enrichment. In culture-negative feces, 7% were positive by mqPCR prior to enrichment, and 40% were positive after enrichment. The proportion of high shedder-positive and culture-positive (high shedder and IMS) samples were significantly different from mqPCR-positive samples before and after enrichment (P < 0.01). Similar results were observed for conventional PCR. Our data suggest that mqPCR and conventional PCR are most useful in identifying high shedder animals and may not be an appropriate substitute to culture-based methods for detection of E. coli O157 in cattle feces.

Evaluation of microplate immunocapture method for detection of Vibrio cholerae, Salmonella Typhi and Shigella flexneri from food.

PubMed

Fakruddin, Md; Hossain, Md Nur; Ahmed, Monzur Morshed

2017-08-29

Improved methods with better separation and concentration ability for detection of foodborne pathogens are in constant need. The aim of this study was to evaluate microplate immunocapture (IC) method for detection of Salmonella Typhi, Shigella flexneri and Vibrio cholerae from food samples to provide a better alternative to conventional culture based methods. The IC method was optimized for incubation time, bacterial concentration, and capture efficiency. 6 h incubation and log 6 CFU/ml cell concentration provided optimal results. The method was shown to be highly specific for the pathogens concerned. Capture efficiency (CE) was around 100% of the target pathogens, whereas CE was either zero or very low for non-target pathogens. The IC method also showed better pathogen detection ability at different concentrations of cells from artificially contaminated food samples in comparison with culture based methods. Performance parameter of the method was also comparable (Detection limit- 25 CFU/25 g; sensitivity 100%; specificity-96.8%; Accuracy-96.7%), even better than culture based methods (Detection limit- 125 CFU/25 g; sensitivity 95.9%; specificity-97%; Accuracy-96.2%). The IC method poses to be the potential to be used as a method of choice for detection of foodborne pathogens in routine laboratory practice after proper validation.

Sample processing approach for detection of ricin in surface samples.

PubMed

Kane, Staci; Shah, Sanjiv; Erler, Anne Marie; Alfaro, Teneile

2017-12-01

With several ricin contamination incidents reported over the past decade, rapid and accurate methods are needed for environmental sample analysis, especially after decontamination. A sample processing method was developed for common surface sampling devices to improve the limit of detection and avoid false negative/positive results for ricin analysis. Potential assay interferents from the sample matrix (bleach residue, sample material, wetting buffer), including reference dust, were tested using a Time-Resolved Fluorescence (TRF) immunoassay. Test results suggested that the sample matrix did not cause the elevated background fluorescence sometimes observed when analyzing post-bleach decontamination samples from ricin incidents. Furthermore, sample particulates (80mg/mL Arizona Test Dust) did not enhance background fluorescence or interfere with ricin detection by TRF. These results suggested that high background fluorescence in this immunoassay could be due to labeled antibody quality and/or quantity issues. Centrifugal ultrafiltration devices were evaluated for ricin concentration as a part of sample processing. Up to 30-fold concentration of ricin was observed by the devices, which serve to remove soluble interferents and could function as the front-end sample processing step to other ricin analytical methods. The procedure has the potential to be used with a broader range of environmental sample types and with other potential interferences and to be followed by other ricin analytical methods, although additional verification studies would be required. Published by Elsevier B.V.

Evaluation of environmental sampling methods for detection of Salmonella enterica in a large animal veterinary hospital.

PubMed

Goeman, Valerie R; Tinkler, Stacy H; Hammac, G Kenitra; Ruple, Audrey

2018-04-01

Environmental surveillance for Salmonella enterica can be used for early detection of contamination; thus routine sampling is an integral component of infection control programs in hospital environments. At the Purdue University Veterinary Teaching Hospital (PUVTH), the technique regularly employed in the large animal hospital for sample collection uses sterile gauze sponges for environmental sampling, which has proven labor-intensive and time-consuming. Alternative sampling methods use Swiffer brand electrostatic wipes for environmental sample collection, which are reportedly effective and efficient. It was hypothesized that use of Swiffer wipes for sample collection would be more efficient and less costly than the use of gauze sponges. A head-to-head comparison between the 2 sampling methods was conducted in the PUVTH large animal hospital and relative agreement, cost-effectiveness, and sampling efficiency were compared. There was fair agreement in culture results between the 2 sampling methods, but Swiffer wipes required less time and less physical effort to collect samples and were more cost-effective.

Optimization of a Viability PCR Method for the Detection of Listeria monocytogenes in Food Samples.

PubMed

Agustí, Gemma; Fittipaldi, Mariana; Codony, Francesc

2018-06-01

Rapid detection of Listeria and other microbial pathogens in food is an essential part of quality control and it is critical for ensuring the safety of consumers. Culture-based methods for detecting foodborne pathogens are time-consuming, laborious and cannot detect viable but non-culturable microorganism, whereas viability PCR methodology provides quick results; it is able to detect viable but non-culturable cells, and allows for easier handling of large amount of samples. Although the most critical point to use viability PCR technique is achieving the complete exclusion of dead cell amplification signals, many improvements are being introduced to overcome this. In the present work, the yield of dead cell DNA neutralization was enhanced by incorporating two new sample treatment strategies: tube change combined with a double light treatment. This procedure was successfully tested using artificially contaminated food samples, showing improved neutralization of dead cell DNA.

Detection of human papillomavirus DNA in urine. A review of the literature.

PubMed

Vorsters, A; Micalessi, I; Bilcke, J; Ieven, M; Bogers, J; Van Damme, P

2012-05-01

The detection of human papillomavirus (HPV) DNA in urine, a specimen easily obtained by a non-invasive self-sampling method, has been the subject of a considerable number of studies. This review provides an overview of 41 published studies; assesses how different methods and settings may contribute to the sometimes contradictory outcomes; and discusses the potential relevance of using urine samples in vaccine trials, disease surveillance, epidemiological studies, and specific settings of cervical cancer screening. Urine sampling, storage conditions, sample preparation, DNA extraction, and DNA amplification may all have an important impact on HPV DNA detection and the form of viral DNA that is detected. Possible trends in HPV DNA prevalence in urine could be inferred from the presence of risk factors or the diagnosis of cervical lesions. HPV DNA detection in urine is feasible and may become a useful tool but necessitates further improvement and standardization.

Dissolved pesticide concentrations entering the Sacramento-San Joaquin Delta from the Sacramento and San Joaquin Rivers, California, 2012-13

USGS Publications Warehouse

Orlando, James L.; McWayne, Megan; Sanders, Corey; Hladik, Michelle

2014-01-01

Surface-water samples were collected from the Sacramento and San Joaquin Rivers where they enter the Sacramento–San Joaquin Delta, and analyzed by the U.S. Geological Survey for a suite of 99 current-use pesticides and pesticide degradates. Samples were collected twice per month from May 2012 through July 2013 and from May 2012 through April 2013 at the Sacramento River at Freeport, and the San Joaquin River near Vernalis, respectively. Samples were analyzed by two separate laboratory methods by using gas chromatography with mass spectrometry or liquid chromatography with tandem mass spectrometry. Method detection limits ranged from 0.9 to 10.5 nanograms per liter (ng/L). A total of 37 pesticides and degradates were detected in water samples collected during the study (18 herbicides, 11 fungicides, 7 insecticides, and 1 synergist). The most frequently detected pesticides overall were the herbicide hexazinone (detected in 100 percent of the samples); 3,4-dichloroaniline (97 percent), which is a degradate of the herbicides diuron and propanil; the fungicide azoxystrobin (83 percent); and the herbicides diuron (72 percent), simazine (66 percent), and metolachlor (64 percent). Insecticides were rarely detected during the study. Pesticide concentrations varied from below the method detection limits to 984 ng/L (hexazinone). Twenty seven pesticides and (or) degradates were detected in Sacramento River samples, and the average number of pesticides per sample was six. The most frequently detected compounds in these samples were hexazinone (detected in 100 percent of samples), 3,4-dichloroaniline (97 percent), azoxystrobin (88 percent), diuron (56 percent), and simazine (50 percent). Pesticides with the highest detected maximum concentrations in Sacramento River samples included the herbicide clomazone (670 ng/L), azoxystrobin (368 ng/L), 3,4-dichloroaniline (364 ng/L), hexazinone (130 ng/L), and propanil (110 ng/L), and all but hexazinone are primarily associated with rice agriculture. In addition to the twice monthly sampling, surface-water samples were collected from the Sacramento River on 5 consecutive days following a rainfall event in the Sacramento urban area. Samples collected following this event contained an average of 11 pesticides. The insecticides carbaryl, fipronil, and imidacloprid; the herbicide DCPA; and the fungicide imazalil were only detected in the Sacramento River during this storm-runoff event, and two detections of fipronil during this period exceeded the U.S. Environmental Protection Agency Aquatic Life Benchmark (11 ng/L) for chronic toxicity to invertebrates in freshwater. In San Joaquin River samples, 26 pesticides and (or) degradates were detected, and the average number detected per sample was 9. The most frequently detected compounds in these samples were hexazinone and metolachlor (detected in 100 percent of samples); diuron (96 percent); the fungicide boscalid (96 percent); the degradates 3,4-dicloroaniline (92 percent) and NN-(3,4-Dichlorophenyl)-N’-methylurea (DCPMU; 83 percent); simazine (83 percent); and azoxystrobin (75 percent). The pesticides with the highest detected maximum concentrations were hexazinone (984 ng/L), diuron (695 ng/L), simazine (524 ng/L), the herbicide prometryn (155 ng/L), metolachlor (127 ng/L), boscalid (112 ng/L), DCPMU (111 ng/L), and the herbicide pendimethalin (108 ng/L).

Optical Observation, Image-processing, and Detection of Space Debris in Geosynchronous Earth Orbit

NASA Astrophysics Data System (ADS)

Oda, H.; Yanagisawa, T.; Kurosaki, H.; Tagawa, M.

2014-09-01

We report on optical observations and an efficient detection method of space debris in the geosynchronous Earth orbit (GEO). We operate our new Australia Remote Observatory (ARO) where an 18 cm optical telescope with a charged-coupled device (CCD) camera covering a 3.14-degree field of view is used for GEO debris survey, and analyse datasets of successive CCD images using the line detection method (Yanagisawa and Nakajima 2005). In our operation, the exposure time of each CCD image is set to be 3 seconds (or 5 seconds), and the time interval of CCD shutter open is about 4.7 seconds (or 6.7 seconds). In the line detection method, a sufficient number of sample objects are taken from each image based on their shape and intensity, which includes not only faint signals but also background noise (we take 500 sample objects from each image in this paper). Then we search a sequence of sample objects aligning in a straight line in the successive images to exclude the noise sample. We succeed in detecting faint signals (down to about 1.8 sigma of background noise) by applying the line detection method to 18 CCD images. As a result, we detected about 300 GEO objects up to magnitude of 15.5 among 5 nights data. We also calculate orbits of objects detected using the Simplified General Perturbations Satellite Orbit Model 4(SGP4), and identify the objects listed in the two-line-element (TLE) data catalogue publicly provided by the U.S. Strategic Command (USSTRATCOM). We found that a certain amount of our detections are new objects that are not contained in the catalogue. We conclude that our ARO and detection method posse a high efficiency detection of GEO objects despite the use of comparatively-inexpensive observation and analysis system. We also describe the image-processing specialized for the detection of GEO objects (not for usual astronomical objects like stars) in this paper.

Method for nucleic acid isolation using supercritical fluids

DOEpatents

Nivens, D.E.; Applegate, B.M.

1999-07-13

A method is disclosed for detecting the presence of a microorganism in an environmental sample involves contacting the sample with a supercritical fluid to isolate nucleic acid from the microorganism, then detecting the presence of a particular sequence within the isolated nucleic acid. The nucleic acid may optionally be subjected to further purification. 4 figs.

Shiga toxin-producing Escherichia coli in meat: a preliminary simulation study on detection capabilities for three sampling methods

USDA-ARS?s Scientific Manuscript database

The objective of this simulation study is to determine which sampling method (Cozzini core sampler, core drill shaving, and N-60 surface excision) will better detect Shiga Toxin-producing Escherichia coli (STEC) at varying levels of contamination when present in the meat. 1000 simulated experiments...

Current methods for detecting the presence of botulinum neurotoxins in food and other biological samples

USDA-ARS?s Scientific Manuscript database

Current methods for detecting the presence of botulinum neurotoxins in food and other biological samples Botulinum neurotoxins (BoNTs), the causative agents of botulism, are among the most lethal human bacterial toxins and the causative agent of botulism. BoNTs are also classified as Select Agents ...

Assessment of Hyporheic Zone, Flood-Plain, Soil-Gas, Soil, and Surface-Water Contamination at the McCoys Creek Chemical Training Area, Fort Gordon, Georgia, 2009-2010

USGS Publications Warehouse

Guimaraes, Wladmir B.; Falls, W. Fred; Caldwell, Andral W.; Ratliff, W. Hagan; Wellborn, John B.; Landmeyer, James E.

2011-01-01

The U.S. Geological Survey, in cooperation with the U.S. Department of the Army Environmental and Natural Resources Management Office of the U.S. Army Signal Center and Fort Gordon, Georgia, assessed the hyporheic zone, flood plain, soil gas, soil, and surface water for contaminants at the McCoys Creek Chemical Training Area (MCTA) at Fort Gordon, from October 2009 to September 2010. The assessment included the detection of organic contaminants in the hyporheic zone, flood plain, soil gas, and surface water. In addition, the organic contaminant assessment included the analysis of organic compounds classified as explosives and chemical agents in selected areas. Inorganic contaminants were assessed in soil and surface-water samples. The assessment was conducted to provide environmental contamination data to the U.S. Army at Fort Gordon pursuant to requirements of the Resource Conservation and Recovery Act Part B Hazardous Waste Permit process. Ten passive samplers were deployed in the hyporheic zone and flood plain, and total petroleum hydrocarbons (TPH) and octane were detected above the method detection level in every sampler. Other organic compounds detected above the method detection level in the hyporheic zone and flood-plain samplers were trichloroethylene, and cis- and trans- 1, 2-dichloroethylene. One trip blank detected TPH below the method detection level but above the nondetection level. The concentrations of TPH in the samplers were many times greater than the concentrations detected in the blank; therefore, all other TPH concentrations detected are considered to represent environmental conditions. Seventy-one soil-gas samplers were deployed in a grid pattern across the MCTA. Three trip blanks and three method blanks were used and not deployed, and TPH was detected above the method detection level in two trip blanks and one method blank. Detection of TPH was observed at all 71 samplers, but because TPH was detected in the trip and method blanks, TPH was censored and, therefore, only 7 of the 71 samplers were reported as detecting TPH. In addition, benzene, toluene, ethylbenzene, and total xylene were detected above the method detection level in 22 samplers. Other compounds detected above the method detection level included naphthalene, octane, undecane, tridecane, 1,2,4-trimethylbenzene, trichloroethylene, perchloroethylene, chloroform, and 1,4-dichlorobenzene. Subsequent to the soil-gas survey, five locations with elevated contaminant mass were selected and a passive sampler was deployed at those locations to detect the presence of organic compounds classified as explosives or chemical agents. No explosives or chemical agents were detected above the method detection level, but some compounds were detected below the method detection level but above the nondetection level. Dimethyl disulfide, benzothiazole, chloroacetophenones, and para-chlorophenyl methyl sulfide were all detected below the method detection level but above the nondetection level. The compounds 2,4-dinitrotoluene, and para-chlorophenyl methyl sulfone were detected in samplers but also were detected in trip blanks and are not considered as present in the MCTA. The same five locations that were selected for sampling of explosives and chemical agents were selected for soil sampling. Metal concentrations in composite soil samples collected at five locations from land surface to a depth of 6 inches did not exceed the U.S. Environmental Protection Agency Regional Screening Levels for Industrial Soil. Concentrations in some compounds were higher than the South Carolina Department of Health and Environmental Control background levels for nearby South Carolina, including aluminum, arsenic, barium, beryllium, chromium, copper, iron, lead, manganese, nickel, and potassium. A surface-water sample was collected from McCoys Creek and analyzed for volatile organic compounds, semivolatile organic compounds, and inorganic compounds (metals). No volatile organic compounds and (or) semivolatile organic compounds were detected at levels above the maximum contaminant level of the U.S. Environmental Protection Agency (USEPA) National Primary Drinking Water Standard, and no inorganic compounds exceeded the maximum contaminant level of the USEPA National Primary Drinking Water Standard or the Georgia In-Stream Water-Quality Standard. Iron was the only inorganic compound detected in the surface-water sample (578 micrograms per liter) that exceeded the USEPA National Secondary Drinking Water Standard of 300 micrograms per liter.

Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples.

PubMed

Kasturi, Kuppuswamy N; Drgon, Tomas

2017-07-15

The methods currently used for detecting Salmonella in environmental samples require 2 days to produce results and have limited sensitivity. Here, we describe the development and validation of a real-time PCR Salmonella screening method that produces results in 18 to 24 h. Primers and probes specific to the gene invA , group D, and Salmonella enterica serovar Enteritidis organisms were designed and evaluated for inclusivity and exclusivity using a panel of 329 Salmonella isolates representing 126 serovars and 22 non- Salmonella organisms. The invA - and group D-specific sets identified all the isolates accurately. The PCR method had 100% inclusivity and detected 1 to 2 copies of Salmonella DNA per reaction. Primers specific for Salmonella -differentiating fragment 1 (Sdf-1) in conjunction with the group D set had 100% inclusivity for 32 S Enteritidis isolates and 100% exclusivity for the 297 non-Enteritidis Salmonella isolates. Single-laboratory validation performed on 1,741 environmental samples demonstrated that the PCR method detected 55% more positives than the V itek i mmuno d iagnostic a ssay s ystem (VIDAS) method. The PCR results correlated well with the culture results, and the method did not report any false-negative results. The receiver operating characteristic (ROC) analysis documented excellent agreement between the results from the culture and PCR methods (area under the curve, 0.90; 95% confidence interval of 0.76 to 1.0) confirming the validity of the PCR method. IMPORTANCE This validated PCR method detects 55% more positives for Salmonella in half the time required for the reference method, VIDAS. The validated PCR method will help to strengthen public health efforts through rapid screening of Salmonella spp. in environmental samples.

Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples

PubMed Central

Drgon, Tomas

2017-01-01

ABSTRACT The methods currently used for detecting Salmonella in environmental samples require 2 days to produce results and have limited sensitivity. Here, we describe the development and validation of a real-time PCR Salmonella screening method that produces results in 18 to 24 h. Primers and probes specific to the gene invA, group D, and Salmonella enterica serovar Enteritidis organisms were designed and evaluated for inclusivity and exclusivity using a panel of 329 Salmonella isolates representing 126 serovars and 22 non-Salmonella organisms. The invA- and group D-specific sets identified all the isolates accurately. The PCR method had 100% inclusivity and detected 1 to 2 copies of Salmonella DNA per reaction. Primers specific for Salmonella-differentiating fragment 1 (Sdf-1) in conjunction with the group D set had 100% inclusivity for 32 S. Enteritidis isolates and 100% exclusivity for the 297 non-Enteritidis Salmonella isolates. Single-laboratory validation performed on 1,741 environmental samples demonstrated that the PCR method detected 55% more positives than the Vitek immunodiagnostic assay system (VIDAS) method. The PCR results correlated well with the culture results, and the method did not report any false-negative results. The receiver operating characteristic (ROC) analysis documented excellent agreement between the results from the culture and PCR methods (area under the curve, 0.90; 95% confidence interval of 0.76 to 1.0) confirming the validity of the PCR method. IMPORTANCE This validated PCR method detects 55% more positives for Salmonella in half the time required for the reference method, VIDAS. The validated PCR method will help to strengthen public health efforts through rapid screening of Salmonella spp. in environmental samples. PMID:28500041

An intercomparison of five ammonia measurement techniques

NASA Technical Reports Server (NTRS)

Williams, E. J.; Sandholm, S. T.; Bradshaw, J. D.; Schendel, J. S.; Langford, A. O.; Quinn, P. K.; Lebel, P. J.; Vay, S. A.; Roberts, P. D.; Norton, R. B.

1992-01-01

Results obtained from five techniques for measuring gas-phase ammonia at low concentration in the atmosphere are compared. These methods are: (1) a photofragmentation/laser-induced fluorescence (PF/LIF) instrument; (2) a molybdenum oxide annular denuder sampling/chemiluminescence detection technique; (3) a tungsten oxide denuder sampling/chemiluminescence detection system; (4) a citric-acid-coated denuder sampling/ion chromatographic analysis (CAD/IC) method; and (5) an oxalic-acid-coated filter pack sampling/colorimetric analysis method. It was found that two of the techniques, the PF/LIF and the CAD/IC methods, measured approximately 90 percent of the calculated ammonia added in the spiking tests and agreed very well with each other in the ambient measurements.

Discrepancy between culture and DNA probe analysis for the detection of periodontal bacteria.

PubMed

van Steenbergen, T J; Timmerman, M F; Mikx, F H; de Quincey, G; van der Weijden, G A; van der Velden, U; de Graaff, J

1996-10-01

The purpose of this study was to compare a commercially available DNA probe technique with conventional cultural techniques for the detection of Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis and Prevotella intermedia in subgingival plaque samples. Samples from 20 patients with moderate to severe periodontitis were evaluated at baseline and during a 15 months period of periodontal treatment. Paperpoints from 4 periodontal pockets per patient were forwarded to Omnigene for DNA probe analysis, and simultaneously inserted paperpoints from the same pockets were analyzed by standard culture techniques. In addition, mixed bacterial samples were constructed harbouring known proportions of 25 strains of A. actinomycetemcomitans, P. gingivalis and P. intermedia each. A relatively low concordance was found between both methods. At baseline a higher detection frequency was found for A. actinomycetemcomitans and P. gingivalis for the DNA probe technique; for P. intermedia the detection frequency by culture was higher. For A. actinomycetemcomitans, 21% of the culture positive samples was positive with the DNA probe. Testing the constructed bacterial samples with the DNA probe method resulted in about 16% false positive results for the 3 species tested. Furthermore, 40% of P. gingivalis strains were not detected by the DNA probe. The present data suggest that at least part of the discrepancies found between the DNA probe technique used and cultural methods are caused by false positive and false negative DNA probe results. Therefore, the value of this DNA probe method for the detection of periodontal pathogens is questionable.

Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

USGS Publications Warehouse

Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

2007-01-01

The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

Statistical approaches to the analysis of point count data: A little extra information can go a long way

USGS Publications Warehouse

Farnsworth, G.L.; Nichols, J.D.; Sauer, J.R.; Fancy, S.G.; Pollock, K.H.; Shriner, S.A.; Simons, T.R.; Ralph, C. John; Rich, Terrell D.

2005-01-01

Point counts are a standard sampling procedure for many bird species, but lingering concerns still exist about the quality of information produced from the method. It is well known that variation in observer ability and environmental conditions can influence the detection probability of birds in point counts, but many biologists have been reluctant to abandon point counts in favor of more intensive approaches to counting. However, over the past few years a variety of statistical and methodological developments have begun to provide practical ways of overcoming some of the problems with point counts. We describe some of these approaches, and show how they can be integrated into standard point count protocols to greatly enhance the quality of the information. Several tools now exist for estimation of detection probability of birds during counts, including distance sampling, double observer methods, time-depletion (removal) methods, and hybrid methods that combine these approaches. Many counts are conducted in habitats that make auditory detection of birds much more likely than visual detection. As a framework for understanding detection probability during such counts, we propose separating two components of the probability a bird is detected during a count into (1) the probability a bird vocalizes during the count and (2) the probability this vocalization is detected by an observer. In addition, we propose that some measure of the area sampled during a count is necessary for valid inferences about bird populations. This can be done by employing fixed-radius counts or more sophisticated distance-sampling models. We recommend any studies employing point counts be designed to estimate detection probability and to include a measure of the area sampled.

Determination of ammonium in river water and sewage samples by capillary zone electrophoresis with direct UV detection.

PubMed

Fukushi, Keiichi; Ito, Hideyuki; Kimura, Kenichi; Yokota, Kuriko; Saito, Keiitsu; Chayama, Kenji; Takeda, Sahori; Wakida, Shin-ichi

2006-02-17

We developed capillary zone electrophoresis (CZE) with direct UV detection for determination of ammonium in environmental water samples. Ammonium in the samples was partly converted into ammonia in the alkaline background electrolyte (BGE) during migration and was detected by molecular absorption of ammonia at 190 nm in approximately 7 min. The limit of detection (LOD) for ammonium was 0.24 mg/l (as nitrogen) at a signal-to-noise ratio of three. The respective values of the relative standard deviation (RSD) of peak area, peak height, and migration time for ammonium were 2.1, 1.8, and 0.46%. Major alkali and alkaline earth metal ions coexisting in the samples did not interfere with ammonium determination by the proposed method. The proposed method determined ammonium in surface water and sewage samples. The results were compared to those obtained using ion chromatography (IC).

Determination of methyl mercury by aqueous phase Eehylation, followed by gas chromatographic separation with cold vapor atomic fluorescence detection

USGS Publications Warehouse

De Wild, John F.; Olsen, Mark L.; Olund, Shane D.

2002-01-01

A recent national sampling of streams in the United States revealed low methyl mercury concentrations in surface waters. The resulting median and mean concentrations, calculated from 104 samples, were 0.06 nanograms per liter (ng/L) and 0.15 ng/L, respectively. This level of methyl mercury in surface water in the United States has created a need for analytical techniques capable of detecting sub-nanogram per liter concentrations. In an attempt to create a U.S. Geological Survey approved method, the Wisconsin District Mercury Laboratory has adapted a distillation/ethylation/ gas-phase separation method with cold vapor atomic fluorescence spectroscopy detection for the determination of methyl mercury in filtered and unfiltered waters. This method is described in this report. Based on multiple analyses of surface water and ground-water samples, a method detection limit of 0.04 ng/L was established. Precision and accuracy were evaluated for the method using both spiked and unspiked ground-water and surface-water samples. The percent relative standard deviations ranged from 10.2 to 15.6 for all analyses at all concentrations. Average recoveries obtained for the spiked matrices ranged from 88.8 to 117 percent. The precision and accuracy ranges are within the acceptable method-performance limits. Considering the demonstrated detection limit, precision, and accuracy, the method is an effective means to quantify methyl mercury in waters at or below environmentally relevant concentrations

Recombinase Polymerase Amplification (RPA) of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops

PubMed Central

Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

2014-01-01

Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37–42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15–25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops. PMID:25310647

Recombinase polymerase amplification (RPA) of CaMV-35S promoter and nos terminator for rapid detection of genetically modified crops.

PubMed

Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

2014-10-10

Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37-42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15-25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops.

Molecular method for detection of total coliforms in drinking water samples.

PubMed

Maheux, Andrée F; Boudreau, Dominique K; Bisson, Marc-Antoine; Dion-Dupont, Vanessa; Bouchard, Sébastien; Nkuranga, Martine; Bergeron, Michel G; Rodriguez, Manuel J

2014-07-01

This work demonstrates the ability of a bacterial concentration and recovery procedure combined with three different PCR assays targeting the lacZ, wecG, and 16S rRNA genes, respectively, to detect the presence of total coliforms in 100-ml samples of potable water (presence/absence test). PCR assays were first compared to the culture-based Colilert and MI agar methods to determine their ability to detect 147 coliform strains representing 76 species of Enterobacteriaceae encountered in fecal and environmental settings. Results showed that 86 (58.5%) and 109 (74.1%) strains yielded a positive signal with Colilert and MI agar methods, respectively, whereas the lacZ, wecG, and 16S rRNA PCR assays detected 133 (90.5%), 111 (75.5%), and 146 (99.3%) of the 147 total coliform strains tested. These assays were then assessed by testing 122 well water samples collected in the Québec City region of Canada. Results showed that 97 (79.5%) of the samples tested by culture-based methods and 95 (77.9%), 82 (67.2%), and 98 (80.3%) of samples tested using PCR-based methods contained total coliforms, respectively. Consequently, despite the high genetic variability of the total coliform group, this study demonstrated that it is possible to use molecular assays to detect total coliforms in potable water: the 16S rRNA molecular assay was shown to be as efficient as recommended culture-based methods. This assay might be used in combination with an Escherichia coli molecular assay to assess drinking water quality. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Molecular Method for Detection of Total Coliforms in Drinking Water Samples

PubMed Central

Boudreau, Dominique K.; Bisson, Marc-Antoine; Dion-Dupont, Vanessa; Bouchard, Sébastien; Nkuranga, Martine; Bergeron, Michel G.; Rodriguez, Manuel J.

2014-01-01

This work demonstrates the ability of a bacterial concentration and recovery procedure combined with three different PCR assays targeting the lacZ, wecG, and 16S rRNA genes, respectively, to detect the presence of total coliforms in 100-ml samples of potable water (presence/absence test). PCR assays were first compared to the culture-based Colilert and MI agar methods to determine their ability to detect 147 coliform strains representing 76 species of Enterobacteriaceae encountered in fecal and environmental settings. Results showed that 86 (58.5%) and 109 (74.1%) strains yielded a positive signal with Colilert and MI agar methods, respectively, whereas the lacZ, wecG, and 16S rRNA PCR assays detected 133 (90.5%), 111 (75.5%), and 146 (99.3%) of the 147 total coliform strains tested. These assays were then assessed by testing 122 well water samples collected in the Québec City region of Canada. Results showed that 97 (79.5%) of the samples tested by culture-based methods and 95 (77.9%), 82 (67.2%), and 98 (80.3%) of samples tested using PCR-based methods contained total coliforms, respectively. Consequently, despite the high genetic variability of the total coliform group, this study demonstrated that it is possible to use molecular assays to detect total coliforms in potable water: the 16S rRNA molecular assay was shown to be as efficient as recommended culture-based methods. This assay might be used in combination with an Escherichia coli molecular assay to assess drinking water quality. PMID:24771030

Explosive detection using high-volume vapor sampling and analysis by trained canines and ultra-trace detection equipment

NASA Astrophysics Data System (ADS)

Fisher, Mark; Sikes, John; Prather, Mark

2004-09-01

The dog's nose is an effective, highly-mobile sampling system, while the canine olfactory organs are an extremely sensitive detector. Having been trained to detect a wide variety of substances with exceptional results, canines are widely regarded as the 'gold standard' in chemical vapor detection. Historically, attempts to mimic the ability of dogs to detect vapors of explosives using electronic 'dogs noses' has proven difficult. However, recent advances in technology have resulted in development of detection (i.e., sampling and sensor) systems with performance that is rapidly approaching that of trained canines. The Nomadics Fido was the first sensor to demonstrate under field conditions the detection of landmines with performance approaching that of canines. More recently, comparative testing of Fido against canines has revealed that electronic vapor detection, when coupled with effective sampling methods, can produce results comparable to that of highly-trained canines. The results of these comparative tests will be presented, as will recent test results in which explosives hidden in cargo were detected using Fido with a high-volume sampling technique. Finally, the use of canines along with electronic sensors will be discussed as a means of improving the performance and expanding the capabilities of both methods.

Protocol for Detection of Yersinia pestis in Environmental ...

EPA Pesticide Factsheets

Methods Report This is the first ever open-access and detailed protocol available to all government departments and agencies, and their contractors to detect Yersinia pestis, the pathogen that causes plague, from multiple environmental sample types including water. Each analytical method includes sample processing procedure for each sample type in a step-by-step manner. It includes real-time PCR, traditional microbiological culture, and the Rapid Viability PCR (RV-PCR) analytical methods. For large volume water samples it also includes an ultra-filtration-based sample concentration procedure. Because of such a non-restrictive availability of this protocol to all government departments and agencies, and their contractors, the nation will now have increased laboratory capacity to analyze large number of samples during a wide-area plague incident.

Development of an Analytical Protocol for Determination of Cyanide in Human Biological Samples Based on Application of Ion Chromatography with Pulsed Amperometric Detection

PubMed Central

Ruman, Marek; Narkowicz, Sylwia; Namieśnik, Jacek

2017-01-01

A simple and accurate ion chromatography (IC) method with pulsed amperometric detection (PAD) was proposed for the determination of cyanide ion in urine, sweat, and saliva samples. The sample pretreatment relies on alkaline digestion and application of Dionex OnGuard II H cartridge. Under the optimized conditions, the method showed good linearity in the range of 1–100 μg/L for urine, 5–100 μg/L for saliva, and 3–100 μg/L for sweat samples with determination coefficients (R) > 0.992. Low detection limits (LODs) in the range of 1.8 μg/L, 5.1 μg/L, and 5.8 μg/L for urine, saliva, and sweat samples, respectively, and good repeatability (CV < 3%, n = 3) were obtained. The proposed method has been successfully applied to the analysis of human biological samples. PMID:29348966

Development of an Analytical Protocol for Determination of Cyanide in Human Biological Samples Based on Application of Ion Chromatography with Pulsed Amperometric Detection.

PubMed

Jaszczak, Ewa; Ruman, Marek; Narkowicz, Sylwia; Namieśnik, Jacek; Polkowska, Żaneta

2017-01-01

A simple and accurate ion chromatography (IC) method with pulsed amperometric detection (PAD) was proposed for the determination of cyanide ion in urine, sweat, and saliva samples. The sample pretreatment relies on alkaline digestion and application of Dionex OnGuard II H cartridge. Under the optimized conditions, the method showed good linearity in the range of 1-100  μ g/L for urine, 5-100  μ g/L for saliva, and 3-100  μ g/L for sweat samples with determination coefficients ( R ) > 0.992. Low detection limits (LODs) in the range of 1.8  μ g/L, 5.1  μ g/L, and 5.8  μ g/L for urine, saliva, and sweat samples, respectively, and good repeatability (CV < 3%, n = 3) were obtained. The proposed method has been successfully applied to the analysis of human biological samples.

Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

Treesearch

Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Adam J. Sepulveda; Bradley B. Shepard; Stephen F. Jane; Andrew R. Whiteley; Winsor H. Lowe; Michael K. Schwartz

2016-01-01

Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive...

Steroidal hormones and other endocrine active compounds in shallow groundwater in nonagricultural areas of Minnesota—Study design, methods, and data, 2009–10

USGS Publications Warehouse

Erickson, Melinda L.

2012-01-01

The U.S. Geological Survey, in cooperation with the Minnesota Pollution Control Agency, completed a study on the occurrence of steroidal hormones and other endocrine active compounds in shallow groundwater in nonagricultural areas of Minnesota during 2009–10. This report describes the study design and methods, and presents the data collected on steroidal hormones and other related compounds. Environmental and quality-control samples were collected from 40 wells as part of this study. Samples were analyzed by the U.S. Geological Survey National Water Quality Laboratory for 16 steroidal hormones and 4 other related compounds, of which all but 2 compounds are endocrine active compounds. Most of the water samples did not contain detectable concentrations of any of the 20 compounds analyzed. Water samples from three wells had detectable concentrations of one or more compounds. Bisphenol A was detected in samples from three wells, and trans-diethylstilbestrol was detected in one of the samples in which bisphenol A also was detected.

Parallel evaluation of broad virus detection methods.

PubMed

Modrof, Jens; Berting, Andreas; Kreil, Thomas R

2014-01-01

The testing for adventitious viruses is of critical importance during development and production of biological products. The recent emergence and ongoing development of broad virus detection methods calls for an evaluation of whether these methods can appropriately be implemented into current adventitious agent testing procedures. To assess the suitability of several broad virus detection methods, a comparative experimental study was conducted: four virus preparations, which were spiked at two different concentrations each into two different cell culture media, were sent to four investigators in a blinded fashion for analysis with broad virus detection methods such as polymerase chain reaction-electrospray ionization mass spectrometry (PCR-ESI/MS), microarray, and two approaches utilizing massively parallel sequencing. The results that were reported by the investigators revealed that all methods were able to identify the majority of samples correctly (mean 83%), with a surprisingly narrow range among the methods, that is, between 72% (PCR-ESI/MS) and 95% (microarray). In addition to the correct results, a variety of unexpected assignments were reported for a minority of samples, again with little variation regarding the methods used (range 20-45%), while false negatives were reported for 0-25% of the samples. Regarding assay sensitivity, the viruses were detected by all methods included in this study at concentrations of about 4-5 log10 quantitative PCR copies/mL, and probably with higher sensitivity in some cases. In summary, the broad virus detection methods investigated were shown to be suitable even for detection of relatively low virus concentrations. However, there is also some potential for the production of false-positive as well as false-negative assignments, which indicates the requirement for further improvements before these methods can be considered for routine use. © PDA, Inc. 2014.

Gas chromatography with flame photometric detection of 31 organophosphorus pesticide residues in Alpinia oxyphylla dried fruits.

PubMed

Zhao, Xiangsheng; Kong, Weijun; Wei, Jianhe; Yang, Meihua

2014-11-01

A simple, rapid and effective gas chromatography-flame photometric detection method was established for simultaneous multi-component determination of 31 organophosphorus pesticides (OPPs) residues in Alpinia oxyphylla, which is widely consumed as a traditional medicine and food in China. Sample preparation was completed in a single step without any clean-up procedure. All pesticides expressed good linear relationships between 0.004 and 1.0 μg/mL with correlation coefficients higher than 0.9973. The method gave satisfactory recoveries for most pesticides. The limits of detection varied from 1 to 10 ng/mL, and the limits of quantification (LOQs) were between 4 and 30 ng/mL. The proposed method was successfully applied to 55 commercial samples purchased from five different areas. Five pesticide residues were detected in four (7.27%) samples. The positive samples were confirmed by gas chromatography with tandem mass spectrometry (GC-MS/MS). Copyright © 2014 Elsevier Ltd. All rights reserved.

Field Detection of Citrus Huanglongbing Associated with ' Candidatus Liberibacter Asiaticus' by Recombinese Polymerase Amplification within 15 min.

PubMed

Qian, Wenjuan; Lu, Ying; Meng, Youqing; Ye, Zunzhong; Wang, Liu; Wang, Rui; Zheng, Qiqi; Wu, Hui; Wu, Jian

2018-06-06

' Candidatus Liberibacter asiaticus' (Las) is the most prevalent bacterium associated with huanglongbing, which is one of the most destructive diseases of citrus. In this paper, an extremely rapid and simple method for field detection of Las from leaf samples, based on recombinase polymerase amplification (RPA), is described. Three RPA primer pairs were designed and evaluated. RPA amplification was optimized so that it could be accomplished within 10 min. In combination with DNA crude extraction by a 50-fold dilution after 1 min of grinding in 0.5 M sodium hydroxide and visual detection via fluorescent DNA dye (positive samples display obvious green fluorescence while negative samples remain colorless), the whole detection process can be accomplished within 15 min. The sensitivity and specificity of this RPA-based method were evaluated and were proven to be equal to those of real-time PCR. The reliability of this method was also verified by analyzing field samples.

Label-free virus detection using silicon photonic microring resonators

PubMed Central

McClellan, Melinda S.; Domier, Leslie L; Bailey, Ryan C.

2013-01-01

Viruses represent a continual threat to humans through a number of mechanisms, which include disease, bioterrorism, and destruction of both plant and animal food resources. Many contemporary techniques used for the detection of viruses and viral infections suffer from limitations such as the need for extensive sample preparation or the lengthy window between infection and measurable immune response, for serological methods. In order to develop a method that is fast, cost-effective, and features reduced sample preparation compared to many other virus detection methods, we report the application of silicon photonic microring resonators for the direct, label-free detection of intact viruses in both purified samples as well as in a complex, real-world analytical matrix. As a model system, we demonstrate the quantitative detection of Bean pod mottle virus, a pathogen of great agricultural importance, with a limit of detection of 10 ng/mL. By simply grinding a small amount of leaf sample in buffer with a mortar and pestle, infected leaves can be identified over a healthy control with a total analysis time of less than 45 min. Given the inherent scalability and multiplexing capability of the semiconductor-based technology, we feel that silicon photonic microring resonators are well-positioned as a promising analytical tool for a number of viral detection applications. PMID:22138465

Ensemble based adaptive over-sampling method for imbalanced data learning in computer aided detection of microaneurysm.

PubMed

Ren, Fulong; Cao, Peng; Li, Wei; Zhao, Dazhe; Zaiane, Osmar

2017-01-01

Diabetic retinopathy (DR) is a progressive disease, and its detection at an early stage is crucial for saving a patient's vision. An automated screening system for DR can help in reduce the chances of complete blindness due to DR along with lowering the work load on ophthalmologists. Among the earliest signs of DR are microaneurysms (MAs). However, current schemes for MA detection appear to report many false positives because detection algorithms have high sensitivity. Inevitably some non-MAs structures are labeled as MAs in the initial MAs identification step. This is a typical "class imbalance problem". Class imbalanced data has detrimental effects on the performance of conventional classifiers. In this work, we propose an ensemble based adaptive over-sampling algorithm for overcoming the class imbalance problem in the false positive reduction, and we use Boosting, Bagging, Random subspace as the ensemble framework to improve microaneurysm detection. The ensemble based over-sampling methods we proposed combine the strength of adaptive over-sampling and ensemble. The objective of the amalgamation of ensemble and adaptive over-sampling is to reduce the induction biases introduced from imbalanced data and to enhance the generalization classification performance of extreme learning machines (ELM). Experimental results show that our ASOBoost method has higher area under the ROC curve (AUC) and G-mean values than many existing class imbalance learning methods. Copyright © 2016 Elsevier Ltd. All rights reserved.

An Improved Sparse Representation over Learned Dictionary Method for Seizure Detection.

PubMed

Li, Junhui; Zhou, Weidong; Yuan, Shasha; Zhang, Yanli; Li, Chengcheng; Wu, Qi

2016-02-01

Automatic seizure detection has played an important role in the monitoring, diagnosis and treatment of epilepsy. In this paper, a patient specific method is proposed for seizure detection in the long-term intracranial electroencephalogram (EEG) recordings. This seizure detection method is based on sparse representation with online dictionary learning and elastic net constraint. The online learned dictionary could sparsely represent the testing samples more accurately, and the elastic net constraint which combines the 11-norm and 12-norm not only makes the coefficients sparse but also avoids over-fitting problem. First, the EEG signals are preprocessed using wavelet filtering and differential filtering, and the kernel function is applied to make the samples closer to linearly separable. Then the dictionaries of seizure and nonseizure are respectively learned from original ictal and interictal training samples with online dictionary optimization algorithm to compose the training dictionary. After that, the test samples are sparsely coded over the learned dictionary and the residuals associated with ictal and interictal sub-dictionary are calculated, respectively. Eventually, the test samples are classified as two distinct categories, seizure or nonseizure, by comparing the reconstructed residuals. The average segment-based sensitivity of 95.45%, specificity of 99.08%, and event-based sensitivity of 94.44% with false detection rate of 0.23/h and average latency of -5.14 s have been achieved with our proposed method.

Simultaneous quantitative analysis of arsenic, bismuth, selenium, and tellurium in soil samples using multi-channel hydride-generation atomic fluorescence spectrometry.

PubMed

Wang, Fang; Zhang, Gai

2011-03-01

The basic principles and the application of hydride-generation multi-channel atomic fluorescence spectrometry (HG-MC-AFS) in soil analysis are described. It is generally understood that only one or two elements can be simultaneously detected by commonly used one- or two-channel HG-AFS. In this work, a new sample-sensitive and effective method for the analysis of arsenic, bismuth, tellurium, and selenium in soil samples by simultaneous detection using HG-MC-AFS was developed. The method detection limits for arsenic, bismuth, tellurium, and selenium are 0.19 μg/g, 0.10 μg/g, 0.11 μg/g, and 0.08 μg/g, respectively. This method was successfully applied to the simultaneous determination of arsenic, bismuth, tellurium, and selenium in soil samples.

Automated Broad-Range Molecular Detection of Bacteria in Clinical Samples

PubMed Central

Hoogewerf, Martine; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

2016-01-01

Molecular detection methods, such as quantitative PCR (qPCR), have found their way into clinical microbiology laboratories for the detection of an array of pathogens. Most routinely used methods, however, are directed at specific species. Thus, anything that is not explicitly searched for will be missed. This greatly limits the flexibility and universal application of these techniques. We investigated the application of a rapid universal bacterial molecular identification method, IS-pro, to routine patient samples received in a clinical microbiology laboratory. IS-pro is a eubacterial technique based on the detection and categorization of 16S-23S rRNA gene interspace regions with lengths that are specific for each microbial species. As this is an open technique, clinicians do not need to decide in advance what to look for. We compared routine culture to IS-pro using 66 samples sent in for routine bacterial diagnostic testing. The samples were obtained from patients with infections in normally sterile sites (without a resident microbiota). The results were identical in 20 (30%) samples, IS-pro detected more bacterial species than culture in 31 (47%) samples, and five of the 10 culture-negative samples were positive with IS-pro. The case histories of the five patients from whom these culture-negative/IS-pro-positive samples were obtained suggest that the IS-pro findings are highly clinically relevant. Our findings indicate that an open molecular approach, such as IS-pro, may have a high added value for clinical practice. PMID:26763956

Effective PCR detection of animal species in highly processed animal byproducts and compound feeds.

PubMed

Fumière, Olivier; Dubois, Marc; Baeten, Vincent; von Holst, Christoph; Berben, Gilbert

2006-07-01

In this paper we present a polymerase chain reaction (PCR)-based method for detecting meat and bone meal (MBM) in compound feedingstuffs. By choosing adequate DNA targets from an appropriate localisation in the genome, the real-time PCR method developed here proved to be robust to severe heat treatment of the MBM, showing high sensitivity in the detection of MBM. The method developed here permits the specific detection of processed pig and cattle materials treated at 134 degrees C in various feed matrices down to a limit of detection of about 0.1%. This technique has also been successfully applied to well-characterised MBM samples heated to as high as 141 degrees C, as well as to various blind feed samples with very low MBM contents. Finally, the method also passed several official European ring trials.

Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

PubMed

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

Rapid detection of total and viable Legionella pneumophila in tap water by immunomagnetic separation, double fluorescent staining and flow cytometry.

PubMed

Keserue, Hans-Anton; Baumgartner, Andreas; Felleisen, Richard; Egli, Thomas

2012-11-01

We developed a rapid detection method for Legionella pneumophila (Lp) by filtration, immunomagnetic separation, double fluorescent staining, and flow cytometry (IMS-FCM method). The method requires 120 min and can discriminate 'viable' and 'membrane-damaged' cells. The recovery is over 85% of spiked Lp SG 1 cells in 1 l of tap water and detection limits are around 50 and 15 cells per litre for total and viable Lp, respectively. The method was compared using water samples from house installations in a blind study with three environmental laboratories performing the ISO 11731 plating method. In 53% of the water samples from different taps and showers significantly higher concentrations of Lp were detected by flow cytometry. No correlation to the plate culture method was found. Since also 'viable but not culturable' (VNBC) cells are detected by our method, this result was expected. The IMS-FCM method is limited by the specificity of the used antibodies; in the presented case they target Lp serogroups 1-12. This and the fact that no Lp-containing amoebae are detected may explain why in 21% of all samples higher counts were observed using the plate culture method. Though the IMS-FCM method is not yet fit to completely displace the established plating method (ISO 11731) for routine Lp monitoring, it has major advantages to plating and can quickly provide important insights into the ecology of this pathogen in water distribution systems. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Rapid detection of acetamiprid in foods using surface-enhanced Raman spectroscopy (SERS).

PubMed

Wijaya, Wisiani; Pang, Shintaro; Labuza, Theodore P; He, Lili

2014-04-01

Acetamiprid is a neonicotinoid pesticide that is commonly used in modern farming. Acetamiprid residue in food commodities can be a potential harm to human and has been implicated in the honey bee hive die off crisis. In this study, we developed rapid, simple, and sensitive methods to detect acetamiprid in apple juice and on apple surfaces using surface-enhanced Raman spectroscopy (SERS). No pretreatment of apple juice sample was performed. A simple surface swab method was used to recover acetamiprid from the apple surface. Samples were incubated with silver dendrites for several minutes and SERS spectra were taken directly from the silver surface. Detection of a set of 5 apple juice samples can be done within 10 min. The swab-SERS method took 15 min for a set of 5 samples. Resulting spectral data were analyzed using principal component analysis. The highest acetamiprid peak at 634 cm(-1) was used to detect and quantify the amount of acetamiprid spiked in 1:1 water-methanol solvent, apple juice, and on apple surface. The SERS method was able to successfully detect acetamiprid at 0.5 μg/mL (0.5 ppm) in solvent, 3 μg/mL (3 ppm) in apple juice, and 0.125 μg/cm(2) on apple surfaces. The SERS methods provide simple, rapid, and sensitive ways to detect acetamiprid in beverages and on the surfaces of thick skinned fruits and vegetables. © 2014 Institute of Food Technologists®

Rapid combined assay for Salmonella detection in food samples.

PubMed

Gadó, I; Major, P; Király, M; Pláveczky, M G

2000-01-01

A rapid method was developed to detect salmonellae in food samples. The method gave a possibility to obtain results after 28 h 30 min. The preenrichment in buffered peptone water lasted for 6 h, the enrichment in Rappaport-Vassiliadis medium was applied for 18 h followed by PCR with INVA1-INVA2 primer pair, adapting Chiu and Ou's method. This procedure was suitable to demonstrate salmonella contamination at min. 10 cfu/25 g sample. Out of 18 samples there was a good agreement between the results of the conventional and rapid methods in case of 17 samples. PCR with SPVC1-SPVC2 primer pair informing about the presence of virulence plasmid was performed in separate tubes, because decreased sensitivity was observed in case of multiplex PCR.

Optimization of the solvent-based dissolution method to sample volatile organic compound vapors for compound-specific isotope analysis.

PubMed

Bouchard, Daniel; Wanner, Philipp; Luo, Hong; McLoughlin, Patrick W; Henderson, James K; Pirkle, Robert J; Hunkeler, Daniel

2017-10-20

The methodology of the solvent-based dissolution method used to sample gas phase volatile organic compounds (VOC) for compound-specific isotope analysis (CSIA) was optimized to lower the method detection limits for TCE and benzene. The sampling methodology previously evaluated by [1] consists in pulling the air through a solvent to dissolve and accumulate the gaseous VOC. After the sampling process, the solvent can then be treated similarly as groundwater samples to perform routine CSIA by diluting an aliquot of the solvent into water to reach the required concentration of the targeted contaminant. Among solvents tested, tetraethylene glycol dimethyl ether (TGDE) showed the best aptitude for the method. TGDE has a great affinity with TCE and benzene, hence efficiently dissolving the compounds during their transition through the solvent. The method detection limit for TCE (5±1μg/m 3 ) and benzene (1.7±0.5μg/m 3 ) is lower when using TGDE compared to methanol, which was previously used (385μg/m 3 for TCE and 130μg/m 3 for benzene) [2]. The method detection limit refers to the minimal gas phase concentration in ambient air required to load sufficient VOC mass into TGDE to perform δ 13 C analysis. Due to a different analytical procedure, the method detection limit associated with δ 37 Cl analysis was found to be 156±6μg/m 3 for TCE. Furthermore, the experimental results validated the relationship between the gas phase TCE and the progressive accumulation of dissolved TCE in the solvent during the sampling process. Accordingly, based on the air-solvent partitioning coefficient, the sampling methodology (e.g. sampling rate, sampling duration, amount of solvent) and the final TCE concentration in the solvent, the concentration of TCE in the gas phase prevailing during the sampling event can be determined. Moreover, the possibility to analyse for TCE concentration in the solvent after sampling (or other targeted VOCs) allows the field deployment of the sampling method without the need to determine the initial gas phase TCE concentration. The simplified field deployment approach of the solvent-based dissolution method combined with the conventional analytical procedure used for groundwater samples substantially facilitates the application of CSIA to gas phase studies. Copyright © 2017 Elsevier B.V. All rights reserved.

Virus recovering from strawberries: Evaluation of a skimmed milk organic flocculation method for assessment of microbiological contamination.

PubMed

Melgaço, Fabiana Gil; Victoria, Matias; Corrêa, Adriana Abreu; Ganime, Ana Carolina; Malta, Fábio Correia; Brandão, Marcelo Luiz Lima; de Mello Medeiros, Valéria; de Oliveira Rosas, Carla; Bricio, Silvia Maria Lopes; Miagostovich, Marize Pereira

2016-01-18

Skimmed milk organic flocculation method was adapted, optimized and compared with polyethylene glycol (PEG) precipitation and filtration methods for recovering viruses from a strawberry matrix. Spiking experiments with norovirus genogroup II genotype 4 (NoV GII.4) and murine norovirus 1 (MNV-1) demonstrated that the organic flocculation method associated with a glycine elution buffer, filter bag and cetyltrimethylammonium bromide (CTAB) showed a recovery percentage of 2.5 and 32 times higher than PEG precipitation and filtration methodologies for NoV recovering. Furthermore, this method was used for investigating NoV and human adenoviruses (HAdVs) in 90 samples of fresh strawberries commercialized in Rio de Janeiro markets. NoV GI and GII were not detected in those samples and MNV-1, used as internal process control (IPC), was recovered in 95.5% (86) of them. HAdVs were detected in 18 (20.0%) samples and characterized by nucleotide sequencing as Human Mastadenovirus specie F and as type specie HAdV-2. Bacterial analysis did not detect Salmonella spp. and Listeria monocytogenes, however, 3.3% of fecal coliforms were detected in those samples. These results indicate the organic flocculation method as an alternative for recovering enteric viruses from strawberries, emphasizing a need for virus surveillance in food matrices.

Detection of alpha-fetoprotein in magnetic immunoassay of thin channels using biofunctional nanoparticles

NASA Astrophysics Data System (ADS)

Tsai, H. Y.; Gao, B. Z.; Yang, S. F.; Li, C. S.; Fuh, C. Bor

2014-01-01

This paper presents the use of fluorescent biofunctional nanoparticles (10-30 nm) to detect alpha-fetoprotein (AFP) in a thin-channel magnetic immunoassay. We used an AFP model biomarker and s-shaped deposition zones to test the proposed detection method. The results show that the detection using fluorescent biofunctional nanoparticle has a higher throughput than that of functional microparticle used in previous experiments on affinity reactions. The proposed method takes about 3 min (versus 150 min of previous method) to detect 100 samples. The proposed method is useful for screening biomarkers in clinical applications, and can reduce the run time for sandwich immunoassays to less than 20 min. The detection limits (0.06 pg/ml) and linear ranges (0.068 pg/ml-0.68 ng/ml) of AFP using fluorescent biofunctional nanoparticles are the same as those of using functional microparticles within experimental errors. This detection limit is substantially lower and the linear range is considerably wider than those of enzyme-linked immunosorbent assay (ELISA) and other methods in sandwich immunoassay methods. The differences between this method and an ELISA in AFP measurements of serum samples were less than 12 %. The proposed method provides simple, fast, and sensitive detection with a high throughput for biomarkers.

Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples

USGS Publications Warehouse

Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.

2013-01-01

Environmental DNA (eDNA) methods for detecting aquatic species are advancing rapidly, but with little evaluation of field protocols or precision of resulting estimates. We compared sampling results from traditional field methods with eDNA methods for two amphibians in 13 streams in central Idaho, USA. We also evaluated three water collection protocols and the influence of sampling location, time of day, and distance from animals on eDNA concentration in the water. We found no difference in detection or amount of eDNA among water collection protocols. eDNA methods had slightly higher detection rates than traditional field methods, particularly when species occurred at low densities. eDNA concentration was positively related to field-measured density, biomass, and proportion of transects occupied. Precision of eDNA-based abundance estimates increased with the amount of eDNA in the water and the number of replicate subsamples collected. eDNA concentration did not vary significantly with sample location in the stream, time of day, or distance downstream from animals. Our results further advance the implementation of eDNA methods for monitoring aquatic vertebrates in stream habitats.

Detection of Multi-walled Carbon Nanotubes and Carbon Nanodiscs on Workplace Surfaces at a Small-Scale Producer.

PubMed

Hedmer, Maria; Ludvigsson, Linus; Isaxon, Christina; Nilsson, Patrik T; Skaug, Vidar; Bohgard, Mats; Pagels, Joakim H; Messing, Maria E; Tinnerberg, Håkan

2015-08-01

The industrial use of novel-manufactured nanomaterials such as carbon nanotubes and carbon nanodiscs is increasing globally. Occupational exposure can occur during production, downstream use, and disposal. The health effects of many nanomaterials are not yet fully characterized and to handle nano-objects, their aggregates and agglomerates >100nm (NOAA), a high degree of control measures and personal protective equipment are required. The emission of airborne NOAA during production and handling can contaminate workplace surfaces with dust, which can be resuspended resulting in secondary inhalation exposures and dermal exposures. This study surveys the presence of carbon-based nanomaterials, such as multi-walled carbon nanotubes (MWCNTs) and carbon nanodiscs, as surface contamination at a small-scale producer using a novel tape sampling method. Eighteen different surfaces at a small-scale producer were sampled with an adhesive tape sampling method. The surfaces selected were associated with the production and handling of MWCNT powder in the near-field zone. Surfaces in the far-field zone were also sampled. In addition, tape stripping of the skin was performed on one worker. The tape samples were analysed with scanning electron microscopy to detect the carbon-based NOAA. Air sampling with a personal impactor was also performed on a worker who was producing MWCNTs the same day as the tape samples were collected. MWCNTs were detected in 50% of the collected tape samples and carbon nanodiscs in 17%. MWCNTs and carbon nanodiscs were identified in all parts of the workplace, thus, increasing the risk for secondary inhalation and dermal exposure of the workers. Both airborne MWCNTs and carbon nanodiscs were detected in the personal impactor samples. The tape-strip samples from the worker showed no presence of carbon-containing nanoparticles. Tape sampling is a functional method for detecting surface contamination of carbon-based NOAA and for exposure control during production at potentially any workplace that produces or handles such manufactured nanomaterials. With the tape method, it is possible to monitor if a potential for secondary inhalation exposure or dermal exposure exists through resuspension of dust deposited on workplace surfaces. By means of air sampling, we could confirm that carbon nanodiscs were resuspended into the air at the workplace even though they were not handled during that particular work shift. MWCNTs were detected in the air samples, but can have been derived from either resuspension or from the work tasks with MWCNTs that were performed during the air sampling. Tape sampling is a complementary method to air sampling and together these two methods provide a better view of the hygienic situation in workplaces where NOAA can be emitted into work environments. © The Author 2015. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.

Inflight Microbial Monitoring-An Alternative Method to Culture Based Detection Currently Used on International Space Station

NASA Technical Reports Server (NTRS)

Khodadad, Christina L.; Birmele, Michele N.; Roman, Monsi; Hummerick, Mary E.; Smith, David J.; Wheeler, Raymond M.

2015-01-01

Previous research has shown that microorganisms and potential human pathogens have been detected on the International Space Station (ISS). The potential to introduce new microorganisms occurs with every exchange of crew or addition of equipment or supplies. Previous research has shown that microorganisms introduced to the ISS are readily transferred between crew and subsystems and back (i.e. ECLSS, environmental control and life support systems). Current microbial characterization methods require enrichment of microorganisms and a 48-hour incubation time. This increases the microbial load while detecting a limited number of microorganisms. The culture based method detects approximately 1-10% of the total organisms present and provides no identification, To identify and enumerate ISS samples requires that samples to be returned to Earth for complete analysis. Therefore, a more expedient, low-cost, in-flight method of microbial detection, identification, and enumeration is warranted. The RAZOR EX, a ruggedized, commercial off the shelf, real-time PCR field instrument was tested for its ability to detect microorganism at low concentrations within one hour. Escherichia coli, Salmonella enterica Typhimurium, and Pseudomonas aeruginosa were detected at low levels using real-time DNA amplification. Total heterotrophic counts could also be detected using a 16S gene marker that can identify up to 98% of all bacteria. To reflect viable cells found in the samples, RNA was also detectable using a modified, single-step reverse transcription reaction.

Flow cytometric detection method for DNA samples

DOEpatents

Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Round Rock, TX

2011-07-05

Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM.TM. on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA.TM., on the 5' end.

Flow cytometric detection method for DNA samples

DOEpatents

Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Livermore, CA

2006-08-01

Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM, on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA, on the 5' end.

Measurement of pattern roughness and local size variation using CD-SEM: current status

NASA Astrophysics Data System (ADS)

Fukuda, Hiroshi; Kawasaki, Takahiro; Kawada, Hiroki; Sakai, Kei; Kato, Takashi; Yamaguchi, Satoru; Ikota, Masami; Momonoi, Yoshinori

2018-03-01

Measurement of line edge roughness (LER) is discussed from four aspects: edge detection, PSD prediction, sampling strategy, and noise mitigation, and general guidelines and practical solutions for LER measurement today are introduced. Advanced edge detection algorithms such as wave-matching method are shown effective for robustly detecting edges from low SNR images, while conventional algorithm with weak filtering is still effective in suppressing SEM noise and aliasing. Advanced PSD prediction method such as multi-taper method is effective in suppressing sampling noise within a line edge to analyze, while number of lines is still required for suppressing line to line variation. Two types of SEM noise mitigation methods, "apparent noise floor" subtraction method and LER-noise decomposition using regression analysis are verified to successfully mitigate SEM noise from PSD curves. These results are extended to LCDU measurement to clarify the impact of SEM noise and sampling noise on LCDU.

A simple high performance liquid chromatography method for analyzing paraquat in soil solution samples.

PubMed

Ouyang, Ying; Mansell, Robert S; Nkedi-Kizza, Peter

2004-01-01

A high performance liquid chromatography (HPLC) method with UV detection was developed to analyze paraquat (1,1'-dimethyl-4,4'-dipyridinium dichloride) herbicide content in soil solution samples. The analytical method was compared with the liquid scintillation counting (LSC) method using 14C-paraquat. Agreement obtained between the two methods was reasonable. However, the detection limit for paraquat analysis was 0.5 mg L(-1) by the HPLC method and 0.05 mg L(-1) by the LSC method. The LSC method was, therefore, 10 times more precise than the HPLC method for solution concentrations less than 1 mg L(-1). In spite of the high detection limit, the UC (nonradioactive) HPLC method provides an inexpensive and environmentally safe means for determining paraquat concentration in soil solution compared with the 14C-LSC method.

RCRA Facility investigation report for Waste Area Grouping 6 at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Volume 5, Technical Memorandums 06-09A, 06-10A, and 06-12A

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

This report provides a detailed summary of the activities carried out to sample groundwater at Waste Area Grouping (WAG) 6. The analytical results for samples collected during Phase 1, Activity 2 of the WAG 6 Resource Conservation and Recovery Act Facility Investigation (RFI) are also presented. In addition, analytical results for Phase 1, activity sampling events for which data were not previously reported are included in this TM. A summary of the groundwater sampling activities of WAG 6, to date, are given in the Introduction. The Methodology section describes the sampling procedures and analytical parameters. Six attachments are included. Attachmentsmore » 1 and 2 provide analytical results for selected RFI groundwater samples and ORNL sampling event. Attachment 3 provides a summary of the contaminants detected in each well sampled for all sampling events conducted at WAG 6. Bechtel National Inc. (BNI)/IT Corporation Contract Laboratory (IT) RFI analytical methods and detection limits are given in Attachment 4. Attachment 5 provides the Oak Ridge National Laboratory (ORNL)/Analytical Chemistry Division (ACD) analytical methods and detection limits and Resource Conservation and Recovery Act (RCRA) quarterly compliance monitoring (1988--1989). Attachment 6 provides ORNL/ACD groundwater analytical methods and detection limits (for the 1990 RCRA semi-annual compliance monitoring).« less

Combination of atomic force microscopy and mass spectrometry for the detection of target protein in the serum samples of children with autism spectrum disorders

NASA Astrophysics Data System (ADS)

Kaysheva, A. L.; Pleshakova, T. O.; Kopylov, A. T.; Shumov, I. D.; Iourov, I. Y.; Vorsanova, S. G.; Yurov, Y. B.; Ziborov, V. S.; Archakov, A. I.; Ivanov, Y. D.

2017-10-01

Possibility of detection of target proteins associated with development of autistic disorders in children with use of combined atomic force microscopy and mass spectrometry (AFM/MS) method is demonstrated. The proposed method is based on the combination of affine enrichment of proteins from biological samples and visualization of these proteins by AFM and MS analysis with quantitative detection of target proteins.

Rapid fusion method for the determination of Pu, Np, and Am in large soil samples

DOE PAGES

Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; ...

2015-02-14

A new rapid sodium hydroxide fusion method for the preparation of 10-20 g soil samples has been developed by the Savannah River National Laboratory (SRNL). The method enables lower detection limits for plutonium, neptunium, and americium in environmental soil samples. The method also significantly reduces sample processing time and acid fume generation compared to traditional soil digestion techniques using hydrofluoric acid. Ten gram soil aliquots can be ashed and fused using the new method in 1-2 hours, completely dissolving samples, including refractory particles. Pu, Np and Am are separated using stacked 2mL cartridges of TEVA and DGA Resin and measuredmore » using alpha spectrometry. The method can be adapted for measurement by inductively-coupled plasma mass spectrometry (ICP-MS). Two 10 g soil aliquots of fused soil may be combined prior to chromatographic separations to further improve detection limits. Total sample preparation time, including chromatographic separations and alpha spectrometry source preparation, is less than 8 hours.« less

Estimating the Effects of Detection Heterogeneity and Overdispersion on Trends Estimated from Avian Point Counts

EPA Science Inventory

Point counts are a common method for sampling avian distribution and abundance. Though methods for estimating detection probabilities are available, many analyses use raw counts and do not correct for detectability. We use a removal model of detection within an N-mixture approa...

Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material

PubMed Central

Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.

2000-01-01

A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384

Investigation of Human Cancers for Retrovirus by Low-Stringency Target Enrichment and High-Throughput Sequencing.

PubMed

Vinner, Lasse; Mourier, Tobias; Friis-Nielsen, Jens; Gniadecki, Robert; Dybkaer, Karen; Rosenberg, Jacob; Langhoff, Jill Levin; Cruz, David Flores Santa; Fonager, Jannik; Izarzugaza, Jose M G; Gupta, Ramneek; Sicheritz-Ponten, Thomas; Brunak, Søren; Willerslev, Eske; Nielsen, Lars Peter; Hansen, Anders Johannes

2015-08-19

Although nearly one fifth of all human cancers have an infectious aetiology, the causes for the majority of cancers remain unexplained. Despite the enormous data output from high-throughput shotgun sequencing, viral DNA in a clinical sample typically constitutes a proportion of host DNA that is too small to be detected. Sequence variation among virus genomes complicates application of sequence-specific, and highly sensitive, PCR methods. Therefore, we aimed to develop and characterize a method that permits sensitive detection of sequences despite considerable variation. We demonstrate that our low-stringency in-solution hybridization method enables detection of <100 viral copies. Furthermore, distantly related proviral sequences may be enriched by orders of magnitude, enabling discovery of hitherto unknown viral sequences by high-throughput sequencing. The sensitivity was sufficient to detect retroviral sequences in clinical samples. We used this method to conduct an investigation for novel retrovirus in samples from three cancer types. In accordance with recent studies our investigation revealed no retroviral infections in human B-cell lymphoma cells, cutaneous T-cell lymphoma or colorectal cancer biopsies. Nonetheless, our generally applicable method makes sensitive detection possible and permits sequencing of distantly related sequences from complex material.

Pneumocystis jiroveci in HIV/AIDS patients: detection by FTA filter paper together with PCR in noninvasive induced sputum specimens.

PubMed

Jaijakul, Siraya; Saksirisampant, Wilai; Prownebon, Juraratt; Yenthakam, Sutin; Mungthin, Mathirut; Leelayoova, Saovanee; Nuchprayoon, Surang

2005-09-01

To detect P. jiroveci (previously named P. carinii) by PCR using FTA filter paper to extract the DNA, from noninvasive induced sputum samples of HIV/AIDS patients. Fifty two HIV/AIDS patients suspected of Pneumocystis jiroveci pneumonia (PJP) in King Chulalongkorn Memorial Hospital were recruited. Both cytological method and PCR with FTA filter paper technique were performed to detect P jiroveci from each specimen. The detectability rate of P. jiroveci infection was 21%. The PCR with FTA filter paper method was 4 folds much more sensitive than Giemsa staining technique. P. jiroveci was detected in 18% of the HIV/AIDS patients in spite of receiving standard PJP prophylaxis. Detection of P. jiroveci by using FTA filter paper together with PCR in induced sputum samples could detect more cases of P. jiroveci infection than by using cytological method. DNA extraction using the FTA filter paper was more rapid and convenient than other extraction methods. The causes of failure of PJP prophylaxis should be evaluated.

Rapid and Highly Sensitive Detection of Lead Ions in Drinking Water Based on a Strip Immunosensor

PubMed Central

Kuang, Hua; Xing, Changrui; Hao, Changlong; Liu, Liqiang; Wang, Libing; Xu, Chuanlai

2013-01-01

In this study, we have first developed a rapid and sensitive strip immunosensor based on two heterogeneously-sized gold nanoparticles (Au NPs) probes for the detection of trace lead ions in drinking water. The sensitivity was 4-fold higher than that of the conventional LFA under the optimized conditions. The visual limit of detection (LOD) of the amplified method for qualitative detection lead ions was 2 ng/mL and the LOD for semi-quantitative detection could go down to 0.19 ng/mL using a scanning reader. The method suffered from no interference from other metal ions and could be used to detect trace lead ions in drinking water without sample enrichment. The recovery of the test samples ranged from 96% to 103%. As the detection method could be accomplished within 15 min, this method could be used as a potential tool for preliminary monitoring of lead contamination in drinking water. PMID:23539028

Comparing efficiency of American Fisheries Society standard snorkeling techniques to environmental DNA sampling techniques

USGS Publications Warehouse

Ulibarri, Roy M.; Bonar, Scott A.; Rees, Christopher B.; Amberg, Jon J.; Ladell, Bridget; Jackson, Craig

2017-01-01

Analysis of environmental DNA (eDNA) is an emerging technique used to detect aquatic species through water sampling and the extraction of biological material for amplification. Our study compared the efficacy of eDNA methodology to American Fisheries Society (AFS) standard snorkeling surveys with regard to detecting the presence of rare fish species. Knowing which method is more efficient at detecting target species will help managers to determine the best way to sample when both traditional sampling methods and eDNA sampling are available. Our study site included three Navajo Nation streams that contained Navajo Nation Genetic Subunit Bluehead Suckers Catostomus discobolus and Zuni Bluehead Suckers C. discobolus yarrowi. We first divided the entire wetted area of streams into consecutive 100-m reaches and then systematically selected 10 reaches/stream for snorkel and eDNA surveys. Surface water samples were taken in 10-m sections within each 100-m reach, while fish presence was noted via snorkeling in each 10-m section. Quantitative PCR was run on each individual water sample in quadruplicate to test for the presence or absence of the target species. With eDNA sampling techniques, we were able to positively detect both species in two out of the three streams. Snorkeling resulted in positive detection of both species in all three streams. In streams where the target species were detected with eDNA sampling, snorkeling detected fish at 11–29 sites/stream, whereas eDNA detected fish at 3–12 sites/stream. Our results suggest that AFS standard snorkeling is more effective than eDNA for detecting target fish species. To improve our eDNA procedures, the amount of water collected and tested should be increased. Additionally, filtering water on-site may improve eDNA techniques for detecting fish. Future research should focus on standardization of eDNA sampling to provide a widely operational sampling tool.

A Method for Choosing the Best Samples for Mars Sample Return

PubMed Central

Gordon, Peter R.

2018-01-01

Abstract Success of a future Mars Sample Return mission will depend on the correct choice of samples. Pyrolysis-FTIR can be employed as a triage instrument for Mars Sample Return. The technique can thermally dissociate minerals and organic matter for detection. Identification of certain mineral types can determine the habitability of the depositional environment, past or present, while detection of organic matter may suggest past or present habitation. In Mars' history, the Theiikian era represents an attractive target for life search missions and the acquisition of samples. The acidic and increasingly dry Theiikian may have been habitable and followed a lengthy neutral and wet period in Mars' history during which life could have originated and proliferated to achieve relatively abundant levels of biomass with a wide distribution. Moreover, the sulfate minerals produced in the Theiikian are also known to be good preservers of organic matter. We have used pyrolysis-FTIR and samples from a Mars analog ferrous acid stream with a thriving ecosystem to test the triage concept. Pyrolysis-FTIR identified those samples with the greatest probability of habitability and habitation. A three-tier scoring system was developed based on the detection of (i) organic signals, (ii) carbon dioxide and water, and (iii) sulfur dioxide. The presence of each component was given a score of A, B, or C depending on whether the substance had been detected, tentatively detected, or not detected, respectively. Single-step (for greatest possible sensitivity) or multistep (for more diagnostic data) pyrolysis-FTIR methods informed the assignments. The system allowed the highest-priority samples to be categorized as AAA (or A*AA if the organic signal was complex), while the lowest-priority samples could be categorized as CCC. Our methods provide a mechanism with which to rank samples and identify those that should take the highest priority for return to Earth during a Mars Sample Return mission. Key Words: Mars—Astrobiology—Search for Mars' organics—Infrared spectroscopy—Planetary habitability and biosignatures. Astrobiology 18, 556–570. PMID:29443541

A Method for Choosing the Best Samples for Mars Sample Return.

PubMed

Gordon, Peter R; Sephton, Mark A

2018-05-01

Success of a future Mars Sample Return mission will depend on the correct choice of samples. Pyrolysis-FTIR can be employed as a triage instrument for Mars Sample Return. The technique can thermally dissociate minerals and organic matter for detection. Identification of certain mineral types can determine the habitability of the depositional environment, past or present, while detection of organic matter may suggest past or present habitation. In Mars' history, the Theiikian era represents an attractive target for life search missions and the acquisition of samples. The acidic and increasingly dry Theiikian may have been habitable and followed a lengthy neutral and wet period in Mars' history during which life could have originated and proliferated to achieve relatively abundant levels of biomass with a wide distribution. Moreover, the sulfate minerals produced in the Theiikian are also known to be good preservers of organic matter. We have used pyrolysis-FTIR and samples from a Mars analog ferrous acid stream with a thriving ecosystem to test the triage concept. Pyrolysis-FTIR identified those samples with the greatest probability of habitability and habitation. A three-tier scoring system was developed based on the detection of (i) organic signals, (ii) carbon dioxide and water, and (iii) sulfur dioxide. The presence of each component was given a score of A, B, or C depending on whether the substance had been detected, tentatively detected, or not detected, respectively. Single-step (for greatest possible sensitivity) or multistep (for more diagnostic data) pyrolysis-FTIR methods informed the assignments. The system allowed the highest-priority samples to be categorized as AAA (or A*AA if the organic signal was complex), while the lowest-priority samples could be categorized as CCC. Our methods provide a mechanism with which to rank samples and identify those that should take the highest priority for return to Earth during a Mars Sample Return mission. Key Words: Mars-Astrobiology-Search for Mars' organics-Infrared spectroscopy-Planetary habitability and biosignatures. Astrobiology 18, 556-570.

Extraction of total nucleic acid based on silica-coated magnetic particles for RT-qPCR detection of plant RNA virus/viroid.

PubMed

Sun, Ning; Deng, Congliang; Zhao, Xiaoli; Zhou, Qi; Ge, Guanglu; Liu, Yi; Yan, Wenlong; Xia, Qiang

2014-02-01

In this study, a nucleic acid extraction method based on silica-coated magnetic particles (SMPs) and RT-qPCR assay was developed to detect Arabis mosaic virus (ArMV), Lily symptomless virus (LSV), Hop stunt viroid (HSVd) and grape yellow speckle viroid 1 (GYSVd-1). The amplification sequences of RT-qPCR were reversely transcribed in vitro as RNA standard templates. The standard curves covered six or seven orders of magnitude with a detection limit of 100 copies per each assay. Extraction efficiency of the SMPs method was evaluated by recovering spiked ssRNAs from plant samples and compared to two commercial kits (TRIzol and RNeasy Plant mini kit). Results showed that the recovery rate of SMPs method was comparable to the commercial kits when spiked ssRNAs were extracted from lily leaves, whereas it was two or three times higher than commercial kits when spiked ssRNAs were extracted from grapevine leaves. SMPs method was also used to extract viral nucleic acid from15 ArMV-positive lily leaf samples and 15 LSV-positive lily leaf samples. SMPs method did not show statistically significant difference from other methods on detecting ArMV, but LSV. The SMPs method has the same level of virus load as the TRIzol, and its mean virus load of was 0.5log10 lower than the RNeasy Plant mini kit. Nucleic acid was extracted from 19 grapevine-leaf samples with SMPs and the two commercial kits and subsequently screened for HSVd and GYSVd-1 by RT-qPCR. Regardless of HSVd or GYSVd-1, SMPs method outperforms other methods on both positive rate and the viroid load. In conclusion, SMPs method was able to efficiently extract the nucleic acid of RNA viruses or viroids, especially grapevine viroids, from lily-leaf or grapevine-leaf samples for RT-qPCR detection. Copyright © 2013 Elsevier B.V. All rights reserved.

Evaluation of an anion exchange resin-based method for concentration of F-RNA coliphages (enteric virus indicators) from water samples.

PubMed

Pérez-Méndez, A; Chandler, J C; Bisha, B; Goodridge, L D

2014-08-01

Enteric viral contaminants in water represent a public health concern, thus methods for detecting these viruses or their indicator microorganisms are needed. Because enteric viruses and their viral indicators are often found at low concentrations in water, their detection requires upfront concentration methods. In this study, a strong basic anion exchange resin was evaluated as an adsorbent material for the concentration of F-RNA coliphages (MS2, Qβ, GA, and HB-P22). These coliphages are recognized as enteric virus surrogates and fecal indicator organisms. Following adsorption of the coliphages from 50ml water samples, direct RNA isolation and real time RT-PCR detection were performed. In water samples containing 10(5)pfu/ml of the F-RNA coliphages, the anion exchange resin (IRA-900) adsorbed over 96.7% of the coliphages present, improving real time RT-PCR detection by 5-7 cycles compared to direct testing. F-RNA coliphage RNA recovery using the integrated method ranged from 12.6% to 77.1%. Resin-based concentration of samples with low levels of the F-RNA coliphages allowed for 10(0)pfu/ml (MS2 and Qβ) and 10(-1)pfu/ml (GA and HB-P22) to be detected. The resin-based method offers considerable advantages in cost, speed, simplicity and field adaptability. Copyright © 2014 Elsevier B.V. All rights reserved.

Major improvement of the reference method of the French drug resistance network for P-glycoprotein detection in human haematological malignancies.

PubMed

Huet, Sylvie; Marie, Jean-Pierre; Laurand, Armelle; Robert, Jacques

2005-09-01

The aim of this study was to improve significantly the sensitivity and specificity of the flow cytometric assay of P-glycoprotein (Pgp) implemented and validated by the laboratories of the French Drug Resistance Network [Huet S, Marie JP, Gualde N, Robert J. Reference method for detection of Pgp mediated multidrug resistance in human hematological malignancies: a method validated by the laboratories of the French Drug Resistance Network. Cytometry 1998;34:248-56] in cells displaying low level of resistance. Fluoresceine-conjugated monoclonal antibodies (Mabs) and propidium iodide were respectively replaced by phycoerythrin-conjugated Mabs and Sytox green. The removal of erythrocytes and granulocytes by density gradient was replaced by the lysis of erythrocytes after Mab incubation. Using these conditions, Pgp could be detected in the K-H30 line, which was negative in former studies, with Mab/Control ratios increasing by 3.7- to 5.9-fold, and Mab/Control ratios in the parental sensitive K562 line still ranging between 0.8 and 1.2. When tested on 16 blood samples from patients presenting haematological malignancies, six samples presented low positivity, which was not detected with the former method, while 10 samples remained negative with the two methods. Pgp was specifically detected in pathological blood cells in the six positive samples.

A rapid single-tube protocol for HAV detection by nested real-time PCR.

PubMed

Hu, Yuan; Arsov, Ivica

2014-09-01

Infections by food-borne viruses such as hepatitis A virus (HAV) and norovirus are significant public health concerns worldwide. Since food-borne viruses are rarely confirmed through direct isolation from contaminated samples, highly sensitive molecular techniques remain the methods of choice for the detection of viral genetic material. Our group has previously developed a specific nested real-time PCR (NRT-PCR) assay for HAV detection that improved overall sensitivity. Furthermore in this study, we have developed a single-tube NRT-PCR approach for HAV detection in food samples that reduces the likelihood of cross contamination between tubes during sample manipulation. HAV RNA was isolated from HAV-spiked food samples and HAV-infected cell cultures. All reactions following HAV RNA isolation, including conventional reverse transcriptase PCR, nested-PCR, and RT-PCR were performed in a single tube. Our results demonstrated that all the samples tested positive by RT-PCR and nested-PCR were also positive by a single-tube NRT-PCR. The detection limits observed for HAV-infected cell cultures and HAV-spiked green onions were 0.1 and 1 PFU, respectively. This novel method retained the specificity and robustness of the original NRT-PCR method, while greatly reducing sample manipulation, turnaround time, and the risk of carry-over contamination. Single-tube NRT-PCR thus represents a promising new tool that can potentially facilitate the detection of HAV in foods thereby improving food safety and public health.

Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

PubMed

Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

2016-07-07

To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori.

Comprehensive solid-phase extraction of multitudinous bioactive peptides from equine plasma and urine for doping detection.

PubMed

Guan, Fuyu; Robinson, Mary A

2017-09-08

The ability to analyze biological samples for multitudinous exogenous peptides with a single analytical method is desired for doping control in horse racing. The key to achieving this goal is the capability of extracting all target peptides from the sample matrix. In the present study, theory of mixed-mode solid-phase extraction (SPE) of peptides from plasma is described, and a generic mixed-mode SPE procedure has been developed for recovering multitudinous exogenous peptides with remarkable sequence diversity, from equine plasma and urine in a single procedure. Both the theory and the developed SPE procedure have led to the development of a novel analytical method for comprehensive detection of multitudinous bioactive peptides in equine plasma and urine using liquid chromatography coupled to high resolution mass spectrometry (LC-HRMS). Thirty nine bioactive peptides were extracted with strong anion-exchange mixed-mode SPE sorbent, separated on a reversed-phase C 18 column and detected by HRMS and data-dependent tandem mass spectrometry. The limit of detection (LOD) was 10-50 pg mL -1 in plasma for most of the peptides and 100 pg mL -1 for the remaining. For urine, LOD was 20-400 pg mL -1 for most of the peptides and 1-4 ng mL -1 for the others. In vitro degradation of the peptides in equine plasma and urine was examined at ambient temperature; the peptides except those with a D-amino acid at position 2 were unstable not only in plasma but also in urine. The developed method was successful in analysis of plasma and urine samples from horses administered dermorphin. Additionally, dermorphin metabolites were identified in the absence of reference standards. The developed SPE procedure and LC-HRMS method can theoretically detect virtually all peptides present at a sufficient concentration in a sample. New peptides can be readily included in the method to be detected without method re-development. The developed method also generates such data that can be retrospectively analyzed for peptides unknown at the time of sample analysis. It is the first generic analytical method for comprehensive detection of multitudinous exogenous peptides in biological samples, to the authors' knowledge. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of Viable Cryptosporidium parvum in Soil by Reverse Transcription–Real-Time PCR Targeting hsp70 mRNA ▿

PubMed Central

Liang, Zhanbei; Keeley, Ann

2011-01-01

Extraction of high-quality mRNA from Cryptosporidium parvum is a key step in PCR detection of viable oocysts in environmental samples. Current methods for monitoring oocysts are limited to water samples; therefore, the goal of this study was to develop a rapid and sensitive procedure for Cryptosporidium detection in soil samples. The efficiencies of five RNA extraction methods were compared (mRNA extraction with the Dynabeads mRNA Direct kit after chemical and physical sample treatments, and total RNA extraction methods using the FastRNA Pro Soil-Direct, PowerSoil Total RNA, E.Z.N.A. soil RNA, and Norgen soil RNA purification kits) for the direct detection of Cryptosporidium with oocyst-spiked sandy, loamy, and clay soils by using TaqMan reverse transcription-PCR. The study also evaluated the presence of inhibitors by synthesis and incorporation of an internal positive control (IPC) RNA into reverse transcription amplifications, used different facilitators (bovine serum albumin, yeast RNA, salmon DNA, skim milk powder, casein, polyvinylpyrrolidone, sodium hexametaphosphate, and Salmonella enterica serovar Typhi) to mitigate RNA binding on soil components, and applied various treatments (β-mercaptoethanol and bead beating) to inactivate RNase and ensure the complete lysis of oocysts. The results of spiking studies showed that Salmonella cells most efficiently relieved binding of RNA. With the inclusion of Salmonella during extraction, the most efficient mRNA method was Dynabeads, with a detection limit of 6 × 102 oocysts g−1 of sandy soil. The most efficient total RNA method was PowerSoil, with detection limits of 1.5 × 102, 1.5 × 103, and 1.5 × 104 C. parvum oocysts g−1 soil for sandy, loamy, and clay samples, respectively. PMID:21803904

LC/ESI-MS/MS method for quantification of 28 synthetic cannabinoids in neat oral fluid and its application to preliminary studies on their detection windows.

PubMed

Kneisel, Stefan; Speck, Michael; Moosmann, Bjoern; Corneillie, Todd M; Butlin, Nathaniel G; Auwärter, Volker

2013-05-01

Serum and urine samples are commonly used for the analysis of synthetic cannabinoids in biofluids; however, their utilization as analytical matrices for drug abstinence control features some substantial drawbacks. While for blood collection invasive sampling is inevitable, the urinary analysis of synthetic cannabinoids is limited by the lack of available reference standards of the respective major metabolites. Moreover, the long detectability of synthetic cannabinoids in both matrices hampers the identification of a recent synthetic cannabinoid use. This article describes the development, validation and application of an LC/ESI-MS/MS method for the quantification of 28 synthetic cannabinoids in neat oral fluid (OF) samples. OF samples were prepared by protein precipitation using ice-cold acetonitrile. Chromatographic separation was achieved by gradient elution on a Luna Phenyl Hexyl column (50 × 2 mm, 5 μm), while detection was carried out on a QTrap 4000 instrument in positive ionization mode. The limits of detection ranged from 0.02 to 0.40 ng/mL, whereas the lower limits of quantification ranged from 0.2 to 4.0 ng/mL. The method was applied to authentic samples collected during two preliminary studies in order to obtain insights into the general detectability and detection windows of synthetic cannabinoids in this matrix. The results indicate that synthetic cannabinoids are transferred from the blood stream into OF and vice versa only at a very low rate. Therefore, positive OF samples are due to contamination of the oral cavity during smoking. As these drug-contaminations could be detected up to approximately 2 days, neat oral fluid appears to be well suited for detection of a recent synthetic cannabinoid use.

Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.

PubMed

Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders

2018-03-10

Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.

Detection of viable Cronobacter spp. (Enterobacter sakazakii) by one-step RT-PCR in dry aquatic product.

PubMed

Ye, Yingwang; Wu, Qingping; Zhang, Jumei; Jiang, He; Hu, Wang

2012-11-01

Cronobacter are opportunistic food-borne pathogens associated with meningitis, sepsis, and necrotizing enterocolitis. Little attempt has focused on detection of viable cell of Cronobacter spp. in dry aquatic products, which were frequently used for raw materials of infant foods due to high nutrition. In this paper, one-step reverse transcription polymerase chain reaction (RT-PCR) was developed for detection of viable Cronobacter spp. in dry aquatic products. Specificity test indicated that clearly expected amplicon in size 469 bp was amplified from RNA of Cronobacter, but not from RNA of negative controls and DNA of Cronobacter strains. The sensitivity was 10(4) CFU/mL of Cronobacter strain in artificially fish meal samples and 10(1) CFU/mL of Cronobacter after 10-h enrichment. In a total of 81 dry aquatic products, 9.8%, 8.6%, and 9.8% of samples were found to be positive for Cronobacter by one-step RT-PCR, U.S. Food and Drug Administration method, and Druggan-Forsythe-Iversen medium, respectively. The results clearly indicated that one-step RT-PCR could avoid the interference of residual DNA of Cronobacter in food samples and be used to specifically detect viable Cronobacter spp. for large-scale monitoring of food samples. The use of rapid and specific detection of food borne pathogens in food samples was most of importance for control and precaution of food borne diseases. In this study, one-step RT-PCR was developed for detection of Cronobacter spp. in aquatic products. A comparison of different methods for detection of Cronobacter indicated that the newly developed method could be widely used to specifically detect Cronobacter spp. in food samples. © 2012 Institute of Food Technologists®

Roka Listeria detection method using transcription mediated amplification to detect Listeria species in select foods and surfaces. Performance Tested Method(SM) 011201.

PubMed

Hua, Yang; Kaplan, Shannon; Reshatoff, Michael; Hu, Ernie; Zukowski, Alexis; Schweis, Franz; Gin, Cristal; Maroni, Brett; Becker, Michael; Wisniewski, Michele

2012-01-01

The Roka Listeria Detection Assay was compared to the reference culture methods for nine select foods and three select surfaces. The Roka method used Half-Fraser Broth for enrichment at 35 +/- 2 degrees C for 24-28 h. Comparison of Roka's method to reference methods requires an unpaired approach. Each method had a total of 545 samples inoculated with a Listeria strain. Each food and surface was inoculated with a different strain of Listeria at two different levels per method. For the dairy products (Brie cheese, whole milk, and ice cream), our method was compared to AOAC Official Method(SM) 993.12. For the ready-to-eat meats (deli chicken, cured ham, chicken salad, and hot dogs) and environmental surfaces (sealed concrete, stainless steel, and plastic), these samples were compared to the U.S. Department of Agriculture/Food Safety and Inspection Service-Microbiology Laboratory Guidebook (USDA/FSIS-MLG) method MLG 8.07. Cold-smoked salmon and romaine lettuce were compared to the U.S. Food and Drug Administration/Bacteriological Analytical Manual, Chapter 10 (FDA/BAM) method. Roka's method had 358 positives out of 545 total inoculated samples compared to 332 positive for the reference methods. Overall the probability of detection analysis of the results showed better or equivalent performance compared to the reference methods.

Modified flotation method with the use of Percoll for the detection of Isospora suis oocysts in suckling piglet faeces.

PubMed

Karamon, Jacek; Ziomko, Irena; Cencek, Tomasz; Sroka, Jacek

2008-10-01

The modification of flotation method for the examination of diarrhoeic piglet faeces for the detection of Isospora suis oocysts was elaborated. The method was based on removing fractions of fat from the sample of faeces by centrifugation with a 25% Percoll solution. The investigations were carried out in comparison to the McMaster method. From five variants of the Percoll flotation method, the best results were obtained when 2ml of flotation liquid per 1g of faeces were used. The limit of detection in the Percoll flotation method was 160 oocysts per 1g, and was better than with the McMaster method. The efficacy of the modified method was confirmed by results obtained in the examination of the I. suis infected piglets. From all faecal samples, positive samples in the Percoll flotation method were double the results than that of the routine method. Oocysts were first detected by the Percoll flotation method on day 4 post-invasion, i.e. one-day earlier than with the McMaster method. During the experiment (except for 3 days), the extensity of I. suis invasion in the litter examined by the Percoll flotation method was higher than that with the McMaster method. The obtained results show that the modified flotation method with the use of Percoll could be applied in the diagnostics of suckling piglet isosporosis.

Detection of Legionella pneumophila by PCR-ELISA method in industrial cooling tower water.

PubMed

Soheili, Majid; Nejadmoghaddam, Mohammad Reza; Babashamsi, Mohammad; Ghasemi, Jamileh; Jeddi Tehrani, Mahmood

2007-11-15

Water supply and Cooling Tower Water (CTW) are among the most common sources of Legionella pneumophila (LP) contamination. A nonradio active method is described to detect LP in industrial CTW samples. DNA was purified and amplified by nested -PCR with amplimers specific for the 16s rRNA gene of LP. The 5' end biotinylated oligomer probe was immobilized on sterptavidin B coated microtiter plates. The nested-PCR product was labeled with digoxigenin and then hybridized with 5'-biotinylated probes. The amplification products were detected by using proxidase-labled anti dioxygenin antibody in a colorimetric reaction. The assay detected LP present in 1 L of 5 CTW samples examined. All of the samples were Legionella positive in both culture and PCR-ELISA methods. The PCR-ELISA assay appears to exhibit high specificity and is a more rapid technique in comparison with bacterial culture method. Thus could prove suitable for use in the routine examination of industrial CTW contamination.

Mini-column assay for rapid detection of malachite green in fish.

PubMed

Shalaby, Ali R; Emam, Wafaa H; Anwar, Mervat M

2017-07-01

A simple, rapid and economical mini-column method for detecting malachite green (MG) residue in fish was developed. The method used a column with 2mm ID that was tightly packed with silica gel followed by alumina. Detection of MG was performed by viewing the developed mini-column at visible light by naked eye; where MG was seen as compact green band at the confluence of the silica gel layer with alumina layer. The limit of detection of the assay was 2ng which conform the minimum required performance limit (MRPL). Evaluation utility of the method indicated that all blank and spiked samples at levels below MRPL were assessed as accepted. The intensity of the green band increased whenever MG level in the extract increased; indicated that suggested mini-column technique could be used for semi-quantitative determination of MG in fish samples. The method can be used to select the questionable samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

Two alternative DNA extraction methods to improve the detection of Mycobacterium-tuberculosis-complex members in cattle and red deer tissue samples.

PubMed

Fell, Shari; Bröckl, Stephanie; Büttner, Mathias; Rettinger, Anna; Zimmermann, Pia; Straubinger, Reinhard K

2016-09-15

Bovine tuberculosis (bTB), which is caused by Mycobacterium bovis and M. caprae, is a notifiable animal disease in Germany. Diagnostic procedure is based on a prescribed protocol that is published in the framework of German bTB legislation. In this protocol small sample volumes are used for DNA extraction followed by real-time PCR analyses. As mycobacteria tend to concentrate in granuloma and the infected tissue in early stages of infection does not necessarily show any visible lesions, it is likely that DNA extraction from only small tissue samples (20-40 mg) of a randomly chosen spot from the organ and following PCR testing may result in false negative results. In this study two DNA extraction methods were developed to process larger sample volumes to increase the detection sensitivity of mycobacterial DNA in animal tissue. The first extraction method is based on magnetic capture, in which specific capture oligonucleotides were utilized. These nucleotides are linked to magnetic particles and capture Mycobacterium-tuberculosis-complex (MTC) DNA released from 10 to 15 g of tissue material. In a second approach remaining sediments from the magnetic capture protocol were further processed with a less complex extraction protocol that can be used in daily routine diagnostics. A total number of 100 tissue samples from 34 cattle (n = 74) and 18 red deer (n = 26) were analyzed with the developed protocols and results were compared to the prescribed protocol. All three extraction methods yield reliable results by the real-time PCR analysis. The use of larger sample volume led to a sensitivity increase of DNA detection which was shown by the decrease of Ct-values. Furthermore five samples which were tested negative or questionable by the official extraction protocol were detected positive by real time PCR when the alternative extraction methods were used. By calculating the kappa index, the three extraction protocols resulted in a moderate (0.52; protocol 1 vs 3) to almost perfect agreement (1.00; red deer sample testing with all protocols). Both new methods yielded increased detection rates for MTC DNA detection in large sample volumes and consequently improve the official diagnostic protocol.

Quantitative determination of methamphetamine in oral fluid by liquid-liquid extraction and gas chromatography/mass spectrometry.

PubMed

Bahmanabadi, L; Akhgari, M; Jokar, F; Sadeghi, H B

2017-02-01

Methamphetamine abuse is one of the most medical and social problems many countries face. In spite of the ban on the use of methamphetamine, it is widely available in Iran's drug black market. There are many analytical methods for the detection of methamphetamine in biological specimen. Oral fluid has become a popular specimen to test for the presence of methamphetamine. The purpose of the present study was to develop a method for the extraction and detection of methamphetamine in oral fluid samples using liquid-liquid extraction (LLE) and gas chromatography/mass spectrometry (GC/MS) methods. An analytical study was designed in that blank and 50 authentic oral fluid samples were collected to be first extracted by LLE and subsequently analysed by GC/MS. The method was fully validated and showed an excellent intra- and inter-assay precision (reflex sympathetic dystrophy ˂ 10%) for external quality control samples. Recovery with LLE methods was 96%. Limit of detection and limit of quantitation were 5 and 15 ng/mL, respectively. The method showed high selectivity, no additional peak due to interfering substances in samples was observed. The introduced method was sensitive, accurate and precise enough for the extraction of methamphetamine from oral fluid samples in forensic toxicology laboratories.

Detection of pathogenic Yersinia enterocolitica in foods and water by immunomagnetic separation, nested polymerase chain reactions, and colorimetric detection of amplified DNA.

PubMed Central

Kapperud, G; Vardund, T; Skjerve, E; Hornes, E; Michaelsen, T E

1993-01-01

A two-step polymerase chain reaction (PCR) procedure with two nested pairs of primers specific for the yadA gene of Yersinia enterocolitica was developed. The PCR assay identified all common pathogenic serogroups (O:3, O:5,27, O:8, O:9, O:13, and O:21) from three continents and differentiated pathogenic Y. enterocolitica from Y. pseudotuberculosis and from a variety of nonpathogenic yersiniae representing 25 serogroups and four species. The performance of the method was evaluated with seeded food and water samples. We compared two procedures for sample preparation prior to PCR: one was based on immunomagnetic separation of the target bacteria from the sample, using magnetic particles coated with immunoglobulin antibodies to Y. enterocolitica serogroup O:3, and the other method consisted of a series of centrifugation steps combined with proteinase treatment. Regardless of the method used, the PCR assay was capable of detecting 10 to 30 CFU/g of meat in 10(6)-fold excess of indigenous bacteria. When the samples were enriched overnight in a nonselective medium, the sensitivity was increased to approximately 2 CFU/g, except for samples with an extremely high background flora (> 10(7) CFU/g). We compared gel electrophoretic detection of PCR products with a colorimetric detection method designated DIANA (detection of immobilized amplified nucleic acids), which enabled easy visualization of amplified fragments in a microtiter plate format with an optical density reader. DIANA and gel electrophoresis showed complete concordance in their discrimination between positive and negative samples. The combination of immunomagnetic separation, nested PCR, and DIANA makes possible the development of a fully automated analytic process which requires a minimum of laboratory manipulations. Images PMID:8215366

Diagnosis of bacteremia in pediatric oncologic patients by in-house real-time PCR.

PubMed

Quiles, Milene Gonçalves; Menezes, Liana Carballo; Bauab, Karen de Castro; Gumpl, Elke Kreuscher; Rocchetti, Talita Trevizani; Palomo, Flavia Silva; Carlesse, Fabianne; Pignatari, Antonio Carlos Campos

2015-07-23

Infections are the major cause of morbidity and mortality in children with cancer. Gaining a favorable prognosis for these patients depends on selecting the appropriate therapy, which in turn depends on rapid and accurate microbiological diagnosis. This study employed real-time PCR (qPCR) to identify the main pathogens causing bloodstream infection (BSI) in patients treated at the Pediatric Oncology Institute IOP-GRAACC-UNIFESP-Brazil. Antimicrobial resistance genes were also investigated using this methodology. A total of 248 samples from BACTEC® blood culture bottles and 99 whole-blood samples collected in tubes containing EDTA K2 Gel were isolated from 137 patients. All samples were screened by specific Gram probes for multiplex qPCR. Seventeen sequences were evaluated using gender-specific TaqMan probes and the resistance genes bla SHV, bla TEM, bla CTX, bla KPC, bla IMP, bla SPM, bla VIM, vanA, vanB and mecA were detected using the SYBR Green method. Positive qPCR results were obtained in 112 of the blood culture bottles (112/124), and 90 % agreement was observed between phenotypic and molecular microbial detection methods. For bacterial and fungal identification, the performance test showed: sensitivity 87 %; specificity 91 %; NPV 90 %; PPV 89 % and accuracy of 89 % when compared with the phenotypic method. The mecA gene was detected in 37 samples, extended-spectrum β-lactamases were detected in six samples and metallo-β-lactamase coding genes in four samples, with 60 % concordance between the two methods. The qPCR on whole blood detected eight samples possessing the mecA gene and one sample harboring the vanB gene. The bla KPC, bla VIM, bla IMP and bla SHV genes were not detected in this study. Real-time PCR is a useful tool in the early identification of pathogens and antimicrobial resistance genes from bloodstream infections of pediatric oncologic patients.

Ultra trace determination of 31 pesticides in water samples by direct injection-rapid resolution liquid chromatography-electrospray tandem mass spectrometry.

PubMed

Díaz, Laura; Llorca-Pórcel, Julio; Valor, Ignacio

2008-08-22

A liquid chromatography-tandem mass spectrometry (LC-MS/MS)-based method for the detection of pesticides in tap and treated wastewater was developed and validated according to the ISO/IEC 17025:1999. Key features of this method include direct injection of 100 microL of sample, an 11 min separation by means of a rapid resolution liquid chromatography system with a 4.6 mm x 50 mm, 1.8 microm particle size reverse phase column and detection by electrospray ionization (ESI) MS-MS. The limits of detection were below 15 ng L(-1) and correlation coefficients for the calibration curves in the range of 30-2000 ng L(-1) were higher than 0.99. Precision was always below 20% and accuracy was confirmed by external evaluation. The main advantages of this method are direct injection of sample without preparative procedures and low limits of detection that fulfill the requirements established by the current European regulations governing pesticide detection.

Generation and coherent detection of QPSK signal using a novel method of digital signal processing

NASA Astrophysics Data System (ADS)

Zhao, Yuan; Hu, Bingliang; He, Zhen-An; Xie, Wenjia; Gao, Xiaohui

2018-02-01

We demonstrate an optical quadrature phase-shift keying (QPSK) signal transmitter and an optical receiver for demodulating optical QPSK signal with homodyne detection and digital signal processing (DSP). DSP on the homodyne detection scheme is employed without locking the phase of the local oscillator (LO). In this paper, we present an extracting one-dimensional array of down-sampling method for reducing unwanted samples of constellation diagram measurement. Such a novel scheme embodies the following major advantages over the other conventional optical QPSK signal detection methods. First, this homodyne detection scheme does not need strict requirement on LO in comparison with linear optical sampling, such as having a flat spectral density and phase over the spectral support of the source under test. Second, the LabVIEW software is directly used for recovering the QPSK signal constellation without employing complex DSP circuit. Third, this scheme is applicable to multilevel modulation formats such as M-ary PSK and quadrature amplitude modulation (QAM) or higher speed signals by making minor changes.

Method and apparatus for detecting dilute concentrations of radioactive xenon in samples of xenon extracted from the atmosphere

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warburton, William K.; Hennig, Wolfgang G.

A method and apparatus for measuring the concentrations of radioxenon isotopes in a gaseous sample wherein the sample cell is surrounded by N sub-detectors that are sensitive to both electrons and to photons from radioxenon decays. Signal processing electronics are provided that can detect events within the sub-detectors, measure their energies, determine whether they arise from electrons or photons, and detect coincidences between events within the same or different sub-detectors. The energies of detected two or three event coincidences are recorded as points in associated two or three-dimensional histograms. Counts within regions of interest in the histograms are then usedmore » to compute estimates of the radioxenon isotope concentrations. The method achieves lower backgrounds and lower minimum detectable concentrations by using smaller detector crystals, eliminating interference between double and triple coincidence decay branches, and segregating double coincidences within the same sub-detector from those occurring between different sub-detectors.« less

The efficiency of concentration methods used to detect enteric viruses in anaerobically digested sludge

PubMed Central

Prado, Tatiana; Guilayn, Wilma de Carvalho Pereira Bonet; Gaspar, Ana Maria Coimbra; Miagostovich, Marize Pereira

2013-01-01

The presence of enteric viruses in biosolids can be underestimated due to the inefficient methods (mainly molecular methods) used to recover the viruses from these matrices. Therefore, the goal of this study was to evaluate the different methods used to recover adenoviruses (AdV), rotavirus species A (RVA), norovirus genogroup II (NoV GII) and the hepatitis A virus (HAV) from biosolid samples at a large urban wastewater treatment plant in Brazil after they had been treated by mesophilic anaerobic digestion. Quantitative polymerase chain reaction (PCR) was used for spiking experiments to compare the detection limits of feasible methods, such as beef extract elution and ultracentrifugation. Tests were performed to detect the inhibition levels and the bacteriophage PP7 was used as an internal control. The results showed that the inhibitors affected the efficiency of the PCR reaction and that beef extract elution is a suitable method for detecting enteric viruses, mainly AdV from biosolid samples. All of the viral groups were detected in the biosolid samples: AdV (90%), RVA, NoV GII (45%) and HAV (18%), indicating the viruses' resistance to the anaerobic treatment process. This is the first study in Brazil to detect the presence of RVA, AdV, NoV GII and HAV in anaerobically digested sludge, highlighting the importance of adequate waste management. PMID:23440119

Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

PubMed

Tattiyapong, P; Sirikanchana, K; Surachetpong, W

2018-02-01

Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.

A PVC/polypyrrole sensor designed for beef taste detection using electrochemical methods and sensory evaluation.

PubMed

Zhu, Lingtao; Wang, Xiaodan; Han, Yunxiu; Cai, Yingming; Jin, Jiahui; Wang, Hongmei; Xu, Liping; Wu, Ruijia

2018-03-01

An electrochemical sensor for detection of beef taste was designed in this study. This sensor was based on the structure of polyvinyl chloride/polypyrrole (PVC/PPy), which was polymerized onto the surface of a platinum (Pt) electrode to form a Pt-PPy-PVC film. Detecting by electrochemical methods, the sensor was well characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The sensor was applied to detect 10 rib-eye beef samples and the accuracy of the new sensor was validated by sensory evaluation and ion sensor detection. Several cluster analysis methods were used in the study to distinguish the beef samples. According to the obtained results, the designed sensor showed a high degree of association of electrochemical detection and sensory evaluation, which proved a fast and precise sensor for beef taste detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Love-Wave Sensors Combined with Microfluidics for Fast Detection of Biological Warfare Agents

PubMed Central

Matatagui, Daniel; Fontecha, José Luis; Fernández, María Jesús; Gràcia, Isabel; Cané, Carles; Santos, José Pedro; Horrillo, María Carmen

2014-01-01

The following paper examines a time-efficient method for detecting biological warfare agents (BWAs). The method is based on a system of a Love-wave immunosensor combined with a microfluidic chip which detects BWA samples in a dynamic mode. In this way a continuous flow-through of the sample is created, promoting the reaction between antigen and antibody and allowing a fast detection of the BWAs. In order to prove this method, static and dynamic modes have been simulated and different concentrations of BWA simulants have been tested with two immunoreactions: phage M13 has been detected using the mouse monoclonal antibody anti-M13 (AM13), and the rabbit immunoglobulin (Rabbit IgG) has been detected using the polyclonal antibody goat anti-rabbit (GAR). Finally, different concentrations of each BWA simulants have been detected with a fast response time and a desirable level of discrimination among them has been achieved. PMID:25029282

An Efficient Silent Data Corruption Detection Method with Error-Feedback Control and Even Sampling for HPC Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Di, Sheng; Berrocal, Eduardo; Cappello, Franck

The silent data corruption (SDC) problem is attracting more and more attentions because it is expected to have a great impact on exascale HPC applications. SDC faults are hazardous in that they pass unnoticed by hardware and can lead to wrong computation results. In this work, we formulate SDC detection as a runtime one-step-ahead prediction method, leveraging multiple linear prediction methods in order to improve the detection results. The contributions are twofold: (1) we propose an error feedback control model that can reduce the prediction errors for different linear prediction methods, and (2) we propose a spatial-data-based even-sampling method tomore » minimize the detection overheads (including memory and computation cost). We implement our algorithms in the fault tolerance interface, a fault tolerance library with multiple checkpoint levels, such that users can conveniently protect their HPC applications against both SDC errors and fail-stop errors. We evaluate our approach by using large-scale traces from well-known, large-scale HPC applications, as well as by running those HPC applications on a real cluster environment. Experiments show that our error feedback control model can improve detection sensitivity by 34-189% for bit-flip memory errors injected with the bit positions in the range [20,30], without any degradation on detection accuracy. Furthermore, memory size can be reduced by 33% with our spatial-data even-sampling method, with only a slight and graceful degradation in the detection sensitivity.« less

Broad-Range Detection of Microorganisms Directly from Bronchoalveolar Lavage Specimens by PCR/Electrospray Ionization-Mass Spectrometry

PubMed Central

Ullberg, Måns; Lüthje, Petra; Mölling, Paula; Strålin, Kristoffer

2017-01-01

The clinical demand on rapid microbiological diagnostic is constantly increasing. PCR coupled to electrospray ionization-mass spectrometry, PCR/ESI-MS, offers detection and identification of over 750 bacteria and Candida species directly from clinical specimens within 6 hours. In this study, we investigated the clinical performance of the IRIDICA BAC LRT Assay for detection of bacterial pathogens in 121 bronchoalveolar lavage (BAL) samples that were received consecutively at our bacterial laboratory for BAL culture. Commensal or pathogenic microorganisms were detected in 118/121 (98%) BAL samples by PCR/ESI-MS, while in 104/121 (86%) samples by routine culture (P<0.01). Detection of potentially pathogenic microorganisms by PCR/ESI-MS was evaluated in comparison with conventional culture-based or molecular methods. The agreement between positive findings was overall good. Most Staphylococcus aureus-positive PCR/ESI-MS results were confirmed by culture or species-specific PCR (27/33, 82%). The identity of Streptococcus pneumoniae could however be confirmed for only 6/17 (35%) PCR/ESI-MS-positive samples. Non-cultivable and fastidious pathogens, which were not covered by standard culture procedures were readily detected by PCR/ESI-MS, including Legionella pneumophila, Bordetella pertussis, Norcadia species and Mycoplasma pneumoniae. In conclusion, PCR/ESI-MS detected a broad range of potential pathogens with equal or superior sensitivity compared to conventional methods within few hours directly from BAL samples. This novel method might thus provide a relevant tool for diagnostics in critically ill patients. PMID:28085931

Cultural and Molecular Evidence of Legionella spp. Colonization in Dental Unit Waterlines: Which Is the Best Method for Risk Assessment?

PubMed

Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M

2016-02-06

Legionella spp. are ubiquitous in aquatic habitats and water distribution systems, including dental unit waterlines (DUWLs). The aim of the present study was to determine the prevalence of Legionella in DUWLs and tap water samples using PMA-qPCR and standard culture methods. The total viable counts (TVCs) of aerobic heterotrophic bacteria in the samples were also determined. Legionella spp. were detected and quantified using the modified ISO 11731 culture method. Extracted genomic DNA was analysed using the iQ-Check Quanti Legionella spp. kit, and the TVCs were determined according to the ISO protocol 6222. Legionella spp. were detected in 100% of the samples using the PMA-qPCR method, whereas these bacteria were detected in only 7% of the samples using the culture method. The number of colony forming units (CFUs) of the TVCs in the DUWL and tap water samples differed, with the bacterial load being significantly lower in the tap water samples (p-value = 0). The counts obtained were within the Italian standard range established for potable water in only 5% of the DUWL water samples and in 77% of the tap water samples. Our results show that the level of Legionella spp. contamination determined using the culture method does not reflect the true scale of the problem, and consequently we recommend testing for the presence of aerobic heterotrophic bacteria based on the assumption that Legionella spp. are components of biofilms.

Cultural and Molecular Evidence of Legionella spp. Colonization in Dental Unit Waterlines: Which Is the Best Method for Risk Assessment?

PubMed Central

Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M.

2016-01-01

Legionella spp. are ubiquitous in aquatic habitats and water distribution systems, including dental unit waterlines (DUWLs). The aim of the present study was to determine the prevalence of Legionella in DUWLs and tap water samples using PMA-qPCR and standard culture methods. The total viable counts (TVCs) of aerobic heterotrophic bacteria in the samples were also determined. Legionella spp. were detected and quantified using the modified ISO 11731 culture method. Extracted genomic DNA was analysed using the iQ-Check Quanti Legionella spp. kit, and the TVCs were determined according to the ISO protocol 6222. Legionella spp. were detected in 100% of the samples using the PMA-qPCR method, whereas these bacteria were detected in only 7% of the samples using the culture method. The number of colony forming units (CFUs) of the TVCs in the DUWL and tap water samples differed, with the bacterial load being significantly lower in the tap water samples (p-value = 0). The counts obtained were within the Italian standard range established for potable water in only 5% of the DUWL water samples and in 77% of the tap water samples. Our results show that the level of Legionella spp. contamination determined using the culture method does not reflect the true scale of the problem, and consequently we recommend testing for the presence of aerobic heterotrophic bacteria based on the assumption that Legionella spp. are components of biofilms. PMID:26861373

Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; determination of organophosphate pesticides in filtered water by gas chromatography with flame photometric detection

USGS Publications Warehouse

Jha, Virendra K.; Wydoski, Duane S.

2002-01-01

A method for the isolation of 20 parent organophosphate pesticides and 5 pesticide degradates from filtered natural-water samples is described. Seven of these compounds are reported permanently with an estimated concentration because of performance issues. Water samples are filtered to remove suspended particulate matter, and then 1 liter of filtrate is pumped through disposable solid-phase extraction columns that contain octadecyl-bonded porous silica to extract the compounds. The C-18 columns are dried with nitrogen gas, and method compounds are eluted from the columns with ethyl acetate. The extract is analyzed by dual capillary-column gas chromatography with flame photometric detection. Single-operator method detection limits in all three water-matrix samples ranged from 0.004 to 0.012 microgram per liter. Method performance was validated by spiking all compounds into three different matrices at three different concentrations. Eight replicates were analyzed at each concentration level in each matrix. Mean recoveries of method compounds spiked in surface-water samples ranged from 39 to 149 percent and those in ground-water samples ranged from 40 to 124 percent for all pesticides except dimethoate. Mean recoveries of method compounds spiked in reagent-water samples ranged from 41 to 119 percent for all pesticides except dimethoate. Dimethoate exhibited reduced recoveries (mean of 43 percent in low- and medium-concentration level spiked samples and 20 percent in high-concentration level spiked samples) in all matrices because of incomplete collection on the C-18 column. As a result, concen-trations of dimethoate and six other compounds (based on performance issues) in samples are reported in this method with an estimated remark code.

Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

PubMed Central

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893

Determination of Ochratoxin A in wine by packed in-tube solid phase microextraction followed by high performance liquid chromatography coupled to tandem mass spectrometry.

PubMed

Andrade, Mariane A; Lanças, Fernando M

2017-04-14

Ochratoxin A (OTA), a widely studied mycotoxin, can be found in a variety of food matrices. As its concentration in food is generally low (in the order of μg kg -1 ), sample preparation techniques are necessary for the analyte purification and pre-concentration in order to achieve the required low detection limits. The separation and detection methods used for OTA analysis should also offer proper sensitivity in order to allow the adequate quantification of the analyte. This manuscript addresses the development of a methodology aiming the analysis of OTA in wine samples by packed in-tube SPME in flow through extraction mode coupled to HPLC-MS/MS. The in-tube SPME set up utilized a PEEK tube packed with C18 particles as the extraction column. The method was optimized by a central composite design 2 2 +3 extra central points, having as factors the percentage of ACN and time in the sample load step. The functionalities of the method were attested and its analytical conditions, enhanced by using 22% of ACN and 6min in the sample load step. Validation of the method was also accomplished prior to analyses of both dry red wine and dry white wine samples. The method demonstrated proper sensitivity, with detection and quantification limits equal to 0.02 and 0.05μgL -1 , respectively. Linearity and precision exhibited a 0.996 correlation coefficient and RSD under 6%, respectively. The method proved to be accurate at medium and higher concentration levels with a maximum recovery of 73% at higher concentration levels. OTA was not detected in either dry red and dry white wine samples evaluated in this work. If present, it would be at concentrations lower than the detection and quantification limits established for the proposed method, and considered not a potential danger to human health according to our present knowledge. Copyright © 2017 Elsevier B.V. All rights reserved.

Occurrence of clostridia in commercially available curry roux.

PubMed

Fujisawa, T; Aikawa, K; Takahashi, T; Yamai, S; Ueda, S

2001-12-01

The occurrence of clostridia was investigated in a total of 60 commercially available curry roux samples. Clostridia were isolated from 37 (62%) samples, and Clostridium perfringens was isolated from 7 (12%) samples. The isolates of C. perfringens did not produce enterotoxin. The frequency of occurrence was higher by the enrichment broth culture detection method than by the agar plate or pouch method. These findings suggest that enrichment broth culture is necessary for the detection of clostridia.

Efficient sample preparation method based on solvent-assisted dispersive solid-phase extraction for the trace detection of butachlor in urine and waste water samples.

PubMed

Aladaghlo, Zolfaghar; Fakhari, Alireza; Behbahani, Mohammad

2016-10-01

In this work, an efficient sample preparation method termed solvent-assisted dispersive solid-phase extraction was applied. The used sample preparation method was based on the dispersion of the sorbent (benzophenone) into the aqueous sample to maximize the interaction surface. In this approach, the dispersion of the sorbent at a very low milligram level was achieved by inserting a solution of the sorbent and disperser solvent into the aqueous sample. The cloudy solution created from the dispersion of the sorbent in the bulk aqueous sample. After pre-concentration of the butachlor, the cloudy solution was centrifuged and butachlor in the sediment phase dissolved in ethanol and determined by gas chromatography with flame ionization detection. Under the optimized conditions (solution pH = 7.0, sorbent: benzophenone, 2%, disperser solvent: ethanol, 500 μL, centrifuged at 4000 rpm for 3 min), the method detection limit for butachlor was 2, 3 and 3 μg/L for distilled water, waste water, and urine sample, respectively. Furthermore, the preconcentration factor was 198.8, 175.0, and 174.2 in distilled water, waste water, and urine sample, respectively. Solvent-assisted dispersive solid-phase extraction was successfully used for the trace monitoring of butachlor in urine and waste water samples. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparative Evaluation of Veriflow®Listeria Species to USDA Culture-Based Method for the Detection of Listeria spp. in Food and Environmental Samples.

PubMed

Joelsson, Adam C; Terkhorn, Shawn P; Brown, Ashley S; Puri, Amrita; Pascal, Benjamin J; Gaudioso, Zara E; Siciliano, Nicholas A

2017-09-01

Veriflow® Listeria species (Veriflow LS) is a molecular-based assay for the presumptive detection of Listeria spp. from environmental surfaces (stainless steel, sealed concrete, plastic, and ceramic tile) and ready-to-eat (RTE) food matrixes (hot dogs and deli meat). The assay utilizes a PCR detection method coupled with a rapid, visual, flow-based assay that develops in 3 min post-PCR amplification and requires only a 24 h enrichment for maximum sensitivity. The Veriflow LS system eliminates the need for sample purification, gel electrophoresis, or fluorophore-based detection of target amplification and does not require complex data analysis. This Performance Tested MethodSM validation study demonstrated the ability of the Veriflow LS assay to detect low levels of artificially inoculated Listeria spp. in six distinct environmental and food matrixes. In each unpaired reference comparison study, probability of detection analysis indicated that there was no significant difference between the Veriflow LS method and the U.S. Department of Agriculture Food Safety and Inspection Service Microbiology Laboratory Guide Chapter 8.08 reference method. Fifty-one strains of various Listeria spp. were detected in the inclusivity study, and 35 nonspecific organisms went undetected in the exclusivity study. The study results show that the Veriflow LS is a sensitive, selective, and robust assay for the presumptive detection of Listeria spp. sampled from environmental surfaces (stainless steel, sealed concrete, plastic, and ceramic tile) and RTE food matrixes (hot dogs and deli meat).

Sequence-based methods for detecting and evaluating the human gut mycobiome.

PubMed

Suhr, M J; Banjara, N; Hallen-Adams, H E

2016-03-01

We surveyed the fungal microbiota in 16 faecal samples from healthy humans with a vegetarian diet. Fungi were identified using molecular cloning, 454 pyrosequencing and a Luminex analyte-specific reagent (ASR) assay, all targeting the ITS region of the rRNA genes. Fungi were detected in each faecal sample and at least 46 distinct fungal operational taxonomic units (OTUs) were detected, from two phyla - Ascomycota and Basidiomycota. Fusarium was the most abundant genus, followed by Malassezia, Penicillium, Aspergillus and Candida. Commonly detected fungi such as Aspergillus and Penicillium, as well as known dietary fungi Agaricus bisporus and Ophiocordyceps sinensis, are presumed to be transient, allochthonous members due to their abundance in the environment or dietary associations. No single method identified the full diversity of fungi in all samples; pyrosequencing detected more distinct OTUs than the other methods, but failed to detect OTUs in some samples that were detected by cloning and/or ASR assays. ASRs were limited by the commercially available assays, but the potential to design new, optimized assays, coupled with speed and cost, makes the ASR method worthy of further study. Fungi play a role in human gut ecology and health. The field lags immensely behind bacterial gut microbiota research, and studies continue to identify new fungi in faecal samples from healthy humans. However, many of these 'new' species are incapable of growth in the human GI tract, let alone making a meaningful contribution to the gut microbial community. Fungi actually inhabiting and impacting the gut likely constitute a small set of species, and an optimized, targeted, probe-based assay may prove to be the most sensible way of quantifying their abundances. © 2015 The Society for Applied Microbiology.

Collection of Oral Fluids Using Cotton Ropes as a Sampling Method to Detect Foot-and-Mouth Disease Virus Infection in Pigs.

PubMed

Vosloo, W; Morris, J; Davis, A; Giles, M; Wang, J; Nguyen, H T T; Kim, P V; Quach, N V; Le, P T T; Nguyen, P H N; Dang, H; Tran, H X; Vu, P P; Hung, V V; Le, Q T; Tran, T M; Mai, T M T; Le, Q T V; Singanallur, N B

2015-10-01

In high-density farming practices, it is important to constantly monitor for infectious diseases, especially diseases that have the potential to spread rapidly between holdings. Pigs are known to amplify foot-and-mouth disease (FMD) by excreting large amounts of virus, and it is therefore important to detect the virus quickly and accurately to minimize the spread of disease. Ropes were used to collect oral fluid samples from pigs, and each sample was compared to saliva samples collected from individual animals by detecting FMD virus RNA using real-time PCR. Two different experiments are described where groups of pigs were infected with different serotypes of FMD virus, either with or without vaccination, and unvaccinated pigs were kept in aerosol contact. The sensitivity of the rope sampling varied between 0.67 and 0.92, and the statistical agreement between this method and individual sampling ranged from substantial to moderate for the two different serotypes. The ease of collecting oral fluids using ropes together with the high sensitivity of subsequent FMD detection through PCR indicates that this could be a useful method to monitor pig populations for FMD virus infection. With further validation of the sensitivity of detection of FMD virus RNA, this can be a cost-effective, non-invasive diagnostic tool. © 2013 Blackwell Verlag GmbH.

Clinical evaluation of a Mucorales-specific real-time PCR assay in tissue and serum samples.

PubMed

Springer, Jan; Lackner, Michaela; Ensinger, Christian; Risslegger, Brigitte; Morton, Charles Oliver; Nachbaur, David; Lass-Flörl, Cornelia; Einsele, Hermann; Heinz, Werner J; Loeffler, Juergen

2016-12-01

Molecular diagnostic assays can accelerate the diagnosis of fungal infections and subsequently improve patient outcomes. In particular, the detection of infections due to Mucorales is still challenging for laboratories and physicians. The aim of this study was to evaluate a probe-based Mucorales-specific real-time PCR assay (Muc18S) using tissue and serum samples from patients suffering from invasive mucormycosis (IMM). This assay can detect a broad range of clinically relevant Mucorales species and can be used to complement existing diagnostic tests or to screen high-risk patients. An advantage of the Muc18S assay is that it exclusively detects Mucorales species allowing the diagnosis of Mucorales DNA without sequencing within a few hours. In paraffin-embedded tissue samples this PCR-based method allowed rapid identification of Mucorales in comparison with standard methods and showed 91 % sensitivity in the IMM tissue samples. We also evaluated serum samples, an easily accessible material, from patients at risk from IMM. Mucorales DNA was detected in all patients with probable/proven IMM (100 %) and in 29 % of the possible cases. Detection of IMM in serum could enable an earlier diagnosis (up to 21 days) than current methods including tissue samples, which were gained mainly post-mortem. A screening strategy for high-risk patients, which would enable targeted treatment to improve patient outcomes, is therefore possible.

Derivative spectrum chromatographic method for the determination of trimethoprim in honey samples using an on-line solid-phase extraction technique.

PubMed

Uchiyama, Kazuhisa; Kondo, Mari; Yokochi, Rika; Takeuchi, Yuri; Yamamoto, Atsushi; Inoue, Yoshinori

2011-07-01

A simple, selective and rapid analytical method for determination of trimethoprim (TMP) in honey samples was developed and validated. This method is based on a SPE technique followed by HPLC with photodiode array detection. After dilution and filtration, aliquots of 500 μL honey samples were directly injected to an on-line SPE HPLC system. TMP was extracted on an RP SPE column, and separated on a hydrophilic interaction chromatography column during HPLC analysis. At the first detection step, the noise level of the photodiode array data was reduced with two-dimensional equalizer filtering, and then the smoothed data were subjected to derivative spectrum chromatography. On the second-derivative chromatogram at 254 nm, the limit of detection and the limit of quantification of TMP in a honey sample were 5 and 10 ng/g, respectively. The proposed method showed high accuracy (60-103%) with adequate sensitivity for TMP monitoring in honey samples. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparison of marine sampling methods for organic contaminants: Passive samplers, water extractions, and live oyster deployment.

PubMed

Raub, Kristin B; Vlahos, Penny; Whitney, Michael

2015-08-01

Laboratory and field trials evaluated the efficacy of three methods of detecting aquatic pesticide concentrations. Currently used pesticides: atrazine, metolachlor, and diazinon and legacy pesticide dieldrin were targeted. Pesticides were extracted using solid-phase extraction (SPE) of water samples, titanium plate passive samplers coated in ethylene vinyl acetate (EVA) and eastern oysters (Crassostrea viginica) as biosamplers. A laboratory study assessed the extraction efficiencies and precision of each method. Passive samplers yielded the highest precision of the three methods (RSD: 3-14% EVA plates; 19-60% oysters; and 25-56% water samples). Equilibrium partition coefficients were derived. A significant relationship was found between the concentration in oyster tissue and the ambient aquatic concentration. In the field (Housatonic River, CT (U.S.)) water sampling (n = 5) detected atrazine at 1.61-7.31 μg L(-1), oyster sampling (n = 2×15) detected dieldrin at n.d.-0.096 μg L(-1) SW and the passive samplers (n = 5×3) detected atrazine at 0.97-3.78 μg L(-1) SW and dieldrin at n.d.-0.68 μg L(-1) SW. Copyright © 2015 Elsevier Ltd. All rights reserved.

A Direct and Rapid Method to Determine Cyanide in Urine by Capillary Electrophoresis

PubMed Central

Zhang, Qiyang; Maddukuri, Naveen; Gong, Maojun

2015-01-01

Cyanides are poisonous chemicals that widely exist in nature and industrial processes as well as accidental fires. Rapid and accurate determination of cyanide exposure would facilitate forensic investigation, medical diagnosis, and chronic cyanide monitoring. Here, a rapid and direct method was developed for the determination of cyanide ions in urinary samples. This technique was based on an integrated capillary electrophoresis system coupled with laser-induced fluorescence (LIF) detection. Cyanide ions were derivatized with naphthalene-2,3-dicarboxaldehyde (NDA) and a primary amine (glycine) for LIF detection. Three separate reagents, NDA, glycine, and cyanide sample, were mixed online, which secured uniform conditions between samples for cyanide derivatization and reduced the risk of precipitation formation of mixtures. Conditions were optimized; the derivatization was completed in 2-4 minutes, and the separation was observed in 25 s. The limit of detection (LOD) was 4.0 nM at 3-fold signal-to-noise ratio for standard cyanide in buffer. The cyanide levels in urine samples from smokers and non-smokers were determined by using the method of standard addition, which demonstrated significant difference of cyanide levels in urinary samples from the two groups of people. The developed method was rapid and accurate, and is anticipated to be applicable to cyanide detection in waste water with appropriate modification. PMID:26342870

Rectal swab sampling followed by an enrichment culture-based real-time PCR assay to detect Salmonella enterocolitis in children.

PubMed

Lin, L-H; Tsai, C-Y; Hung, M-H; Fang, Y-T; Ling, Q-D

2011-09-01

Although routine bacterial culture is the traditional reference standard method for the detection of Salmonella infection in children with diarrhoea, it is a time-consuming procedure that usually only gives results after 3-4 days. Some molecular detection methods can improve the turn-around time to within 24 h, but these methods are not applied directly from stool or rectal swab specimens as routine diagnostic methods for the detection of gastrointestinal pathogens. In this study, we tested the feasibility of a bacterial enrichment culture-based real-time PCR assay method for detecting and screening for diarrhoea in children caused by Salmonella. Our results showed that the minimum real-time PCR assay time required to detect enriched bacterial culture from a swab was 3 h. In all children with suspected Salmonella diarrhoea, the enrichment culture-based real-time PCR achieved 85.4% sensitivity and 98.1% specificity, as compared with the 53.7% sensitivity and 100% specificity of detection with the routine bacterial culture method. We suggest that rectal swab sampling followed by enrichment culture-based real-time PCR is suitable as a rapid method for detecting and screening for Salmonella in paediatric patients. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Evaluation of a Method for Rapid Detection of Listeria monocytogenes in Dry-Cured Ham Based on Impedanciometry Combined with Chromogenic Agar.

PubMed

Labrador, Mirian; Rota, María C; Pérez, Consuelo; Herrera, Antonio; Bayarri, Susana

2018-05-01

The food industry is in need of rapid, reliable methodologies for the detection of Listeria monocytogenes in ready-to-eat products, as an alternative to the International Organization of Standardization (ISO) 11290-1 reference method. The aim of this study was to evaluate impedanciometry combined with chromogenic agar culture for the detection of L. monocytogenes in dry-cured ham. The experimental setup consisted in assaying four strains of L. monocytogenes and two strains of Listeria innocua in pure culture. The method was evaluated according to the ISO 16140:2003 standard through a comparative study with the ISO reference method with 119 samples of dry-cured ham. Significant determination coefficients ( R 2 of up to 0.99) for all strains assayed in pure culture were obtained. The comparative study results had 100% accuracy, 100% specificity, and 100% sensitivity. Impedanciometry followed by chromogenic agar culture was capable of detecting 1 CFU/25 g of food. L. monocytogenes was not detected in the 65 commercial samples tested. The method evaluated herein represents a promising alternative for the food industry in its efforts to control L. monocytogenes. Overall analysis time is shorter and the method permits a straightforward analysis of a large number of samples with reliable results.

Varying face occlusion detection and iterative recovery for face recognition

NASA Astrophysics Data System (ADS)

Wang, Meng; Hu, Zhengping; Sun, Zhe; Zhao, Shuhuan; Sun, Mei

2017-05-01

In most sparse representation methods for face recognition (FR), occlusion problems were usually solved via removing the occlusion part of both query samples and training samples to perform the recognition process. This practice ignores the global feature of facial image and may lead to unsatisfactory results due to the limitation of local features. Considering the aforementioned drawback, we propose a method called varying occlusion detection and iterative recovery for FR. The main contributions of our method are as follows: (1) to detect an accurate occlusion area of facial images, an image processing and intersection-based clustering combination method is used for occlusion FR; (2) according to an accurate occlusion map, the new integrated facial images are recovered iteratively and put into a recognition process; and (3) the effectiveness on recognition accuracy of our method is verified by comparing it with three typical occlusion map detection methods. Experiments show that the proposed method has a highly accurate detection and recovery performance and that it outperforms several similar state-of-the-art methods against partial contiguous occlusion.

Evaluation of a Wipe Surface Sample Method for Collection of Bacillus Spores from Nonporous Surfaces▿

PubMed Central

Brown, Gary S.; Betty, Rita G.; Brockmann, John E.; Lucero, Daniel A.; Souza, Caroline A.; Walsh, Kathryn S.; Boucher, Raymond M.; Tezak, Mathew; Wilson, Mollye C.; Rudolph, Todd

2007-01-01

Polyester-rayon blend wipes were evaluated for efficiency of extraction and recovery of powdered Bacillus atrophaeus spores from stainless steel and painted wallboard surfaces. Method limits of detection were also estimated for both surfaces. The observed mean efficiency of polyester-rayon blend wipe recovery from stainless steel was 0.35 with a standard deviation of ±0.12, and for painted wallboard it was 0.29 with a standard deviation of ±0.15. Evaluation of a sonication extraction method for the polyester-rayon blend wipes produced a mean extraction efficiency of 0.93 with a standard deviation of ±0.09. Wipe recovery quantitative limits of detection were estimated at 90 CFU per unit of stainless steel sample area and 105 CFU per unit of painted wallboard sample area. The method recovery efficiency and limits of detection established in this work provide useful guidance for the planning of incident response environmental sampling following the release of a biological agent such as Bacillus anthracis. PMID:17122390

Evaluation of a wipe surface sample method for collection of Bacillus spores from nonporous surfaces.

PubMed

Brown, Gary S; Betty, Rita G; Brockmann, John E; Lucero, Daniel A; Souza, Caroline A; Walsh, Kathryn S; Boucher, Raymond M; Tezak, Mathew; Wilson, Mollye C; Rudolph, Todd

2007-02-01

Polyester-rayon blend wipes were evaluated for efficiency of extraction and recovery of powdered Bacillus atrophaeus spores from stainless steel and painted wallboard surfaces. Method limits of detection were also estimated for both surfaces. The observed mean efficiency of polyester-rayon blend wipe recovery from stainless steel was 0.35 with a standard deviation of +/-0.12, and for painted wallboard it was 0.29 with a standard deviation of +/-0.15. Evaluation of a sonication extraction method for the polyester-rayon blend wipes produced a mean extraction efficiency of 0.93 with a standard deviation of +/-0.09. Wipe recovery quantitative limits of detection were estimated at 90 CFU per unit of stainless steel sample area and 105 CFU per unit of painted wallboard sample area. The method recovery efficiency and limits of detection established in this work provide useful guidance for the planning of incident response environmental sampling following the release of a biological agent such as Bacillus anthracis.

Direct analysis of organic priority pollutants by IMS

NASA Technical Reports Server (NTRS)

Giam, C. S.; Reed, G. E.; Holliday, T. L.; Chang, L.; Rhodes, B. J.

1995-01-01

Many routine methods for monitoring of trace amounts of atmospheric organic pollutants consist of several steps. Typical steps are: (1) collection of the air sample; (2) trapping of organics from the sample; (3) extraction of the trapped organics; and (4) identification of the organics in the extract by GC (gas chromatography), HPLC (High Performance Liquid Chromatography), or MS (Mass Spectrometry). These methods are often cumbersome and time consuming. A simple and fast method for monitoring atmospheric organics using an IMS (Ion Mobility Spectrometer) is proposed. This method has a short sampling time and does not require extraction of the organics since the sample is placed directly in the IMS. The purpose of this study was to determine the responses in the IMS to organic 'priority pollutants'. Priority pollutants including representative polycyclic aromatic hydrocarbons (PAHs), phthalates, phenols, chlorinated pesticides, and polychlorinated biphenyls (PCB's) were analyzed in both the positive and negative detection mode at ambient atmospheric pressure. Detection mode and amount detected are presented.

Surveying Europe’s Only Cave-Dwelling Chordate Species (Proteus anguinus) Using Environmental DNA

PubMed Central

Márton, Orsolya; Schmidt, Benedikt R.; Gál, Júlia Tünde; Jelić, Dušan

2017-01-01

In surveillance of subterranean fauna, especially in the case of rare or elusive aquatic species, traditional techniques used for epigean species are often not feasible. We developed a non-invasive survey method based on environmental DNA (eDNA) to detect the presence of the red-listed cave-dwelling amphibian, Proteus anguinus, in the caves of the Dinaric Karst. We tested the method in fifteen caves in Croatia, from which the species was previously recorded or expected to occur. We successfully confirmed the presence of P. anguinus from ten caves and detected the species for the first time in five others. Using a hierarchical occupancy model we compared the availability and detection probability of eDNA of two water sampling methods, filtration and precipitation. The statistical analysis showed that both availability and detection probability depended on the method and estimates for both probabilities were higher using filter samples than for precipitation samples. Combining reliable field and laboratory methods with robust statistical modeling will give the best estimates of species occurrence. PMID:28129383

Application of COLD-PCR for improved detection of KRAS mutations in clinical samples.

PubMed

Zuo, Zhuang; Chen, Su S; Chandra, Pranil K; Galbincea, John M; Soape, Matthew; Doan, Steven; Barkoh, Bedia A; Koeppen, Hartmut; Medeiros, L Jeffrey; Luthra, Rajyalakshmi

2009-08-01

KRAS mutations have been detected in approximately 30% of all human tumors, and have been shown to predict response to some targeted therapies. The most common KRAS mutation-detection strategy consists of conventional PCR and direct sequencing. This approach has a 10-20% detection sensitivity depending on whether pyrosequencing or Sanger sequencing is used. To improve detection sensitivity, we compared our conventional method with the recently described co-amplification-at-lower denaturation-temperature PCR (COLD-PCR) method, which selectively amplifies minority alleles. In COLD-PCR, the critical denaturation temperature is lowered to 80 degrees C (vs 94 degrees C in conventional PCR). The sensitivity of COLD-PCR was determined by assessing serial dilutions. Fifty clinical samples were used, including 20 fresh bone-marrow aspirate specimens and the formalin-fixed paraffin-embedded (FFPE) tissue of 30 solid tumors. Implementation of COLD-PCR was straightforward and required no additional cost for reagents or instruments. The method was specific and reproducible. COLD-PCR successfully detected mutations in all samples that were positive by conventional PCR, and enhanced the mutant-to-wild-type ratio by >4.74-fold, increasing the mutation detection sensitivity to 1.5%. The enhancement of mutation detection by COLD-PCR inversely correlated with the tumor-cell percentage in a sample. In conclusion, we validated the utility and superior sensitivity of COLD-PCR for detecting KRAS mutations in a variety of hematopoietic and solid tumors using either fresh or fixed, paraffin-embedded tissue.

Modified graphene oxide sensors for ultra-sensitive detection of nitrate ions in water.

PubMed

Ren, Wen; Mura, Stefania; Irudayaraj, Joseph M K

2015-10-01

Nitrate ions is a very common contaminant in drinking water and has a significant impact on the environment, necessitating routine monitoring. Due to its chemical and physical properties, it is hard to directly detect nitrate ions with high sensitivity in a simple and inexpensive manner. Herein with amino group modified graphene oxide (GO) as a sensing element, we show a direct and ultra-sensitive method to detect nitrate ions, at a lowest detected concentration of 5 nM in river water samples, much lower than the reported methods based on absorption spectroscopy. Furthermore, unlike the reported strategies based on absorption spectroscopy wherein the nitrate concentration is determined by monitoring an increase in aggregation of gold nanoparticles (GNPs), our method evaluates the concentration of nitrate ions based on reduction in aggregation of GNPs for monitoring in real samples. To improve sensitivity, several optimizations were performed, including the assessment of the amount of modified GO required, concentration of GNPs and incubation time. The detection methodology was characterized by zeta potential, TEM and SEM. Our results indicate that an enrichment of modified GO with nitrate ions contributed to excellent sensitivity and the entire detection procedure could be completed within 75 min with only 20 μl of sample. This simple and rapid methodology was applied to monitor nitrate ions in real samples with excellent sensitivity and minimum pretreatment. The proposed approach paves the way for a novel means to detect anions in real samples and highlights the potential of GO based detection strategy for water quality monitoring. Copyright © 2015 Elsevier B.V. All rights reserved.

Validate or falsify: Lessons learned from a microscopy method claimed to be useful for detecting Borrelia and Babesia organisms in human blood.

PubMed

Aase, Audun; Hajdusek, Ondrej; Øines, Øivind; Quarsten, Hanne; Wilhelmsson, Peter; Herstad, Tove K; Kjelland, Vivian; Sima, Radek; Jalovecka, Marie; Lindgren, Per-Eric; Aaberge, Ingeborg S

2016-01-01

A modified microscopy protocol (the LM-method) was used to demonstrate what was interpreted as Borrelia spirochetes and later also Babesia sp., in peripheral blood from patients. The method gained much publicity, but was not validated prior to publication, which became the purpose of this study using appropriate scientific methodology, including a control group. Blood from 21 patients previously interpreted as positive for Borrelia and/or Babesia infection by the LM-method and 41 healthy controls without known history of tick bite were collected, blinded and analysed for these pathogens by microscopy in two laboratories by the LM-method and conventional method, respectively, by PCR methods in five laboratories and by serology in one laboratory. Microscopy by the LM-method identified structures claimed to be Borrelia- and/or Babesia in 66% of the blood samples of the patient group and in 85% in the healthy control group. Microscopy by the conventional method for Babesia only did not identify Babesia in any samples. PCR analysis detected Borrelia DNA in one sample of the patient group and in eight samples of the control group; whereas Babesia DNA was not detected in any of the blood samples using molecular methods. The structures interpreted as Borrelia and Babesia by the LM-method could not be verified by PCR. The method was, thus, falsified. This study underlines the importance of doing proper test validation before new or modified assays are introduced.

Multiple animal studies for medical chemical defense program in soldier/patient decontamination and drug development on task 85-17: Validation of an analytical method for the detection of soman (GD), mustard (HD), tabun (GA), and VX in wastewater samples. Final report, 13 October 1985-1 January 1989

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joiner, R.L.; Hayes, L.; Rust, W.

1989-05-01

The following report summarizes the development and validation of an analytical method for the analyses of soman (GD), mustard (HD), VX, and tabun (GA) in wastewater. The need for an analytical method that can detect GD, HD, VX, and GA with the necessary sensitivity (< 20 parts per billion (PPB))and selectivity is essential to Medical Research and Evaluation Facility (MREF) operations. The analytical data were generated using liquid-liquid extraction of the wastewater, with the extract being concentrated and analyzed by gas chromatography (GC) methods. The sample preparation and analyses methods were developed in support of ongoing activities within the MREF.more » We have documented the precision and accuracy of the analytical method through an expected working calibration range (3.0 to 60 ppb). The analytical method was statistically evaluated over a range of concentrations to establish a detection limit and quantitation limit for the method. Whenever the true concentration is 8.5 ppb or above, the probability is at least 99.9 percent that the measured concentration will be ppb or above. Thus, 6 ppb could be used as a lower reliability limit for detecting concentrations in excess of 8.5 ppb. In summary, the proposed sample extraction and analyses methods are suitable for quantitative analyses to determine the presence of GD, HD, VX, and GA in wastewater samples. Our findings indicate that we can detect any of these chemical surety materiel (CSM) in water at or below the established U.S. Army Surgeon General's safety levels in drinking water.« less

Detecting bacteria and Determining Their Susceptibility to Antibiotics by Stochastic Confinement in Nanoliter Droplets using Plug-Based Microfluidics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boedicker, J.; Li, L; Kline, T

2008-01-01

This article describes plug-based microfluidic technology that enables rapid detection and drug susceptibility screening of bacteria in samples, including complex biological matrices, without pre-incubation. Unlike conventional bacterial culture and detection methods, which rely on incubation of a sample to increase the concentration of bacteria to detectable levels, this method confines individual bacteria into droplets nanoliters in volume. When single cells are confined into plugs of small volume such that the loading is less than one bacterium per plug, the detection time is proportional to plug volume. Confinement increases cell density and allows released molecules to accumulate around the cell, eliminatingmore » the pre-incubation step and reducing the time required to detect the bacteria. We refer to this approach as stochastic confinement. Using the microfluidic hybrid method, this technology was used to determine the antibiogram - or chart of antibiotic sensitivity - of methicillin-resistant Staphylococcus aureus (MRSA) to many antibiotics in a single experiment and to measure the minimal inhibitory concentration (MIC) of the drug cefoxitin (CFX) against this strain. In addition, this technology was used to distinguish between sensitive and resistant strains of S. aureus in samples of human blood plasma. High-throughput microfluidic techniques combined with single-cell measurements also enable multiple tests to be performed simultaneously on a single sample containing bacteria. This technology may provide a method of rapid and effective patient-specific treatment of bacterial infections and could be extended to a variety of applications that require multiple functional tests of bacterial samples on reduced timescales.« less

Detecting chaos in irregularly sampled time series.

PubMed

Kulp, C W

2013-09-01

Recently, Wiebe and Virgin [Chaos 22, 013136 (2012)] developed an algorithm which detects chaos by analyzing a time series' power spectrum which is computed using the Discrete Fourier Transform (DFT). Their algorithm, like other time series characterization algorithms, requires that the time series be regularly sampled. Real-world data, however, are often irregularly sampled, thus, making the detection of chaotic behavior difficult or impossible with those methods. In this paper, a characterization algorithm is presented, which effectively detects chaos in irregularly sampled time series. The work presented here is a modification of Wiebe and Virgin's algorithm and uses the Lomb-Scargle Periodogram (LSP) to compute a series' power spectrum instead of the DFT. The DFT is not appropriate for irregularly sampled time series. However, the LSP is capable of computing the frequency content of irregularly sampled data. Furthermore, a new method of analyzing the power spectrum is developed, which can be useful for differentiating between chaotic and non-chaotic behavior. The new characterization algorithm is successfully applied to irregularly sampled data generated by a model as well as data consisting of observations of variable stars.

Review of recent advances in analytical techniques for the determination of neurotransmitters

PubMed Central

Perry, Maura; Li, Qiang; Kennedy, Robert T.

2009-01-01

Methods and advances for monitoring neurotransmitters in vivo or for tissue analysis of neurotransmitters over the last five years are reviewed. The review is organized primarily by neurotransmitter type. Transmitter and related compounds may be monitored by either in vivo sampling coupled to analytical methods or implanted sensors. Sampling is primarily performed using microdialysis, but low-flow push-pull perfusion may offer advantages of spatial resolution while minimizing the tissue disruption associated with higher flow rates. Analytical techniques coupled to these sampling methods include liquid chromatography, capillary electrophoresis, enzyme assays, sensors, and mass spectrometry. Methods for the detection of amino acid, monoamine, neuropeptide, acetylcholine, nucleoside, and soluable gas neurotransmitters have been developed and improved upon. Advances in the speed and sensitivity of these methods have enabled improvements in temporal resolution and increased the number of compounds detectable. Similar advances have enabled improved detection at tissue samples, with a substantial emphasis on single cell and other small samples. Sensors provide excellent temporal and spatial resolution for in vivo monitoring. Advances in application to catecholamines, indoleamines, and amino acids have been prominent. Improvements in stability, sensitivity, and selectivity of the sensors have been of paramount interest. PMID:19800472

Red-shouldered hawk occupancy surveys in central Minnesota, USA

USGS Publications Warehouse

Henneman, C.; McLeod, M.A.; Andersen, D.E.

2007-01-01

Forest-dwelling raptors are often difficult to detect because many species occur at low density or are secretive. Broadcasting conspecific vocalizations can increase the probability of detecting forest-dwelling raptors and has been shown to be an effective method for locating raptors and assessing their relative abundance. Recent advances in statistical techniques based on presence-absence data use probabilistic arguments to derive probability of detection when it is <1 and to provide a model and likelihood-based method for estimating proportion of sites occupied. We used these maximum-likelihood models with data from red-shouldered hawk (Buteo lineatus) call-broadcast surveys conducted in central Minnesota, USA, in 1994-1995 and 2004-2005. Our objectives were to obtain estimates of occupancy and detection probability 1) over multiple sampling seasons (yr), 2) incorporating within-season time-specific detection probabilities, 3) with call type and breeding stage included as covariates in models of probability of detection, and 4) with different sampling strategies. We visited individual survey locations 2-9 times per year, and estimates of both probability of detection (range = 0.28-0.54) and site occupancy (range = 0.81-0.97) varied among years. Detection probability was affected by inclusion of a within-season time-specific covariate, call type, and breeding stage. In 2004 and 2005 we used survey results to assess the effect that number of sample locations, double sampling, and discontinued sampling had on parameter estimates. We found that estimates of probability of detection and proportion of sites occupied were similar across different sampling strategies, and we suggest ways to reduce sampling effort in a monitoring program.

Detection of β-Lactams and Chloramphenicol Residues in Raw Milk-Development and Application of an HPLC-DAD Method in Comparison with Microbial Inhibition Assays.

PubMed

Karageorgou, Eftychia; Christoforidou, Sofia; Ioannidou, Maria; Psomas, Evdoxios; Samouris, Georgios

2018-06-01

The present study was carried out to assess the detection sensitivity of four microbial inhibition assays (MIAs) in comparison with the results obtained by the High Performance Liquid Chromatography with Diode-Array Detection (HPLC-DAD) method for antibiotics of the β-lactam group and chloramphenicol in fortified raw milk samples. MIAs presented fairly good results when detecting β-lactams, whereas none were able to detect chloramphenicol at or above the permissible limits. HPLC analysis revealed high recoveries of examined compounds, whereas all detection limits observed were lower than their respective maximum residue limits (MRL) values. The extraction and clean-up procedure of antibiotics was performed by a modified matrix solid phase dispersion procedure using a mixture of Plexa by Agilent and QuEChERS as a sorbent. The HPLC method developed was validated, determining the accuracy, precision, linearity, decision limit, and detection capability. Both methods were used to monitor raw milk samples of several cows and sheep, obtained from producers in different regions of Greece, for the presence of examined antibiotic residues. Results obtained showed that MIAs could be used effectively and routinely to detect antibiotic residues in several milk types. However, in some cases, spoilage of milk samples revealed that the kits' sensitivity could be strongly affected, whereas this fact does not affect the effectiveness of HPLC-DAD analysis.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Method for chemical amplification based on fluid partitioning in an immiscible liquid

DOEpatents

Anderson, Brian L.; Colston, Bill W.; Elkin, Christopher J.

2015-06-02

A system for nucleic acid amplification of a sample comprises partitioning the sample into partitioned sections and performing PCR on the partitioned sections of the sample. Another embodiment of the invention provides a system for nucleic acid amplification and detection of a sample comprising partitioning the sample into partitioned sections, performing PCR on the partitioned sections of the sample, and detecting and analyzing the partitioned sections of the sample.

Method for chemical amplification based on fluid partitioning in an immiscible liquid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Brian L.; Colston, Bill W.; Elkin, Christopher J.

A system for nucleic acid amplification of a sample comprises partitioning the sample into partitioned sections and performing PCR on the partitioned sections of the sample. Another embodiment of the invention provides a system for nucleic acid amplification and detection of a sample comprising partitioning the sample into partitioned sections, performing PCR on the partitioned sections of the sample, and detecting and analyzing the partitioned sections of the sample.

Comparative Evaluation of Veriflow® Salmonella Species to USDA and FDA Culture-Based Methods for the Detection of Salmonella spp. in Food and Environmental Samples.

PubMed

Puri, Amrita; Joelsson, Adam C; Terkhorn, Shawn P; Brown, Ashley S; Gaudioso, Zara E; Siciliano, Nicholas A

2017-09-01

Veriflow® Salmonella species (Veriflow SS) is a molecular-based assay for the presumptive detection of Salmonella spp. from environmental surfaces (stainless steel, sealed concrete, plastic, and ceramic tile), dairy (2% milk), raw meat (20% fat ground beef), chicken carcasses, and ready-to-eat (RTE) food (hot dogs). The assay utilizes a PCR detection method coupled with a rapid, visual, flow-based assay that develops in 3 min post-PCR amplification and requires only an 18 h enrichment for maximum sensitivity. The Veriflow SS system eliminates the need for sample purification, gel electrophoresis, or fluorophore-based detection of target amplification and does not require complex data analysis. This Performance Tested MethodSM validation study demonstrated the ability of the Veriflow SS method to detect low levels of artificially inoculated or naturally occurring Salmonella spp. in eight distinct environmental and food matrixes. In each reference comparison study, probability of detection analysis indicated that there was no significant difference between the Veriflow SS method and the U.S. Department of Agriculture Food Safety and Inspection Service Microbiology Laboratory Guidebook Chapter 4.06 and the U.S. Food and Drug Administration Bacteriological Analytical Manual Chapter 5 reference methods. A total of 104 Salmonella strains were detected in the inclusivity study, and 35 nonspecific organisms went undetected in the exclusivity study. The study results show that the Veriflow SS method is a sensitive, selective, and robust assay for the presumptive detection of Salmonella spp. sampled from environmental surfaces (stainless steel, sealed concrete, plastic, and ceramic tile), dairy (2% milk), raw meat (20% fat ground beef), chicken carcasses, and RTE food (hot dogs).

Detection of antileishmanial antibodies in blood sampled from blood bank donors in Istanbul.

PubMed

Ates, Sezen Canim; Bagirova, Malahat; Allahverdiyev, Adil M; Baydar, Serap Yesilkir; Koc, Rabia Cakir; Elcicek, Serhat; Abamor, Emrah Sefik; Oztel, Olga Nehir

2012-06-01

According to the WHO, only 5-20% of the total cases of leishmaniasis are symptomatic leishmaniasis; the other cases are identified as asymptomatic leishmaniasis. In recent studies, it has been demonstrated that donor blood plays an important role in the epidemiology of asymptomatic leishmaniasis. However, the number of the studies on this subject is still insufficient. Additionally, donor blood samples obtained from Istanbul, which is the biggest metropolitan area in Turkey, have not been investigated with regard to Leishmania. Moreover, there is no information about the sensitivity of noninvasive serological methods that are used in the detection of leishmaniasis donor blood samples. Accordingly, this study aimed to investigate the presence of antileishmanial antibodies in blood samples obtained from blood bank donors in Istanbul, by using different serologic methods, and to determine the most sensitive detection method. Blood samples were taken from 188 healthy blood bank donors to the Capa Turkish Red Crescent Blood Bank (Istanbul, Turkey), and the presence of antileishmanial antibodies was measured by indirect immunofluorescent antibody test (IFAT), ELISA, immunochromatographic dipstick rapid test, and western blot (WB). Antileishmanial antibodies were determined in 12 out of 188 samples by IFAT (6.4%), and six out of these 12 donors were found to be positive at diagnostic titer 1:128 (3.2%). One hundred and eighty eight samples were investigated by ELISA and one (0.5%) of them gave a positive result. None of 188 samples provided a positive result by immunochromatographic test. WB applied to the 12 seroreactive donors showed that three out of 12 donors were positive. In this study, the presence of antileishmanial antibodies in blood samples of blood bank donors from Istanbul has been demonstrated by using feasible and low-cost serological methods. Additionally, in comparison with other simple and low-cost detection methods, WB was used for confirmation. IFAT has a higher sensitivity and therefore may be preferred as a prescreening method in endemic or nonendemic areas.

A New Remote-Sensing Method for Mine Detection using HPM Irradiation and IR Detection.

DTIC Science & Technology

1999-12-01

absorption of microwave energy by the mine. This signature appears at the soil surface after a brief time-delay from the start of HPM illumination. At...detection de cible, l’operation de teledetection, la capacite de detecter des cibles sous un ciel couvert avec peu de dependance du cycle solaire et la...the temperature of the sample depends on the microwave energy absorbed by the sample and varies inversely with the sample thermal heat capacity. The

Determination of 4-nonylphenol and 4-octylphenol in human blood samples by high-performance liquid chromatography with multi-electrode electrochemical coulometric-array detection.

PubMed

Inoue, K; Yoshimura, Y; Makino, T; Nakazawa, H

2000-11-01

Alkylphenols can affect human health because they disrupt the endocrine system. In this study, an analytical method for determining trace amounts of 4-nonylphenol (NP) and 4-octylphenol (OP) in human blood samples was developed. Reversed-phase HPLC with multi-electrode electrochemical coulometric-array detection was used for the determination of NP and OP in plasma and serum samples prepared with a solid-phase extraction method. The separation was achieved using an isocratic mobile phase of 0.7% phosphoric acid-acetonitrile with a C18 reversed phase column. The detection limits of NP and OP were 1.0 and 0.5 ng ml-1, respectively. The recoveries of NP and OP added to human plasma samples were above 70.0% with a relative standard deviation of less than 15.5%. The method was found to be applicable to the determination of NP and OP in various human blood samples such as serum and plasma.

Efficacy of the detection of Legionella in hot and cold water samples by culture and PCR. I. Standardization of methods.

PubMed

Wójcik-Fatla, Angelina; Stojek, Nimfa Maria; Dutkiewicz, Jacek

2012-01-01

The aim of the present study was: - to compare methods for concentration and isolation of Legionella DNA from water; - to examine the efficacy of various modifications of PCR test (PCR, semi-nested PCR, and real-time PCR) for the detection of known numbers of Legionella pneumophila in water samples artificially contaminated with the strain of this bacterium and in randomly selected samples of environmental water, in parallel with examination by culture. It was found that filtration is much more effective than centrifugation for the concentration of DNA in water samples, and that the Qiamp DNA Mini-Kit is the most efficient for isolation of Legionella DNA from water. The semi-nested PCR and real-time PCR proved to be the most sensitive methods for detection of Legionella DNA in water samples. Both PCR modifications showed a high correlation with recovery of Legionella by culture (p<0.01), while no correlation occurred between the results of one-stage PCR and culture (p>0.1).

Comparison of droplet digital PCR and conventional quantitative PCR for measuring EGFR gene mutation

PubMed Central

ZHANG, BO; XU, CHUN-WEI; SHAO, YUN; WANG, HUAI-TAO; WU, YONG-FANG; SONG, YE-YING; LI, XIAO-BING; ZHANG, ZHE; WANG, WEN-JING; LI, LI-QIONG; CAI, CONG-LI

2015-01-01

Early detection of epidermal growth factor receptor (EGFR) mutation, particularly EGFR T790M mutation, is of clinical significance. The aim of the present study was to compare the performances of amplification refractory mutation system-based quantitative polymerase chain reaction (ARMS-qPCR) and droplet digital polymerase chain reaction (ddPCR) approaches in the detection of EGFR mutation and explore the feasibility of using ddPCR in the detection of samples with low mutation rates. EGFR gene mutations in plasmid samples with different T790M mutation rates (0.1–5%) and 10 clinical samples were detected using the ARMS-qPCR and ddPCR approaches. The results demonstrated that the ARMS-qPCR method stably detected the plasmid samples (6,000 copies) with 5 and 1% mutation rates, while the ddPCR approach reliably detected those with 5% (398 copies), 1% (57 copies), 0.5% (24 copies) and 0.1% (average 6 copies) mutation rates. For the 10 clinical samples, the results for nine samples by the ARMS-qPCR and ddPCR methods were consistent; however, the sample N006, indicated to be EGFR wild-type by ARMS-qPCR, was revealed to have a clear EGFR T790M mutation with seven copies of mutant alleles in a background of 6,000 wild-type copies using ddPCR technology. This study demonstrates the feasibility of applying the ddPCR system to detect EGFR mutation and identified the advantage of ddPCR in the detection of samples with a low EGFR mutation abundance, particularly the secondary EGFR T790M resistance mutation, which enables early diagnosis before acquired resistance to tyrosine kinase inhibitors becomes clinically detectable. PMID:25780439

Biomarkers for liver fibrosis

DOEpatents

Jacobs, Jon M.; Burnum-Johnson, Kristin E.; Baker, Erin M.; Smith, Richard D.; Gritsenko, Marina A.; Orton, Daniel

2017-05-16

Methods and systems for diagnosing or prognosing liver fibrosis in a subject are provided. In some examples, such methods and systems can include detecting liver fibrosis-related molecules in a sample obtained from the subject, comparing expression of the molecules in the sample to controls representing expression values expected in a subject who does not have liver fibrosis or who has non-progressing fibrosis, and diagnosing or prognosing liver fibrosis in the subject when differential expression of the molecules between the sample and the controls is detected. Kits for the diagnosis or prognosis of liver fibrosis in a subject are also provided which include reagents for detecting liver fibrosis related molecules.

Biomarkers for liver fibrosis

DOEpatents

Jacobs, Jon M.; Burnum-Johnson, Kristin E.; Baker, Erin M.; Smith, Richard D.; Gritsenko, Marina A.; Orton, Daniel

2015-09-15

Methods and systems for diagnosing or prognosing liver fibrosis in a subject are provided. In some examples, such methods and systems can include detecting liver fibrosis-related molecules in a sample obtained from the subject, comparing expression of the molecules in the sample to controls representing expression values expected in a subject who does not have liver fibrosis or who has non-progressing fibrosis, and diagnosing or prognosing liver fibrosis in the subject when differential expression of the molecules between the sample and the controls is detected. Kits for the diagnosis or prognosis of liver fibrosis in a subject are also provided which include reagents for detecting liver fibrosis related molecules.

Determination of airborne carbonyls: comparison of a thermal desorption/GC method with the standard DNPH/HPLC method.

PubMed

Ho, Steven Sai Hang; Yu, Jian Zhen

2004-02-01

The standard method for the determination of gaseous carbonyls is to collect carbonyls onto 2,4-dinitrophenyl hydrazine (DNPH) coated solid sorbent followed by solvent extraction of the solid sorbent and analysis of the derivatives using high-pressure liquid chromatography (HPLC). This paper describes a newly developed approach that involves collection of the carbonyls onto pentafluorophenyl hydrazine (PFPH) coated solid sorbents followed by thermal desorption and gas chromatographic (GC) analysis of the PFPH derivatives with mass spectrometric (MS) detection. Sampling tubes loaded with 510 nmol of PFPH on Tenax sorbent effectively collect gaseous carbonyls, including formaldehyde, acetaldehyde, propanal, butanal, heptanal, octanal, acrolein, 2-furfural, benzaldehyde, p-tolualdehyde, glyoxal, and methylglyoxal, at a flow rate of at least up to 100 mL/min. All of the tested carbonyls are shown to have method detection limits (MDLs) of subnanomoles per sampling tube, corresponding to air concentrations of <0.3 ppbv for a sampled volume of 24 L. These limits are 2-12 times lower than those that can be obtained using the DNPH/HPLC method. The improvement of MDLs is especially pronounced for carbonyls larger than formaldehyde and acetaldehyde. The PFPH/GC method also offers better peak separation and more sensitive and specific detection through the use of MS detection. Comparison studies on ambient samples and kitchen exhaust samples have demonstrated that the two methods do not yield systematic differences in concentrations of the carbonyls that are above their respective MDLs in both methods, including formaldehyde, acetaldehyde, acrolein, and butanal. The lower MDLs afforded by the PFPH/ GC method also enable the determination of a few more carbonyls in both applications.

Development of a robust chromatographic method for the detection of chlorophenols in cork oak forest soils.

PubMed

McLellan, Iain; Hursthouse, Andrew; Morrison, Calum; Varela, Adélia; Pereira, Cristina Silva

2014-02-01

A major concern for the cork and wine industry is 'cork taint' which is associated with chloroanisoles, the microbial degradation metabolites of chlorophenols. The use of chlorophenolic compounds as pesticides within cork forests was prohibited in 1993 in the European Union (EU) following the introduction of industry guidance. However, cork produced outside the EU is still thought to be affected and simple, robust methods for chlorophenol analysis are required for wider environmental assessment by industry and local environmental regulators. Soil samples were collected from three common-use forests in Tunisia and from one privately owned forest in Sardinia, providing examples of varied management practice and degree of human intervention. These provided challenge samples for the optimisation of a HPLC-UV detection method. It produced recoveries consistently >75% against a soil CRM (ERM-CC008) for pentachlorophenol. The optimised method, with ultraviolet (diode array) detection is able to separate and quantify 16 different chlorophenols at field concentrations greater than the limits of detection ranging from 6.5 to 191.3 μg/kg (dry weight). Application to a range of field samples demonstrated the absence of widespread contamination in forest soils at sites sampled in Sardinia and Tunisia.

Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory : determination of organophosphate pesticides in whole water by continuous liquid-liquid extraction and capillary-column gas chromatography with flame photometric detection

USGS Publications Warehouse

Jha, Virendra K.; Wydoski, Duane S.

2003-01-01

A method for the isolation of 20 parent organophosphate pesticides and 5 organophosphate pesticide degradates from natural-water samples is described. Compounds are extracted from water samples with methylene chloride using a continuous liquid-liquid extractor for 6 hours. The solvent is evaporated using heat and a flow of nitrogen to a volume of 1 milliliter and solvent exchanged to ethyl acetate. Extracted compounds are determined by capillary-column gas chromatography with flame photometric detection. Single-operator derived method detection limits in three water-matrix samples ranged from 0.003 to 0.009 microgram per liter. Method performance was validated by spiking all compounds in three different matrices at three different concentrations. Eight replicates were analyzed at each concentration in each matrix. Mean recoveries of most method compounds spiked in surface-water samples ranged from 54 to 137 percent and those in ground-water samples ranged from 40 to 109 percent for all pesticides. Recoveries in reagent-water samples ranged from 42 to 104 percent for all pesticides. The only exception was O-ethyl-O-methyl-S-propylphosphorothioate, which had variable recovery in all three matrices ranging from 27 to 79 percent. As a result, the detected concentration of O-ethyl-O-methyl-S-propylphosphorothioate in samples is reported in this method with an estimated remark code. Based on the performance issue, two more compounds, disulfoton and ethion monoxon, also will be reported in this method with an estimated remark code. Estimated-value compounds, which are ?E-coded? in the data base, do not meet the performance criteria for unqualified quantification, but are retained in the method because the compounds are important owing to high use or potential environmental effects and because analytical performance has been consistent and reproducible.

Detection of hyphomycetes in the upper respiratory tract of patients with cystic fibrosis.

PubMed

Horré, R; Marklein, G; Siekmeier, R; Reiffert, S-M

2011-11-01

The respiratory tract of cystic fibrosis patients is colonised by bacteria and fungi. Although colonisation by slow growing fungi such as Pseudallescheria, Scedosporium and Exophiala species has been studied previously, the colonisation rate differs from study to study. Infections caused by these fungi have been recognised, especially after lung transplants. Monitoring of respiratory tract colonisation in cystic fibrosis patients includes the use of several semi-selective culture media to detect bacteria such as Pseudomonas aeruginosa and Burkholderia cepacia as well as Candida albicans. It is relevant to study whether conventional methods are sufficient for the detection of slow growing hyphomycetes or if additional semi-selective culture media should be used. In total, 589 respiratory specimens from cystic fibrosis patients were examined for the presence of slow growing hyphomycetes. For 439 samples from 81 patients, in addition to conventional methods, erythritol-chloramphenicol agar was used for the selective isolation of Exophiala dermatitidis and paraffin-covered liquid Sabouraud media for the detection of phaeohyphomycetes. For 150 subsequent samples from 42 patients, SceSel+ agar was used for selective isolation of Pseudallescheria and Scedosporium species,and brain-heart infusion bouillon containing a wooden stick for hyphomycete detection. Selective isolation techniques were superior in detecting non-Aspergillus hyphomycetes compared with conventional methods. Although liquid media detected fewer strains of Exophiala, Pseudallescheria and Scedosporium species, additional hyphomycete species not detected by other methods were isolated. Current conventional methods are insufficient to detect non-Aspergillus hyphomycetes, especially Exophiala, Pseudallescheria and Scedosporium species, in sputum samples of cystic fibrosis patients. © 2010 Blackwell Verlag GmbH.

Application of surface enhanced Raman scattering and competitive adaptive reweighted sampling on detecting furfural dissolved in transformer oil

NASA Astrophysics Data System (ADS)

Chen, Weigen; Zou, Jingxin; Wan, Fu; Fan, Zhou; Yang, Dingkun

2018-03-01

Detecting the dissolving furfural in mineral oil is an essential technical method to evaluate the ageing condition of oil-paper insulation and the degradation of mechanical properties. Compared with the traditional detection method, Raman spectroscopy is obviously convenient and timesaving in operation. This study explored the method of applying surface enhanced Raman scattering (SERS) on quantitative analysis of the furfural dissolved in oil. Oil solution with different concentration of furfural were prepared and calibrated by high-performance liquid chromatography. Confocal laser Raman spectroscopy (CLRS) and SERS technology were employed to acquire Raman spectral data. Monte Carlo cross validation (MCCV) was used to eliminate the outliers in sample set, then competitive adaptive reweighted sampling (CARS) was developed to select an optimal combination of informative variables that most reflect the chemical properties of concern. Based on selected Raman spectral features, support vector machine (SVM) combined with particle swarm algorithm (PSO) was used to set up a furfural quantitative analysis model. Finally, the generalization ability and prediction precision of the established method were verified by the samples made in lab. In summary, a new spectral method is proposed to quickly detect furfural in oil, which lays a foundation for evaluating the ageing of oil-paper insulation in oil immersed electrical equipment.

Method and automated apparatus for detecting coliform organisms

NASA Technical Reports Server (NTRS)

Dill, W. P.; Taylor, R. E.; Jeffers, E. L. (Inventor)

1980-01-01

Method and automated apparatus are disclosed for determining the time of detection of metabolically produced hydrogen by coliform bacteria cultured in an electroanalytical cell from the time the cell is inoculated with the bacteria. The detection time data provides bacteria concentration values. The apparatus is sequenced and controlled by a digital computer to discharge a spent sample, clean and sterilize the culture cell, provide a bacteria nutrient into the cell, control the temperature of the nutrient, inoculate the nutrient with a bacteria sample, measures the electrical potential difference produced by the cell, and measures the time of detection from inoculation.

Transport of explosives I: TNT in soil and its equilibrium vapor

NASA Astrophysics Data System (ADS)

Baez, Bibiana; Correa, Sandra N.; Hernandez-Rivera, Samuel P.; de Jesus, Maritza; Castro, Miguel E.; Mina, Nairmen; Briano, Julio G.

2004-09-01

Landmine detection is an important task for military operations and for humanitarian demining. Conventional methods for landmine detection involve measurements of physical properties. Several of these methods fail on the detection of modern mines with plastic enclosures. Methods based on the detection signature explosives chemicals such as TNT and DNT are specific to landmines and explosive devices. However, such methods involve the measurements of the vapor trace, which can be deceiving of the actual mine location because of the complex transport phenomena that occur in the soil neighboring the buried landmine. We report on the results of the study of the explosives subject to similar environmental conditions as the actual mines. Soil samples containing TNT were used to study the effects of aging, temperature and moisture under controlled conditions. The soil used in the investigation was Ottawa sand. A JEOL GCMate II gas chromatograph +/- mass spectrometer coupled to a Tunable Electron Energy Monochromator (TEEM-GC/MS) was used to develop the method of analysis of explosives under enhanced detection conditions. Simultaneously, a GC with micro cell 63Ni, Electron Capture Detector (μECD) was used for analysis of TNT in sand. Both techniques were coupled with Solid-Phase Micro Extraction (SPME) methodology to collect TNT doped sand samples. The experiments were done in both, headspace and immersion modes of SPME for sampling of explosives. In the headspace experiments it was possible to detect appreciable TNT vapors as early as 1 hour after of preparing the samples, even at room temperature (20 °C). In the immersion experiments, I-SPME technique allowed for the detection of concentrations as low as 0.010 mg of explosive per kilogram of soil.

Viability qPCR, a new tool for Legionella risk management.

PubMed

Lizana, X; López, A; Benito, S; Agustí, G; Ríos, M; Piqué, N; Marqués, A M; Codony, F

2017-11-01

Viability quantitative Polymerase Chain Reaction (v-qPCR) is a recent analytical approach for only detecting live microorganisms by DNA amplification-based methods This approach is based on the use of a reagent that irreversibly fixes dead cells DNA. In this study, we evaluate the utility of v-qPCR versus culture method for Legionellosis risk management. The present study was performed using 116 real samples. Water samples were simultaneously analysed by culture, v-qPCR and qPCR methods. Results were compared by means of a non-parametric test. In 11.6% of samples using both methods (culture method and v-qPCR) results were positive, in 50.0% of samples both methods gave rise to negative results. As expected, equivalence between methods was not observed in all cases, as in 32.1% of samples positive results were obtained by v-qPCR and all of them gave rise to negative results by culture. Only in 6.3% of samples, with very low Legionella levels, was culture positive and v-qPCR negative. In 3.5% of samples, overgrowth of other bacteria did not allow performing the culture. When comparing both methods, significant differences between culture and v-qPCR were in the samples belonging to the cooling towers-evaporative condensers group. The v-qPCR method detected greater presence and obtained higher concentrations of Legionella spp. (p<0.001). Otherwise, no significant differences between methods were found in the rest of the groups. The v-qPCR method can be used as a quick tool to evaluate Legionellosis risk, especially in cooling towers-evaporative condensers, where this technique can detect higher levels than culture. The combined interpretation of PCR results along with the ratio of live cells is proposed as a tool for understanding the sample context and estimating the Legionellosis risk potential according to 4 levels of hierarchy. Copyright © 2017 Elsevier GmbH. All rights reserved.

A simple and fast detection method for bovine milk residues in foods: a 2-site monoclonal antibody immunochromatography assay.

PubMed

Xuli, Wu; Weiyi, He; Ji, Kunmei; Wenpu, Wan; Dongsheng, Hu; Hui, Wu; Xinpin, Luo; Zhigang, Liu

2013-03-01

The ingredient declaration on food labels assumes paramount importance in the protection of food-allergic consumers. China has not implemented Food allergen labeling. A gold immunochromatography assay (GICA) was developed using 2 monoclonal antibodies (mAb) against the milk allergen β-lactoglobulin in this study. The GICA was specific for pure milk samples with a sensitivity of 0.2 ng/mL. Milk protein traces extracted from 110 food products were detected by this method. The labels of 106 were confirmed by our GICA method: 57 food samples originally labeled as containing milk were positive for β-lactoglobulin and 49 food samples labeled as not containing milk were negative for β-lactoglobulin. However, 3 food samples falsely labeled as containing milk were found to contain no β-lactoglobulin whereas 1 food sample labeled as not containing milk actually contained β-lactoglobulin. First, these negatives could be because of the addition of a casein fraction. Second, some countries demand that food manufacturers label all ingredients derived from milk as "containing milk" even though the ingredients contain no detectable milk protein by any method. Our GICA method could thus provide a fast and simple method for semiquantitatation of β-lactoglobulin in foods. The present method provides a fast, simple, semiquantitative method for the determination of milk allergens in foods. © 2013 Institute of Food Technologists®

Comparison of PCR-based methods for the simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in clinical samples.

PubMed

de Filippis, Ivano; de Andrade, Claudia Ferreira; Caldeira, Nathalia; de Azevedo, Aline Carvalho; de Almeida, Antonio Eugenio

2016-01-01

Several in-house PCR-based assays have been described for the detection of bacterial meningitis caused by Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae from clinical samples. PCR-based methods targeting different bacterial genes are frequently used by different laboratories worldwide, but no standard method has ever been established. The aim of our study was to compare different in-house and a commercial PCR-based tests for the detection of bacterial pathogens causing meningitis and invasive disease in humans. A total of 110 isolates and 134 clinical samples (99 cerebrospinal fluid and 35 blood samples) collected from suspected cases of invasive disease were analyzed. Specific sets of primers frequently used for PCR-diagnosis of the three pathogens were used and compared with the results achieved using the multiplex approach described here. Several different gene targets were used for each microorganism, namely ctrA, crgA and nspA for N. meningitidis, ply for S. pneumoniae, P6 and bexA for H. influenzae. All used methods were fast, specific and sensitive, while some of the targets used for the in-house PCR assay detected lower concentrations of genomic DNA than the commercial method. An additional PCR reaction is described for the differentiation of capsulated and non-capsulated H. influenzae strains, the while commercial method only detects capsulated strains. The in-house PCR methods here compared showed to be rapid, sensitive, highly specific, and cheaper than commercial methods. The in-house PCR methods could be easily adopted by public laboratories of developing countries for diagnostic purposes. The best results were achieved using primers targeting the genes nspA, ply, and P6 which were able to detect the lowest DNA concentrations for each specific target. Copyright © 2016 Elsevier Editora Ltda. All rights reserved.

Detectability of the emerald ash borer (Coleoptera: Buprestidae) in asymptomatic urban trees by using branch samples.

PubMed

Ryall, Krista L; Fidgen, Jeffrey G; Turgeon, Jean J

2011-06-01

The emerald ash borer, Agrilus planipennis Fairmaire, is an exotic invasive insect causing extensive mortality to ash trees, Fraxinus spp., in Canada and the United States. Detection of incipient populations of this pest is difficult because of its cryptic life stages and a multiyear time lag between initial attack and the appearance of signs or symptoms of infestation. We sampled branches from open-grown urban ash trees to develop a sample unit suitable for detecting low density A. planipennis infestation before any signs or symptoms are evident. The sample unit that maximized detection rates consisted of one 50-cm-long piece from the base of a branch ≥6 cm diameter in the midcrown. The optimal sample size was two such branches per tree. This sampling method detected ≈75% of asymptomatic trees known to be infested by using more intensive sampling and ≈3 times more trees than sampling one-fourth of the circumference of the trunk at breast height. The method is less conspicuous and esthetically damaging to a tree than the removal of bark from the main stem or the use of trap trees, and could be incorporated into routine sanitation or maintenance of city-owned trees to identify and delineate infested areas. This research indicates that branch sampling greatly reduces false negatives associated with visual surveys and window sampling at breast height. Detection of A. planipennis-infested asymptomatic trees through branch sampling in urban centers would provide landowners and urban foresters with more time to develop and implement management tactics.

Label-free virus detection using silicon photonic microring resonators.

PubMed

McClellan, Melinda S; Domier, Leslie L; Bailey, Ryan C

2012-01-15

Viruses represent a continual threat to humans through a number of mechanisms, which include disease, bioterrorism, and destruction of both plant and animal food resources. Many contemporary techniques used for the detection of viruses and viral infections suffer from limitations such as the need for extensive sample preparation or the lengthy window between infection and measurable immune response, for serological methods. In order to develop a method that is fast, cost-effective, and features reduced sample preparation compared to many other virus detection methods, we report the application of silicon photonic microring resonators for the direct, label-free detection of intact viruses in both purified samples as well as in a complex, real-world analytical matrix. As a model system, we demonstrate the quantitative detection of Bean pod mottle virus, a pathogen of great agricultural importance, with a limit of detection of 10 ng/mL. By simply grinding a small amount of leaf sample in buffer with a mortar and pestle, infected leaves can be identified over a healthy control with a total analysis time of less than 45 min. Given the inherent scalability and multiplexing capability of the semiconductor-based technology, we feel that silicon photonic microring resonators are well-positioned as a promising analytical tool for a number of viral detection applications. Copyright © 2011 Elsevier B.V. All rights reserved.

Characterisation of a new, highly effective method for detecting nematode eggs (Ascaris spp., Toxocara spp., Trichuris spp.) in sewage sludge containing flocculants.

PubMed

Zdybel, Jolanta; Karamon, Jacek; Różycki, Mirosław; Bilska-Zając, Ewa; Kłapeć, Teresa; Cencek, Tomasz

2016-11-01

Because traditional methods used for sewage sludge parasitological examinations have low sensitivity, a new, highly effective method (own method - OM) was devised. The principle of this method is to eliminate the flocculent effect on the structure of sewage sludge by mechanically damaging floccules in the presence of surfactants and to increase the effectiveness of egg isolation processes in large volumes of liquids. The objective of this study was to estimate the effectiveness of the OM in detecting nematode eggs in sewage sludge samples containing flocculants. In the first stage, the effectiveness of the OM was compared to 4 other methods routinely used in parasitological examinations of dehydrated sewage sludge. Next, method standardisation was performed using sewage sludge samples supplemented with eggs from 3 parasite species (Ascaris suum, Toxocara canis and Trichuris vulpis). The study demonstrated that OM efficiency was 6-65 times greater than other methods, depending on the method and type of detected eggs. Limit of detection (LOD) calculations for the OM were performed on samples supplemented with a known number of parasite eggs resulting in 10, 5 and 3 eggs/50 g of sample for A. suum, T. vulpis and T. canis eggs, respectively. The limits of quantification (LOQ) of the OM were established as 200 eggs/50 g of sample for A. suum and T. vulpis eggs and 50 eggs/50 g of sample for T. canis eggs. The rectilinear regression functions, which determined the relationship between the number of eggs detected in OM measurements and the number of eggs contained in the samples, were characterised by high and statistically significant coefficients of determination (r 2 ). The slopes of the trend lines were 0.3188, 0.3821 and 0.3276, and the intercepts were -11.223, -9.0261 and -23.15 for A. suum, T. canis and T. vulpis eggs, respectively. Method sensitivity, calculated as the slope coefficient of the regression function and expressed as a percentage, ranged from 32% to 38% depending on egg type. The study confirmed that the OM may be applied to quantify parasite eggs in dehydrated sewage sludge containing polyelectrolytes. Copyright © 2016 Elsevier Inc. All rights reserved.

Critical considerations for the application of environmental DNA methods to detect aquatic species

USGS Publications Warehouse

Goldberg, Caren S.; Turner, Cameron R.; Deiner, Kristy; Klymus, Katy E.; Thomsen, Philip Francis; Murphy, Melanie A.; Spear, Stephen F.; McKee, Anna; Oyler-McCance, Sara J.; Cornman, Robert S.; Laramie, Matthew B.; Mahon, Andrew R.; Lance, Richard F.; Pilliod, David S.; Strickler, Katherine M.; Waits, Lisette P.; Fremier, Alexander K.; Takahara, Teruhiko; Herder, Jelger E.; Taberlet, Pierre

2016-01-01

Species detection using environmental DNA (eDNA) has tremendous potential for contributing to the understanding of the ecology and conservation of aquatic species. Detecting species using eDNA methods, rather than directly sampling the organisms, can reduce impacts on sensitive species and increase the power of field surveys for rare and elusive species. The sensitivity of eDNA methods, however, requires a heightened awareness and attention to quality assurance and quality control protocols. Additionally, the interpretation of eDNA data demands careful consideration of multiple factors. As eDNA methods have grown in application, diverse approaches have been implemented to address these issues. With interest in eDNA continuing to expand, supportive guidelines for undertaking eDNA studies are greatly needed.Environmental DNA researchers from around the world have collaborated to produce this set of guidelines and considerations for implementing eDNA methods to detect aquatic macroorganisms.Critical considerations for study design include preventing contamination in the field and the laboratory, choosing appropriate sample analysis methods, validating assays, testing for sample inhibition and following minimum reporting guidelines. Critical considerations for inference include temporal and spatial processes, limits of correlation of eDNA with abundance, uncertainty of positive and negative results, and potential sources of allochthonous DNA.We present a synthesis of knowledge at this stage for application of this new and powerful detection method.

Comparative evaluation of chromogenic agar CM1046 and mFC agar for detection of E. coli and thermotolerant coliform bacteria from water samples.

PubMed

Wohlsen, T D

2011-08-01

The equivalence of Oxoid (CM 1046) Brilliance((TM)) E. coli/coliform selective agar to mFC agar, as used in the Australian/New Zealand Standard Method to detect thermotolerant coliforms and Escherichia coli in water samples, was assessed. A total of 244 water samples were analysed in parallel over a 5-month period. Sewage effluent samples (n = 131, sites = 43), freshwater (n = 62, sites = 18) and marine/brackish water samples (n = 51, sites = 23) were analysed. The Wilcoxon matched-pairs signed-ranks test showed a varying degree of statistical difference between the two methods. All matrices had a higher recovery in the trial method. Enterococci faecalis, Aeromonas spp. and Vibrio spp. did not grow on the CM1046 agar, and Pseudomonas aeruginosa and Enterobacter aerogenes were inhibited. The use of CM 1046 for the detection and enumeration of E. coli and thermotolerant coliforms in water samples is a suitable alternative to the AS/NZS Standard Method. The use of CM1046 agar was less labour intensive and time consuming, as no secondary confirmation steps were required. Confirmed results could be reported within 24 h of sample analysis, as compared to 48 h with the reference method. Public health concerns can be addressed in a more efficient manner. © 2011 Unitywater. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

Method for the detection of nitro-containing compositions using ultraviolet photolysis

DOEpatents

Reagen, William K.; Lancaster, Gregory D.; Partin, Judy K.; Moore, Glenn A.

2000-01-01

A method for detecting nitro-containing compositions (e.g. nitrate/nitrite materials) in water samples and on solid substrates. In a water sample, ultraviolet light is applied to the sample so that dissolved nitro compositions therein will photolytically dissociate into gaseous nitrogen oxides (NO.sub.2(g) and/or NO.sub.(g)). A carrier gas is then introduced into the sample to generate a gaseous stream which includes the carrier gas combined with any gaseous nitrogen oxides. The carrier gas is thereafter directed into a detector. To detect nitro-compositions on solid substrates, ultraviolet light is applied thereto. A detector is then used to detect any gaseous nitrogen oxides which are photolytically generated during ultraviolet illumination. An optional carrier gas may be applied to the substrate during illumination to produce a gaseous stream which includes the carrier gas and any gaseous nitrogen oxides. The gaseous stream is then supplied to the detector.

A new method for evaluating radon and thoron alpha-activities per unit volume inside and outside various natural material samples by calculating SSNTD detection efficiencies for the emitted alpha-particles and measuring the resulting track densities.

PubMed

Misdaq, M A; Aitnouh, F; Khajmi, H; Ezzahery, H; Berrazzouk, S

2001-08-01

A Monte Carlo computer code for determining detection efficiencies of the CR-39 and LR-115 II solid-state nuclear track detectors (SSNTD) for alpha-particles emitted by the uranium and thorium series inside different natural material samples was developed. The influence of the alpha-particle initial energy on the SSNTD detection efficiencies was investigated. Radon (222Rn) and thoron (220Rn) alpha-activities per unit volume were evaluated inside and outside the natural material samples by exploiting data obtained for the detection efficiencies of the SSNTD utilized for the emitted alpha-particles, and measuring the resulting track densities. Results obtained were compared to those obtained by other methods. Radon emanation coefficients have been determined for some of the considered material samples.

Single molecule targeted sequencing for cancer gene mutation detection.

PubMed

Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W; He, Jiankui

2016-05-19

With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis.

Multi-residue method for the analysis of 85 current-use and legacy pesticides in bed and suspended sediments

USGS Publications Warehouse

Smalling, K.L.; Kuivila, K.M.

2008-01-01

A multi-residue method was developed for the simultaneous determination of 85 current-use and legacy organochlorine pesticides in a single sediment sample. After microwave-assisted extraction, clean-up of samples was optimized using gel permeation chromatography and either stacked carbon and alumina solid-phase extraction cartridges or a deactivated Florisil column. Analytes were determined by gas chromatography with ion-trap mass spectrometry and electron capture detection. Method detection limits ranged from 0.6 to 8.9 ??g/kg dry weight. Bed and suspended sediments from a variety of locations were analyzed to validate the method and 29 pesticides, including at least 1 from every class, were detected.

Estimating site occupancy rates for aquatic plants using spatial sub-sampling designs when detection probabilities are less than one

USGS Publications Warehouse

Nielson, Ryan M.; Gray, Brian R.; McDonald, Lyman L.; Heglund, Patricia J.

2011-01-01

Estimation of site occupancy rates when detection probabilities are <1 is well established in wildlife science. Data from multiple visits to a sample of sites are used to estimate detection probabilities and the proportion of sites occupied by focal species. In this article we describe how site occupancy methods can be applied to estimate occupancy rates of plants and other sessile organisms. We illustrate this approach and the pitfalls of ignoring incomplete detection using spatial data for 2 aquatic vascular plants collected under the Upper Mississippi River's Long Term Resource Monitoring Program (LTRMP). Site occupancy models considered include: a naïve model that ignores incomplete detection, a simple site occupancy model assuming a constant occupancy rate and a constant probability of detection across sites, several models that allow site occupancy rates and probabilities of detection to vary with habitat characteristics, and mixture models that allow for unexplained variation in detection probabilities. We used information theoretic methods to rank competing models and bootstrapping to evaluate the goodness-of-fit of the final models. Results of our analysis confirm that ignoring incomplete detection can result in biased estimates of occupancy rates. Estimates of site occupancy rates for 2 aquatic plant species were 19–36% higher compared to naive estimates that ignored probabilities of detection <1. Simulations indicate that final models have little bias when 50 or more sites are sampled, and little gains in precision could be expected for sample sizes >300. We recommend applying site occupancy methods for monitoring presence of aquatic species.

A PCR procedure for the detection of Giardia intestinalis cysts and Escherichia coli in lettuce.

PubMed

Ramirez-Martinez, M L; Olmos-Ortiz, L M; Barajas-Mendiola, M A; Giono Cerezo, S; Avila, E E; Cuellar-Mata, P

2015-06-01

Giardia intestinalis is a pathogen associated with foodborne outbreaks and Escherichia coli is commonly used as a marker of faecal contamination. Implementation of routine identification methods of G. intestinalis is difficult for the analysis of vegetables and the microbiological detection of E. coli requires several days. This study proposes a PCR-based assay for the detection of E. coli and G. intestinalis cysts using crude DNA isolated from artificially contaminated lettuce. The G. intestinalis and E. coli PCR assays targeted the β-giardin and uidA genes, respectively, and were 100% specific. Forty lettuces from local markets were analysed by both PCR and light microscopy and no cysts were detected, the calculated detection limit was 20 cysts per gram of lettuce; however, by PCR, E. coli was detected in eight of ten randomly selected samples of lettuce. These data highlight the need to validate procedures for routine quality assurance. These PCR-based assays can be employed as alternative methods for the detection of G. intestinalis and E. coli and have the potential to allow for the automation and simultaneous detection of protozoa and bacterial pathogens in multiple samples. Significance and impact of the study: There are few studies for Giardia intestinalis detection in food because methods for its identification are difficult for routine implementation. Here, we developed a PCR-based method as an alternative to the direct observation of cysts in lettuce by light microscopy. Additionally, Escherichia coli was detected by PCR and the sanitary quality of lettuce was evaluated using molecular and standard microbiological methods. Using PCR, the detection probability of Giardia cysts inoculated onto samples of lettuce was improved compared to light microscopy, with the advantage of easy automation. These methods may be employed to perform timely and affordable detection of foodborne pathogens. © 2015 The Society for Applied Microbiology.

Detection limits of Legionella pneumophila in environmental samples after co-culture with Acanthamoeba polyphaga

PubMed Central

2013-01-01

Background The efficiency of recovery and the detection limit of Legionella after co-culture with Acanthamoeba polyphaga are not known and so far no investigations have been carried out to determine the efficiency of the recovery of Legionella spp. by co-culture and compare it with that of conventional culturing methods. This study aimed to assess the detection limits of co-culture compared to culture for Legionella pneumophila in compost and air samples. Compost and air samples were spiked with known concentrations of L. pneumophila. Direct culturing and co-culture with amoebae were used in parallel to isolate L. pneumophila and recovery standard curves for both methods were produced for each sample. Results The co-culture proved to be more sensitive than the reference method, detecting 102-103 L. pneumophila cells in 1 g of spiked compost or 1 m3 of spiked air, as compared to 105-106 cells in 1 g of spiked compost and 1 m3 of spiked air. Conclusions Co-culture with amoebae is a useful, sensitive and reliable technique to enrich L. pneumophila in environmental samples that contain only low amounts of bacterial cells. PMID:23442526

Real-time PCR detection of Plasmodium directly from whole blood and filter paper samples

PubMed Central

2011-01-01

Background Real-time PCR is a sensitive and specific method for the analysis of Plasmodium DNA. However, prior purification of genomic DNA from blood is necessary since PCR inhibitors and quenching of fluorophores from blood prevent efficient amplification and detection of PCR products. Methods Reagents designed to specifically overcome PCR inhibition and quenching of fluorescence were evaluated for real-time PCR amplification of Plasmodium DNA directly from blood. Whole blood from clinical samples and dried blood spots collected in the field in Colombia were tested. Results Amplification and fluorescence detection by real-time PCR were optimal with 40× SYBR® Green dye and 5% blood volume in the PCR reaction. Plasmodium DNA was detected directly from both whole blood and dried blood spots from clinical samples. The sensitivity and specificity ranged from 93-100% compared with PCR performed on purified Plasmodium DNA. Conclusions The methodology described facilitates high-throughput testing of blood samples collected in the field by fluorescence-based real-time PCR. This method can be applied to a broad range of clinical studies with the advantages of immediate sample testing, lower experimental costs and time-savings. PMID:21851640

A broad range assay for rapid detection and etiologic characterization of bacterial meningitis: performance testing in samples from sub-Sahara.

PubMed

Won, Helen; Yang, Samuel; Gaydos, Charlotte; Hardick, Justin; Ramachandran, Padmini; Hsieh, Yu-Hsiang; Kecojevic, Alexander; Njanpop-Lafourcade, Berthe-Marie; Mueller, Judith E; Tameklo, Tsidi Agbeko; Badziklou, Kossi; Gessner, Bradford D; Rothman, Richard E

2012-09-01

This study aimed to conduct a pilot evaluation of broad-based multiprobe polymerase chain reaction (PCR) in clinical cerebrospinal fluid (CSF) samples compared to local conventional PCR/culture methods used for bacterial meningitis surveillance. A previously described PCR consisting of initial broad-based detection of Eubacteriales by a universal probe, followed by Gram typing, and pathogen-specific probes was designed targeting variable regions of the 16S rRNA gene. The diagnostic performance of the 16S rRNA assay in "127 CSF samples was evaluated in samples from patients from Togo, Africa, by comparison to conventional PCR/culture methods. Our probes detected Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. Uniprobe sensitivity and specificity versus conventional PCR were 100% and 54.6%, respectively. Sensitivity and specificity of uniprobe versus culture methods were 96.5% and 52.5%, respectively. Gram-typing probes correctly typed 98.8% (82/83) and pathogen-specific probes identified 96.4% (80/83) of the positives. This broad-based PCR algorithm successfully detected and provided species level information for multiple bacterial meningitis agents in clinical samples. Copyright © 2012 Elsevier Inc. All rights reserved.

A broad range assay for rapid detection and etiologic characterization of bacterial meningitis: performance testing in samples from sub-Sahara☆, ☆☆,★

PubMed Central

Won, Helen; Yang, Samuel; Gaydos, Charlotte; Hardick, Justin; Ramachandran, Padmini; Hsieh, Yu-Hsiang; Kecojevic, Alexander; Njanpop-Lafourcade, Berthe-Marie; Mueller, Judith E.; Tameklo, Tsidi Agbeko; Badziklou, Kossi; Gessner, Bradford D.; Rothman, Richard E.

2012-01-01

This study aimed to conduct a pilot evaluation of broad-based multiprobe polymerase chain reaction (PCR) in clinical cerebrospinal fluid (CSF) samples compared to local conventional PCR/culture methods used for bacterial meningitis surveillance. A previously described PCR consisting of initial broad-based detection of Eubacteriales by a universal probe, followed by Gram typing, and pathogen-specific probes was designed targeting variable regions of the 16S rRNA gene. The diagnostic performance of the 16S rRNA assay in “”127 CSF samples was evaluated in samples from patients from Togo, Africa, by comparison to conventional PCR/culture methods. Our probes detected Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. Uniprobe sensitivity and specificity versus conventional PCR were 100% and 54.6%, respectively. Sensitivity and specificity of uniprobe versus culture methods were 96.5% and 52.5%, respectively. Gram-typing probes correctly typed 98.8% (82/83) and pathogen-specific probes identified 96.4% (80/83) of the positives. This broad-based PCR algorithm successfully detected and provided species level information for multiple bacterial meningitis agents in clinical samples. PMID:22809694

Life detection systems.

NASA Technical Reports Server (NTRS)

Mitz, M. A.

1972-01-01

Some promising newer approaches for detecting microorganisms are discussed, giving particular attention to the integration of different methods into a single instrument. Life detection methods may be divided into biological, chemical, and cytological methods. Biological methods are based on the biological properties of assimilation, metabolism, and growth. Devices for the detection of organic materials are considered, taking into account an instrument which volatilizes, separates, and analyzes a sample sequentially. Other instrumental systems described make use of a microscope and the cytochemical staining principle.

Efficient IDUA Gene Mutation Detection with Combined Use of dHPLC and Dried Blood Samples

PubMed Central

Duarte, Ana Joana; Vieira, Luis

2013-01-01

Objectives. Development of a simple mutation directed method in order to allow lowering the cost of mutation testing using an easily obtainable biological material. Assessment of the feasibility of such method was tested using a GC-rich amplicon. Design and Methods. A method of denaturing high-performance liquid chromatography (dHPLC) was improved and implemented as a technique for the detection of variants in exon 9 of the IDUA gene. The optimized method was tested in 500 genomic DNA samples obtained from dried blood spots (DBS). Results. With this dHPLC approach it was possible to detect different variants, including the common p.Trp402Ter mutation in the IDUA gene. The high GC content did not interfere with the resolution and reliability of this technique, and discrimination of G-C transversions was also achieved. Conclusion. This PCR-based dHPLC method is proved to be a rapid, a sensitive, and an excellent option for screening numerous samples obtained from DBS. Furthermore, it resulted in the consistent detection of clearly distinguishable profiles of the common p.Trp402Ter IDUA mutation with an advantageous balance of cost and technical requirements. PMID:27335677

Rapid and sensitive detection of human astrovirus in water samples by loop-mediated isothermal amplification with hydroxynaphthol blue dye.

PubMed

Yang, Bo-Yun; Liu, Xiao-Lu; Wei, Yu-Mei; Wang, Jing-Qi; He, Xiao-Qing; Jin, Yi; Wang, Zi-Jian

2014-02-14

The aim of this paper was to develop a reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapid, sensitive and inexpensive detection of astrovirus. The detection limit of LAMP using in vitro RNA transcripts was 3.6 × 10 copies·μL⁻¹, which is as sensitive as the presently used PCR assays. However, the LAMP products could be identified as different colors with the naked eye following staining with hydroxynaphthol blue dye (HNB). No cross-reactivity with other gastroenteric viruses (rotavirus and norovirus) was observed, indicating the relatively high specificity of LAMP. The RT-LAMP method with HNB was used to effectively detect astrovirus in reclaimed water samples. The LAMP technique described in this study is a cheap, sensitive, specific and rapid method for the detection of astrovirus. The RT-LAMP method can be simply applied for the specific detection of astrovirus and has the potential to be utilized in the field as a screening test.

Results of analyses of the fungicide Chlorothalonil, its degradation products, and other selected pesticides at 22 surface-water sites in five Southern states, 2003-04

USGS Publications Warehouse

Scribner, Elisabeth A.; Orlando, James L.; Battaglin, William A.; Sandstrom, Mark; Kuivila, Kathryn; Meyer, Michael T.

2006-01-01

In accordance with the mission of the U.S. Geological Survey (USGS) Toxic Substances Hydrology Program, a pesticide study was conducted during 2003-04 to determine the occurrence of the fungicide chlorothalonil and its degradation products at 22 surface-water sites in five Southern States. Water-quality samples were collected during the peanut-growing season (June-September) in 2003. During the peanut-growing season in 2004, samples were collected after large storms. An analytical method was developed at the USGS Organic Geochemistry Research Laboratory in Lawrence, Kansas, to measure chlorothalonil and its degradation products by liquid chromatography/mass spectrometry (LC/MS). Chlorothalonil was detected in 4 of the 113 surface-water samples. The primary degradation product of chlorothalonil, 4-hydroxy-chlorothalonil, was detected in 26 of the 113 samples with concentrations ranging from 0.002 to 0.930 microgram per liter. The chlorothalonil degradation products, 1-amide-4-hydroxy-chorothalonil and 1,3-diamide-chlorothalonil, were detected in one water sample each at 0.020 and 0.161 microgram per liter, respectively. The USGS Methods and Research Development Group, Lakewood, Colorado, developed a custom method for chlorothalonil using gas chromatography/mass spectrometry (GC/MS) in an effort to achieve a lower laboratory reporting level (LRL) than the USGS National Water-Quality Laboratory (NWQL) schedule 2060, which analyzes the compound chlorothalonil at a LRL of 0.035 ?g/L. The group succeeded in achieving a lower GC/MS reporting level of 0.01 ?g/L. Chlorothalonil was detected in 5 of 68 water samples analyzed using the custom GC/MS method, whereas chlorothalonil was detected in 2 of 21 water samples analyzed using NWQL schedule 2060. In addition to analysis of chlorothalonil and its degradation products, samples were analyzed using the USGS NWQL schedules 2001 and 2060 for about 114 pesticides and their degradation products. Samples also were analyzed for dissolved organic carbon, suspended sediment, and percentage of silt- and clay-sized particles. Overall, it was found that chlorothalonil was detected only infrequently and at relatively low concentrations. Chlorothalonil's major degradation product, 4-hydroxy-chlorothalonil, was detected most frequently, occurred generally at higher concentrations in water samples than did the parent fungicide, and the data from this study reaffirmed that it is the dominant degradation product of chlorothalonil in the peanut-growing environment.

Level 2 validation of a flow cytometric method for detection of Escherichia coli O157:H7 in raw spinach.

PubMed

Williams, Anna J; Cooper, Willie M; Summage-West, Christine V; Sims, Lillie M; Woodruff, Robert; Christman, Jessica; Moskal, Ted J; Ramsaroop, Shawn; Sutherland, John B; Alusta, Pierre; Wilkes, Jon G; Buzatu, Dan A

2015-12-23

The Bacteriological Analytical Manual (BAM) method currently used by the United States Food and Drug Administration (FDA) to detect Escherichia coli O157:H7 in spinach was systematically compared to a new flow cytometry based method. This Food and Drug Administration (FDA) level 2 external laboratory validation study was designed to determine the latter method's sensitivity and speed for analysis of this pathogen in raw spinach. Detection of target cell inoculations with a low cell count is critical, since enterohemorrhagic strains of E. coli require an infective dose of as few as 10 cells (Schmid-Hempel and Frank, 2007). Although, according to the FDA, the infectious dose is unknown (Food and Drug Administration, 1993). Therefore, the inoculation level into the spinach, a total of 2.0±2.6 viable E. coli O157 cells, was specified to yield between 25% and 75% detection by the new method, out of 20 samples (10 positives and 10 negatives). This criterion was met in that the new method detected 60% of the nominally positive samples; the corresponding sensitivity of the reference method was 50%. For both methods the most likely explanation for false negatives was that no viable cells were actually introduced into the sample. In this validation study, the flow cytometry method was equal to the BAM in sensitivity and far superior in speed. Published by Elsevier B.V.

Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases

PubMed Central

Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

2015-01-01

Background Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. Methods We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Results Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. Conclusions We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and the prevention of preterm delivery. PMID:26042418

Comparison of two commercially available rapid detection methods and a conventional culture method to detect naturally occurring salmonellae on broiler carcasses

USDA-ARS?s Scientific Manuscript database

Many different screening devices and sampling methods have been used to detect the presence of naturally occurring Salmonella on commercially processed broiler carcasses. The objective of this study was to compare two commercial screening systems (BAX® and Roka®) to a standard cultural procedure use...

Quantification of ethanol in plasma by electrochemical detection with an unmodified screen printed carbon electrode

NASA Astrophysics Data System (ADS)

Tian, Gang; Zhang, Xiao-Qing; Zhu, Ming-Song; Zhang, Zhong; Shi, Zheng-Hu; Ding, Min

2016-03-01

Simple, rapid and accurate detection of ethanol concentration in blood is very crucial in the diagnosis and management of potential acute ethanol intoxication patients. A novel electrochemical detection method was developed for the quantification of ethanol in human plasma with disposable unmodified screen-printed carbon electrode (SPCE) without sample preparation procedure. Ethanol was detected indirectly by the reaction product of ethanol dehydrogenase (ADH) and cofactor nicotinamide adenine dinucleotide (NAD+). Method validation indicated good quantitation precisions with intra-day and inter-day relative standard deviations of ≤9.4% and 8.0%, respectively. Ethanol concentration in plasma is linear ranging from 0.10 to 3.20 mg/mL, and the detection limit is 40.0 μg/mL (S/N > 3). The method shows satisfactory correlation with the reference method of headspace gas chromatography in twenty human plasma samples (correlation coefficient 0.9311). The proposed method could be applied to diagnose acute ethanol toxicity or ethanol-related death.

Quantification of ethanol in plasma by electrochemical detection with an unmodified screen printed carbon electrode

PubMed Central

Tian, Gang; Zhang, Xiao-Qing; Zhu, Ming-Song; Zhang, Zhong; Shi, Zheng-Hu; Ding, Min

2016-01-01

Simple, rapid and accurate detection of ethanol concentration in blood is very crucial in the diagnosis and management of potential acute ethanol intoxication patients. A novel electrochemical detection method was developed for the quantification of ethanol in human plasma with disposable unmodified screen-printed carbon electrode (SPCE) without sample preparation procedure. Ethanol was detected indirectly by the reaction product of ethanol dehydrogenase (ADH) and cofactor nicotinamide adenine dinucleotide (NAD+). Method validation indicated good quantitation precisions with intra-day and inter-day relative standard deviations of ≤9.4% and 8.0%, respectively. Ethanol concentration in plasma is linear ranging from 0.10 to 3.20 mg/mL, and the detection limit is 40.0 μg/mL (S/N > 3). The method shows satisfactory correlation with the reference method of headspace gas chromatography in twenty human plasma samples (correlation coefficient 0.9311). The proposed method could be applied to diagnose acute ethanol toxicity or ethanol-related death. PMID:27006081

Use of FTA sampling cards for molecular detection of avian influenza virus in wild birds.

PubMed

Keeler, Shamus P; Ferro, Pamela J; Brown, Justin D; Fang, Xingwang; El-Attrache, John; Poulson, Rebecca; Jackwood, Mark W; Stallknecht, David E

2012-03-01

Current avian influenza (AI) virus surveillance programs involving wild birds rely on sample collection methods that require refrigeration or low temperature freezing to maintain sample integrity for virus isolation and/or reverse-transcriptase (RT) PCR. Maintaining the cold chain is critical for the success of these diagnostic assays but is not always possible under field conditions. The aim of this study was to test the utility of Finders Technology Associates (FTA) cards for reliable detection of AI virus from cloacal and oropharyngeal swabs of wild birds. The minimum detectable titer was determined, and the effect of room temperature storage was evaluated experimentally using multiple egg-propagated stock viruses (n = 6). Using real time RT-PCR, we compared results from paired cloacal swab and samples collected on FTA cards from both experimentally infected mallards (Anasplatyrhynchos) and hunter-harvested waterfowl sampled along the Texas Gulf Coast. Based on the laboratory trials, the average minimal detectable viral titer was determined to be 1 x 10(4.7) median embryo infectious dose (EID50)/ml (range: 1 x 10(4.3) to 1 x 10(5.4) EID50/ml), and viral RNA was consistently detectable on the FTA cards for a minimum of 20 days and up to 30 days for most subtypes at room temperature (23 C) storage. Real-time RT-PCR of samples collected using the FTA cards showed fair to good agreement in live birds when compared with both real-time RT-PCR and virus isolation of swabs. AI virus detection rates in samples from several wild bird species were higher when samples were collected using the FTA cards compared with cloacal swabs. These results suggest that FTA cards can be used as an alternative sample collection method when traditional surveillance methods are not possible, especially in avian populations that have historically received limited testing or situations in which field conditions limit the ability to properly store or ship swab samples.

Pseudomonas screening assay

NASA Technical Reports Server (NTRS)

Margalit, Ruth (Inventor)

1993-01-01

A method for the detection of Pseudomonas bacteria is described where an Azurin-specific antibody is employed for detecting the presence of Azurin in a test sample. The detection of the presence of Azurin in the sample is a conclusive indicator of the presence of the Pseudomonas bacteria since the Azurin protein is a specific marker for this bacterial strain.

A parameter selection for Raman spectroscopy-based detection of chemical contaminants in food powders

USDA-ARS?s Scientific Manuscript database

Raman spectroscopy technique has proven to be a reliable method for detection of chemical contaminants in food ingredients and products. To detect each contaminant particle in a food sample, it is important to determine the effective depth of penetration of laser through the food sample and the corr...

A Unimodal Model for Double Observer Distance Sampling Surveys.

PubMed

Becker, Earl F; Christ, Aaron M

2015-01-01

Distance sampling is a widely used method to estimate animal population size. Most distance sampling models utilize a monotonically decreasing detection function such as a half-normal. Recent advances in distance sampling modeling allow for the incorporation of covariates into the distance model, and the elimination of the assumption of perfect detection at some fixed distance (usually the transect line) with the use of double-observer models. The assumption of full observer independence in the double-observer model is problematic, but can be addressed by using the point independence assumption which assumes there is one distance, the apex of the detection function, where the 2 observers are assumed independent. Aerially collected distance sampling data can have a unimodal shape and have been successfully modeled with a gamma detection function. Covariates in gamma detection models cause the apex of detection to shift depending upon covariate levels, making this model incompatible with the point independence assumption when using double-observer data. This paper reports a unimodal detection model based on a two-piece normal distribution that allows covariates, has only one apex, and is consistent with the point independence assumption when double-observer data are utilized. An aerial line-transect survey of black bears in Alaska illustrate how this method can be applied.

A sensitive and efficient method for trace analysis of some phenolic compounds using simultaneous derivatization and air-assisted liquid-liquid microextraction from human urine and plasma samples followed by gas chromatography-nitrogen phosphorous detection.

PubMed

Farajzadeh, Mir Ali; Afshar Mogaddam, Mohammad Reza; Alizadeh Nabil, Ali Akbar

2015-12-01

In present study, a simultaneous derivatization and air-assisted liquid-liquid microextraction method combined with gas chromatography-nitrogen phosphorous detection has been developed for the determination of some phenolic compounds in biological samples. The analytes are derivatized and extracted simultaneously by a fast reaction with 1-flouro-2,4-dinitrobenzene under mild conditions. Under optimal conditions low limits of detection in the range of 0.05-0.34 ng mL(-1) are achievable. The obtained extraction recoveries are between 84 and 97% and the relative standard deviations are less than 7.2% for intraday (n = 6) and interday (n = 4) precisions. The proposed method was demonstrated to be a simple and efficient method for the analysis of phenols in biological samples. Copyright © 2015 John Wiley & Sons, Ltd.

Automation of sample processing for ICP-MS determination of 90Sr radionuclide at ppq level for nuclear technology and environmental purposes.

PubMed

Kołacińska, Kamila; Chajduk, Ewelina; Dudek, Jakub; Samczyński, Zbigniew; Łokas, Edyta; Bojanowska-Czajka, Anna; Trojanowicz, Marek

2017-07-01

90 Sr is a widely determined radionuclide for environmental purposes, nuclear waste control, and can be also monitored in coolants in nuclear reactor plants. In the developed method, the ICP-MS detection was employed together with sample processing in sequential injection analysis (SIA) setup, equipped with a lab-on-valve with mechanized renewal of sorbent bed for solid-phase extraction. The optimized conditions of determination included preconcentration of 90 Sr on cation-exchange column and removal of different type of interferences using extraction Sr-resin. The limit of detection of the developed procedure depends essentially on the configuration of the employed ICP-MS spectrometer and on the available volume of the sample to be analyzed. For 1L initial sample volume, the method detection limit (MDL) value was evaluated as 2.9ppq (14.5BqL -1 ). The developed method was applied to analyze spiked river water samples, water reference materials, and also simulated and real samples of the nuclear reactor coolant. Copyright © 2016 Elsevier B.V. All rights reserved.

Enzymatic digestion and selective quantification of underivatised delta-9-tetrahydrocannabinol and cocaine in human hair using gas chromatography-mass spectrometry.

PubMed

Breidi, Salah Eddine; Barker, James; Petróczi, Andrea; Naughton, Declan P

2012-01-01

Gas chromatography-mass spectrometric (GC-MS) methods for drug analysis routinely employ derivatising reagents. The aim of this paper was to develop a method for the analysis of two recreational drugs, delta-9-tetrahydrocannabinol (Δ(9)-THC) and cocaine in hair samples using GC-MS, without prior derivatisation, thus allowing the sample to be reanalysed in its original form. An enzymatic digestion technique was also developed. Ten hair samples, that were known positive for either Δ(9)-THC and/or cocaine, were enzymatically digested, extracted, and then analysed by GC-MS. All samples measured contained Δ(9)-THC and one sample contained cocaine. The limits of detection (LOD) and quantification (LOQ) were 0.02 ng/mg and 0.05 ng/mg, respectively, for cocaine and 0.015 ng/mg and 0.02 ng/mg, respectively, for Δ(9)-THC. The wide detection window, ease of direct analysis by GC-MS, lower detection limits of underivatised samples, and the stability of drugs using this technique may offer an improved method of analysis.

Enzymatic Digestion and Selective Quantification of Underivatised Delta-9-Tetrahydrocannabinol and Cocaine in Human Hair Using Gas Chromatography-Mass Spectrometry

PubMed Central

Breidi, Salah Eddine; Barker, James; Petróczi, Andrea; Naughton, Declan P.

2012-01-01

Gas chromatography-mass spectrometric (GC-MS) methods for drug analysis routinely employ derivatising reagents. The aim of this paper was to develop a method for the analysis of two recreational drugs, delta-9-tetrahydrocannabinol (Δ9-THC) and cocaine in hair samples using GC-MS, without prior derivatisation, thus allowing the sample to be reanalysed in its original form. An enzymatic digestion technique was also developed. Ten hair samples, that were known positive for either Δ9-THC and/or cocaine, were enzymatically digested, extracted, and then analysed by GC-MS. All samples measured contained Δ9-THC and one sample contained cocaine. The limits of detection (LOD) and quantification (LOQ) were 0.02 ng/mg and 0.05 ng/mg, respectively, for cocaine and 0.015 ng/mg and 0.02 ng/mg, respectively, for Δ9-THC. The wide detection window, ease of direct analysis by GC-MS, lower detection limits of underivatised samples, and the stability of drugs using this technique may offer an improved method of analysis. PMID:22567573

Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

PubMed

Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

2000-01-01

Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

Rapid detection of Escherichia coli and enterococci in recreational water using an immunomagnetic separation/adenosine triphosphate technique

USGS Publications Warehouse

Bushon, R.N.; Brady, A.M.; Likirdopulos, C.A.; Cireddu, J.V.

2009-01-01

Aims: The aim of this study was to examine a rapid method for detecting Escherichia coli and enterococci in recreational water. Methods and Results: Water samples were assayed for E. coli and enterococci by traditional and immunomagnetic separation/adenosine triphosphate (IMS/ATP) methods. Three sample treatments were evaluated for the IMS/ATP method: double filtration, single filtration, and direct analysis. Pearson's correlation analysis showed strong, significant, linear relations between IMS/ATP and traditional methods for all sample treatments; strongest linear correlations were with the direct analysis (r = 0.62 and 0.77 for E. coli and enterococci, respectively). Additionally, simple linear regression was used to estimate bacteria concentrations as a function of IMS/ATP results. The correct classification of water-quality criteria was 67% for E. coli and 80% for enterococci. Conclusions: The IMS/ATP method is a viable alternative to traditional methods for faecal-indicator bacteria. Significance and Impact of the Study: The IMS/ATP method addresses critical public health needs for the rapid detection of faecal-indicator contamination and has potential for satisfying US legislative mandates requiring methods to detect bathing water contamination in 2 h or less. Moreover, IMS/ATP equipment is considerably less costly and more portable than that for molecular methods, making the method suitable for field applications. ?? 2009 The Authors.

Occurrence of Organic Wastewater Compounds in Selected Surface-Water Supplies, Triangle Area of North Carolina, 2002-2005

USGS Publications Warehouse

Giorgino, M.J.; Rasmussen, R.B.; Pfeifle, C.M .

2007-01-01

Selected organic wastewater compounds, such as household, industrial, and agricultural-use compounds, sterols, pharmaceuticals, and antibiotics, were measured at eight sites classified as drinking-water supplies in the Triangle Area of North Carolina. From October 2002 through July 2005, seven of the sites were sampled twice, and one site was sampled 28 times, for a total of 42 sets of environmental samples. Samples were analyzed for as many as 126 compounds using three laboratory analytical methods. These methods were developed by the U.S. Geological Survey to detect low levels (generally less than or equal to 1.0 microgram per liter) of the target compounds in filtered water. Because analyses were conducted on filtered samples, the results presented in this report may not reflect the total concentration of organic wastewater compounds in the waters that were sampled. Various quality-control samples were used to quality assure the results in terms of method performance and possible laboratory or field contamination. Of the 108 organic wastewater compounds that met method performance criteria, 24 were detected in at least one sample during the study. These 24 compounds included 3 pharmaceutical compounds, 6 fire retardants and plasticizers, 3 antibiotics, 3 pesticides, 6 fragrances and flavorants, 1 disinfectant, and 2 miscellaneous-use compounds, all of which likely originated from a variety of domestic, industrial, and agricultural sources. The 10 most frequently detected compounds included acetyl-hexamethyl tetrahydronaphthalene and hexahydro-hexamethyl cyclopentabenzopyran (synthetic musks that are widely used in personal-care products and are known endocrine disruptors); tri(2-chloroethyl) phosphate, tri(dichloroisopropyl) phosphate, and tributyl phosphate (fire retardants); metolachlor (herbicide); caffeine (nonprescription stimulant); cotinine (metabolite of nicotine); acetaminophen (nonprescription analgesic); and sulfamethoxazole (prescription antibiotic). The occurrence and distribution of organic wastewater compounds varied considerably among sampling sites, but at least one compound was detected at every location. The most organic wastewater compounds (19) were detected at the Neuse River above U.S. 70 at Smithfield, where two-thirds of the total number of samples were collected. The fewest organic wastewater compounds (1) were detected at the Eno River at Hillsborough. The detection of multiple organic wastewater compounds was common, with a median of 3.5 and as many as 12 compounds observed in individual samples. Some compounds, including acetaminophen, cotinine, tri(2-chloroethyl) phosphate, and metolachlor, were detected at numerous sites and in numerous samples, indicating that they are widely distributed in the environment. Other organic wastewater compounds, including acetyl-hexamethyl tetrahydronaphthalene and hexahydro-hexamethyl cyclopentabenzopyran, were detected in numerous samples but at only one location, indicating that sources of these compounds are more site specific. Results indicate that municipal wastewater may be a source of antibiotics and synthetic musks; however, the three sites in this study that are located downstream from wastewater discharges also receive runoff from agricultural, urban, and rural residential lands. Source identification was not an objective of this study. Concentrations of individual compounds generally were less than 0.5 microgram per liter. No concentrations exceeded Federal drinking-water standards or health advisories, nor water-quality criteria established by the State of North Carolina; however, such criteria are available for only a few of the compounds that were studied. Compared with other surface waters that have been sampled across the United States, the Triangle Area water-supply sites had fewer detections of organic wastewater compounds; however, differences in study design and analytical methods used among studies must be considered when mak

Recommended Mass Spectrometry-Based Strategies to Identify Ricin-Containing Samples.

PubMed

Kalb, Suzanne R; Schieltz, David M; Becher, François; Astot, Crister; Fredriksson, Sten-Åke; Barr, John R

2015-11-25

Ricin is a protein toxin produced by the castor bean plant (Ricinus communis) together with a related protein known as R. communis agglutinin (RCA120). Mass spectrometric (MS) assays have the capacity to unambiguously identify ricin and to detect ricin's activity in samples with complex matrices. These qualitative and quantitative assays enable detection and differentiation of ricin from the less toxic RCA120 through determination of the amino acid sequence of the protein in question, and active ricin can be monitored by MS as the release of adenine from the depurination of a nucleic acid substrate. In this work, we describe the application of MS-based methods to detect, differentiate and quantify ricin and RCA120 in nine blinded samples supplied as part of the EQuATox proficiency test. Overall, MS-based assays successfully identified all samples containing ricin or RCA120 with the exception of the sample spiked with the lowest concentration (0.414 ng/mL). In fact, mass spectrometry was the most successful method for differentiation of ricin and RCA120 based on amino acid determination. Mass spectrometric methods were also successful at ranking the functional activities of the samples, successfully yielding semi-quantitative results. These results indicate that MS-based assays are excellent techniques to detect, differentiate, and quantify ricin and RCA120 in complex matrices.

Enhancing the Detection of Giardia duodenalis Cysts in Foods by Inertial Microfluidic Separation

PubMed Central

Ganz, Kyle R.; Clime, Liviu; Farber, Jeffrey M.; Corneau, Nathalie

2015-01-01

The sensitivity and specificity of current Giardia cyst detection methods for foods are largely determined by the effectiveness of the elution, separation, and concentration methods used. The aim of these methods is to produce a final suspension with an adequate concentration of Giardia cysts for detection and a low concentration of interfering food debris. In the present study, a microfluidic device, which makes use of inertial separation, was designed and fabricated for the separation of Giardia cysts. A cyclical pumping platform and protocol was developed to concentrate 10-ml suspensions down to less than 1 ml. Tests involving Giardia duodenalis cysts and 1.90-μm microbeads in pure suspensions demonstrated the specificity of the microfluidic chip for cysts over smaller nonspecific particles. As the suspension cycled through the chip, a large number of beads were removed (70%) and the majority of the cysts were concentrated (82%). Subsequently, the microfluidic inertial separation chip was integrated into a method for the detection of G. duodenalis cysts from lettuce samples. The method greatly reduced the concentration of background debris in the final suspensions (10-fold reduction) in comparison to that obtained by a conventional method. The method also recovered an average of 68.4% of cysts from 25-g lettuce samples and had a limit of detection (LOD) of 38 cysts. While the recovery of cysts by inertial separation was slightly lower, and the LOD slightly higher, than with the conventional method, the sample analysis time was greatly reduced, as there were far fewer background food particles interfering with the detection of cysts by immunofluorescence microscopy. PMID:25841016

Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

USGS Publications Warehouse

Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C

2015-01-01

Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations where detection probability using traditional survey methods is low or access by trained personnel is limited.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

PubMed Central

Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

Comparison of four machine learning methods for object-oriented change detection in high-resolution satellite imagery

NASA Astrophysics Data System (ADS)

Bai, Ting; Sun, Kaimin; Deng, Shiquan; Chen, Yan

2018-03-01

High resolution image change detection is one of the key technologies of remote sensing application, which is of great significance for resource survey, environmental monitoring, fine agriculture, military mapping and battlefield environment detection. In this paper, for high-resolution satellite imagery, Random Forest (RF), Support Vector Machine (SVM), Deep belief network (DBN), and Adaboost models were established to verify the possibility of different machine learning applications in change detection. In order to compare detection accuracy of four machine learning Method, we applied these four machine learning methods for two high-resolution images. The results shows that SVM has higher overall accuracy at small samples compared to RF, Adaboost, and DBN for binary and from-to change detection. With the increase in the number of samples, RF has higher overall accuracy compared to Adaboost, SVM and DBN.

Single-hole hollow molecularly imprinted polymer embedded carbon dot for fast detection of tetracycline in honey.

PubMed

Li, Huiyu; Zhao, Li; Xu, Yuan; Zhou, Tianyu; Liu, Haochi; Huang, Ning; Ding, Jie; Li, Yi; Ding, Lan

2018-08-01

It is difficult to detect tetracycline (TC) in honey sample by using carbon dots (CDs) because the autofluorescence of the matrix of honey sample overlaps with the fluorescence emission spectrum of the large majority of CDs. Herein, single-hole hollow molecularly imprinted polymers embedded carbon dots (HMIP@CD) was prepared via microwave-assisted method. TC in diluted honey sample was adsorbed by the HMIP@CD within 3 min, after which the HMIP@CD absorbed with TC was separated by centrifugation from honey sample and redispersed into phosphate buffer solution. The autofluorescence of honey that interferes with the fluorescence signal of HMIP@CD was avoided. The method exhibited an excellent linearity within 10-200 μg L -1 and a low detection limit of 3.1 μg L -1 . At three spiking levels of TC, the recoveries ranged from 93% to 105% with precisions below 1.6%. This method provides an effective strategy for detecting analyte in complex matrix with autofluorescence interference. Copyright © 2018. Published by Elsevier B.V.

Effect of sample storage time on detection of hybridization signals in Checkerboard DNA-DNA hybridization.

PubMed

do Nascimento, Cássio; Muller, Katia; Sato, Sandra; Albuquerque Junior, Rubens Ferreira

2012-04-01

Long-term sample storage can affect the intensity of the hybridization signals provided by molecular diagnostic methods that use chemiluminescent detection. The aim of this study was to evaluate the effect of different storage times on the hybridization signals of 13 bacterial species detected by the Checkerboard DNA-DNA hybridization method using whole-genomic DNA probes. Ninety-six subgingival biofilm samples were collected from 36 healthy subjects, and the intensity of hybridization signals was evaluated at 4 different time periods: (1) immediately after collecting (n = 24) and (2) after storage at -20 °C for 6 months (n = 24), (3) for 12 months (n = 24), and (4) for 24 months (n = 24). The intensity of hybridization signals obtained from groups 1 and 2 were significantly higher than in the other groups (p < 0.001). No differences were found between groups 1 and 2 (p > 0.05). The Checkerboard DNA-DNA hybridization method was suitable to detect hybridization signals from all groups evaluated, and the intensity of signals decreased significantly after long periods of sample storage.

Determination of benazolin-ethyl residues in soil and rape seed by SPE clean-up and GC with electron capture detection.

PubMed

Liu, Xiaolu; Yang, Tao; Hu, Jiye

2013-01-01

A method has been developed and established for residue determination of benazolin-ethyl in soil and rape seed samples by gas chromatography with electron capture detection (GC-ECD). Limits of quantification of the method are 0.005 mg/kg for both soil and rape seed, which are sufficiently below the maximum residue limit, and the limit of detection is 0.0023 ng. The average recoveries of the analyte range from 85.89 to 105.84% with relative standard deviations (coefficient of variation) less than 5.53% at the three spike levels (0.005, 0.1 and 0.5 mg/kg). The half-life of benazolin-ethyl in soil from the experimental field is 4.62 days. The final residues of benazolin-ethyl in soil and rape seed samples are lower than 0.005 mg/kg at harvest time. Direct confirmation of the analyte in real samples is achieved by GC-mass spectrometry. It is demonstrated that the proposed method is simple, rapid and efficient, and reliable to detect benazolin-ethyl residues in soil and rape seed samples.

Linking landscape characteristics to local grizzly bear abundance using multiple detection methods in a hierarchical model

USGS Publications Warehouse

Graves, T.A.; Kendall, Katherine C.; Royle, J. Andrew; Stetz, J.B.; Macleod, A.C.

2011-01-01

Few studies link habitat to grizzly bear Ursus arctos abundance and these have not accounted for the variation in detection or spatial autocorrelation. We collected and genotyped bear hair in and around Glacier National Park in northwestern Montana during the summer of 2000. We developed a hierarchical Markov chain Monte Carlo model that extends the existing occupancy and count models by accounting for (1) spatially explicit variables that we hypothesized might influence abundance; (2) separate sub-models of detection probability for two distinct sampling methods (hair traps and rub trees) targeting different segments of the population; (3) covariates to explain variation in each sub-model of detection; (4) a conditional autoregressive term to account for spatial autocorrelation; (5) weights to identify most important variables. Road density and per cent mesic habitat best explained variation in female grizzly bear abundance; spatial autocorrelation was not supported. More female bears were predicted in places with lower road density and with more mesic habitat. Detection rates of females increased with rub tree sampling effort. Road density best explained variation in male grizzly bear abundance and spatial autocorrelation was supported. More male bears were predicted in areas of low road density. Detection rates of males increased with rub tree and hair trap sampling effort and decreased over the sampling period. We provide a new method to (1) incorporate multiple detection methods into hierarchical models of abundance; (2) determine whether spatial autocorrelation should be included in final models. Our results suggest that the influence of landscape variables is consistent between habitat selection and abundance in this system.

Development of a specific immunomagnetic capture-PCR for rapid detection of viable Mycoplasma agalactiae in sheep milk samples.

PubMed

Sanna, G; Lecca, V; Foddai, A; Tola, S

2014-12-01

To develop an immunomagnetic capture (IMC) to detect viable Mycoplasma agalactiae in routine ovine milk samples. Polyclonal antibodies against two M. agalactiae membrane surface proteins (P80 and P55) were covalently conjugated to magnetic beads (MBs) to form MB-Ab80 and MB-Ab55. Mycoplasma agalactiae cells were captured by a specific antigen-antibody reaction and magnetic separation. Immunomagnetic capture (IMC) was used to isolate and concentrate M. agalactiae in serial decimal dilutions and in artificially contaminated milk to facilitate subsequent detection by PCR. A 375-bp fragment of M. agalactiae was amplified using a pair of M. agalactiae-specific primers in PCR. The limit of detection of IMC-PCR method ranged from 10 to 10(2)  CCU ml(-1) when mycoplasmas were resuspended in PBS and from 10(2) to 10(3)  CCU ml(-1) when mycoplasmas were resuspended in uncontaminated ovine milk. This study also describes the application of IMC-PCR method to test for M. agalactiae in 516 milk samples collected from sheep with suspected contagious agalactia. Its performance was evaluated relative to culture. This report has demonstrated for the first time, the effective use of rapid and reliable IMC combined with PCR assay for the detection of viable M. agalactiae. The method IMC-PCR provides an alternative to conventional microbiological detection, method and it could be applied to quick detection of M. agalactiae in routine sheep milk samples. © 2014 The Authors published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.

Determination of dapsone in serum and saliva using reversed-phase high-performance liquid chromatography with ultraviolet or electrochemical detection.

PubMed

Moncrieff, J

1994-03-18

A simple, extractionless method for the determination of dapsone in serum and saliva is described. Reversed-phase high-performance liquid chromatography is used with UV detection at 295 nm or electrochemical detection at 0.7 V. Diazoxide in buffer is the internal standard for UV detection and practolol for electrochemical detection. Sample preparation is minimal with protein precipitation of serum samples whilst saliva samples are simply diluted with addition of an internal standard. Low-level serum and saliva samples are front-cut on-line with a 3 cm laboratory-made precolumn in the loop position on a standard Valco injection valve. Isocratic separation is achieved on a 250 mm x 4.6 mm I.D. stainless-steel Spherisorb S5 ODS-1 column. The mobile phase for high levels of dapsone is acetonitrile-elution buffer (12:88, v/v) at 2 ml/min and a column temperature of 40 degrees C for both serum and saliva separations. For the low-level assays using electrochemical detection and solid-phase clean-up, the mobile phase is acetonitrile-methanol-elution buffer (9:4:87, v/v/v). The UV and electrochemical detection limits are 25 ng/ml and 200 pg/ml, respectively, in both serum and saliva. This simple method is applicable to the routine monitoring of dapsone levels in serum from leprotic patients and electrochemical detection gives a simple, reliable method for the monitoring of trough values in subjects on anti-malarial prophylaxis.

Detection of Classical swine fever virus infection by individual oral fluid of pigs following experimental inoculation.

PubMed

Petrini, Stefano; Pierini, Ilaria; Giammarioli, Monica; Feliziani, Francesco; De Mia, Gian Mario

2017-03-01

We evaluated the use of oral fluid as an alternative to serum samples for Classical swine fever virus (CSFV) detection. Individual oral fluid and serum samples were collected at different times post-infection from pigs that were experimentally inoculated with CSFV Alfort 187 strain. We found no evidence of CSFV neutralizing antibodies in swine oral fluid samples under our experimental conditions. In contrast, real-time reverse transcription-polymerase chain reaction could detect CSFV nucleic acid from the oral fluid as early as 8 d postinfection, which also coincided with the time of initial detection in blood samples. The probability of CSFV detection in oral fluid was identical or even higher than in the corresponding blood sample. Our results support the feasibility of using this sampling method for CSFV genome detection, which may represent an additional cost-effective tool for CSF control.

DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan.

PubMed

Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro

2016-10-11

Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.

A longitudinal study of Campylobacter distribution in a turkey production chain

PubMed Central

Perko-Mäkelä, Päivikki; Isohanni, Pauliina; Katzav, Marianne; Lund, Marianne; Hänninen, Marja-Liisa; Lyhs, Ulrike

2009-01-01

Background Campylobacter is the most common cause of bacterial enteritis worldwide. Handling and eating of contaminated poultry meat has considered as one of the risk factors for human campylobacteriosis.Campylobacter contamination can occur at all stages of a poultry production cycle. The objective of this study was to determine the occurrence of Campylobacter during a complete turkey production cycle which lasts for 1,5 years of time. For detection of Campylobacter, a conventional culture method was compared with a PCR method. Campylobacter isolates from different types of samples have been identified to the species level by a multiplex PCR assay. Methods Samples (N = 456) were regularly collected from one turkey parent flock, the hatchery, six different commercial turkey farms and from 11 different stages at the slaughterhouse. For the detection of Campylobacter, a conventional culture and a PCR method were used. Campylobacter isolates (n = 143) were identified to species level by a multiplex PCR assay. Results No Campylobacter were detected in either the samples from the turkey parent flock or from hatchery samples using the culture method. PCR detected Campylobacter DNA in five faecal samples and one fluff and eggshell sample. Six flocks out of 12 commercial turkey flocks where found negative at the farm level but only two were negative at the slaughterhouse. Conclusion During the brooding period Campylobacter might have contact with the birds without spreading of the contamination within the flock. Contamination of working surfaces and equipment during slaughter of a Campylobacter positive turkey flock can persist and lead to possible contamination of negative flocks even after the end of the day's cleaning and desinfection. Reduction of contamination at farm by a high level of biosecurity control and hygiene may be one of the most efficient ways to reduce the amount of contaminated poultry meat in Finland. Due to the low numbers of Campylobacter in the Finnish turkey production chain, enrichment PCR seems to be the optimal detection method here. PMID:19348687

Assessment of microbiological contamination of fresh, minimally processed, and ready-to-eat lettuces (Lactuca sativa), Rio de Janeiro State, Brazil.

PubMed

Brandão, Marcelo L L; Almeida, Davi O; Bispo, Fernanda C P; Bricio, Silvia M L; Marin, Victor A; Miagostovich, Marize P

2014-05-01

This study aimed to assess the microbiological contamination of lettuces commercialized in Rio de Janeiro, Brazil, in order to investigate detection of norovirus genogroup II (NoV GII), Salmonella spp., total and fecal coliforms, such as Escherichia coli. For NoV detection samples were processed using the adsorption-elution concentration method associated to real-time quantitative polymerase chain reaction (qPCR). A total of 90 samples of lettuce including 30 whole fresh lettuces, 30 minimally processed (MP) lettuces, and 30 raw ready-to-eat (RTE) lettuce salads were randomly collected from different supermarkets (fresh and MP lettuce samples), food services, and self-service restaurants (RTE lettuce salads), all located in Rio de Janeiro, Brazil, from October 2010 to December 2011. NoV GII was not detected and PP7 bacteriophage used as internal control process (ICP) was recovered in 40.0%, 86.7%, and 76.7% of those samples, respectively. Salmonella spp. was not detected although fecal contamination has been observed by fecal coliform concentrations higher than 10(2) most probable number/g. E. coli was detected in 70.0%, 6.7%, and 30.0% of fresh, MP, and RTE samples, respectively. This study highlights the need to improve hygiene procedures at all stages of vegetable production and to show PP7 bacteriophage as an ICP for recovering RNA viruses' methods from MP and RTE lettuce samples, encouraging the evaluation of new protocols that facilitate the establishment of methodologies for NoV detection in a greater number of food microbiology laboratories. The PP7 bacteriophage can be used as an internal control process in methods for recovering RNA viruses from minimally processed and ready-to-eat lettuce samples. © 2014 Institute of Food Technologists®

[Detection of endotoxins of Gram-negative bacteria on the basis of electromagnetic radiation frequency spectrum].

PubMed

Likhoded, V G; Kuleshova, N V; Sergieva, N V; Konev, Iu V; Trubnikova, I A; Sudzhian, E V

2007-01-01

Method of Gram-negative bacteria endotoxins detection on the basis of their own spectrum of electromagnetic radiation frequency was developed. Frequency spectrum typical for chemotype Re glycolipid, which is a part of lypopolysaccharides in the majority of Gram-negative bacteria, was used. Two devices--"Mini- Expert-DT" (manufactured by IMEDIS, Moscow) and "Bicom" (manufactured by Regumed, Germany)--were used as generators of electromagnetic radiation. Detection of endotoxin using these devices was performed by electropuncture vegetative resonance test. Immunoenzyme reaction with antibodies to chemotype Re glycolipid was used during analysis of preparations for assessment of resonance-frequency method specificity. The study showed that resonance-frequency method can detect lypopolysaccharides of different enterobacteria in quantities up to 0.1 pg as well as bacteria which contain lypopolysaccharides. At the same time, this method does not detect such bacteria as Staphylococcus aureus, Bifidobacterium spp., Lactobacillus spp., and Candida albicans. The method does not require preliminary processing of blood samples and can be used for diagnostics of endotoxinemia, and detection of endotoxins in blood samples or injection solutions.

Direct injection GC method for measuring light hydrocarbon emissions from cooling-tower water.

PubMed

Lee, Max M; Logan, Tim D; Sun, Kefu; Hurley, N Spencer; Swatloski, Robert A; Gluck, Steve J

2003-12-15

A Direct Injection GC method for quantifying low levels of light hydrocarbons (C6 and below) in cooling water has been developed. It is intended to overcome the limitations of the currently available technology. The principle of this method is to use a stripper column in a GC to strip waterfrom the hydrocarbons prior to entering the separation column. No sample preparation is required since the water sample is introduced directly into the GC. Method validation indicates that the Direct Injection GC method offers approximately 15 min analysis time with excellent precision and recovery. The calibration studies with ethylene and propylene show that both liquid and gas standards are suitable for routine calibration and calibration verification. The sampling method using zero headspace traditional VOA (Volatile Organic Analysis) vials and a sample chiller has also been validated. It is apparent that the sampling method is sufficient to minimize the potential for losses of light hydrocarbons, and samples can be held at 4 degrees C for up to 7 days with more than 93% recovery. The Direct Injection GC method also offers <1 ppb (w/v) level method detection limits for ethylene, propylene, and benzene. It is superior to the existing El Paso stripper method. In addition to lower detection limits for ethylene and propylene, the Direct Injection GC method quantifies individual light hydrocarbons in cooling water, provides better recoveries, and requires less maintenance and setup costs. Since the instrumentation and supplies are readily available, this technique could easily be established as a standard or alternative method for routine emission monitoring and leak detection of light hydrocarbons in cooling-tower water.

Air sampling with solid phase microextraction

NASA Astrophysics Data System (ADS)

Martos, Perry Anthony

There is an increasing need for simple yet accurate air sampling methods. The acceptance of new air sampling methods requires compatibility with conventional chromatographic equipment, and the new methods have to be environmentally friendly, simple to use, yet with equal, or better, detection limits, accuracy and precision than standard methods. Solid phase microextraction (SPME) satisfies the conditions for new air sampling methods. Analyte detection limits, accuracy and precision of analysis with SPME are typically better than with any conventional air sampling methods. Yet, air sampling with SPME requires no pumps, solvents, is re-usable, extremely simple to use, is completely compatible with current chromatographic equipment, and requires a small capital investment. The first SPME fiber coating used in this study was poly(dimethylsiloxane) (PDMS), a hydrophobic liquid film, to sample a large range of airborne hydrocarbons such as benzene and octane. Quantification without an external calibration procedure is possible with this coating. Well understood are the physical and chemical properties of this coating, which are quite similar to those of the siloxane stationary phase used in capillary columns. The log of analyte distribution coefficients for PDMS are linearly related to chromatographic retention indices and to the inverse of temperature. Therefore, the actual chromatogram from the analysis of the PDMS air sampler will yield the calibration parameters which are used to quantify unknown airborne analyte concentrations (ppb v to ppm v range). The second fiber coating used in this study was PDMS/divinyl benzene (PDMS/DVB) onto which o-(2,3,4,5,6- pentafluorobenzyl) hydroxylamine (PFBHA) was adsorbed for the on-fiber derivatization of gaseous formaldehyde (ppb v range), with and without external calibration. The oxime formed from the reaction can be detected with conventional gas chromatographic detectors. Typical grab sampling times were as small as 5 seconds. With 300 seconds sampling, the formaldehyde detection limit was 2.1 ppbv, better than any other 5 minute sampling device for formaldehyde. The first-order rate constant for product formation was used to quantify formaldehyde concentrations without a calibration curve. This spot sampler was used to sample the headspace of hair gel, particle board, plant material and coffee grounds for formaldehyde, and other carbonyl compounds, with extremely promising results. The SPME sampling devices were also used for time- weighted average sampling (30 minutes to 16 hours). Finally, the four new SPME air sampling methods were field tested with side-by-side comparisons to standard air sampling methods, showing a tremendous use of SPME as an air sampler.

Analytical method development for the determination of emerging contaminants in water using supercritical-fluid chromatography coupled with diode-array detection.

PubMed

Del Carmen Salvatierra-Stamp, Vilma; Ceballos-Magaña, Silvia G; Gonzalez, Jorge; Ibarra-Galván, Valentin; Muñiz-Valencia, Roberto

2015-05-01

An analytical method using supercritical-fluid chromatography coupled with diode-array detection for the determination of seven emerging contaminants-two pharmaceuticals (carbamazepine and glyburide), three endocrine disruptors (17α-ethinyl estradiol, bisphenol A, and 17β-estradiol), one bactericide (triclosan), and one pesticide (diuron)-was developed and validated. These contaminants were chosen because of their frequency of use and their toxic effects on both humans and the environment. The optimized chromatographic separation on a Viridis BEH 2-EP column achieved baseline resolution for all compounds in less than 10 min. This separation was applied to environmental water samples after sample preparation. The optimized sample treatment involved a preconcentration step by means of solid-phase extraction using C18-OH cartridges. The proposed method was validated, finding recoveries higher than 94 % and limits of detection and limits of quantification in the range of 0.10-1.59 μg L(-1) and 0.31-4.83 μg L(-1), respectively. Method validation established the proposed method to be selective, linear, accurate, and precise. Finally, the method was successfully applied to environmental water samples.

High-throughput adaptive sampling for whole-slide histopathology image analysis (HASHI) via convolutional neural networks: Application to invasive breast cancer detection.

PubMed

Cruz-Roa, Angel; Gilmore, Hannah; Basavanhally, Ajay; Feldman, Michael; Ganesan, Shridar; Shih, Natalie; Tomaszewski, John; Madabhushi, Anant; González, Fabio

2018-01-01

Precise detection of invasive cancer on whole-slide images (WSI) is a critical first step in digital pathology tasks of diagnosis and grading. Convolutional neural network (CNN) is the most popular representation learning method for computer vision tasks, which have been successfully applied in digital pathology, including tumor and mitosis detection. However, CNNs are typically only tenable with relatively small image sizes (200 × 200 pixels). Only recently, Fully convolutional networks (FCN) are able to deal with larger image sizes (500 × 500 pixels) for semantic segmentation. Hence, the direct application of CNNs to WSI is not computationally feasible because for a WSI, a CNN would require billions or trillions of parameters. To alleviate this issue, this paper presents a novel method, High-throughput Adaptive Sampling for whole-slide Histopathology Image analysis (HASHI), which involves: i) a new efficient adaptive sampling method based on probability gradient and quasi-Monte Carlo sampling, and, ii) a powerful representation learning classifier based on CNNs. We applied HASHI to automated detection of invasive breast cancer on WSI. HASHI was trained and validated using three different data cohorts involving near 500 cases and then independently tested on 195 studies from The Cancer Genome Atlas. The results show that (1) the adaptive sampling method is an effective strategy to deal with WSI without compromising prediction accuracy by obtaining comparative results of a dense sampling (∼6 million of samples in 24 hours) with far fewer samples (∼2,000 samples in 1 minute), and (2) on an independent test dataset, HASHI is effective and robust to data from multiple sites, scanners, and platforms, achieving an average Dice coefficient of 76%.

High-throughput adaptive sampling for whole-slide histopathology image analysis (HASHI) via convolutional neural networks: Application to invasive breast cancer detection

PubMed Central

Gilmore, Hannah; Basavanhally, Ajay; Feldman, Michael; Ganesan, Shridar; Shih, Natalie; Tomaszewski, John; Madabhushi, Anant; González, Fabio

2018-01-01

Precise detection of invasive cancer on whole-slide images (WSI) is a critical first step in digital pathology tasks of diagnosis and grading. Convolutional neural network (CNN) is the most popular representation learning method for computer vision tasks, which have been successfully applied in digital pathology, including tumor and mitosis detection. However, CNNs are typically only tenable with relatively small image sizes (200 × 200 pixels). Only recently, Fully convolutional networks (FCN) are able to deal with larger image sizes (500 × 500 pixels) for semantic segmentation. Hence, the direct application of CNNs to WSI is not computationally feasible because for a WSI, a CNN would require billions or trillions of parameters. To alleviate this issue, this paper presents a novel method, High-throughput Adaptive Sampling for whole-slide Histopathology Image analysis (HASHI), which involves: i) a new efficient adaptive sampling method based on probability gradient and quasi-Monte Carlo sampling, and, ii) a powerful representation learning classifier based on CNNs. We applied HASHI to automated detection of invasive breast cancer on WSI. HASHI was trained and validated using three different data cohorts involving near 500 cases and then independently tested on 195 studies from The Cancer Genome Atlas. The results show that (1) the adaptive sampling method is an effective strategy to deal with WSI without compromising prediction accuracy by obtaining comparative results of a dense sampling (∼6 million of samples in 24 hours) with far fewer samples (∼2,000 samples in 1 minute), and (2) on an independent test dataset, HASHI is effective and robust to data from multiple sites, scanners, and platforms, achieving an average Dice coefficient of 76%. PMID:29795581

Comparison of various liquid chromatographic methods involving UV and atmospheric pressure chemical ionization mass spectrometric detection for the efficient trace analysis of phenylurea herbicides in various types of water samples.

PubMed

van der Heeft, E; Dijkman, E; Baumann, R A; Hogendoorn, E A

2000-05-19

The performance of mass spectrometric (MS) detection and UV detection in combination with reversed-phase liquid chromatography without and with the use of coupled column RPLC (LC-LC) has been compared for the trace analysis of phenylurea herbicides in environmental waters. The selected samples of this comparative study originated from an inter-laboratory study. For both detection modes, a 50 mm x 4.6 mm I.D. column and a 100 mm x 4.6 mm I.D. column packed with 3 microm C18 were used as the first (C-1) and second (C-2) column, respectively. Atmospheric pressure chemical ionization mass spectrometry was performed on a magnetic sector instrument. The LC-LC-MS analysis was carried out on-line by means of direct large volume (11.7 ml) injection (LVI). The performance of both on-line (LVI, 4 ml of sample) and off-line LC-LC-UV (244 nm) analysis was investigated. The latter procedure consisted of a solid-phase extraction (SPE) of 250 ml of water sample on a 500 mg C18 cartridge. The comparative study showed that LC-LC-MS is more selective then LC-LC-UV and, in most cases, more sensitive. The LVI-LC-LC-MS approach combines direct quantification and confirmation of most of the analytes down to a level of 0.01 microg/l in water samples in less then 30 min. As regards LC-LC-UV, the off-line method appeared to be a more viable approach in comparison with the on-line procedure. This method allows the screening of phenylurea's in various types of water samples down to a level of at least 0.05 microg/l. On-line analysis with LVI provided marginal sensitivity (limits of detection of about 0.1 microg/l) and selectivity was sometimes less in case of surface water samples. Both the on-line LVI-LC-LC-MS method and the LC-LC-UV method using off-line SPE were validated by analysing a series of real-life reference samples. These samples were part of an inter-laboratory test and contained residues of herbicides ranging from 0.02 to 0.8 microg/l. Beside good correlation between the methods the data agreed very well with the true values of the samples.

Field-based evaluation of a male-specific (F+) RNA coliphage concentration method.

PubMed

Chandler, J C; Pérez-Méndez, A; Paar, J; Doolittle, M M; Bisha, B; Goodridge, L D

2017-01-01

Fecal contamination of water poses a significant risk to public health due to the potential presence of pathogens, including enteric viruses. Therefore, sensitive, reliable and easy to use methods for the concentration, detection and quantification of microorganisms associated with the safety and quality of water are needed. In this study, we performed a field evaluation of an anion exchange resin-based method to concentrate male-specific (F+) RNA coliphages (FRNA), fecal indicator organisms, from diverse environmental waters that were suspected to be contaminated with feces. In this system, FRNA coliphages are adsorbed to anion exchange resin and direct nucleic acid isolation is performed, yielding a sample amenable to real-time reverse transcriptase (RT)-PCR detection. Matrix-dependent inhibition of this method was evaluated using known quantities of spiked FRNA coliphages belonging to four genogroups (GI, GII, GII and GIV). RT-PCR-based detection was successful in 97%, 72%, 85% and 98% of the samples spiked (10 6 pfu/l) with GI, GII, GIII and GIV, respectively. Differential FRNA coliphage genogroup detection was linked to inhibitors that altered RT-PCR assay efficiency. No association between inhibition and the physicochemical properties of the water samples was apparent. Additionally, the anion exchange resin method facilitated detection of naturally present FRNA coliphages in 40 of 65 environmental water samples (61.5%), demonstrating the viability of this system to concentrate FRNA coliphages from water. Copyright © 2016 Elsevier B.V. All rights reserved.

Transversely Excited Atmospheric CO2 Laser-Induced Plasma Spectroscopy for the Detection of Heavy Metals in Soil

NASA Astrophysics Data System (ADS)

Khumaeni, A.; Sugito, H.; Setia Budi, W.; Yoyo Wardaya, A.

2018-01-01

A rapid detection of heavy metals in soil was presented by the metal-assisted gas plasma method using specific characteristics of a pulsed, transversely excited atmospheric (TEA) CO2 laser. The soil particles were placed in a hole made of acrylic plate. The sample was covered by a to prevent the soil particles from being blown off. The mesh also functioned to initiate a luminous plasma. When a TEA CO2 laser (1500 mJ, 200 ns) was focused on the soil sample, passing through the metal mesh, some of the laser energy was used to generate the gas plasma on the mesh surface, and the remaining laser energy was employed to ablate the soil particles. The fine, ablated soil particles moved into the gas plasma region to be dissociated and excited. Using this technique, analysis can be made with reduced sample pretreatment, and therefore a rapid analysis can be performed efficiently. The results proved that the signal to noise ratio (S/N) of the emission spectral lines is much better for the case of the present method (mesh method) compared to the case of standard laser-induced breakdown spectroscopy using the pellet method. Rapid detection of heavy metal elements in soil has been successfully carried out. The detection limits of Cu and Hg in soil were estimated to be 3 and 10 mg/kg, respectively. The present method has good potential for rapid and sensitive detection of heavy metals in soil samples.

Spatially Resolved Chemical Imaging for Biosignature Analysis: Terrestrial and Extraterrestrial Examples

NASA Astrophysics Data System (ADS)

Bhartia, R.; Wanger, G.; Orphan, V. J.; Fries, M.; Rowe, A. R.; Nealson, K. H.; Abbey, W. J.; DeFlores, L. P.; Beegle, L. W.

2014-12-01

Detection of in situ biosignatures on terrestrial and planetary missions is becoming increasingly more important. Missions that target the Earth's deep biosphere, Mars, moons of Jupiter (including Europa), moons of Saturn (Titan and Enceladus), and small bodies such as asteroids or comets require methods that enable detection of materials for both in-situ analysis that preserve context and as a means to select high priority sample for return to Earth. In situ instrumentation for biosignature detection spans a wide range of analytical and spectroscopic methods that capitalize on amino acid distribution, chirality, lipid composition, isotopic fractionation, or textures that persist in the environment. Many of the existing analytical instruments are bulk analysis methods and while highly sensitive, these require sample acquisition and sample processing. However, by combining with triaging spectroscopic methods, biosignatures can be targeted on a surface and preserve spatial context (including mineralogy, textures, and organic distribution). To provide spatially correlated chemical analysis at multiple spatial scales (meters to microns) we have employed a dual spectroscopic approach that capitalizes on high sensitivity deep UV native fluorescence detection and high specificity deep UV Raman analysis.. Recently selected as a payload on the Mars 2020 mission, SHERLOC incorporates these optical methods for potential biosignatures detection on Mars. We present data from both Earth analogs that operate as our only examples known biosignatures and meteorite samples that provide an example of abiotic organic formation, and demonstrate how provenance effects the spatial distribution and composition of organics.

Fluidics platform and method for sample preparation and analysis

DOEpatents

Benner, W. Henry; Dzenitis, John M.; Bennet, William J.; Baker, Brian R.

2014-08-19

Herein provided are fluidics platform and method for sample preparation and analysis. The fluidics platform is capable of analyzing DNA from blood samples using amplification assays such as polymerase-chain-reaction assays and loop-mediated-isothermal-amplification assays. The fluidics platform can also be used for other types of assays and analyzes. In some embodiments, a sample in a sealed tube can be inserted directly. The following isolation, detection, and analyzes can be performed without a user's intervention. The disclosed platform may also comprises a sample preparation system with a magnetic actuator, a heater, and an air-drying mechanism, and fluid manipulation processes for extraction, washing, elution, assay assembly, assay detection, and cleaning after reactions and between samples.

A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'

PubMed Central

Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

2016-01-01

Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum (‘Ca. P. prunorum’) detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor ‘Ca. P. prunorum’ infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect ‘Ca. P. prunorum’ and Plum pox virus (PPV) in Prunus. PMID:26742106

Review of Processing and Analytical Methods for Francisella ...

EPA Pesticide Factsheets

Journal Article The etiological agent of tularemia, Francisella tularensis, is a resilient organism within the environment and can be acquired many ways (infectious aerosols and dust, contaminated food and water, infected carcasses, and arthropod bites). However, isolating F. tularensis from environmental samples can be challenging due to its nutritionally fastidious and slow-growing nature. In order to determine the current state of the science regarding available processing and analytical methods for detection and recovery of F. tularensis from water and soil matrices, a review of the literature was conducted. During the review, analysis via culture, immunoassays, and genomic identification were the most commonly found methods for F. tularensis detection within environmental samples. Other methods included combined culture and genomic analysis for rapid quantification of viable microorganisms and use of one assay to identify multiple pathogens from a single sample. Gaps in the literature that were identified during this review suggest that further work to integrate culture and genomic identification would advance our ability to detect and to assess the viability of Francisella spp. The optimization of DNA extraction, whole genome amplification with inhibition-resistant polymerases, and multiagent microarray detection would also advance biothreat detection.

A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

PubMed

Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

2016-12-01

To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

Monitoring the Presence of 13 Active Compounds in Surface Water Collected from Rural Areas in Northwestern Spain

PubMed Central

Iglesias, Alejandra; Nebot, Carolina; Vázquez, Beatriz I.; Coronel-Olivares, Claudia; Franco Abuín, Carlos M.; Cepeda, Alberto

2014-01-01

Drug residues are considered environmental contaminants, and their occurrence has recently become a matter of concern. Analytical methods and monitoring systems are therefore required to control the continuous input of these drug residues into the environment. This article presents a suitable HPLC-ESI-MS/MS method for the simultaneous extraction, detection and quantification of residues of 13 drugs (antimicrobials, glucocorticosteroids, anti-inflammatories, anti-hypertensives, anti-cancer drugs and triphenylmethane dyes) in surface water. A monitoring study with 549 water samples was carried out in northwestern Spain to detect the presence of drug residues over two sampling periods during 2010, 2011 and 2012. Samples were collected from rural areas with and without farming activity and from urban areas. The 13 analytes were detected, and 18% of the samples collected showed positive results for the presence of at least one analyte. More collection sites were located in rural areas than in urban areas. However, more positive samples with higher concentrations and a larger number of analytes were detected in samples collected from sites located after the discharge of a WWTP. Results indicated that the WWTPs seems to act as a concentration point. Positive samples were also detected at a site located near a drinking water treatment plant. PMID:24837665

Comparison of ELISA and Microscopy for detection of Cryptosporidium in stool

PubMed Central

Sharma, Madhu; Chaudhary, Uma; Yadav, Aparna

2014-01-01

Background: Cryptosporidiosis, a diarrheal disease caused by the protozoan parasite Cryptosporidium spp. has become recognized as one of the most common causes of water borne diseases in humans. Aims and Objectives: To compare the sensitivity of ELISA and Microscopy for detection of Cryptosporidium in stool samples Materials and Methods: The study was conducted in the Department of Microbiology of PT. B.D. Sharma PGIMS Rohtak, between January 2011 to june 2011 on 50 stool samples, which were processed for detection of cryptosporidial antigen by ELISA and detection of cysts by microscopy (Modified Ziehl and Nelsen staining). Study and Design: This was a prospective study conducted in the Department of Microbiology in PT. BD Sharma, PGIMS, Rohtak, India. Result: Out of total, 50 stool samples eighteen (36%) samples were found positive for Cryptosporidium cysts by microscopy in comparison to 3(6%) stool samples which were found positive for cryptosporidial antigen by ELISA. Samples found positive with ELISA were also positive with microscopy. Sensitivity, specificity, positive predictive value and negative predictive value for ELISA was 16.7%, 100%, 100% and 68% respectively. Conclusion: The study concludes that stool microscopic Modified acid fast staining is more sensitive method than ELISA for detection of Cryptosporidium in stool samples but the specificity of ELISA was more than microscopy. PMID:25584216

Monitoring the presence of 13 active compounds in surface water collected from rural areas in northwestern Spain.

PubMed

Iglesias, Alejandra; Nebot, Carolina; Vázquez, Beatriz I; Coronel-Olivares, Claudia; Abuín, Carlos M Franco; Cepeda, Alberto

2014-05-15

Drug residues are considered environmental contaminants, and their occurrence has recently become a matter of concern. Analytical methods and monitoring systems are therefore required to control the continuous input of these drug residues into the environment. This article presents a suitable HPLC-ESI-MS/MS method for the simultaneous extraction, detection and quantification of residues of 13 drugs (antimicrobials, glucocorticosteroids, anti-inflammatories, anti-hypertensives, anti-cancer drugs and triphenylmethane dyes) in surface water. A monitoring study with 549 water samples was carried out in northwestern Spain to detect the presence of drug residues over two sampling periods during 2010, 2011 and 2012. Samples were collected from rural areas with and without farming activity and from urban areas. The 13 analytes were detected, and 18% of the samples collected showed positive results for the presence of at least one analyte. More collection sites were located in rural areas than in urban areas. However, more positive samples with higher concentrations and a larger number of analytes were detected in samples collected from sites located after the discharge of a WWTP. Results indicated that the WWTPs seems to act as a concentration point. Positive samples were also detected at a site located near a drinking water treatment plant.