Prevalence of genetically modified rice, maize, and soy in Saudi food products.

PubMed

Elsanhoty, Rafaat M; Al-Turki, A I; Ramadan, Mohamed Fawzy

2013-10-01

Qualitative and quantitative DNA-based methods were applied to detect genetically modified foods in samples from markets in the Kingdom of Saudi Arabia. Two hundred samples were collected from Al-Qassim, Riyadh, and Mahdina in 2009 and 2010. GMOScreen 35S and NOS test kits for the detection of genetically modified organism varieties in samples were used. The positive results obtained from GMOScreen 35S and NOS were identified using specific primer pairs. The results indicated that all rice samples gave negative results for the presence of 35S and NOS terminator. About 26 % of samples containing soybean were positive for 35S and NOS terminator and 44 % of samples containing maize were positive for the presence of 35S and/or NOS terminator. The results showed that 20.4 % of samples was positive for maize line Bt176, 8.8 % was positive for maize line Bt11, 8.8 % was positive for maize line T25, 5.9 % was positive for maize line MON 810, and 5.9 % was positive for StarLink maize. Twelve samples were shown to contain <3 % of genetically modified (GM) soy and 6 samples >10 % of GM soy. Four samples containing GM maize were shown to contain >5 % of GM maize MON 810. Four samples containing GM maize were shown to contain >1 % of StarLink maize. Establishing strong regulations and certified laboratories to monitor GM foods or crops in Saudi market is recommended.

Test/QA Plan for Verification of Coliform Detection Technologies for Drinking Water

EPA Science Inventory

The coliform detection technologies to be tested use chromatogenic and fluorogenic growth media to detect coliforms and E. coli based on the enzymatic activity of these organisms. The systems consist of single-use sample containers that contain pre-measured reagents and can be u...

Detection of cocaine in cargo containers by high-volume vapor sampling: field test at Port of Miami

NASA Astrophysics Data System (ADS)

Neudorfl, Pavel; Hupe, Michael; Pilon, Pierre; Lawrence, Andre H.; Drolet, Gerry; Su, Chih-Wu; Rigdon, Stephen W.; Kunz, Terry D.; Ulwick, Syd; Hoglund, David E.; Wingo, Jeff J.; Demirgian, Jack C.; Shier, Patrick

1997-02-01

The use of marine containers is a well known smuggling method for large shipments of drugs. Such containers present an ideal method of smuggling as the examination method is time consuming, difficult and expensive for the importing community. At present, various methods are being studied for screening containers which would allow to rapidly distinguish between innocent and suspicious cargo. Air sampling is one such method. Air is withdrawn for the inside of containers and analyzed for telltale vapors uniquely associated with the drug. The attractive feature of the technique is that the containers could be sampled without destuffing and opening, since air could be conveniently withdrawn via ventilation ducts. In the present paper, the development of air sampling methodology for the detection of cocaine hydrochloride will be discussed, and the results from a recent field test will be presented. The results indicated that vapors of cocaine and its decomposition product, ecgonidine methyl ester, could serve as sensitive indicators of the presence of the drug in the containers.

Planar optical waveguide based sandwich assay sensors and processes for the detection of biological targets including early detection of cancers

DOEpatents

Martinez, Jennifer S [Santa Fe, NM; Swanson, Basil I [Los Alamos, NM; Shively, John E [Arcadia, CA; Li, Lin [Monrovia, CA

2009-06-02

An assay element is described including recognition ligands adapted for binding to carcinoembryonic antigen (CEA) bound to a film on a single mode planar optical waveguide, the film from the group of a membrane, a polymerized bilayer membrane, and a self-assembled monolayer containing polyethylene glycol or polypropylene glycol groups therein and an assay process for detecting the presence of CEA is described including injecting a possible CEA-containing sample into a sensor cell including the assay element, maintaining the sample within the sensor cell for time sufficient for binding to occur between CEA present within the sample and the recognition ligands, injecting a solution including a reporter ligand into the sensor cell; and, interrogating the sample within the sensor cell with excitation light from the waveguide, the excitation light provided by an evanescent field of the single mode penetrating into the biological target-containing sample to a distance of less than about 200 nanometers from the waveguide thereby exciting any bound reporter ligand within a distance of less than about 200 nanometers from the waveguide and resulting in a detectable signal.

[Improved method of studying the blood for sterility].

PubMed

Talapa, A I

1983-05-01

The technique used for the inoculation and subculturing of blood samples in testing them for sterility is described. This technique eliminates the possibility of contaminating the culture medium and the blood sample under test with extraneous bacterial flora. Blood samples were inoculated without opening the containers with the culture medium. Inoculation was made with the syringe and the needle used for taking the blood sample through the punctured rubber stopper closing the container. Subculturing on solid culture media was also carried out without opening the containers: the rubber stopper was punctured and the contents of the container withdrawn with a pipette needle. The use of this new technique made it possible to detect bacteremia in 12.8% of cases, only in persons with purulent and septic diseases, whereas by using the existing technique bacteremia was detected both in sick and healthy persons, in 38.6% and 26.6% of cases, respectively.

Determination of Total Soy Isoflavones in Dietary Supplements, Supplement Ingredients, and Soy Foods by High-Performance Liquid Chromatography with Ultraviolet Detection: Collaborative Study

PubMed Central

Collison, Mark W.

2008-01-01

An interlaboratory study was conducted to evaluate a method for determining total soy isoflavones in dietary supplements, dietary supplement ingredients, and soy foods. Isoflavones were extracted using aqueous acetonitrile containing a small amount of dimethylsulfoxide (DMSO) and all 12 of the naturally occuring isoflavones in soy were determined by high-performance liquid Chromatography (HPLC) with UV detection using apigenin as an internal standard. Fifteen samples (6 pairs of blind duplicates plus 3 additional samples) of soy isoflavone ingredients, soy isoflavone dietary supplements, soy flour, and soy protein products were successfully analyzed by 13 collaborating laboratories in 6 countries. For repeatability, the relative standard deviations (RSDr) ranged from 1.07 for samples containing over 400 mg/g total isoflavones to 3.31 for samples containing 0.87 mg/g total isoflavones, and for reproducibility the RSDR values ranged from 2.29 for samples containing over 400 mg/g total isoflavones to 9.36 for samples containing 0.87 mg/g total isoflavones. HorRat values ranged from 1.00 to 1.62 for all samples containing at least 0.8 mg/g total isoflavones. One sample, containing very low total isoflavones (<0.05 mg/g), gave RSDR values of 175 and a HorRat value of 17.6. This sample was deemed to be below the usable range of the method. The method provides accurate and precise results for analysis of soy isoflavones in dietary supplements and soy foods. PMID:18567292

Determination of total soy isoflavones in dietary supplements, supplement ingredients, and soy foods by high-performance liquid chromatography with ultraviolet detection: collaborative study.

PubMed

Collison, Mark W

2008-01-01

An interlaboratory study was conducted to evaluate a method for determining total soy isoflavones in dietary supplements, dietary supplement ingredients, and soy foods. Isoflavones were extracted using aqueous acetonitrile containing a small amount of dimethylsulfoxide (DMSO) and all 12 of the naturally occuring isoflavones in soy were determined by high-performance liquid chromatography (HPLC) with UV detection using apigenin as an internal standard. Fifteen samples (6 pairs of blind duplicates plus 3 additional samples) of soy isoflavone ingredients, soy isoflavone dietary supplements, soy flour, and soy protein products were successfully analyzed by 13 collaborating laboratories in 6 countries. For repeatability, the relative standard deviations (RSDr) ranged from 1.07 for samples containing over 400 mglg total isoflavones to 3.31 for samples containing 0.87 mg/g total isoflavones, and for reproducibility the RSDR values ranged from 2.29 for samples containing over 400 mg/g total isoflavones to 9.36 for samples containing 0.87 mg/g total isoflavones. HorRat values ranged from 1.00 to 1.62 for all samples containing at least 0.8 mg/g total isoflavones. One sample, containing very low total isoflavones (< 0.05 mg/g), gave RSDR values of 175 and a HorRat value of 17.6. This sample was deemed to be below the usable range of the method. The method provides accurate and precise results for analysis of soy isoflavones in dietary supplements and soy foods.

Quantitative Analysis of Neonicotinoid Insecticide Residues in Foods: Implication for Dietary Exposures

PubMed Central

2015-01-01

This study quantitatively measured neonicotinoids in various foods that are common to human consumption. All fruit and vegetable samples (except nectarine and tomato) and 90% of honey samples were detected positive for at least one neonicotinoid; 72% of fruits, 45% of vegetables, and 50% of honey samples contained at least two different neonicotinoids in one sample, with imidacloprid having the highest detection rate among all samples. All pollen samples from New Zealand contained multiple neonicotinoids, and five of seven pollens from Massachusetts detected positive for imidacloprid. These results show the prevalence of low-level neonicotinoid residues in fruits, vegetables, and honey that are readily available in the market for human consumption and in the environment where honeybees forage. In light of new reports of toxicological effects in mammals, the results strengthen the importance of assessing dietary neonicotinoid intakes and the potential human health effects. PMID:24933495

Quantitative analysis of neonicotinoid insecticide residues in foods: implication for dietary exposures.

PubMed

Chen, Mei; Tao, Lin; McLean, John; Lu, Chensheng

2014-07-02

This study quantitatively measured neonicotinoids in various foods that are common to human consumption. All fruit and vegetable samples (except nectarine and tomato) and 90% of honey samples were detected positive for at least one neonicotinoid; 72% of fruits, 45% of vegetables, and 50% of honey samples contained at least two different neonicotinoids in one sample, with imidacloprid having the highest detection rate among all samples. All pollen samples from New Zealand contained multiple neonicotinoids, and five of seven pollens from Massachusetts detected positive for imidacloprid. These results show the prevalence of low-level neonicotinoid residues in fruits, vegetables, and honey that are readily available in the market for human consumption and in the environment where honeybees forage. In light of new reports of toxicological effects in mammals, the results strengthen the importance of assessing dietary neonicotinoid intakes and the potential human health effects.

Method for the detection of nitro-containing compositions using ultraviolet photolysis

DOEpatents

Reagen, William K.; Lancaster, Gregory D.; Partin, Judy K.; Moore, Glenn A.

2000-01-01

A method for detecting nitro-containing compositions (e.g. nitrate/nitrite materials) in water samples and on solid substrates. In a water sample, ultraviolet light is applied to the sample so that dissolved nitro compositions therein will photolytically dissociate into gaseous nitrogen oxides (NO.sub.2(g) and/or NO.sub.(g)). A carrier gas is then introduced into the sample to generate a gaseous stream which includes the carrier gas combined with any gaseous nitrogen oxides. The carrier gas is thereafter directed into a detector. To detect nitro-compositions on solid substrates, ultraviolet light is applied thereto. A detector is then used to detect any gaseous nitrogen oxides which are photolytically generated during ultraviolet illumination. An optional carrier gas may be applied to the substrate during illumination to produce a gaseous stream which includes the carrier gas and any gaseous nitrogen oxides. The gaseous stream is then supplied to the detector.

Permeation absorption sampler with multiple detection

DOEpatents

Zaromb, Solomon

1990-01-01

A system for detecting analytes in air or aqueous systems includes a permeation absorption preconcentrator sampler for the analytes and analyte detectors. The preconcentrator has an inner fluid-permeable container into which a charge of analyte-sorbing liquid is intermittently injected, and a fluid-impermeable outer container. The sample is passed through the outer container and around the inner container for trapping and preconcentrating the analyte in the sorbing liquid. The analyte can be detected photometrically by injecting with the sorbing material a reagent which reacts with the analyte to produce a characteristic color or fluorescence which is detected by illuminating the contents of the inner container with a light source and measuring the absorbed or emitted light, or by producing a characteristic chemiluminescence which can be detected by a suitable light sensor. The analyte can also be detected amperometrically. Multiple inner containers may be provided into which a plurality of sorbing liquids are respectively introduced for simultaneously detecting different analytes. Baffles may be provided in the outer container. A calibration technique is disclosed.

Alpha-PVP as an active component of herbal highs in Poland between 2013 and 2015.

PubMed

Byrska, Bogumiła; Stanaszek, Roman; Zuba, Dariusz

2017-08-01

Alpha-PVP (alpha-pyrrolidinovalerophenone, α-PVP) is a synthetic derivative of cathinone. It has been one of the most frequently detected new psychoactive substances (NPS) available on the drug market in recent years in Poland. The usual routes of administration of the drug include oral, insufflation, and injection. Unexpectedly, we dealt with a great number of herbal samples that turned out to contain α-PVP. A total number of 352 herbal samples from 19 cases in which we detected synthetic cathinones, were investigated in the Institute of Forensic Research (IFR) from 2013 to 2015. The seized products that were received by our laboratory were first screened by gas chromatography coupled to mass spectrometry (GC-MS). Quantification of α-PVP and other cathinones was performed by ultra-performance liquid chromatography with photodiode array detection (UPLC-PDA). Of the samples, 84% contained only α-PVP. Other groups of products were those containing only α-PVT, α-PVP and α-PVT, α-PVP and synthetic cannabinoid A-834, 735, and α-PVP and cannabis. In one herbal sample, α-PVP was detected along with caffeine and tadalafil. The herbal products present on the market containing only α-PVP usually had a mass of 0.3 to 0.6 g, and concentration range in this group of samples was 3.0-44.0% (content: 13.0-222.0 mg per package). The amount of α-PVP in samples below 0.30 g was in a range 9-18 mg whiles in samples above 0.60 g it was in the range 30-716 mg. There were also products containing a mixture of α-PVP and α-PVT. In those samples, α-PVP concentrations were: 3.0-6.0% (amount: 15.0-34.0 mg). Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Improvement of immunoassay detection system by using alternating current magnetic susceptibility

NASA Astrophysics Data System (ADS)

Kawabata, R.; Mizoguchi, T.; Kandori, A.

2016-03-01

A major goal with this research was to develop a low-cost and highly sensitive immunoassay detection system by using alternating current (AC) magnetic susceptibility. We fabricated an improved prototype of our previously developed immunoassay detection system and evaluated its performance. The prototype continuously moved sample containers by using a magnetically shielded brushless motor, which passes between two anisotropic magneto resistance (AMR) sensors. These sensors detected the magnetic signal in the direction where each sample container passed them. We used the differential signal obtained from each AMR sensor's output to improve the signal-to-noise ratio (SNR) of the magnetic signal measurement. Biotin-conjugated polymer beads with avidin-coated magnetic particles were prepared to examine the calibration curve, which represents the relation between AC magnetic susceptibility change and polymer-bead concentration. For the calibration curve measurement, we, respectively, measured the magnetic signal caused by the magnetic particles by using each AMR sensor installed near the upper or lower part in the lateral position of the passing sample containers. As a result, the SNR of the prototype was 4.5 times better than that of our previous system. Moreover, the data obtained from each AMR sensor installed near the upper part in the lateral position of the passing sample containers exhibited an accurate calibration curve that represented good correlation between AC magnetic susceptibility change and polymer-bead concentration. The conclusion drawn from these findings is that our improved immunoassay detection system will enable a low-cost and highly sensitive immunoassay.

Improvement of immunoassay detection system by using alternating current magnetic susceptibility.

PubMed

Kawabata, R; Mizoguchi, T; Kandori, A

2016-03-01

A major goal with this research was to develop a low-cost and highly sensitive immunoassay detection system by using alternating current (AC) magnetic susceptibility. We fabricated an improved prototype of our previously developed immunoassay detection system and evaluated its performance. The prototype continuously moved sample containers by using a magnetically shielded brushless motor, which passes between two anisotropic magneto resistance (AMR) sensors. These sensors detected the magnetic signal in the direction where each sample container passed them. We used the differential signal obtained from each AMR sensor's output to improve the signal-to-noise ratio (SNR) of the magnetic signal measurement. Biotin-conjugated polymer beads with avidin-coated magnetic particles were prepared to examine the calibration curve, which represents the relation between AC magnetic susceptibility change and polymer-bead concentration. For the calibration curve measurement, we, respectively, measured the magnetic signal caused by the magnetic particles by using each AMR sensor installed near the upper or lower part in the lateral position of the passing sample containers. As a result, the SNR of the prototype was 4.5 times better than that of our previous system. Moreover, the data obtained from each AMR sensor installed near the upper part in the lateral position of the passing sample containers exhibited an accurate calibration curve that represented good correlation between AC magnetic susceptibility change and polymer-bead concentration. The conclusion drawn from these findings is that our improved immunoassay detection system will enable a low-cost and highly sensitive immunoassay.

Feasibility of Using Fluorescence Spectrophotometry to Develop a Sensitive Dye Immersion Method for Container Closure Integrity Testing of Prefilled Syringes.

PubMed

Lu, Xujin; Lloyd, David K; Klohr, Steven E

2016-01-01

A feasibility study was conducted for a sensitive and robust dye immersion method for the measurement of container closure integrity of unopened prefilled syringes using fluorescence spectrophotometry as the detection method. A Varian Cary Eclipse spectrofluorometer was used with a custom-made sample holder to position the intact syringe in the sample compartment for fluorescence measurements. Methylene blue solution was initially evaluated as the fluorophore in a syringe with excitation at 607 nm and emission at 682 nm, which generated a limit of detection of 0.05 μg/mL. Further studies were conducted using rhodamine 123, a dye with stronger fluorescence. Using 480 nm excitation and 525 nm emission, the dye in the syringe could be easily detected at levels as low as 0.001 μg/mL. The relative standard deviation for 10 measurements of a sample of 0.005 μg/mL (with repositioning of the syringe after each measurement) was less than 1.1%. A number of operational parameters were optimized, including the photomultiplier tube voltage, excitation, and emission slit widths. The specificity of the testing was challenged by using marketed drug products and a protein sample, which showed no interference to the rhodamine detection. Results obtained from this study demonstrated that using rhodamine 123 for container closure integrity testing with in-situ (in-syringe) fluorescence measurements significantly enhanced the sensitivity and robustness of the testing and effectively overcame limitations of the traditional methylene blue method with visual or UV-visible absorption detection. Ensuring container closure integrity of injectable pharmaceutical products is necessary to maintain quality throughout the shelf life of a sterile drug product. Container closure integrity testing has routinely been used to evaluate closure integrity during product development and production line qualification of prefilled syringes, vials, and devices. However, container closure integrity testing has recently gained industry attention due to increased regulatory agency scrutiny regarding the analytical rigor of container closure integrity testing methods and expectations to use container closure integrity testing in lieu of sterility tests in stability programs. Methylene blue dye is often used for dye ingress testing of container closure integrity, but we found it unsuitable for reliable detection of small breaches in prefilled syringes of drug product. This work describes the suitability and advantages of using a fluorescent dye and spectroscopic detection for a robust, sensitive, and quality control-friendly container closure integrity testing method for prefilled syringes. © PDA, Inc. 2016.

Multiplex picodroplet digital PCR to detect KRAS mutations in circulating DNA from the plasma of colorectal cancer patients.

PubMed

Taly, Valerie; Pekin, Deniz; Benhaim, Leonor; Kotsopoulos, Steve K; Le Corre, Delphine; Li, Xinyu; Atochin, Ivan; Link, Darren R; Griffiths, Andrew D; Pallier, Karine; Blons, Hélène; Bouché, Olivier; Landi, Bruno; Hutchison, J Brian; Laurent-Puig, Pierre

2013-12-01

Multiplex digital PCR (dPCR) enables noninvasive and sensitive detection of circulating tumor DNA with performance unachievable by current molecular-detection approaches. Furthermore, picodroplet dPCR facilitates simultaneous screening for multiple mutations from the same sample. We investigated the utility of multiplex dPCR to screen for the 7 most common mutations in codons 12 and 13 of the KRAS (Kirsten rat sarcoma viral oncogene homolog) oncogene from plasma samples of patients with metastatic colorectal cancer. Fifty plasma samples were tested from patients for whom the primary tumor biopsy tissue DNA had been characterized by quantitative PCR. Tumor characterization revealed that 19 patient tumors had KRAS mutations. Multiplex dPCR analysis of the plasma DNA prepared from these samples identified 14 samples that matched the mutation identified in the tumor, 1 sample contained a different KRAS mutation, and 4 samples had no detectable mutation. Among the tumor samples that were wild type for KRAS, 2 KRAS mutations were identified in the corresponding plasma samples. Duplex dPCR (i.e., wild-type and single-mutation assay) was also used to analyze plasma samples from patients with KRAS-mutated tumors and 5 samples expected to contain the BRAF (v-raf murine sarcoma viral oncogene homolog B) V600E mutation. The results for the duplex analysis matched those for the multiplex analysis for KRAS-mutated samples and, owing to its higher sensitivity, enabled detection of 2 additional samples with low levels of KRAS-mutated DNA. All 5 samples with BRAF mutations were detected. This work demonstrates the clinical utility of multiplex dPCR to screen for multiple mutations simultaneously with a sensitivity sufficient to detect mutations in circulating DNA obtained by noninvasive blood collection.

Introduction to Mars Sampling Handling Workshop Series. Workshop on Life Detection: Issues and Topics

NASA Technical Reports Server (NTRS)

Rummel, John D.

2001-01-01

Before martian soil and rock samples can be distributed to the research community, the returned materials will initially be quarantined and examined in a proposed BSL-4 containment facility to assure that no putative martian microorganisms or attendant potential biohazards exist. During the initial quarantine, state-of-the-art life detection and biohazard testing of the returned martian samples will be conducted. Life detection, as defined here in regard to Mars sample return missions, is the detection of living organisms and/or materials that have been derived from living organisms that may be present in the sample.

Occurrence of severe gastroenteritis in pups after canine parvovirus vaccine administration: a clinical and laboratory diagnostic dilemma.

PubMed

Decaro, Nicola; Desario, Costantina; Elia, Gabriella; Campolo, Marco; Lorusso, Alessio; Mari, Viviana; Martella, Vito; Buonavoglia, Canio

2007-01-26

A total of 29 faecal samples collected from dogs with diarrhoea following canine parvovirus (CPV) vaccination were tested by minor groove binder (MGB) probe assays for discrimination between CPV vaccine and field strains and by diagnostic tests for detection of other canine pathogens. Fifteen samples tested positive only for CPV field strains; however, both vaccine and field strains were detected in three samples. Eleven samples were found to contain only the vaccine strain, although eight of them tested positive for other pathogens of dogs. Only three samples were found to contain the vaccine strain without evidence of canine pathogens. The present study confirms that most cases of parvovirus-like disease occurring shortly after vaccination are related to infection with field strains of canine parvovirus type 2 (CPV-2) rather than to reversion to virulence of the modified live virus contained in the vaccine.

Inspection tester for explosives

DOEpatents

Haas, Jeffrey S.; Simpson, Randall L.; Satcher, Joe H.

2007-11-13

An inspection tester that can be used anywhere as a primary screening tool by non-technical personnel to determine whether a surface contains explosives. It includes a body with a sample pad. First and second explosives detecting reagent holders and dispensers are operatively connected to the body and the sample pad. The first and second explosives detecting reagent holders and dispensers are positioned to deliver the explosives detecting reagents to the sample pad. A is heater operatively connected to the sample pad.

Inspection tester for explosives

DOEpatents

Haas, Jeffrey S.; Simpson, Randall L.; Satcher, Joe H.

2010-10-05

An inspection tester that can be used anywhere as a primary screening tool by non-technical personnel to determine whether a surface contains explosives. It includes a body with a sample pad. First and second explosives detecting reagent holders and dispensers are operatively connected to the body and the sample pad. The first and second explosives detecting reagent holders and dispensers are positioned to deliver the explosives detecting reagents to the sample pad. A is heater operatively connected to the sample pad.

Occurrence and distribution of selected contaminants in public drinking-water supplies in the surficial aquifer in Delaware

USGS Publications Warehouse

Ferrari, Matthew J.

2001-01-01

Water samples were collected from August through November 2000 from 30 randomly selected public drinking-water supply wells screened in the unconfined aquifer in Delaware, and analyzed to assess the occurrence and distribution of selected pesticide compounds, volatile organic compounds, major inorganic ions, and nutrients. Water from a subset of 10 wells was sampled and analyzed for radium and radon. The average age of ground water entering the well screens in all the wells was determined to be generally less than 20 years. Low concentrations of pesticide compounds and volatile organic compounds were detected throughout the State of Delaware, with several compounds often detected in each water sample. Pesticide and metabolite (pesticide degradation products) concentrations were generally less than 1 microgram per liter, and were detected in sam-ples from 27 of 30 wells. Of the 45 pesticides and 13 metabolites analyzed, 19 compounds (13 pesticides and 6 metabolites) were detected in at least 1 of the 30 samples. Desethylatrazine, alachlor ethane sulfonic acid, metolachlor ethane sulfonic acid, metolachlor, and atrazine were the most frequently detected pesticide compounds, and were present in at least half the samples. None of the pesticide detections was above the U.S. Environmental Protection Agency's Primary Maximum Contaminant Levels or Health Advisories. Volatile organic compounds also were present at low concentrations (generally less than 1 microgram per liter) in samples from all 30 wells. Of the 85 volatile organic com-pounds analyzed, 34 compounds were detected in at least 1 of the 30 samples. Chloroform, tetrachloroethene, and methyl tert-butyl ether were the most frequently detected volatile organic compounds, and were found in at least half the samples. None of the volatile organic compound detections was above U.S. Environmental Protection Agency's Primary Maximum Contaminant Levels or Health Advisories. A few samples contained compounds with concentrations above the U.S. Environmental Protection Agency's Primary Maximum Contaminant Levels or Secondary Maximum Contaminant Levels for inorganic compounds and radionuclides. One sample out of 30 contained a concentration of nitrite plus nitrate above the U.S. Environmental Protection Agency's Primary Maximum Contaminant Level of 10 milligrams per liter as nitrogen. Iron and manganese concentrations above the U.S. Environmental Protection Agency's Secondary Maximum Contaminant Levels were found in 7 of 30 ground-water samples, most of them from Sussex County. In the 10 wells sampled for radionuclides, only one sample had detectable levels of radium-224 and -226, and another sample contained detectable levels of radium-228; both of these samples also had detectable gross-alpha and gross-beta activities. None of these activities were above the U.S. Environ-mental Protection Agency's Primary Maximum Contaminant Levels or Secondary Maximum Contaminant Levels. Radon was detected in all 10 samples, but was above the current U.S. Environmental Protection Agency's proposed Primary Maximum Contaminant Level of 300 picocuries per liter in only one sample.

Targeted and non-targeted detection of lemon juice adulteration by LC-MS and chemometrics.

PubMed

Wang, Zhengfang; Jablonski, Joseph E

2016-01-01

Economically motivated adulteration (EMA) of lemon juice was detected by LC-MS and principal component analysis (PCA). Twenty-two batches of freshly squeezed lemon juice were adulterated by adding an aqueous solution containing 5% citric acid and 6% sucrose to pure lemon juice to obtain 30%, 60% and 100% lemon juice samples. Their total titratable acidities, °Brix and pH values were measured, and then all the lemon juice samples were subject to LC-MS analysis. Concentrations of hesperidin and eriocitrin, major phenolic components of lemon juice, were quantified. The PCA score plots for LC-MS datasets were used to preview the classification of pure and adulterated lemon juice samples. Results showed a large inherent variability in the chemical properties among 22 batches of 100% lemon juice samples. Measurement or quantitation of one or several chemical properties (targeted detection) was not effective in detecting lemon juice adulteration. However, by using the LC-MS datasets, including both chromatographic and mass spectrometric information, 100% lemon juice samples were successfully differentiated from adulterated samples containing 30% lemon juice in the PCA score plot. LC-MS coupled with chemometric analysis can be a complement to existing methods for detecting juice adulteration.

Microbial contamination of cosmetics and personal care items in Egypt--body lotions and talcum powders.

PubMed

Ashour, M S; Abdelaziz, A A; Hefni, H; el-Tayeb, O M

1989-06-01

We examined a total of 54 samples, including 18 body lotions and 36 talcum powders, for their total aerobic bacterial, coliform and fungal counts. We also carried out anaerobic bacterial counts for talcum powder as well as tests to detect some potentially hazardous bacteria in all tested samples. Talcum powders were more heavily contaminated with bacteria and fungi than body lotions. More than 40% of the tested body lotions contained no viable bacteria or less than 100 c.f.u./g. while all the talcum powders tested contained more than 100 c.f.u./g. Thirty per cent of the talcum powders were contaminated with 10(4) c.f.u./g. and none of the body lotions were contaminated to that extent. No coliforms were recovered from any of the body lotions, while 17% of the talcum powder examined contained coliforms in the range of 230-500 c.f.u./g. Staphylococcus spp. were detected in 18 samples of both talcum powders and body lotions, three of these Staphylococci were of the aureus type. Three samples of talcum powder contained E. coli, two samples contained Enterobacter agglomerans and one sample contained Citrobacter freundii. Seventy per cent of the body lotions showed no fungal counts, while 83% of the talcum powders examined were contaminated with fungi and most of the contaminated talcum powders contained more than 100 fungal cells/g. With regard to the anaerobic bacterial counts for talcum powders, 50% of the samples showed no counts while the other 50% contained less than 100 c.f.u./g. Four samples were contaminated with Clostridium perfringens, although C. tetani was not recovered from any of the samples.

System for measuring radioactivity of labelled biopolymers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gross, V.

1980-07-08

A system is described for measuring radioactivity of labelled biopolymers, comprising: a set of containers adapted for receiving aqueous solutions of biological samples containing biopolymers which are subsequently precipitated in said containers on particles of diatomite in the presence of a coprecipitator, then filtered, dissolved, and mixed with a scintillator; radioactivity measuring means including a detection chamber to which is fed the mixture produced in said set of containers; an electric drive for moving said set of containers in a stepwise manner; means for proportional feeding of said coprecipitator and a suspension of diatomite in an acid solution to saidmore » containers which contain the biological sample for forming an acid precipitation of biopolymers; means for the removal of precipitated samples from said containers; precipitated biopolymer filtering means for successively filtering the precipitate, suspending the precipitate, dissolving the biopolymers mixed with said scintillator for feeding of the mixture to said detection chamber; a system of pipelines interconnecting said above-recited means; and said means for measuring radioactivity of labelled biopolymers including, a measuring cell arranged in a detection chamber and communicating with said means for filtering precipitated biopolymers through one pipeline of said system of pipelines; a program unit electrically connected to said electric drive, said means for acid precipatation of biopolymers, said means for the removal of precipitated samples from said containers, said filtering means, and said radioactivity measuring device; said program unit adapted to periodically switch on and off the above-recited means and check the sequence of the radioactivity measuring operations; and a control unit for controlling the initiation of the system and for selecting programs.« less

Chip-based device for parallel sorting, amplification, detection, and identification of nucleic acid subsequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beer, Neil Reginald; Colston, Jr, Billy W.

An apparatus for chip-based sorting, amplification, detection, and identification of a sample having a planar substrate. The planar substrate is divided into cells. The cells are arranged on the planar substrate in rows and columns. Electrodes are located in the cells. A micro-reactor maker produces micro-reactors containing the sample. The micro-reactor maker is positioned to deliver the micro-reactors to the planar substrate. A microprocessor is connected to the electrodes for manipulating the micro-reactors on the planar substrate. A detector is positioned to interrogate the sample contained in the micro-reactors.

N-nitrosodimethylamine, nitrate and nitrate-reducing microorganisms in human milk.

PubMed

Uibu, J; Tauts, O; Levin, A; Shimanovskaya, N; Matto, R

1996-10-01

Of 54 milk samples from 54 healthy nursing women analysed for volatile N-nitrosamines, 42 appeared negative. Trace amounts (below the detection limit 0.5 microgram l-1) of N-nitrosodimethylamine were detected in the milk of 10 mothers and two samples contained this compound at 1.1 and 1.2 micrograms 1-1 respectively. Almost all samples investigated contained nitrate (mean 2.9 +/- 2.3 mg1-1 and nitrate reducing microorganisms (mean 4.2 +/- 1.0 log ml-1). The recent finding of N-nitrosodimethylamine in human milk gives evidence of the continuous endogenous formation of N-nitrosamines.

GICHD Mine Dog Testing Project - Soil Sample Results No.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

PHELAN, JAMES M.; BARNETT, JAMES L.; BENDER, SUSAN FAE ANN

2003-03-01

A mine dog evaluation project initiated by the Geneva International Center for Humanitarian Demining is evaluating the capability and reliability of mine detection dogs. The performance of field-operational mine detection dogs will be measured in test minefields in Afghanistan and Bosnia containing actual, but unfused landmines. Repeated performance testing over two years through various seasonal weather conditions will provide data simulating near real world conditions. Soil samples will be obtained adjacent to the buried targets repeatedly over the course of the test. Chemical analysis results from these soil samples will be used to evaluate correlations between mine dog detection performancemore » and seasonal weather conditions. This report documents the analytical chemical methods and results from the third batch of soils received. This batch contained samples from Kharga, Afghanistan collected in October 2002.« less

GICHD mine dog testing project : soil sample results #5.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnett, James L.; Phelan, James M.; Archuleta, Luisa M.

2004-01-01

A mine dog evaluation project initiated by the Geneva International Center for Humanitarian Demining is evaluating the capability and reliability of mine detection dogs. The performance of field-operational mine detection dogs will be measured in test minefields in Afghanistan containing actual, but unfused landmines. Repeated performance testing over two years through various seasonal weather conditions will provide data simulating near real world conditions. Soil samples will be obtained adjacent to the buried targets repeatedly over the course of the test. Chemical analysis results from these soil samples will be used to evaluate correlations between mine dog detection performance and seasonalmore » weather conditions. This report documents the analytical chemical methods and results from the fifth batch of soils received. This batch contained samples from Kharga, Afghanistan collected in June 2003.« less

Raman spectroscopy method for subsurface detection of food powders through plastic layers

NASA Astrophysics Data System (ADS)

Dhakal, Sagar; Chao, Kuanglin; Qin, Jianwei; Schmidt, Walter F.; Kim, Moon S.; Chan, Diane E.; Bae, Abigail

2017-05-01

Proper chemical analyses of materials in sealed containers are important for quality control purpose. Although it is feasible to detect chemicals at top surface layer, it is relatively challenging to detect objects beneath obscuring surface. This study used spatially offset Raman spectroscopy (SORS) method to detect urea, ibuprofen and acetaminophen powders contained within one or more (up to eight) layers of gelatin capsules to demonstrate subsurface chemical detection and identification. A 785 nm point-scan Raman spectroscopy system was used to acquire spatially offset Raman spectra for an offset range of 0 to 10 mm from the surfaces of 24 encapsulated samples, using a step size of 0.1 mm to obtain 101 spectral measurements per sample. With increasing offset distance, the fraction of information from the deeper subsurface material increased compared to that from the top surface material. The series of measurements was analyzed to differentiate and identify the top surface and subsurface materials. Containing mixed contributions from the powder and capsule, the SORS of each sample was decomposed using self modeling mixture analysis (SMA) to obtain pure component spectra of each component and corresponding components were identified using spectral information divergence values. Results show that SORS technique together with SMA method has a potential for non-invasive detection of chemicals at deep subsurface layer.

Effect of absorbing impurities on the accuracy of the optical method for the detection of the iodine-containing substances resulting from the processing of waste nuclear fuel

NASA Astrophysics Data System (ADS)

Kireev, S. V.; Simanovsky, I. G.; Shnyrev, S. L.

2010-12-01

The study is aimed at an increase in the accuracy of the optical method for the detection of the iodine-containing substances in technological liquids resulting form the processing of the waste nuclear fuel. It is demonstrated that the accuracy can be increased owing to the measurements at various combinations of wavelengths depending on the concentrations of impurities that are contained in the sample under study and absorb in the spectral range used for the detection of the iodine-containing substances.

Screening of ground water samples for volatile organic compounds using a portable gas chromatograph

USGS Publications Warehouse

Buchmiller, R.C.

1989-01-01

A portable gas chromatograph was used to screen 32 ground water samples for volatile organic compounds. Seven screened samples were positive; four of the seven samples had volatile organic substances identified by second-column confirmation. Four of the seven positive, screened samples also tested positive in laboratory analyses of duplicate samples. No volatile organic compounds were detected in laboratory analyses of samples that headspace screening indicated to be negative. Samples that contained volatile organic compounds, as identified by laboratory analysis, and that contained a volatile organic compound present in a standard of selected compounds were correctly identified by using the portable gas chromatography. Comparisons of screened-sample data with laboratory data indicate the ability to detect selected volatile organic compounds at concentrations of about 1 microgram per liter in the headspace of water samples by use of a portable gas chromatography. -Author

Identification of feces by detection of Bacteroides genes.

PubMed

Nakanishi, Hiroaki; Shojo, Hideki; Ohmori, Takeshi; Hara, Masaaki; Takada, Aya; Adachi, Noboru; Saito, Kazuyuki

2013-01-01

In forensic science, the identification of feces is very important in a variety of crime investigations. However, no sensitive and simple fecal identification method using molecular biological techniques has been reported. Here, we focused on the fecal bacteria, Bacteroides uniformis, Bacteroides vulgatus and Bacteroides thetaiotaomicron, and developed a novel fecal identification method by detection of the gene sequences specific to these bacteria in various body (feces, blood, saliva, semen, urine, vaginal fluids and skin surfaces) and forensic (anal adhesions) specimens. Bacterial gene detection was performed by real-time PCR using a minor groove binding probe to amplify the RNA polymerase β-subunit gene of B. uniformis and B. vulgatus, and the α-1-6 mannanase gene of B. thetaiotaomicron. At least one of these bacteria was detected in the feces of 20 donors; the proportions of B. uniformis, B. vulgatus and B. thetaiotaomicron were 95, 85 and 60%, respectively. Bacteroides vulgatus was also detected in one of six vaginal fluid samples, but B. thetaiotaomicron and B. uniformis were not detected in body samples other than feces. Further, we applied this method to forensic specimens from 18 donors. Eighteen anal adhesions also contained at least one of three bacteria; B. uniformis, B. vulgatus and B. thetaiotaomicron were detected in 89, 78 and 56%, respectively, of the specimens. Thus, these bacteria were present at a high frequency in the fecal and forensic specimens, while either B. uniformis or B. vulgatus was detected in all samples. Therefore, B. uniformis and B. vulgatus represent more appropriate target species than B. thetaiotaomicron for the identification of fecal material. If B. vulgatus and/or B. uniformis are detected, it is likely that the sample contains feces. Taken together, our results suggest that the use of molecular biological techniques will aid the detection of feces in forensic practice, although it is possible that the samples contained both feces and vaginal fluid. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Detection and differentiation of coxiella burnetii in biological fluids

DOEpatents

Frazier, Marvin E.; Mallavia, Louis P.; Samuel, James E.; Baca, Oswald G.

1993-01-01

Methods for detecting the presence of Coxiella burnetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA with a DNA probe containing DNA sequences that specifically hybridize with C. burnetii DNA of strains associated with the capacity to cause acute or chronic disease.

Near real time vapor detection and enhancement using aerosol adsorption

DOEpatents

Novick, Vincent J.; Johnson, Stanley A.

1999-01-01

A vapor sample detection method where the vapor sample contains vapor and ambient air and surrounding natural background particles. The vapor sample detection method includes the steps of generating a supply of aerosol that have a particular effective median particle size, mixing the aerosol with the vapor sample forming aerosol and adsorbed vapor suspended in an air stream, impacting the suspended aerosol and adsorbed vapor upon a reflecting element, alternatively directing infrared light to the impacted aerosol and adsorbed vapor, detecting and analyzing the alternatively directed infrared light in essentially real time using a spectrometer and a microcomputer and identifying the vapor sample.

Near real time vapor detection and enhancement using aerosol adsorption

DOEpatents

Novick, V.J.; Johnson, S.A.

1999-08-03

A vapor sample detection method is described where the vapor sample contains vapor and ambient air and surrounding natural background particles. The vapor sample detection method includes the steps of generating a supply of aerosol that have a particular effective median particle size, mixing the aerosol with the vapor sample forming aerosol and adsorbed vapor suspended in an air stream, impacting the suspended aerosol and adsorbed vapor upon a reflecting element, alternatively directing infrared light to the impacted aerosol and adsorbed vapor, detecting and analyzing the alternatively directed infrared light in essentially real time using a spectrometer and a microcomputer and identifying the vapor sample. 13 figs.

Method for immunodiagnostic detection of dioxins at low concentrations

DOEpatents

Vanderlaan, Martin; Stanker, Larry H.; Watkins, Bruce E.; Petrovic, Peter; Gorbach, Siegbert

1995-01-01

A method is described for the use of monoclonal antibodies in a sensitive immunoassay for halogenated dioxins and dibenzofurans in industrial samples which contain impurities. Appropriate sample preparation and selective enzyme amplification of the immunoassay sensitivity permits detection of dioxin contaminants in industrial or environmental samples at concentrations in the range of a few parts per trillion.

Planar optical waveguide based sandwich assay sensors and processes for the detection of biological targets including protein markers, pathogens and cellular debris

DOEpatents

Martinez, Jennifer S [Santa Fe, NM; Swanson, Basil I [Los Alamos, NM; Grace, Karen M [Los Alamos, NM; Grace, Wynne K [Los Alamos, NM; Shreve, Andrew P [Santa Fe, NM

2009-06-02

An assay element is described including recognition ligands bound to a film on a single mode planar optical waveguide, the film from the group of a membrane, a polymerized bilayer membrane, and a self-assembled monolayer containing polyethylene glycol or polypropylene glycol groups therein and an assay process for detecting the presence of a biological target is described including injecting a biological target-containing sample into a sensor cell including the assay element, with the recognition ligands adapted for binding to selected biological targets, maintaining the sample within the sensor cell for time sufficient for binding to occur between selected biological targets within the sample and the recognition ligands, injecting a solution including a reporter ligand into the sensor cell; and, interrogating the sample within the sensor cell with excitation light from the waveguide, the excitation light provided by an evanescent field of the single mode penetrating into the biological target-containing sample to a distance of less than about 200 nanometers from the waveguide thereby exciting the fluorescent-label in any bound reporter ligand within a distance of less than about 200 nanometers from the waveguide and resulting in a detectable signal.

Spectral feature characterization methods for blood stain detection in crime scene backgrounds

NASA Astrophysics Data System (ADS)

Yang, Jie; Mathew, Jobin J.; Dube, Roger R.; Messinger, David W.

2016-05-01

Blood stains are one of the most important types of evidence for forensic investigation. They contain valuable DNA information, and the pattern of the stains can suggest specifics about the nature of the violence that transpired at the scene. Blood spectral signatures containing unique reflectance or absorption features are important both for forensic on-site investigation and laboratory testing. They can be used for target detection and identification applied to crime scene hyperspectral imagery, and also be utilized to analyze the spectral variation of blood on various backgrounds. Non-blood stains often mislead the detection and can generate false alarms at a real crime scene, especially for dark and red backgrounds. This paper measured the reflectance of liquid blood and 9 kinds of non-blood samples in the range of 350 nm - 2500 nm in various crime scene backgrounds, such as pure samples contained in petri dish with various thicknesses, mixed samples with different colors and materials of fabrics, and mixed samples with wood, all of which are examined to provide sub-visual evidence for detecting and recognizing blood from non-blood samples in a realistic crime scene. The spectral difference between blood and non-blood samples are examined and spectral features such as "peaks" and "depths" of reflectance are selected. Two blood stain detection methods are proposed in this paper. The first method uses index to denote the ratio of "depth" minus "peak" over"depth" add"peak" within a wavelength range of the reflectance spectrum. The second method uses relative band depth of the selected wavelength ranges of the reflectance spectrum. Results show that the index method is able to discriminate blood from non-blood samples in most tested crime scene backgrounds, but is not able to detect it from black felt. Whereas the relative band depth method is able to discriminate blood from non-blood samples on all of the tested background material types and colors.

Development and Application of a New Method for Specific and Sensitive Enumeration of Spores of Nonproteolytic Clostridium botulinum Types B, E, and F in Foods and Food Materials ▿

PubMed Central

Peck, Michael W.; Plowman, June; Aldus, Clare F.; Wyatt, Gary M.; Penaloza Izurieta, Walter; Stringer, Sandra C.; Barker, Gary C.

2010-01-01

The highly potent botulinum neurotoxins are responsible for botulism, a severe neuroparalytic disease. Strains of nonproteolytic Clostridium botulinum form neurotoxins of types B, E, and F and are the main hazard associated with minimally heated refrigerated foods. Recent developments in quantitative microbiological risk assessment (QMRA) and food safety objectives (FSO) have made food safety more quantitative and include, as inputs, probability distributions for the contamination of food materials and foods. A new method that combines a selective enrichment culture with multiplex PCR has been developed and validated to enumerate specifically the spores of nonproteolytic C. botulinum. Key features of this new method include the following: (i) it is specific for nonproteolytic C. botulinum (and does not detect proteolytic C. botulinum), (ii) the detection limit has been determined for each food tested (using carefully structured control samples), and (iii) a low detection limit has been achieved by the use of selective enrichment and large test samples. The method has been used to enumerate spores of nonproteolytic C. botulinum in 637 samples of 19 food materials included in pasta-based minimally heated refrigerated foods and in 7 complete foods. A total of 32 samples (5 egg pastas and 27 scallops) contained spores of nonproteolytic C. botulinum type B or F. The majority of samples contained <100 spores/kg, but one sample of scallops contained 444 spores/kg. Nonproteolytic C. botulinum type E was not detected. Importantly, for QMRA and FSO, the construction of probability distributions will enable the frequency of packs containing particular levels of contamination to be determined. PMID:20709854

Development and application of a new method for specific and sensitive enumeration of spores of nonproteolytic Clostridium botulinum types B, E, and F in foods and food materials.

PubMed

Peck, Michael W; Plowman, June; Aldus, Clare F; Wyatt, Gary M; Izurieta, Walter Penaloza; Stringer, Sandra C; Barker, Gary C

2010-10-01

The highly potent botulinum neurotoxins are responsible for botulism, a severe neuroparalytic disease. Strains of nonproteolytic Clostridium botulinum form neurotoxins of types B, E, and F and are the main hazard associated with minimally heated refrigerated foods. Recent developments in quantitative microbiological risk assessment (QMRA) and food safety objectives (FSO) have made food safety more quantitative and include, as inputs, probability distributions for the contamination of food materials and foods. A new method that combines a selective enrichment culture with multiplex PCR has been developed and validated to enumerate specifically the spores of nonproteolytic C. botulinum. Key features of this new method include the following: (i) it is specific for nonproteolytic C. botulinum (and does not detect proteolytic C. botulinum), (ii) the detection limit has been determined for each food tested (using carefully structured control samples), and (iii) a low detection limit has been achieved by the use of selective enrichment and large test samples. The method has been used to enumerate spores of nonproteolytic C. botulinum in 637 samples of 19 food materials included in pasta-based minimally heated refrigerated foods and in 7 complete foods. A total of 32 samples (5 egg pastas and 27 scallops) contained spores of nonproteolytic C. botulinum type B or F. The majority of samples contained <100 spores/kg, but one sample of scallops contained 444 spores/kg. Nonproteolytic C. botulinum type E was not detected. Importantly, for QMRA and FSO, the construction of probability distributions will enable the frequency of packs containing particular levels of contamination to be determined.

Chemical analyses of ground-water samples from the Rio Grande Valley in the vicinity of Albuquerque, New Mexico, October 1993 through January 1994

USGS Publications Warehouse

Wilkins, D.W.; Schlottmann, J.L.; Ferree, D.M.

1996-01-01

A study was conducted to investigate general ground-water- quality conditions and contaminant locations in the Rio Grande Valley in the vicinity of Albuquerque, New Mexico. Water samples from 36 observation wells in 12 well nests were analyzed. The well nests are located along three roads near the Rio Grande--two well nests near Paseo del Norte, five well nests near Monta?o Road, and five well nests near Rio Bravo Boulevard. The water samples were collected from October 19, 1993, through January 18, 1994. Water-quality types by major-ion composition were calcium bicarbonate (found in most samples), sodium sulfate, calcium sulfate, and calcium sulfate chloride. Nutrients were detected in all but one sample. Ammonia was detected in 34 samples, nitrite in 4 samples, and nitrate in 17 samples. Orthophosphate was detected in 31 samples. Organic carbon was detected in all samples collected. The trace elements arsenic and barium were detected in all samples and zinc in 31 samples. Fourteen samples contained detectable copper. Cadmium was detected in one sample, chromium in two samples, lead in four samples, and selenium in two samples. Mercury and silver were not detected.

Assessment of drinking water quality using indicator bacteria and bacteriophages.

PubMed

Méndez, Javier; Audicana, Ana; Cancer, Mercedes; Isern, Anna; Llaneza, Julian; Moreno, Belén; Navarro, Mercedes; Tarancón, M Lluisa; Valero, Fernando; Ribas, Ferran; Jofre, Juan; Lucena, Francisco

2004-09-01

Bacterial indicators and bacteriophages suggested as potential indicators of water quality were determined by public laboratories in water from springs, household water wells, and rural and metropolitan water supplies in north-eastern Spain. Indicator bacteria were detected more frequently than bacteriophages in springs, household water wells and rural water supplies. In contrast, positive bacteriophage detections were more numerous than those of bacteria in metropolitan water supplies. Most of the metropolitan water supply samples containing indicators had concentrations of chlorine below 0.1 mg l(-1), their indicator loads resembling more closely those of rural water supplies than any other samples taken from metropolitan water supplies. The number of samples from metropolitan water supplies containing more than 0.1 mg l(-1) of chlorine that contained phages clearly outnumbered those containing indicator bacteria. Some association was observed between rainfall and the presence of indicators. Sediments from service reservoirs and water from dead ends in the distribution network of one of the metropolitan water supplies were also tested. Bacterial indicators and phages were detected in a higher percentage than in samples of tap water from the same network. Additionally, indicator bacteria were detected more frequently than bacteriophages in sediments of service reservoirs and water from dead end samples. We conclude that naturally occurring indicator bacteria and bacteriophages respond differently to chlorination and behave differently in drinking water distribution networks. Moreover, this study has shown that testing for the three groups of phages in routine laboratories is easy to implement and feasible without the requirement for additional material resources for the laboratories.

Multiplex cytokine profiling with highly pathogenic material: use of formalin solution in luminex analysis.

PubMed

Dowall, Stuart D; Graham, Victoria A; Tipton, Thomas R W; Hewson, Roger

2009-08-31

Work with highly pathogenic material mandates the use of biological containment facilities, involving microbiological safety cabinets and specialist laboratory engineering structures typified by containment level 3 (CL3) and CL4 laboratories. Consequences of working in high containment are the practical difficulties associated with containing specialist assays and equipment often essential for experimental analyses. In an era of increased interest in biodefence pathogens and emerging diseases, immunological analysis has developed rapidly alongside traditional techniques in virology and molecular biology. For example, in order to maximise the use of small sample volumes, multiplexing has become a more popular and widespread approach to quantify multiple analytes simultaneously, such as cytokines and chemokines. The luminex microsphere system allows for the detection of many cytokines and chemokines in a single sample, but the detection method of using aligned lasers and fluidics means that samples often have to be analysed in low containment facilities. In order to perform cytokine analysis in materials from high containment (CL3 and CL4 laboratories), we have developed an appropriate inactivation methodology after staining steps, which although results in a reduction of median fluorescent intensity, produces statistically comparable outcomes when judged against non-inactivated samples. This methodology thus extends the use of luminex technology for material that contains highly pathogenic biological agents.

VOCs, pesticides, nitrate, and their mixtures in groundwater used for drinking water in the United States

USGS Publications Warehouse

Squillace, P.J.; Scott, J.C.; Moran, M.J.; Nolan, B.T.; Kolpin, D.W.

2002-01-01

Samples of untreated groundwater from 1255 domestic drinking-water wells and 242 public supply wells were analyzed as part of the National Water-Quality Assessment Program of the U.S. Geological Survey between 1992 and 1999. Wells were sampled to define the regional quality of the groundwater resource and, thus, were distributed geographically across large aquifers, primarily in rural areas. For each sample, as many as 60 volatile organic compounds (VOCs), 83 pesticides, and nitrate were analyzed. On the basis of previous studies, nitrate concentrations as nitrogen ≥3 mg/L were considered to have an anthropogenic origin. VOCs were detected more frequently (44%) than pesticides (38%) or anthropogenic nitrate (28%). Seventy percent of the samples contained at least one VOC, pesticide, or anthropogenic nitrate; 47% contained at least two compounds; and 33% contained at least three compounds. The combined concentrations of VOCs and pesticides ranged from about 0.001 to 100 μg/L, with a median of 0.02 μg/L. Water from about 12% of the wells contained one or more compounds that exceeded U.S. Environmental Protection Agency drinking-water standards or human health criteria, primarily because of nitrate concentrations exceeding the maximum contaminant level in domestic wells. A mixture is defined as a unique combination of two or more particular compounds, regardless of the presence of other compounds that may occur in the same sample. There were 100 mixtures (significantly associated with agricultural land use) that had a detection frequency between 2% and 19%. There were 302 mixtures (significantly associated with urban land use) that had a detection frequency between 1% and <2%. Only 14 compounds (seven VOCs, six pesticides, and nitrate) contributed over 95% of the detections in these 402 mixtures; however, most samples with these mixtures also contain a variety of other compounds.

Thermodynamic framework to assess low abundance DNA mutation detection by hybridization.

PubMed

Willems, Hanny; Jacobs, An; Hadiwikarta, Wahyu Wijaya; Venken, Tom; Valkenborg, Dirk; Van Roy, Nadine; Vandesompele, Jo; Hooyberghs, Jef

2017-01-01

The knowledge of genomic DNA variations in patient samples has a high and increasing value for human diagnostics in its broadest sense. Although many methods and sensors to detect or quantify these variations are available or under development, the number of underlying physico-chemical detection principles is limited. One of these principles is the hybridization of sample target DNA versus nucleic acid probes. We introduce a novel thermodynamics approach and develop a framework to exploit the specific detection capabilities of nucleic acid hybridization, using generic principles applicable to any platform. As a case study, we detect point mutations in the KRAS oncogene on a microarray platform. For the given platform and hybridization conditions, we demonstrate the multiplex detection capability of hybridization and assess the detection limit using thermodynamic considerations; DNA containing point mutations in a background of wild type sequences can be identified down to at least 1% relative concentration. In order to show the clinical relevance, the detection capabilities are confirmed on challenging formalin-fixed paraffin-embedded clinical tumor samples. This enzyme-free detection framework contains the accuracy and efficiency to screen for hundreds of mutations in a single run with many potential applications in molecular diagnostics and the field of personalised medicine.

GICHD mine dog testing project - soil sample results #4.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnett, James L.; Phelan, James M.; Archuleta, Luisa M.

2003-08-01

A mine dog evaluation project initiated by the Geneva International Center for Humanitarian Demining is evaluating the capability and reliability of mine detection dogs. The performance of field-operational mine detection dogs will be measured in test minefields in Afghanistan and Bosnia containing actual, but unfused landmines. Repeated performance testing over two years through various seasonal weather conditions will provide data simulating near real world conditions. Soil samples will be obtained adjacent to the buried targets repeatedly over the course of the test. Chemical analysis results from these soil samples will be used to evaluate correlations between mine dog detection performancemore » and seasonal weather conditions. This report documents the analytical chemical methods and results from the fourth batch of soils received. This batch contained samples from Kharga, Afghanistan collected in April 2003 and Sarajevo, Bosnia collected in May 2003.« less

Ground-water-quality data for selected wells in the Beaver Creek watershed, West Tennessee

USGS Publications Warehouse

Williams, S.D.

1996-01-01

In 1993 the U.S. Geological Survey, in cooperation with the Tennessee Department of Environment and Conservation (TDEC), began an investigation of the quality of ground water in the Beaver Creek watershed in West Tennessee. A total of 408 water samples were collected from 91 wells during 5 sampling periods in 1994. Water samples were analyzed for selected water-quality properties, fecal coliform and streptococci bacteria, nutrients, and major inorganic constituents. Selected well- construction data and information on potential sources of contamination were also collected for the 91 wells sampled. Nitrate concentrations (measured as NO3) ranged from a detection limit of 0.1 to 91 milligrams per liter (mg/L). Nitrate concentrations exceeding 13 mg/L were detected in 71 of the samples collected. Nitrate concentrations in water samples collected from three wells exceeded the TDEC primary drinking water standard of 44 mg/L for nitrate (measured as NO3). Nitrite (measured as NO2), ammonium (measured as NH4), and orthophosphate (measured as PO4) concentrations in samples were generally less than 0.1 mg/L (detection limit). Fecal coliform bacteria were detected in 33 of the 408 water samples collected. Samples from 21 of the 91 wells contained fecal coliform bacteria during one or more of the five sampling periods. Fecal streptococci bacteria were detected in 123 of the 408 samples. Samples from 59 wells contained fecal streptococci bacteria during one or more of the five sampling periods.

Aflatoxins in spices marketed in Portugal.

PubMed

Martins, M L; Martins, H M; Bernardo, F

2001-04-01

Seventy-nine prepackaged samples of 12 different types of spice powders (five cardamom, five cayenne pepper, eight chilli, five cloves, seven cumin, five curry) powder, five ginger, five mustard, 10 nutmeg, 12 paprika, five saffron and seven white pepper) were selected from supermarkets and ethnic shops in Lisbon (Portugal) for estimation of aflatoxins by immunoaffinity column clean-up followed by HPLC. Aflatoxin B1 (AFB1) was detected in 34 samples of prepackaged spices (43.0%). All of the cayenne pepper samples were contaminated with levels ranging from 2 to 32 microg AFB1/kg. Three nutmeg samples contained levels ranging from 1 to 5 microg/kg, three samples had levels ranging from 6 to 20 microg/kg, and there were two with 54 microg/kg and 58 microg/ kg. Paprika contained levels of aflatoxin B1 ranging from 1 to 20 microg/kg. Chilli, cumin, curry powder, saffron and white pepper samples had levels ranging from 1 to 5 microg/kg. Aflotoxins were not detected in cardamon, cloves, ginger and mustard. None of the samples analysed contained aflatoxins B2, G1 and G2.

Detection and characterisation of aluminium-containing nanoparticles in Chinese noodles by single particle ICP-MS.

PubMed

Loeschner, Katrin; Correia, Manuel; López Chaves, Carlos; Rokkjær, Inge; Sloth, Jens J

2018-01-01

This study investigated Chinese noodles for the presence of aluminium-containing nanoparticles by using inductively coupled plasma mass spectrometry in single particle mode (spICP-MS) after enzymatic digestion by α-amylase. The aluminium concentrations in the noodle samples, determined by conventional ICP-MS without or with the use of hydrofluoric acid for digestion, were 5.4 ± 1.9 µg/g and 10.1 ± 2.2 µg/g (N = 21), respectively. Aluminium-containing nanoparticles were detected by spICP-MS in all 21 samples. Depending on the assumed particle composition, Al 2 O 3 or Al 2 O 3 ∙2SiO 2 ∙2H 2 O, the median particle diameters were either below or above 100 nm, respectively. The minimum detectable particle diameter by spICP-MS was between 54 and 83 nm. The mass recovery of aluminium in the form of particles was between 5% and 18%. The presented work reports for the first time the detection of Al-containing particles in food by spICP-MS.

Automatic Residential/Commercial Classification of Parcels with Solar Panel Detections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morton, April M; Omitaomu, Olufemi A; Kotikot, Susan

A computational method to automatically detect solar panels on rooftops to aid policy and financial assessment of solar distributed generation. The code automatically classifies parcels containing solar panels in the U.S. as residential or commercial. The code allows the user to specify an input dataset containing parcels and detected solar panels, and then uses information about the parcels and solar panels to automatically classify the rooftops as residential or commercial using machine learning techniques. The zip file containing the code includes sample input and output datasets for the Boston and DC areas.

Chemical Characteristics of Organic Aerosols in Shanghai: A Study by Ultrahigh-Performance Liquid Chromatography Coupled With Orbitrap Mass Spectrometry

NASA Astrophysics Data System (ADS)

Wang, Xinke; Hayeck, Nathalie; Brüggemann, Martin; Yao, Lei; Chen, Hangfei; Zhang, Ci; Emmelin, Corinne; Chen, Jianmin; George, Christian; Wang, Lin

2017-11-01

Particulate matter 2.5 (PM2.5) filter samples were collected in July and October 2014 and January and April 2015 in urban Shanghai and analyzed using ultrahigh-performance liquid chromatography coupled to Orbitrap mass spectrometry. The measured chromatogram-mass spectra were processed by a nontarget screening approach to identify significant signals. In total, 810-1,510 chemical formulas of organic compounds in the negative polarity (negative electrospray ionization (ESI-)) and 860-1,790 in the positive polarity (ESI+), respectively, were determined. The chemical characteristics of organic aerosols (OAs) in Shanghai varied among different months and between daytime and nighttime. In the January samples, organics were generally richer in terms of both number and abundance, whereas those in the July samples were far lower. More CHO- (compounds containing only carbon, hydrogen, and oxygen and detected in ESI-) and CHOS- (sulfur-containing organics) were found in the daytime samples, suggesting a photochemical source, whereas CHONS- (nitrogen- and sulfur-containing organics) were more abundant in the nighttime samples, due to nocturnal nitrate radical chemistry. A significant number of monocyclic and polycyclic aromatic compounds, and nitrogen- and sulfur-containing heterocyclic compounds, were detected in all samples, indicating that biomass burning and fossil fuel combustion made important contributions to the OAs in urban Shanghai. Additionally, precursor-product pair analysis indicates that the epoxide pathway is an important formation route for organosulfates observed in Shanghai. Moreover, a similar analysis suggests that 35-57% of nitrogen-containing compounds detected in ESI+ could be formed through reactions between ammonia and carbonyls. Our study presents a comprehensive overview of OAs in urban Shanghai, which helps to understand their characteristics and sources.

Emerging contaminants at a closed and an operating landfill in Oklahoma

USGS Publications Warehouse

Andrews, William J.; Masoner, Jason R.; Cozzarelli, Isabelle M.

2012-01-01

Landfills are the final depositories for a wide range of solid waste from both residential and commercial sources, and therefore have the potential to produce leachate containing many organic compounds found in consumer products such as pharmaceuticals, plasticizers, disinfectants, cleaning agents, fire retardants, flavorings, and preservatives, known as emerging contaminants (ECs). Landfill leachate was sampled from landfill cells of three different age ranges from two landfills in Central Oklahoma. Samples were collected from an old cell containing solid waste greater than 25 years old, an intermediate age cell with solid waste between 16 and 3 years old, and operating cell with solid waste less than 5 years old to investigate the chemical variability and persistence of selected ECs in landfill leachate of differing age sources. Twenty-eight of 69 analyzed ECs were detected in one or more samples from the three leachate sources. Detected ECs ranged in concentration from 0.11 to 114 μg/L and included 4 fecal and plant sterols, 13 household\\industrial, 7 hydrocarbon, and 4 pesticide compounds. Four ECs were solely detected in the oldest leachate sample, two ECs were solely detected in the intermediate leachate sample, and no ECs were solely detected in the youngest leachate sample. Eleven ECs were commonly detected in all three leachate samples and are an indication of the contents of solid waste deposited over several decades and the relative resistance of some ECs to natural attenuation processes in and near landfills.

Development of LAMP assays for the molecular detection of taeniid infection in canine in Tibetan rural area.

PubMed

Feng, Kai; Li, Wei; Guo, Zhihong; Duo, Hong; Fu, Yong; Shen, Xiuying; Tie, Cheng; E, Rijie; Xiao, Changqin; Luo, Yanhong; Qi, Guo; Ni, Ma; Ma, Qingmei; Yamazaki, Wataru; Yoshida, Ayako; Horii, Yoichiro; Yagi, Kinpei; Nonaka, Nariaki

2017-12-22

For field-identification of taeniid cestodes in canine animals in Tibetan area, loop-mediated isothermal amplification (LAMP) assays for Echinococcus multilocularis, E. shiquicus, Taenia hydatigena, T. multiceps, T. pisiformis and T. crassiceps were developed and evaluated along with the reported assay for E. granulosus. The LAMP assays showed specific reaction with their corresponding target species DNA with the detection limit of 1 to 10 pg. Moreover, the assays for E. granulosus, E. multilocularis, T. hydatigena and T. multiceps could detect DNA extracted from 3 or more eggs of their corresponding target species. Then, the LAMP assays were applied on samples containing 3 to 35 taeniid eggs obtained from 61 field-collected canine feces in Qinghai, and the result was compared with a reported multiplex PCR and sequence analysis. The LAMP assays and the PCR detected single species DNA of E. granulosus, E. shiquicus, T. hydatigena and T. multiceps in 5, 2, 44 and 2 samples, respectively. In the rest 8 samples, DNA of both E. granulosus and T. hydatigena were detected by the PCR but the LAMP assays detected those DNAs in 2 samples and only T. hydatigena DNA in 6 samples. It was assumed that less than 3 E. granulosus eggs were mixed in the samples although the samples contained 21 to 27 eggs in total. In conclusion, the LAMP assays were less sensitive than the multiplex PCR, but would have adequate sensitivity for field use in Tibetan area.

Fecal indicators and zoonotic pathogens in household drinking water taps fed from rainwater tanks in Southeast Queensland, Australia.

PubMed

Ahmed, W; Hodgers, L; Sidhu, J P S; Toze, S

2012-01-01

In this study, the microbiological quality of household tap water samples fed from rainwater tanks was assessed by monitoring the numbers of Escherichia coli bacteria and enterococci from 24 households in Southeast Queensland (SEQ), Australia. Quantitative PCR (qPCR) was also used for the quantitative detection of zoonotic pathogens in water samples from rainwater tanks and connected household taps. The numbers of zoonotic pathogens were also estimated in fecal samples from possums and various species of birds by using qPCR, as possums and birds are considered to be the potential sources of fecal contamination in roof-harvested rainwater (RHRW). Among the 24 households, 63% of rainwater tank and 58% of connected household tap water (CHTW) samples contained E. coli and exceeded Australian drinking water guidelines of <1 CFU E. coli per 100 ml water. Similarly, 92% of rainwater tanks and 83% of CHTW samples also contained enterococci. In all, 21%, 4%, and 13% of rainwater tank samples contained Campylobacter spp., Salmonella spp., and Giardia lamblia, respectively. Similarly, 21% of rainwater tank and 13% of CHTW samples contained Campylobacter spp. and G. lamblia, respectively. The number of E. coli (P = 0.78), Enterococcus (P = 0.64), Campylobacter (P = 0.44), and G. lamblia (P = 0.50) cells in rainwater tanks did not differ significantly from the numbers observed in the CHTW samples. Among the 40 possum fecal samples tested, Campylobacter spp., Cryptosporidium parvum, and G. lamblia were detected in 60%, 13%, and 30% of samples, respectively. Among the 38 bird fecal samples tested, Campylobacter spp., Salmonella spp., C. parvum, and G. lamblia were detected in 24%, 11%, 5%, and 13% of the samples, respectively. Household tap water samples fed from rainwater tanks tested in the study appeared to be highly variable. Regular cleaning of roofs and gutters, along with pruning of overhanging tree branches, might also prove effective in reducing animal fecal contamination of rainwater tanks.

Fecal Indicators and Zoonotic Pathogens in Household Drinking Water Taps Fed from Rainwater Tanks in Southeast Queensland, Australia

PubMed Central

Hodgers, L.; Sidhu, J. P. S.; Toze, S.

2012-01-01

In this study, the microbiological quality of household tap water samples fed from rainwater tanks was assessed by monitoring the numbers of Escherichia coli bacteria and enterococci from 24 households in Southeast Queensland (SEQ), Australia. Quantitative PCR (qPCR) was also used for the quantitative detection of zoonotic pathogens in water samples from rainwater tanks and connected household taps. The numbers of zoonotic pathogens were also estimated in fecal samples from possums and various species of birds by using qPCR, as possums and birds are considered to be the potential sources of fecal contamination in roof-harvested rainwater (RHRW). Among the 24 households, 63% of rainwater tank and 58% of connected household tap water (CHTW) samples contained E. coli and exceeded Australian drinking water guidelines of <1 CFU E. coli per 100 ml water. Similarly, 92% of rainwater tanks and 83% of CHTW samples also contained enterococci. In all, 21%, 4%, and 13% of rainwater tank samples contained Campylobacter spp., Salmonella spp., and Giardia lamblia, respectively. Similarly, 21% of rainwater tank and 13% of CHTW samples contained Campylobacter spp. and G. lamblia, respectively. The number of E. coli (P = 0.78), Enterococcus (P = 0.64), Campylobacter (P = 0.44), and G. lamblia (P = 0.50) cells in rainwater tanks did not differ significantly from the numbers observed in the CHTW samples. Among the 40 possum fecal samples tested, Campylobacter spp., Cryptosporidium parvum, and G. lamblia were detected in 60%, 13%, and 30% of samples, respectively. Among the 38 bird fecal samples tested, Campylobacter spp., Salmonella spp., C. parvum, and G. lamblia were detected in 24%, 11%, 5%, and 13% of the samples, respectively. Household tap water samples fed from rainwater tanks tested in the study appeared to be highly variable. Regular cleaning of roofs and gutters, along with pruning of overhanging tree branches, might also prove effective in reducing animal fecal contamination of rainwater tanks. PMID:22020514

Infectious Cryptosporidium parvum oocysts in final reclaimed effluent

USGS Publications Warehouse

Gennaccaro, A.L.; McLaughlin, M.R.; Quintero-Betancourt, W.; Huffman, D.E.; Rose, J.B.

2003-01-01

Water samples collected throughout several reclamation facilities were analyzed for the presence of infectious Cryptosporidium parvum by the focus detection method-most-probable-number cell culture technique. Results revealed the presence of infectious C. parvum oocysts in 40% of the final disinfected effluent samples. Sampled effluent contained on average seven infectious oocysts per 100 liters. Thus, reclaimed water is not pathogen free but contains infectious C. parvum.

No transmission of hepatitis E virus in pigs fed diets containing commercial spray-dried porcine plasma: a retrospective study of samples from several swine trials.

PubMed

Pujols, Joan; Rodríguez, Carmen; Navarro, Nuria; Pina-Pedrero, Sonia; Campbell, Joy M; Crenshaw, Joe; Polo, Javier

2014-12-24

Hepatitis E virus (HEV) has been reported in the human population and pigs are a recognized reservoir for HEV and a possible source of HEV transmission to humans. Spray-dried porcine plasma (SDPP) is an ingredient commonly used in feed for pigs around the world. Even though processing conditions used to produce SDPP should be adequate to inactivate HEV, it was of interest to analyze commercial SDPP samples for presence of genome and antibodies (AB) against HEV and to retrospectively analyze serum samples collected from pigs used in past experiments that had been fed diets containing either 0% or 8% SDPP to detect potential transmission of HEV as determined by seroconversion. Eighty-five commercial SDPP samples were analyzed by ELISA and 100% of them contained AB against HEV, while 22.4% (11 of 49 samples analyzed) were positive for HEV RNA. Frozen sera samples (n = 140) collected from 70 pigs used in past experiments that had been fed diets containing either 0% or 8% commercial SDPP was analyzed by ELISA for AB against HEV. Age of pigs at sera sampling ranged from 3 to 15 weeks and feeding duration of diets ranged from approximately 4 to 9 weeks. One lot of SDPP used in one experiment was analyzed and confirmed to contain HEV RNA. Regardless of the diet fed, some sera samples collected at the beginning of an experiment contained AB titer against HEV. These sera samples were collected from weaned pigs prior to feeding of the experimental diets and the HEV titer was probably from maternal origin. However, by the end of the experiments, HEV titer was not detected or had declined by more than 50% of the initial titer concentration. To our knowledge, this is the first study reporting presence of HEV AB titer and RNA in SDPP. Retrospective analysis of serum collected from pigs fed diets with SDPP revealed no indication of seroconversion to HEV. The results indicate that feeding SDPP in diets for pigs does not represent a risk of transmitting HEV, even though HEV genome may be detected in SDPP.

Portable tester for determining gas content within a core sample

DOEpatents

Garcia, Jr., Fred; Schatzel, Steven J.

1998-01-01

A portable tester is provided for reading and displaying the pressure of a gas released from a rock core sample stored within a sealed container and for taking a sample of the released pressurized gas for chemical analysis thereof for subsequent use in a modified direct method test which determines the volume of gas and specific type of gas contained within the core sample. The portable tester includes a pair of low and high range electrical pressure transducers for detecting a gas pressure; a pair of low and high range display units for displaying the pressure of the detected gas- a selector valve connected to the low and high range pressure transducers, a selector knob for selecting gas flow to one of the flow paths; control valve having an inlet connection to the sealed container, and outlets connected to: a sample gas canister, a second outlet port connected to the selector valve means for reading the pressure of the gas from the sealed container to either the low range or high range pressure transducers, and a connection for venting gas contained within the sealed container to the atmosphere. A battery is electrically connected to and supplies the power for operating the unit. The pressure transducers, display units, selector and control valve means and the battery is mounted to and housed within a protective casing for portable transport and use.

Portable tester for determining gas content within a core sample

DOEpatents

Garcia, F. Jr.; Schatzel, S.J.

1998-04-21

A portable tester is provided for reading and displaying the pressure of a gas released from a rock core sample stored within a sealed container and for taking a sample of the released pressurized gas for chemical analysis thereof for subsequent use in a modified direct method test which determines the volume of gas and specific type of gas contained within the core sample. The portable tester includes a pair of low and high range electrical pressure transducers for detecting a gas pressure; a pair of low and high range display units for displaying the pressure of the detected gas; a selector valve connected to the low and high range pressure transducers and a selector knob for selecting gas flow to one of the flow paths; control valve having an inlet connection to the sealed container; and outlets connected to: a sample gas canister, a second outlet port connected to the selector valve means for reading the pressure of the gas from the sealed container to either the low range or high range pressure transducers, and a connection for venting gas contained within the sealed container to the atmosphere. A battery is electrically connected to and supplies the power for operating the unit. The pressure transducers, display units, selector and control valve means and the battery is mounted to and housed within a protective casing for portable transport and use. 5 figs.

Using a portable ion mobility spectrometer to screen dietary supplements for sibutramine.

PubMed

Dunn, Jamie D; Gryniewicz-Ruzicka, Connie M; Kauffman, John F; Westenberger, Benjamin J; Buhse, Lucinda F

2011-02-20

In response to recent incidents of undeclared sibutramine, an appetite suppressant found in dietary supplements, we developed a method to detect sibutramine using hand-held ion mobility spectrometers with an analysis time of 15 s. Ion mobility spectrometry is a high-throughput and sensitive technique that has been used for illicit drug, explosive, volatile organic compound and chemical warfare detection. We evaluated a hand-held ion mobility spectrometer as a tool for the analysis of supplement extracts containing sibutramine. The overall instrumental limit of detection of five portable ion mobility spectrometers was 2 ng of sibutramine HCl. When sample extractions containing 30 ng/μl or greater of sibutramine were analyzed, saturation of the ionization chamber of the spectrometer occurred and the instrument required more than three cleaning cycles to remove the drug. Hence, supplement samples suspected of containing sibutramine should be prepared at concentrations of 2-20 ng/μl. To obtain this target concentration range for products containing unknown amounts of sibutramine, we provided a simple sample preparation procedure, allowing the U.S. Food and Drug Administration or other agencies to screen products using the portable ion mobility spectrometer. Published by Elsevier B.V.

Metals, pesticides, and semivolatile organic compounds in sediment in Valley Forge National Historical Park, Montgomery County, Pennsylvania

USGS Publications Warehouse

Reif, Andrew G.; Sloto, Ronald A.

1997-01-01

The Schuylkill River flows through Valley Forge National Historical Park in Lower Providence and West Norriton Townships in Montgomery County, Pa. The concentration of selected metals, pesticides, semivolatile organic compounds, and total carbon in stream-bottom sediments from Valley Forge National Historical Park were determined for samples collected once at 12 sites in and around the Schuylkill River.Relatively low concentrations of arsenic, chromium, copper, and lead were detected in all samples. The concentrations of these metals are similar to concentrations in other stream-bottom sediment samples collected in the region. The concentrations of iron, manganese, and zinc were elevated in samples from four sites in the Schuylkill River, and the concentration of mercury was elevated in a sample from an impoundment along the river.The organophosphorus insecticide diazinon was detected in relatively low concentrations in half of the 12 samples analyzed. The organo-chlorine insecticide DDE was detected in all 12 samples analyzed; dieldrin was detected in 10 samples, chlordane, DDD, and DDT were detected in 9 samples, and heptachlor epoxide was detected in one sample. The concentrations of organo-chlorine and organophosphorus insecticides were relatively low and similar to concentrations in samples collected in the region.Detectable concentrations of 17 semivolatile organic compounds were measured in the 12 samples analyzed. The most commonly detected compounds were fluoranthene, phenanthrene, and pyrene. The maximum concentration detected was 4,800 micrograms per kilogram of phenanthrene. The highest concentrations of compounds were detected in Lamb Run, a small tributary to the Schuylkill River with headwaters in an industrial corporate center. The concentration of compounds in the Schuylkill River below Lamb Run is higher than the Schuylkill River above Lamb Run, indicating that sediment from Lamb Run is increasing the concentration of semivolatile organic compounds in sediment from the Schuylkill River. Concentrations of semivolatile organic compounds are lower in sediment from the Schuylkill River below Myer's Run than above Myer's Run because of the addition of relatively clean sediment from Myer's Run. Samples collected from the floodplain, impounding basin, and wetland along the Schuylkill River contained the lowest concen-trations of semivolatile organic compounds.Detectable concentrations of polychlorinated biphenyls (PCB's) were measured in 11 of the 12 samples analyzed. The maximum PCB concentration was 37 micrograms per kilogram. Sediment samples from Lamb Run contained the highest concentrations of semivolatile organic compounds and PCB's.

A Spatially Offset Raman Spectroscopy Method for Non-Destructive Detection of Gelatin-Encapsulated Powders

PubMed Central

Chao, Kuanglin; Dhakal, Sagar; Qin, Jianwei; Peng, Yankun; Schmidt, Walter F.; Kim, Moon S.; Chan, Diane E.

2017-01-01

Non-destructive subsurface detection of encapsulated, coated, or seal-packaged foods and pharmaceuticals can help prevent distribution and consumption of counterfeit or hazardous products. This study used a Spatially Offset Raman Spectroscopy (SORS) method to detect and identify urea, ibuprofen, and acetaminophen powders contained within one or more (up to eight) layers of gelatin capsules to demonstrate subsurface chemical detection and identification. A 785-nm point-scan Raman spectroscopy system was used to acquire spatially offset Raman spectra for an offset range of 0 to 10 mm from the surfaces of 24 encapsulated samples, using a step size of 0.1 mm to obtain 101 spectral measurements per sample. As the offset distance was increased, the spectral contribution from the subsurface powder gradually outweighed that of the surface capsule layers, allowing for detection of the encapsulated powders. Containing mixed contributions from the powder and capsule, the SORS spectra for each sample were resolved into pure component spectra using self-modeling mixture analysis (SMA) and the corresponding components were identified using spectral information divergence values. As demonstrated here for detecting chemicals contained inside thick capsule layers, this SORS measurement technique coupled with SMA has the potential to be a reliable non-destructive method for subsurface inspection and authentication of foods, health supplements, and pharmaceutical products that are prepared or packaged with semi-transparent materials. PMID:28335453

Ground-water quality beneath irrigated agriculture in the central High Plains aquifer, 1999-2000

USGS Publications Warehouse

Bruce, Breton W.; Becker, Mark F.; Pope, Larry M.; Gurdak, Jason J.

2003-01-01

In 1999 and 2000, 30 water-quality monitoring wells were installed in the central High Plains aquifer to evaluate the quality of recently recharged ground water in areas of irrigated agriculture and to identify the factors affecting ground-water quality. Wells were installed adjacent to irrigated agricultural fields with 10- or 20-foot screened intervals placed near the water table. Each well was sampled once for about 100 waterquality constituents associated with agricultural practices. Water samples from 70 percent of the wells (21 of 30 sites) contained nitrate concentrations larger than expected background concentrations (about 3 mg/L as N) and detectable pesticides. Atrazine or its metabolite, deethylatrazine, were detected with greater frequency than other pesticides and were present in all 21 samples where pesticides were detected. The 21 samples with detectable pesticides also contained tritium concentrations large enough to indicate that at least some part of the water sample had been recharged within about the last 50 years. These 21 ground-water samples are considered to show water-quality effects related to irrigated agriculture. The remaining 9 groundwater samples contained no pesticides, small tritium concentrations, and nitrate concentrations less than 3.45 milligrams per liter as nitrogen. These samples are considered unaffected by the irrigated agricultural land-use setting. Nitrogen isotope ratios indicate that commercial fertilizer was the dominant source of nitrate in 13 of the 21 samples affected by irrigated agriculture. Nitrogen isotope ratios for 4 of these 21 samples were indicative of an animal waste source. Dissolved-solids concentrations were larger in samples affected by irrigated agriculture, with large sulfate concentrations having strong correlation with large dissolved solids concentrations in these samples. A strong statistical correlation is shown between samples affected by irrigated agriculture and sites with large rates of pesticide and nitrogen applications and shallow depths to ground water.

Analysis of three variables in sampling solutions used to assay bacteria of hands: type of solution, use of antiseptic neutralizers, and solution temperature.

PubMed Central

Larson, E L; Strom, M S; Evans, C A

1980-01-01

Tests were performed using the sterile bag technique to determine the effects of type of sampling solution, use of antiseptic neutralizers, and solution temperature on the detection and quantitation of bacteria on hands. Using paired hand cultures, three sampling solutions were compared: quarter-strength Ringer solution, a phosphate buffer containing Triton X-100, and the same buffer containing antiseptic neutralizers. The phosphate buffer containing Triton X-100 was significantly better than quarter-strength Ringer solution in mean bacterial yield; the neutralizer-containing sampling solution was slightly better than Triton X-100-containing solution, although differences were not significant at the P = 0.05 level. Temperature (6 or 23 degrees C) of the sampling solution showed no consistent effect on bacterial yield from hands tested with the fluid containing neutralizers. PMID:7012171

Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

PubMed

Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

2013-07-01

The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (<0.1%) and four were found to be correctly labelled as containing pork. However, one sausage sample was labelled as containing 5% beef, but beef DNA was not detected and a meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

Assessment of soil and water contaminants from selected locations in and near the Idaho Army National Guard Orchard Training Area, Ada County, Idaho, 2001-2003

USGS Publications Warehouse

Parliman, D.J.

2004-01-01

In 2001, the National Guard Bureau and the U.S. Geological Survey began a project to compile hydrogeologic data and determine presence or absence of soil, surface-water, and ground-water contamination at the Idaho Army National Guard Orchard Training Area in southwestern Idaho. Between June 2002 and April 2003, a total of 114 soil, surface-water, ground-water, precipitation, or dust samples were collected from 68 sample sites (65 different locations) in the Orchard Training Area (OTA) or along the vehicle corridor to the OTA. Soil and water samples were analyzed for concentrations of selected total trace metals, major ions, nutrients, explosive compounds, semivolatile organics, and petroleum hydrocarbons. Water samples also were analyzed for concentrations of selected dissolved trace metals and major ions. Distinguishing naturally occurring large concentrations of trace metals, major ions, and nutrients from contamination related to land and water uses at the OTA was difficult. There were no historical analyses for this area to compare with modern data, and although samples were collected from 65 locations in and near the OTA, sampled areas represented only a small part of the complex OTA land-use areas and soil types. For naturally occurring compounds, several assumptions were made?anomalously large concentrations, when tied to known land uses, may indicate presence of contamination; naturally occurring concentrations cannot be separated from contamination concentrations in mid- and lower ranges of data; and smallest concentrations may represent the lowest naturally occurring range of concentrations and (or) the absence of contaminants related to land and water uses. Presence of explosive, semivolatile organic (SVOC), and petroleum hydrocarbon compounds in samples indicates contamination from land and water uses. In areas along the vehicle corridor and major access roads within the OTA, most trace metal, major ion, and nutrient concentrations in soil samples were not in the upper 10th percentile of data, but concentrations of 25 metals, ions, or nutrients were in the upper 10th percentile in a puddle sample near the heavy equipment maneuvering area, MPRC-H. The largest concentrations of tin, ammonia, and nitrite plus nitrate (as nitrogen) in water from the OTA were detected in a sample from this puddle. Petroleum hydrocarbons were the most common contaminant, detected in all soil and surface-water samples. An SVOC, bis (2-ethylhexyl) phthalate, a plasticizer, was detected at a site along the vehicle corridor. In Maneuver Areas within the OTA, many soil samples contained at least one trace metal, major ion, or nutrient in the upper 10th percentile of data, and the largest concentrations of cobalt, iron, mercury, titanium, sodium, ammonia, or total phosphorus were detected in 6 of 13 soil samples outside the Tadpole Lake area. The largest concentrations of aluminum, arsenic, beryllium, nickel, selenium, silver, strontium, thallium, vanadium, chloride, potassium, sulfate, and nitrite plus nitrate were detected in soil samples from the Tadpole Lake area. Water from Tadpole Lake contained the largest total concentrations of 19 trace metals, 4 major ions, and 1 nutrient. Petroleum hydrocarbons were detected in 5 soil samples and water from Tadpole Lake. SVOCs related to combustion of fuel or plasticizers were detected in 1 soil sample. Explosive compounds were detected in 1 precipitation sample.In the Impact Area within the OTA, most soil samples contained at least one trace metal, major ion, or nutrient in the upper 10th percentile of data, and the largest concentrations of barium, chromium, copper, manganese, lead, or orthophosphate were detected in 6 of the 18 soil samples. Petroleum hydrocarbons were detected in 4 soil samples, SVOCs in 6 samples, and explosive compounds in 4 samples. In the mobilization and training equipment site (MATES) compound adjacent to the OTA, all soil and water samples contained at lea

Seasonal Variability and Effects of Stormflow on Concentrations of Pesticides and their Degradates in Kisco River and Middle Branch Croton River Surface Water, Croton Reservoir System, New York, May 2000-February 2001

USGS Publications Warehouse

Phillips, Patrick J.; Bode, Robert W.

2004-01-01

Seven herbicides (2,4-D, 2,4-D methyl ester, bromacil, dicamba, diuron, imazaquin, and sulfometuron), four insecticides (carbaryl, diazinon, imidacloprid, and malathion), two fungicides (metalaxyl and myclobutanil), and caffeine (an indicator of wastewater) were detected in at least one sample from the Kisco River at concentrations above 0.1 ug/L (micrograms per liter). Four of these compounds - 2,4-D, 2,4-D methyl ester, dicamba, and metalaxyl - were detected in at least one sample from the Kisco River at a concentration above 1 ug/L. Only three herbicides (2,4-D, imazethapyr, and prometon) and caffeine were detected at concentrations above 0.1 ug/L in one or more of the Middle Branch Croton River samples, and no compounds were detected above 0.4 ug/L in Middle Branch Croton River samples. No samples contained concentrations of pesticides that exceeded human health-based water-quality standards. However, samples from the Kisco River contained four insecticides (carbaryl, chlorpyrifos, diazinon, and malathion) and one herbicide (2,4-D) in concentrations that exceeded water-quality criteria for the protection of aquatic life. Aquatic-life protection criteria were generally exceeded only in stormflow samples collected in June, September, and December 2000. No samples from the Middle Branch Croton River contained target compounds that exceeded water-quality criteria for the protection of aquatic life. Pesticide concentrations were generally higher, and the numbers of compounds generally larger in samples from the Kisco River than in samples from the Middle Branch Croton River, probably because the Kisco River watershed has a greater population density and is more extensively developed. The highest concentrations of most compounds in both streams were detected in stormflow samples collected in June, September, and December 2000. This indicates that stormflow sampling is essential in assessments of pesticide occurrence in streams that drain developed lands. The lowest concentrations of most compounds at both sites were detected in baseflow samples collected from October 2000 through February 2001, although the concentrations of several compounds increased substantially during stormflows at the Kisco River site in November and December, 2000.

Environmental Survey of Drinking Water Sources in Kampala, Uganda, during a Typhoid Fever Outbreak

PubMed Central

Kahler, A. M.; Nansubuga, I.; Nanyunja, E. M.; Kaplan, B.; Jothikumar, N.; Routh, J.; Gómez, G. A.; Mintz, E. D.; Hill, V. R.

2017-01-01

ABSTRACT In 2015, a typhoid fever outbreak began in downtown Kampala, Uganda, and spread into adjacent districts. In response, an environmental survey of drinking water source types was conducted in areas of the city with high case numbers. A total of 122 samples was collected from 12 source types and tested for Escherichia coli, free chlorine, and conductivity. An additional 37 grab samples from seven source types and 16 paired large volume (20 liter) samples from wells and springs were also collected and tested for the presence of Salmonella enterica serovar Typhi. Escherichia coli was detected in 60% of kaveras (drinking water sold in plastic bags) and 80% of refilled water bottles; free chlorine was not detected in either source type. Most jerry cans (68%) contained E. coli and had free chlorine residuals below the WHO-recommended level of 0.5 mg/liter during outbreaks. Elevated conductivity readings for kaveras, refilled water bottles, and jerry cans (compared to treated surface water supplied by the water utility) suggested that they likely contained untreated groundwater. All unprotected springs and wells and more than 60% of protected springs contained E. coli. Water samples collected from the water utility were found to have acceptable free chlorine levels and no detectable E. coli. While S. Typhi was not detected in water samples, Salmonella spp. were detected in samples from two unprotected springs, one protected spring, and one refilled water bottle. These data provided clear evidence that unregulated vended water and groundwater represented a risk for typhoid transmission. IMPORTANCE Despite the high incidence of typhoid fever globally, relatively few outbreak investigations incorporate drinking water testing. During waterborne disease outbreaks, measurement of physical-chemical parameters, such as free chlorine residual and electrical conductivity, and of microbiological parameters, such as the presence of E. coli or the implicated etiologic agent, in drinking water samples can identify contaminated sources. This investigation indicated that unregulated vended water and groundwater sources were contaminated and were therefore a risk to consumers during the 2015 typhoid fever outbreak in Kampala. Identification of contaminated drinking water sources and sources that do not contain adequate disinfectant levels can lead to rapid targeted interventions. PMID:28970225

Enzymatic digestion and selective quantification of underivatised delta-9-tetrahydrocannabinol and cocaine in human hair using gas chromatography-mass spectrometry.

PubMed

Breidi, Salah Eddine; Barker, James; Petróczi, Andrea; Naughton, Declan P

2012-01-01

Gas chromatography-mass spectrometric (GC-MS) methods for drug analysis routinely employ derivatising reagents. The aim of this paper was to develop a method for the analysis of two recreational drugs, delta-9-tetrahydrocannabinol (Δ(9)-THC) and cocaine in hair samples using GC-MS, without prior derivatisation, thus allowing the sample to be reanalysed in its original form. An enzymatic digestion technique was also developed. Ten hair samples, that were known positive for either Δ(9)-THC and/or cocaine, were enzymatically digested, extracted, and then analysed by GC-MS. All samples measured contained Δ(9)-THC and one sample contained cocaine. The limits of detection (LOD) and quantification (LOQ) were 0.02 ng/mg and 0.05 ng/mg, respectively, for cocaine and 0.015 ng/mg and 0.02 ng/mg, respectively, for Δ(9)-THC. The wide detection window, ease of direct analysis by GC-MS, lower detection limits of underivatised samples, and the stability of drugs using this technique may offer an improved method of analysis.

Enzymatic Digestion and Selective Quantification of Underivatised Delta-9-Tetrahydrocannabinol and Cocaine in Human Hair Using Gas Chromatography-Mass Spectrometry

PubMed Central

Breidi, Salah Eddine; Barker, James; Petróczi, Andrea; Naughton, Declan P.

2012-01-01

Gas chromatography-mass spectrometric (GC-MS) methods for drug analysis routinely employ derivatising reagents. The aim of this paper was to develop a method for the analysis of two recreational drugs, delta-9-tetrahydrocannabinol (Δ9-THC) and cocaine in hair samples using GC-MS, without prior derivatisation, thus allowing the sample to be reanalysed in its original form. An enzymatic digestion technique was also developed. Ten hair samples, that were known positive for either Δ9-THC and/or cocaine, were enzymatically digested, extracted, and then analysed by GC-MS. All samples measured contained Δ9-THC and one sample contained cocaine. The limits of detection (LOD) and quantification (LOQ) were 0.02 ng/mg and 0.05 ng/mg, respectively, for cocaine and 0.015 ng/mg and 0.02 ng/mg, respectively, for Δ9-THC. The wide detection window, ease of direct analysis by GC-MS, lower detection limits of underivatised samples, and the stability of drugs using this technique may offer an improved method of analysis. PMID:22567573

Comparison of fecal pooling strategies for detection of Mycobacterium avium ssp. paratuberculosis in cattle.

PubMed

McKenna, S L B; Ritter, C; Dohoo, I; Keefe, G P; Barkema, H W

2018-05-23

In herds with typical moderate to low within-herd prevalence, testing for Mycobacterium avium ssp. paratuberculosis (MAP), the infectious agent of Johne's disease, will be more cost-effective if individual fecal samples are cultured in composite pools. However, sensitivity to classify a pool containing 1 or more positive individual samples as positive may depend on pool size and number of individual positive samples within a pool. Fecal samples collected from 994 dairy cows sampled at slaughter were cultured to detect MAP. Culturing was done both individually and as composite pooled samples using the TREK ESP Culture System II broth medium (Thermo Fisher Scientific, Trek Diagnostic Systems Inc., Cleveland, OH). Composite samples consisted of pools containing feces from 3, 5, 8, 10, or 15 cows. The number of individual fecal culture-positive cows within each pool ranged from 0 to 4. Culture of individual fecal samples detected MAP in 36 (3.6%) of the 994 cows. Individual samples that were detected within the first 50 d by TREK ESP Culture System II were more likely to lead to a positive pool result. In total, 840 pooled fecal samples were examined for presence of MAP, and of those, 272 pools actually contained feces from fecal culture-positive cows. The crude sensitivity (proportion of pools that contained at least 1 fecal-positive cow that tested positive) for pools of 3, 5, 8, 10, and 15 was 47, 67, 44, 59, and 39%, respectively. Across pools, an increase of the number of fecal culture-positive samples from 1 to 2 enhanced overall crude sensitivity from 44 to 71%. However, sensitivity did not further increase for pools with 3 or 4 fecal culture-positive samples (63 and 60%, respectively). Additionally, a simulation analysis assessing probability of pooled fecal samples being positive in herds of 50 and 100 cows was conducted. The simulation assumed that 1, 2, or 5 cows per herd were MAP fecal culture-positive and that pools of 5 and 10 were used. This low-prevalence herd simulation indicated that weighted mean herd probabilities of detecting a positive herd ranged between 52 and 99.3%, with the lowest probability for pools of 10 with 1 positive cow in the herd and the highest probability for pools of 5 with 5 positive cows in the herd. However, overall, pools of 5 and 10 had similar diagnostic capabilities, enabling cost savings by utilizing pools of 10. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

[Antimony and other heavy metals in metallic kitchen ware].

PubMed

Ishiwata, H; Sugita, T; Yoshihira, K

1989-01-01

The antimony in metallic kitchen ware was determined. The content of this element in metals used for the production or repairing of utensils, containers and packaging which come in contact with foods is regulated and should be less than 5% in under the Japanese Food Sanitation Law. In eight metallic samples, antimony was detected in solder used for the production of a can for green tea and an eggbeater. The contents were 1.30% in the former and 1.90% in the latter. No antimony was detected in solder used for a cookie cutter. A sample of solder used for electric work, not for food utensils, contained 0.81% of antimony. In other metallic utensils which come in contact with food such as aluminum foil, a brass spoon, a stainless steel fork, a wire netting, and an iron rock for vegetable color stabilizing, antimony was not detected at a 0.05% detection limit. A qualitative test using rhodamine B also showed positive results in only three solder samples. Lead concentrations in solder used for the kitchen ware were from 39.3 to 51.3%. These concentrations were higher than the limit (20%) of lead content by the Law. No cadmium was detected in any samples.

Method for predicting peptide detection in mass spectrometry

DOEpatents

Kangas, Lars [West Richland, WA; Smith, Richard D [Richland, WA; Petritis, Konstantinos [Richland, WA

2010-07-13

A method of predicting whether a peptide present in a biological sample will be detected by analysis with a mass spectrometer. The method uses at least one mass spectrometer to perform repeated analysis of a sample containing peptides from proteins with known amino acids. The method then generates a data set of peptides identified as contained within the sample by the repeated analysis. The method then calculates the probability that a specific peptide in the data set was detected in the repeated analysis. The method then creates a plurality of vectors, where each vector has a plurality of dimensions, and each dimension represents a property of one or more of the amino acids present in each peptide and adjacent peptides in the data set. Using these vectors, the method then generates an algorithm from the plurality of vectors and the calculated probabilities that specific peptides in the data set were detected in the repeated analysis. The algorithm is thus capable of calculating the probability that a hypothetical peptide represented as a vector will be detected by a mass spectrometry based proteomic platform, given that the peptide is present in a sample introduced into a mass spectrometer.

Tape Cassette Bacteria Detection System

NASA Technical Reports Server (NTRS)

1973-01-01

The design, fabrication, and testing of an automatic bacteria detection system with a zero-g capability and based on the filter-capsule approach is described. This system is intended for monitoring the sterility of regenerated water in a spacecraft. The principle of detection is based on measuring the increase in chemiluminescence produced by the action of bacterial porphyrins (i.e., catalase, cytochromes, etc.) on a luminol-hydrogen peroxide mixture. Since viable as well as nonviable organisms initiate this luminescence, viable organisms are detected by comparing the signal of an incubated water sample with an unincubated control. Higher signals for the former indicate the presence of viable organisms. System features include disposable sealed sterile capsules, each containing a filter membrane, for processing discrete water samples and a tape transport for moving these capsules through a processing sequence which involves sample concentration, nutrient addition, incubation, a 4 Molar Urea wash and reaction with luminol-hydrogen peroxide in front of a photomultiplier tube. Liquids are introduced by means of a syringe needle which pierces a rubber septum contained in the wall of the capsule. Detection thresholds obtained with this unit towards E. coli and S. marcescens assuming a 400 ml water sample are indicated.

Proportional counter device for detecting electronegative species in an air sample

DOEpatents

Allman, Steve L.; Chen, Fang C.; Chen, Chung-Hsuan

1994-01-01

Apparatus for detecting an electronegative species comprises an analysis chamber, an inlet communicating with the analysis chamber for admitting a sample containing the electronegative species and an ionizable component, a radioactive source within the analysis chamber for emitting radioactive energy for ionizing a component of the sample, a proportional electron detector within the analysis chamber for detecting electrons emitted from the ionized component, and a circuit for measuring the electrons and determining the presence of the electronegative species by detecting a reduction in the number of available electrons due to capture of electrons by the electronegative species.

Proportional counter device for detecting electronegative species in an air sample

DOEpatents

Allman, S.L.; Chen, F.C.; Chen, C.H.

1994-03-08

Apparatus for detecting an electronegative species comprises an analysis chamber, an inlet communicating with the analysis chamber for admitting a sample containing the electronegative species and an ionizable component, a radioactive source within the analysis chamber for emitting radioactive energy for ionizing a component of the sample, a proportional electron detector within the analysis chamber for detecting electrons emitted from the ionized component, and a circuit for measuring the electrons and determining the presence of the electronegative species by detecting a reduction in the number of available electrons due to capture of electrons by the electronegative species. 2 figures.

Thermodynamic framework to assess low abundance DNA mutation detection by hybridization

PubMed Central

Willems, Hanny; Jacobs, An; Hadiwikarta, Wahyu Wijaya; Venken, Tom; Valkenborg, Dirk; Van Roy, Nadine; Vandesompele, Jo; Hooyberghs, Jef

2017-01-01

The knowledge of genomic DNA variations in patient samples has a high and increasing value for human diagnostics in its broadest sense. Although many methods and sensors to detect or quantify these variations are available or under development, the number of underlying physico-chemical detection principles is limited. One of these principles is the hybridization of sample target DNA versus nucleic acid probes. We introduce a novel thermodynamics approach and develop a framework to exploit the specific detection capabilities of nucleic acid hybridization, using generic principles applicable to any platform. As a case study, we detect point mutations in the KRAS oncogene on a microarray platform. For the given platform and hybridization conditions, we demonstrate the multiplex detection capability of hybridization and assess the detection limit using thermodynamic considerations; DNA containing point mutations in a background of wild type sequences can be identified down to at least 1% relative concentration. In order to show the clinical relevance, the detection capabilities are confirmed on challenging formalin-fixed paraffin-embedded clinical tumor samples. This enzyme-free detection framework contains the accuracy and efficiency to screen for hundreds of mutations in a single run with many potential applications in molecular diagnostics and the field of personalised medicine. PMID:28542229

Occurrence of active and inactive herbicide ingredients at selected sites in Iowa

USGS Publications Warehouse

Wang, W.; Liszewski, M.; Buchmiller, R.; Cherryholmes, K.

1995-01-01

Herbicides were detected in 50% of water samples, ranging from 78% of water samples from the Ames site to 25% from the Walnut Creek site. Among herbicides detected, listed in decreasing order of frequency, were atrazine > alachlor > cyanazine > metolachlor > metribuzin. Volatile organic compounds were detected in 11% of water samples. Among the compounds detected, listed in decreasing order of frequency, were xylene > toluene > acetone. One sample contained a detectable amount of aliphatic compound(s), with the empirical formula of C8H18. Results from the Deer Creek site showed that herbicides were detected primarily in the top layer (1.2 m), whereas xylene and other alkylbenzenes were detected at 2.1 m or deeper. Apparently, physico-chemical and other factors are separating herbicides and volatile organic compounds in the shallow unsaturated zone.

Application of the Mars Organic Analyzer to nucleobase and amine biomarker detection.

PubMed

Skelley, Alison M; Cleaves, H James; Jayarajah, Christine N; Bada, Jeffrey L; Mathies, Richard A

2006-12-01

The Mars Organic Analyzer (MOA), a portable microfabricated capillary electrophoresis instrument being developed for planetary exploration, is used to analyze a wide variety of fluorescamine-labeled amine-containing biomarker compounds, including amino acids, mono and diaminoalkanes, amino sugars, nucleobases, and nucleobase degradation products. The nucleobases cytosine and adenine, which contain an exocyclic primary amine, were effectively labeled, separated, and detected at concentrations <500 nM. To test the general applicability of the MOA for biomarker detection, amino acids and mono- and diamines were extracted from bacterial cells using both hydrolysis and sublimation followed by analysis. The extrapolated limit of detection provided by the valine biomarker was approximately 4 x 10(3) cells per sample. Products of an NH(4)CN polymerization that simulate a prebiotic synthesis were also successfully isolated via sublimation and analyzed. Adenine and alanine/serine were detected with no additional sample cleanup at 120 +/- 13 microM and 4.1 +/- 1 microM, respectively, corresponding to a reaction yield of 0.04% and 0.0003%, respectively. This study demonstrates that the MOA provides sensitive detection and analysis of low levels of a wide variety of amine-containing organic compounds from both biological and abiotic sources.

Detection of Organophosphate Flame Retardants in Furniture Foam and US House Dust

PubMed Central

Stapleton, Heather M.; Klosterhaus, Susan; Eagle, Sarah; Fuh, Jennifer; Meeker, John D.; Blum, Arlene; Webster, Thomas F.

2009-01-01

Restrictions on the use of polybrominated diphenyl ethers (PBDEs) have resulted in the increased use of alternate flame retardant chemicals to meet flammability standards. However, it has been difficult to determine which chemical formulations are currently being used in high volumes to meet flammability standards since the use of flame retardant formulations in consumer products is not transparent (i.e. not provided to customers). To investigate chemicals being used as replacements for PentaBDE in polyurethane foam, we analyzed foam samples from 26 different pieces of furniture purchased in the United States primarily between 2003 and 2009 using gas chromatography mass spectrometry. Samples included foam from couches, chairs, mattress pads, pillows, and, in one case, foam from a sound proofing system of a laboratory grade dust sieve. Fifteen of the foam samples contained the flame retardant tris(1,3-dichloro-2-propyl) phosphate (TDCPP; 1–5% by weight), four samples contained tris(1-chloro-2-propyl) phosphate (TCPP; 0.5 –2.2 % by weight), one sample contained brominated chemicals found in a new flame retardant mixture called Firemaster 550 (4.2% by weight), and one foam sample collected from a futon likely purchased prior to 2004 contained PentaBDE (0.5% by weight). Due to the high frequency of detection of the chlorinated phosphate compounds in furniture foam, we analyzed extracts from 50 house dust samples collected between 2002 and 2007 in the Boston, MA area for TDCPP, TCPP, and another high volume use organophosphate-based flame retardant used in foam, triphenylphosphate (TPP). Detection frequencies for TDCPP and TPP in the dust samples were >96% and were log normally distributed, similar to observations for PBDEs. TCPP was positively detected in dust in only 24% of the samples, but detection was significantly limited by a co-elution problem. The geometric mean concentrations for TCPP, TDCPP and TPP in house dust were 570, 1890, and 7360 ng/g, respectively, and maximum values detected in dust were 5490, 56,080 and 1,798,000 ng/g, respectively. These data suggest that levels of these organophosphate flame retardants are comparable, or in some cases, greater than, levels of PBDEs in house dust. The high prevalence of these chemicals in foam and the high concentrations measured in dust (as high as 1.8 mg/g), warrant further studies to evaluate potential health effects from dust exposure, particularly for children. PMID:19848166

Survey on Metals Contained in Stainless Steel Kitchenware and Tableware.

PubMed

Shiozawa, Yuu; Haneishi, Nahoko; Suzuki, Kumi; Ogimoto, Mami; Takanashi, Mayu; Tomioka, Naoko; Uematsu, Yoko; Monma, Kimio

2017-01-01

Stainless steel kitchenware and tableware on sale in Japan were investigated. Surface elemental composition ratios of 172 samples were analyzed by the fluorescence X-ray method. High levels of manganese (9.59-20.03%)were detected in 17 samples. This finding was confirmed by ICP analysis. Next, we conducted migration tests. Samples conformed to the Italian Specific Migration Limits. Moreover, lead and antimony were not detected in these samples, in accordance with the Japanese Food Sanitation Law.

Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

PubMed

Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

2018-01-02

The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004). In comparison with the detection of the Vibrio profiles in fourteen food samples using standard method, Reverse Transcriptase-PCR-DGGE resulted in 100%, 75% and 50% similarity in 3, 1 and 6 food samples, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

Occurrence of Pharmaceuticals in Shallow Ground-Water of Suffolk County, New York, 2002-05

USGS Publications Warehouse

Benotti, Mark J.; Fisher, Shawn; Terracciano, Stephen

2006-01-01

Seventy (70) water samples were collected from 61 wells in the upper glacial and Magothy aquifers (9 wells were sampled twice) during 2002-05 and analyzed for 24 pharmaceuticals. Wells were selected for their proximity to known wastewater-treatment facilities that discharge to the shallow upper glacial aquifer. Pharmaceuticals were detected in 28 of the 70 samples, 19 of which contained one compound, and 9 of which contained two or more compounds. Concentrations of detected compounds were extremely low; most ranged from 0.001 to 0.1 microgram per liter (part per billion). The two most commonly detected compounds were carbamazepine (an antiepileptic drug) and sulfamethoxazole (an antibiotic). Occurrence of pharmaceutical compounds in Suffolk County ground-water is less prevalent than in susceptible streams of the United States that were tested in 1998-2000, but the similarity of median concentrations of the detected compounds of the two data sets indicates that current wastewater practices can serve to introduce pharmaceuticals to this shallow aquifer.

Enhanced monitor system for water protection

DOEpatents

Hill, David E [Knoxville, TN; Rodriquez, Jr., Miguel [Oak Ridge, TN; Greenbaum, Elias [Knoxville, TN

2009-09-22

An automatic, self-contained device for detecting toxic agents in a water supply includes an analyzer for detecting at least one toxic agent in a water sample, introducing a means for introducing a water sample into the analyzer and discharging the water sample from the analyzer, holding means for holding a water sample for a pre-selected period of time before the water sample is introduced into the analyzer, and an electronics package that analyzes raw data from the analyzer and emits a signal indicating the presence of at least one toxic agent in the water sample.

Recommended Mass Spectrometry-Based Strategies to Identify Ricin-Containing Samples.

PubMed

Kalb, Suzanne R; Schieltz, David M; Becher, François; Astot, Crister; Fredriksson, Sten-Åke; Barr, John R

2015-11-25

Ricin is a protein toxin produced by the castor bean plant (Ricinus communis) together with a related protein known as R. communis agglutinin (RCA120). Mass spectrometric (MS) assays have the capacity to unambiguously identify ricin and to detect ricin's activity in samples with complex matrices. These qualitative and quantitative assays enable detection and differentiation of ricin from the less toxic RCA120 through determination of the amino acid sequence of the protein in question, and active ricin can be monitored by MS as the release of adenine from the depurination of a nucleic acid substrate. In this work, we describe the application of MS-based methods to detect, differentiate and quantify ricin and RCA120 in nine blinded samples supplied as part of the EQuATox proficiency test. Overall, MS-based assays successfully identified all samples containing ricin or RCA120 with the exception of the sample spiked with the lowest concentration (0.414 ng/mL). In fact, mass spectrometry was the most successful method for differentiation of ricin and RCA120 based on amino acid determination. Mass spectrometric methods were also successful at ranking the functional activities of the samples, successfully yielding semi-quantitative results. These results indicate that MS-based assays are excellent techniques to detect, differentiate, and quantify ricin and RCA120 in complex matrices.

Oil residue contamination of continental shelf sediments of the Gulf of Mexico.

PubMed

Harding, V; Camp, J; Morgan, L J; Gryko, J

2016-12-15

We have investigated the distribution of a heavy oil residue in the coastal sediments of the Gulf of Mexico. The amount of the contamination was determined by high-temperature pyrolysis coupled with the Gas Chromatography-Mass Spectrometry (GCMS) of air-dried sediments. The pyrolysis products contain straight-chain saturated and unsaturated hydrocarbons, such as dodecane and 1-dodecene, resulting in a very characteristic pattern of double peaks in the GCMS. Hydrocarbons containing 8 to 23 carbon atoms were detected in the pyrolysis products. Using thermal pyrolysis we have found that the sediment samples collected along Texas, Louisiana, and Mississippi shores contain no detectable traces of oil residue, but most of the samples collected along Alabama and Florida shores contain ~200ppm of heavy oil residue. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detection of special nuclear materials using prompt gamma-rays from fast and slow neutron-induced fission

NASA Astrophysics Data System (ADS)

Kane, Steven Ze

A complete system has been simulated using experimentally obtained input parameters for the detection of special nuclear materials (SNM). A variation of the associated particle imaging (API) technique, referred to as reverse associated particle imaging detection (RAPID), has been developed in the context of detecting 5-kg spherical samples of U-235 in cargo containers uniformly filled with wood (low-Z) or iron (high-Z) at densities ranging from 0.1 g/cm3 to 0.4 g/cm3, the maximal density for a uniformly fully loaded 40-ft standard cargo container. In addition, samples were located at the center of a given container to study worst-case scenarios. The RAPID technique allows for the interrogation of containers at neutron production rates between 1x108 neutrons/s and 4x108 neutrons/s, depending on cargo material and density. These rates are low enough to prevent transmutation of materials in cargo and radiation safety hazards are limited. The merit of performance for the system is the time to detect the threat material with 95% probability of detection and 10-4 false positive rate per interrogated voxel of cargo. The detection of 5-kg of U-235 was chosen because this quantity of material is near the lower limit of the amount of special nuclear material that might be used in a nuclear weapon. This is in contrast to the 25-kg suggested sensitivity proposed by the International Atomic Energy Agency (IAEA).

Organic compounds in the Murchison meteorite.

NASA Technical Reports Server (NTRS)

Ponnamperuma, C.

1972-01-01

Impressive supporting evidence for the concept of the chemical evolution of life has appeared in the discovery of biologically important compounds in extraterrestrial samples. The approaches pursued to detect extraterrestrial organic compounds include the study of interstellar space by radioastronomy, the evaluation of the Apollo lunar samples, and the analysis of meteorites, both ancient and recent. It has been found that the clouds of gas in the interstellar medium contain a wide variety of molecules, most of which are organic in nature. The carbonaceous chondrites contain polymeric organic matter. Amino acids have been detected in the Murchison meteorite.

Serologic Evidence of Lyssavirus Infection in Bats, Cambodia

PubMed Central

Molia, Sophie; Audry, Laurent; Hout, Sotheara; Ngin, Sopheak; Walston, Joe; Bourhy, Hervé

2004-01-01

In Cambodia, 1,303 bats of 16 species were tested for lyssavirus. No lyssavirus nucleocapsid was detected in 1,283 brains tested by immunofluorescence assay. Antibodies against lyssaviruses were detected by enzyme-linked immunosorbent assay in 144 (14.7%) of 981 serum samples. Thirty of 187 serum samples contained neutralizing antibodies against different lyssaviruses. PMID:15663870

Detection of Human Immunodeficiency Virus Type 1 (HIV-1) RNA in Pools of Sera Negative for Antibodies to HIV-1 and HIV-2

PubMed Central

Morandi, Pierre-Alain; Schockmel, Gérard A.; Yerly, Sabine; Burgisser, Philippe; Erb, Peter; Matter, Lukas; Sitavanc, Radan; Perrin, Luc

1998-01-01

A total of 234 pools were prepared from 10,692 consecutive serum samples negative for antibodies to human immunodeficiency virus type 1 (HIV-1) and HIV-2 collected at five virological laboratories (average pool size, 45 serum samples). Pools were screened for the presence of HIV-1 RNA by a modified commercial assay (Amplicor HIV-1 Monitor test) which included an additional polyethylene glycol (PEG) precipitation step prior to purification of viral RNA (PEG Amplicor assay). The sensitivity of this assay for HIV-1 RNA detection in individual serum samples within pools matches that of standard commercial assays for individual serum samples, i.e., 500 HIV-1 RNA copies per ml. Five pools were identified as positive, and each one contained one antibody-negative, HIV-1 RNA-positive serum sample, corresponding to an average of 1 infected sample per 2,138 serum samples. Retrospective analysis revealed that the five HIV-1 RNA-positive specimens originated from individuals who had symptomatic primary HIV-1 infection at the time of sample collection and who were also positive for p24 antigenemia. We next assessed the possibility of performing the prepurification step by high-speed centrifugation (50,000 × g for 80 min) of 1.5-ml pools containing 25 μl of 60 individual serum samples, of which only 1 contained HIV-1 RNA (centrifugation Amplicor assay). The sensitivity of this assay also matches the sensitivities of standard commercial assays for HIV-1 RNA detection in individual serum samples. The results demonstrate that both assays with pooled sera can be applied to the screening of large numbers of serum samples in a time- and cost-efficient manner. PMID:9620372

METAL RESISTIVITY MEASURING DEVICE

DOEpatents

Renken, J. Jr.; Myers, R.G.

1960-12-20

An eddy current device is offered for detecting discontinuities in metal samples. Alternate short and long duration pulses are inductively applied to a metal sample via the outer coil of a probe. The long pulses give a resultant signal from the metal sample responsive to probe-tosample spacing and discontinuities within the sample and the shont pulses give a resultant signal responsive only to probe -to-sample spacing. The inner coil of the probe detects the two resultant signals and transmits them to a separation network where the two signals are separated. The two separated signals are then transmitted to a compensation network where the detected signals due to the short pulses are used to compensate for variations due to probe-to-sample spacing contained in the detected signals from the long pulses. Thus, a resultant signal is obtained responsive to discontinuities within the sample and independent of probe-to- sample spacing.

Metal Resistivity Measuring Device

DOEpatents

Renken, Jr, C. J.; Myers, R. G.

1960-12-20

An eddy current device is designed for detecting discontinuities in metal samples. Alternate short and long duration pulses are inductively applied to a metal sample via the outer coil of a probe. The lorg pulses give a resultant signal from the metal sample responsive to probe-tosample spacing and discontinuities with the sample, and the short pulses give a resultant signal responsive only to probe-to-sample spacing. The inner coil of the probe detects the two resultant signals and transmits them to a separation network where the two signals are separated. The two separated signals are then transmitted to a compensation network where the detected signals due to the short pulses are used to compensate for variations due to probeto-sample spacing contained in the detected signals from the long pulses. Thus a resultant signal is obtained responsive to discontinuities within the sample and independent of probe-to- sample spacing.

Small system for tritium accelerator mass spectrometry

DOEpatents

Roberts, M.L.; Davis, J.C.

1993-02-23

Apparatus for ionizing and accelerating a sample containing isotopes of hydrogen and detecting the ratios of hydrogen isotopes contained in the sample is disclosed. An ion source generates a substantially linear ion beam including ions of tritium from the sample. A radio-frequency quadrupole accelerator is directly coupled to and axially aligned with the source at an angle of substantially zero degrees. The accelerator accelerates species of the sample having different mass to different energy levels along the same axis as the ion beam. A spectrometer is used to detect the concentration of tritium ions in the sample. In one form of the invention, an energy loss spectrometer is used which includes a foil to block the passage of hydrogen, deuterium and [sup 3]He ions, and a surface barrier or scintillation detector to detect the concentration of tritium ions. In another form of the invention, a combined momentum/energy loss spectrometer is used which includes a magnet to separate the ion beams, with Faraday cups to measure the hydrogen and deuterium and a surface barrier or scintillation detector for the tritium ions.

Small system for tritium accelerator mass spectrometry

DOEpatents

Roberts, Mark L.; Davis, Jay C.

1993-01-01

Apparatus for ionizing and accelerating a sample containing isotopes of hydrogen and detecting the ratios of hydrogen isotopes contained in the sample is disclosed. An ion source generates a substantially linear ion beam including ions of tritium from the sample. A radio-frequency quadrupole accelerator is directly coupled to and axially aligned with the source at an angle of substantially zero degrees. The accelerator accelerates species of the sample having different mass to different energy levels along the same axis as the ion beam. A spectrometer is used to detect the concentration of tritium ions in the sample. In one form of the invention, an energy loss spectrometer is used which includes a foil to block the passage of hydrogen, deuterium and .sup.3 He ions, and a surface barrier or scintillation detector to detect the concentration of tritium ions. In another form of the invention, a combined momentum/energy loss spectrometer is used which includes a magnet to separate the ion beams, with Faraday cups to measure the hydrogen and deuterium and a surface barrier or scintillation detector for the tritium ions.

Flow injection trace gas analysis method for on-site determination of organoarsenicals

DOEpatents

Aldstadt, III, Joseph H.

1997-01-01

A method for real-time determination of the concentration of Lewisite in the ambient atmosphere, the method includes separating and collecting a Lewisite sample from the atmosphere in a collection chamber, converting the collected Lewisite to an arsenite ion solution sample, pumping the arsenite ion containing sample to an electrochemical detector connected to the collection chamber, and electrochemically detecting the converted arsenite ions in the sample, whereby the concentration of arsenite ions detected is proportional to the concentration of Lewisite in the atmosphere.

A survey of chemical constituents in National Fish Hatchery fish feed

USGS Publications Warehouse

Maule, Alec G.; Gannam, Ann; Davis, Jay

2006-01-01

Recent studies have demonstrated that various fish feeds contain significant concentrations of contaminants, many of which can bioaccumulate and bioconcentrate in fish. It appears that numerous organochlorine (OC) contaminants are present in the fish oils and fish meals used in feed manufacture, and some researchers speculate that all fish feeds contain measurable levels of some contaminants. To determine the presence and concentration of contaminants in feeds used in National Fish Hatcheries managed by the U.S. Fish & Wildlife Service, we systematically collected samples of feed from 11 hatcheries that raise cold-water species, and analyzed them for a suite of chemical contaminants. All of the samples (collected from October 2001 to October 2003) contained measurable concentrations of at least one dioxin, furan, polychlorinated biphenyl (PCB) congener, or dichlorodiphenyltrichloroethane (DDT) metabolite. All samples which were assayed for all contaminants contained one or more of those classes of compounds and most contained more than one; dioxin was detected in 39 of the 55 samples for which it was assayed, 24 of 55 contained furans and 24 of 55 samples contained DDT or its metabolites. There with 10- to 150-fold differences in the range in concentrations of the additive totals for PCBs, dioxins, furans and DDT. Although PCBs were the most commonly detected contaminant in our study (all samples in which it was assayed), the concentrations (range: 0.07 to 10.46 ng g·1 wet weight) were low compared to those reported previously. In general, we also found lower levels of organochlorine contaminants than have been reported previously in fish feed. Perhaps most notable is the near absence of OC pesticides~xcept for DDT (and its metabolites) and just two samples containing benzene hexachloride (Lindane). While contaminant concentrations were generally low, the ecological impacts can not be determined without a measure of the bioaccumulation of these compounds in the fish and the fate of these compounds after the fish are released from the hatcheries.

Detection of Small Numbers of Campylobacter jejuni and Campylobacter coli Cells in Environmental Water, Sewage, and Food Samples by a Seminested PCR Assay

PubMed Central

Waage, Astrid S.; Vardund, Traute; Lund, Vidar; Kapperud, Georg

1999-01-01

A rapid and sensitive assay was developed for detection of small numbers of Campylobacter jejuni and Campylobacter coli cells in environmental water, sewage, and food samples. Water and sewage samples were filtered, and the filters were enriched overnight in a nonselective medium. The enrichment cultures were prepared for PCR by a rapid and simple procedure consisting of centrifugation, proteinase K treatment, and boiling. A seminested PCR based on specific amplification of the intergenic sequence between the two Campylobacter flagellin genes, flaA and flaB, was performed, and the PCR products were visualized by agarose gel electrophoresis. The assay allowed us to detect 3 to 15 CFU of C. jejuni per 100 ml in water samples containing a background flora consisting of up to 8,700 heterotrophic organisms per ml and 10,000 CFU of coliform bacteria per 100 ml. Dilution of the enriched cultures 1:10 with sterile broth prior to the PCR was sometimes necessary to obtain positive results. The assay was also conducted with food samples analyzed with or without overnight enrichment. As few as ≤3 CFU per g of food could be detected with samples subjected to overnight enrichment, while variable results were obtained for samples analyzed without prior enrichment. This rapid and sensitive nested PCR assay provides a useful tool for specific detection of C. jejuni or C. coli in drinking water, as well as environmental water, sewage, and food samples containing high levels of background organisms. PMID:10103261

An optical spot test for the detection of dopamine in human urine using stabilized in air lipid films.

PubMed

Nikolelis, Dimitrios P; Drivelos, Dimitrios A; Simantiraki, Maria G; Koinis, Spyros

2004-04-15

The present technique describes a simple, sensitive spot test for the rapid one-shot detection of dopamine in human urine using lipid films with incorporated resorcin[4]arene receptor that are synthesized by a chemical reaction with a methacrylate polymer on a glass fiber filter. The lipid films without the receptor provided fluorescence under a UV lamp. The use of the receptor in these films quenched this fluorescence, and the color became similar to that of the filters without the lipid films. A drop of dopamine or urine containing this stimulant provided a "switching on" of the fluorescence, which allows the rapid detection of this stimulant in human urine at 10(-8) M concentrations. The novelty of the present work is that it opens new routes in the field of biosensing, i.e., development of sensitive, rapid, and simple methods for detecting species based on the fluorescence of the lipid membranes on a polymer film, and provides a spot test technique for the rapid detection of dopamine. The effect of potent interferences including a wide range of compounds usually found in human urine (i.e., ascorbic aid, glucose, leucine, glycine, tartrate, citrate, bicarbonate, and caffeine) was examined using an aqueous buffered solution that contained the potent interference and dopamine at two lower concentration levels (i.e., 3 x 10(-8)-10(-8) M). The effect of proteins and lipids was also investigated at these two lower dopamine concentration levels in aqueous buffered solution. The results showed no interferences from all these constituents at concentrations usually found in human urine samples; for example, albumin up to 3.22 g/L concentration levels did not provide any interference (i.e., no fluorescence). A drop of urine containing this stimulant provided similar results, i.e., a "switching on" of the fluorescence that allows a technique for the rapid detection of this stimulant in human urine at 10(-8) M concentrations. The technique is not based on a calibration graph but is a semiquantitative method for the detection of dopamine in real samples of urine that can be complimentary to HPLC methods. The difference in color between the samples containing dopamine at concentration levels of 10(-8)-10(-7) M can be easily distinguished by naked eye and a digital camera. An increase of dopamine concentration from 10(-8) to 10(-7) M makes the color more blue whereas the color of the filters remains purple in the blank test (i.e., addition of a urine sample without dopamine or dopamine at concentration levels of 10(-9) M to the filters that contain the lipid membranes with incorporated receptor). The reproducibility of the method was checked in approximately 100 samples, and all of them were found to provide similar results. Note that it was also found that the colors remain stable in the samples containing dopamine for periods of more than two months.

Efficient method of image edge detection based on FSVM

NASA Astrophysics Data System (ADS)

Cai, Aiping; Xiong, Xiaomei

2013-07-01

For efficient object cover edge detection in digital images, this paper studied traditional methods and algorithm based on SVM. It analyzed Canny edge detection algorithm existed some pseudo-edge and poor anti-noise capability. In order to provide a reliable edge extraction method, propose a new detection algorithm based on FSVM. Which contains several steps: first, trains classify sample and gives the different membership function to different samples. Then, a new training sample is formed by increase the punishment some wrong sub-sample, and use the new FSVM classification model for train and test them. Finally the edges are extracted of the object image by using the model. Experimental result shows that good edge detection image will be obtained and adding noise experiments results show that this method has good anti-noise.

Experience in the use of hyperspectral data for the detection of vegetation containing narcotic substances

NASA Astrophysics Data System (ADS)

Sedelnikov, V. P.; Lukashevich, E. L.; Karpukhina, O. A.

2014-12-01

This paper provides the characteristics of an experimental sample of a hyperspectral videospectrometer Sokol-SCP and presents examples of the hyperspectral data received as a result of flight tests. The results of the detection of vegetation containing narcotic substances by spectral attributes using the obtained hyperspectral information are considered. The opportunity for using the hyperspectral data for detection of cannabis and papaver sites, including those in mixed crops with masking vegetation, is confirmed.

A Neutron Based Interrogation System For SNM In Cargo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kane, Steven Z.; Koltick, David S.

A complete system has been simulated using experimentally obtained input parameters for the detection of special nuclear materials (SNM). A variation of the associated particle imaging (API) technique, referred to as reverse associated particle imaging detection (RAPID), has been developed in the context of detecting 5-kg spherical samples of U-235 in cargo. The RAPID technique allows for the interrogation of containers at neutron production rates between {approx}1x10{sup 8} neutrons/s and {approx}3x10{sup 8} neutrons/s. The merit of performance for the system is the time to detect the threat material with 95% probability of detection and 10{sup -4} false positive rate permore » interrogated voxel of cargo. Detection times of 5 minutes were found for a maximally loaded cargo container uniformly filled with iron and as low as 1 second in containers loaded to 1/4 of full capacity with either iron or wood. The worse case system performance, 30 minutes interrogation time, occurs for a maximally loaded container containing wood at 0.4 g/cm{sup 3}.« less

The Microbial Detection Array Combined with Random Phi29-Amplification Used as a Diagnostic Tool for Virus Detection in Clinical Samples

PubMed Central

Erlandsson, Lena; Rosenstierne, Maiken W.; McLoughlin, Kevin; Jaing, Crystal; Fomsgaard, Anders

2011-01-01

A common technique used for sensitive and specific diagnostic virus detection in clinical samples is PCR that can identify one or several viruses in one assay. However, a diagnostic microarray containing probes for all human pathogens could replace hundreds of individual PCR-reactions and remove the need for a clear clinical hypothesis regarding a suspected pathogen. We have established such a diagnostic platform for random amplification and subsequent microarray identification of viral pathogens in clinical samples. We show that Phi29 polymerase-amplification of a diverse set of clinical samples generates enough viral material for successful identification by the Microbial Detection Array, demonstrating the potential of the microarray technique for broad-spectrum pathogen detection. We conclude that this method detects both DNA and RNA virus, present in the same sample, as well as differentiates between different virus subtypes. We propose this assay for diagnostic analysis of viruses in clinical samples. PMID:21853040

40 CFR Appendix B to Part 136 - Definition and Procedure for the Determination of the Method Detection Limit-Revision 1.11

Code of Federal Regulations, 2013 CFR

2013-07-01

... that the analyte concentration is greater than zero and is determined from analysis of a sample in a given matrix containing the analyte. Scope and Application This procedure is designed for applicability to a wide variety of sample types ranging from reagent (blank) water containing analyte to wastewater...

40 CFR Appendix B to Part 136 - Definition and Procedure for the Determination of the Method Detection Limit-Revision 1.11

Code of Federal Regulations, 2014 CFR

2014-07-01

... that the analyte concentration is greater than zero and is determined from analysis of a sample in a given matrix containing the analyte. Scope and Application This procedure is designed for applicability to a wide variety of sample types ranging from reagent (blank) water containing analyte to wastewater...

40 CFR Appendix B to Part 136 - Definition and Procedure for the Determination of the Method Detection Limit-Revision 1.11

Code of Federal Regulations, 2011 CFR

2011-07-01

... that the analyte concentration is greater than zero and is determined from analysis of a sample in a given matrix containing the analyte. Scope and Application This procedure is designed for applicability to a wide variety of sample types ranging from reagent (blank) water containing analyte to wastewater...

Evaluation of organic compounds and trace elements in Amazon Creek Basin, Oregon, September 1990

USGS Publications Warehouse

Rinella, F.A.

1993-01-01

Water and bottom sediment were collected from Amazon Creek, Oregon during a summer low-flow condition and analyzed for different classes of organic compounds, including many from the U.S. Environmental Protection Agency's priority pollutant list. Bottom sediment also was analyzed for trace elements typically associated with urban runoff. Trace-element concentrations in the less than 63 micrometer fraction of Amazon Creek bottom-sediment samples were compared with baseline concentrations (expected 95 percent confidence range) for soils from the Western United States and with concen- trations found in bottom sediment from the Willamette River Basin. Total-digestion concentrations of antimony, arsenic, cadmium, chromium, cobalt, copper, lead, manganese, mercury, nickel, silver, titanium, and zinc were enriched at some or all sites sampled. Whole-water samples from some sites contained concentrations of several chlorophenoxy-acid herbicides, the organophosphorus insecticide diazinon, and several semivolatile priority pollutants. Classes of compounds not detected in whole-water samples included carbamate insecticides, triazine and other nitrogen-containing herbicides, and purgeable organic compounds. Bottom-sediment samples contained many organochlorine compounds, including chlordane, DDT plus metabolites, dieldrin, endrin, heptachlor epoxide (a metabolite of heptachlor), and PCBs at some or all sites sampled. Twenty-four of 54 semivolatile compounds were detected in bottom- sediment samples at some or all sites sampled.

Microfluidic paper-based analytical device for particulate metals.

PubMed

Mentele, Mallory M; Cunningham, Josephine; Koehler, Kirsten; Volckens, John; Henry, Charles S

2012-05-15

A microfluidic paper-based analytical device (μPAD) fabricated by wax printing was designed to assess occupational exposure to metal-containing aerosols. This method employs rapid digestion of particulate metals using microliters of acid added directly to a punch taken from an air sampling filter. Punches were then placed on a μPAD, and digested metals were transported to detection reservoirs upon addition of water. These reservoirs contained reagents for colorimetric detection of Fe, Cu, and Ni. Dried buffer components were used to set the optimal pH in each detection reservoir, while precomplexation agents were deposited in the channels between the sample and detection zones to minimize interferences from competing metals. Metal concentrations were quantified from color intensity images using a scanner in conjunction with image processing software. Reproducible, log-linear calibration curves were generated for each metal, with method detection limits ranging from 1.0 to 1.5 μg for each metal (i.e., total mass present on the μPAD). Finally, a standard incineration ash sample was aerosolized, collected on filters, and analyzed for the three metals of interest. Analysis of this collected aerosol sample using a μPAD showed good correlation with known amounts of the metals present in the sample. This technology can provide rapid assessment of particulate metal concentrations at or below current regulatory limits and at dramatically reduced cost.

Nitrosamines in cured meat products.

PubMed

Sen, N P; Iyengar, J R; Miles, W F; Panalaks, T

1976-01-01

One hundred samples of specially selected spiced meat products (sausages, salami, bologna, wieners, meat loaf, canned luncheon mean, etc) were analysed for nitrate, nitrite and volatile nitrosamines. None of the samples contained high levels of nitrosamines, but many contained traces, generally in the range from 2-50 mug/kg. Some contained as many as four nitrosamines, namely, NDMA, NDEA, NPip and NPy. In a few cases the samples were reanalysed after two weeks' storage at 4 or -20 degrees C, but no significant change in the nitrosamine levels could be detected. The identity of the nitrosamines was confirmed by GLC-high-resolution-MS.

Detection and genome characterization of bovine polyomaviruses in beef muscle and ground beef samples from Germany.

PubMed

Gräfe, Donina; Ehlers, Bernhard; Mäde, Dietrich; Ellerbroek, Lüppo; Seidler, Tassilo; Johne, Reimar

2017-01-16

Polyomaviruses are small, non-enveloped, circular double-stranded DNA viruses. Some polyomaviruses can induce tumors and cancer under certain circumstances. The bovine polyomaviruses (BPyV) 1-3 have been only scarcely analyzed so far. It was hypothesized that the consumption of beef meat containing polyomaviruses could contribute to the development of cancer in humans. In order to assess the distribution of the BPyV genome in meat from Germany, 101 beef muscle samples and 10 ground beef samples were analyzed here. A specific sample preparation method combined with or without rolling circle amplification (RCA), and BPyV-specific PCRs were developed and applied. BPyV-1 DNA was detected in 1/101 (1%) samples from beef meat and in 2/10 (20%) ground beef samples. BPyV-2 DNA was detected in 3/10 (30%) ground beef samples, whereas BPyV-3 was not detected in the samples. Application of RCA did not increase the detection rate in ground beef samples. Sequence analysis of the PCR products indicated the presence of BPyV-1, BPyV-2a and BPyV-2b. The whole genome of a BPyV-1 strain from ground beef meat showed 97.8% sequence identity to the BPyV-1 reference strain and that of a BPyV-2a strain from ground beef meet showed 99.9% sequence identity to strain 2aS11. It can be concluded that BPyV genomes can be frequently detected in ground beef samples, although higher sample numbers should be investigated in future to confirm this finding. Further studies should focus on the infectivity, tumorigenicity and heat resistance of the contained viruses in order to assess the risk of cancer induction through consumption of BPyVs present in beef products. Copyright © 2016 Elsevier B.V. All rights reserved.

Contamination of animal feedingstuffs with undeclared antimicrobial additives.

PubMed

Lynas, L; Currie, D; McCaughey, W J; McEvoy, J D; Kennedy, D G

1998-01-01

A study was carried out on 397 feedingstuffs and 11 premixes on which 161 (39.5%) were declared free of medication and 247 (60.5%) were medicated. These were subjected to analysis for the presence of antibiotics. Of the 247 medicated feeds 87 (35.2%) contained undeclared antimicrobials of which 59 (23.9%) were at a concentration sufficient to allow quantification by HPLC. Of the 161 unmedicated feeds 71 (44.1%) were shown to contain detectable antimicrobials of which 42 (26.1%) contained concentrations which could be quantified by HPLC. The most frequently identified contaminating antimicrobials were chlortetracycline (CTC) (15.2%), sulphonamides (6.9%), penicillin (3.4%) and ionophores (3.4%). Four samples (ionophores--3, sulphadimidine--1) contained therapeutic concentrations and one sample a supra-therapeutic concentration (monensin). The remainder were sub-therapeutic. All the contaminating concentrations of sulphadimidine detected were sufficient to cause violative tissue residues if fed to animals immediately prior to slaughter.

Circular birefringence/dichroism measurement of optical scattering samples using amplitude-modulation polarimetry

NASA Astrophysics Data System (ADS)

Liu, Wei-Chun; Lo, Yu-Lung; Phan, Quoc-Hung

2018-03-01

A method is proposed for extracting the circular birefringence (CB), circular dichroism (CD) and depolarization (Dep) properties of optical scattering samples using an amplitude-modulation polarimetry technique. The validity of the proposed method is demonstrated by extracting the CB property of pure glucose aqueous samples, the CB/Dep properties of glucose solutions containing 0.02% lipofundin particles, and the CD/Dep properties of chlorophyllin solutions containing suspended polystyrene microspheres. The results show that the proposed technique has the ability to detect pure glucose with a resolution of 66 mg/dL over a concentration range of 0-500 mg/dL. Moreover, the glucose concentration of the CB/Dep samples can be detected over the same range with a resolution of 168 mg/dL. Finally, the chlorophyllin concentration of the CD/Dep sample can be detected over the range of 0-200 μg/dL with a resolution of 6.5 × 10-5. In general, the results show that the proposed technique provides a reliable and accurate means of measuring the CB/CD properties of optical samples with scattering effects, and thus has significant potential for biological sensing applications.

40 CFR Table 6 to Subpart IIIii of... - Examples of Techniques for Equipment Problem Identification, Leak Detection and Mercury Vapor

Code of Federal Regulations, 2011 CFR

2011-07-01

... inspections b. Portable mercury vapor analyzer—ultraviolet light absorption detector A sample of gas is drawn... detector A sample of gas is drawn through a detection cell containing a gold film detector. Elemental mercury amalgamates with the gold film, changing the resistance of the detector in proportion to the...

40 CFR Table 6 to Subpart IIIii of... - Examples of Techniques for Equipment Problem Identification, Leak Detection and Mercury Vapor

Code of Federal Regulations, 2012 CFR

2012-07-01

... inspections b. Portable mercury vapor analyzer—ultraviolet light absorption detector A sample of gas is drawn... detector A sample of gas is drawn through a detection cell containing a gold film detector. Elemental mercury amalgamates with the gold film, changing the resistance of the detector in proportion to the...

Conjugated polymer with carboxylate groups-Hg2 + system as a turn-on fluorescence probe for label-free detection of cysteine-containing compounds

NASA Astrophysics Data System (ADS)

Mi, Hongyu; Guan, Mingming; Liu, Jilin; Shan, Hongyan; Fei, Qiang; Huan, Yanfu; Feng, Guodong

2017-04-01

In this work, a turn on fluorescent sensor, based on Hg2 + coordination conjugated polymer, was developed to detect cysteine-containing compounds. The fluorescence of conjugated polymer (poly(2,5-bis (sodium 4-oxybutyrate) -1,4 - phenylethynylene-alt-1,4-phenyleneethynylene; PPE-OBS) would be quenched by Hg2 + because of the coordination-induced aggregation and electron transfers of PPE-OBS toward Hg2 +. When there were some cysteine-containing compounds in PPE-OBS-Hg2 + system, the fluorescence of PPE-OBS would be recovered. It indicated that the PPE-OBS-Hg2 + system could be used to detect cysteine-containing compounds. Under the optimized conditions, the experiment results showed that there were particularly linear range, high sensitivity and selectivity over other amino acids. The limit of detection (LOD) of cysteine (Cys), homocysteine (Hcy) and glutathione (GSH) were 0.725 μmol L- 1, 0.982 μmol L- 1 and 1.21 μmol L- 1 by using this sensor. In addition, Cys standard recovery in several green tea drink and honey samples was also demonstrated. The recovery of Cys was range from 96.3 to 105.0% and RSD was less than 3.25%. The satisfactory results demonstrated that the proposed method could be as a potential fluorescent method for determining cysteine-containing compounds in real samples.

Detecting trace pesticides in real time using single particle aerosol mass spectrometry.

PubMed

Barker, Zachary; Venkatchalam, Veena; Martin, Audrey N; Farquar, George R; Frank, Matthias

2010-02-28

Pesticides are toxic substances and may cause unintentional harm if improperly used. The ubiquitous nature of pesticides, with frequent use in agriculture and the household, and the potential for harm that pesticides pose to non-target organisms such as wildlife, humans, and pets, demonstrate the need for rapid and effective detection and identification of these compounds. In this study, single particle aerosol mass spectrometry (SPAMS) was used to rapidly detect compounds from four classes of pesticides commonly used in agricultural and household applications. These include permethrin (pyrethroid class), malathion and dichlorvos (organophosphate class), imidacloprid (chloronicotinyl class), and carbaryl (carbamate class). Analytical standards of each compound were diluted and aerosolized using a nebulizer to create particles for analysis in the SPAMS instrument. The resultant dual-polarity time-of-flight mass spectra were then analyzed to identify the characteristic peaks of the compound in each sample. In addition, samples of commercial products containing pesticides, a commercial insecticide spray, containing permethrin, and a canine flea collar, containing carbaryl, were analyzed in their original form using SPAMS without any significant sample preparation. The characteristic mass spectral peaks of the active pesticides in these samples were identified using the mass spectra obtained earlier from the pesticide analytical standards. By successfully identifying pesticides in analytical standards and in commercial products, it is demonstrated herein that the SPAMS system may be capable of pesticide detection in numerous environmental and agricultural situations. Copyright 2010 Elsevier B.V. All rights reserved.

Nonpoint-source pollutant discharges of the three major tributaries to Reelfoot Lake, west Tennessee, October 1987-September 1989

USGS Publications Warehouse

Lewis, Michael E.; Garrett, Jerry W.; Hoos, Anne B.

1992-01-01

An investigation of the concentration and loads of nitrogen, phosphorus, and suspended sediment in storm runoff to Reelfoot Lake, in western Tennessee, was conducted from October 1987 through September 1989. Concentrations of selected herbicides also were defined. Reelfoot Lake, with a sur$ace area of about 15,500 acres, is the largest natural lake in Tennessee and an important recreation and fisheries resource. Previous studies showed that the lake is hypereutrophic, a condition caused by high concentrations of nutrients in water and sediments discharged from the three principal tributaries (South Reelfoot Creek, North Reelfoot Creek, and Running Slough) to the lake. Pesticides, including herbicides, have been detected in the lake?s bottom sediments. Storm runoff contributed about 87percent of the total water discharge of the three main tributaries to Reelfoot Lake. South Reelfoot Creek contributed about 4.7 tons per acre per year of suspended sediment, while North Reelfoot Creek contributed about 1.9 tons per acre per year. Running Slough contributed only about 0.31 ton per acre per year of suspended sediment. Most of the suspended sediment was transported by storm runoff between October and March. About 80 percent of the annual streamflow of the three tributaries occurs during these months. The North Reelfoot Creek basin contributed 8.2 pounds per acre per year of total nitrogen and 2.4 pounds per acre per year of total phosphorus. South Reelfoot Creek basin contributed about 6.5 and 1.3 pounds per acre per year of total nitrogen and phosphorus, respectively, while Running Slough basin contributions were 3.4 and 0.86 pounds per acre per year, respectively. The differences in nutrient yields appear to result from more row-crop agriculture and the relatively steeply sloping agricultural land in the North Reelfoot Creek basin. Ninety-one percent of the total nitrogen load and 95 percent of the total phosphorus load in the three streams was transported by storm runof/ Significant diflerences in the mean concentrations of nutrients in runoff were defined between the active agricultural months (April through September) and the inactive months (October through March). Storm-runofS samples were analyzed for II selected triazine herbicides. Alachlor and atrazine were the most commonly detected herbicides. Thirty-two percent of the samples contained detectable levels of alachlor and 93 percent of the samples contained detectable levels of atrazine. Ninety percent of the samples collected during the active agricultural months contained detectable leveki of alachlor and all 29 samples contained detectable levels of atrazine. Sixteen samples exceeded lifetime health-advisory levels for atrazine in drinking water (3 micrograms per liter); two samples collected from the April IS, 1988, storm at North Reelfoot Creek and South Reelfoot Creek contained 42 and 57 micrograms per liter of atrazine, respectively. Concentrations of the other nine triazine herbicides were generally less than the level of detection (0.1 microgram per liter).

Environmental Survey of Drinking Water Sources in Kampala, Uganda, during a Typhoid Fever Outbreak.

PubMed

Murphy, J L; Kahler, A M; Nansubuga, I; Nanyunja, E M; Kaplan, B; Jothikumar, N; Routh, J; Gómez, G A; Mintz, E D; Hill, V R

2017-12-01

In 2015, a typhoid fever outbreak began in downtown Kampala, Uganda, and spread into adjacent districts. In response, an environmental survey of drinking water source types was conducted in areas of the city with high case numbers. A total of 122 samples was collected from 12 source types and tested for Escherichia coli , free chlorine, and conductivity. An additional 37 grab samples from seven source types and 16 paired large volume (20 liter) samples from wells and springs were also collected and tested for the presence of Salmonella enterica serovar Typhi. Escherichia coli was detected in 60% of kaveras (drinking water sold in plastic bags) and 80% of refilled water bottles; free chlorine was not detected in either source type. Most jerry cans (68%) contained E. coli and had free chlorine residuals below the WHO-recommended level of 0.5 mg/liter during outbreaks. Elevated conductivity readings for kaveras, refilled water bottles, and jerry cans (compared to treated surface water supplied by the water utility) suggested that they likely contained untreated groundwater. All unprotected springs and wells and more than 60% of protected springs contained E. coli Water samples collected from the water utility were found to have acceptable free chlorine levels and no detectable E. coli While S Typhi was not detected in water samples, Salmonella spp. were detected in samples from two unprotected springs, one protected spring, and one refilled water bottle. These data provided clear evidence that unregulated vended water and groundwater represented a risk for typhoid transmission. IMPORTANCE Despite the high incidence of typhoid fever globally, relatively few outbreak investigations incorporate drinking water testing. During waterborne disease outbreaks, measurement of physical-chemical parameters, such as free chlorine residual and electrical conductivity, and of microbiological parameters, such as the presence of E. coli or the implicated etiologic agent, in drinking water samples can identify contaminated sources. This investigation indicated that unregulated vended water and groundwater sources were contaminated and were therefore a risk to consumers during the 2015 typhoid fever outbreak in Kampala. Identification of contaminated drinking water sources and sources that do not contain adequate disinfectant levels can lead to rapid targeted interventions. Copyright © 2017 American Society for Microbiology.

Characterisation of a new, highly effective method for detecting nematode eggs (Ascaris spp., Toxocara spp., Trichuris spp.) in sewage sludge containing flocculants.

PubMed

Zdybel, Jolanta; Karamon, Jacek; Różycki, Mirosław; Bilska-Zając, Ewa; Kłapeć, Teresa; Cencek, Tomasz

2016-11-01

Because traditional methods used for sewage sludge parasitological examinations have low sensitivity, a new, highly effective method (own method - OM) was devised. The principle of this method is to eliminate the flocculent effect on the structure of sewage sludge by mechanically damaging floccules in the presence of surfactants and to increase the effectiveness of egg isolation processes in large volumes of liquids. The objective of this study was to estimate the effectiveness of the OM in detecting nematode eggs in sewage sludge samples containing flocculants. In the first stage, the effectiveness of the OM was compared to 4 other methods routinely used in parasitological examinations of dehydrated sewage sludge. Next, method standardisation was performed using sewage sludge samples supplemented with eggs from 3 parasite species (Ascaris suum, Toxocara canis and Trichuris vulpis). The study demonstrated that OM efficiency was 6-65 times greater than other methods, depending on the method and type of detected eggs. Limit of detection (LOD) calculations for the OM were performed on samples supplemented with a known number of parasite eggs resulting in 10, 5 and 3 eggs/50 g of sample for A. suum, T. vulpis and T. canis eggs, respectively. The limits of quantification (LOQ) of the OM were established as 200 eggs/50 g of sample for A. suum and T. vulpis eggs and 50 eggs/50 g of sample for T. canis eggs. The rectilinear regression functions, which determined the relationship between the number of eggs detected in OM measurements and the number of eggs contained in the samples, were characterised by high and statistically significant coefficients of determination (r 2 ). The slopes of the trend lines were 0.3188, 0.3821 and 0.3276, and the intercepts were -11.223, -9.0261 and -23.15 for A. suum, T. canis and T. vulpis eggs, respectively. Method sensitivity, calculated as the slope coefficient of the regression function and expressed as a percentage, ranged from 32% to 38% depending on egg type. The study confirmed that the OM may be applied to quantify parasite eggs in dehydrated sewage sludge containing polyelectrolytes. Copyright © 2016 Elsevier Inc. All rights reserved.

Occurrence of Fumigants and Hazardous Off-gassing Chemicals in Shipping Containers Arriving in Sweden

PubMed Central

Johanson, Gunnar

2017-01-01

Abstract Containerized cargo shipment makes up the backbone of international trade. The principal aim of this cross-sectional study was to establish a qualitative and quantitative description of gaseous fumigants and volatile off-gassing substances facing workers tasked with entering shipping containers. A total of 372 packed and 119 empty shipping containers were sampled in six ports and two distribution centers in Sweden. Fourier-transform infrared spectrometry (FTIR) and photoionization detection (PID) were the analytical methods applied to the bulk of samples. A small number of adsorbent samples were analyzed using gas chromatography–mass spectrometry (GC–MS). The results were compared to Swedish occupational exposure limits (OELs), the closest parallel to relevant work situations. Based on the FTIR analyses, 30 of 249 (12%) containers arrived with concentrations of fumigants and off-gassing substances above the 8-h OELs and close to 7% were above the short-term exposure limits. Eight detected chemicals were classified as carcinogens and 4% of the containers arrived with levels of carcinogens above the OELs, at a maximum 30 times the 8-h OEL. Considerable differences were observed between ports, ranging from 0 to 33% of containers arriving with concentrations above the OELs. It is believed that all observation results, apart from a single instance of a confirmed fumigant, phosphine, at 3 p.p.m., and possibly three instances of carbon dioxide, can be attributed to off-gassing substances. The FTIR methodology proved useful for quick preliminary checks and in-depth screening and identification. The PID method produced both false-negative and false-positive results where only 48% matched the FTIR observations. Adsorbent sampling with GC–MS analysis was useful for confirming volatile organic compounds but was deemed too slow for day-to-day screening. The high frequency of contaminated containers, the detection of several carcinogens, and the sporadic occurrences of high levels of fumigants are serious concerns that need to be properly recognized in order to protect the workers at risk. PMID:28395344

Pharmaceutical compounds in shallow groundwater in non-agricultural areas of Minnesota: study design, methods, and data, 2013

USGS Publications Warehouse

Elliott, Sarah M.; Erickson, Melinda L.

2014-01-01

The U.S. Geological Survey, in cooperation with the Minnesota Pollution Control Agency, completed a study on the occurrence of pharmaceutical compounds and other contaminants of emerging concern in shallow groundwater in non-agricultural areas of Minnesota during 2013. This report describes the study design and methods for the study on the occurrence of pharmaceuticals and other contaminants of emerging concern, and presents the data collected on pharmaceutical compounds. Samples were analyzed by the U.S. Geological Survey National Water Quality Laboratory for 110 pharmaceutical compounds using research method 9017. Samples from 21 of 45 wells had detectable concentrations of at least one of the 110 compounds analyzed. One sample contained detectable concentrations of nine compounds, which was the most detected in a single sample. Fewer than five compounds were detected in most samples. Among all samples, 27 of the 110 compounds were detected in groundwater from at least one well. Desmethyldiltiazem and nicotine were the most frequently detected compounds, each detected in 5 of 46 environmental samples (one well was sampled twice so a total of 46 environmental samples were collected from 45 wells). Caffeine had the highest detectable concentration of all the compounds at 2,060 nanograms per liter.

Subclinical Reactivation and Shed of Infectious Varicella Zoster Virus in Saliva of Astronauts

NASA Technical Reports Server (NTRS)

Cohrs, Randall J.; Mehta, Satish K.; Schmid, D. Scott; Gilden, Donald H.; Pierson, Duane L.

2007-01-01

We have previously detected VZV in healthy astronauts both during spaceflight and shortly after landing. Herein, we show that VZV shed in seropositive astronauts is infectious. A total of 40 saliva samples were obtained from each of the 3 astronauts. From each astronaut, 14 samples were taken 109 to 133 days before liftoff, 1 sample was taken every day during 12 days in space, and one sample was taken for 14 consecutive days beginning the second day after landing. Quantitative PCR was used to detect VZV DNA in saliva. None of 42 preflight saliva samples contained VZV DNA. VZV DNA was detected in saliva from 2 of 3 astronauts. In 1 astronaut, 6 of 12 samples obtained during space flight contained 120 to 2,500 copies of VZV DNA per ml; after landing, 1250 copies of VZV DNA were present on day 2, 45 copies on day 3, and 110 copies on day 5. All samples taken 6 to 15 days after touchdown were negative for VZV DNA. In the second astronaut, 5 of 12 samples obtained during space flight contained 18 to 650 copies of VZV DNA per ml; after landing, 560 copies of VZV DNA were present in saliva on day 2, 340 copies on day 4, 45 copies on day 5, and 23 copes on day 6. All samples taken 7 to 15 days after touchdown were negative for VZV DNA. Saliva taken 2 to 6 days after landing from all 3 astronauts was cultured on human fetal lung cells. After one subcultivation, a cytopathic effect developed in cultures inoculated with saliva from the two astronauts whose saliva contained VZV DNA. Both PCR and immunostaining identified the isolates to be VZV and not HSV-1. Importantly, the astronaut in whom no VZV was detected had a history of zoster 9 years earlier. It is possible that a boost in cell-mediated immunity to VZV which is known to develop after zoster protected him from subclinical reactivation. The genotype of the two VZV isolates was determined by VZV ORF22-based PCR/sequencing along with FRET-based PCR assays that target specific nucleotide polymorphisms. Both VZV isolates were found to be the European genotype which also contained a rare MspI restriction enodnuclease site in VZV ORF62 at position 107,252. These findings extend our previous demonstration of VZV DNA in saliva of astronauts by showing that infectious VZV is also present. Thus, like HSV-1 and HSV-2, VZV can reactivate and shed infectious virus in the absence of clinical disease.

Recommended Mass Spectrometry-Based Strategies to Identify Ricin-Containing Samples

PubMed Central

Kalb, Suzanne R.; Schieltz, David M.; Becher, François; Astot, Crister; Fredriksson, Sten-Åke; Barr, John R.

2015-01-01

Ricin is a protein toxin produced by the castor bean plant (Ricinus communis) together with a related protein known as R. communis agglutinin (RCA120). Mass spectrometric (MS) assays have the capacity to unambiguously identify ricin and to detect ricin’s activity in samples with complex matrices. These qualitative and quantitative assays enable detection and differentiation of ricin from the less toxic RCA120 through determination of the amino acid sequence of the protein in question, and active ricin can be monitored by MS as the release of adenine from the depurination of a nucleic acid substrate. In this work, we describe the application of MS-based methods to detect, differentiate and quantify ricin and RCA120 in nine blinded samples supplied as part of the EQuATox proficiency test. Overall, MS-based assays successfully identified all samples containing ricin or RCA120 with the exception of the sample spiked with the lowest concentration (0.414 ng/mL). In fact, mass spectrometry was the most successful method for differentiation of ricin and RCA120 based on amino acid determination. Mass spectrometric methods were also successful at ranking the functional activities of the samples, successfully yielding semi-quantitative results. These results indicate that MS-based assays are excellent techniques to detect, differentiate, and quantify ricin and RCA120 in complex matrices. PMID:26610568

Reagent Selection Methodology for a Novel Explosives Detection Platform

ScienceCinema

Warner, Marvin

2018-02-14

This video describes research being conducted by Dr. Marvin Warner, a research scientist at Pacific Northwest National Laboratory, in the individual pieces of antibodies used to set up a chemical reaction that will give off light just by mixing reagents together with a sample that contains an explosive molecule. This technology would help detect if explosives are present with just the use of a handheld system or container.

Performance of the Fecal Immunochemical Test for Colorectal Cancer Screening Using Different Stool-Collection Devices: Preliminary Results from a Randomized Controlled Trial.

PubMed

Shin, Hye Young; Suh, Mina; Baik, Hyung Won; Choi, Kui Son; Park, Boyoung; Jun, Jae Kwan; Hwang, Sang-Hyun; Kim, Byung Chang; Lee, Chan Wha; Oh, Jae Hwan; Lee, You Kyoung; Han, Dong Soo; Lee, Do-Hoon

2016-11-15

We are in the process of conducting a randomized trial to determine whether compliance with the fecal immunochemical test (FIT) for colorectal cancer screening differs according to the stool-collection method. This study was an interim analysis of the performance of two stool-collection devices (sampling bottle vs conventional container). In total, 1,701 individuals (age range, 50 to 74 years) were randomized into the sampling bottle group (intervention arm) or the conventional container group (control arm). In both groups, we evaluated the FIT positivity rate, the positive predictive value for advanced neoplasia, and the detection rate for advanced neoplasia. The FIT positivity rates were 4.1% for the sampling bottles and 2.0% for the conventional containers; these values were significantly different. The positive predictive values for advanced neoplasia in the sampling bottles and conventional containers were 11.1% (95% confidence interval [CI], -3.4 to 25.6) and 12.0% (95% CI, -0.7 to 24.7), respectively. The detection rates for advanced neoplasia in the sampling bottles and conventional containers were 4.5 per 1,000 persons (95% CI, 2.0 to 11.0) and 2.4 per 1,000 persons (95% CI, 0.0 to 5.0), respectively. The impact of these findings on FIT screening performance was unclear in this interim analysis. This impact should therefore be evaluated in the final analysis following the final enrollment period.

Rapid Waterborne Pathogen Detection with Mobile Electronics.

PubMed

Wu, Tsung-Feng; Chen, Yu-Chen; Wang, Wei-Chung; Kucknoor, Ashwini S; Lin, Che-Jen; Lo, Yu-Hwa; Yao, Chun-Wei; Lian, Ian

2017-06-09

Pathogen detection in water samples, without complex and time consuming procedures such as fluorescent-labeling or culture-based incubation, is essential to public safety. We propose an immunoagglutination-based protocol together with the microfluidic device to quantify pathogen levels directly from water samples. Utilizing ubiquitous complementary metal-oxide-semiconductor (CMOS) imagers from mobile electronics, a low-cost and one-step reaction detection protocol is developed to enable field detection for waterborne pathogens. 10 mL of pathogen-containing water samples was processed using the developed protocol including filtration enrichment, immune-reaction detection and imaging processing. The limit of detection of 10 E. coli O157:H7 cells/10 mL has been demonstrated within 10 min of turnaround time. The protocol can readily be integrated into a mobile electronics such as smartphones for rapid and reproducible field detection of waterborne pathogens.

Complete validation of a unique digestion assay to detect Trichinella larvae in horse meat demonstrates the reliability of this assay for meeting food safety and trade requirements.

PubMed

Forbes, L B; Hill, D E; Parker, S; Tessaro, S V; Gamble, H R; Gajadhar, A A

2008-03-01

A tissue digestion assay using a double separatory funnel procedure for the detection of Trichinella larvae in horse meat was validated for application in food safety programs and trade. The assay consisted of a pepsin-HCl digestion step to release larvae from muscle tissue and two sequential sedimentation steps in separatory funnels to recover and concentrate larvae for detection with a stereomicroscope. With defined critical control points, the assay was conducted within a quality assurance system compliant with International Organization for Standardization-International Electrotechnical Commission (ISO/IEC) 17025 guidelines. Samples used in the validation were obtained from horses experimentally infected with Trichinella spiralis to obtain a range of muscle larvae densities. One-, 5-, and 10-g samples of infected tissue were combined with 99, 95, and 90 g, respectively, of known negative horse tissue to create a 100-g sample for testing. Samples of 5 and 10 g were more likely to be positive than were 1-g samples when larval densities were less than three larvae per gram (lpg). This difference is important because ingested meat with 1 lpg is considered the threshold for clinical disease in humans. Using a 5-g sample size, all samples containing 1.3 to 2 lpg were detected, and 60 to 100% of samples with infected horse meat containing 0.1 to 0.7 lpg were detected. In this study, the double separatory funnel digestion assay was efficient and reliable for its intended use in food safety and trade. This procedure is the only digestion assay for Trichinella in horse meat that has been validated as consistent and effective at critical levels of sensitivity.

Detection and differentiation of coxiella burnetii in biological fluids

DOEpatents

Frazier, Marvin E.; Mallavia, Louis P.; Samuel, James E.; Baca, Oswald G.

1990-01-01

Methods for detecting the presence of Coxiella burenetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA (specifically rickettsial DNA) with a C. burnetii-specific labeled DNA probe. Radioisotope and biotin labels are preferred, allowing detection through autoradiography and colorimetric assays, respectively.

Detection and differentiation of coxiella burnetii in biological fluids

DOEpatents

Frazier, Marvin E.; Mallavia, Louis P.; Baca, Oswald G.; Samuel, James E.

1989-01-01

Methods for detecting the presence of Coxiella burnetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA (specifically rickettsial DNA) with a C. burnetii-specific labeled DNA probe. Radioisotope and biotin labels are preferred, allowing detection through autoradiography and colorimetric assays, respectively.

Flow injection trace gas analysis method for on-site determination of organoarsenicals

DOEpatents

Aldstadt, J.H. III

1997-06-24

A method is described for real-time determination of the concentration of Lewisite in the ambient atmosphere, the method includes separating and collecting a Lewisite sample from the atmosphere in a collection chamber, converting the collected Lewisite to an arsenite ion solution sample, pumping the arsenite ion containing sample to an electrochemical detector connected to the collection chamber, and electrochemically detecting the converted arsenite ions in the sample, whereby the concentration of arsenite ions detected is proportional to the concentration of Lewisite in the atmosphere. 2 figs.

Rapid and accurate detection of KRAS mutations in colorectal cancers using the isothermal-based optical sensor for companion diagnostics

PubMed Central

Koo, Bonhan; Lee, Tae Yoon; Lee, Jeong Hoon; Shin, Yong; Lim, Seok-Byung

2017-01-01

Although KRAS mutational status testing is becoming a companion diagnostic tool for managing patients with colorectal cancer (CRC), there are still several difficulties when analyzing KRAS mutations using the existing assays, particularly with regard to low sensitivity, its time-consuming, and the need for large instruments. We developed a rapid, sensitive, and specific mutation detection assay based on the bio-photonic sensor termed ISAD (isothermal solid-phase amplification/detection), and used it to analyze KRAS gene mutations in human clinical samples. To validate the ISAD-KRAS assay for use in clinical diagnostics, we examined for hotspot KRAS mutations (codon 12 and codon 13) in 70 CRC specimens using PCR and direct sequencing methods. In a serial dilution study, ISAD-KRAS could detect mutations in a sample containing only 1% of the mutant allele in a mixture of wild-type DNA, whereas both PCR and direct sequencing methods could detect mutations in a sample containing approximately 30% of mutant cells. The results of the ISAD-KRAS assay from 70 clinical samples matched those from PCR and direct sequencing, except in 5 cases, wherein ISAD-KRAS could detect mutations that were not detected by PCR and direct sequencing. We also found that the sensitivity and specificity of ISAD-KRAS were 100% within 30 min. The ISAD-KRAS assay provides a rapid, highly sensitive, and label-free method for KRAS mutation testing, and can serve as a robust and near patient testing approach for the rapid detection of patients most likely to respond to anti-EGFR drugs. PMID:29137388

[Radioactive cesium analysis in radiation-tainted beef by gamma-ray spectrometry with germanium semiconductor detector].

PubMed

Minatani, Tomiaki; Nagai, Hiroyuki; Nakamura, Masashi; Otsuka, Kimihito; Sakai, Yoshimichi

2012-01-01

The detection limit and precision of radioactive cesium measurement in beef by gamma-ray spectrometry with a germanium semiconductor detector were evaluated. Measurement for 2,000 seconds using a U-8 container (100 mL) provided a detection limit of radioactive cesium (the sum of 134Cs and 137Cs) of around 20 Bq/kg. The 99% confidence interval of the measurement of provisional maximum residue limit level (491 Bq/kg) samples ranged from 447 to 535 Bq/kg. Beef is heterogeneous, containing muscle and complex fat layers. Depending on the sampled parts, the measurement value is variable. It was found that radioactive cesium content of the muscle layer was clearly different from that of fat, and slight differences were observed among parts of the sample (SD=16.9 Bq/kg), even though the same region (neck block) of beef sample was analyzed.

Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures

PubMed Central

McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.

2017-01-01

Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae-negative STEC and eae-positive E. coli, but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets (stx and eae) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli. By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae-negative STEC and eae-positive E. coli (0–2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and accuracy of current methods for EHEC detection in foods. PMID:28303131

Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

PubMed

McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

2017-01-01

Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and accuracy of current methods for EHEC detection in foods.

Prevalence of pathogenic bacteria in Ixodes ricinus ticks in Central Bohemia.

PubMed

Klubal, Radek; Kopecky, Jan; Nesvorna, Marta; Sparagano, Olivier A E; Thomayerova, Jana; Hubert, Jan

2016-01-01

Bacteria associated with the tick Ixodes ricinus were assessed in specimens unattached or attached to the skin of cats, dogs and humans, collected in the Czech Republic. The bacteria were detected by PCR in 97 of 142 pooled samples including 204 ticks, i.e. 1-7 ticks per sample, collected at the same time from one host. A fragment of the bacterial 16S rRNA gene was amplified, cloned and sequenced from 32 randomly selected samples. The most frequent sequences were those related to Candidatus Midichloria midichlori (71% of cloned sequences), followed by Diplorickettsia (13%), Spiroplasma (3%), Rickettsia (3%), Pasteurella (3%), Morganella (3%), Pseudomonas (2%), Bacillus (1%), Methylobacterium (1%) and Phyllobacterium (1%). The phylogenetic analysis of Spiroplasma 16S rRNA gene sequences showed two groups related to Spiroplasma eriocheiris and Spiroplasma melliferum, respectively. Using group-specific primers, the following potentially pathogenic bacteria were detected: Borellia (in 20% of the 142 samples), Rickettsia (12%), Spiroplasma (5%), Diplorickettsia (5%) and Anaplasma (2%). In total, 68% of I. ricinus samples (97/142) contained detectable bacteria and 13% contained two or more putative pathogenic groups. The prevalence of tick-borne bacteria was similar to the observations in other European countries.

Method and apparatus for detecting gem-polyhalogenated hydrocarbons

DOEpatents

Anderson, deceased, William G.; Anderson, legal representative, Johanna S.

1990-01-01

A method and optrode for detecting gem polyhalogenated hydrocarbons in a sample fluid based on a single phase Fujiwara reaction as provided. The method comprises contacting a reaction mixture with a sample fluid which contains the gem-polyhalogenated hydrocarbons. The reaction mixture comprises an aqueous solution of pyridine or derivative thereof and a hindered nitrogen base. Upon contact a fluorescent and/or chromgenic reaction product forms whose fluorescence and/or absorbance is related to the concentration of gem-polyhalogenated hydrocarbons in the sample fluid.

Survey of bottled drinking water sold in Canada. Part 2. Selected volatile organic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Page, B.D.; Conacher, H.B.S.; Salminen, J.

Selected volatile organic compound (VOC) contaminants were determined in 182 samples of retail bottled waters purchased in Canada. Samples included spring water (86) packaged in containers of polyethylene or in smaller containers of transparent plastic or glass, mineral water (61) packaged only in transparent plastic or glass, and miscellaneous bottled waters (35). Analyses were performed by 3 laboratories, each using headspace sampling and capillary gas chromatography with either mass spectrometric (1 laboratory) or flame ionization detection with mass spectrometric confirmation, if required (2 laboratories). Benzene, the contaminant of primary interest, was detected in only 1 of the 182 samples atmore » 2 {mu}g/kg. Other VOC contaminants detected (number of positive samples, average, and range of positives in {mu}g/kg) included toluene (20, 6.92, 0.5-63), cyclohexane (23, 39.2, 3-108), chloroform (12, 25.8, 3.7-70), and dichloromethane (4, 59, 22-97). Cyclohexane was found in the plastic and as a migrant from the plastic in 20 samples of spring water, but it was found in only 1 of 61 mineral water samples analyzed at only 3 {mu}g/kg/. Chloroform was found almost exclusively in samples that could have been obtained from public water supplies. It was not found in mineral water samples, but it was found in 1 spring water sample at 3.7 {mu}g/kg. The source of the toluene contamination was not known. Other VOCs detected include ethanol and limonene, associated with added flavoring; pentane, as a migrant from a foamed polystyrene cap liner; and 1,1,2,2-tetra-chloroethylene in a sample of demineralized water. 10 refs., 6 tabs.« less

Characterization of organic matter in cloud waters sampled at the puy de Dôme mountain using FT-ICR-MS

NASA Astrophysics Data System (ADS)

Bianco, A.; Chaumerliac, N.; Vaitilingom, M.; Deguillaume, L.; Bridoux, M. C.

2017-12-01

The chemical composition of organic matter in cloud water is highly complex. The organic species result from their dissolution from the gas phase or from the soluble fraction of the particle phase. They are also produced by aqueous phase reactivity. Several low molecular weight organic species have been quantified such as aldehydes and carboxylic acids. Recently, amino acids were also detected in cloud water and their presence is related to the presence of microorganisms. Compounds presenting similarities with high molecular weight organic substances or HULIS found in aerosols were also observed in clouds. Overall, these studies mainly focused on individual compounds or functional groups rather than the complex mixture at the molecular level. This study presents a non-targeted approach to characterize the organic matter in clouds. Samples were collected at the puy de Dôme Mountain (France). Two cloud water samples (June & July 2016) were analyzed using high resolution mass spectrometry (ESI-FT-ICR-MS 9.4T). A reversed solid phase extraction (SPE) procedure was performed to concentrate dissolved organic matter components. Composer (v.1.5.3) software was used to filter the mass spectral data, recalibrate externally the dataset and calculate all possible formulas for detected anions. The first cloud sample (June) resulted from air mass coming from the North (North Sea) while the second one (July) resulted from air mass coming from the West (Atlantic Ocean). Thus, both cloud events derived from marine air masses but were characterized by different hydrogen peroxide concentration and dissolved organic carbon content and were sampled at different periods during the day. Elemental compositions of 6487 and 3284 unique molecular species were identified in each sample. Nitrogen-containing compounds (CHNO compounds), sulfur-containing compounds (CHOS & CHNOS compounds) and other oxygen-containing compounds (CHO compounds) with molecular weights up to 800 Da were detected. The main class is CHNO (53% for both samples) while sulfur-containing compounds represent for the two samples respectively 21 & 14% of the total assigned molecular formulas. CHO compounds molecular formulas are respectively 25 & 32%. Among the two samples, only 2490 molecular formulas were found common to the two samples.

Method performance and multi-laboratory assessment of a normal phase high pressure liquid chromatography-fluorescence detection method for the quantitation of flavanols and procyanidins in cocoa and chocolate containing samples.

PubMed

Robbins, Rebecca J; Leonczak, Jadwiga; Johnson, J Christopher; Li, Julia; Kwik-Uribe, Catherine; Prior, Ronald L; Gu, Liwei

2009-06-12

The quantitative parameters and method performance for a normal-phase HPLC separation of flavanols and procyanidins in chocolate and cocoa-containing food products were optimized and assessed. Single laboratory method performance was examined over three months using three separate secondary standards. RSD(r) ranged from 1.9%, 4.5% to 9.0% for cocoa powder, liquor and chocolate samples containing 74.39, 15.47 and 1.87 mg/g flavanols and procyanidins, respectively. Accuracy was determined by comparison to the NIST Standard Reference Material 2384. Inter-lab assessment indicated that variability was quite low for seven different cocoa-containing samples, with a RSD(R) of less than 10% for the range of samples analyzed.

Short communication: Macrocyclic lactone residues in butter from Brazilian markets.

PubMed

Macedo, Fabio; Marsico, Eliane Teixeira; Conte-Júnior, Carlos Adam; de Almeida Furtado, Leonardo; Brasil, Taila Figueredo; Pereira Netto, Annibal Duarte

2015-06-01

Macrocyclic lactones (ML) are commonly used in drug formulations for the treatment of parasites in cattle. In Brazil, except for drugs (or formulations) with long-term (half-life) effects, ML are registered for use in bovines. Indiscriminate use of ML may result in the presence of residues in milk and dairy products due to their lipophilic properties and thermal stability. This study applied a method of liquid chromatography with fluorimetric detection, recently developed and validated for the determination of residues of abamectin, doramectin, ivermectin, and moxidectin in butter. The method was applied to 38 samples of commercial butter purchased in the metropolitan area of Rio de Janeiro, Brazil, between June and September 2013, analyzed in triplicate. Ivermectin was detected in 89.5% of the samples, with concentrations between 0.3 and 119.4 µg/kg; 76.3% of the samples contained doramectin (0.6 to 64.7 µg/kg) and 55.2% contained abamectin (0.7 to 4.5 µg/kg). Most butter samples (76.3%) contained residues of more than 1 ML; however, no residues of moxidectin were detected. The results showed a high incidence of the presence of avermectins in butter samples. Butter is not included in the Brazilian National Plan for Control of Residues and Contaminants in Animal Products. As ML residues concentrate in lipophilic compounds, butter and other fatty dairy products should be screened for the presence of ML residues. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Enhancement in sample collection for the detection of MDMA using a novel planar SPME (PSPME) device coupled to ion mobility spectrometry (IMS).

PubMed

Gura, Sigalit; Guerra-Diaz, Patricia; Lai, Hanh; Almirall, José R

2009-07-01

Trace detection of illicit drugs challenges the scientific community to develop improved sensitivity and selectivity in sampling and detection techniques. Ion mobility spectrometry (IMS) is one of the prominent trace detectors for illicit drugs and explosives, mostly due to its portability, high sensitivity and fast analysis. Current sampling methods for IMS rely on wiping suspected surfaces or withdrawing air through filters to collect particulates. These methods depend greatly on the particulates being bound onto surfaces or having sufficient vapour pressure to be airborne. Many of these compounds are not readily available in the headspace due to their low vapour pressure. This research presents a novel SPME device for enhanced air sampling and shows the use of optimized IMS by genetic algorithms to target volatile markers and/or odour signatures of illicit substances. The sampling method was based on unique static samplers, planar substrates coated with sol-gel polydimethyl siloxane (PDMS) nanoparticles, also known as planar solid-phase microextraction (PSPME). Due to its surface chemistry, high surface area and capacity, PSPME provides significant increases in sensitivity over conventional fibre SPME. The results show a 50-400 times increase in the detection capacity for piperonal, the odour signature of 3,4-methylenedioxymethamphetamine (MDMA). The PSPME-IMS technique was able to detect 600 ng of piperonal in a 30 s extraction from a quart-sized can containing 5 MDMA tablets, while detection using fibre SPME-IMS was not attainable. In a blind study of six cases suspected to contain varying amounts of MDMA in the tablets, PSPME-IMS successfully detected five positive cases and also produced no false positives or false negatives. One positive case had minimal amounts of MDMA resulting in a false negative response for fibre SPME-IMS.

National Water Quality Laboratory, 1995 services catalog

USGS Publications Warehouse

Timme, P.J.

1995-01-01

This Services Catalog contains information about field supplies and analytical services available from the National Water Quality Laboratory in Denver, Colo., and field supplies available from the Quality Water Service Unit in Ocala, Fla., to members of the U.S. Geological Survey. To assist personnel in the selection of analytical services, this catalog lists sample volume, required containers, applicable concentration range, detection level, precision of analysis, and preservation requirements for samples.

Study on Dicarboxylic Acids in Aerosol Samples with Capillary Electrophoresis

PubMed Central

Adler, Heidi; Sirén, Heli

2014-01-01

The research was performed to study the simultaneous detection of a homologous series of α, ω-dicarboxylic acids (C2–C10), oxalic, malonic, succinic, glutaric, adipic, pimelic, suberic, azelaic, and sebacic acids, with capillary electrophoresis using indirect UV detection. Good separation efficiency in 2,6-pyridinedicarboxylic acid as background electrolyte modified with myristyl trimethyl ammonium bromide was obtained. The dicarboxylic acids were ionised and separated within five minutes. For the study, authentic samples were collected onto dry cellulose membrane filters of a cascade impactor (12 stages) from outdoor spring aerosols in an urban area. Hot water and ultrasonication extraction methods were used to isolate the acids from membrane filters. Due to the low concentrations of acids in the aerosols, the extracts were concentrated with solid-phase extraction (SPE) before determination. The enrichment of the carboxylic acids was between 86 and 134% with sample pretreatment followed by 100-time increase by preparation of the sample to 50 μL. Inaccuracy was optimised for all the sample processing steps. The aerosols contained dicarboxylic acids C2–C10. Then, mostly they contained C2, C5, and C10. Only one sample contained succinic acid. In the study, the concentrations of the acids in aerosols were lower than 10 ng/m3. PMID:24729915

Volatile products in the corrosion of Cr, Mo, Ti and four superalloys exposed to O2 containing H2O and gaseous NaCl

NASA Technical Reports Server (NTRS)

Fryburg, G. C.; Miller, R. A.; Kohl, F. J.; Stearns, C. A.

1977-01-01

Cooled target collection techniques were used to study the formation of volatile products when samples of Cr, Ti, IN-738, 713C, NASA-TRW VIA and B-1900 were exposed, at elevated temperatures, to oxidizing environments containing H2O(g) and NaCl(g). Samples were heated to 1050 C in one atmosphere of slowly flowing oxygen, saturated with water at 21 C, and containing about 50 ppm NaCl(g). Volatile products were detected for all materials except B-1900 and Ti. High pressure mass spectrometric sampling was used to directly identify volatile products emanating from samples of Cr and IN-738 subject to the above environments.

Western Eos Chaos on Mars: A Potential Site for Future Landing and Returning Samples

NASA Astrophysics Data System (ADS)

Asif Iqbal Kakkassery; Rajesh, V. J.

2018-04-01

Introducing Eos Chaos as a potential area for collecting samples. Eos Chaos contains a number of aqueous minerals. We have detected zoisite — a least reported low-grade metamorphic mineral from this area.

[Study on tetrodotoxin detection and toxic puffer fish identification of roasted fish fillet at the retail in Beijing and Qingdao].

PubMed

Shen, Qing; Jiang, Tao; Li, Nan; Wang, Jiahui; Han, Chunhui; Zhang, Jing; Xu, Jin; Zhang, Dongfeng; Li, Fengqin

2014-11-01

The roasted fish fillet sample at the retail collected in Beijing and Qingdao were detected for TTX, and the TTX positive samples was analyzed for fish species identification. TTX was tested by EUSA method and the cytochrome c oxidase I (COI) genome of TTX-positive samples was extracted and identified by DNA barcode. Totally, 90 samples were tested by EUSA and 58 (64.4%) samples were positive for TTX with the levels ranging from 0.10 mg/kg to 63.81 mg/kg. Among the TTX positive samples, 24 (41.3%) were identified containing toxic puffer fish and 21 (87.5%) were Lagocephalus lunaris, the highly toxic puffer fish. Some roasted fish fillet samples obtained from the retail in two cities were positive for TTX and contained toxic puffer fish. Based on these results, we suggest that roasted fish fillet producers should prevent toxic puffer fish from mixing in the raw material and the I regulators should strengthen the TTX surveillance and product labeling supervision of roasted fish fillet.

Microfluidic devices, systems, and methods for quantifying particles using centrifugal force

DOEpatents

Schaff, Ulrich Y.; Sommer, Gregory J.; Singh, Anup K.

2015-11-17

Embodiments of the present invention are directed toward microfluidic systems, apparatus, and methods for measuring a quantity of cells in a fluid. Examples include a differential white blood cell measurement using a centrifugal microfluidic system. A method may include introducing a fluid sample containing a quantity of cells into a microfluidic channel defined in part by a substrate. The quantity of cells may be transported toward a detection region defined in part by the substrate, wherein the detection region contains a density media, and wherein the density media has a density lower than a density of the cells and higher than a density of the fluid sample. The substrate may be spun such that at least a portion of the quantity of cells are transported through the density media. Signals may be detected from label moieties affixed to the cells.

Method for isolating chromosomal DNA in preparation for hybridization in suspension

DOEpatents

Lucas, Joe N.

2000-01-01

A method is provided for detecting nucleic acid sequence aberrations using two immobilization steps. According to the method, a nucleic acid sequence aberration is detected by detecting nucleic acid sequences having both a first nucleic acid sequence type (e.g., from a first chromosome) and a second nucleic acid sequence type (e.g., from a second chromosome), the presence of the first and the second nucleic acid sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. In the method, immobilization of a first hybridization probe is used to isolate a first set of nucleic acids in the sample which contain the first nucleic acid sequence type. Immobilization of a second hybridization probe is then used to isolate a second set of nucleic acids from within the first set of nucleic acids which contain the second nucleic acid sequence type. The second set of nucleic acids are then detected, their presence indicating the presence of a nucleic acid sequence aberration. Chromosomal DNA in a sample containing cell debris is prepared for hybridization in suspension by treating the mixture with RNase. The treated DNA can also be fixed prior to hybridization.

[Examination of analytical method for triphenyltin (TPT) and tributyltin (TBT) to revise the official methods based on "Act on the Control of Household Products Containing Harmful Substances"].

PubMed

Kawakami, Tsuyoshi; Isama, Kazuo; Nakashima, Harunobu; Yoshida, Jin; Ooshima, Tomoko; Ohno, Hiroyuki; Uemura, Hitoshi; Shioda, Hiroko; Kikuchi, Yoko; Matsuoka, Atsuko; Nishimura, Tetsuji

2012-01-01

The use of triphenyltin (TPT) and tributyltin (TBT) in some household products is banned by "Act on the Control of Household Products Containing Harmful Substances" in Japan. To revise the official analytical method, the method for detecting these organotin compounds was examined in six laboratories using a textile product, water-based adhesive, oil-based paint, which contained known amounts of TPT and TBT (0.1, 1.0, 10 μg/g). TPT and TBT were measured by GC-MS after ethyl-derivation with sodium tetraethylborate. The TBT recoveries in the samples were 70-120%. The TPT recoveries in the water-based adhesive samples were 80-110%, while its concentrations in the textile product and oil-based paint samples decreased because of dephenylation during storage. However, the precision of the method examined was satisfactory because most coefficients of variation for TPT and TBT in the samples were less than 10%. Furthermore, the revised method was able to detect concentrations lower than the officially regulated value. However, the sample matrix and the condition of analytical instrument might affect the estimated TPT and TBT concentrations. Therefore, the revised method may not be suitable for quantitative tests; rather, it can be employed to judge the acceptable levels of these organotin compounds by comparing the values of control sample containing regulated amounts of TPT and TBT with those for an unknown sample, with deuterated TPT and TBT as surrogate substances. It is desirable that TPT in textile and oil-based paint samples are analyzed immediately after the samples obtained because of the decomposition of TPT.

Recovery of viruses from field samples of raw, digested, and lagoon-dried sludges*

PubMed Central

Sattar, Syed A.; Westwood, J. C. N.

1979-01-01

In a 22-month study, viruses were detected in 84% (62/74) of raw, 53% (19/36) of anaerobically digested, and 39% (11/28) of lagoon-dried sludge samples. Lagoon sludge contained detectable viruses (reovirus and enterovirus groups) even after 8 months of retention. Because of such prolonged virus survival in sludge, care must be taken in its disposal or utilization. PMID:311705

Simple and Rapid Determination of Ferulic Acid Levels in Food and Cosmetic Samples Using Paper-Based Platforms

PubMed Central

Tee-ngam, Prinjaporn; Nunant, Namthip; Rattanarat, Poomrat; Siangproh, Weena; Chailapakul, Orawon

2013-01-01

Ferulic acid is an important phenolic antioxidant found in or added to diet supplements, beverages, and cosmetic creams. Two designs of paper-based platforms for the fast, simple and inexpensive evaluation of ferulic acid contents in food and pharmaceutical cosmetics were evaluated. The first, a paper-based electrochemical device, was developed for ferulic acid detection in uncomplicated matrix samples and was created by the photolithographic method. The second, a paper-based colorimetric device was preceded by thin layer chromatography (TLC) for the separation and detection of ferulic acid in complex samples using a silica plate stationary phase and an 85:15:1 (v/v/v) chloroform: methanol: formic acid mobile phase. After separation, ferulic acid containing section of the TLC plate was attached onto the patterned paper containing the colorimetric reagent and eluted with ethanol. The resulting color change was photographed and quantitatively converted to intensity. Under the optimal conditions, the limit of detection of ferulic acid was found to be 1 ppm and 7 ppm (S/N = 3) for first and second designs, respectively, with good agreement with the standard HPLC-UV detection method. Therefore, these methods can be used for the simple, rapid, inexpensive and sensitive quantification of ferulic acid in a variety of samples. PMID:24077320

Detection of porcine DNA in gelatine and gelatine-containing processed food products-Halal/Kosher authentication.

PubMed

Demirhan, Yasemin; Ulca, Pelin; Senyuva, Hamide Z

2012-03-01

A commercially available real-time PCR, based on a multi-copy target cytochrome b (cyt b) using porcine specific primers, has been validated for the Halal/Kosher authentication of gelatine. Extraction and purification of DNA from gelatine were successfully achieved using the SureFood® PREP Animal system, and real-time PCR was carried out using SureFood® Animal ID Pork Sens kit. The minimum level of adulteration that could be detected was 1.0% w/w for marshmallows and gum drops. A small survey was undertaken of processed food products such as gum drops, marshmallows and Turkish delight, believed to contain gelatine. Of fourteen food products from Germany, two samples were found to contain porcine gelatine, whereas of twenty-nine samples from Turkey twenty-eight were negative. However, one product from Turkey contained porcine DNA and thus was not Halal, and neither was the use of porcine gelatine indicated on the product label. Copyright © 2011 Elsevier Ltd. All rights reserved.

A high-throughput microRNA expression profiling system.

PubMed

Guo, Yanwen; Mastriano, Stephen; Lu, Jun

2014-01-01

As small noncoding RNAs, microRNAs (miRNAs) regulate diverse biological functions, including physiological and pathological processes. The expression and deregulation of miRNA levels contain rich information with diagnostic and prognostic relevance and can reflect pharmacological responses. The increasing interest in miRNA-related research demands global miRNA expression profiling on large numbers of samples. We describe here a robust protocol that supports high-throughput sample labeling and detection on hundreds of samples simultaneously. This method employs 96-well-based miRNA capturing from total RNA samples and on-site biochemical reactions, coupled with bead-based detection in 96-well format for hundreds of miRNAs per sample. With low-cost, high-throughput, high detection specificity, and flexibility to profile both small and large numbers of samples, this protocol can be adapted in a wide range of laboratory settings.

System and method for preconcentrating, identifying, and quantifying chemical and biological substances

DOEpatents

Yu, Conrad M.; Koo, Jackson C.

2000-01-01

A system and method for preconcentrating, identifying, and quantifying chemical and biological substances is disclosed. An input valve directs a first volume of a sample gas to a surface acoustic wave (SAW) device. The SAW device preconcentrates and detects a mass of a substance within the sample gas. An output valve receives a second volume of the sample gas containing the preconcentrated substance from the SAW device and directs the second volume to a gas chromatograph (GC). The GC identifies the preconcentrated substance within the sample gas. A shunt valve exhausts a volume of the sample gas equal to the first volume minus the second volume away from the SAW device and the GC. The method of the present invention includes the steps of opening an input valve for passing a first volume of a sample gas to a SAW device; preconcentrating and detecting a mass of a substance within the sample gas using the SAW device; opening an output valve for passing a second volume of the sample gas containing the preconcentrated substance to a gas chromatograph (GC); and then identifying the preconcentrated substance within the sample gas using the GC.

Practical direct plaque assay for coliphages in 100-ml samples of drinking water.

PubMed Central

Grabow, W O; Coubrough, P

1986-01-01

A practical single-agar-layer plaque assay for the direct detection of coliphages in 100-ml samples of water was designed and evaluated. With this assay a 100-ml sample of water, an agar medium containing divalent cations, and the host Escherichia coli C (ATCC 13706) were mixed in a single container, and the mixture was plated on 10 14-cm-diameter petri dishes. It was more sensitive, reliable, and accurate than various other methods and proved rapid, simple, and economic. PMID:3532952

A homogeneous biochemiluminescent assay for detection of influenza

NASA Astrophysics Data System (ADS)

Hui, Kwok Min; Li, Xiao Jing; Pan, Lu; Li, X. J.

2015-05-01

Current methods of rapid detection of influenza are based on detection of the nucleic acids or antigens of influenza viruses. Since influenza viruses constantly mutate leading to appearance of new strains or variants of viruses, these detection methods are susceptible to genetic changes in influenza viruses. Type A and B influenza viruses contain neuraminidase, an essential enzyme for virus replication which enables progeny influenza viruses leave the host cells to infect new cells. Here we describe an assay method, the homogeneous biochemiluminescent assay (HBA), for rapid detection of influenza by detecting viral neuraminidase activity. The assay mimics the light production process of a firefly: a viral neuraminidase specific substrate containing a luciferin moiety is cleaved in the presence of influenza virus to release luciferin, which becomes a substrate to firefly luciferase in a light production system. All reagents can be formulated in a single reaction mix so that the assay involves only one manual step, i.e., sample addition. Presence of Type A or B influenza virus in the sample leads to production of strong, stable and easily detectable light signal, which lasts for hours. Thus, this influenza virus assay is suitable for use in point-of-care settings.

Concentrations and distribution of manmade organic compounds in the Lake Tahoe Basin, Nevada and California, 1997-99

USGS Publications Warehouse

Lico, Michael S.; Pennington, Nyle

1999-01-01

The U.S. Geological Survey, in cooperation with the Tahoe Regional Planning Agency and the Lahontan Regional Water-Quality Control Board, sampled Lake Tahoe, major tributary streams to Lake Tahoe, and several other lakes in the Lake Tahoe Basin for manmade organic compounds during 1997-99. Gasoline components were found in all samples collected from Lake Tahoe during the summer boating season. Methyl tert-butyl ether (MTBE), benzene, toluene, ethylbenzene, and xylenes (BTEX) were the commonly detected compounds in these samples. Most samples from tributary streams and lakes with no motorized boating had no detectable concentrations of gasoline components. Motorized boating activity appears to be directly linked in space and time to the occurrence of these gasoline components. Other sources of gasoline components to Lake Tahoe, such as the atmosphere, surface runoff, and subsurface flow, are minor compared to the input by motorized boating. Water sampled from Lake Tahoe during mid-winter, when motorized boating activity is low, had no MTBE and only one sample had any detectable BTEX compounds. Soluble pesticides rarely were detected in water samples from the Lake Tahoe Basin. The only detectable concentrations of these compounds were in samples from Blackwood and Taylor Creeks collected during spring runoff. Concentrations found in these samples were low, in the 1 to 4 nanograms per liter range. Organochlorine compounds were detected in samples collected from semipermeable membrane devices (SPMD's) collected from Lake Tahoe, tributary streams, and Upper Angora Lake. In Lake Tahoe, SPMD samples collected offshore from urbanized areas contained the largest number and highest concentrations of organochlorine compounds. The most commonly detected organochlorine compounds were cis- and trans-chlordane, p, p'-DDE, and hexachlorobenzene. In tributary streams, SPMD samples collected during spring runoff generally had higher combined concentrations of organochlorine compounds than those collected during baseflow conditions. Upper Angora Lake had the fewest number of organochlorine compounds detected of all lake samples. Dioxins and furans were not detected in SPMD samples from two sites in Lake Tahoe or from two tributary streams. The number of polycyclic aromatic hydrocarbon (PAH) compounds and their combined concentrations generally were higher in samples from Lake Tahoe than those from tributary streams. Areas of high-motorized boating activity at Lake Tahoe had the largest number and highest concentrations of PAH's. PAH compounds were detected in samples from SPMD's in four of six tributary streams during spring runoff, all tributary streams during baseflow conditions, and at all lake sites. The most commonly detected PAH's in tributary streams during spring runoff were phenanthrene, fluoranthene, pyrene, and chrysene, and during baseflow conditions were phenanthrene, 1-methylphenanthrene, diethylnaphthalene, and pyrene. Upper Truckee River, which has an urban area in its drainage basin, had the largest number and highest combined concentration of PAH's of all stream samples. Bottom-sediment from Lake Tahoe had detectable concentrations of p-cresol, a phenol, in all but one sample. A sample collected near Chambers Lodge contained phenol at an estimated concentration of 4 micrograms per kilogram (?g/kg). Bottom-sediment samples from tributary streams had no detectable concentrations of organochlorine or PAH compounds. Several compounds were detected in bottom sediment from Upper Angora Lake at high concentrations. These compounds and their concentrations were p, p'-DDD (10 ?g/kg), p, p'-DDE (7.4 ?g/kg), 2,6-dimethylnaphthalene (estimated at 190 ?g/kg), pentachlorophenol (3,000 ?g/kg), and p-cresol (4,400 ?g/kg).

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Experimental Determination of the HPGe Spectrometer Efficiency Calibration Curves for Various Sample Geometry for Gamma Energy from 50 keV to 2000 keV

NASA Astrophysics Data System (ADS)

Saat, Ahmad; Hamzah, Zaini; Yusop, Mohammad Fariz; Zainal, Muhd Amiruddin

2010-07-01

Detection efficiency of a gamma-ray spectrometry system is dependent upon among others, energy, sample and detector geometry, volume and density of the samples. In the present study the efficiency calibration curves of newly acquired (August 2008) HPGe gamma-ray spectrometry system was carried out for four sample container geometries, namely Marinelli beaker, disc, cylindrical beaker and vial, normally used for activity determination of gamma-ray from environmental samples. Calibration standards were prepared by using known amount of analytical grade uranium trioxide ore, homogenized in plain flour into the respective containers. The ore produces gamma-rays of energy ranging from 53 keV to 1001 keV. Analytical grade potassium chloride were prepared to determine detection efficiency of 1460 keV gamma-ray emitted by potassium isotope K-40. Plots of detection efficiency against gamma-ray energy for the four sample geometries were found to fit smoothly to a general form of ɛ = AΕa+BΕb, where ɛ is efficiency, Ε is energy in keV, A, B, a and b are constants that are dependent on the sample geometries. All calibration curves showed the presence of a "knee" at about 180 keV. Comparison between the four geometries showed that the efficiency of Marinelli beaker is higher than cylindrical beaker and vial, while cylindrical disk showed the lowest.

Imaging and automated detection of Sitophilus oryzae (Coleoptera: Curculionidae) pupae in hard red winter wheat.

PubMed

Toews, Michael D; Pearson, Tom C; Campbell, James F

2006-04-01

Computed tomography, an imaging technique commonly used for diagnosing internal human health ailments, uses multiple x-rays and sophisticated software to recreate a cross-sectional representation of a subject. The use of this technique to image hard red winter wheat, Triticum aestivm L., samples infested with pupae of Sitophilus oryzae (L.) was investigated. A software program was developed to rapidly recognize and quantify the infested kernels. Samples were imaged in a 7.6-cm (o.d.) plastic tube containing 0, 50, or 100 infested kernels per kg of wheat. Interkernel spaces were filled with corn oil so as to increase the contrast between voids inside kernels and voids among kernels. Automated image processing, using a custom C language software program, was conducted separately on each 100 g portion of the prepared samples. The average detection accuracy in the five infested kernels per 100-g samples was 94.4 +/- 7.3% (mean +/- SD, n = 10), whereas the average detection accuracy in the 10 infested kernels per 100-g sample was 87.3 +/- 7.9% (n = 10). Detection accuracy in the 10 infested kernels per 100-g samples was slightly less than the five infested kernels per 100-g samples because of some infested kernels overlapping with each other or air bubbles in the oil. A mean of 1.2 +/- 0.9 (n = 10) bubbles (per tube) was incorrectly classed as infested kernels in replicates containing no infested kernels. In light of these positive results, future studies should be conducted using additional grains, insect species, and life stages.

Method and apparatus for generating motor current spectra to enhance motor system fault detection

DOEpatents

Linehan, Daniel J.; Bunch, Stanley L.; Lyster, Carl T.

1995-01-01

A method and circuitry for sampling periodic amplitude modulations in a nonstationary periodic carrier wave to determine frequencies in the amplitude modulations. The method and circuit are described in terms of an improved motor current signature analysis. The method insures that the sampled data set contains an exact whole number of carrier wave cycles by defining the rate at which samples of motor current data are collected. The circuitry insures that a sampled data set containing stationary carrier waves is recreated from the analog motor current signal containing nonstationary carrier waves by conditioning the actual sampling rate to adjust with the frequency variations in the carrier wave. After the sampled data is transformed to the frequency domain via the Discrete Fourier Transform, the frequency distribution in the discrete spectra of those components due to the carrier wave and its harmonics will be minimized so that signals of interest are more easily analyzed.

A universal reference sample derived from clone vector for improved detection of differential gene expression

PubMed Central

Khan, Rishi L; Gonye, Gregory E; Gao, Guang; Schwaber, James S

2006-01-01

Background Using microarrays by co-hybridizing two samples labeled with different dyes enables differential gene expression measurements and comparisons across slides while controlling for within-slide variability. Typically one dye produces weaker signal intensities than the other often causing signals to be undetectable. In addition, undetectable spots represent a large problem for two-color microarray designs and most arrays contain at least 40% undetectable spots even when labeled with reference samples such as Stratagene's Universal Reference RNAs™. Results We introduce a novel universal reference sample that produces strong signal for all spots on the array, increasing the average fraction of detectable spots to 97%. Maximizing detectable spots on the reference image channel also decreases the variability of microarray data allowing for reliable detection of smaller differential gene expression changes. The reference sample is derived from sequence contained in the parental EST clone vector pT7T3D-Pac and is called vector RNA (vRNA). We show that vRNA can also be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This reference sample can be made inexpensively in large quantities as a renewable resource that is consistent across experiments. Conclusion Results of this study show that vRNA provides a useful universal reference that yields high signal for almost all spots on a microarray, reduces variation and allows for comparisons between experiments and laboratories. Further, it can be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This type of reference allows for detection of small changes in differential expression while reference designs in general allow for large-scale multivariate experimental designs. vRNA in combination with reference designs enable systems biology microarray experiments of small physiologically relevant changes. PMID:16677381

Development of a dual test procedure for DNA typing and methamphetamine detection using a trace amount of stimulant-containing blood.

PubMed

Irii, Toshiaki; Maebashi, Kyoko; Fukui, Kenji; Sohma, Ryoko; Matsumoto, Sari; Takasu, Shojiro; Iwadate, Kimiharu

2016-05-01

Investigation of drug-related crimes, such as violation of the Stimulant Drug Control Law, requires identifying the used drug (mainly stimulant drugs, methamphetamine hydrochloride) from a drug solution and the DNA type of the drug user from a trace of blood left in the syringe used to inject the drug. In current standard test procedures, DNA typing and methamphetamine detection are performed as independent tests that use two separate portions of a precious sample. The sample can be entirely used up by either analysis. Therefore, we developed a new procedure involving partial lysis of a stimulant-containing blood sample followed by separation of the lysate into a precipitate for DNA typing and a liquid-phase fraction for methamphetamine detection. The method enables these two tests to be run in parallel using a single portion of sample. Samples were prepared by adding methamphetamine hydrochloride water solution to blood. Samples were lysed with Proteinase K in PBS at 56°C for 20min, cooled at -20°C after adding methanol, and then centrifuged at 15,000rpm. Based on the biopolymer-precipitating ability of alcohol, the precipitate was used for DNA typing and the liquid-phase fraction for methamphetamine detection. For DNA typing, the precipitate was dissolved and DNA was extracted, quantified, and subjected to STR analysis using the AmpFℓSTR® Identifiler® Plus PCR Amplification Kit. For methamphetamine detection, the liquid-phase fraction was evaporated with N2 gas after adding 20μL acetic acid and passed through an extraction column; the substances captured in the column were eluted with a solvent, derivatized, and quantitatively detected using gas chromatograph/mass spectrometry. This method was simple and could be completed in approximately 2h. Both DNA typing and methamphetamine detection were possible, which suggests that this method may be valuable for use in criminal investigations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Characterization Data Package for Containerized Sludge Samples Collected from Engineered Container SCS-CON-210

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fountain, Matthew S.; Fiskum, Sandra K.; Baldwin, David L.

This data package contains the K Basin sludge characterization results obtained by Pacific Northwest National Laboratory during processing and analysis of four sludge core samples collected from Engineered Container SCS-CON-210 in 2010 as requested by CH2M Hill Plateau Remediation Company. Sample processing requirements, analytes of interest, detection limits, and quality control sample requirements are defined in the KBC-33786, Rev. 2. The core processing scope included reconstitution of a sludge core sample distributed among four to six 4-L polypropylene bottles into a single container. The reconstituted core sample was then mixed and subsampled to support a variety of characterization activities. Additionalmore » core sludge subsamples were combined to prepare a container composite. The container composite was fractionated by wet sieving through a 2,000 micron mesh and a 500-micron mesh sieve. Each sieve fraction was sampled to support a suite of analyses. The core composite analysis scope included density determination, radioisotope analysis, and metals analysis, including the Waste Isolation Pilot Plant Hazardous Waste Facility Permit metals (with the exception of mercury). The container composite analysis included most of the core composite analysis scope plus particle size distribution, particle density, rheology, and crystalline phase identification. A summary of the received samples, core sample reconstitution and subsampling activities, container composite preparation and subsampling activities, physical properties, and analytical results are presented. Supporting data and documentation are provided in the appendices. There were no cases of sample or data loss and all of the available samples and data are reported as required by the Quality Assurance Project Plan/Sampling and Analysis Plan.« less

Characteristics of the LacTek test as applied to tissue samples: assessment of performance using incurred field samples.

PubMed

Mitchell, J M; McNab, W B; Yee, A J; Griffiths, M W; McEwen, S A; Spilsbury, L; Boison, J O

1998-08-01

The Lactek test, marketed for antimicrobial residue detection in milk, was validated for the detection of antimicrobial residues in tissues. A previous study found that the LacTek test could confidently identify tissue samples spiked with antimicrobial residues. However, the test could not reliably distinguish violative from nonviolative spiked samples relative to Canadian maximum residue limits (MRLs). The objectives of this study were to assess and compare the performance of the LacTek tests for beta-lactams, tetracyclines, gentamicin, and sulfamethazine on samples containing naturally incurred residues by running the test in parallel with the standard microbial inhibition test (MIT) presently used for the routine testing of tissues at our facility and to assess the agreement with high pressure liquid chromatographic (HPLC) determinative methods. Parallel testing with the official MIT found that the Lactek tests could be confidently used for testing tissue samples containing incurred residues. Among 1,008 MIT-positive samples, the LacTek test found that 90% contained beta-lactams and/or tetracyclines. A further 7.3% of violative residues could not be identified to an antimicrobial class. In addition, 9% of samples testing negative on the MIT were found to contain an antimicrobial residue by the LacTek tests. Comparative testing with HPLC methods found that there was very good agreement between the two tests and that most violations were due to penicillin G and oxytetracycline. Although the LacTek test cannot be used to distinguish violative from nonviolative residue levels, it does offer several advantages over the present MIT. These include speed, ease of use, the ability to identify residues to a specific class, and an improved sensitivity at the MRL level for the most commonly found antimicrobials in tissue.

Sodium benzoate and potassium sorbate preservatives in Iranian doogh.

PubMed

Zamani Mazdeh, F; Esmaeili Aftabdari, F; Moradi-Khatoonabadi, Z; Shaneshin, M; Torabi, P; Shams Ardekani, M R; Hajimahmoodi, M

2014-01-01

Sodium benzoate and potassium sorbate are two common preservatives used in Iran, yet use of these preservatives in doogh (Iranian dairy-based drink) is forbidden according to national standards. The aim of this study was to consider the presence of these preservatives in doogh by high-performance liquid chromatography with UV detection (HPLC-UV). The method was performed using a C18 column and detection at 225 nm. The mobile phase contained ammonium acetate buffer (pH = 4.2) and acetonitrile (80:20 v/v). The survey included 130 samples of doogh for identification and quantification of the named preservatives. All samples contained sodium benzoate, but potassium sorbate was detected in only 13% of them. The means of benzoate and sorbate were 21.3 ± 2.7 and 13.3 ± 39.6 mg kg(-1), respectively. The limits of detection were 2 and 40 ng g(-1) for benzoate and sorbate, respectively. Results indicate that sodium benzoate may occur in doogh naturally.

Evaluation of asbestos-containing products and released fibers in home appliances.

PubMed

Hwang, Sung Ho; Park, Wha Me

2016-09-01

The purpose of this study was to detect asbestos-containing products and released asbestos fibers from home appliances. The authors investigated a total of 414 appliances manufactured between 1986 and 2007. Appliances were divided into three categories: large-sized electric appliances, small-sized electric appliances, and household items. Analysis for asbestos-containing material (ACM) was performed using polarized light microscopy (PLM) and stereoscopic microscopy. Air sampling was performed to measure airborne concentration of asbestos using a phase-contrast microscope (PCM). The results of the analysis for ACM in appliances show that large-sized electric appliances (refrigerators, washing machines, kimchi-refrigerators) and household items (bicycles, motorcycles, gas boilers) contain asbestos material and small-sized electric appliances do not contain asbestos material. All appliances with detected asbestos material showed typical characteristics of chrysotile (7-50%) and tremolite (7-10%). No released fibers of ACM were detected from the tested appliances when the appliances were operating. This study gives the basic information on asbestos risk to people who use home appliances. All appliances with detected asbestos material showed typical characteristics of chrysotile (7-50%) and tremolite (7-10%). No released fibers of ACM were detected from the tested appliances when the appliances were operating.

Rapid detection of gelatin in dental materials using attenuated total reflection fourier transform infrared spectroscopy (ATR-FTIR)

NASA Astrophysics Data System (ADS)

Irfanita, N.; Jaswir, I.; Mirghani, M. E. S.; Sukmasari, S.; Ardini, Y. D.; Lestari, W.

2017-08-01

The presence of gelatin is not limited to food products but has also been found in pharmaceuticals. Most dental materials available in Malaysia are imported from other countries and might contain gelatin which is a protein derived either from porcine, bovine or other animal sources. Authentication of gelatin is crucial due to religious and health concerns. Therefore, this study aimed to detect gelatin in dental materials using ATR-FTIR. Forty two samples of dental material were purchased from dental suppliers and detection was done using ATR-FTIR. The spectrum from each sample was compared against standard bovine and porcine gelatin. Experimental dental paste containing bovine and porcine gelatin at concentrations of 5, 10, 15 and 20% were also prepared for quantification analysis. The results showed that gelatin was present in nine out of forty two samples of dental materials but the species of origin was not confirmed. Meanwhile, in the experimental bovine and porcine dental paste, it was seen that as the concentration increased, the intensity of the absorption of Amide group also increased. Thus, ATR-FTIR can be utilized as a reliable tool to detect gelatin in dental materials and other pharmaceuticals.

Use of Sequence-independent, single-primer amplification (SISPA) with NGS platform for detection of RNA viruses in clinical samples

USDA-ARS?s Scientific Manuscript database

Current technologies for next generation sequencing (NGS) have revolutionized metagenomics analysis of clinical samples. One advantage of the NGS platform is the possibility to sequence the genetic material in samples without any prior knowledge of the sequence contained within. Sequence-Independent...

Steroidal hormones and other endocrine active compounds in shallow groundwater in nonagricultural areas of Minnesota—Study design, methods, and data, 2009–10

USGS Publications Warehouse

Erickson, Melinda L.

2012-01-01

The U.S. Geological Survey, in cooperation with the Minnesota Pollution Control Agency, completed a study on the occurrence of steroidal hormones and other endocrine active compounds in shallow groundwater in nonagricultural areas of Minnesota during 2009–10. This report describes the study design and methods, and presents the data collected on steroidal hormones and other related compounds. Environmental and quality-control samples were collected from 40 wells as part of this study. Samples were analyzed by the U.S. Geological Survey National Water Quality Laboratory for 16 steroidal hormones and 4 other related compounds, of which all but 2 compounds are endocrine active compounds. Most of the water samples did not contain detectable concentrations of any of the 20 compounds analyzed. Water samples from three wells had detectable concentrations of one or more compounds. Bisphenol A was detected in samples from three wells, and trans-diethylstilbestrol was detected in one of the samples in which bisphenol A also was detected.

Detection of Toxoplasma gondii DNA in Brazilian oysters (Crassostrea rhizophorae).

PubMed

Ribeiro, L A; Santos, L K N S S; Brito, P A; Maciel, B M; Da Silva, A V; Albuquerque, G R

2015-05-04

The aim of this study was to detect evidence of Toxoplasma gondii using polymerase chain reaction (PCR)-based techniques in oysters (Crassostrea rhizophorae) obtained from the southern coastal region of Bahia, Brazil. A total of 624 oysters were collected, and the gills and digestive glands were dissected. Each tissue sample was separated into pools containing tissues (of the same type) from three animals, leading to a total of 416 experimental samples for analysis (208 samples each from the gills and digestive glands). Molecular analysis using PCR-based detection of the T. gondii AF 146527 repetitive fragment yielded negative results for all samples. However, when nested-PCR was used for detection of the T. gondii SAG-1 gene, 17 samples were positive, with the gills being the tissue with maximal detection of the parasite. These positive results were confirmed by sample sequencing. It is therefore suggested that C. rhizophorae oysters are capable of filtering and retaining T. gondii oocysts in their tissue. This represents a risk to public health because they are traditionally ingested in natura.

UHPLC-MS/MS determination of ochratoxin A and fumonisins in coffee using QuEChERS extraction combined with mixed-mode SPE purification.

PubMed

Nielsen, Kristian Fog; Ngemela, Archard Ferdinand; Jensen, Lene Bai; de Medeiros, Lívia Soman; Rasmussen, Peter Have

2015-01-28

A method was developed for simultaneous determination of the mycotoxins: ochratoxin A (OTA) and fumonisins B2 (FB2), B4 (FB4), and B6 (FB6) in green, roasted, and instant coffee. Extraction was performed by QuEChERS (quick, easy, cheap, effective, rugged, and safe) under acidic conditions followed by mixed-mode reversed phase-anion exchange solid phase extraction. OTA and FB2 were detected at levels down to 0.5 and 2 μg/kg by UHPLC-MS/MS and quantitated via isotope dilution using U-(13)C-labeled FB2 and OTA as internal standards. Mixing 20% isopropanol in the acetonitrile of the acidic UHPLC gradient system increased the signal intensity by 50% and decreased the ion-suppression with 50-75% in roasted coffee samples. About half of the roasted coffee samples (n = 57, from 9 countries) contained detectable levels of OTA, however, with only 5 samples above the EU regulatory limit of 5 μg/kg and the highest with 21 μg/kg. None of the 25 instant coffee samples contained OTA above the EU regulatory level of 10 μg/kg. Nonetheless, the toxin could be detected in 56% of the analyzed instant coffee samples. Fumonisins were not detected in any of the roasted or instant coffee samples (n = 82). However, in the green coffee samples (n = 18) almost half of the samples were positive with a maximum value of 164 μg/kg (sum of FB2, FB4, and FB6). This discrepancy between green coffee and processed coffees indicated that the fumonisins decompose during the roasting process, which was confirmed in roasting experiments. Here fumonisins could not be detected after roasting of the green, 164 μg/kg coffee, sample. Under the same conditions, OTA was reduced from 2.4 to 0.5 μg/kg.

Application of dual-energy x-ray techniques for automated food container inspection

NASA Astrophysics Data System (ADS)

Shashishekhar, N.; Veselitza, D.

2016-02-01

Manufacturing for plastic food containers often results in small metal particles getting into the containers during the production process. Metal detectors are usually not sensitive enough to detect these metal particles (0.5 mm or lesser), especially when the containers are stacked in large sealed shipping packages; X-ray inspection of these packages provides a viable alternative. This paper presents the results of an investigation into dual-energy X-ray techniques for automated detection of small metal particles in plastic food container packages. The sample packages consist of sealed cardboard boxes containing stacks of food containers: plastic cups for food, and Styrofoam cups for noodles. The primary goal of the investigation was to automatically identify small metal particles down to 0.5 mm diameter in size or less, randomly located within the containers. The multiple container stacks in each box make it virtually impossible to reliably detect the particles with single-energy X-ray techniques either visually or with image processing. The stacks get overlaid in the X-ray image and create many indications almost identical in contrast and size to real metal particles. Dual-energy X-ray techniques were investigated and found to result in a clear separation of the metal particles from the food container stack-ups. Automated image analysis of the resulting images provides reliable detection of the small metal particles.

Visual detection of particulates in x-ray images of processed meat products

NASA Astrophysics Data System (ADS)

Schatzki, Thomas F.; Young, Richard; Haff, Ron P.; Eye, J.; Wright, G.

1996-08-01

A study was conducted to test the efficacy of detecting particulate contaminants in processed meat samples by visual observation of line-scanned x-ray images. Six hundred field- collected processed-product samples were scanned at 230 cm2/s using 0.5 X 0.5-mm resolution and 50 kV, 13 mA excitation. The x-ray images were image corrected, digitally stored, and inspected off-line, using interactive image enhancement. Forty percent of the samples were spiked with added contaminants to establish the visual recognition of contaminants as a function of sample thickness (1 to 10 cm), texture of the x-ray image (smooth/textured), spike composition (wood/bone/glass), size (0.1 to 0.4 cm), and shape (splinter/round). The results were analyzed using a maximum likelihood logistic regression method. In packages less than 6 cm thick, 0.2-cm-thick bone chips were easily recognized, 0.1-cm glass splinters were recognized with some difficulty, while 0.4-cm-thick wood was generally missed. Operational feasibility in a time-constrained setting was confirmed. One half percent of the samples arriving from the field contained bone slivers > 1 cm long, 1/2% contained metallic material, while 4% contained particulates exceeding 0.3 cm in size. All of the latter appeared to be bone fragments.

Occurrence of Fumigants and Hazardous Off-gassing Chemicals in Shipping Containers Arriving in Sweden.

PubMed

Svedberg, Urban; Johanson, Gunnar

2017-03-01

Containerized cargo shipment makes up the backbone of international trade. The principal aim of this cross-sectional study was to establish a qualitative and quantitative description of gaseous fumigants and volatile off-gassing substances facing workers tasked with entering shipping containers. A total of 372 packed and 119 empty shipping containers were sampled in six ports and two distribution centers in Sweden. Fourier-transform infrared spectrometry (FTIR) and photoionization detection (PID) were the analytical methods applied to the bulk of samples. A small number of adsorbent samples were analyzed using gas chromatography-mass spectrometry (GC-MS). The results were compared to Swedish occupational exposure limits (OELs), the closest parallel to relevant work situations. Based on the FTIR analyses, 30 of 249 (12%) containers arrived with concentrations of fumigants and off-gassing substances above the 8-h OELs and close to 7% were above the short-term exposure limits. Eight detected chemicals were classified as carcinogens and 4% of the containers arrived with levels of carcinogens above the OELs, at a maximum 30 times the 8-h OEL. Considerable differences were observed between ports, ranging from 0 to 33% of containers arriving with concentrations above the OELs. It is believed that all observation results, apart from a single instance of a confirmed fumigant, phosphine, at 3 p.p.m., and possibly three instances of carbon dioxide, can be attributed to off-gassing substances. The FTIR methodology proved useful for quick preliminary checks and in-depth screening and identification. The PID method produced both false-negative and false-positive results where only 48% matched the FTIR observations. Adsorbent sampling with GC-MS analysis was useful for confirming volatile organic compounds but was deemed too slow for day-to-day screening. The high frequency of contaminated containers, the detection of several carcinogens, and the sporadic occurrences of high levels of fumigants are serious concerns that need to be properly recognized in order to protect the workers at risk. © The Author 2017. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.

External quality assessment for enterovirus 71 and coxsackievirus A16 detection by reverse transcription-PCR using armored RNA as a virus surrogate.

PubMed

Song, Liqiong; Sun, Shipeng; Li, Bo; Pan, Yang; Li, Wenli; Zhang, Kuo; Li, Jinming

2011-10-01

Three armored RNAs (virus-like particles [VLPs]) containing target sequences from enterovirus 71 (EV71) and coxsackievirus A16 (CA16) and a pan-enterovirus (pan-EV) sequence were constructed and used in an external quality assessment (EQA) to determine the performance of laboratories in the detection of EV71 and CA16. The EQA panel, which consisted of 20 samples, including 14 positive samples with different concentrations of EV and either EV71 or CA16 armored RNAs, 2 samples with all 3 armored RNAs, and 4 negative-control samples (NaN(3)-preserved minimal essential medium [MEM] without VLPs), was distributed to 54 laboratories that perform molecular diagnosis of hand, foot, and mouth disease (HFMD) virus infections. A total of 41 data sets from 41 participants were returned; 5 (12.2%) were generated using conventional in-house reverse transcription-PCR (RT-PCR) assays, and 36 (87.8%) were generated using commercial real-time RT-PCR assays. Performance assessments of laboratories differed; 12 (29.3%) showed a need for improvement. Surprisingly, 4 laboratories were unable to detect EV71 RNA in any samples, even those containing the highest concentration of 10(7) IU/ml. Furthermore, the detection sensitivity for EV71 among all laboratories (82.1%) was substantially lower than that for EV (97.4%) or CA16 (95.1%). Overall, the results of the present study indicate that EQA should be performed periodically to help laboratories monitor their ability to detect HFMD viruses and to improve the comparability of results from different laboratories.

Miniature Laboratory for Detecting Sparse Biomolecules

NASA Technical Reports Server (NTRS)

Lin, Ying; Yu, Nan

2005-01-01

A miniature laboratory system has been proposed for use in the field to detect sparsely distributed biomolecules. By emphasizing concentration and sorting of specimens prior to detection, the underlying system concept would make it possible to attain high detection sensitivities without the need to develop ever more sensitive biosensors. The original purpose of the proposal is to aid the search for signs of life on a remote planet by enabling the detection of specimens as sparse as a few molecules or microbes in a large amount of soil, dust, rocks, water/ice, or other raw sample material. Some version of the system could prove useful on Earth for remote sensing of biological contamination, including agents of biological warfare. Processing in this system would begin with dissolution of the raw sample material in a sample-separation vessel. The solution in the vessel would contain floating microscopic magnetic beads coated with substances that could engage in chemical reactions with various target functional groups that are parts of target molecules. The chemical reactions would cause the targeted molecules to be captured on the surfaces of the beads. By use of a controlled magnetic field, the beads would be concentrated in a specified location in the vessel. Once the beads were thus concentrated, the rest of the solution would be discarded. This procedure would obviate the filtration steps and thereby also eliminate the filter-clogging difficulties of typical prior sample-concentration schemes. For ferrous dust/soil samples, the dissolution would be done first in a separate vessel before the solution is transferred to the microbead-containing vessel.

External Quality Assessment for Enterovirus 71 and Coxsackievirus A16 Detection by Reverse Transcription-PCR Using Armored RNA as a Virus Surrogate▿†

PubMed Central

Song, Liqiong; Sun, Shipeng; Li, Bo; Pan, Yang; Li, Wenli; Zhang, Kuo; Li, Jinming

2011-01-01

Three armored RNAs (virus-like particles [VLPs]) containing target sequences from enterovirus 71 (EV71) and coxsackievirus A16 (CA16) and a pan-enterovirus (pan-EV) sequence were constructed and used in an external quality assessment (EQA) to determine the performance of laboratories in the detection of EV71 and CA16. The EQA panel, which consisted of 20 samples, including 14 positive samples with different concentrations of EV and either EV71 or CA16 armored RNAs, 2 samples with all 3 armored RNAs, and 4 negative-control samples (NaN3-preserved minimal essential medium [MEM] without VLPs), was distributed to 54 laboratories that perform molecular diagnosis of hand, foot, and mouth disease (HFMD) virus infections. A total of 41 data sets from 41 participants were returned; 5 (12.2%) were generated using conventional in-house reverse transcription-PCR (RT-PCR) assays, and 36 (87.8%) were generated using commercial real-time RT-PCR assays. Performance assessments of laboratories differed; 12 (29.3%) showed a need for improvement. Surprisingly, 4 laboratories were unable to detect EV71 RNA in any samples, even those containing the highest concentration of 107 IU/ml. Furthermore, the detection sensitivity for EV71 among all laboratories (82.1%) was substantially lower than that for EV (97.4%) or CA16 (95.1%). Overall, the results of the present study indicate that EQA should be performed periodically to help laboratories monitor their ability to detect HFMD viruses and to improve the comparability of results from different laboratories. PMID:21865426

Liquid chromatography-hydride generation-atomic absorption spectrometry for the speciation of tin in seafoods.

PubMed

Viñas, Pilar; López-García, Ignacio; Merino-Meroño, Beatriz; Campillo, Natalia; Hernández-Cordóba, Manuel

2004-04-01

Liquid chromatography with hydride generation atomic absorption spectrometry as the detection system was applied to the separation and determination of inorganic tin, tributyltin, dibutyltin, monobutyltin, diphenyltin and monophenyltin. A reversed phase C18 column and a methanol/water/acetic acid (70:27:3, v/v/v) mixture containing 0.05%(v/v) triethylamine and 0.1%(w/v) tropolone as the mobile phase (isocratic elution) were used. Extraction of organotins from the samples was carried out using methanol containing 0.05%(w/v) tropolone, a process that was repeated twice. The supernatants were shaken with water and dichloromethane in a separating funnel and the organic phase was collected and evaporated to dryness. When the method was applied to the speciation of tin in fresh and canned mussels, no organotins above the detection limits were identified in any of the samples, inorganic tin being the only species detected. The reliability of the procedure was checked by analyzing the total tin content of the samples by electrothermal atomic absorption spectrometry and by speciation of tin in a certified reference material, mussel tissue (CRM 477). The method can be used for environmental monitoring of organotins contaminated samples.

A method for detecting fungal contaminants in wall cavities.

PubMed

Spurgeon, Joe C

2003-01-01

This article describes a practical method for detecting the presence of both fungal spores and culturable fungi in wall cavities. Culturable fungi were collected in 25 mm cassettes containing 0.8 microm mixed cellulose ester filters using aggressive sampling conditions. Both culturable fungi and fungal spores were collected in modified slotted-disk cassettes. The sample volume was 4 L. The filters were examined microscopically and dilution plated onto multiple culture media. Collecting airborne samples in filter cassettes was an effective method for assessing wall cavities for fungal contaminants, especially because this method allowed the sample to be analyzed by both microscopy and culture media. Assessment criteria were developed that allowed the sample results to be used to classify wall cavities as either uncontaminated or contaminated. As a criterion, wall cavities with concentrations of culturable fungi below the limit of detection (LOD) were classified as uncontaminated, whereas those cavities with detectable concentrations of culturable fungi were classified as contaminated. A total of 150 wall cavities was sampled as part of a field project. The concentrations of culturable fungi were below the LOD in 34% of the samples, whereas Aspergillus and/or Penicillium were the only fungal genera detected in 69% of the samples in which culturable fungi were detected. Spore counting resulted in the detection of Stachybotrys-like spores in 25% of the samples that were analyzed, whereas Stachybotrys chartarum colonies were only detected on 2% of malt extract agar plates and on 6% of corn meal agar plates.

A Draft Protocol for Detecting Possible Biohazards in Martian Samples Returned to Earth

NASA Technical Reports Server (NTRS)

Viso, M.; DeVincenzi, D. L.; Race, M. S.; Schad, P. J.; Stabekis, P. D.; Acevedo, S. E.; Rummel, J. D.

2002-01-01

In preparation for missions to Mars that will involve the return of samples, it is necessary to prepare for the safe receiving, handling, testing, distributing, and archiving of martian materials here on Earth. Previous groups and committees have studied selected aspects of sample return activities, but a specific protocol for handling and testing of returned -=1 samples from Mars remained to be developed. To refine the requirements for Mars sample hazard testing and to develop criteria for the subsequent release of sample materials from precautionary containment, NASA Planetary Protection Officer, working in collaboration with CNES, convened a series of workshops to produce a Protocol by which returned martian sample materials could be assessed for biological hazards and examined for evidence of life (extant or extinct), while safeguarding the samples from possible terrestrial contamination. The Draft Protocol was then reviewed by an Oversight and Review Committee formed specifically for that purpose and composed of senior scientists. In order to preserve the scientific value of returned martian samples under safe conditions, while avoiding false indications of life within the samples, the Sample Receiving Facility (SRF) is required to allow handling and processing of the Mars samples to prevent their terrestrial contamination while maintaining strict biological containment. It is anticipated that samples will be able to be shipped among appropriate containment facilities wherever necessary, under procedures developed in cooperation with international appropriate institutions. The SRF will need to provide different types of laboratory environments for carrying out, beyond sample description and curation, the various aspects of the protocol: Physical/Chemical analysis, Life Detection testing, and Biohazard testing. The main principle of these tests will be described and the criteria for release will be discussed, as well as the requirements for the SRF and its personnel.

Gravimetric antigen detection utilizing antibody-modified lipid bilayers.

PubMed

Larsson, Charlotte; Bramfeldt, Hanna; Wingren, Christer; Borrebaeck, Carl; Höök, Fredrik

2005-10-01

Lipid bilayers containing 5% nitrilotriacetic acid (NTA) lipids supported on SiO2 have been used as a template for immobilization of oligohistidine-tagged single-chained antibody fragments (scFvs) directed against cholera toxin. It was demonstrated that histidine-tagged scFvs could be equally efficiently coupled to an NTA-Ni2+-containing lipid bilayer from a purified sample as from an expression supernatant, thereby providing a coupling method that eliminates time-consuming protein prepurification steps. Irrespective of whether the coupling was made from the unpurified or purified antibody preparation, the template proved to be efficient for antigen (cholera toxin) detection, verified using quartz crystal microbalance with dissipation monitoring. In addition, via a secondary amplification step using lipid vesicles containing GM1 (the natural membrane receptor for cholera toxin), the detection limit of cholera toxin was less than 750 pM. To further strengthen the coupling of scFvs to the lipid bilayer, scFvs containing two histidine tags, instead of just one tag, were also evaluated. The increased coupling strength provided via the bivalent anchoring significantly reduced scFv displacement in complex solutions containing large amounts of histidine-containing proteins, verified via cholera toxin detection in serum.

Possibility of the detection and identification of substance at long distance at using broad THz pulse

NASA Astrophysics Data System (ADS)

Trofimov, Vyacheslav A.; Varentsova, Svetlana A.; Trofimov, Vladislav V.

2014-10-01

The spectral properties of THz pulses containing a few cycles reflected from a flat metallic mirror placed at long distance about 3.5 meters from the parabolic mirror are investigated. The samples for analysis were placed before this mirror. Measurements were provided at room temperature of about 18-20° C and humidity of about 70%. The aim of investigation was the detection of a substance under real conditions. At the present time our measurements contain features of both transmission and reflection modes. This leads to a strong modulation of the spectrum and makes difficulties for identification. As samples for our current research we used several neutral substances: paper layers, a thick paper bag, chocolate and cookies. The first problem deals with the detection of common and mismatched spectral properties of samples with paper layers, a thick paper bag and explosives. HMX, PETN and RDX were used as explosive samples. The dependence of the accuracy of identification of samples with paper layers and a thick bag is studied when using short transmitted THz signals with opposite absolute phases as calibration signals. Common and mismatched spectral features of neutral substances: chocolate, cookies and drugs MA, MDMA were investigated by modified integral criteria as well.

Residual Agar Determination in Bacterial Spores by Electrospray Ionization Mass Spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahl, Karen L.; Colburn, Heather A.; Wunschel, David S.

2010-02-15

Presented here is an analytical method to detect residual agar from a bacterial spore sample as an indication of culturing on an agar plate. This method is based on the resolubilization of agar polysaccharide from a bacterial spore sample, enzymatic digestion, followed by electrospray ionization tandem mass spectrometry (ESI-MSn) analysis for detection of a specific agar fragment ion. A range of Bacillus species and strains were selected to demonstrate the effectiveness of this approach. The characteristic agar fragment ion was detected in the spores grown on agar that were washed from 1 to 5 times, irradiated or non-irradiated and notmore » in the spores grown in broth. A sample containing approximately 108 spores is currently needed for confident detection of residual agar from culture on agar plates in the presence of bacterial spores with a limit of detection of approximately 1 ppm agar spiked into a broth-grown spore sample. The results of a proficiency test with 42 blinded samples are presented demonstrating the utility of this method with no false positives and only 3 false negatives for samples that were below the detection level of the method as documented.« less

Anomaly detection in reconstructed quantum states using a machine-learning technique

NASA Astrophysics Data System (ADS)

Hara, Satoshi; Ono, Takafumi; Okamoto, Ryo; Washio, Takashi; Takeuchi, Shigeki

2014-02-01

The accurate detection of small deviations in given density matrices is important for quantum information processing. Here we propose a method based on the concept of data mining. We demonstrate that the proposed method can more accurately detect small erroneous deviations in reconstructed density matrices, which contain intrinsic fluctuations due to the limited number of samples, than a naive method of checking the trace distance from the average of the given density matrices. This method has the potential to be a key tool in broad areas of physics where the detection of small deviations of quantum states reconstructed using a limited number of samples is essential.

ARSENIC SPECIATION IN CARROT EXTRACTS WITH AN EMPHASIS ON THE DETECTION OF MMA(III) AND MMTA

EPA Science Inventory

The two predominant routes of arsenic exposure are dietary ingestion and drinking water consumption. Dietary arsenic, unlike drinking water arsenic, contains a variety of arsenicals with dramatically different toxicities. The list of arsenicals detected in dietary samples conti...

Socioeconomic inequalities in childhood exposure to secondhand smoke before and after smoke-free legislation in three UK countries

PubMed Central

Moore, Graham F.; Currie, Dorothy; Gilmore, Gillian; Holliday, Jo C.; Moore, Laurence

2012-01-01

Background Secondhand smoke (SHS) exposure is higher among lower socioeconomic status (SES) children. Legislation restricting smoking in public places has been associated with reduced childhood SHS exposure and increased smoke-free homes. This paper examines socioeconomic patterning in these changes. Methods Repeated cross-sectional survey of 10 867 schoolchildren in 304 primary schools in Scotland, Wales and Northern Ireland. Children provided saliva for cotinine assay, completing questionnaires before and 12 months after legislation. Results SHS exposure was highest, and private smoking restrictions least frequently reported, among lower SES children. Proportions of saliva samples containing <0.1 ng/ml (i.e. undetectable) cotinine increased from 31.0 to 41.0%. Although across the whole SES spectrum, there was no evidence of displacement of smoking into the home or increased SHS exposure, socioeconomic inequality in the likelihood of samples containing detectable levels of cotinine increased. Among children from the poorest families, 96.9% of post-legislation samples contained detectable cotinine, compared with 38.2% among the most affluent. Socioeconomic gradients at higher exposure levels remained unchanged. Among children from the poorest families, one in three samples contained >3 ng/ml cotinine. Smoking restrictions in homes and cars increased, although socioeconomic patterning remained. Conclusions Urgent action is needed to reduce inequalities in SHS exposure. Such action should include emphasis on reducing smoking in cars and homes. PMID:22448041

[Detection of genetically modified soy (Roundup-Ready) in processed food products].

PubMed

Hagen, M; Beneke, B

2000-01-01

In this study, the application of a qualitative and a quantitative method of analysis to detect genetically modified RR-Soy (Roundup-Ready Soy) in processed foods is described. A total of 179 various products containing soy such as baby food and diet products, soy drinks and desserts, tofu and tofu products, soy based meat substitutes, soy protein, breads, flour, granules, cereals, noodles, soy bean sprouts, fats and oils as well as condiments were investigated following the pattern of the section 35 LMBG-method L 23.01.22-1. The DNA was extracted from the samples and analysed using a soybean specific lectin gene PCR as well as a PCR, specific for the genetic modification. Additional, by means of PCR in combination with fluorescence-detection (TaqMan 5'-Nuclease Assay), suspicious samples were subjected to a real-time quantification of the percentage of genetically modified RR-Soy. The methods of analysis proved to be extremely sensitive and specific in regard to the food groups checked. The fats and oils, as well as the condiments were the exceptions in which amplifiable soy DNA could not be detected. The genetic modification of RR-Soy was detected in 34 samples. Eight of these samples contained more than 1% of RR-Soy. It is necessary to determine the percentage of transgenic soy in order to assess whether genetically modified ingredients were deliberately added, or whether they were caused by technically unavoidable contamination (for example during transportation and processing).

Electrochemical sample matrix elimination for trace-level potentiometric detection with polymeric membrane ion-selective electrodes.

PubMed

Chumbimuni-Torres, Karin Y; Calvo-Marzal, Percy; Wang, Joseph; Bakker, Eric

2008-08-01

Potentiometric sensors are today sufficiently well understood and optimized to reach ultratrace level (subnanomolar) detection limits for numerous ions. In many cases of practical relevance, however, a high electrolyte background hampers the attainable detection limits. A particularly difficult sample matrix for potentiometric detection is seawater, where the high saline concentration forms a major interfering background and reduces the activity of most trace metals by complexation. This paper describes for the first time a hyphenated system for the online electrochemically modulated preconcentration and matrix elimination of trace metals, combined with a downstream potentiometric detection with solid contact polymeric membrane ion-selective microelectrodes. Following the preconcentration at the bismuth-coated electrode, the deposited metals are oxidized and released to a medium favorable to potentiometric detection, in this case calcium nitrate. Matrix interferences arising from the saline sample medium are thus circumvented. This concept is successfully evaluated with cadmium as a model trace element and offers potentiometric detection down to low parts per billion levels in samples containing 0.5 M NaCl background electrolyte.

Electrochemical Sample Matrix Elimination for Trace Level Potentiometric Detection with Polymeric Membrane Ion-Selective Electrodes

PubMed Central

Chumbimuni-Torres, Karin Y.; Calvo-Marzal, Percy; Wang, Joseph; Bakker, Eric

2008-01-01

Potentiometric sensors are today sufficiently well understood and optimized to reach ultra-trace level (sub-nanomolar) detection limits for numerous ions. In many cases of practical relevance, however, a high electrolyte background hampers the attainable detection limits. A particularly difficult sample matrix for potentiometric detection is seawater, where the high saline concentration forms a major interfering background and reduces the activity of most trace metals by complexation. This paper describes for the first time a hyphenated system for the online electrochemically modulated preconcentration and matrix elimination (EMPM) of trace metals, combined with a downstream potentiometric detection with solid contact polymeric membrane ion-selective microelectrodes. Following the preconcentration at the bismuth coated electrodes, the deposited metals are oxidized and released to a medium favorable to potentiometric detection, in this case calcium nitrate. Matrix interferences arising from the saline sample medium are thus circumvented. This concept is successfully evaluated with cadmium as a model trace element and offers potentiometric detection down to low parts per billion levels in samples containing 0.5 M NaCl background electrolyte. PMID:18570385

Towards a “Sample-In, Answer-Out” Point-of-Care Platform for Nucleic Acid Extraction and Amplification: Using an HPV E6/E7 mRNA Model System

PubMed Central

Gulliksen, Anja; Keegan, Helen; Martin, Cara; O'Leary, John; Solli, Lars A.; Falang, Inger Marie; Grønn, Petter; Karlgård, Aina; Mielnik, Michal M.; Johansen, Ib-Rune; Tofteberg, Terje R.; Baier, Tobias; Gransee, Rainer; Drese, Klaus; Hansen-Hagge, Thomas; Riegger, Lutz; Koltay, Peter; Zengerle, Roland; Karlsen, Frank; Ausen, Dag; Furuberg, Liv

2012-01-01

The paper presents the development of a “proof-of-principle” hands-free and self-contained diagnostic platform for detection of human papillomavirus (HPV) E6/E7 mRNA in clinical specimens. The automated platform performs chip-based sample preconcentration, nucleic acid extraction, amplification, and real-time fluorescent detection with minimal user interfacing. It consists of two modular prototypes, one for sample preparation and one for amplification and detection; however, a common interface is available to facilitate later integration into one single module. Nucleic acid extracts (n = 28) from cervical cytology specimens extracted on the sample preparation chip were tested using the PreTect HPV-Proofer and achieved an overall detection rate for HPV across all dilutions of 50%–85.7%. A subset of 6 clinical samples extracted on the sample preparation chip module was chosen for complete validation on the NASBA chip module. For 4 of the samples, a 100% amplification for HPV 16 or 33 was obtained at the 1 : 10 dilution for microfluidic channels that filled correctly. The modules of a “sample-in, answer-out” diagnostic platform have been demonstrated from clinical sample input through sample preparation, amplification and final detection. PMID:22235204

Plasma capric acid concentrations in healthy subjects determined by high-performance liquid chromatography.

PubMed

Shrestha, Rojeet; Hui, Shu-Ping; Imai, Hiromitsu; Hashimoto, Satoru; Uemura, Naoto; Takeda, Seiji; Fuda, Hirotoshi; Suzuki, Akira; Yamaguchi, Satoshi; Hirano, Ken-Ichi; Chiba, Hitoshi

2015-09-01

Capric acid (FA10:0, decanoic acid) is a medium-chain fatty acid abundant in tropical oils such as coconut oil, whereas small amounts are present in milk of goat, cow, and human. Orally ingested FA10:0 is transported to the liver and quickly burnt within it. Only few reports are available for FA10:0 concentrations in human plasma. Fasting (n = 5, male/female = 3/2, age 31 ± 9.3 years old) and non-fasting (n = 106, male/female = 44/62, age 21.9 ± 3.2 years old) blood samples were collected from apparently healthy Japanese volunteers. The total FA10:0 in the plasma were measured by high-performance liquid chromatography after derivatization with 2-nitrophenylhydrazine followed by UV detection. Inter and intra-assay coefficient of variation of FA10:0 assay at three different concentrations ranged in 1.7-3.9 and 1.3-5.4%, respectively, with an analytical recovery of 95.2-104.0%. FA10:0 concentration was below detection limit (0.1 µmol/L) in each fasting human plasma. FA10:0 was not detected in 50 (47.2%) of 106 non-fasting blood samples, while 29 (27.4%) plasma samples contained FA10:0 less than or equal to 0.5 µmol/L (0.4 ± 0.1), and 27 (25.5%) contained it at more than 0.5 µmol/L (0.9 ± 0.3). A half of the non-fasting plasma samples contained detectable FA10:0. This simple, precise, and accurate high-performance liquid chromatography method might be useful for monitoring plasma FA10:0 during medium-chain triglycerides therapy. © The Author(s) 2015.

Anatoxin-a and its metabolites in blue-green algae food supplements from Canada and Portugal.

PubMed

Rawn, Dorothea F K; Niedzwiadek, Barbara; Lau, Benjamin P Y; Saker, Martin

2007-03-01

Blue-green algae and spirulina are marketed in health food stores and over the Internet as food supplements in Canada, the United States, and Europe. The reported benefits of consuming these products include improved digestion, strengthening of the immune system, and relief from the symptoms of attention deficit disorder. Some of these products have been found to contain elevated concentrations of microcystins, which are known hepatotoxins. In addition to producing microcystins, Anabaena sp. and Aphanizomenon sp. also produce the potent neurotoxin anatoxin-a. Samples of food supplements containing blue-green algae and spirulina were collected in Portugal and from urban centers across Canada in 2005. Extracts of these supplements were analyzed to determine the presence and concentrations of anatoxin-a and its two main metabolites, dihydroanatoxin-a and epoxyanatoxin-a. Initial analyses were performed using high-performance liquid chromatography (HPLC) with fluorescence detection, and confirmation required the use of LC with tandem mass spectrometry (LC-MS-MS). The HPLC with fluorescence detection indicated no anatoxin-a, but four samples were suspected to contain either dihydroanatoxin-a or epoxyanatoxin-a at 0.1 to 0.2 microg/g. LC-MS-MS results, however, indicated no trace of either transformation product in any sample analyzed. The detection limits for anatoxin-a, dihydroanatoxin-a, and epoxyanatoxin-a were similar for both fluorescence detection (0.2 to 0.3, 0.4 to 1.4, and 0.2 to 1.5 pg on the column, respectively) and mass spectrometry (0.3 to 1.5, 0.3 to 0.8, and 0.5 to 0.8 pg on the column, respectively). Because of the higher specificity of the LC-MS-MS analysis, all tested food supplement samples were considered free of anatoxin-a and its transformation products.

Evaluation of the FilmArray® system for detection of Bacillus anthracis, Francisella tularensis, and Yersinia pestis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seiner, Derrick R.; Colburn, Heather A.; Baird, Cheryl L.

2013-04-29

To evaluate the sensitivity and specificity of the Idaho Technologies FilmArray® Biothreat Panel for the detection of Bacillus anthracis (Ba), Francisella tularensis (Ft), and Yersinia pestis (Yp) DNA, and demonstrate the detection of Ba spores. Methods and Results: DNA samples from Ba, Ft and Yp strains and near-neighbors, and live Ba spores were analyzed using the Biothreat Panel, a multiplexed PCR-based assay for 17 pathogens and toxins. Sensitivity studies with DNA suggest a limit of detection of 250 genome equivalents (GEs) per sample. Furthermore, the correct call of Ft, Yp or Bacillus species was made in 63 of 72 samplesmore » tested at 25 GE or less. With samples containing 25 Ba Sterne spores, at least one of the two possible Ba markers were identified in all samples tested. We observed no cross-reactivity with near-neighbor DNAs.« less

Tritium monitor

DOEpatents

Chastagner, Philippe

1994-01-01

A system for continuously monitoring the concentration of tritium in an aqueous stream. The system pumps a sample of the stream to magnesium-filled combustion tube which reduces the sample to extract hydrogen gas. The hydrogen gas is then sent to an isotope separation device where it is separated into two groups of isotopes: a first group of isotopes containing concentrations of deuterium and tritium, and a second group of isotopes having substantially no deuterium and tritium. The first group of isotopes containing concentrations of deuterium and tritium is then passed through a tritium detector that produces an output proportional to the concentration of tritium detected. Preferably, the detection system also includes the necessary automation and data collection equipment and instrumentation for continuously monitoring an aqueous stream.

Tritium monitor

DOEpatents

Chastagner, P.

1994-06-14

A system is described for continuously monitoring the concentration of tritium in an aqueous stream. The system pumps a sample of the stream to magnesium-filled combustion tube which reduces the sample to extract hydrogen gas. The hydrogen gas is then sent to an isotope separation device where it is separated into two groups of isotopes: a first group of isotopes containing concentrations of deuterium and tritium, and a second group of isotopes having substantially no deuterium and tritium. The first group of isotopes containing concentrations of deuterium and tritium is then passed through a tritium detector that produces an output proportional to the concentration of tritium detected. Preferably, the detection system also includes the necessary automation and data collection equipment and instrumentation for continuously monitoring an aqueous stream. 1 fig.

HNU-HANBY PCP IMMUNOASSAY TEST KIT - INNOVATIVE TECHNOLOGY EVALUATION REPORT

EPA Science Inventory

The HNU-Hanby pentachlorophenol (PCP) test kit rapidly analyzes for PCP in soil samples. The test kit can only detect those PCP carriers that contain aromatic compounds. The test kit estimates PCP concentrations in soil samples indirectly by measuring petroleum hydrocarbon carrie...

Higher atypical enteropathogenic Escherichia coli (a-EPEC) bacterial loads in children with diarrhea are associated with PCR detection of the EHEC factor for adherence 1/lymphocyte inhibitory factor A (efa1/lifa) gene.

PubMed

Slinger, Robert; Lau, Kimberley; Slinger, Michael; Moldovan, Ioana; Chan, Francis

2017-03-23

Typical enteropathogenic Escherichia coli (t-EPEC) are known to cause diarrhea in children but it is uncertain whether atypical EPEC (a-EPEC) do, since a-EPEC lack the bundle-forming pilus (bfp) gene that encodes a key adherence factor in t-EPEC. In culture-based studies of a-EPEC, the presence of another adherence factor, called EHEC factor for adherence/lymphocyte activation inhibitor (efa1/lifA), was strongly associated with diarrhea. Since a-EPEC culture is not feasible in clinical laboratories, we designed an efa1/lifA quantitative PCR assay and examined whether the presence of efa1/lifA was associated with higher a-EPEC bacterial loads in pediatric diarrheal stool samples. Fecal samples from children with diarrhea were tested by qPCR for EPEC (presence of eae gene) and for shiga toxin genes to exclude enterohemorrhagic E. coli, which also contain the eae gene. EPEC containing samples were then tested for the bundle-forming pilus gene found in t-EPEC and efa1/lifA. The eae gene quantity in efa1/lifA-positive and negative samples was compared. Thirty-nine of 320 (12%) fecal samples tested positive for EPEC and 38/39 (97%) contained a-EPEC. The efa1/lifA gene was detected in 16/38 (42%) a-EPEC samples. The median eae concentration for efa1/lifA positive samples was significantly higher than for efa1/lifA negative samples (median 16,745 vs. 1183 copies/µL, respectively, p = 0.006). Atypical enteropathogenic E. coli-positive diarrheal stool samples containing the efa1/lifA gene had significantly higher bacterial loads than samples lacking this gene. This supports the idea that efa1/lifA contributes to diarrheal pathogenesis and suggests that, in EPEC-positive samples, efa/lifA may be a useful additional molecular biomarker.

Determination of furan levels in commercial samples of baby food from Brazil and preliminary risk assessment.

PubMed

Pavesi Arisseto, A; Vicente, E; De Figueiredo Toledo, M C

2010-08-01

Commercial baby food samples available on the Brazilian market (n = 31) were analysed for furan content using a gas chromatography-mass spectrometry method preceded by solid-phase microextraction. A limit of detection of 0.7 microg kg(-1), a limit of quantitation of 2.4 microg kg(-1), mean recoveries varying from 80% to 107%, and coefficients of variation ranging from 5.6% to 9.4% for repeatability and from 7.4% to 12.4% for within-laboratory reproducibility were obtained during an in-house validation. The levels of furan found in the samples were from not detected to 95.5 microg kg(-1). Samples containing vegetables and meat showed higher furan levels as compared with those containing only fruits. An exposure assessment showed furan intakes up to 2.4 microg kg(-1) body weight day(-1) (99th percentile) for babies fed exclusively with commercial baby foods. Margins of exposure obtained from intakes estimated in this work indicated a potential public health concern.

Polyphenolic and hydroxycinnamate contents of whole coffee fruits from China, India, and Mexico.

PubMed

Mullen, W; Nemzer, B; Stalmach, A; Ali, S; Combet, E

2013-06-05

Air-dried whole coffee fruits, beans, and husks from China, India, and Mexico were analyzed for their chlorogenic acids (CGA), caffeine, and polyphenolic content. Analysis was by HPLC and Orbitrap exact mass spectrometry. Total phenol, total flavonol, and antioxidant capacity were measured. The hydroxycinnamate profile consisted of caffeoylquinic acids, feruloyquinic acids, dicaffeoylquinic acids, and caffeoyl-feruloylquinic acids. A range of flavan-3-ols as well as flavonol conjugates were detected. The CGA content was similar for both Mexican and Indian coffee fruits but was much lower in the samples from China. Highest levels of flavan-3-ols were found in the Indian samples, whereas the Mexican samples contained the highest flavonols. Amounts of CGAs in the beans were similar to those in the whole fruits, but flavan-3-ols and flavonols were not detected. The husks contained the same range of polyphenols as those in the whole fruits. The highest levels of caffeine were found in the Robusta samples.

Volatiles from roasted byproducts of the poultry-processing industry.

PubMed

Wettasinghe, M; Vasanthan, T; Temelli, F; Swallow, K

2000-08-01

Volatiles of roasted chicken breast muscle and byproducts, such as backbones, breastbones, spent bones, and skin, were investigated. Total volatile concentrations ranged from 2030 ppb in the roasted backbones to 4049 ppb in the roasted skin. The major classes of volatile compounds detected in roasted samples were aldehydes (648-1532 ppb) and alcohols (336-1006 ppb). Nitrogen- and/or sulfur-containing compounds were also detected in appreciable quantities (161-706 ppb) in all samples. For all samples, hexanal and 2-methyl-2-buten-1-ol were dominant among the aldehydes and alcohols, respectively. Among the nitrogen- and sulfur-containing compounds, Maillard reaction products, such as tetrahydropyridazines, piperidines, and thiazoles, were the major contributors to the total volatile content in all samples. The composition of volatiles observed in roasted byproducts was markedly different from that of the roasted breast muscle. Therefore, the blending of the byproducts in appropriate proportions or blending of volatile flavor extracts from different byproducts may be necessary to obtain an aroma that mimics roasted chicken aroma.

Quality of water in the Trinity and Edwards aquifers, south-central Texas, 1996-98

USGS Publications Warehouse

Fahlquist, Lynne; Ardis, Ann F.

2004-01-01

During 1996–98, the U.S. Geological Survey studied surface- and ground-water quality in south-central Texas. The ground-water components included the upper and middle zones (undifferentiated) of the Trinity aquifer in the Hill Country and the unconfined part (recharge zone) and confined part (artesian zone) of the Edwards aquifer in the Balcones fault zone of the San Antonio region. The study was supplemented by information compiled from four ground-water-quality studies done during 1996–98.Trinity aquifer waters are more mineralized and contain larger dissolved solids, sulfate, and chloride concentrations compared to Edwards aquifer waters. Greater variability in water chemistry in the Trinity aquifer likely reflects the more variable lithology of the host rock. Trace elements were widely detected, mostly at small concentrations. Median total nitrogen was larger in the Edwards aquifer than in the Trinity aquifer. Ammonia nitrogen was detected more frequently and at larger concentrations in the Trinity aquifer than in the Edwards aquifer. Although some nitrate nitrogen concentrations in the Edwards aquifer exceeded a U.S. Geological Survey national background threshold concentration, no concentrations exceeded the U.S. Environmental Protection Agency public drinking-water standard.Synthetic organic compounds, such as pesticides and volatile organic compounds, were detected in the Edwards aquifer and less frequently in the Trinity aquifer, mostly at very small concentrations (less than 1 microgram per liter). These compounds were detected most frequently in urban unconfined Edwards aquifer samples. Atrazine and its breakdown product deethylatrazine were the most frequently detected pesticides, and trihalomethanes were the most frequently detected volatile organic compounds. Widespread detections of these compounds, although at small concentrations, indicate that anthropogenic activities affect ground-water quality.Radon gas was detected throughout the Trinity aquifer but not throughout the Edwards aquifer. Fourteen samples from the Trinity aquifer and 10 samples from the Edwards aquifer exceeded a proposed U.S. Environmental Protection Agency public drinking-water standard. Sources of radon in the study area might be granitic sediments underlying the Trinity aquifer and igneous intrusions in and below the Edwards aquifer.The presence of tritium in nearly all Edwards aquifer samples indicates that some component of sampled water is young (less than about 50 years), even for long flow paths in the confined zone. About one-half of the Trinity aquifer samples contained tritium, indicating that only part of the aquifer contains young water.Hydrogen and oxygen isotopes of water provide indicators of recharge sources to the Trinity and Edwards aquifers. Most ground-water samples have a meteorological isotopic signature indicating recharge as direct infiltration of water with little residence time on the land surface. Isotopic data from some samples collected from the unconfined Edwards aquifer indicate the water has undergone evaporation. At the time that ground-water samples were collected (during a drought), nearby streams were the likely sources of recharge to these wells.

Determination of selected fatty acids in dried sweat spot using gas chromatography with flame ionization detection.

PubMed

Kanďár, Roman; Drábková, Petra; Andrlová, Lenka; Kostelník, Adam; Čegan, Alexander

2016-11-01

A method is described for the determination of fatty acids in dried sweat spot and plasma samples using gas chromatography with flame ionization detection. Plasma and dried sweat spot samples were obtained from a group of blood donors. The sweat was collected from each volunteer during exercise. Sweat was spotted onto collection paper containing butylated hydroxytoluene. Fatty acids were derivatized with acetyl chloride in methanol to form methyl esters of fatty acids. The fatty acids in dried sweat spot samples treated with butylated hydroxytoluene and stored at -20°C were stable for 3 months. Our results indicate that sweat contains, among fatty acids with short chain, also fatty acids with long chain and unsaturated fatty acids. Linear relationships between percentage content of selected fatty acids in dried sweat spot and plasma were observed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Seasonality of Cryptosporidium oocyst detection in surface waters of Meru, Kenya as determined by two isolation methods followed by PCR

PubMed Central

Muchiri, John M.; Ascolillo, Luke; Mugambi, Mutuma; Mutwiri, Titus; Ward, Honorine D.; Naumova, Elena N.; Egorov, Andrey I.; Cohen, Seth; Else, James G.; Griffiths, Jeffrey K.

2009-01-01

Meru, Kenya has watersheds which are shared by wildlife, humans and domesticated animals. These surface waters can be contaminated by the waterborne pathogen Cryptosporidium. To quantify the seasonality and prevalence of Cryptosporidium in Meru regional surface waters, we used a calcium carbonate flocculation (CCF) and sucrose floatation method, and a filtration and immunomagnetic bead separation method, each of which used PCR for Cryptosporidium detection and genotyping. Monthly water samples were collected from January through June in 2003 and 2004, bracketing two April-May rainy seasons. We detected significant seasonality with 8 of 9 positive samples from May and June (p < 0.0014), which followed peak rainy season precipitation and includes some of the subsequent dry season. Six of 9 positive samples revealed C. parvum, and 3 contained C. andersoni. None contained C. hominis. Our results indicate that Meru surface waters are Cryptosporidium-contaminated at the end of rainy seasons, consistent with the timing of human infections reported by others from East Africa and contrasting with the onset of rainy season peak incidence reported from West Africa. PMID:18957776

Spatial distribution of organochlorine contaminants in soil, sediment, and fish in Bikini and Enewetak Atolls of the Marshall Islands, Pacific Ocean.

PubMed

Wang, Jun; Caccamise, Sarah A L; Wu, Liejun; Woodward, Lee Ann; Li, Qing X

2011-08-01

Several nuclear tests were performed at Enewetak and Bikini Atolls in the Marshall Islands between 1946 and 1958. The events at Bikini Atoll involved several ships that were tested for durability during nuclear explosions, and 24 vessels now rest on the bottom of the Bikini lagoon. Nine soil samples were collected from different areas on the two islands of the atoll, and eighteen sediment, nine fish, and one lobster were collected in the vicinity of the sunken ships. Organochlorine pesticides (OCPs), polychlorinated biphenyls (PCBs), and polychlorinated terphenyls (PCTs) in these samples were analyzed using gas chromatography/ion trap mass spectrometry (GC/ITMS). The average recoveries ranged from 78% to 104% for the different PCB congeners. The limits of detection (LOD) for PCBs, PCTs, DDE, DDT, and dieldrin ranged 10-50 pg g(-1). Some fish from Enewetak contained PCBs at a concentration range of 37-137 ng g(-1), dry weight (dw), and most of the soils from Enewetak showed evidence of PCBs (22-392 ng g(-1)dw). Most of the Bikini lagoon sediment samples contained PCBs, and the highest was the one collected from around the Saratoga, an aircraft carrier (1555 ng g(-1)dw). Some of the fish samples, most of the soil samples, and only one of the sediment samples contained 2,2-bis(4-chlorophenyl)-1,1-dichloroethylene (DDE) and PCBs. In addition to PCBs, the soils from Enewetak Atoll contained PCTs. PCTs were not detected in the sediment samples from Bikini Atoll. The results suggest local pollution sources of PCBs, PCTs, and OCPs. Copyright © 2011. Published by Elsevier Ltd.

Fiber optical asssembly for fluorescence spectrometry

DOEpatents

Piltch, Martin S.; Gray, Perry Clayton; Rubenstein, Richard

2015-08-18

System is provided for detecting the presence of an analyte of interest in a sample, said system comprising an elongated, transparent container for a sample; an excitation source in optical communication with the sample, wherein radiation from the excitation source is directed along the length of the sample, and wherein the radiation induces a signal which is emitted from the sample; and, at least two linear arrays disposed about the sample holder, each linear array comprising a plurality of optical fibers having a first end and a second end, wherein the first ends of the fibers are disposed along the length of the container and in proximity thereto; the second ends of the fibers of each array are bundled together to form a single end port.

X-ray detection properties of plastic scintillators containing surface-modified Bi2O3 nanoparticles

NASA Astrophysics Data System (ADS)

Hiyama, Fumiyuki; Noguchi, Takio; Koshimizu, Masanori; Kishimoto, Shunji; Haruki, Rie; Nishikido, Fumihiko; Fujimoto, Yutaka; Aida, Tsutomu; Takami, Seiichi; Adschiri, Tadafumi; Asai, Keisuke

2018-05-01

Plastic scintillators containing Bi2O3 nanoparticles (NPs) were developed as detectors for X-ray synchrotron radiation. A hydrothermal method was used to synthesize the NPs that had average particle sizes of less than 10 nm. Higher NP concentration led to a higher detection efficiency at 67.4 keV. The light yield of the scintillator containing 5 wt % Bi2O3 NPs was comparable with or higher than that of the commercially available plastic scintillator, EJ 256. The time resolution of the developed scintillation detector equipped with each sample scintillator was approximately 0.6 ns. Dispersion of nanoparticles within plastic scintillators is generally applicable and has wide application as a method for preparation of plastic scintillators for detecting X-ray synchrotron radiation.

Approach for ochratoxin A fast screening in spices using clean-up tandem immunoassay columns with confirmation by high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS).

PubMed

Goryacheva, I Yu; De Saeger, S; Lobeau, M; Eremin, S A; Barna-Vetró, I; Van Peteghem, C

2006-09-01

An approach for ochratoxin A (OTA) fast cost-effective screening based on clean-up tandem immunoassay columns was developed and optimized for OTA detection with a cut-off level of 10 microg kg(-1) in spices. Two procedures were tested and applied for OTA detection. Column with bottom detection immunolayer was optimized for OTA determination in Capsicum ssp. spices. A modified clean-up tandem immunoassay procedure with top detection immunolayer was successfully applied for all tested spices. Its main advantages were decreasing of the number of analysis steps and quantity of antibody and also minimizing of matrix effects. The total duration of the extraction and analysis was about 40 min for six samples. Chilli, red pepper, pili-pili, cayenne, paprika, nutmeg, ginger, white pepper and black pepper samples were analyzed for OTA contamination by the proposed clean-up tandem immunoassay procedures. Clean-up tandem immunoassay results were confirmed by HPLC-MS/MS with immunoaffinity column clean-up. Among 17 tested Capsicum ssp. spices, 6 samples (35%) contained OTA in a concentration exceeding the 10 microg kg(-1) limit discussed by the European Commission. All tested nutmeg (n=8), ginger (n=5), white pepper (n=7) and black pepper (n=6) samples did not contain OTA above this action level.

Airborne asbestos exposures associated with work on asbestos fire sleeve materials.

PubMed

Blake, Charles L; Harbison, Stephen C; Johnson, Giffe T; Harbison, Raymond D

2011-11-01

Asbestos-containing fire sleeves have been used as a fire protection measure for aircraft fluid hoses. This investigation was conducted to determine the level of airborne asbestos fiber exposure experienced by mechanics who work with fire sleeve protected hoses. Duplicate testing was performed inside a small, enclosed workroom during the fabrication of hose assemblies. Personal air samples taken during this work showed detectable, but low airborne asbestos fiber exposures. Analysis of personal samples (n=9) using phrase contract microscopy (PCM) indicated task duration airborne fiber concentrations ranging from 0.017 to 0.063 fibers per milliliter (f/ml) for sampling durations of 167-198 min, and 0.022-0.14 f/ml for 30 min samples. Airborne chrysotile fibers were detected for four of these nine personal samples, and the resulting asbestos adjusted airborne fiber concentrations ranged from 0.014 to 0.025 f/ml. These results indicate that work with asbestos fire sleeve and fire sleeve protected hose assemblies, does not produce regulatory noncompliant levels of asbestos exposure for persons who handle, cut and fit these asbestos-containing materials. Copyright © 2011 Elsevier Inc. All rights reserved.

The signature-based radiation-scanning approach to standoff detection of improvised explosive devices.

PubMed

Brewer, R L; Dunn, W L; Heider, S; Matthew, C; Yang, X

2012-07-01

The signature-based radiation-scanning technique for detection of improvised explosive devices is described. The technique seeks to detect nitrogen-rich chemical explosives present in a target. The technology compares a set of "signatures" obtained from a test target to a collection of "templates", sets of signatures for a target that contain an explosive in a specific configuration. Interrogation of nitrogen-rich fertilizer samples, which serve as surrogates for explosives, is shown experimentally to be able to discriminate samples of 3.8L and larger. Copyright © 2011 Elsevier Ltd. All rights reserved.

Pesticides and their metabolites in wells of Suffolk County, New York, 1998

USGS Publications Warehouse

Phillips, Patrick J.; Eckhardt, D.A.; Terracciano, S.A.; Rosenmann, Larry

1999-01-01

Five insecticide residues and 20 herbicide residues were detected in water samples collected from 50 shallow wells screened in the surficial sand and gravel aquifer in Suffolk County, Long Island in areas with known or suspected residues. Laboratory analytical methods with extremely low detection limits - from 0.001 to 0.2 ?g/L (micrograms per liter) - were used to analyze the samples for 60 pesticide residues. Forty-four of the samples contained at least one pesticide residue, and some samples contained as many as 11 different pesticides or pesticide metabolites. Only four water- quality standards were exceeded in the samples collected in this study. Dieldrin exceeded the New York State Class GA standard (0.004 ?g/L) in samples from eight wells. The Federal and New York State Maximum Contaminant Level for simazine (4 ?g/L) was exceeded in samples from two wells, and the State Class GA standard for simazine (0.5 ?g/L) was exceeded in samples from six wells. Federal water-quality standards have not been established for many of the compounds detected in this study, including herbicide metabolites. Maximum concentrations of four herbicide metabolites -metolachlor ESA (ethanesulfonic acid), metolachlor OA (oxanilic acid), and the alachlor metabolites alachlor ESA and alachlor OA -exceeded 20 ?g/L. The maximum concentration of one herbicide (tebuthiuron) exceeded 10 ?g/L, and the maximum concentration of three herbicides (simazine, metolachlor, and atrazine) and one herbicide metabolite (deisopropylatrazine) ranged from 1 to 10 ?g/L. The herbicide metolachlor, which is used on potato fields in Suffolk County, and its metabolites (metolachlor ESA and metolachlor OA) were most frequently detected in samples from agricultural areas. The herbicides simazine and tebuthiuron, which were used in utility rights-of-way, and the simazine metabolite deisopropylatrazine were detected at concentrations greater than 0.05 ?g/L most frequently in samples from residential and mixed land-use areas. The results of this investigation are not necessarily representative of conditions throughout the remainder of Long Island, because these samples were collected in areas of known or suspected residues.

Comparison of potentially pathogenic free-living amoeba hosts by Legionella spp. in substrate-associated biofilms and floating biofilms from spring environments.

PubMed

Hsu, Bing-Mu; Huang, Chin-Chun; Chen, Jung-Sheng; Chen, Nai-Hsiung; Huang, Jen-Te

2011-10-15

This study compares five genera of free-living amoebae (FLA) hosts by Legionella spp. in the fixed and floating biofilm samples from spring environments. Detection rate of Legionella spp. was 26.9% for the floating biofilms and 3.1% for the fixed biofilms. Acanthamoeba spp., Hartmanella vermiformis, and Naegleria spp. were more frequently detected in floating biofilm than in fixed biofilm samples. The percentage of pathogenic Acanthamoeba spp. among all the genus Acanthamoeba detected positive samples was 19.6%. The potential pathogenic Naegleria spp. (for example, Naegleria australiensis, Naegleria philippinensis, and Naegleria italica) was 54.2% to all the Naegleria detected positive samples. In the study, 12 serotypes of possible pneumonia causing Legionella spp. were detected, and their percentage in all the Legionella containing samples was 42.4%. The FLA parasitized by Legionella included unnamed Acanthamoeba genotype, Acanthamoeba griffini, Acanthamoeba jacobsi, H. vermiformis, and N. australiensis. Significant differences were also observed between the presence/absence of H. vermiformis and Legionella parasitism in FLA. Comparisons between the culture-confirmed method and the PCR-based detection method for detecting FLA and Legionella in biofilms showed great variation. Therefore, using these analysis methods together to detect FLA and Legionella is recommended. Copyright © 2011 Elsevier Ltd. All rights reserved.

Determination of selected anions in water by ion chromatography

USGS Publications Warehouse

Fishman, Marvin J.; Pyen, Grace

1979-01-01

Ion chromatography is a rapid, sensitive, precise, and accurate method for the determination of major anions in rain water and surface waters. Simultaneous analyses of a single sample for bromide, chloride, fluoride, nitrate, nitrite, orthophosphate, and sulfate require approximately 20 minutes to obtain a chromatogram.Minimum detection limits range from 0.01 milligrams per liter for fluoride to 0.20 milligrams per liter for chloride and sulfate. Percent relative standard deviations were less than nine percent for all anions except nitrite in Standard Reference Water Samples. Only one reference sample contained nitrite and its concentration was near the minimum level of detection. Similar precision was found for chloride, nitrate, and sulfate at concentrations less than 5 milligrams per liter in rainfall samples. Precision for fluoride ranged from 12 to 22 percent, but is attributed to the low concentrations in these samples. The other anions were not detected.To determine accuracy of results, several samples were spiked with known concentrations of fluoride, chloride, nitrate, and sulfate; recoveries ranged from 96 to 103 percent. Known amounts of bromide and phosphate were added, separately, to several other waters, which contained bromide or phosphate. Recovery of added bromide and phosphate ranged from approximately 95 to 104 percent. No recovery data were obtained for nitrite.Chloride, nitrate, nitrite, orthophosphate, and sulfate, in several samples, were also determined independently by automated colorimetric procedures. An automated ion-selective electrode method was used to determine fluoride. Results are in agreement with results obtained by ion chromatography.

A rapid and simple method of detection of Blepharisma japonicum using PCR and immobilisation on FTA paper

PubMed Central

Hide, Geoff; Hughes, Jacqueline M; McNuff, Robert

2003-01-01

Background The rapid expansion in the availability of genome and DNA sequence information has opened up new possibilities for the development of methods for detecting free-living protozoa in environmental samples. The protozoan Blepharisma japonicum was used to investigate a rapid and simple detection system based on polymerase chain reaction amplification (PCR) from organisms immobilised on FTA paper. Results Using primers designed from the α-tubulin genes of Blepharisma, specific and sensitive detection to the equivalent of a single Blepharisma cell could be achieved. Similar detection levels were found using water samples, containing Blepharisma, which were dried onto Whatman FTA paper. Conclusion This system has potential as a sensitive convenient detection system for Blepharisma and could be applied to other protozoan organisms. PMID:14516472

CTP (Cochlin-tomoprotein) detection in the profuse fluid leakage (gusher) from cochleostomy.

PubMed

Ikezono, Tetsuo; Sugizaki, Kazuki; Shindo, Susumu; Sekiguchi, Satomi; Pawankar, Ruby; Baba, Shunkichi; Yagi, Toshiaki

2010-08-01

By testing 125 samples, we confirmed that Cochlin-tomoprotein (CTP) is present in the perilymph, not in cerebrospinal fluid (CSF). Perilymph and CSF exist in two distinct compartments, even in the case of a malformed inner ear with a bony defect in the lamina cribrosa, as described here. Cochleostomy might have suddenly decreased the perilymph pressure, allowing the influx of CSF into the inner ear resulting in profuse fluid leakage, first perilymph then CSF. The first purpose of this study was to further confirm the specificity of the perilymph-specific protein CTP that we reported recently. Secondly, we assessed the nature of the fluid leakage from the cochleostomy using the CTP detection test. A standardized CTP detection test was performed on 65 perilymph and 60 CSF samples. Samples of profuse fluid leakage collected from cochleostomy during cochlear implantation surgery of one patient with branchio-oto-renal (BOR) syndrome were also tested by the CTP detection test. CTP was detected in 60 of 65 perilymph samples but not in any of the CSF samples. The leaked fluid was shown to contain CTP, i.e. perilymph, at the outset, and then the CTP detection signals gradually disappeared as time elapsed.

Application of a bacterial whole cell biosensor for the rapid detection of cytotoxicity in heavy metal contaminated seawater.

PubMed

Cui, Zhisong; Luan, Xiao; Jiang, Huichao; Li, Qian; Xu, Guangfei; Sun, Chengjun; Zheng, Li; Song, Yizhi; Davison, Paul A; Huang, Wei E

2018-06-01

A toxicity biosensor Acinetobacter baylyi Tox2 was constructed with the host strain A. baylyi ADP1 harboring a new and medium-copy-number plasmid pWH1274_lux, and was applied to detect the cytotoxicity of heavy metal contaminated seawater. The gene cassette luxCDABE was controlled by constitutively expressed promoter P tet on pWH1274_lux and the bioluminescence intensity of the biosensor reduces in proportional to the concentrations of toxic compounds. A. baylyi Tox2 exhibits tolerance to salinity, hence it is applicable to seawater samples. A. baylyi Tox2 and Mugilogobius chulae were exposed to different concentrations of heavy metals (Hg 2+ , Zn 2+ , Cu 2+ , and Cd 2+ ) in artificial seawater for performance comparison and Pearson correlation analysis showed a significant correlation (p < 0.01) between A. baylyi Tox2 toxicity detection and the fish (M. chulae) exposure test. This suggests that the performance of A. baylyi Tox2 is comparable to the conventional fish toxicity test in terms of cytotoxicity detection of heavy metal contaminated seawater. Furthermore, A. baylyi Tox2 was used to evaluate cytotoxicity of field-collected seawater samples. The results indicate that there was a significant correlation between the luminescence inhibition ratio (IR) of A. baylyi Tox2 and heavy metal concentrations detected by ICP-MS in the samples. Two seawater samples, which contained a high concentration of total heavy metals, exhibited stronger cytotoxicity than the samples containing low concentrations of heavy metals. In conclusion, A. baylyi Tox2 can be used as an alternative tool to aquatic animals for the evaluation of the cytotoxicity of heavy metal contamination in the marine environment. Copyright © 2018 Elsevier Ltd. All rights reserved.

Mossbauer spectrometer radiation detector

NASA Technical Reports Server (NTRS)

Singh, J. J. (Inventor)

1973-01-01

A Mossbauer spectrometer with high efficiencies in both transmission and backscattering techniques is described. The device contains a sodium iodide crystal for detecting radiation caused by the Mossbauer effect, and two photomultipliers to collect the radiation detected by the crystal. When used in the transmission technique, the sample or scatterer is placed between the incident radiation source and the detector. When used in a backscattering technique, the detector is placed between the incident radiation source and the sample of scatterer such that the incident radiation will pass through a hole in the crystal and strike the sample. Diagrams of the instrument are provided.

Presence of Antibiotics in Shallow Groundwater in the Northern and Southwestern Regions of China.

PubMed

Chen, Liang; Lang, Hang; Liu, Fei; Jin, Song; Yan, Tao

2018-05-01

Antibiotics are widely used, and there is a serious concern about its adverse impacts on the environment and human health. To our knowledge, prior to this work, there was no evidence of the potential presence of antibiotics in groundwater in China, despite populous speculations. This study reported the detection of 35 target antibiotics of 6 groups (chloramphenicois, lincosamides, marcrolides, quinolones, sulfonamides, and tetracyclines), in shallow groundwater samples collected in northern and southwestern China. Thirty-four of thirty-five target antibiotics were detected in the groundwater samples; 73 of 74 monitoring wells contained at least one antibiotic; and at least two antibiotics were detected in 72 of the 74 wells. Ofloxacin (1199.7 ng/L), lincomycin (860.7 ng/L), and norfloxacin (441.9 ng/L) as well as antibiotics with the highest detection frequency such as sulfapyridine (70%), norfloxacin (69%), and lincomycin (64%) were detected at elevated concentrations. The highest detection frequency and concentration of lincosamides were observed in those groundwater samples, but no clear distribution patterns were observed for the six antibiotic groups. Moreover, shallow groundwater in southwestern China seemed to contain most antibiotics, likely due to the high antibiotics discharge and frequent exchange of groundwater with surface matrices. The findings from this work suggest that groundwater in China has been widely contaminated by antibiotics, and presumably other pharmaceutical compounds that have not been investigated to date. © 2017, National Ground Water Association.

Multiplexed Paper Analytical Device for Quantification of Metals using Distance-Based Detection

PubMed Central

Cate, David M.; Noblitt, Scott D.; Volckens, John; Henry, Charles S.

2015-01-01

Exposure to metal-containing aerosols has been linked with adverse health outcomes for almost every organ in the human body. Commercially available techniques for quantifying particulate metals are time-intensive, laborious, and expensive; often sample analysis exceeds $100. We report a simple technique, based upon a distance-based detection motif, for quantifying metal concentrations of Ni, Cu, and Fe in airborne particulate matter using microfluidic paper-based analytical devices. Paper substrates are used to create sensors that are self-contained, self-timing, and require only a drop of sample for operation. Unlike other colorimetric approaches in paper microfluidics that rely on optical instrumentation for analysis, with distance-based detection, analyte is quantified visually based on the distance of a colorimetric reaction, similar to reading temperature on a thermometer. To demonstrate the effectiveness of this approach, Ni, Cu, and Fe were measured individually in single-channel devices; detection limits as low as 0.1, 0.1, and 0.05 µg were reported for Ni, Cu, and Fe. Multiplexed analysis of all three metals was achieved with detection limits of 1, 5, and 1 µg for Ni, Cu, and Fe. We also extended the dynamic range for multi-analyte detection by printing concentration gradients of colorimetric reagents using an off the shelf inkjet printer. Analyte selectivity was demonstrated for common interferences. To demonstrate utility of the method, Ni, Cu, and Fe were measured from samples of certified welding fume; levels measured with paper sensors matched known values determined gravimetrically. PMID:26009988

Detection of the urban release of a bacillus anthracis simulant by air sampling.

PubMed

Garza, Alexander G; Van Cuyk, Sheila M; Brown, Michael J; Omberg, Kristin M

2014-01-01

In 2005 and 2009, the Pentagon Force Protection Agency (PFPA) staged deliberate releases of a commercially available organic pesticide containing Bacillus amyloliquefaciens to evaluate PFPA's biothreat response protocols. In concert with, but independent of, these releases, the Department of Homeland Security sponsored experiments to evaluate the efficacy of commonly employed air and surface sampling techniques for detection of an aerosolized biological agent. High-volume air samplers were placed in the expected downwind plume, and samples were collected before, during, and after the releases. Environmental surface and personal air samples were collected in the vicinity of the high-volume air samplers hours after the plume had dispersed. The results indicate it is feasible to detect the release of a biological agent in an urban area both during and after the release of a biological agent using high-volume air and environmental sampling techniques.

Sorbic and benzoic acid in non-preservative-added food products in Turkey.

PubMed

Cakir, Ruziye; Cagri-Mehmetoglu, Arzu

2013-01-01

Sorbic acid (SA) and benzoic acid (BA) were determined in yoghurt, tomato and pepper paste, fruit juices, chocolates, soups and chips in Turkey by using high-pressure liquid chromatography (HPLC). Levels were compared with Turkish Food Codex limits. SA was detected only in 2 of 21 yoghurt samples, contrary to BA, which was found in all yoghurt samples but one, ranging from 10.5 to 159.9 mg/kg. Both SA and BA were detected also in 3 and 6 of 23 paste samples in a range of 18.1-526.4 and 21.7-1933.5 mg/kg, respectively. Only 1 of 23 fruit juices contained BA. SA was not detected in any chips, fruit juice, soup, or chocolate sample. Although 16.51% of the samples was not compliant with the Turkish Food Codex limits, estimated daily intake of BA or SA was below the acceptable daily intake.

Fast single run of vanilla fingerprint markers on microfluidic-electrochemistry chip for confirmation of common frauds.

PubMed

Avila, Mónica; Zougagh, Mohammed; Escarpa, Alberto; Ríos, Angel

2009-10-01

A new strategy based on the fast separation of the fingerprint markers of Vanilla planifolia extracts and vanilla-related samples on microfluidic-electrochemistry chip is proposed. This methodology allowed the detection of all required markers for confirmation of common frauds in this field. The elution order was strategically connected with sequential sample screening and analyte confirmation steps, where first ethyl vanillin was detected to distinguish natural from adultered samples; second, vanillin as prominent marker in V. planifolia, but frequently added in its synthetic form; and third, the final detection of the fingerprint markers (p-hydroxybenzaldehyde, vanillic acid, and p-hydroxybenzoic acid) of V. planifolia with confirmation purposes. The reliability of the proposed methodology was demonstrated in the confirmation the natural or non-natural origin of vanilla in samples using V. planifolia extracts and other selected food samples containing this flavor.

Measurement of Epstein-Barr virus DNA load using a novel quantification standard containing two EBV DNA targets and SYBR Green I dye.

PubMed

Lay, Meav-Lang J; Lucas, Robyn M; Ratnamohan, Mala; Taylor, Janette; Ponsonby, Anne-Louise; Dwyer, Dominic E

2010-09-22

Reactivation of Epstein-Barr virus (EBV) infection may cause serious, life-threatening complications in immunocompromised individuals. EBV DNA is often detected in EBV-associated disease states, with viral load believed to be a reflection of virus activity. Two separate real-time quantitative polymerase chain reaction (QPCR) assays using SYBR Green I dye and a single quantification standard containing two EBV genes, Epstein-Barr nuclear antigen-1 (EBNA-1) and BamHI fragment H rightward open reading frame-1 (BHRF-1), were developed to detect and measure absolute EBV DNA load in patients with various EBV-associated diseases. EBV DNA loads and viral capsid antigen (VCA) IgG antibody titres were also quantified on a population sample. EBV DNA was measurable in ethylenediaminetetraacetic acid (EDTA) whole blood, peripheral blood mononuclear cells (PBMCs), plasma and cerebrospinal fluid (CSF) samples. EBV DNA loads were detectable from 8.0 × 10(2) to 1.3 × 10(8) copies/ml in post-transplant lymphoproliferative disease (n = 5), 1.5 × 10(3) to 2.0 × 10(5) copies/ml in infectious mononucleosis (n = 7), 7.5 × 10(4) to 1.1 × 10(5) copies/ml in EBV-associated haemophagocytic syndrome (n = 1), 2.0 × 10(2) to 5.6 × 10(3) copies/ml in HIV-infected patients (n = 12), and 2.0 × 10(2) to 9.1 × 10(4) copies/ml in the population sample (n = 218). EBNA-1 and BHRF-1 DNA were detected in 11.0% and 21.6% of the population sample respectively. There was a modest correlation between VCA IgG antibody titre and BHRF-1 DNA load (rho = 0.13, p = 0.05) but not EBNA-1 DNA load (rho = 0.11, p = 0.11). Two sensitive and specific real-time PCR assays using SYBR Green I dye and a single quantification standard containing two EBV DNA targets, were developed for the detection and measurement of EBV DNA load in a variety of clinical samples. These assays have application in the investigation of EBV-related illnesses in immunocompromised individuals.

MODIFYING EPA METHOD 314.0 FOR ANALYSIS OF PERCHLORATE IN AQUEOUS SAMPLES CONTAINING HIGH TOTAL DISSOLVED SOLIDS

EPA Science Inventory

Through the Regional Applied Research Effort (RARE) program, the Chemical Exposure Research Branch and Region 9 personnel in San Francisco, California are collaborating on a project to explore sample pretreatment and preconcentration techniques to lower the method detection limit...

Development of reagents for immunoassay of Phytophthora ramorum in nursery water samples

Treesearch

Douglas G. Luster; Timothy Widmer; Michael McMahon; C. André Lévesque

2017-01-01

Current regulations under the August 6, 2014 USDA APHIS Official Regulatory Protocol (Confirmed Nursery Protocol: Version 8.2) for Nurseries Containing Plants Infected with Phytophthora ramorum mandates the sampling of water in affected nurseries to demonstrate they are free of P. ramorum. Currently, detection of

Determination of acaricide residues in saudi arabian honey and beeswax using solid phase extraction and gas chromatography.

PubMed

Kamel, Alaa; Al-Ghamdi, Ahmad

2006-01-01

Determination of acaricide residues of flumethrin, tau-fluvalinate, coumaphos, and amitraz in honey and beeswax was carried out using a rapid extraction method utilizing C-18 SPE cartridges and an analytical method utilizing GC with ECD, NPD, and MSD detectors for the four acaricides. Recovery percentages from the extraction method ranged from 90-102%, while the minimum detection levels ranged from 0.01-0.05 mg/kg for the acaricides. Nine of the 21 analyzed samples were found to be contaminated with the acaricides tau-fluvalinate and coumaphos. Neither flumethrin nor amitraz was detected in any of the honey or wax samples. Coumaphos was found only in honey samples in which two samples exceeded the tolerance levels set by EPA and EC regulations. It has not been detected in beeswax. Five honey samples and eight beeswax samples were found to be contaminated with tau-fluvalinate. One of the wax samples was contaminated with a relatively high residue of tau-fluvalinate and contained above 10 mg/kg.

Visual detection of particulates in processed meat products by x ray

NASA Astrophysics Data System (ADS)

Schatzki, Thomas F.; Young, Richard; Haff, Ron P.; Eye, J.; Wright, G.

1995-01-01

A test has been run to study the efficacy of detecting particulate contaminants in processed meat samples by manual observation of line-scanned x-ray images. Six hundred processed product samples arriving over a 3 month period at a national USDA-FSIS laboratory were scanned at 230 cm2sec with 0.5 X 0.5 mm resolution, using 50 KV, 13 ma excitation, with digital interfacing and image correction. Images were inspected off-line, using interactive image enhancement. Forty percent of the samples were spiked, blind to the analyst, in order to establish the manual recognition rate as a function of sample thickness [1 - 10 cm] and texture of the x-ray image [smooth/textured], as well as spike composition [wood/bone/glass], size [1 - 4 mm] and shape [splinter/round]. The results have been analyzed using maximum likelihood logistic regression. In meat packages less than 6 cm thick, 2 mm bone chips are easily recognized, 1 mm glass splinters with some difficulty, while wood is generally missed even at 4 mm. Operational feasibility in a time-constrained setting has bee confirmed. One half percent of the samples arriving from the field contained bone slivers > 1 cm long, one half percent contained metallic material, while 4% contained particulates exceeding 3.2 mm in size. All of the latter appeared to be bone fragments.

Flow injection/atomic absorption spectrometric determination of zineb in commercial formulations of pesticide based on slurry sampling.

PubMed

Cassella, Ricardo J; Salim, Verĵnica A; Garrigues, Salvador; Santelli, Ricardo E; de la Guardia, Miguel

2002-11-01

This paper reports on a new strategy for the slurry sampling determination of dithiocarbamate pesticide zineb [[ethylenebis(dithiocarbamato)]zinc] employing a FIA system with a flame atomic absorption spectrometry detector. In the flow system, an on-line alkaline hydrolysis of the pesticide is performed, allowing the release of Zn(II) ions to the solution, which are easily detected by a flame AAS technique. Several parameters that could affect the performance of the analytical methodology were studied, such as the concentration of NH3(aq) used in the hydrolysis step, the effect of the presence of Triton X-100 on the sensitivity and precision, and the FIA parameters (carrier flow rate and mixing coil volume). Under optimized conditions, aqueous slurries containing 2.5 to 25 microg ml(-1) zineb provided good linear calibration fits. From the obtained data, a detection limit (3sigma) of 1.0 microg ml(-1) zineb was found and a repeatability of 2.7% was obtained from 12 measurements of a slurry containing 2.5 microg m(-1) zineb. On the other hand, a precision (reproducibility) of 7.8% was achieved from three determinations of a sample containing 128 mg g(-1) of the pesticide. Also, the developed system provides a sampling frequency of 72 h(-1).

The evaluation of a positive direct antiglobulin test (autocontrol) in pretransfusion testing revisited.

PubMed

Judd, W J; Barnes, B A; Steiner, E A; Oberman, H A; Averill, D B; Butch, S H

1986-01-01

Direct antiglobulin tests (DATs) using anti-IgG were performed on 65,049 blood samples from prospective transfusion recipients; 3570 tests (5.49%) were positive. Using criteria published previously (primarily excluding patients not transfused within the preceding 14 days), 778 samples from other than neonatal patients were selected for further evaluation. Eluates that did not react were obtained on 518 (66.6%) of these samples. Warm-reactive autoantibodies were apparent in 192 eluates, while 16 contained drug-related antibodies, anti-A or anti-B from prior transfusion with ABO mismatched blood components, or anti-D passively acquired from immune serum globulin. Fifty-two eluates contained alloantibodies; however, in only six of these cases did the corresponding serum lack unexpected alloantibodies, as determined by routine pretransfusion studies. Three additional weakly reactive clinically significant alloantibodies were detected solely through additional serum tests performed on DAT-positive samples. On the basis of these findings, the DAT had a low predictive value when used to detect the early manifestations of an immune response to recently transfused red cells. Elimination of the autocontrol from routine pretransfusion testing, therefore, carries minimal risk to patients yet will undoubtedly contribute to the containment of health care costs. Moreover, the risk is lower than that associated with the elimination of the antiglobulin crossmatch.

Method and apparatus for generating motor current spectra to enhance motor system fault detection

DOEpatents

Linehan, D.J.; Bunch, S.L.; Lyster, C.T.

1995-10-24

A method and circuitry are disclosed for sampling periodic amplitude modulations in a nonstationary periodic carrier wave to determine frequencies in the amplitude modulations. The method and circuit are described in terms of an improved motor current signature analysis. The method insures that the sampled data set contains an exact whole number of carrier wave cycles by defining the rate at which samples of motor current data are collected. The circuitry insures that a sampled data set containing stationary carrier waves is recreated from the analog motor current signal containing nonstationary carrier waves by conditioning the actual sampling rate to adjust with the frequency variations in the carrier wave. After the sampled data is transformed to the frequency domain via the Discrete Fourier Transform, the frequency distribution in the discrete spectra of those components due to the carrier wave and its harmonics will be minimized so that signals of interest are more easily analyzed. 29 figs.

An integrated, self-contained microfluidic cassette for isolation, amplification, and detection of nucleic acids

PubMed Central

Chen, Dafeng; Mauk, Michael; Qiu, Xianbo; Liu, Changchun; Kim, Jitae; Ramprasad, Sudhir; Ongagna, Serge; Abrams, William R.; Malamud, Daniel; Corstjens, Paul L. A. M.

2010-01-01

A self-contained, integrated, disposable, sample-to-answer, polycarbonate microfluidic cassette for nucleic acid—based detection of pathogens at the point of care was designed, constructed, and tested. The cassette comprises on-chip sample lysis, nucleic acid isolation, enzymatic amplification (polymerase chain reaction and, when needed, reverse transcription), amplicon labeling, and detection. On-chip pouches and valves facilitate fluid flow control. All the liquids and dry reagents needed for the various reactions are pre-stored in the cassette. The liquid reagents are stored in flexible pouches formed on the chip surface. Dry (RT-)PCR reagents are pre-stored in the thermal cycling, reaction chamber. The process operations include sample introduction; lysis of cells and viruses; solid-phase extraction, concentration, and purification of nucleic acids from the lysate; elution of the nucleic acids into a thermal cycling chamber and mixing with pre-stored (RT-)PCR dry reagents; thermal cycling; and detection. The PCR amplicons are labeled with digoxigenin and biotin and transmitted onto a lateral flow strip, where the target analytes bind to a test line consisting of immobilized avidin-D. The immobilized nucleic acids are labeled with up-converting phosphor (UCP) reporter particles. The operation of the cassette is automatically controlled by an analyzer that provides pouch and valve actuation with electrical motors and heating for the thermal cycling. The functionality of the device is demonstrated by detecting the presence of bacterial B.Cereus, viral armored RNA HIV, and HIV I virus in saliva samples. The cassette and actuator described here can be used to detect other diseases as well as the presence of bacterial and viral pathogens in the water supply and other fluids. PMID:20401537

An integrated, self-contained microfluidic cassette for isolation, amplification, and detection of nucleic acids.

PubMed

Chen, Dafeng; Mauk, Michael; Qiu, Xianbo; Liu, Changchun; Kim, Jitae; Ramprasad, Sudhir; Ongagna, Serge; Abrams, William R; Malamud, Daniel; Corstjens, Paul L A M; Bau, Haim H

2010-08-01

A self-contained, integrated, disposable, sample-to-answer, polycarbonate microfluidic cassette for nucleic acid-based detection of pathogens at the point of care was designed, constructed, and tested. The cassette comprises on-chip sample lysis, nucleic acid isolation, enzymatic amplification (polymerase chain reaction and, when needed, reverse transcription), amplicon labeling, and detection. On-chip pouches and valves facilitate fluid flow control. All the liquids and dry reagents needed for the various reactions are pre-stored in the cassette. The liquid reagents are stored in flexible pouches formed on the chip surface. Dry (RT-)PCR reagents are pre-stored in the thermal cycling, reaction chamber. The process operations include sample introduction; lysis of cells and viruses; solid-phase extraction, concentration, and purification of nucleic acids from the lysate; elution of the nucleic acids into a thermal cycling chamber and mixing with pre-stored (RT-)PCR dry reagents; thermal cycling; and detection. The PCR amplicons are labeled with digoxigenin and biotin and transmitted onto a lateral flow strip, where the target analytes bind to a test line consisting of immobilized avidin-D. The immobilized nucleic acids are labeled with up-converting phosphor (UCP) reporter particles. The operation of the cassette is automatically controlled by an analyzer that provides pouch and valve actuation with electrical motors and heating for the thermal cycling. The functionality of the device is demonstrated by detecting the presence of bacterial B.Cereus, viral armored RNA HIV, and HIV I virus in saliva samples. The cassette and actuator described here can be used to detect other diseases as well as the presence of bacterial and viral pathogens in the water supply and other fluids.

Comparative Evaluation of the Diagnostic Performance of the Prototype Cepheid GeneXpert Ebola Assay

PubMed Central

Jansen van Vuren, Petrus; Grobbelaar, Antoinette; Storm, Nadia; Conteh, Ousman; Konneh, Kelfala; Kamara, Abdul; Sanne, Ian

2015-01-01

The Ebola virus disease (EVD) outbreak in West Africa has highlighted an urgent need for point-of-care (POC) assays for the diagnosis of this devastating disease in resource-limited African countries. The diagnostic performance characteristics of a prototype Cepheid GeneXpert Ebola POC used to detect Ebola virus (EBOV) in stored serum and plasma samples collected from suspected EVD cases in Sierra Leone in 2014 and 2015 was evaluated. The GeneXpert Ebola POC is a self-contained single-cartridge automated system that targets the glycoprotein (GP) and nucleoprotein (NP) genes of EBOV and yields results within 90 min. Results from 281 patient samples were compared to the results of a TaqMan real-time reverse transcription-PCR (RT-PCR) targeting the polymerase gene and performed on two real-time PCR machines. Agreement between the three platforms was 100% at cycle threshold (CT) values of ≤34.99, but discordant results were noted between CT values of 35 and 45.The diagnostic sensitivity of the three platforms was 100% in 91 patient samples that were confirmed to be infectious by virus isolation. All three molecular platforms detected viral EBOV RNA in additional samples that did not contain viable EBOV. The analytical sensitivity of the GeneXpert Ebola POC for the detection of NP was higher, and comparable to that of polymerase gene detection, than that for the detection of GP when using a titrated laboratory stock of EBOV. There was no detectable cross-reactivity with other hemorrhagic fever viruses or arboviruses. The GeneXpert Ebola POC offers an easy to operate and sensitive diagnostic tool that can be used for the rapid screening of suspected EVD cases in treatment or in holding centers during EVD outbreaks. PMID:26637383

Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

PubMed

Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

2015-09-01

Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

Coupled multi-group neutron photon transport for the simulation of high-resolution gamma-ray spectroscopy applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burns, Kimberly A.

2009-08-01

The accurate and efficient simulation of coupled neutron-photon problems is necessary for several important radiation detection applications. Examples include the detection of nuclear threats concealed in cargo containers and prompt gamma neutron activation analysis for nondestructive determination of elemental composition of unknown samples.

X ray sensitive area detection device

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor); Witherow, William K. (Inventor); Pusey, Marc L. (Inventor); Yost, Vaughn H. (Inventor)

1990-01-01

A radiation sensitive area detection device is disclosed which comprises a phosphor-containing film capable of receiving and storing an image formed by a pattern of incoming x rays, UV, or other radiation falling on the film. The device is capable of fluorescing in response to stimulation by a light source in a manner directly proportional to the stored radiation pattern. The device includes: (1) a light source capable of projecting light or other appropriate electromagnetic wave on the film so as to cause it to fluoresce; (2) a means to focus the fluoresced light coming from the phosphor-containing film after light stimulation; and (3) at least one charged coupled detector or other detecting element capable of receiving and digitizing the pattern of fluoresced light coming from the phosphor-containing film. The device will be able to generate superior x ray images of high resolution from a crystal or other sample and will be particularly advantageous in that instantaneous near-real-time images of rapidly deteriorating samples can be obtained. Furthermore, the device can be made compact and sturdy, thus capable of carrying out x ray or other radiation imaging under a variety of conditions, including those experienced in space.

Observation of residues in tissues of chickens exposed to low dietary concentrations of chloramphenicol.

PubMed

Rejtharová, Martina; Rejthar, Libor; Čačková, Katarína; Bureš, Jiří; Vernerová, Eva; Hera, Alfred

2017-04-01

To investigate potential residues in tissues arising from naturally occurring low levels of chloramphenicol in plant material, feeding studies were conducted with chickens. A common chicken feed was prepared containing 0, 10, 50 and 200 μg kg -1 chloramphenicol and levels were confirmed by LC-MS/MS. Four separate groups of broiler chickens, eight animals in each group, were fed all their 35-day life with this contaminated feed. They were allowed ad libitum access to this feed and fresh water. After slaughtering the chickens, the residues in muscle and liver tissues were determined using GC/MS-NCI method. No residues were detected in tissues of animals from groups fed with feed containing 0, 10 or 50 µg kg -1 . Low chloramphenicol residual concentrations were observed in a few of the muscle samples obtained from the group of chickens fed with feed containing chloramphenicol in added concentration 200 µg kg -1 . No residues were detected in the remaining samples of this group. These results indicate that when residues of chloramphenicol are detected it is in all probability through illegal use.

Detection of silver nanoparticles in parsley by solid sampling high-resolution-continuum source atomic absorption spectrometry.

PubMed

Feichtmeier, Nadine S; Leopold, Kerstin

2014-06-01

In this work, we present a fast and simple approach for detection of silver nanoparticles (AgNPs) in biological material (parsley) by solid sampling high-resolution-continuum source atomic absorption spectrometry (HR-CS AAS). A novel evaluation strategy was developed in order to distinguish AgNPs from ionic silver and for sizing of AgNPs. For this purpose, atomisation delay was introduced as significant indication of AgNPs, whereas atomisation rates allow distinction of 20-, 60-, and 80-nm AgNPs. Atomisation delays were found to be higher for samples containing silver ions than for samples containing silver nanoparticles. A maximum difference in atomisation delay normalised by the sample weight of 6.27 ± 0.96 s mg(-1) was obtained after optimisation of the furnace program of the AAS. For this purpose, a multivariate experimental design was used varying atomisation temperature, atomisation heating rate and pyrolysis temperature. Atomisation rates were calculated as the slope of the first inflection point of the absorbance signals and correlated with the size of the AgNPs in the biological sample. Hence, solid sampling HR-CS AAS was proved to be a promising tool for identifying and distinguishing silver nanoparticles from ionic silver directly in solid biological samples.

Occurrence of nitrate, nitrite and volatile nitrosamines in certain feedstuffs and animal products.

PubMed

Ologhobo, A D; Adegede, H I; Maduagiwu, E N

1996-01-01

Nitrate, nitrite and nitrosamines were analysed in poultry feeds, meat and eggs. The poultry meat was boiled and roasted while the eggs were raw and boiled, and the effects of these processing treatments on the level of these compounds were investigated. Nitrate levels in the meat samples were significantly (P < 0.05) reduced by boiling and roasting, with boiling being more effective. Nitrite levels were also reduced significantly by processing (P < 0.05). The feed samples contained levels of nitrate which were significantly different (P < 0.05) from one producer to another. Nitrite levels were generally low in all feed samples. Nitrosamines were not detected in any of the feed samples and in the meat samples except in two samples of boiled meat which contained 0.001 g/kg each.

Supervised target detection in hyperspectral images using one-class Fukunaga-Koontz Transform

NASA Astrophysics Data System (ADS)

Binol, Hamidullah; Bal, Abdullah

2016-05-01

A novel hyperspectral target detection technique based on Fukunaga-Koontz transform (FKT) is presented. FKT offers significant properties for feature selection and ordering. However, it can only be used to solve multi-pattern classification problems. Target detection may be considered as a two-class classification problem, i.e., target versus background clutter. Nevertheless, background clutter typically contains different types of materials. That's why; target detection techniques are different than classification methods by way of modeling clutter. To avoid the modeling of the background clutter, we have improved one-class FKT (OC-FKT) for target detection. The statistical properties of target training samples are used to define tunnel-like boundary of the target class. Non-target samples are then created synthetically as to be outside of the boundary. Thus, only limited target samples become adequate for training of FKT. The hyperspectral image experiments confirm that the proposed OC-FKT technique provides an effective means for target detection.

Characterization of Diarrheagenic Escherichia coli Isolated in Organic Waste Products (Cattle Fecal Matter, Manure and, Slurry) from Cattle's Markets in Ouagadougou, Burkina Faso.

PubMed

Bako, Evariste; Kagambèga, Assèta; Traore, Kuan Abdoulaye; Bagre, Touwendsida Serge; Ibrahim, Hadiza Bawa; Bouda, Soutongnooma Caroline; Bonkoungou, Isidore Juste Ouindgueta; Kaboré, Saidou; Zongo, Cheikna; Traore, Alfred Sababenejo; Barro, Nicolas

2017-09-22

Cattle farming can promote diarrheal disease transmission through waste, effluents or cattle fecal matter. The study aims to characterize the diarrheagenic Escherichia coli (DEC) isolated from cattle feces, manure in the composting process and slurry, collected from four cattle markets in Ouagadougou. A total of 585 samples (340 cattle feces, 200 slurries and 45 manures in the composting process) were collected from the four cattle markets between May 2015 and May 2016. A multiplex Polymerase Chain Reaction (PCR), namely 16-plex PCR, was used to screen simultaneously the virulence genes specific for shiga toxin-producing E. coli (STEC), enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC) and enteroaggregative E. coli (EAEC). DEC was detected in 10.76% of samples. ETEC was the most prevalent (9.91%). STEC and EAEC have been observed with the same rate (0.51%). ETEC were detected in 12.64% of cattle feces, in 6.66% of manure in the composting process and in 5% of slurry. STEC were detected in 0.58% of cattle feces and in 2.22% of manure in the composting process. EAEC was detected only in 1% of slurry and in 2.22% of manure in the composting process. ETEC strains were identified based on estIa gene and/or estIb gene and/or elt gene amplification. Of the 58 ETEC, 10.34% contained astA , 17.24% contained elt , 3.44% contained estIa and 79.31% contained estIb . The two positive EAEC strains contained only the aggR gene, and the third was positive only for the pic gene. The results show that effluent from cattle markets could contribute to the spreading of DEC in the environment in Burkina Faso.

Laser fluorometric analysis of plants for uranium exploration

USGS Publications Warehouse

Harms, T.F.; Ward, F.N.; Erdman, J.A.

1981-01-01

A preliminary test of biogeochemical exploration for locating uranium occurrences in the Marfa Basin, Texas, was conducted in 1978. Only 6 of 74 plant samples (mostly catclaw mimosa, Mimosa biuncifera) contained uranium in amounts above the detection limit (0.4 ppm in the ash) of the conventional fluorometric method. The samples were then analyzed using a Scintrex UA-3 uranium analyzer* * Use of trade names in this paper is for descriptive purposes only and does not constitute endorsement by the U.S. Geological Survey. - an instrument designed for direct analysis of uranium in water, and which can be conveniently used in a mobile field laboratory. The detection limit for uranium in plant ash (0.05 ppm) by this method is almost an order of magnitude lower than with the fluorometric conventional method. Only 1 of the 74 samples contained uranium below the detection limit of the new method. Accuracy and precision were determined to be satisfactory. Samples of plants growing on mineralized soils and nonmineralized soils show a 15-fold difference in uranium content; whereas the soils themselves (analyzed by delayed neutron activation analysis) show only a 4-fold difference. The method involves acid digestion of ashed tissue, extraction of uranium into ethyl acetate, destruction of the ethyl acetate, dissolution of the residue in 0.005% nitric acid, and measurement. ?? 1981.

Low-Level detections of halogenated volatile organic compounds in groundwater: Use in vulnerability assessments

USGS Publications Warehouse

Plummer, Niel; Busenberg, E.; Eberts, S.M.; Bexfield, L.M.; Brown, C.J.; Fahlquist, L.S.; Katz, B.G.; Landon, M.K.

2008-01-01

Concentrations of halogenated volatile organic compounds (VOCs) were determined by gas chromatography (GC) with an electron-capture detector (GC-ECD) and by gas chromatography with mass spectrometry (GC-MS) in 109 groundwater samples from five study areas in the United States. In each case, the untreated water sample was used for drinking-water purposes or was from a monitoring well in an area near a drinking-water source. The minimum detection levels (MDLs) for 25 VOCs that were identified in GC-ECD chromatograms, typically, were two to more than four orders of magnitude below the GC-MS MDLs. At least six halogenated VOCs were detected in all of the water samples analyzed by GC-ECD, although one or more VOCs were detected in only 43% of the water samples analyzed by GC-MS. In nearly all of the samples, VOC concentrations were very low and presented no known health risk. Most of the low-level VOC detections indicated post-1940s recharge, or mixtures of recharge that contained a fraction of post-1940s water. Concentrations of selected halogenated VOCs in groundwater from natural and anthropogenic atmospheric sources were estimated and used to recognize water samples that are being impacted by nonatmospheric sources. A classification is presented to perform vulnerability assessments at the scale of individual wells using the number of halogenated VOC detections and total dissolved VOC concentrations in samples of untreated drinking water. The low-level VOC detections are useful in vulnerability assessments, particularly for samples in which no VOCs are detected by GC-MS analysis.

Sorbitol, Rubus fruit, and misconception.

PubMed

Lee, Jungmin

2015-01-01

It is unclear how the misunderstanding that Rubus fruits (e.g., blackberries, raspberries) are high in sugar alcohol began, or when it started circulating in the United States. In reality, they contain little sugar alcohol. Numerous research groups have reported zero detectable amounts of sugar alcohol in fully ripe Rubus fruit, with the exception of three out of 82 Rubus fruit samples (cloudberry 0.01 g/100 g, red raspberry 0.03 g/100 g, and blackberry 4.8 g/100 g(∗); (∗)highly unusual as 73 other blackberry samples contained no detectable sorbitol). Past findings on simple carbohydrate composition of Rubus fruit, other commonly consumed Rosaceae fruit, and additional fruits (24 genera and species) are summarised. We are hopeful that this review will clarify Rosaceae fruit sugar alcohol concentrations and individual sugar composition; examples of non-Rosaceae fruit and prepared foods containing sugar alcohol are included for comparison. A brief summary of sugar alcohol and health will also be presented. Published by Elsevier Ltd.

Anthropogenic Organic Compounds in Source and Finished Water from Community Water System Wells in Western and Central Connecticut, 2002-2004

USGS Publications Warehouse

Trombley, Thoams J.; Brown, Craig J.; Delzer, Gregory C.

2007-01-01

A water-quality assessment by the U.S. Geological Survey (USGS) determined the occurrence of anthropogenic (manmade) organic compounds (AOCs) in water from 15 community water system (CWS) wells and associated finished drinking water. The study, which focused on water from the unconfined glacial stratified aquifer in western and central Connecticut, was conducted as part of the USGS National Water-Quality Assessment Program (NAWQA) Source Water-Quality Assessment (SWQA) project and included analysis of water samples for 88 volatile organic compounds (VOCs), 120 pesticides, and 50 other anthropogenic organic compounds (OAOCs). During Phase I of the study, 25 AOCs were detected (12 VOCs, 10 pesticides, and 3 OAOCs) in source-water samples collected from 15 CWS wells sampled once from October 2002 to May 2003. Although concentrations generally were low (less than 1 microgram per liter), four compounds were detected at higher concentrations in ground water from four wells. The most frequently occurring AOCs were detected in more than half of the samples and included chloroform (87 percent), methyl tert-butyl ether (MTBE, 80 percent), 1,1,1-trichloroethane (67 percent), atrazine (60 percent), deethylatrazine (60 percent), perchloroethene (PCE, 53 percent), and simazine (53 percent). Trichloroethene (TCE) was detected in 47 percent of samples. Samples generally contained a mixture of compounds ranging from 2 to 19 detected compounds, with an average of 8 detected compounds per sample. During Phase II of the study, 42 AOCs were detected in source-water samples collected from 10 resampled CWS wells or their associated finished water. Trihalomethanes accounted for most of the VOCs detections with all concentrations less than 1 microgram per liter. Chloroform, the most frequently detected VOC, was found in all source-water and all finished-water samples. As with the Phase I samples, other frequently detected VOCs included MTBE, and the solvents 1,1,1-trichloroethane, PCE, and TCE. Triazine herbicides and their degradation products accounted for most of the detected pesticides.

Determination of ammonium in aqueous samples using new headspace dynamic in-syringe liquid-phase microextraction with in situ derivitazation coupled with liquid chromatography-fluorescence detection.

PubMed

Muniraj, Sarangapani; Yan, Cheing-Tong; Shih, Hou-Kung; Ponnusamy, Vinoth Kumar; Jen, Jen-Fon

2012-11-19

A new simultaneous derivatization and extraction method for the preconcentration of ammonia using new one-step headspace dynamic in-syringe liquid-phase microextraction with in situ derivatization was developed for the trace determination of ammonium in aqueous samples by liquid chromatography with fluorescence detection (LC-FLD). The acceptor phase (as derivatization reagent) containing o-phthaldehyde and sodium sulfite was held within a syringe barrel and immersed in the headspace of sample container. The gaseous ammonia from the alkalized aqueous sample formed a stable isoindole derivative with the acceptor phase inside the syringe barrel through the reciprocated movements of plunger. After derivatization-cum-extraction, the acceptor phase was directly injected into LC-FLD for analysis. Parameters affecting the ammonia evolution and the extraction/derivatization efficiency such as sample matrix, pH, temperature, sampling time, and the composition of derivatization reagent, reaction temperature, and frequency of reciprocated plunger, were studied thoroughly. Results indicated that the maximum extraction efficiency was obtained by using 100μL derivatization reagent in a 1-mL gastight syringe under 8 reciprocated movements of plunger per min to extract ammonia evolved from a 20mL alkalized aqueous solution at 70°C (preheated 4min) with 380rpm stirring for 8min. The detection was linear in the concentration range of 0.625-10μM with the correlation coefficient of 0.9967 and detection limit of 0.33μM (5.6ng mL(-1)) based on SN(-1)=3. The method was applied successfully to determine ammonium in real water samples without any prior cleanup of the samples, and has been proved to be a simple, sensitive, efficient and cost-effective procedure for trace ammonium determination in aqueous samples. Copyright © 2012 Elsevier B.V. All rights reserved.

Performance of polymerase chain reaction for the diagnosis of cystic echinococcosis using serum, urine, and cyst fluid samples

PubMed Central

Chaya, DR; Parija, Subhash Chandra

2014-01-01

Introduction: Cystic echinococcosis (CE) is a chronic zoonosis which presents with variable clinical manifestations. Currently the diagnosis of this disease is based on radiological findings and serological tests which lack specificity. Although antigen detection from the cyst fluid is the most specific, it is seldom done due to the complications involved. Detecting the presence of Echinococcus granulosus specific deoxyribonucleic acid (DNA) by the polymerase chain reaction (PCR) could provide a definitive diagnosis of CE. Materials and Methods: An in-house PCR assay was devised to detect E. granulosus specific DNA in serum, urine and hydatid cyst fluid. The ability of the PCR to detect E. granulosus in the above mentioned samples were observed in comparison with other antigen and antibody detection tests. Results: Serum samples from surgically confirmed patients of CE with ruptured cysts contained the corresponding DNA while the in the majority of cases who had an intact cyst had no DNA of E. granulosus in their serum. DNA of E. granulosus was not found to be excreted in urine. PCR performed equal to antigen detection ELISA while testing hydatid cyst fluid samples. Conclusions: Serum and urine might not serve as useful samples for the molecular diagnosis of cystic echinococcosis. However, PCR can be useful on serum samples to detect ruptured hydatid cysts and on hydatid cyst fluid to confirm the parasitic diagnosis. PMID:24754027

Performance of polymerase chain reaction for the diagnosis of cystic echinococcosis using serum, urine, and cyst fluid samples.

PubMed

Chaya, Dr; Parija, Subhash Chandra

2014-01-01

Cystic echinococcosis (CE) is a chronic zoonosis which presents with variable clinical manifestations. Currently the diagnosis of this disease is based on radiological findings and serological tests which lack specificity. Although antigen detection from the cyst fluid is the most specific, it is seldom done due to the complications involved. Detecting the presence of Echinococcus granulosus specific deoxyribonucleic acid (DNA) by the polymerase chain reaction (PCR) could provide a definitive diagnosis of CE. An in-house PCR assay was devised to detect E. granulosus specific DNA in serum, urine and hydatid cyst fluid. The ability of the PCR to detect E. granulosus in the above mentioned samples were observed in comparison with other antigen and antibody detection tests. Serum samples from surgically confirmed patients of CE with ruptured cysts contained the corresponding DNA while the in the majority of cases who had an intact cyst had no DNA of E. granulosus in their serum. DNA of E. granulosus was not found to be excreted in urine. PCR performed equal to antigen detection ELISA while testing hydatid cyst fluid samples. Serum and urine might not serve as useful samples for the molecular diagnosis of cystic echinococcosis. However, PCR can be useful on serum samples to detect ruptured hydatid cysts and on hydatid cyst fluid to confirm the parasitic diagnosis.

Development of a new pentaplex real-time PCR assay for the identification of poly-microbial specimens containing Staphylococcus aureus and other staphylococci, with simultaneous detection of staphylococcal virulence and methicillin resistance markers.

PubMed

Okolie, Charles E; Wooldridge, Karl G; Turner, David P; Cockayne, Alan; James, Richard

2015-06-01

Staphylococcus aureus strains harbouring genes encoding virulence and antibiotic resistance are of public health importance. In clinical samples, pathogenic S. aureus is often mixed with putatively less pathogenic coagulase-negative staphylococci (CoNS), both of which can harbour mecA, the gene encoding staphylococcal methicillin-resistance. There have been previous attempts at distinguishing MRSA from MRCoNS, most of which were based on the detection of one of the pathognomonic markers of S. aureus, such as coa, nuc or spa. That approach might suffice for discrete colonies and mono-microbial samples; it is inadequate for identification of clinical specimens containing mixtures of S. aureus and CoNS. In the present study, a real-time pentaplex PCR assay has been developed which simultaneously detects markers for bacteria (16S rRNA), coagulase-negative staphylococcus (cns), S. aureus (spa), Panton-Valentine leukocidin (pvl) and methicillin resistance (mecA). Staphylococcal and non-staphylococcal bacterial strains (n = 283) were used to validate the new assay. The applicability of this test to clinical samples was evaluated using spiked blood cultures (n = 43) containing S. aureus and CoNS in mono-microbial and poly-microbial models, which showed that the 5 markers were all detected as expected. Cycling completes within 1 h, delivering 100% specificity, NPV and PPV with a detection limit of 1.0 × 10(1) to 3.0 × 10(1) colony forming units (CFU)/ml, suggesting direct applicability in routine diagnostic microbiology. This is the most multiplexed real-time PCR-based PVL-MRSA assay and the first detection of a unique marker for CoNS without recourse to the conventional elimination approach. There was no evidence that this new assay produced invalid/indeterminate test results. Copyright © 2015 Elsevier Ltd. All rights reserved.

Presence of Emerging Per- and Polyfluoroalkyl Substances (PFASs) in River and Drinking Water near a Fluorochemical Production Plant in the Netherlands.

PubMed

Gebbink, Wouter A; van Asseldonk, Laura; van Leeuwen, Stefan P J

2017-10-03

The present study investigated the presence of legacy and emerging per- and polyfluoroalkyl substances (PFASs) in river water collected in 2016 up- and downstream from a fluorochemical production plant, as well as in river water from control sites, in The Netherlands. Additionally, drinking water samples were collected from municipalities in the vicinity from the production plant, as well as in other regions in The Netherlands. The PFOA replacement chemical GenX was detected at all downstream river sampling sites with the highest concentration (812 ng/L) at the first sampling location downstream from the production plant, which was 13 times higher than concentrations of sum perfluoroalkylcarboxylic acids and perfluoroalkanesulfonates (∑PFCA+∑PFSA). Using high resolution mass spectrometry, 11 polyfluoroalkyl acids belonging to the C 2n H 2n F 2n O 2 , C 2n H 2n+2 F 2n SO 4 or C 2n+1 H 2n F 2n+4 SO 4 homologue series were detected, but only in downstream water samples. These emerging PFASs followed a similar distribution as GenX among the downstream sampling sites, suggesting the production plant as the source. Polyfluoroalkyl sulfonates (C 2n H 2 F 4n SO 3 ) were detected in all collected river water samples, and therefore appear to be ubiquitous contaminants in Dutch rivers. GenX was also detected in drinking water collected from 3 out of 4 municipalities in the vicinity of the production plant, with highest concentration at 11 ng/L. Drinking water containing the highest level of GenX also contained two C 2n H 2n F 2n O 2 homologues.

Presence of Emerging Per- and Polyfluoroalkyl Substances (PFASs) in River and Drinking Water near a Fluorochemical Production Plant in the Netherlands

PubMed Central

2017-01-01

The present study investigated the presence of legacy and emerging per- and polyfluoroalkyl substances (PFASs) in river water collected in 2016 up- and downstream from a fluorochemical production plant, as well as in river water from control sites, in The Netherlands. Additionally, drinking water samples were collected from municipalities in the vicinity from the production plant, as well as in other regions in The Netherlands. The PFOA replacement chemical GenX was detected at all downstream river sampling sites with the highest concentration (812 ng/L) at the first sampling location downstream from the production plant, which was 13 times higher than concentrations of sum perfluoroalkylcarboxylic acids and perfluoroalkanesulfonates (∑PFCA+∑PFSA). Using high resolution mass spectrometry, 11 polyfluoroalkyl acids belonging to the C2nH2nF2nO2, C2nH2n+2F2nSO4 or C2n+1H2nF2n+4SO4 homologue series were detected, but only in downstream water samples. These emerging PFASs followed a similar distribution as GenX among the downstream sampling sites, suggesting the production plant as the source. Polyfluoroalkyl sulfonates (C2nH2F4nSO3) were detected in all collected river water samples, and therefore appear to be ubiquitous contaminants in Dutch rivers. GenX was also detected in drinking water collected from 3 out of 4 municipalities in the vicinity of the production plant, with highest concentration at 11 ng/L. Drinking water containing the highest level of GenX also contained two C2nH2nF2nO2 homologues. PMID:28853567

Comparing efficiency of American Fisheries Society standard snorkeling techniques to environmental DNA sampling techniques

USGS Publications Warehouse

Ulibarri, Roy M.; Bonar, Scott A.; Rees, Christopher B.; Amberg, Jon J.; Ladell, Bridget; Jackson, Craig

2017-01-01

Analysis of environmental DNA (eDNA) is an emerging technique used to detect aquatic species through water sampling and the extraction of biological material for amplification. Our study compared the efficacy of eDNA methodology to American Fisheries Society (AFS) standard snorkeling surveys with regard to detecting the presence of rare fish species. Knowing which method is more efficient at detecting target species will help managers to determine the best way to sample when both traditional sampling methods and eDNA sampling are available. Our study site included three Navajo Nation streams that contained Navajo Nation Genetic Subunit Bluehead Suckers Catostomus discobolus and Zuni Bluehead Suckers C. discobolus yarrowi. We first divided the entire wetted area of streams into consecutive 100-m reaches and then systematically selected 10 reaches/stream for snorkel and eDNA surveys. Surface water samples were taken in 10-m sections within each 100-m reach, while fish presence was noted via snorkeling in each 10-m section. Quantitative PCR was run on each individual water sample in quadruplicate to test for the presence or absence of the target species. With eDNA sampling techniques, we were able to positively detect both species in two out of the three streams. Snorkeling resulted in positive detection of both species in all three streams. In streams where the target species were detected with eDNA sampling, snorkeling detected fish at 11–29 sites/stream, whereas eDNA detected fish at 3–12 sites/stream. Our results suggest that AFS standard snorkeling is more effective than eDNA for detecting target fish species. To improve our eDNA procedures, the amount of water collected and tested should be increased. Additionally, filtering water on-site may improve eDNA techniques for detecting fish. Future research should focus on standardization of eDNA sampling to provide a widely operational sampling tool.

[Study of methods of decalcification for making united slices of tooth and affiliated periodontic tissues].

PubMed

Wang, Yu; Mu, Ya-bing; Miao, Lei-ying; Sun, Hong-chen; Li, Cheng-ku

2007-03-01

To study the methods of decalcification for making united slices of tooth and affiliated periodontic tissues. Twenty-one samples containing dog molars and affiliated periodontic tissues were divided into seven mean groups. The pH value of solution, time of decalcification, weight and volume of samples, and content of decalcified calcium were detected. The slices were observed by HE, specific, and immunohistochemical stain. The velocity of decalcification increased with decrease of solution pH. The weight of samples lightened by 37.61%, the volume reduced by 25.97% on average, and calcium decalcified was 174.49 mg per gram humid samples. The EDTA decalcification was slowest, but it was best. Decalcification was fast in Plank-Rycho solution while the section was worst, and faster in the formyl solution containing aluminium chloride than in EDTA, and the section was better. The 50% formyl solution containing aluminium chloride is an ideal decalcifying solution.

Masking of endotoxin in surfactant samples: Effects on Limulus-based detection systems.

PubMed

Reich, Johannes; Lang, Pierre; Grallert, Holger; Motschmann, Hubert

2016-09-01

Over the last few decades Limulus Amebocyte Lysate (LAL) has been the most sensitive method for the detection of endotoxins (Lipopolysaccharides) and is well accepted in a broad field of applications. Recently, Low Endotoxin Recovery (LER) in biopharmaceutical drug products has been noticed, whereby the detection of potential endotoxin contaminations is not ensured. Notably, most of these drug products contain surfactants, which can have crucial effects on the detectability of endotoxin. In order to analyze the driving forces of LER, endotoxin detection in samples containing nonionic surfactants in various buffer systems was investigated. The results show that the process of LER is kinetically controlled and temperature-dependent. Furthermore, only the simultaneous presence of nonionic surfactants and components capable of forming metal complexes resulted in LER. In addition, capacity experiments show that even hazardous amounts of endotoxin can remain undetectable within such formulation compositions. In conclusion, the LER phenomenon is caused by endotoxin masking and not by test interference. In this process, the supramolecular structure of endotoxin is altered and exhibits only a limited susceptibility in binding to the Factor C of Limulus-based detection systems. We propose a two-step mechanism of endotoxin masking by complex forming agents and nonionic surfactants. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Detection of Cryptosporidium and Giardia in clinical laboratories in Europe--a comparative study.

PubMed

Manser, M; Granlund, M; Edwards, H; Saez, A; Petersen, E; Evengard, B; Chiodini, P

2014-01-01

To determine the routine diagnostic methods used and compare the performance in detection of oocysts of Cryptosporidium species and cysts of Giardia intestinalis in faecal samples by European specialist parasitology laboratories and European clinical laboratories. Two sets of seven formalin-preserved faecal samples, one containing cysts of Giardia intestinalis and the other, containing oocysts of Cryptosporidium, were sent to 18 laboratories. Participants were asked to examine the specimens using their routine protocol for detecting these parasites and state the method(s) used. Eighteen laboratories answered the questionnaire. For detection of Giardia, 16 of them used sedimentation/concentration followed by light microscopy. Using this technique the lower limit of detection of Giardia was 17.2 cysts/mL of faeces in the best performing laboratories. Only three of 16 laboratories used fluorescent-conjugated antibody-based microscopy. For detection of Cryptosporidium acid-fast staining was used by 14 of the 17 laboratories that examined the samples. With this technique the lower limit of detection was 976 oocysts/mL of faeces. Fluorescent-conjugated antibody-based microscopy was used by only five of the 17 laboratories. There was variation in the lower limit of detection of cysts of Giardia and oocysts of Cryptosporidium between laboratories using the same basic microscopic methods. Fluorescent-conjugated antibody-based microscopy was not superior to light microscopy under the conditions of this study. There is a need for a larger-scale multi-site comparison of the methods used for the diagnosis of these parasites and the development of a Europe-wide laboratory protocol based upon its findings. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data

PubMed Central

Navarro, Pedro J.; Fernández, Carlos; Borraz, Raúl; Alonso, Diego

2016-01-01

This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution) is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN), Naïve Bayes classifier (NBC), and Support Vector Machine (SVM). These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%), accuracy (96.2%) and specificity (96.8%). PMID:28025565

Doppler-corrected differential detection system

NASA Technical Reports Server (NTRS)

Simon, Marvin K. (Inventor); Divsalar, Dariush (Inventor)

1991-01-01

Doppler in a communication system operating with a multiple differential phase-shift-keyed format (MDPSK) creates an adverse phase shift in an incoming signal. An open loop frequency estimation is derived from a Doppler-contaminated incoming signal. Based upon the recognition that, whereas the change in phase of the received signal over a full symbol contains both the differentially encoded data and the Doppler induced phase shift, the same change in phase over half a symbol (within a given symbol interval) contains only the Doppler induced phase shift, and the Doppler effect can be estimated and removed from the incoming signal. Doppler correction occurs prior to the receiver's final output of decoded data. A multiphase system can operate with two samplings per symbol interval at no penalty in signal-to-noise ratio provided that an ideal low pass pre-detection filter is employed, and two samples, at 1/4 and 3/4 of the symbol interval T sub s, are taken and summed together prior to incoming signal data detection.

A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data.

PubMed

Navarro, Pedro J; Fernández, Carlos; Borraz, Raúl; Alonso, Diego

2016-12-23

This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution) is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN), Naïve Bayes classifier (NBC), and Support Vector Machine (SVM). These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%), accuracy (96.2%) and specificity (96.8%).

Frequent hepatitis E virus contamination in food containing raw pork liver, France.

PubMed

Pavio, Nicole; Merbah, Thiziri; Thébault, Anne

2014-11-01

Food products containing raw pork liver are suspected to be vehicles for transmission of hepatitis E virus. Four categories of food products, comprising 394 samples, were analyzed to determine hepatitis E virus prevalence. Virus was detected in 3%-30% of the different categories. Phylogenetic analysis showed high identity with human and swine sequences.

High-Collection-Efficiency Fluorescence Detection Cell

NASA Technical Reports Server (NTRS)

Hanisco, Thomas; Cazorla, Maria; Swanson, Andrew

2013-01-01

A new fluorescence cell has been developed for the laser induced fluorescence (LIF) detection of formaldehyde. The cell is used to sample a flow of air that contains trace concentrations of formaldehyde. The cell provides a hermetically sealed volume in which a flow of air containing formaldehyde can be illuminated by a laser. The cell includes the optics for transmitting the laser beam that is used to excite the formaldehyde and for collecting the resulting fluorescence. The novelty of the cell is its small size and simple design that provides a more robust and cheaper alternative to the state of the art. Despite its simplicity, the cell provides the same sensitivity to detection as larger, more complicated cells.

Detection of hepatitis A viral antigen by radioimmunoassay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hollinger, F.B.; Bradley, D.W.; Maynard, J.E.

1975-11-01

With coded samples, the effectiveness and specificity of a micro-SPIRA procedure for rapidly and quantitatively detecting type A hepatitis-associated antigen in large numbers of specimens from infected liver, stool, or serum has been demonstrated. Samples which were judged to be negative by IEM were found to contain significant levels of HAV antigen by this immunoradiometric technique. The detection of significant levels of HAV antigen in infected chimpanzees supports epidemiologic evidence of viremia during the acute stage of the disease. The results of this study suggest that the diagnosis of type A hepatitis by a convention serologic procedure may now bemore » at hand. (auth)« less

The 1064 nm laser-induced breakdown spectroscopy (LIBS) inspection to detect the nutrient elements in freshly cut carrot samples

NASA Astrophysics Data System (ADS)

Yudasari, N.; Prasetyo, S.; Suliyanti, M. M.

2018-03-01

The laser-induced breakdown spectroscopy (LIBS) technique was applied to detect the nutrient elements contained in fresh carrot. Nd:YAG laser the wavelength of 1064 nm was employed in the experiments for ablation. Employing simple set-up of LIBS and preparing the sample with less step method, we are able to detect 18 chemical elements including some fundamental element of carrot, i.e Mg, Al, Fe, Mn, Ti, Ca, and Mn. By applying normalized profiles calculation on some of the element, we are able to compare the concentration level of each element of the outer and inner part of carrot.

Anthropogenic Organic Compounds in Ground Water and Finished Water of Community Water Systems near Dayton, Ohio, 2002-04

USGS Publications Warehouse

Thomas, Mary Ann

2007-01-01

Source water for 15 community-water-system (CWS) wells in the vicinity of Dayton, Ohio, was sampled to evaluate the occurrence of 258 anthropogenic compounds (AOCs). At least one AOC was detected in 12 of the 15 samples. Most samples contained a mixture of compounds (average of four compounds per sample). The compounds that were detected in more than 30 percent of the samples included three volatile organic compounds (VOCs) (trichloroethene, chloroform, and 1,1,1-trichloroethane) and four pesticides or pesticide breakdown products (prometon, simazine, atrazine, and deethylatrazine). In general, VOCs were detected at higher concentrations than pesticides were; among the VOCs, the maximum detected concentration was 4.8 ?g/L (for trichloroethene), whereas among the pesticides, the maximum detected concentration was 0.041 ?g/L (for atrazine). During a later phase of the study, samples of source water from five CWS wells were compared to samples of finished water associated with each well. In general, VOC detections were higher in finished water than in source water, primarily due to the occurrence of trihalomethanes, which are compounds that can form during the treatment process. In contrast, pesticide detections were relatively similar between source- and finished-water samples. To assess the human-health relevance of the data, concentrations of AOCs were compared to their respective human-health benchmarks. For pesticides, the maximum detected concentrations were at least 2 orders of magnitude less than the benchmark values. However, three VOCs - trichloroethene, carbon tetrachloride, and tetrachloromethane - were detected at concentrations that approach human-health benchmarks and therefore may warrant inclusion in a low-concentration, trends monitoring program.

Hog Charm II tetracycline test screening results compared with a liquid chromatography tandem mass spectrometry 10-μg/kg method.

PubMed

Salter, Robert; Holmes, Steven; Legg, David; Coble, Joel; George, Bruce

2012-02-01

Pork tissue samples that tested positive and negative by the Charm II tetracycline test screening method in the slaughter plant laboratory were tested with the modified AOAC International liquid chromatography tandem mass spectrometry (LC-MS-MS) method 995.09 to determine the predictive value of the screening method at detecting total tetracyclines at 10 μg/kg of tissue, in compliance with Russian import regulations. There were 218 presumptive-positive tetracycline samples of 4,195 randomly tested hogs. Of these screening test positive samples, 83% (182) were positive, >10 μg/kg by LC-MS-MS; 12.8% (28) were false violative, greater than limit of detection (LOD) but <10 μg/kg; and 4.2% (8) were not detected at the LC-MS-MS LOD. The 36 false-violative and not-detected samples represent 1% of the total samples screened. Twenty-seven of 30 randomly selected tetracycline screening negative samples tested below the LC-MS-MS LOD, and 3 samples tested <3 μg/kg chlortetracycline. Results indicate that the Charm II tetracycline test is effective at predicting hogs containing >10 μg/kg total tetracyclines in compliance with Russian import regulations.

Direct detection of Mycobacterium avium in environmental water and scale samples by loop-mediated isothermal amplification.

PubMed

Nishiuchi, Yukiko; Tamaru, Aki; Suzuki, Yasuhiko; Kitada, Seigo; Maekura, Ryoji; Tateishi, Yoshitaka; Niki, Mamiko; Ogura, Hisashi; Matsumoto, Sohkichi

2014-06-01

We previously demonstrated the colonization of Mycobacterium avium complex in bathrooms by the conventional culture method. In the present study, we aimed to directly detect M. avium organisms in the environment using loop-mediated isothermal amplification (LAMP), and to demonstrate the efficacy of LAMP by comparing the results with those obtained by culture. Our data showed that LAMP analysis has detection limits of 100 fg DNA/reaction for M. avium. Using an FTA(®) elute card, DNA templates were extracted from environmental samples from bathrooms in the residences of 29 patients with pulmonary M. avium disease. Of the 162 environmental samples examined, 143 (88%) showed identical results by both methods; 20 (12%) and 123 (76%) samples were positive and negative, respectively, for M. avium. Of the remaining 19 samples (12%), seven (5%) and 12 (7%) samples were positive by the LAMP and culture methods, respectively. All samples that contained over 20 colony forming units/primary isolation plate, as measured by the culture method, were also positive by the LAMP method. Our data demonstrate that the combination of the FTA elute card and LAMP can facilitate prompt detection of M. avium in the environment.

Sources of Listeria monocytogenes Contamination in a Cold-Smoked Rainbow Trout Processing Plant Detected by Pulsed-Field Gel Electrophoresis Typing

PubMed Central

Autio, Tiina; Hielm, Sebastian; Miettinen, Maria; Sjöberg, Anna-Maija; Aarnisalo, Kaarina; Björkroth, Johanna; Mattila-Sandholm, Tiina; Korkeala, Hannu

1999-01-01

Sites of Listeria monocytogenes contamination in a cold-smoked rainbow trout (Oncorhynchus mykiss) processing plant were detected by sampling the production line, environment, and fish at different production stages. Two lots were monitored. The frequency of raw fish samples containing L. monocytogenes was low. During processing, the frequency of fish contaminated with L. monocytogenes clearly rose after brining, and the most contaminated sites of the processing plant were the brining and postbrining areas. A total of 303 isolates from the raw fish, product, and the environment were characterized by pulsed-field gel electrophoresis (PFGE). PFGE yielded nine pulsotypes, which formed four clusters. The predominating L. monocytogenes pulsotypes of the final product were associated with brining and slicing, whereas contaminants of raw fish were not detected in the final product. Air-mediated contamination in the plant could not be proved. In accordance with these results, an L. monocytogenes eradication program was planned. The use of hot steam, hot air, and hot water seemed to be useful in eliminating L. monocytogenes. None of the control samples taken in the 5 months after the eradication program was implemented contained L. monocytogenes. PMID:9872773

Determination of thiopental in urine sample with high-performance liquid chromatography using iodine-azide reaction as a postcolumn detection system.

PubMed

Zakrzewski, Robert; Ciesielski, Witold

2005-09-25

The reaction between iodine and azide ions induced by thiopental was utilized as a postcolumn reaction for chromatographic determination of thiopental. The method is based on the separation of thiopental on an Nova-Pak CN HP column with an acetonitrile-aqueous solution of sodium azide as a mobile phase, followed by spectrophotometric measurement of the residual iodine (lambda=350 nm) from the postcolumn iodine-azide reaction induced by thiopental after mixing an iodine solution containing iodide ions with the column effluent containing azide ions and thiopental. Chromatograms obtained for thiopental showed negative peaks as a result of the decrease in background absorbance. The detection limit (defined as S/N=3) was 20 nM (0.4 pmol injected amount) for thiopental. Calibration graphs, plotted as peak area versus concentrations, were linear from 40 nM. The elaborated method was applied to determine thiopental in urine samples. The detection limit (defined as S/N=3) was 0.025 nmol/ml urine. Calibration graphs, plotted as peak area versus concentrations, were linear from 0.05 nmol/ml urine. Authentic urine samples were analyzed, thiopental was determined at nmol/ml urine level.

Self-filling and self-purging apparatus for detecting spontaneous radiation from substances in fluids

DOEpatents

Larson, I. Lauren; Chiles, Marion M.; Miller, V. Clint

1993-01-01

Disclosed herein is a radiation detector providing for the in situ automatic sampling of fluids containing substances emitting radiation, especially Cerenkov radiation. The detector permits sampling within well casings and is self-purging such that no additional provisions must be established for the storage and disposal of contaminated fluids.

Occurrence of fungicides and other pesticides in surface water, groundwater, and sediment from three targeted-use areas in the United States, 2009

USGS Publications Warehouse

Orlando, James L.; Smalling, Kelly L.; Reilly, Timothy J.; Boehlke, Adam; Meyer, Michael T.; Kuivila, Kathryn

2013-01-01

Surface-water, groundwater, and suspended- and bedsediment samples were collected in three targeted-use areas in the United States where potatoes were grown during 2009 and analyzed for an extensive suite of fungicides and other pesticides by gas chromatograph/mass spectrometry and liquid chromatography with tandem mass spectrometry. Fungicides were detected in all environmental matrices sampled during the study. The most frequently detected fungicides were azoxystrobin, boscalid, chlorothalonil, and pyraclostrobin. Other pesticides that were detected frequently included amino phosphonic acid (AMPA), atrazine, metolaclor, and the organochlorine insecticide p,p’-DDT and its degradates p,p’-DDD and p,p’-DDE. A greater number of pesticides were detected in surface water relative to the other environmental matrices sampled, and at least one pesticide was detected in 62 of the 63 surfacewater samples. The greatest numbers of pesticides and the maximum observed concentrations for most pesticides were measured in surface-water samples from Idaho. In eight surface- water samples (six from Idaho and two from Wisconsin), concentrations of bifenthrin, metolachlor, or malathion exceeded U.S. Environmental Protection Agency freshwater aquatic-life benchmarks for chronic toxicity to invertebrates. Thirteen pesticides, including seven fungicides, were detected in groundwater samples. Shallow groundwater samples collected beneath recently harvested potato fields contained more pesticides and had higher concentrations of pesticides than samples collected from other groundwater sources sampled during the study. Generally, pesticide concentrations were lower in groundwater samples than in surfacewater or sediment samples, with the exception of the fungicide boscalid, which was found to have its highest concentration in a shallow groundwater sample collected in Wisconsin. Thirteen pesticides, including four fungicides, were detected in suspended-sediment samples. The most frequently detected compounds were the fungicides boscalid, pyraclostrobin, and zoxamide, and the degradates p,p’-DDD and p,p’-DDE. Twenty pesticides, including six fungicides, were detected in bed-sediment samples. The most frequently detected compounds were pyraclostrobin, p,p’-DDT, p,p’-DDD, and p,p’-DDE.

Immunochemical Studies on Selected Marine Toxins

DTIC Science & Technology

1993-05-31

6) Critical evaluation of established immunoassays was made through analysis of various naturally -occurring MCYST containing samples. We found that...hepatopancreas of toxic clams rather than the soft tissues. Microcystin could also be detected by ELISA in naturally -occurring algae bloom samples that...antibody against MCYST 13 7. Other immunochemical studies on MCYST 13 a. Analysis of MCYST in algae and various samples collected from naturally -occurring

Patulin surveillance in apple cider and juice marketed in Michigan.

PubMed

Harris, Kerri L; Bobe, Gerd; Bourquin, Leslie D

2009-06-01

Patulin is the most common mycotoxin found in apples and apple juices. The objective of this study was to determine the concentrations of patulin in (i) apple cider produced and marketed by Michigan apple cider mills during the fall seasons of 2002 to 2003 and 2003 to 2004 and (ii) apple juice and cider, including shelf-stable products, marketed in retail grocery stores in Michigan throughout 2005 and 2006. End product samples (n=493) obtained from 104 Michigan apple cider mills were analyzed for patulin concentration by using solid-phase extraction followed by high-performance liquid chromatography. Patulin was detected (> or =4 microg/liter) in 18.7% of all cider mill samples, with 11 samples (2.2%) having patulin concentrations of > or =50 microg/liter. A greater percentage of cider samples obtained from mills using thermal pasteurization contained detectable patulin (28.4%) than did those from mills using UV light radiation (13.5%) or no pathogen reduction treatment (17.0%). Among retail grocery store samples (n=159), 23% of apple juice and cider samples contained detectable patulin, with 18 samples (11.3%) having patulin concentrations of > or =50 microg/liter. The U.S. Food and Drug Administration (FDA) action level for patulin is 50 microg/kg. Some apple juice samples obtained from retail grocery stores had exceptionally high patulin concentrations, ranging up to 2700 microg/liter. Collectively, these results indicate that most apple cider and juice test samples from Michigan were below the FDA action level for patulin but that certain apple cider and juice processors have inadequate controls over patulin concentrations in final products. The industry, overall, should focus on improved quality of fruit used in juice production and improve culling procedures to reduce patulin concentrations.

Quantification of organic solvents in aquatic toys and swimming learning devices and evaluation of their influence on the smell properties of the corresponding products.

PubMed

Wiedmer, Christoph; Buettner, Andrea

2018-04-01

Based on the observation that the characteristic odour of inflatable aquatic toys for children is predominantly caused by residues of hazardous organic solvents, the concentrations of cyclohexanone, isophorone and phenol were determined in a selection of 20 products obtained from online suppliers located in Germany. Analytes were extracted with dichloromethane after the addition of non-labelled internal standards, and the volatile fraction was isolated using solvent-assisted flavour evaporation (SAFE). Extracts were then concentrated by Vigreux distillation and analysed by means of gas chromatography with mass spectrometric detection (GC-MS). Furthermore, each sample was evaluated regarding its specific olfactory properties by an expert sensory panel. While some samples did not contain significant amounts of solvents, cyclohexanone concentrations above the lower limit of quantification (LLOQ) were determined in nine samples with six samples containing high concentrations ranging from about 1 to 7 g/kg cyclohexanone. Isophorone concentrations above the LLOQ were observed in eight samples. Thereby, six products contained between 0.3 and 1.6 g/kg isophorone and the remaining two samples contained even about 5 g/kg isophorone, each. Likewise, phenol concentrations exceeded the LLOQ in 14 cases, with four samples containing elevated amounts ranging from about 140 to 280 mg/kg phenol.

Detection of Illicit Drugs with the EURITRACK System

NASA Astrophysics Data System (ADS)

Perot, B.; Carasco, C.; Valkovic, V.; Sudac, D.; Franulovic, A.

2009-03-01

The EURopean Illicit TRAfficking Countermeasures Kit (EURITRACK) inspection system has been developed within the 6th EU Framework Program to complement X-ray scanners in the detection of explosives and other illicit materials hidden in cargo containers. Gamma rays are produced inside the cargo materials by 14 MeV tagged neutron beams, which yields information about the chemical composition of the transported goods. In the beginning of year 2007, the EURITRACK system was implemented in the Seaport of Rijeka, Croatia, primarily to carry out a demonstration using real containers to conduct a series of detection tests. This article reports tests performed with real samples of illicit drugs hidden in a metallic cargo with an average density of 0.2 g/cm3. Heroin and cocaine have been distinguished from benign substances based on their chemical composition. Marijuana, which chemical composition is similar to benign materials, cannot be distinguished from common organic goods. However, the detection of an unexpected organic substance inside the metallic cargo indicates that a suspicious object has been hidden in the container.

Mitochondrial DNA Targets Increase Sensitivity of Malaria Detection Using Loop-Mediated Isothermal Amplification ▿

PubMed Central

Polley, Spencer D.; Mori, Yasuyoshi; Watson, Julie; Perkins, Mark D.; González, Iveth J.; Notomi, Tsugunori; Chiodini, Peter L.; Sutherland, Colin J.

2010-01-01

Loop-mediated isothermal amplification (LAMP) of DNA offers the ability to detect very small quantities of pathogen DNA following minimal tissue sample processing and is thus an attractive methodology for point-of-care diagnostics. Previous attempts to diagnose malaria by the use of blood samples and LAMP have targeted the parasite small-subunit rRNA gene, with a resultant sensitivity for Plasmodium falciparum of around 100 parasites per μl. Here we describe the use of mitochondrial targets for LAMP-based detection of any Plasmodium genus parasite and of P. falciparum specifically. These new targets allow routine amplification from samples containing as few as five parasites per μl of blood. Amplification is complete within 30 to 40 min and is assessed by real-time turbidimetry, thereby offering rapid diagnosis with greater sensitivity than is achieved by the most skilled microscopist or antigen detection using lateral flow immunoassays. PMID:20554824

Multi-chamber nucleic acid amplification and detection device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dugan, Lawrence

A nucleic acid amplification and detection device includes an amplification cartridge with a plurality of reaction chambers for containing an amplification reagent and a visual detection reagent, and a plurality of optically transparent view ports for viewing inside the reaction chambers. The cartridge also includes a sample receiving port which is adapted to receive a fluid sample and fluidically connected to distribute the fluid sample to the reaction chamber, and in one embodiment, a plunger is carried by the cartridge for occluding fluidic communication to the reaction chambers. The device also includes a heating apparatus having a heating element whichmore » is activated by controller to generate heat when a trigger event is detected. The heating apparatus includes a cartridge-mounting section which positioned a cartridge in thermal communication with the heating element so that visual changes to the contents of the reaction chambers are viewable through the view ports.« less

Analysis of microdialysate monoamines, including noradrenaline, dopamine and serotonin, using capillary ultra-high performance liquid chromatography and electrochemical detection.

PubMed

Ferry, Barbara; Gifu, Elena-Patricia; Sandu, Ioana; Denoroy, Luc; Parrot, Sandrine

2014-03-01

Electrochemical methods are very often used to detect catecholamine and indolamine neurotransmitters separated by conventional reverse-phase high performance liquid chromatography (HPLC). The present paper presents the development of a chromatographic method to detect monoamines present in low-volume brain dialysis samples using a capillary column filled with sub-2μm particles. Several parameters (repeatability, linearity, accuracy, limit of detection) for this new ultrahigh performance liquid chromatography (UHPLC) method with electrochemical detection were examined after optimization of the analytical conditions. Noradrenaline, adrenaline, serotonin, dopamine and its metabolite 3-methoxytyramine were separated in 1μL of injected sample volume; they were detected above concentrations of 0.5-1nmol/L, with 2.1-9.5% accuracy and intra-assay repeatability equal to or less than 6%. The final method was applied to very low volume dialysates from rat brain containing monoamine traces. The study demonstrates that capillary UHPLC with electrochemical detection is suitable for monitoring dialysate monoamines collected at high sampling rate. Copyright © 2014 Elsevier B.V. All rights reserved.

Integration of Microdialysis Sampling and Microchip Electrophoresis with Electrochemical Detection

PubMed Central

Mecker, Laura C.; Martin, R. Scott

2009-01-01

Here we describe the fabrication, optimization, and application of a microfluidic device that integrates microdialysis (MD) sampling, microchip electrophoresis (ME), and electrochemical detection (EC). The manner in which the chip is produced is reproducible and enables the fixed alignment of the MD/ME and ME/EC interfaces. Poly(dimethylsiloxane) (PDMS) -based valves were used for the discrete injection of sample from the hydrodynamic MD dialysate stream into a separation channel for analysis with ME. To enable the integration of ME with EC detection, a palladium decoupler was used to isolate the high voltages associated with electrophoresis from micron-sized carbon ink detection electrodes. Optimization of the ME/EC interface was needed to allow the use of biologically appropriate perfusate buffers containing high salt content. This optimization included changes in the fabrication procedure, increases in the decoupler surface area, and a programmed voltage shutoff. The ability of the MD/ME/EC system to sample a biological system was demonstrated by using a linear probe to monitor the stimulated release of dopamine from a confluent layer of PC 12 cells. To our knowledge, this is the first report of a microchip-based system that couples microdialysis sampling with microchip electrophoresis and electrochemical detection. PMID:19551945

Vapor permeation-stepwise injection simultaneous determination of methanol and ethanol in biodiesel with voltammetric detection.

PubMed

Shishov, Andrey; Penkova, Anastasia; Zabrodin, Andrey; Nikolaev, Konstantin; Dmitrenko, Maria; Ermakov, Sergey; Bulatov, Andrey

2016-02-01

A novel vapor permeation-stepwise injection (VP-SWI) method for the determination of methanol and ethanol in biodiesel samples is discussed. In the current study, stepwise injection analysis was successfully combined with voltammetric detection and vapor permeation. This method is based on the separation of methanol and ethanol from a sample using a vapor permeation module (VPM) with a selective polymer membrane based on poly(phenylene isophtalamide) (PA) containing high amounts of a residual solvent. After the evaporation into the headspace of the VPM, methanol and ethanol were transported, by gas bubbling, through a PA membrane to a mixing chamber equipped with a voltammetric detector. Ethanol was selectively detected at +0.19 V, and both compounds were detected at +1.20 V. Current subtractions (using a correction factor) were used for the selective determination of methanol. A linear range between 0.05 and 0.5% (m/m) was established for each analyte. The limits of detection were estimated at 0.02% (m/m) for ethanol and methanol. The sample throughput was 5 samples h(-1). The method was successfully applied to the analysis of biodiesel samples. Copyright © 2015 Elsevier B.V. All rights reserved.

An environmental DNA assay for detecting Arctic grayling in the upper Missouri River basin, North America

Treesearch

K. J. Carim; J. C. S. Dysthe; Michael Young; Kevin McKelvey; Michael Schwartz

2016-01-01

The upper Missouri River basin in the northwestern US contains disjunct Arctic grayling (Thymallus arcticus) populations of conservation concern. To assist efforts aimed at understanding Artic grayling distribution, we developed a quantitative PCR assay to detect the presence of Arctic grayling DNA in environmental samples. The assay amplified low...

Concentration of infectious hematopoietic necrosis virus from water samples by tangential flow filtration and polyethylene glycol precipitation

USGS Publications Warehouse

Batts, W.N.; Winton, J.R.

1989-01-01

Infectious hematopoietic necrosis virus (IHNV) was concentrated from water samples by polyethylene glycol (PEG) precipitation, tangential flow filtration (TFF), and by a combination of TFF followed by PEG precipitation of the retentate. Used alone, PEG increased virus titers more than 200-fold, and the efficiency of recovery was as great as 100%. Used alone, TFF concentrated IHNV more than 20-fold, and average recovery was 70%. When the two techniques were combined, 10-L water samples were reduced to about 300 mL by TFF and the virus was precipitated with PEG into a 1 to 2 g pellet; total recovery was as great as 100%. The combined techniques were used to isolate IHNV from water samples taken from a river containing adult sockeye salmon (Oncorhynchus nerka) and from a hatchery pond containing adult spring chinook salmon (O. tshawytscha). The combination of these methods was effective in concentrating and detecting IHNV from water containing only three infectious particles per 10-L sample.

Detection of bat hepatitis E virus RNA in microbats in Japan.

PubMed

Kobayashi, Tomoya; Murakami, Shin; Yamamoto, Terumasa; Mineshita, Ko; Sakuyama, Muneki; Sasaki, Reiko; Maeda, Ken; Horimoto, Taisuke

2018-05-29

Several recent studies have reported that various bat species harbor bat hepatitis E viruses (BatHEV) belonging to the family Hepeviridae, which also contains human hepatitis E virus (HEV). The distribution and ecology of BatHEV are not well known. Here, we collected and screened 81 bat fecal samples from nine bat species in Japan to detect BatHEV RNA by RT-PCR using HEV-specific primers, and detected three positive samples. Sequence and phylogenetic analyses indicated that these three viruses were BatHEVs belonging to genus Orthohepevirus D like other BatHEV strains reported earlier in various countries. These data support the first detection of BatHEVs in Japanese microbats, indicating their wide geographical distribution among multiple bat species.

Portable sensors for drug and explosive detection

NASA Astrophysics Data System (ADS)

Leginus, Joseph M.

1994-03-01

Westinghouse Electric is developing portable, hand-held sensors capable of detecting numerous drugs of abuse (cocaine, heroin, amphetamines) and explosives (trinitrotoluene, pentaerythritol tetranitrate, nitroglycerin). The easy-to-use system consists of a reusable electronics module and disposable probes. The sensor illuminates and detects light transmitted through optical cells of the probe during an antibody-based latex agglutination reaction. Each probe contains all the necessary reagents to carry out a test in a single step. The probe has the ability to lift minute quantities of samples from a variety of surfaces and deliver the sample to a reaction region within the device. The sensor yields a qualitative answer in 30 to 45 seconds and is able to detect illicit substances at nanogram levels.

Mass extraction container closure integrity physical testing method development for parenteral container closure systems.

PubMed

Yoon, Seung-Yil; Sagi, Hemi; Goldhammer, Craig; Li, Lei

2012-01-01

Container closure integrity (CCI) is a critical factor to ensure that product sterility is maintained over its entire shelf life. Assuring the CCI during container closure (C/C) system qualification, routine manufacturing and stability is important. FDA guidance also encourages industry to develop a CCI physical testing method in lieu of sterility testing in a stability program. A mass extraction system has been developed to check CCI for a variety of container closure systems such as vials, syringes, and cartridges. Various types of defects (e.g., glass micropipette, laser drill, wire) were created and used to demonstrate a detection limit. Leakage, detected as mass flow in this study, changes as a function of defect length and diameter. Therefore, the morphology of defects has been examined in detail with fluid theories. This study demonstrated that a mass extraction system was able to distinguish between intact samples and samples with 2 μm defects reliably when the defect was exposed to air, water, placebo, or drug product (3 mg/mL concentration) solution. Also, it has been verified that the method was robust, and capable of determining the acceptance limit using 3σ for syringes and 6σ for vials. Sterile products must maintain their sterility over their entire shelf life. Container closure systems such as those found in syringes and vials provide a seal between rubber and glass containers. This seal must be ensured to maintain product sterility. A mass extraction system has been developed to check container closure integrity for a variety of container closure systems such as vials, syringes, and cartridges. In order to demonstrate the method's capability, various types of defects (e.g., glass micropipette, laser drill, wire) were created in syringes and vials and were tested. This study demonstrated that a mass extraction system was able to distinguish between intact samples and samples with 2 μm defects reliably when the defect was exposed to air, water, placebo, or drug product (3 mg/mL concentration) solution. Also, it was verified that the method showed consistent results, and was able to determine the acceptance limit using 3σ for syringes and 6σ for vials.

Rapid determination of organochlorine pesticides and polychlorinated biphenyls, using selected ion monitoring mass spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hargesheimer, E.E.

Methane chemical ionization (CI)-selected ion monitoring (SIM) mass spectrometry was used to identify and conclusively distinguish 19 organochlorine pesticides from polychlorinated biphenyls (PCBs) at parts-per-trillion to parts-per-billion levels in environmental water sample extracts with minimal sample cleanup. Two CI-SIM screens were developed. One set of ions scanned specifically for the presence of 4 classes of pesticides; diphenylmethane derivatives, bridged polycyclic chlorinated benzenes, and acetanilide pesticides. The second set of ions responded exclusively to PCBs with biphenyl moieties containing from 1 to 8 chlorine atoms. Eight commercial Aroclor mixtures were analyzed and distinguished from the pesticides groups. The detection limit formore » pesticides and PCBs by CI-SIM screening was 0.005 and 0.1 ppB, respectively. CI-SIM can be used as an alternative method for the analysis of biological or environmental samples containing interferences that complicate the detection of PCBs and chlorinated pesticides. 8 references, 6 figures, 6 tables.« less

Microbial Quality and Direct PCR Identification of Lactic Acid Bacteria and Nonpathogenic Staphylococci from Artisanal Low-Acid Sausages

PubMed Central

Aymerich, T.; Martín, B.; Garriga, M.; Hugas, M.

2003-01-01

Detection of six species of lactic acid bacteria and six species of gram-positive catalase-positive cocci from low-acid fermented sausages (fuets and chorizos) was assessed by species-specific PCR. Without enrichment, Lactobacillus sakei and Lactobacillus curvatus were detected in 11.8% of the samples, and Lactobacillus plantarum and Staphylococcus xylosus were detected in 17.6%. Enriched samples allowed the detection of L. sakei and S. xylosus in all of the samples (100%) and of Enterococcus faecium in 11.8% of the sausages. The percentages of L. curvatus, L. plantarum, Staphylococcus carnosus, and Staphylococcus epidermidis varied depending on the sausage type. L. curvatus was detected in 80% of fuets and in 57% of chorizos. L. plantarum was found in 50% of fuets and 100% of chorizos. S. epidermidis was detected in only 11.8% of fuets, and S. carnosus was detected in only 5.9% of chorizos. Lactococcus lactis, Staphylococcus warneri, and Staphylococcus simulans were not detected in any sausage type. From a microbiological point of view, 70.6% of the samples could be considered of high quality, as they had low counts of Enterobacteriaceae and did not contain any of the food-borne pathogens assayed. PMID:12902246

Impedance biosensor based on interdigitated electrode array for detection of E.coli O157:H7 in food products

NASA Astrophysics Data System (ADS)

Ghosh Dastider, Shibajyoti; Barizuddin, Syed; Dweik, Majed; Almasri, Mahmoud F.

2012-05-01

An impedance biosensor was designed, fabricated and tested for detection of viable Escherichia coli O157:H7 in food samples. This device consists of interdigitated microelectrode array (IDEA) fabricated using thin layer of sputtered gold, embedded under a polydimethylsiloxane (PDMS) microchannel. The array of electrodes is designed to detect viable EColi in different food products. The active surface area of the detection array was modified using goat anti-E.coli polyclonal IgG antibody. Contaminated food samples were tested by infusing the supernatant containing bacteria over the IDEA's, through the microchannel. Antibody-antigen binding on the electrodes results in impedance change. Four serial concentrations of E.coli contaminated food samples (3x102 CFUmL-1 to 3x105 CFUmL-1) were tested. The biosensor successfully detected the E.coli samples, with the lower detection limit being 3x103 CFUmL-1 (up to 3cells/μl). Comparing the test results with an IDEA impedance biosensor without microchannel (published elsewhere) indicates that this biosensor have two order of magnitude times higher sensitivity. The proposed biosensor provides qualitative and quantitative detection, and potentially could be used for detection of other type of bacteria by immobilizing the specific type of antibody.

A DNA microarray-based assay to detect dual infection with two dengue virus serotypes.

PubMed

Díaz-Badillo, Alvaro; Muñoz, María de Lourdes; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G; Martínez-Muñoz, Jorge P; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-04-25

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

PubMed Central

Díaz-Badillo, Alvaro; de Lourdes Muñoz, María; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G.; Martínez-Muñoz, Jorge P.; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-01-01

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples. PMID:24776933

Noise suppressing capillary separation system

DOEpatents

Yeung, Edward S.; Xue, Yongjun

1996-07-30

A noise-suppressing capillary separation system for detecting the real-time presence or concentration of an analyte in a sample is provided. The system contains a capillary separation means through which the analyte is moved, a coherent light source that generates a beam which is split into a reference beam and a sample beam that irradiate the capillary, and a detector for detecting the reference beam and the sample beam light that transmits through the capillary. The laser beam is of a wavelength effective to be absorbed by a chromophore in the capillary. The system includes a noise suppressing system to improve performance and accuracy without signal averaging or multiple scans.

VizieR Online Data Catalog: Fermi/non-Fermi blazars jet power and accretion (Chen+, 2015)

NASA Astrophysics Data System (ADS)

Chen, Y. Y.; Zhang, X.; Zhang, H. J.; Yu, X. L.

2017-11-01

We selected the sample using radio catalogues to get the widest possible sample of blazars based on their radio properties. We split them into Fermi-detected sources and non-Fermi detections. Massaro et al. (2009, J/A+A/495/691) created the "Multifrequency Catalogue of Blazars" (Roma-BZCAT), which classifies blazars into three main groups based on their spectral properties. In total, we have a sample containing 177 clean Fermi blazars (96 Fermi FSRQs and 81 Fermi BL Lacs) and 133 non-Fermi blazars (105 non-Fermi FSRQs and 28 non-Fermi BL Lacs). (2 data files).

Noise suppressing capillary separation system

DOEpatents

Yeung, E.S.; Xue, Y.

1996-07-30

A noise-suppressing capillary separation system for detecting the real-time presence or concentration of an analyte in a sample is provided. The system contains a capillary separation means through which the analyte is moved, a coherent light source that generates a beam which is split into a reference beam and a sample beam that irradiate the capillary, and a detector for detecting the reference beam and the sample beam light that transmits through the capillary. The laser beam is of a wavelength effective to be absorbed by a chromophore in the capillary. The system includes a noise suppressing system to improve performance and accuracy without signal averaging or multiple scans. 13 figs.

Effect of Carbon Nanotubes Upon Emissions From Cutting and Sanding Carbon Fiber-Epoxy Composites

PubMed Central

Heitbrink, William A.; Lo, Li-Ming

2015-01-01

Carbon nanotubes (CNTs) are being incorporated into structural composites to enhance material strength. During fabrication or repair activities, machining nanocomposites may release CNTs into the workplace air. An experimental study was conducted to evaluate the emissions generated by cutting and sanding on three types of epoxy-composite panels: Panel A containing graphite fibers, Panel B containing graphite fibers and carbon-based mat, and Panel C containing graphite fibers, carbon-based mat, and multi-walled CNTs. Aerosol sampling was conducted with direct-reading instruments, and filter samples were collected for measuring elemental carbon (EC) and fiber concentrations. Our study results showed that cutting Panel C with a band saw did not generate detectable emissions of fibers inspected by transmission electron microscopy but did increase the particle mass, number, and EC emission concentrations by 20% to 80% compared to Panels A and B. Sanding operation performed on two Panel C resulted in fiber emission rates of 1.9×108 and 2.8×106 fibers per second (f/s), while no free aerosol fibers were detected from sanding Panels A and B containing no CNTs. These free CNT fibers may be a health concern. However, the analysis of particle and EC concentrations from these same samples cannot clearly indicate the presence of CNTs, because extraneous aerosol generation from machining the composite epoxy material increased the mass concentrations of the EC. PMID:26478716

Antibody Microarray for E. coli O157:H7 and Shiga Toxin in Microtiter Plates.

PubMed

Gehring, Andrew G; Brewster, Jeffrey D; He, Yiping; Irwin, Peter L; Paoli, George C; Simons, Tawana; Tu, Shu-I; Uknalis, Joseph

2015-12-04

Antibody microarray is a powerful analytical technique because of its inherent ability to simultaneously discriminate and measure numerous analytes, therefore making the technique conducive to both the multiplexed detection and identification of bacterial analytes (i.e., whole cells, as well as associated metabolites and/or toxins). We developed a sandwich fluorescent immunoassay combined with a high-throughput, multiwell plate microarray detection format. Inexpensive polystyrene plates were employed containing passively adsorbed, array-printed capture antibodies. During sample reaction, centrifugation was the only strategy found to significantly improve capture, and hence detection, of bacteria (pathogenic Escherichia coli O157:H7) to planar capture surfaces containing printed antibodies. Whereas several other sample incubation techniques (e.g., static vs. agitation) had minimal effect. Immobilized bacteria were labeled with a red-orange-fluorescent dye (Alexa Fluor 555) conjugated antibody to allow for quantitative detection of the captured bacteria with a laser scanner. Shiga toxin 1 (Stx1) could be simultaneously detected along with the cells, but none of the agitation techniques employed during incubation improved detection of the relatively small biomolecule. Under optimal conditions, the assay had demonstrated limits of detection of ~5.8 × 10⁵ cells/mL and 110 ng/mL for E. coli O157:H7 and Stx1, respectively, in a ~75 min total assay time.

Evaluation of a quantitative H2S MPN test for fecal microbes analysis of water using biochemical and molecular identification.

PubMed

McMahan, Lanakila; Grunden, Amy M; Devine, Anthony A; Sobsey, Mark D

2012-04-15

The sensitivity and specificity of the H(2)S test to detect fecal bacteria in water has been variable and uncertain in previous studies, partly due to its presence-absence results. Furthermore, in groundwater samples false-positive results have been reported, with H(2)S-positive samples containing no fecal coliforms or Escherichia coli. False-negative results also have been reported in other studies, with H(2)S-negative samples found to contain E. coli. Using biochemical and molecular methods and a novel quantitative test format, this research identified the types and numbers of microbial community members present in natural water samples, including fecal indicators and pathogens as well as other bacteria. Representative water sources tested in this study included cistern rainwater, a protected lake, and wells in agricultural and forest settings. Samples from quantitative H(2)S tests of water were further cultured for fecal bacteria by spread plating onto the selective media for detection and isolation of Aeromonas spp., E. coli, Clostridium spp., H(2)S-producers, and species of Salmonella and Shigella. Isolates were then tested for H(2)S production, and identified to the genus and species level using biochemical methods. Terminal Restriction Fragment Length Polymorphisms (TRFLP) was the molecular method employed to quantitatively characterize microbial community diversity. Overall, it was shown that water samples testing positive for H(2)S bacteria also had bacteria of likely fecal origin and waters containing fecal pathogens also were positive for H(2)S bacteria. Of the microorganisms isolated from natural water, greater than 70 percent were identified using TRFLP analysis to reveal a relatively stable group of organisms whose community composition differed with water source and over time. These results further document the validity of the H(2)S test for detecting and quantifying fecal contamination of water. Copyright © 2011 Elsevier Ltd. All rights reserved.

Determination of N-acetylglucosamine in cosmetic formulations and skin test samples by hydrophilic interaction liquid chromatography and UV detection.

PubMed

Pedrali, Alice; Bleve, Mariella; Capra, Priscilla; Jonsson, Tobias; Massolini, Gabriella; Perugini, Paola; Marrubini, Giorgio

2015-03-25

N-Acetylglucosamine is an ingredient in pharmaceuticals, nutritional supplements and in cosmetics. N-Acetylglucosamine in cosmetics is expected to improve skin hydration, reparation, and to contribute as anti-wrinkle agent. This study reports on the validation and application of an HPLC method based on HILIC and UV detection for determining N-acetylglucosamine in cosmetics and in samples obtained after testing the skin exposed to cosmetics formulations. The chromatographic column used is a ZIC(®)-pHILIC (150 mm × 4.6 mm, 5 μm particle size) on which a mobile phase containing acetonitrile-aqueous KH2PO4 (70:30, v/v) 15 mM was applied in isocratic elution mode injecting 20 μl of sample at 0.5 ml/min constant flow-rate and 10±1°C column temperature. Under these conditions the total run time was 10 min and N-acetylglucosamine eluted baseline separated from all other compounds in the samples. Calibration in the range from 40 to 80 μg/ml allowed to assess the method linearity (R(2)>0.999) in a concentration range corresponding to about 50% to 120% of the expected levels of N-acetylglucosamine in the formulations. Precision expressed by RSD% was always better than 2% in intra-day and inter-day assays of authentic samples. Accuracy was in all cases within 95-105% of the expected concentration value in formulations containing N-acetylglucosamine. The sensitivity of the method was at the level of 10 μg/ml as limit of detection, and at 40 μg/ml as limit of quantitation. The application of the method to formulations containing solid lipid nanoparticles documents its usefulness in cosmetic quality control. The results witness that the method is also suitable for the determination of N-acetylglucosamine in samples obtained from skin test strips. Copyright © 2014 Elsevier B.V. All rights reserved.

Performance of the fourth-generation Bio-Rad GS HIV Combo Ag/Ab enzyme immunoassay for diagnosis of HIV infection in Southern Africa

PubMed Central

Piwowar-Manning, Estelle; Fogel, Jessica M.; Richardson, Paul; Wolf, Shauna; Clarke, William; Marzinke, Mark A.; Fiamma, Agnès; Donnell, Deborah; Kulich, Michal; Mbwambo, Jessie K.K.; Richter, Linda; Gray, Glenda; Sweat, Michael; Coates, Thomas J.; Eshleman, Susan H.

2015-01-01

Background Fourth-generation HIV assays detect both antigen and antibody, facilitating detection of acute/early HIV infection. The Bio-Rad GS HIV Combo Ag/Ab assay (Bio-Rad Combo) is an enzyme immunoassay that simultaneously detects HIV p24 antigen and antibodies to HIV-1 and HIV-2 in serum or plasma. Objective To evaluate the performance of the Bio-Rad Combo assay for detection of HIV infection in adults from Southern Africa. Study design Samples were obtained from adults in Soweto and Vulindlela, South Africa and Dar es Salaam, Tanzania (300 HIV-positive samples; 300 HIV-negative samples; 12 samples from individuals previously classified as having acute/early HIV infection). The samples were tested with the Bio-Rad Combo assay. Additional testing was performed to characterize the 12 acute/early samples. Results All 300 HIV-positive samples were reactive using the Bio-Rad Combo assay; false positive test results were obtained for 10 (3.3%) of the HIV-negative samples (sensitivity: 100%, 95% confidence interval [CI]: 98.8–100%); specificity: 96.7%, 95% CI: 94.0–98.4%). The assay detected 10 of the 12 infections classified as acute/early. The two infections that were not detected had viral loads < 400 copies/mL; one of those samples contained antiretroviral drugs consistent with antiretroviral therapy. Conclusions The Bio-Rad Combo assay correctly classified the majority of study specimens. The specificity reported here may be higher than that seen in other settings, since HIV-negative samples were pre-screened using a different fourth-generation test. The assay also had high sensitivity for detection of acute/early infection. False-negative test results may be obtained in individuals who are virally suppressed. PMID:25542477

Development of optical immunosensors for detection of proteins in serum.

PubMed

Kyprianou, Dimitris; Chianella, Iva; Guerreiro, Antonio; Piletska, Elena V; Piletsky, Sergey A

2013-01-15

The detection of proteins in biological samples such as blood, serum or plasma by biosensors is very challenging due to the complex nature of the matrix, which contains a high level of many interfering compounds. Here we show the application of a novel polymeric immobilisation matrix that helps in the detection of specific protein analytes in biological samples by surface plasmon resonance (SPR) immunosensors. This polymer matrix contains thioacetal functional groups included in the network, and these groups do not require any further activation in order to react with proteins, making it attractive for sensor fabrication. The protein prostate specific antigen (PSA) was selected as a model target analyte. A sandwich format with two primary antibodies recognising different parts (epitopes) of the analyte was used for the detection of PSA in serum. The efficiency of the reduction of non-specific binding achieved with novel polymer was compared with those of other techniques such as coating of sensor surface with polyethylene glycol (PEG), use of charged hydrophilic aspartic acid and surfactants such as Tween20. The detection limit of the polymer based immunosensor was 0.1 ng ml(-1) for free form PSA (f-PSA) in buffer and 5 ng ml(-1) in 20% serum. This is an improvement compared with similar devices reported on literature, indicating the potential of the immunosensor developed here for the analysis of real samples. Copyright © 2012 Elsevier B.V. All rights reserved.

Transgenes in Mexican maize: molecular evidence and methodological considerations for GMO detection in landrace populations

PubMed Central

PIÑEYRO-NELSON, A; VAN HEERWAARDEN, J; PERALES, H R; SERRATOS-HERNÁNDEZ, J A; RANGEL, A; HUFFORD, M B; GEPTS, P; GARAY-ARROYO, A; RIVERA-BUSTAMANTE, R; ÁLVAREZ-BUYLLA, E R

2009-01-01

A possible consequence of planting genetically modified organisms (GMOs) in centres of crop origin is unintended gene flow into traditional landraces. In 2001, a study reported the presence of the transgenic 35S promoter in maize landraces sampled in 2000 from the Sierra Juarez of Oaxaca, Mexico. Analysis of a large sample taken from the same region in 2003 and 2004 could not confirm the existence of transgenes, thereby casting doubt on the earlier results. These two studies were based on different sampling and analytical procedures and are thus hard to compare. Here, we present new molecular data for this region that confirm the presence of transgenes in three of 23 localities sampled in 2001. Transgene sequences were not detected in samples taken in 2002 from nine localities, while directed samples taken in 2004 from two of the positive 2001 localities were again found to contain transgenic sequences. These findings suggest the persistence or re-introduction of transgenes up until 2004 in this area. We address variability in recombinant sequence detection by analyzing the consistency of current molecular assays. We also present theoretical results on the limitations of estimating the probability of transgene detection in samples taken from landraces. The inclusion of a limited number of female gametes and, more importantly, aggregated transgene distributions may significantly lower detection probabilities. Our analytical and sampling considerations help explain discrepancies among different detection efforts, including the one presented here, and provide considerations for the establishment of monitoring protocols to detect the presence of transgenes among structured populations of landraces. PMID:19143938

Transgenes in Mexican maize: molecular evidence and methodological considerations for GMO detection in landrace populations.

PubMed

Piñeyro-Nelson, A; Van Heerwaarden, J; Perales, H R; Serratos-Hernández, J A; Rangel, A; Hufford, M B; Gepts, P; Garay-Arroyo, A; Rivera-Bustamante, R; Alvarez-Buylla, E R

2009-02-01

A possible consequence of planting genetically modified organisms (GMOs) in centres of crop origin is unintended gene flow into traditional landraces. In 2001, a study reported the presence of the transgenic 35S promoter in maize landraces sampled in 2000 from the Sierra Juarez of Oaxaca, Mexico. Analysis of a large sample taken from the same region in 2003 and 2004 could not confirm the existence of transgenes, thereby casting doubt on the earlier results. These two studies were based on different sampling and analytical procedures and are thus hard to compare. Here, we present new molecular data for this region that confirm the presence of transgenes in three of 23 localities sampled in 2001. Transgene sequences were not detected in samples taken in 2002 from nine localities, while directed samples taken in 2004 from two of the positive 2001 localities were again found to contain transgenic sequences. These findings suggest the persistence or re-introduction of transgenes up until 2004 in this area. We address variability in recombinant sequence detection by analyzing the consistency of current molecular assays. We also present theoretical results on the limitations of estimating the probability of transgene detection in samples taken from landraces. The inclusion of a limited number of female gametes and, more importantly, aggregated transgene distributions may significantly lower detection probabilities. Our analytical and sampling considerations help explain discrepancies among different detection efforts, including the one presented here, and provide considerations for the establishment of monitoring protocols to detect the presence of transgenes among structured populations of landraces.

Trace metal analysis by laser ablation-inductively coupled plasmamass spectrometry and x-ray K-edge densitometry of forensic samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berry, Jonna Elizabeth

This dissertation describes a variety of studies on the determination of trace elements in samples with forensic importance. Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) was used to determine the trace element composition of numerous lipstick samples. Lipstick samples were determined to be homogeneous. Most lipstick samples of similar colors were readily distinguishable at a 95% confidence interval based on trace element composition. Numerous strands of a multi-strand speaker cable were analyzed by LA-ICP-MS. The strands in this study are spatially heterogeneous in trace element composition. In actual forensic applications, the possibility of spatial heterogeneity must be considered, especially in casesmore » where only small samples (e.g., copper wire fragments after an explosion) are available. The effects of many unpredictable variables, such as weather, temperature, and human activity, on the retention of gunshot residue (GSR) around projectile wounds were assessed with LAICP- MS. Skin samples around gunshot and stab wounds and larvae feeding in and around the wounds on decomposing pig carcasses were analyzed for elements consistent with GSR (Sb, Pb, Ba, and Cu). These elements were detected at higher levels in skin and larvae samples around the gunshot wounds compared to the stab wounds for an extended period of time throughout decomposition in both a winter and summer study. After decomposition, radiographic images of the pig bones containing possible damage from bullets revealed metallic particles embedded within a number of bones. Metallic particles within the bones were analyzed with x-ray, K-edge densitometry and determined to contain lead, indicating that bullet residue can be retained throughout decomposition and detected within bones containing projectile trauma.« less

NG09 And CTBT On-Site Inspection Noble Gas Sampling and Analysis Requirements

NASA Astrophysics Data System (ADS)

Carrigan, Charles R.; Tanaka, Junichi

2010-05-01

A provision of the Comprehensive Test Ban Treaty (CTBT) allows on-site inspections (OSIs) of suspect nuclear sites to determine if the occurrence of a detected event is nuclear in origin. For an underground nuclear explosion (UNE), the potential success of an OSI depends significantly on the containment scenario of the alleged event as well as the application of air and soil-gas radionuclide sampling techniques in a manner that takes into account both the suspect site geology and the gas transport physics. UNE scenarios may be broadly divided into categories involving the level of containment. The simplest to detect is a UNE that vents a significant portion of its radionuclide inventory and is readily detectable at distance by the International Monitoring System (IMS). The most well contained subsurface events will only be detectable during an OSI. In such cases, 37 Ar and radioactive xenon cavity gases may reach the surface through either "micro-seepage" or the barometric pumping process and only the careful siting of sampling locations, timing of sampling and application of the most site-appropriate atmospheric and soil-gas capturing methods will result in a confirmatory signal. The OSI noble gas field tests NG09 was recently held in Stupava, Slovakia to consider, in addition to other field sampling and analysis techniques, drilling and subsurface noble gas extraction methods that might be applied during an OSI. One of the experiments focused on challenges to soil-gas sampling near the soil-atmosphere interface. During withdrawal of soil gas from shallow, subsurface sample points, atmospheric dilution of the sample and the potential for introduction of unwanted atmospheric gases were considered. Tests were designed to evaluate surface infiltration and the ability of inflatable well-packers to seal out atmospheric gases during sample acquisition. We discuss these tests along with some model-based predictions regarding infiltration under different near-surface hydrologic conditions. We also consider how naturally occurring as well as introduced (e.g., SF6) soil-gas tracers might be used to guard against the possibility of atmospheric contamination of soil gases while sampling during an actual OSI. The views expressed here do not necessarily reflect the opinion of the United States Government, the United States Department of Energy, or Lawrence Livermore National Laboratory. This work has been performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344. LLNL-ABS-418791

Method for early detection of infectious mononucleosis by identifying inmono proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willard, K. E.

1984-10-02

Early detection of infectious mononucleosis is carried out using a sample of human blood by isolating and identifying the presence of Inmono proteins in the sample from a two-dimensional protein map with the proteins being characterized by having isoelectric banding as measured in urea of about -16 to -17 with respect to certain isoelectric point standards and molecular mass of about 70 to 75 K daltons as measured in the presence of sodium dodecylsulfate containing polyacrylamide gels, the presence of the Inmono proteins being correlated with the existence of infectious mononucleosis.

Method for early detection of infectious mononucleosis

DOEpatents

Willard, K.E.

1982-08-10

Early detection of infectious mononucleosis is carried out using a sample of human blood by isolating and identifying the presence of Inmono proteins in the sample from a two-dimensional protein map with the proteins being characterized by having isoelectric banding as measured in urea of about -16 to -17 with respect to certain isoelectric point standards and molecular mass of about 70 to 75 K daltons as measured in the presence of sodium dodecylsulfate containing polyacrylamide gels, the presence of the Inmono proteins being correlated with the existence of infectious mononucleosis.

Method for early detection of infectious mononucleosis by identifying Inmono proteins

DOEpatents

Willard, Karen E.

1984-01-01

Early detection of infectious mononucleosis is carried out using a sample of human blood by isolating and identifying the presence of Inmono proteins in the sample from a two-dimensional protein map with the proteins being characterized by having isoelectric banding as measured in urea of about -16 to -17 with respect to certain isoelectric point standards and molecular mass of about 70 to 75 K daltons as measured in the presence of sodium dodecylsulfate containing polyacrylamide gels, the presence of the Inmono proteins being correlated with the existence of infectious mononucleosis.

Fluorinated Compounds in US Fast Food Packaging | Science ...

EPA Pesticide Factsheets

Per- and polyfluoroalkyl substances (PFASs) are highly persistent synthetic chemicals, some of which have been associated with cancer, developmental toxicity, immunotoxicity, and other health effects. PFASs in grease-resistant food packaging can leach into food and increase dietary exposure. We collected ∼400 samples of food contact papers, paperboard containers, and beverage containers from fast food restaurants throughout the United States and measured total fluorine using particle-induced γ-ray emission (PIGE) spectroscopy. PIGE can rapidly and inexpensively measure total fluorine in solid-phase samples. We found that 46% of food contact papers and 20% of paperboard samples contained detectable fluorine (>16 nmol/cm2). Liquid chromatography/high-resolution mass spectrometry analysis of a subset of 20 samples found perfluorocarboxylates, perfluorosulfonates, and other known PFASs and/or unidentified polyfluorinated compounds (based on nontargeted analysis). The total peak area for PFASs was higher in 70% of samples (10 of 14) with a total fluorine level of >200 nmol/cm2 compared to six samples with a total fluorine level of <16 nmol/cm2. Samples with high total fluorine levels but low levels of measured PFASs may contain volatile PFASs, PFAS polymers, newer replacement PFASs, or other fluorinated compounds. The prevalence of fluorinated chemicals in fast food packaging demonstrates their potentially significant contribution to dietary PFAS exposure and envi

Sensitivity of the ViroSeq HIV-1 Genotyping System for Detection of the K103N Resistance Mutation in HIV-1 Subtypes A, C, and D

PubMed Central

Church, Jessica D.; Jones, Dana; Flys, Tamara; Hoover, Donald; Marlowe, Natalia; Chen, Shu; Shi, Chanjuan; Eshleman, James R.; Guay, Laura A.; Jackson, J. Brooks; Kumwenda, Newton; Taha, Taha E.; Eshleman, Susan H.

2006-01-01

The US Food and Drug Administration-cleared ViroSeq HIV-1 Genotyping System (ViroSeq) and other population sequencing-based human immunodeficiency virus type 1 (HIV-1) genotyping methods detect antiretroviral drug resistance mutations present in the major viral population of a test sample. These assays also detect some mutations in viral variants that are present as mixtures. We compared detection of the K103N nevirapine resistance mutation using ViroSeq and a sensitive, quantitative point mutation assay, LigAmp. The LigAmp assay measured the percentage of K103N-containing variants in the viral population (percentage of K103N). We analyzed 305 samples with HIV-1 subtypes A, C, and D collected from African women after nevirapine administration. ViroSeq detected K103N in 100% of samples with >20% K103N, 77.8% of samples with 10 to 20% K103N, 71.4% of samples with 5 to 10% K103N, and 16.9% of samples with 1 to 5% K103N. The sensitivity of ViroSeq for detection of K103N was similar for subtypes A, C, and D. These data indicate that the ViroSeq system reliably detects the K103N mutation at levels above 20% and frequently detects the mutation at lower levels. Further studies are needed to compare the sensitivity of different assays for detection of HIV-1 drug resistance mutations and to determine the clinical relevance of HIV-1 minority variants. PMID:16931582

Mars Sample Handling and Requirements Panel (MSHARP)

NASA Technical Reports Server (NTRS)

Carr, Michael H.; McCleese, Daniel J.; Bada, Jeffrey L.; Bogard, Donald D.; Clark, Benton C.; DeVincenzi, Donald; Drake, Michael J.; Nealson, Kenneth H.; Papike, James J.; Race, Margaret S.;

Lipidomics as an important key for the identification of beer-spoilage bacteria.

PubMed

Řezanka, T; Matoulková, D; Benada, O; Sigler, K

2015-06-01

Electrospray ionization-tandem mass spectrometry (ESI-MS/MS) was used for characterizing intact plasmalogen phospholipid molecules in beer-spoilage bacteria. Identification of intact plasmalogens was carried out using collision-induced dissociation and the presence of suitable marker molecular species, both qualitative and quantitative, was determined in samples containing the anaerobic bacteria Megasphaera and Pectinatus. Using selected ion monitoring (SIM), this method had a limit of detection at 1 pg for the standard, i.e. 1-(1Z-octadecenyl)-2-oleoyl-sn-glycero-3-phosphoethanolamine and be linear in the range of four orders of magnitude from 2 pg to 20 ng. This technique was applied to intact plasmalogen extracts from the samples of contaminated and uncontaminated beer without derivatization and resulted in the identification of contamination of beer by Megasphaera and Pectinatus bacteria. The limit of detection was about 830 cells of anaerobic bacteria, i.e. bacteria containing natural cyclopropane plasmalogenes (c-p-19:0/15:0), which is the majority plasmalogen located in both Megasphaera and Pectinatus. The SIM ESI-MS method has been shown to be useful for the analysis of low concentration of plasmalogens in all biological samples, which were contaminated with anaerobic bacteria, e.g. juice, not only in beer. Significance and impact of the study: Electrospray ionization-tandem mass spectrometry (ESI-MS/MS) using collision-induced dissociation was used to characterize intact plasmalogen phospholipid molecules in beer-spoilage anaerobic bacteria Megasphaera and Pectinatus. Using selected ion monitoring (SIM), this method has a detection limit of 1 pg for the standard 1-(1Z-octadecenyl)-2-oleoyl-sn-glycero-3-phosphoethanolamine and is linear within four orders of magnitude (2 pg to 20 ng). The limit of detection was about 830 cells of bacteria containing natural cyclopropane plasmalogen (c-p-19:0/15:0). SIM ESI-MS method is useful for analyzing low concentrations of plasmalogens in biological samples contaminated with anaerobic bacteria, e.g. beer or juice. © 2015 The Society for Applied Microbiology.

Application of Coamplification at Lower Denaturation Temperature-PCR Sequencing for Early Detection of Antiviral Drug Resistance Mutations of Hepatitis B Virus

PubMed Central

Wong, Danny Ka-Ho; Tsoi, Ottilia; Huang, Fung-Yu; Seto, Wai-Kay; Fung, James; Lai, Ching-Lung

2014-01-01

Nucleoside/nucleotide analogue for the treatment of chronic hepatitis B virus (HBV) infection is hampered by the emergence of drug resistance mutations. Conventional PCR sequencing cannot detect minor variants of <20%. We developed a modified co-amplification at lower denaturation temperature-PCR (COLD-PCR) method for the detection of HBV minority drug resistance mutations. The critical denaturation temperature for COLD-PCR was determined to be 78°C. Sensitivity of COLD-PCR sequencing was determined using serially diluted plasmids containing mixed proportions of HBV reverse transcriptase (rt) wild-type and mutant sequences. Conventional PCR sequencing detected mutations only if they existed in ≥25%, whereas COLD-PCR sequencing detected mutations when they existed in 5 to 10% of the viral population. The performance of COLD-PCR was compared to conventional PCR sequencing and a line probe assay (LiPA) using 215 samples obtained from 136 lamivudine- or telbivudine-treated patients with virological breakthrough. Among these 215 samples, drug resistance mutations were detected in 155 (72%), 148 (69%), and 113 samples (53%) by LiPA, COLD-PCR, and conventional PCR sequencing, respectively. Nineteen (9%) samples had mutations detectable by COLD-PCR but not LiPA, while 26 (12%) samples had mutations detectable by LiPA but not COLD-PCR, indicating both methods were comparable (P = 0.371). COLD-PCR was more sensitive than conventional PCR sequencing. Thirty-five (16%) samples had mutations detectable by COLD-PCR but not conventional PCR sequencing, while none had mutations detected by conventional PCR sequencing but not COLD-PCR (P < 0.0001). COLD-PCR sequencing is a simple method which is comparable to LiPA and superior to conventional PCR sequencing in detecting minor lamivudine/telbivudine resistance mutations. PMID:24951803

Magnetic bead-based separation of sperm from buccal epithelial cells using a monoclonal antibody against MOSPD3.

PubMed

Li, Xue-Bo; Wang, Qing-Shan; Feng, Yu; Ning, Shu-Hua; Miao, Yuan-Ying; Wang, Ye-Quan; Li, Hong-Wei

2014-11-01

Forensic DNA analysis of sexual assault evidence requires unambiguous differentiation of DNA profiles in mixed samples. To investigate the feasibility of magnetic bead-based separation of sperm from cell mixtures using a monoclonal antibody against MOSPD3 (motile sperm domain-containing protein 3), 30 cell samples were prepared by mixing 10(4) female buccal epithelial cells with sperm cells of varying densities (10(3), 10(4), or 10(5) cells/mL). Western blot and immunofluorescence assays showed that MOSPD3 was detectable on the membrane of sperm cells, but not in buccal epithelial cells. After biotinylated MOSPD3 antibody was incubated successively with the prepared cell mixtures and avidin-coated magnetic beads, microscopic observation revealed that each sperm cell was bound by two or more magnetic beads, in the head, neck, mid-piece, or flagellum. A full single-source short tandem repeat profile could be obtained in 80% of mixed samples containing 10(3) sperm cells/mL and in all samples containing ≥10(4) sperm cells/mL. For dried vaginal swab specimens, the rate of successful detection was 100% in both flocked and cotton swabs preserved for 1 day, 87.5% in flocked swabs and 40% in cotton swabs preserved for 3 days, and 40% in flocked swabs and 16.67% in cotton swabs preserved for 10 days. Our findings suggest that immunomagnetic bead-based separation is potentially a promising alternative to conventional methods for isolating sperm cells from mixed forensic samples.

Progress in the Use of Rapid Molecular Techniques to Detect Life Forms in Soil: Implications for Interplanetary Astrobiology Missions

NASA Technical Reports Server (NTRS)

Warmflash, D.; Larios-Sanz, M.; Fox, G. E.; McKay, D. S.

2002-01-01

To demonstrate the feasibility of two promising technologies, we have applied Enzyme-Linked Immunosorbent Assay (ELISA) as well as probes that target the 16S rRNA molecule to search for life in terrestrial soil samples, known to contain numerous life forms. Additional information is contained in the original extended abstract.

Frequent Hepatitis E Virus Contamination in Food Containing Raw Pork Liver, France

PubMed Central

Merbah, Thiziri; Thébault, Anne

2014-01-01

Food products containing raw pork liver are suspected to be vehicles for transmission of hepatitis E virus. Four categories of food products, comprising 394 samples, were analyzed to determine hepatitis E virus prevalence. Virus was detected in 3%–30% of the different categories. Phylogenetic analysis showed high identity with human and swine sequences. PMID:25340373

Detection of lead nanoparticles in game meat by single particle ICP-MS following use of lead-containing bullets.

PubMed

Kollander, Barbro; Widemo, Fredrik; Ågren, Erik; Larsen, Erik H; Loeschner, Katrin

2017-03-01

This study investigated whether game meat may contain nanoparticles of lead from ammunition. Lead nanoparticles in the range 40 to 750 nm were detected by ICP-MS in single particle mode in game shot with lead-containing bullets. The median diameter of the detected nanoparticles was around 60 nm. The particle mass concentration ranged from 290 to 340 ng/g meat and the particle number concentrations from 27 to 50 million particles/g meat. The size limit of detection strongly depended on the level of dissolved lead and was in the range of 40 to 80 nm. In game meat sampled more than 10 cm away from the wound channel, no lead particles with a diameter larger than 40 nm were detected. In addition to dissolved lead in meat that originated from particulates, the presence of lead nano particles in game meat represents a hitherto unattended source of lead with a largely unknown toxicological impact to humans. Graphical Abstract Detection of lead nanoparticles in game meat by single particle ICP-MS following use of leadcontaining bullets.

Rapid determination of yunaconitine and related alkaloids in aconites and aconite-containing drugs by ultra high-performance liquid chromatography-tandem mass spectrometry.

PubMed

Song, Long; Zhang, Hong; Liu, Xin; Zhao, Zhi-Li; Chen, Shi-Lin; Wang, Zheng-Tao; Xu, Hong-Xi

2012-12-01

Yunaconitine (YAC) is a toxic aconite alkaloid that is considered to be a hidden aconite poison since it is frequently found in body fluids from aconite poisoning patients, but has not been well studied in commonly used herbal drugs. In this paper, a rapid and sensitive ultra high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) detection combined with microwave-assisted extraction (MAE) was developed for high throughput simultaneous determination of YAC and six other toxic aconite alkaloids in 31 samples of crude, processed aconites and aconite-containing drugs. The optimized method showed excellent linearity, precision, accuracy and recovery for all target compounds with short run time. YAC was detected in some samples with contents from 0.015 to 10.41 mg/g. This is the first report on the determination of YAC in Radix Aconiti, Radix Aconiti Kusnezoffii and aconite-containing drugs. This newly developed method facilitates the rapid screening of YAC and related toxic aconite alkaloids and allows YAC to be used as a chemical marker for the quality control of aconites and aconite-containing drugs. Copyright © 2012 John Wiley & Sons, Ltd.

Analysis of chemical weapons decontamination waste from old ton containers from Johnston Atoll using multiple analytical methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Creasy, W.R.; Brickhouse, M.D.; Morrisse, K.M.

1999-07-01

Decontamination waste from chemical weapons (CW) agents has been stored in ton containers on Johnston Atoll since 1971. The waste was recently sampled and analyzed to determine its chemical composition in preparation for future cleanups. Due to the range of products and analytical requirements, multiple chromatographic and spectroscopic methods were necessary, including gas chromatography/mass spectrometry (GC/MS), gas chromatography/atomic emission detection (GC/AED), liquid chromatography/mass spectrometry (LC/MS), capillary electrophoresis (CE), and nuclear magnetic resonance spectroscopy (NMR). The samples were screened for residual agents. No residual sarin (GB) or VX was found to detection limits of 20 ng/mL, but 3% of the samplesmore » contained residual sulfur mustard (HD) at < 140 ng/mL. Decontamination products of agents were identified. The majority (74%) of the ton containers were documented correctly, in that the observed decontamination products were in agreement with the labeled agent type, but for a number of the containers, the contents were not in agreement with the labels. In addition, arsenic compounds that are decontamination products of the agent lewisite (L) were observed in a few ton containers, suggesting that lewisite was originally present but not documented. This study was a prototype to demonstrate the level of effort required to characterize old bulk CW-related waste.« less

Quantitative determination of triterpenoids and formononetin in rhizomes of black cohosh (Actaea racemosa) and dietary supplements by using UPLC-UV/ELS detection and identification by UPLC-MS.

PubMed

Avula, Bharathi; Wang, Yan-Hong; Smillie, Troy J; Khan, Ikhlas A

2009-03-01

A UPLC-UV/ELSD method has been developed for analysis of major triterpenoids and formononetin in ACTAEA RACEMOSA L. (family Ranunculaceae) samples. The best results were obtained with an Acquity UPLC BEH C18 (100 mmx2.1 mm, i. d., 1 microm) column system using gradient elution with a mobile phase consisting of water and acetonitrile:methanol (7:3) at a constant flow rate of 0.3 mL/min. Owing to their low UV absorption, the triterpene saponins were detected by evaporative light scattering. Within 5.5 minutes, three main triterpenoid glycosides [cimiracemoside A, 23- EPI-26-deoxyactein, and actein] and an isoflavonoid, formononetin, could be separated, with detection limits of 5, 5, 10, and 0.01 microg/mL, respectively. The method was successfully used to analyze different Actaea racemosa market products as well as to distinguish between two other ACTAEA species. There was a significant variability in the amounts of the selected triterpene glycosides for the products containing black cohosh and rhizomes of black cohosh. The isoflavone formononetin was not detected in the samples analyzed. LC-MS coupled with the electrospray ionization (ESI) interface method is described for the identification of formononetin and triterpenoid glycosides in plant samples and dietary supplements that claim to contain black cohosh and different species of Actaea.

Ochratoxin A in cereal-based baby foods: occurrence and safety evaluation.

PubMed

Beretta, B; De Domenico, R; Gaiaschi, A; Ballabio, C; Galli, C L; Gigliotti, C; Restani, P

2002-01-01

Ochratoxin A is a typical cereal contaminant with strong nephrotoxic activity. To estimate the quantity of ochratoxin A that can be taken in by a child in the weaning period, several samples of cereal-based baby foods were analysed. Although most samples analysed contained ochratoxin A in undetectable amounts or below the Italian legal limit of 0.5 microg kg(-1), some irregular products were found. In particular, the analyses of the 119 batches (338 samples) of baby foods considered indicated that: 20 batches (16.8%) contained detectable quantities of ochratoxin A and four of these (3.4% of the total) contained ochratoxin A above the Italian permitted value. All samples coming from agricultural practices based on integrated pest management contained undetectable amounts of ochratoxin A, while approximately 5% of batches coming from conventional and organic agricultural practices were above the legal limit. On the basis of the established provisional tolerable weekly intake (PTWI), there is no significant toxicological risk for a child who occasionally consumes a formula with ochratoxin concentration slightly above the permitted level. However, stricter controls have to be applied to reject the batches containing irregular concentrations of ochratoxin A.

Vehicle and cargo inspection system

NASA Astrophysics Data System (ADS)

Verbinski, Victor V.; Orphan, Victor J.

1997-02-01

Vehicle and Cargo Inspection System (VACIS) is comprised of a 1 Curie 137Cs gamma-ray source in a shield and collimator which produces a fan-shaped beam designed to intercept a vertical array of gama-ray detectors contained in a tower structure. The source and detector modules straddle the vehicle or container being inspected and are mounted on self-propelled trolleys which travel in synchronization along two parallel tracks covering the length of the scanned object. The signals from the gamma-ray detector array are processed and displayed so as to produce a 2D gamma-radiographic image of the object. Testing of the system on a variety of empty and lightly-loaded vehicles and containers has demonstrated the effectiveness of VACIS in detecting hidden contraband. For example, a small sample of cocaine only 1.5 inches thick was readily detected in a container.

Purgeable organic compounds in ground water at the Idaho National Engineering Laboratory, Idaho; 1988 and 1989

USGS Publications Warehouse

Mann, L.J.

1990-01-01

Groundwater samples from 38 wells at the Idaho National Engineering Laboratory were analyzed for 36 purgeable organic compounds in 1988-89. Thirty-six of the wells obtain water from the Snake River Plain aquifer and were equipped with dedicated or portable pumps. Water samples from one well that obtains water from the aquifer and one that obtains water from a perched groundwater zone were collected using a thief sampler. Analyses of water from 22 wells indicated the aquifer locally contained detectable concentrations of at least 1 of 19 purgeable organic compounds, mainly carbon tetrachloride, 1,1,1-trichloroethane, and trichloroethylene. Except for five wells, the maximum concentration of a specific compound in groundwater was 6.4 microgram/L or less; concentrations of most compounds were less than 0.2 microgram/L. Water from four wells at and near the Test Area North contained from 44 to 29, 000 micrograms/L of trichloroethylene. Water from a well that obtains water from a discontinuous perched groundwater zone at the Radioactive Waste Management Complex contained 1,400 micrograms/L of carbon tetrachloride, 940 micrograms/L of chloroform, 250 micrograms/L of 1,1,1- trichloroethane, and 1,100 micrograms/L trichloroethylene. Selected purgeable organic compounds, such as total xylene and methylene chloride, were detected in some groundwater samples and some blank samples consisting of boiled deionized water. Their presence in the blank samples suggest the compounds could have been inadvertently introduced into the groundwater sampled during or subsequent to collection. (USGS)

Ferrographic and spectrographic analysis of oil sampled before and after failure of a jet engine

NASA Technical Reports Server (NTRS)

Jones, W. R., Jr.

1980-01-01

An experimental gas turbine engine was destroyed as a result of the combustion of its titanium components. Several engine oil samples (before and after the failure) were analyzed with a Ferrograph as well as plasma, atomic absorption, and emission spectrometers. The analyses indicated that a lubrication system failure was not a causative factor in the engine failure. Neither an abnormal wear mechanism, nor a high level of wear debris was detected in the oil sample from the engine just prior to the test in which the failure occurred. However, low concentrations of titanium were evident in this sample and samples taken earlier. After the failure, higher titanium concentrations were detected in oil samples taken from different engine locations. Ferrographic analysis indicated that most of the titanium was contained in spherical metallic debris after the failure.

Enrichment and Detection of Escherichia coli O157:H7 from Water Samples Using an Antibody Modified Microfluidic Chip

PubMed Central

Dharmasiri, Udara; Witek, Małgorzata A.; Adams, Andre A.; Osiri, John K.; Hupert, Mateusz L.; Bianchi, Thomas S.; Roelke, Daniel L.; Soper, Steven A.

2010-01-01

Low abundant (<100 cells mL-1) E. coli O157:H7 cells were isolated and enriched from environmental water samples using a microfluidic chip. The poly(methylmethacrylate), PMMA, chip contained 8 devices each equipped with 16 curvilinear high aspect ratio channels that were covalently decorated with polyclonal anti-O157 antibodies (pAb) and could search for rare cells through a pAb mediated process. The chip could process independently 8 different samples or one sample using 8 different parallel inputs to increase volume processing throughput. After cell enrichment, cells were released and enumerated using bench top real-time quantitative PCR, targeting genes which effectively discriminated the O157:H7 serotype from other non-pathogenic bacteria. The recovery of target cells from water samples was determined to be ~72%, and the limit-of-detection was found to be 6 colony forming units (cfu) using the slt1 gene as a reporter. We subsequently performed analysis of lake and waste water samples. The simplicity in manufacturing and ease of operation makes this device attractive for the selection of pathogenic species from a variety of water supplies suspected of containing bacterial pathogens at extremely low frequencies. PMID:20218574

The Use of Flow-Injection Analysis with Chemiluminescence Detection of Aqueous Ferrous Iron in Waters Containing High Concentrations of Organic Compounds

PubMed Central

Borman, Christopher J.; Sullivan, B. Patrick; Eggleston, Carrick M.; Colberg, Patricia J. S.

2009-01-01

An evaluation of flow-injection analysis with chemiluminescence detection (FIA-CL) to quantify Fe2+(aq) in freshwaters was performed. Iron-coordinating and/or iron-reducing compounds, dissolved organic matter (DOM), and samples from two natural water systems were used to amend standard solutions of Fe2+(aq). Slopes of the response curves from ferrous iron standards (1 – 100 nM) were compared to the response curves of iron standards containing the amendments. Results suggest that FIA-CL is not suitable for systems containing ascorbate, hydroxylamine, cysteine or DOM. Little or no change in sensitivity occurred in solutions of oxalate and glycine or in natural waters with little organic matter. PMID:22408532

Non-contact evaluation of milk-based products using air-coupled ultrasound

NASA Astrophysics Data System (ADS)

Meyer, S.; Hindle, S. A.; Sandoz, J.-P.; Gan, T. H.; Hutchins, D. A.

2006-07-01

An air-coupled ultrasonic technique has been developed and used to detect physicochemical changes of liquid beverages within a glass container. This made use of two wide-bandwidth capacitive transducers, combined with pulse-compression techniques. The use of a glass container to house samples enabled visual inspection, helping to verify the results of some of the ultrasonic measurements. The non-contact pulse-compression system was used to evaluate agglomeration processes in milk-based products. It is shown that the amplitude of the signal varied with time after the samples had been treated with lactic acid, thus promoting sample destabilization. Non-contact imaging was also performed to follow destabilization of samples by scanning in various directions across the container. The obtained ultrasonic images were also compared to those from a digital camera. Coagulation with glucono-delta-lactone of skim milk poured into this container could be monitored within a precision of a pH of 0.15. This rapid, non-contact and non-destructive technique has shown itself to be a feasible method for investigating the quality of milk-based beverages, and possibly other food products.

Liquid-absorption preconcentrator sampling instrument

DOEpatents

Zaromb, Solomon

1990-01-01

A system for detecting trace concentrations of an analyte in air and includes a preconcentrator for the analyte and an analyte detector. The preconcentrator includes an elongated tubular container in which is disposed a wettable material extending substantially the entire length of the container. One end of the wettable material is continuously wetted with an analyte-sorbing liquid, which flows to the other end of the container. Sample air is flowed through the container in contact with the wetted material for trapping and preconcentrating the traces of analyte in the sorbing liquid, which is then collected at the other end of the container and discharged to the detector. The wetted material may be a wick comprising a bundle of fibers, one end of which is immersed in a reservoir of the analyte-sorbing liquid, or may be a liner disposed on the inner surface of the container, with the sorbing liquid being centrifugally dispersed onto the liner at one end thereof. The container is preferably vertically oriented so that gravity effects the liquid flow.

Liquid-absorption preconcentrator sampling instrument

DOEpatents

Zaromb, S.

1990-12-11

A system is described for detecting trace concentrations of an analyte in air and includes a preconcentrator for the analyte and an analyte detector. The preconcentrator includes an elongated tubular container in which is disposed a wettable material extending substantially the entire length of the container. One end of the wettable material is continuously wetted with an analyte-sorbing liquid, which flows to the other end of the container. Sample air is flowed through the container in contact with the wetted material for trapping and preconcentrating the traces of analyte in the sorbing liquid, which is then collected at the other end of the container and discharged to the detector. The wetted material may be a wick comprising a bundle of fibers, one end of which is immersed in a reservoir of the analyte-sorbing liquid, or may be a liner disposed on the inner surface of the container, with the sorbing liquid being centrifugally dispersed onto the liner at one end thereof. The container is preferably vertically oriented so that gravity effects the liquid flow. 4 figs.

Determination of a wide range of volatile organic compounds in ambient air using multisorbent adsorption/thermal desorption and gas chromatography/mass spectrometry

USGS Publications Warehouse

Pankow, J.F.; Luo, W.; Isabelle, L.M.; Bender, D.A.; Baker, R.J.

1998-01-01

Adsorption/thermal desorption with multisorbent air-sampling cartridges was developed for the determination of 87 method analytes including halogenated alkanes, halogenated alkenes, ethers, alcohols, nitriles, esters, ketones, aromatics, a disulfide, and a furan. The volatilities of the compounds ranged from that of dichlorofluoromethane (CFC12) to that of 1,2,3- trichlorobenzene. The eight most volatile compounds were determined using a 1.5-L air sample and a sample cartridge containing 50 mg of Carbotrap B and 280 mg of Carboxen 1000; the remaining 79 compounds were determined using a 5-L air sample and a cartridge containing 180 mg of Carbotrap B and 70 mg of Carboxen 1000. Analysis and detection were by gas chromatography/mass spectrometry. The minimum detectable level (MDL) concentration values ranged from 0.01 parts per billion by volume (ppbv) for chlorobenzene to 0.4 ppbv for bromomethane; most of the MDL values were in the range 0.02-0.06 ppbv. No breakthrough was detected with the prescribed sample volumes. Analyte stability on the cartridges was very good. Excellent recoveries were obtained with independent check standards. Travel spike recoveries ranged from 90 to 110% for 72 of the 87 compounds. The recoveries were less than 70% for bromomethane and chloroethene and for a few compounds such as methyl acetate that are subject to losses by hydrolysis; the lowest travel spike recovery was obtained for bromomethane (62%). Blank values for all compounds were either below detection or very low. Ambient atmospheric sampling was conducted in New Jersey from April to December, 1997. Three sites characterized by low, moderate, and high densities of urbanization/traffic were sampled. The median detected concentrations of the compounds were either similar at all three sites (as with the chlorofluorocarbon compounds) or increased with the density of urbanization/traffic (as with dichloromethane, MTBE, benzene, and toluene). For toluene, the median detected concentrations were 0.23, 0.42, and 0.70 ppbv at the three sites. Analytical precision was measured using duplicate sampling. As expected, the precision deteriorated with decreasing concentration. At concentrations greater than 0.2 ppbv, most duplicates differed by less than 20%; below the MDL values, the differences between the duplicates were larger, but they were still typically less than 40%.

Determination of hydroxytyrosol and tyrosol by liquid chromatography for the quality control of cosmetic products based on olive extracts.

PubMed

Miralles, Pablo; Chisvert, Alberto; Salvador, Amparo

2015-01-01

An analytical method for the simultaneous determination of hydroxytyrosol and tyrosol in different types of olive extract raw materials and cosmetic cream samples has been developed. The determination was performed by liquid chromatography with UV spectrophotometric detection. Different chromatographic parameters, such as mobile phase pH and composition, oven temperature and different sample preparation variables were studied. The best chromatographic separation was obtained under the following conditions: C18 column set at 35°C and isocratic elution of a mixture ethanol: 1% acetic acid solution at pH 5 (5:95, v/v) as mobile phase pumped at 1 mL min(-1). The detection wavelength was set at 280 nm and the total run time required for the chromatographic analysis was 10 min, except for cosmetic cream samples where 20 min runtime was required (including a cleaning step). The method was satisfactorily applied to 23 samples including solid, water-soluble and fat-soluble olive extracts and cosmetic cream samples containing hydroxytyrosol and tyrosol. Good recoveries (95-107%) and repeatability (1.1-3.6%) were obtained, besides of limits of detection values below the μg mL(-1) level. These good analytical features, as well as its environmentally-friendly characteristics, make the presented method suitable to carry out both the control of the whole manufacture process of raw materials containing the target analytes and the quality control of the finished cosmetic products. Copyright © 2014 Elsevier B.V. All rights reserved.

Determination of the occurrence of gold in an unoxidized Carlin-type ore sample using synchrotron radiation

USGS Publications Warehouse

Chen, J.R.; Chao, E.C.T.; Minkin, J.A.; Back, J.M.; Bagby, W.C.; Rivers, M.L.; Sutton, S.R.; Gordon, B.M.; Hanson, A.L.; Jones, K.W.

1987-01-01

The occurrence of the so-called invisible gold in two unoxidized Carlin-type gold samples from Nevada has been determined using synchrotron X-ray fluorescence (SXRF) analysis at the National Synchrotron Light Source, Brookhaven National Laboratory. A bedded sample from the East ore zone of the Carlin deposit and a breccia sample from Horse Canyon were analyzed. Preliminary results show that gold is found only in the Horse Canyon breccia sample. Experimental details including other X-ray line and diffraction peak interferences, standards used, and minimum detection limits (MDLs) are discussed. Gold, with a MDL range of 0.8 to 3 ppm, was not detected in euhedral pyrite crystals except in the interior porous portion of one grain. Gold was detected in some parts of the matrix. The phase which contains gold has not yet been identified. The highest content of gold so far analyzed is about 40 ppm. There are interesting implications of these new findings. ?? 1987.

Hepatitis E Virus in Pork Production Chain in Czech Republic, Italy, and Spain, 2010

PubMed Central

Di Bartolo, Ilaria; Diez-Valcarce, Marta; Vasickova, Petra; Kralik, Petr; Hernandez, Marta; Angeloni, Giorgia; Ostanello, Fabio; Bouwknegt, Martijn; Rodríguez-Lázaro, David; Pavlik, Ivo

2012-01-01

We evaluated the prevalence of hepatitis E virus (HEV) in the pork production chain in Czech Republic, Italy, and Spain during 2010. A total of 337 fecal, liver, and meat samples from animals at slaughterhouses were tested for HEV by real-time quantitative PCR. Overall, HEV was higher in Italy (53%) and Spain (39%) than in Czech Republic (7.5%). HEV was detected most frequently in feces in Italy (41%) and Spain (39%) and in liver (5%) and meat (2.5%) in Czech Republic. Of 313 sausages sampled at processing and point of sale, HEV was detected only in Spain (6%). HEV sequencing confirmed only g3 HEV strains. Indicator virus (porcine adenovirus) was ubiquitous in fecal samples and absent in liver samples and was detected in 1 slaughterhouse meat sample. At point of sale, we found porcine adenovirus in sausages (1%–2%). The possible dissemination of HEV and other fecal viruses through pork production demands containment measures. PMID:22840221

Detection of genomic loci associated with environmental variables using generalized linear mixed models.

PubMed

Lobréaux, Stéphane; Melodelima, Christelle

2015-02-01

We tested the use of Generalized Linear Mixed Models to detect associations between genetic loci and environmental variables, taking into account the population structure of sampled individuals. We used a simulation approach to generate datasets under demographically and selectively explicit models. These datasets were used to analyze and optimize GLMM capacity to detect the association between markers and selective coefficients as environmental data in terms of false and true positive rates. Different sampling strategies were tested, maximizing the number of populations sampled, sites sampled per population, or individuals sampled per site, and the effect of different selective intensities on the efficiency of the method was determined. Finally, we apply these models to an Arabidopsis thaliana SNP dataset from different accessions, looking for loci associated with spring minimal temperature. We identified 25 regions that exhibit unusual correlations with the climatic variable and contain genes with functions related to temperature stress. Copyright © 2014 Elsevier Inc. All rights reserved.

Virological and bacteriological quality of drinking water in Ethiopia

NASA Astrophysics Data System (ADS)

Bedada, Tesfaye Legesse; Mezemir, Walelign Dessie; Dera, Firehiwot Abera; Sima, Waktole Gobena; Gebre, Samson Girma; Edicho, Redwan Muzeyin; Biegna, Almaz Gonfa; Teklu, Dejenie Shiferaw; Tullu, Kassu Desta

2018-05-01

Since unsafe water is responsible for many illness, deaths, and economic failure, water quality monitoring is essential. A cross-sectional study was conducted on 218 drinking waters samples collected between February and June 2016 to assess water quality using phages by the help of CB390 E. coli host, plaque assay; multiple tube fermentation for coliforms and pour plate for heterotrophic bacteria at Ethiopian Public Health Institute. Heterotrophic plate count greater than 100 cfu/ml was noted in 41 samples and detections of total and thermotolerant coliforms and E. coli in 38, 24, and 10 samples, respectively, and no phages detection in chlorinated waters. While heterotrophic plate count greater than 100 cfu/ml was observed in 100 samples and detections of total and thermotolerant coliforms, E. coli, and phages in 75, 60, 42, and 5 samples, respectively, for untreated waters. The majority of the waters contained indicators above standard limits. This indicates that the sources are contaminated and they are potential threats for health. Hence, regular water monitoring should be a priority agenda.

Detection of triclocarban and two co-contaminating chlorocarbanilides in US aquatic environments using isotope dilution liquid chromatography tandem mass spectrometry.

PubMed

Sapkota, Amir; Heidler, Jochen; Halden, Rolf U

2007-01-01

The antimicrobial compound triclocarban (TCC; 3,4,4'-trichlorocarbanilide; CAS# 101-20-2) is a high-production-volume chemical, recently suggested to cause widespread contamination of US water resources. To test this hypothesis, we developed an isotope dilution liquid chromatography electrospray ionization tandem mass spectrometry method for ultratrace analysis of TCC (0.9 ng/L detection limit) and analyzed low-volume water samples (200 mL) along with primary sludge samples from across the United States. All river water samples (100%) collected downstream of wastewater treatment plants had detectable levels of TCC, as compared to 56% of those taken upstream. Concentrations of TCC (mean+/-standard deviation) downstream of sewage treatment plants (84+/-110 ng/L) were significantly higher (P<0.05; Wilcoxon rank sum test) than those of samples taken upstream (12+/-15 ng/L). Compared to surface water, mean TCC concentrations found in dried, primary sludge obtained from municipal sewage treatment plants in five states were six orders of magnitude greater (19,300+/-7100 microg/kg). Several river samples contained a co-contaminant, identified based on its chromatographic retention time, molecular base ion, and MS/MS fragmentation behavior as 4,4'-dichlorocarbanilide (DCC; CAS# 1219-99-4). In addition to TCC and DCC, municipal sludge contained a second co-contaminant, 3,3',4,4'-tetrachlorocarbanilide (TetraCC; CAS# 4300-43-0). Both newly detected compounds were present as impurities (0.2%(w/w) each) in technical grade TCC (99%). Application of the new method for chlorocarbanilide analysis yielded TCC occurrence data for 13 US states, confirmed the role of sewage treatment plants as environmental inputs of TCC, and identified DCC and TetraCC as previously unrecognized pollutants released into the environment alongside TCC.

The polyphenolic profiles of common bean (Phaseolus vulgaris L.).

PubMed

Lin, Long-Ze; Harnly, James M; Pastor-Corrales, Marcial S; Luthria, Devanand L

2008-03-01

Based on the phenolic profiles obtained by high performance liquid chromatography-electrospray ionization mass spectrometry (HPLC-DAD-ESI/MS), 24 common bean samples, representing 17 varieties and 7 generic off-the-shelf items, belonging to ten US commercial market classes can be organized into six different groups. All of them contained the same hydroxycinnaminic acids, but the flavonoid components showed distinct differences. Black beans contained primarily the 3- O -glucosides of delphinidin, petunidin and malvidin, while pinto beans contained kaempferol and its 3- O -glycosides. Light red kidney bean contained traces of quercetin 3- O -glucoside and its malonates, but pink and dark red kidney beans contained the diglycosides of quercetin and kaempferol. Small red beans contained kaempferol 3- O -glucoside and pelargonidin 3- O -glucoside, while no flavonoids were detected in alubia, cranberry, great northern, and navy beans. This is the first report of the tentative identification of quercetin 3- O -pentosylhexoside and flavonoid glucoside malonates, and the first detailed detection of hydroxycinnamates, in common beans.

Melamine detection in infant formula powder using near- and mid-infrared spectroscopy.

PubMed

Mauer, Lisa J; Chernyshova, Alona A; Hiatt, Ashley; Deering, Amanda; Davis, Reeta

2009-05-27

Near- and mid-infrared spectroscopy methods (NIR, FTIR-ATR, FTIR-DRIFT) were evaluated for the detection and quantification of melamine in infant formula powder. Partial least-squares (PLS) models were established for correlating spectral data to melamine concentration: R(2) > 0.99, RMSECV ≤ 0.9, and RPD ≥ 12. Factorization analysis of spectra was able to differentiate unadulterated infant formula powder from samples containing 1 ppm melamine with no misclassifications, a confidence level of 99.99%, and selectivity > 2. These nondestructive methods require little or no sample preparation. The NIR method has an assay time of 1 min, and a 2 min total time to detection. The FTIR methods require up to 5 min for melamine detection. Therefore, NIR and FTIR methods enable rapid detection of 1 ppm melamine in infant formula powder.

Detection of feline coronavirus using microcantilever sensors

NASA Astrophysics Data System (ADS)

Velanki, Sreepriya; Ji, Hai-Feng

2006-11-01

This work demonstrated the feasibility of detecting severe acute respiratory syndrome associated coronavirus (SARS-CoV) using microcantilever technology by showing that the feline coronavirus (FIP) type I virus can be detected by a microcantilever modified by feline coronavirus (FIP) type I anti-viral antiserum. A microcantilever modified by FIP type I anti-viral antiserum was developed for the detection of FIP type I virus. When the FIP type I virus positive sample is injected into the fluid cell where the microcantilever is held, the microcantilever bends upon the recognition of the FIP type I virus by the antiserum on the surface of the microcantilever. A negative control sample that does not contain FIP type I virus did not cause any bending of the microcantilever. The detection limit of the sensor was 0.1 µg ml-1 when the assay time was <1 h.

A reconnaissance for uranium in carbonaceous rocks in southwestern Colorado and parts of New Mexico

USGS Publications Warehouse

Baltz, Elmer H.

1955-01-01

Coal and carbonaceous shale of the Dakota formation of Cretaceous age were examined for radioactivity in the Colorado Plateau of southwestern Colorado and northwestern New l1exico during the summer of 1953. Older and younger sedimentary rocks and some igneous rocks also were examined, but in less detail, Weak radioactivity was detected at many places but no new deposits of apparent economic importance were discovered. The highest radioactivity of carbonaceous rocks was detected in black shale, siltstone, and sandstone of the Paradox member of the Hermosa formation of Pennsylvanian age. A sample collected from this member at the Bald Eagle prospect in Gypsum Valley, San Higuel County, Colo. contains 0.10. percent uranium. Carbonaceous rocks were investigated at several localities on the Las Vegas Plateau and the Canadian Escarpment in Harding and San Miguel Counties, northeastern New Mexico. Carbonaceous sandstone and siltstone in the middle sandstone member of the Chinle formation of Triassic age contain uranium at a prospect of the Hunt Oil Company southwest of Sabinoso in northeastern San Miguel County, N. Mex. A channel sample across 3.2 feet of mineralized rocks at this locality contains 0.22 percent uranium. Weak radioactivity was detected at two localities in carbonaceous shale of the Dakota and Purgatoire formations of Cretaceous age.

Loop Mediated Isothermal Amplification (LAMP) for Embryo Sex Determination in Pregnant Women at Eight Weeks of Pregnancy.

PubMed

Almasi, Mohammad Amin; Almasi, Galavizh

2017-01-01

In human, SRY (sex-determining region of the Y chromosome) is the major gene for the testis-determining factor which is found in normal XY males and in the rare XX males, and it is absent in normal XX females and many XY females. There are several methods which can indicate a male genotype by the presence of the amplified product of SRY gene. The aim of this study was to identify the SRY gene for embryo sex determination in human during pregnancy using loop mediated isothermal amplification (LAMP) method. A total of 15 blood samples from pregnant women at eight weeks of pregnancy were collected, and Plasma DNA was extracted. LAMP assay was performed using DNA obtained for detection of SRY gene. Furthermore, colorimetric LAMP assay for rapid and easy detection of SRY gene was developed. LAMP results revealed that the positive reaction was highly specific only with samples containing XY chromosomes, while no amplification was found in samples containing XX chromosomes. A total of 15 blood samples from pregnant women were seven male embryos (46.6%) and eight female embryos (53.4%). All used visual components in the colorimetric assay could successfully make a clear distinction between positive and negative ones. The LAMP assay developed in this study is a valuable tool capable of monitoring the purity and detection of SRY gene for sex determination.

Aroma Leakage from Orange Juice Packed in Gable-Top Paper Containers for Chilled Distribution.

PubMed

Aoki, Risa; Tokuda, Aika; Shigemura, Yasutaka; Mineki, Machiko; Sato, Yoshio

2017-01-01

We conducted a study to examine aroma leakage from orange juice packed in gable-top paper containers for chilled distribution. Limonene, an aromatic component of orange juice, was considered as an index compound of aroma leakage, and its seepage on the surface of the container and concentration in the orange juice were measured by GC-MS for 12 commercial samples. After 3 days of storage, limonene was detected on the surface of 8 orange juice containers, and the concentration of limonene in the orange juice was found to have decreased. Thus, limonene leaked through the container within a few days, and the extent of leakage differed between containers, presumably depending upon their barrier properties. In addition, limonene was detected in green tea and milk that was stored together with the unopened orange juice containers at 4℃. The transference of orange aroma into milk was significant, because the contamination of the milk was confirmed by subjective sensory evaluation. This study suggests the possibility of transfer of aroma compounds through paper containers to other beverages.

Enteric Viruses in Raw Vegetables and Groundwater Used for Irrigation in South Korea▿

PubMed Central

Cheong, Sooryun; Lee, Cheonghoon; Song, Sung Won; Choi, Weon Cheon; Lee, Chan Hee; Kim, Sang-Jong

2009-01-01

Raw vegetables irrigated with groundwater that may contain enteric viruses can be associated with food-borne viral disease outbreaks. In this study, we performed reverse transcription-PCR (RT-PCR) and cell culture-PCR to monitor the occurrence of enteric viruses in groundwater samples and in raw vegetables that were cultivated using that groundwater in South Korea. Samples were collected 10 times from three farms located in Gyeonggi Province, South Korea. RT-PCR and cell culture-PCR were performed to detect adenoviruses (AdVs), enteroviruses (EVs), noroviruses (NoVs), and rotaviruses, followed by sequence analyses of the detected strains. Of the 29 groundwater samples and the 30 vegetable samples, five (17%) and three (10%) were positive for enteric viruses, respectively. AdVs were the most frequently detected viruses in four groundwater and three vegetable samples. EVs and NoVs were detected in only one groundwater sample and one spinach sample, respectively. The occurrence of enteric viruses in groundwater and vegetable samples was not correlated with the water temperature and the levels of indicator bacteria, respectively. Phylogenetic analysis indicated that most of the detected AdVs were temporally distributed, irrespective of sample type. Our results indicate that raw vegetables may be contaminated with a broad range of enteric viruses, which may originate from virus-infected farmers and virus-contaminated irrigation water, and these vegetables may act as a potential vector of food-borne viral transmission. PMID:19854919

Potential of cross-priming amplification and DNA-based lateral-flow strip biosensor for rapid on-site GMO screening.

PubMed

Huang, Xin; Zhai, Congcong; You, Qimin; Chen, Hongjun

2014-07-01

The requirement to monitor the presence of genetically modified organisms (GMO) in a variety of marked products has generated an increasing demand for reliable, rapid, and time and cost-effective analytical methods. Here we report an on-site method for rapid detection of cauliflower mosaic virus promoter (CaMV 35S), a common element present in most GMO, using cross-priming amplification (CPA) technology. Detection was achieved using a DNA-based contamination-proof strip biosensor. The limit of detection was 30 copies for the pBI121 plasmid containing the CaMV 35S gene. The certified reference sample of GM maize line MON810 was detectable even at the low relative mass concentration of 0.05%. The developed CPA method had high specificity for the CaMV 35S gene, as compared with other GM lines not containing this gene and non-GM products. The method was further validated using nine real-world samples, and the results were confirmed by real-time PCR analysis. Because of its simplicity, rapidity, and high sensitivity, this method of detecting the CaMV 35S gene has great commercial prospects for rapid GMO screening of high-consumption food and agriculture products.

Development of a PCR Assay for Diagnosing Trematode (Opisthorchis and Haplorchis) Infections in Human Stools

PubMed Central

Kanda, Seiji; Laimanivong, Sakhone; Shimono, Takaki; Darcy, Andrew Waleluma; Phyaluanglath, Amphay; Mishima, Nobuyuki; Nishiyama, Toshimasa

2017-01-01

We developed a combined conventional polymerase chain reaction (PCR) and real-time PCR (qPCR)-based assay for detecting and discriminating between Opisthorchis viverrini and Haplorchis taichui parasite infections. The first PCR amplifies the mitochondrial cytochrome c oxidase subunit I (COI) genes of parasites, and differential diagnosis is achieved by performing qPCR with specific primers and SYBR Green I. The detection limit of the assay was found to be 2.0 × 102 plasmid copies in a test in which a stool sample was spiked with a single egg, which is equivalent to 5 eggs per gram (EPG). The testing of 34 clinical stool samples that had been demonstrated to contain “Opisthorchis-like” eggs by microscopy showed that the novel assay exhibited a sensitivity of 100% for “Opisthorchis-like” parasitic infections, and 71% and 91% of these samples were found to be infected with O. viverrini and H. taichui, respectively. A further four parasitic infections were diagnosed in the 16 negative samples, and the microscopic findings of these samples were confirmed to be false negatives by sequencing analysis. The assay also displayed high specificity during the testing of 10 samples containing other common parasites. The fact that our qPCR SYBR Green I–based assay detected submicroscopic traces of parasitic DNA and was able to differentiate between parasites that produce eggs with similar morphologies indicates that it has a good potential for development of diagnostic application to use in areas where multiple parasites coexist. PMID:27821695

Occurrence of ochratoxin A in cocoa products and chocolate.

PubMed

Serra Bonvehí, Josep

2004-10-06

In this work, the occurrence of ochratoxin A (OTA) in 170 samples of cocoa products of different geographical origins was studied. An immunoaffinity column with HPLC separation was developed to quantify low levels of OTA in cocoa bean, cocoa cake, cocoa mass, cocoa nib, cocoa powder, cocoa shell, cocoa butter, chocolate, and chocolate cream with >80% recoveries. The method was validated by performing replicate analyses of uncontaminated cocoa material spiked at three different levels of OTA (1, 2, and 5 microg/kg). The data obtained were related on the acceptable safe daily exposure for OTA. The highest levels of OTA were detected in roasted cocoa shell and cocoa cake (0.1-23.1 microg/kg) and only at minor levels in the other cocoa products. Twenty-six cocoa and chocolate samples were free from detectable OTA (<0.10 microg/kg). In roasted cocoa powder 38.7% of the samples analyzed contained OTA at levels ranging from 0.1 to 2 microg/kg, and 54.8% was contaminated at >2 microg/kg (and 12 samples at >3 microg/kg). Ochratoxin A was detected in cocoa bean at levels from 0.1 to 3.5 microg/kg, the mean concentration being 0.45 microg/kg; only one sample exceeded 2 microg/kg (4.7%). In contrast, 51.2% of cocoa cake samples contained OTA at levels > or =2 microg/kg, among which 16 exceeded 5 microg/kg (range of 5-9 microg/kg). These results indicate that roasted cocoa powder is not a major source of OTA in the diet.

NEW MEDIUM FOR THE SIMULTANEOUS DETECTION OF TOTAL COLIFORMS AND ESCHERICHIA COLI IN WATER (PUBLISHED ERRATUM APPEARS IN APP ENVIRON MICROBIOL 1993 DEC;59(12):4378)

EPA Science Inventory

A new membrane filter agar medium (MI agar) containing a chromogen, indoxyl-beta-D-glucuronide, and a fluorogen, 4-methylumbelliferyl-beta-D-galactopyranoside, was developed to simultaneously detect and enumerate Escherichia coli and total coliforms (TC) in water samples on the b...

Compressed Sensing Techniques Applied to Ultrasonic Imaging of Cargo Containers.

PubMed

López, Yuri Álvarez; Lorenzo, José Ángel Martínez

2017-01-15

One of the key issues in the fight against the smuggling of goods has been the development of scanners for cargo inspection. X-ray-based radiographic system scanners are the most developed sensing modality. However, they are costly and use bulky sources that emit hazardous, ionizing radiation. Aiming to improve the probability of threat detection, an ultrasonic-based technique, capable of detecting the footprint of metallic containers or compartments concealed within the metallic structure of the inspected cargo, has been proposed. The system consists of an array of acoustic transceivers that is attached to the metallic structure-under-inspection, creating a guided acoustic Lamb wave. Reflections due to discontinuities are detected in the images, provided by an imaging algorithm. Taking into consideration that the majority of those images are sparse, this contribution analyzes the application of Compressed Sensing (CS) techniques in order to reduce the amount of measurements needed, thus achieving faster scanning, without compromising the detection capabilities of the system. A parametric study of the image quality, as a function of the samples needed in spatial and frequency domains, is presented, as well as the dependence on the sampling pattern. For this purpose, realistic cargo inspection scenarios have been simulated.

Compressed Sensing Techniques Applied to Ultrasonic Imaging of Cargo Containers

PubMed Central

Álvarez López, Yuri; Martínez Lorenzo, José Ángel

2017-01-01

One of the key issues in the fight against the smuggling of goods has been the development of scanners for cargo inspection. X-ray-based radiographic system scanners are the most developed sensing modality. However, they are costly and use bulky sources that emit hazardous, ionizing radiation. Aiming to improve the probability of threat detection, an ultrasonic-based technique, capable of detecting the footprint of metallic containers or compartments concealed within the metallic structure of the inspected cargo, has been proposed. The system consists of an array of acoustic transceivers that is attached to the metallic structure-under-inspection, creating a guided acoustic Lamb wave. Reflections due to discontinuities are detected in the images, provided by an imaging algorithm. Taking into consideration that the majority of those images are sparse, this contribution analyzes the application of Compressed Sensing (CS) techniques in order to reduce the amount of measurements needed, thus achieving faster scanning, without compromising the detection capabilities of the system. A parametric study of the image quality, as a function of the samples needed in spatial and frequency domains, is presented, as well as the dependence on the sampling pattern. For this purpose, realistic cargo inspection scenarios have been simulated. PMID:28098841

The aminoethylphosphonate-containing lipids of rumen protozoa

PubMed Central

Dawson, R. M. C.; Kemp, P.

1967-01-01

1. A method is presented for identifying and estimating the aminoethylphosphonate (ciliatine)-containing phospholipids in a complex mixture. 2. Evidence was obtained that the phospholipids of a pure culture of Entodinium caudatum and a mixed rumen protozoa sample contain diglyceride ciliatine, and a plasmalogen ciliatine was detected in the latter. 3. A ninhydrin-positive sphingolipid was isolated from rumen protozoa. Although chromatographically homogeneous on silica gel it contains two components, which were provisionally identified as ceramide ciliatine and ceramide phosphorylethanolamine. 4. A detailed phospholipid analysis of E. caudatum and rumen protozoa is presented. They contain no phosphatidylserine or cardiolipin, but an unidentified phosphoglyceride containing a zwitterionic amino acid is present. PMID:4967076

The presence of Penicillium and Penicillium mycotoxins in food wastes.

PubMed

Rundberget, Thomas; Skaar, Ida; Flåøyen, Arne

2004-01-15

A total of 97 samples (48 summer and 49 winter) of food waste from private households were investigated for Penicillium and for mycotoxins. Twenty-five Penicillium species were isolated and Penicillium crustosum, Penicillium brevicompactum, Penicillium chrysogenum, Penicillium expansum, Penicillium roqueforti, Penicillium spinulosum, Penicillium viridicatum, Penicillium commune, Penicillium citrinum and Penicillium solitum were, in decreasing order, the most frequently identified species. Mycotoxins produced by several of these species, including mycophenolic acid, roquefortine C, penitrems A-F and thomitrems A and E, were detected. Of the 48 summer samples, 36 were severely infected and contained more than 10(5) colony forming units (CFU) Penicillium/g sample. The levels of mycotoxins in these samples were in the range 75-19000 microg/kg mycophenolic acid, 40-920 microg/kg roquefortine C, 35-7500 microg/kg penitrem A, 20-2100 microg/kg thomitrem A and 20-3300 microg/kg thomitrem E. Of the 49 winter samples, only one was found to contain mycophenolic acid (4800 microg/kg) and roquefortine C (190 microg/kg), and this sample was severely infected with P. roqueforti. Thirty samples of food waste collected from the food manufacturing industry were also investigated. The number of Penicillium in these samples was between 10(5) and 10(6) colony forming units (CFU)/g sample. Seven of these samples contained mycophenolic acid ranging from 50 to 600 microg/kg and three of these samples also contained roquefortine C in the range 100-250 microg/kg.

Apparatus and process for microbial detection and enumeration

NASA Technical Reports Server (NTRS)

Wilkins, J. R.; Grana, D. (Inventor)

1982-01-01

An apparatus and process for detecting and enumerating specific microorganisms from large volume samples containing small numbers of the microorganisms is presented. The large volume samples are filtered through a membrane filter to concentrate the microorganisms. The filter is positioned between two absorbent pads and previously moistened with a growth medium for the microorganisms. A pair of electrodes are disposed against the filter and the pad electrode filter assembly is retained within a petri dish by retainer ring. The cover is positioned on base of petri dish and sealed at the edges by a parafilm seal prior to being electrically connected via connectors to a strip chart recorder for detecting and enumerating the microorganisms collected on filter.

Validation of the LacTek test applied to spiked extracts of tissue samples: determination of performance characteristics.

PubMed

Mitchell, J M; Yee, A J; McNab, W B; Griffiths, M W; McEwen, S A

1999-01-01

LacTek tests are competitive enzyme-linked immunosorbent assays intended for rapid detection of antimicrobial residues in bovine milk. In this study, the LacTek test protocol was modified for use with extracts of bovine tissue to detect beta-lactam, tetracycline, and sulfamethazine residues. Test performance characteristics--precision, accuracy, ruggedness, practicability, and analytical specificity and sensitivity--were investigated. Results suggest that LacTek tests can be easily adapted to detect antimicrobial residues in extracts of lean ground beef. However, positive samples may not contain residues at violative concentrations (i.e., Canadian maximum residue limits), and therefore, additional analysis would be required for final confirmation and quantitation (e.g., chromatography).

System and method for detecting components of a mixture including a valving scheme for competition assays

DOEpatents

Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

2017-09-19

Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

System and method for detecting components of a mixture including a valving scheme for competition assays

DOEpatents

Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

2017-07-11

Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

Ambient water quality in aquifers used for drinking-water supplies, Gem County, southwestern Idaho, 2015

USGS Publications Warehouse

Bartolino, James R.; Hopkins, Candice B.

2016-12-20

In recent years, the rapid population growth in Gem County, Idaho, has been similar to other counties in southwestern Idaho, increasing about 54 percent from 1990 to 2015. Because the entire population of the study area depends on groundwater for drinking water supply (either from self-supplied domestic, community, or municipal-supply wells), this population growth, along with changes in land use (including potential petroleum exploration and development), indicated to the public and local officials the need to assess the quality of groundwater used for human consumption. To this end, the U.S. Geological Survey, in cooperation with Gem County and the Idaho Department of Environmental Quality, assessed the quality of groundwater from freshwater aquifers used for domestic supply in Gem County. A total of 47 domestic or municipal wells, 1 spring, and 2 surface-water sites on the Payette River were sampled during September 8–November 19, 2015. The sampled water was analyzed for a variety of constituents, including major ions, trace elements, nutrients, bacteria, radionuclides, dissolved gasses, stable isotopes of water and methane, and either volatile organic compounds (VOCs) or pesticides.To better understand analytical results, a conceptual hydrogeologic framework was developed in which three hydrogeologic units were described: Quaternary-Tertiary deposits (QTd), Tertiary Idaho Group rocks (Tig), and Tertiary-Cretaceous igneous rocks (TKi). Water levels were measured in 30 wells during sampling, and a groundwater-level altitude map was constructed for the QTd and Tig units showing groundwater flow toward the Emmett Valley and Payette River.Analytical results indicate that groundwater in Gem County is generally of good quality. Samples collected from two wells contained water with fluoride concentrations greater than the U.S. Environmental Protection Agency (EPA) Maximum Contaminant Level (MCL) of 4 milligrams per liter (mg/L), six wells contained arsenic at concentrations greater than the EPA MCL of 10 micrograms per liter, and a sample from one well exceeded the MCL of 15 picocuries per liter for alpha particles. Although previous samples collected from some wells in Gem County contained nitrate concentrations greater than the MCL of 10 mg/L, the largest concentration detected in the current study was 5.2 mg/L. Total coliform bacteria was detected in four groundwater samples.Three volatile organic compounds (VOCs) were detected in samples collected from five wells, and five compounds of the triazine class of herbicides were detected in samples from five wells; no concentrations were greater than applicable EPA MCLs. Methane was detected in samples from 36 wells, with the concentration in 1 well large enough to be considered an explosion hazard by U.S. Office of Surface Mining guidelines. Stable isotope signatures of methane in six samples suggest that naturally occurring methane in Gem County is probably of both thermogenic and biogenic origin.

[Correlation of Persistent Free Radicals, PCDD/Fs and Metals in Waste Incineration Fly Ash].

PubMed

Wang, Tian-jiao; Chen, Tong; Zhan, Ming-xiu; Guo, Ying; Li, Xiao-dong

2016-03-15

Environmentally persistent free radicals (EPFRs) are relatively highly stable and found in the formation of polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/Fs). Recent studies have concentrated on model dioxin formation reactions and there are few studies on actual waste incineration fly ash. In order to study EPFRs and the correlation with dioxins and heavy metals in waste incineration fly ash, the spins of EPFRs, concentration of PCDD/Fs and metals in samples from 6 different waste incinerators were detected. The medical waste incineration fly ash from Tianjin, municipal solid waste incineration fly ash from Jiangxi Province, black carbon and slag from municipal solid waste incinerator in Lanxi, Zhejiang Province, all contained EPFRs. Above all the signal in Tianjin sample was the strongest. Hydroxyl radicals, carbon-center radicals and semiquinone radicals were detected. Compared with other samples, Jiangxi fly ash had the highest toxic equivalent quantity (TEQ) of dioxins, up to 7.229 4 ng · g⁻¹. However, the dioxin concentration in the Tianjin sample containing the strongest EPFR signals was only 0.092 8 ng · g⁻¹. There was perhaps little direct numeric link between EPFRs and PCDD/Fs. But the spins of EPFRs in samples presented an increasing trend as the metal contents increased, especially with Al, Fe, Zn. The signal strength of radicals was purposed to be related to the metal contents. The concentration of Zn (0.813 7% ) in the Tianjin sample was the highest and this sample contained much more spins of oxygen-center radicals. We could presume the metal Zn had a greater effect on the formation of EPFRs, and was easier to induce the formation of radicals with a longer half-life period.

Development of a versatile lab-on-a-chip enzyme assay platform for pathogen detection in CBRNE scenarios

NASA Astrophysics Data System (ADS)

Klemm, Richard; Schattschneider, Sebastian; Jahn, Tobias; Hlawatsch, Nadine; Julich, Sandra; Becker, Holger; Gärtner, Claudia

2013-05-01

The ability to integrate complete assays on a microfluidic chip helps to greatly simplify instrument requirements and allows the use of lab-on-a-chip technology in the field. A core application for such field-portable systems is the detection of pathogens in a CBRNE scenario such as permanent monitoring of airborne pathogens, e.g. in metro stations or hospitals etc. As one assay methodology for the pathogen identification, enzymatic assays were chosen. In order evaluate different detection strategies, the realized on-chip enzyme assay module has been designed as a general platform chip. In all application cases, the assays are based on immobilized probes located in microfluidic channels. Therefore a microfluidic chip was realized containing a set of three individually addressable channels, not only for detection of the sample itself also to have a set of references for a quantitative analysis. It furthermore includes two turning valves and a waste container for clear and sealed storage of potential pathogenic liquids to avoid contamination of the environment. All liquids remain in the chip and can be disposed of in proper way subsequently to the analysis. The chip design includes four inlet ports consisting of one sample port (Luer interface) and three mini Luer interfaces for fluidic support of e.g. washing buffer, substrate and enzyme solution. The sample can be applied via a special, sealable sampling vessel with integrated female Luer interface. Thereby also pre-anaytical contamination of the environment can be provided. Other reagents that are required for analysis will be stored off chip.

Heavy metal hazards of sachet water in Nigeria.

PubMed

Orisakwe, Orish Ebere; Igwilo, Innocent O; Afonne, Onyenmechi Johnson; Maduabuchi, John-Moses Ugwuona; Obi, Ejeatuluchukwu; Nduka, John C

2006-01-01

The authors assessed sachet water samples sold in Eastern Nigeria. Using an atomic absorption spectrophotometer, they analyzed levels of lead, cadmium, copper, and nickel. They also analyzed other parameters, such as nitrates, sulfates, chlorides, salinity, total hardness, biological oxygen demand, total dissolved solids, and pH level. Lead levels ranged from 0.002 to 0.036 mg/L in the samples; 5 samples (12.2%) had lead levels above the maximum contaminant level (MCL; 0.015 mg/L). Lead was not detectable in 20 samples (48.8%). Cadmium levels ranged from 0.002 to 0.036 mg/L and exceeded the MCL of 0.005 mg/L in 8 samples (19.5%); it was not detectable in 23 samples (56.1%). Copper was not detected in 2 (0.05%) of the samples. Its range was between 0.018 and 1.401 mg/L. Two samples (0.05%) had copper levels above the MCL (1.30 mg/L). Nickel levels ranged from 0.003 to 0.050 mg/l. The biological oxygen demand of the samples ranged from 3.20 to 36.80 mg/L. Other parameters were normal. The authors found that some of the sachet waters contain heavy metals, and consumers may be exposed to hazards.

Detection and genotyping of Trypanosoma cruzi from açai products commercialized in Rio de Janeiro and Pará, Brazil.

PubMed

Ferreira, Renata Trotta Barroso; Cabral, Maria Luiza; Martins, Ronald Sodré; Araujo, Paula Finamore; da Silva, Sérgio Alves; Britto, Constança; Branquinho, Maria Regina; Cardarelli-Leite, Paola; Moreira, Otacilio C

2018-04-10

Several cases of food-borne acute Chagas disease (ACD) have been reported in the Brazilian Amazon so far. Up to 2004, the occurrence of ACD by oral transmission, associated with food consumption, was rare. Recent cases of ACD in Brazil have been attributed to the consumption of juice from the açai palm containing reservoir animals or insect vectors waste, infected with Trypanosoma cruzi. This study aimed to determine the T. cruzi contamination rate and to genotype the parasite in food samples prepared from açai, which are commercialized in Rio de Janeiro and the Pará States in Brazil. The amplificability of DNA extracted from açai samples, and T. cruzi and Triatominae detection were performed by conventional PCR. Molecular characterization was done by multilocus PCR analysis, to determine the parasite discrete type units (DTUs) based on the size of PCR products in agarose gels, using the intergenic region of the spliced leader (SL), 24 Sα rDNA and nuclear fragment A10 as targets. From the 140 samples of açai-based products analyzed, T. cruzi DNA was detected in 14 samples (10%); triatomine DNA was detected in one of these 14 samples. The parasite genotyping demonstrated that food samples containing açai showed a mixture of T. cruzi DTUs with TcIII, TcV and TcI prevailing. In this study, the molecular detection and identification of T. cruzi from açai-based manufactured food samples, was performed for the first time. Although parasite DNA is a marker of possible contamination during food manufacturing, our findings do not indicate that açai is a source of Chagas disease via oral transmission per se, as live parasites were not investigated. Nevertheless, a molecular approach could be a powerful tool in the epidemiological investigation of outbreaks, supporting previous evidence that açai-based food can be contaminated with T. cruzi. Furthermore, both food quality control and assessment of good manufacturing practices involving açai-based products can be improved, assuring the safety of açai products.

Analysis of multiple enteric viral targets as sewage markers in coral reefs

USGS Publications Warehouse

Lipp, Erin K.; Futch, J. Carrie; Griffin, Dale W.

2007-01-01

Water and coral mucus samples were collected from throughout the Florida Keys National Marine Sanctuary and the Dry Tortugas for three years and were analyzed for human enteric viruses (enteroviruses, noroviruses, hepatitis A virus and adenoviruses) as conservative markers of human sewage using molecular methods. Of the 100 coral and water samples collected, 40 contained genetic material from one or more human enteric viruses. DNA-based adenoviruses were detected widely, in 37.8% of samples and at 91% of stations, including ‘pristine’ reefs in the Dry Tortugas; however, the detection rate was ⩽12% for the RNA-based enteroviruses and noroviruses (hepatitis A virus was never detected). The disparity between the prevalence of RNA- and DNA-based viruses suggests the need for additional work to determine the utility of adenovirus as marker of human sewage.

Point-of-care mobile digital microscopy and deep learning for the detection of soil-transmitted helminths and Schistosoma haematobium.

PubMed

Holmström, Oscar; Linder, Nina; Ngasala, Billy; Mårtensson, Andreas; Linder, Ewert; Lundin, Mikael; Moilanen, Hannu; Suutala, Antti; Diwan, Vinod; Lundin, Johan

2017-06-01

Microscopy remains the gold standard in the diagnosis of neglected tropical diseases. As resource limited, rural areas often lack laboratory equipment and trained personnel, new diagnostic techniques are needed. Low-cost, point-of-care imaging devices show potential in the diagnosis of these diseases. Novel, digital image analysis algorithms can be utilized to automate sample analysis. Evaluation of the imaging performance of a miniature digital microscopy scanner for the diagnosis of soil-transmitted helminths and Schistosoma haematobium, and training of a deep learning-based image analysis algorithm for automated detection of soil-transmitted helminths in the captured images. A total of 13 iodine-stained stool samples containing Ascaris lumbricoides, Trichuris trichiura and hookworm eggs and 4 urine samples containing Schistosoma haematobium were digitized using a reference whole slide-scanner and the mobile microscopy scanner. Parasites in the images were identified by visual examination and by analysis with a deep learning-based image analysis algorithm in the stool samples. Results were compared between the digital and visual analysis of the images showing helminth eggs. Parasite identification by visual analysis of digital slides captured with the mobile microscope was feasible for all analyzed parasites. Although the spatial resolution of the reference slide-scanner is higher, the resolution of the mobile microscope is sufficient for reliable identification and classification of all parasites studied. Digital image analysis of stool sample images captured with the mobile microscope showed high sensitivity for detection of all helminths studied (range of sensitivity = 83.3-100%) in the test set (n = 217) of manually labeled helminth eggs. In this proof-of-concept study, the imaging performance of a mobile, digital microscope was sufficient for visual detection of soil-transmitted helminths and Schistosoma haematobium. Furthermore, we show that deep learning-based image analysis can be utilized for the automated detection and classification of helminths in the captured images.

Point-of-care mobile digital microscopy and deep learning for the detection of soil-transmitted helminths and Schistosoma haematobium

PubMed Central

Holmström, Oscar; Linder, Nina; Ngasala, Billy; Mårtensson, Andreas; Linder, Ewert; Lundin, Mikael; Moilanen, Hannu; Suutala, Antti; Diwan, Vinod; Lundin, Johan

2017-01-01

ABSTRACT Background: Microscopy remains the gold standard in the diagnosis of neglected tropical diseases. As resource limited, rural areas often lack laboratory equipment and trained personnel, new diagnostic techniques are needed. Low-cost, point-of-care imaging devices show potential in the diagnosis of these diseases. Novel, digital image analysis algorithms can be utilized to automate sample analysis. Objective: Evaluation of the imaging performance of a miniature digital microscopy scanner for the diagnosis of soil-transmitted helminths and Schistosoma haematobium, and training of a deep learning-based image analysis algorithm for automated detection of soil-transmitted helminths in the captured images. Methods: A total of 13 iodine-stained stool samples containing Ascaris lumbricoides, Trichuris trichiura and hookworm eggs and 4 urine samples containing Schistosoma haematobium were digitized using a reference whole slide-scanner and the mobile microscopy scanner. Parasites in the images were identified by visual examination and by analysis with a deep learning-based image analysis algorithm in the stool samples. Results were compared between the digital and visual analysis of the images showing helminth eggs. Results: Parasite identification by visual analysis of digital slides captured with the mobile microscope was feasible for all analyzed parasites. Although the spatial resolution of the reference slide-scanner is higher, the resolution of the mobile microscope is sufficient for reliable identification and classification of all parasites studied. Digital image analysis of stool sample images captured with the mobile microscope showed high sensitivity for detection of all helminths studied (range of sensitivity = 83.3–100%) in the test set (n = 217) of manually labeled helminth eggs. Conclusions: In this proof-of-concept study, the imaging performance of a mobile, digital microscope was sufficient for visual detection of soil-transmitted helminths and Schistosoma haematobium. Furthermore, we show that deep learning-based image analysis can be utilized for the automated detection and classification of helminths in the captured images. PMID:28838305

Presence and biological activity of antibiotics used in fuel ethanol and corn co-product production.

PubMed

Compart, D M Paulus; Carlson, A M; Crawford, G I; Fink, R C; Diez-Gonzalez, F; Dicostanzo, A; Shurson, G C

2013-05-01

Antibiotics are used in ethanol production to control bacteria from competing with yeast for nutrients during starch fermentation. However, there is no published scientific information on whether antibiotic residues are present in distillers grains (DG), co-products from ethanol production, or whether they retain their biological activity. Therefore, the objectives of this study were to quantify concentrations of various antibiotic residues in DG and determine whether residues were biologically active. Twenty distillers wet grains and 20 distillers dried grains samples were collected quarterly from 9 states and 43 ethanol plants in the United States. Samples were analyzed for DM, CP, NDF, crude fat, S, P, and pH to describe the nutritional characteristics of the samples evaluated. Samples were also analyzed for the presence of erythromycin, penicillin G, tetracycline, tylosin, and virginiamycin M1, using liquid chromatography and mass spectrometry. Additionally, virginiamycin residues were determined, using a U.S. Food and Drug Administration-approved bioassay method. Samples were extracted and further analyzed for biological activity by exposing the sample extracts to 10(4) to 10(7) CFU/mL concentrations of sentinel bacterial strains Escherichia coli ATCC 8739 and Listeria monocytogenes ATCC 19115. Extracts that inhibited bacterial growth were considered to have biological activity. Physiochemical characteristics varied among samples but were consistent with previous findings. Thirteen percent of all samples contained low (≤1.12 mg/kg) antibiotic concentrations. Only 1 sample extract inhibited growth of Escherichia coli at 10(4) CFU/mL, but this sample contained no detectable concentrations of antibiotic residues. No extracts inhibited Listeria monocytogenes growth. These data indicate that the likelihood of detectable concentrations of antibiotic residues in DG is low; and if detected, they are found in very low concentrations. The inhibition in only 1 DG sample by sentinel bacteria suggests that antibiotic residues in DG were inactivated during the production process or are present in sublethal concentrations.

Assessment of Soil-Gas, Surface-Water, and Soil Contamination at the Installation Railhead, Fort Gordon, Georgia, 2008-2009

USGS Publications Warehouse

Landmeyer, James E.; Harrelson, Larry G.; Ratliff, W. Hagan; Wellborn, John B.

2010-01-01

The U.S. Geological Survey, in cooperation with the U.S. Department of the Army Environmental and Natural Resources Management Office of the U.S. Army Signal Center and Fort Gordon, assessed soil gas, surface water, and soil for contaminants at the Installation Railhead (IR) at Fort Gordon, Georgia, from October 2008 to September 2009. The assessment included delineation of organic contaminants present in soil-gas samples beneath the IR, and in a surface-water sample collected from an unnamed tributary to Marcum Branch in the western part of the IR. Inorganic contaminants were determined in a surface-water sample and in soil samples. This assessment was conducted to provide environmental contamination data to Fort Gordon personnel pursuant to requirements of the Resource Conservation and Recovery Act Part B Hazardous Waste Permit process. Soil-gas samples collected within a localized area on the western part of the IR contained total petroleum hydrocarbons; benzene, toluene, ethylbenzene, and total xylenes (referred to as BTEX); and naphthalene above the method detection level. These soil-gas samples were collected where buildings had previously stood. Soil-gas samples collected within a localized area contained perchloroethylene (PCE). These samples were collected where buildings 2410 and 2405 had been. Chloroform and toluene were detected in a surface-water sample collected from an unnamed tributary to Marcum Branch but at concentrations below the National Primary Drinking Water Standard maximum contaminant level (MCL) for each compound. Iron was detected in the surface-water sample at 686 micrograms per liter (ug/L) and exceeded the National Secondary Drinking Water Standard MCL for iron. Metal concentrations in composite soil samples collected at three locations from land surface to a depth of 6 inches did not exceed the U.S. Environmental Protection Agency Regional Screening Levels for industrial soil.

Minority Human Immunodeficiency Virus Type 1 Variants in Antiretroviral-Naive Persons with Reverse Transcriptase Codon 215 Revertant Mutations▿ †

PubMed Central

Mitsuya, Yumi; Varghese, Vici; Wang, Chunlin; Liu, Tommy F.; Holmes, Susan P.; Jayakumar, Prerana; Gharizadeh, Baback; Ronaghi, Mostafa; Klein, Daniel; Fessel, W. Jeffrey; Shafer, Robert W.

2008-01-01

T215 revertant mutations such as T215C/D/E/S that evolve from the nucleoside reverse transcriptase (RT) inhibitor mutations T215Y/F have been found in about 3% of human immunodeficiency virus type 1 (HIV-1) isolates from newly diagnosed HIV-1-infected persons. We used a newly developed sequencing method—ultradeep pyrosequencing (UDPS; 454 Life Sciences)—to determine the frequency with which T215Y/F or other RT inhibitor resistance mutations could be detected as minority variants in samples from untreated persons that contain T215 revertants (“revertant” samples) compared with samples from untreated persons that lack such revertants (“control” samples). Among the 22 revertant and 29 control samples, UDPS detected a mean of 3.8 and 4.8 additional RT amino acid mutations, respectively. In 6 of 22 (27%) revertant samples and in 4 of 29 control samples (14%; P = 0.4), UDPS detected one or more RT inhibitor resistance mutations. T215Y or T215F was not detected in any of the revertant or control samples; however, 4 of 22 revertant samples had one or more T215 revertants that were detected by UDPS but not by direct PCR sequencing. The failure to detect viruses with T215Y/F in the 22 revertant samples in this study may result from the overwhelming replacement of transmitted T215Y variants by the more fit T215 revertants or from the primary transmission of a T215 revertant in a subset of persons with T215 revertants. PMID:18715933

Nitromethane K-9 Detection Limit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strobel, R; Kury, J

2003-08-29

The Bureau of Alcohol, Tobacco and Firearms (ATF) trains canine/handler teams to detect explosives for government and other agencies worldwide. After completing the training program the teams are tested on an array containing explosives and numerous other samples designed to distract a canine. Passing this test results in a team's certification. These teams can be considered as ''detection instruments'' freshly calibrated just before leaving the ''factory''. Using these teams to examine special experimental arrays immediately following certification can lead to a better understanding of a canine's detection capabilities. Forty-one of these ''detection instruments'' were used in four test series withmore » arrays containing dilute nitromethane-in-water solutions. (The canines had been trained on the amount of nitromethane vapor in equilibrium with the undiluted liquid explosive.) By diluting liquid nitromethane with water, the amount of explosive vapor can be reduced many orders of magnitude to test the lower limit of the canine's nitromethane vapor detection response. The results are presented in this paper.« less

Effect of high-temperature, short-time (HTST) pasteurization on milk containing low numbers of Mycobacterium paratuberculosis.

PubMed

Grant, I R; Ball, H J; Rowe, M T

1998-02-01

The efficacy of high-temperature, short-time (HTST) pasteurization (72 degrees C/15 s) when low numbers (< or = 10(3) cfu ml-1) of Mycobacterium paratuberculosis are present in milk was investigated. Raw cows' milk spiked with Myco. paratuberculosis (10(3) cfu ml-1, 10(2) cfu ml-1, 10 cfu ml-1, and 10 cfu 50 ml-1) was subjected to HTST pasteurization using laboratory pasteurizing units. Ten bovine strains of Myco. paratuberculosis were tested in triplicate. Culture in BACTEC Middlebrook 12B radiometric medium detected acid-fast survivors in 14.8% and 10% of HTST-pasteurized milk samples at the 10(3) and 10(2) cfu ml-1 inoculum levels, respectively, whereas conventional culture on Herrold's egg yolk medium containing mycobactin J detected acid-fast survivors in only 3.7% and 6.7% of the same milk samples. IS900-based PCR confirmed that these acid-fast survivors were Myco. paratuberculosis. No viable Myco. paratuberculosis were isolated from HTST-pasteurized milk initially containing either 10 cfu ml-1 or 10 cfu 50 ml-1.

βC1 is a pathogenicity determinant: not only for begomoviruses but also for a mastrevirus.

PubMed

Kumar, Jitendra; Kumar, Jitesh; Singh, Sudhir P; Tuli, Rakesh

2014-11-01

βC1 proteins, encoded by betasatellites, are known to be pathogenicity determinants, and they are responsible for symptom expression in many devastating diseases caused by begomoviruses. We report the involvement of βC1 in pathogenicity determination of a mastrevirus. Analysis of field samples of wheat plants containing wheat dwarf India virus (WDIV) revealed the presence of a full-length and several defective betasatellite molecules. The detected betasatellite was identified as ageratum yellow leaf curl betasatellite (AYLCB). No begomovirus was detected in any of the samples. The full-length AYLCB contained an intact βC1 gene, whereas the defective molecules contained complete or partial deletions of βC1. Agroinoculation of wheat with the full-length AYLCB and WDIV or of tobacco with ageratum enation virus enhanced the pathogenicity and accumulation of the respective viruses, whereas the defective molecules could not. This study indicates that βC1 is a pathogenicity determinant for WDIV and can interact functionally not only with begomoviruses but also with a mastrevirus.

Tissue-based standoff biosensors for detecting chemical warfare agents

DOEpatents

Greenbaum, Elias; Sanders, Charlene A.

2003-11-18

A tissue-based, deployable, standoff air quality sensor for detecting the presence of at least one chemical or biological warfare agent, includes: a cell containing entrapped photosynthetic tissue, the cell adapted for analyzing photosynthetic activity of the entrapped photosynthetic tissue; means for introducing an air sample into the cell and contacting the air sample with the entrapped photosynthetic tissue; a fluorometer in operable relationship with the cell for measuring photosynthetic activity of the entrapped photosynthetic tissue; and transmitting means for transmitting analytical data generated by the fluorometer relating to the presence of at least one chemical or biological warfare agent in the air sample, the sensor adapted for deployment into a selected area.

Level and Chemical Composition of Cryoglobulins in Schizophrenia

NASA Astrophysics Data System (ADS)

Khoyetsyan, Aren; Boyajyan, Anna; Melkumova, Maya

The blood samples of 40 schizophrenic patients were tested for the presence of cryoglobulins (Cgs) and composition of Cgs was examined. The elevated levels of type III Cgs, containing complement components, were detected in all study subjects.

Evaluation of lipid-containing semipermeable membrane devices for monitoring organochlorine contaminants in the Upper Mississippi river

USGS Publications Warehouse

Ellis, Geoffrey S.; Rostad, Colleen E.; Huckins, James N.; Schmitt, Christopher J.; MacCarthy, Patrick

1995-01-01

Organochlorine contaminants sequestered in lipid-containing semipermeable membrane devices (SPMDs) were compared to those found in tangential-flow ultrafilter permeates as part of a pilot study at 10 sites in the Upper Mississippi River system. Caged and feral fish from three primary sites were also analyzed for comparison. Concentrated organochlorine (OC) compounds were readily extracted from the SPMDs by dialysis into hexane, and samples were analyzed by gas chromatography-negative chemical ionization-mass spectrometry. Fish and water samples were processed by conventional methods. Reasonable agreement was found between analyte SPMD-derived water concentrations and measured values of ultrafilter permeates; however, concentrations of the same analytes in caged fish did not appear to be proportional to water concentrations derived from SPMDs and ultrafilter permeates. The greatest number of OC compounds was detected in SPMDs; fewer were detected in caged fish and feral fish.

Accidental discharge of brodifacoum baits into a freshwater lake: a case study.

PubMed

Fisher, P; Funnell, E; Fairweather, A; Brown, L; Campion, M

2012-02-01

Approximately 700 kg of cereal bait containing 20 ppm of the anticoagulant rodenticide brodifacoum was spilled into a southern New Zealand lake in 2010 from a helicopter being used to transport containers of brodifacoum bait for an aerial baiting operation. In the month after the spill no residual brodifacoum was detected in samples of lake water, sediment, benthic invertebrates, eels, and two birds.

Phanerochaete flavido-alba Laccase Induction and Modification of Manganese Peroxidase Isoenzyme Pattern in Decolorized Olive Oil Mill Wastewaters

PubMed Central

Pérez, J.; de la Rubia, T.; Hamman, O. Ben; Martínez, J.

1998-01-01

Lignin-degrading enzymes were partially purified from supernatant solutions obtained from Phanerochaete flavido-alba-decolorized olive oil mill wastewaters (OMW). The dominant enzymes, manganese peroxidases, exhibited different isoform patterns in decolorized OMW-containing cultures than in residue-free samples. Laccase induction was also detected in OMW-containing cultures but not in control cultures. PMID:9647858

Flavanol and procyanidin content (by degree of polymerization 1-10) of chocolate, cocoa liquors, cocoa powders, and cocoa extracts: first action 2012.24.

PubMed

Robbins, Rebecca J; Leonczak, Jadwiga; Li, Julia; Johnson, J Christopher; Collins, Tom; Kwik-Uribe, Catherine; Schmitz, Harold H

2013-01-01

An international collaborative study was conducted on an HPLC method with fluorescent detection for the determination of flavanols and procyanidins in chocolate and cocoa-containing materials. The sum of the oligomeric fractions with degree of polymerization 1-10 was the determined content value. Sample materials included dark and milk chocolates, cocoa powder, cocoa liquors, and cocoa extracts. The content ranged from approximately 2 to 500 mg/g (defatted basis). Thirteen laboratories--representing commercial, industrial, and academic institutions in six countries--participated in this interlaboratory study. Fourteen samples were sent as blind duplicates to the collaborators. Results for 12 laboratories yielded repeatability RSD (RSDr) values below 10% for all materials analyzed, ranging from 4.17 to 9.61%. Reproducibility RSD (RSDR) values ranged from 5.03 to 12.9% for samples containing 8.07 to 484.7 mg/g material analyzed. In one sample containing a low content of flavanols and procyanidins (approximately 2 mg/g), the RSDR was 17.68%.

Development of Antigen Detection Assay for Diagnosis of Tuberculosis Using Sputum Samples

PubMed Central

Pereira Arias-Bouda, Lenka M.; Nguyen, Lan N.; Ho, Ly M.; Kuijper, Sjoukje; Jansen, Henk M.; Kolk, Arend H. J.

2000-01-01

The rising incidence of tuberculosis worldwide means an increasing burden on diagnostic facilities, so tests simpler than Ziehl-Neelsen staining are needed. Such tests should be objective, reproducible, and have at least as good a detection limit as 104 bacteria/ml. A capture enzyme-linked immunosorbent assay (ELISA) was developed for detection of lipoarabinomannan (LAM) in human sputum samples. As a capture antibody, we used a murine monoclonal antibody against LAM, with rabbit antiserum against Mycobacterium tuberculosis as a source of detector antibodies. The sensitivity of the capture ELISA was evaluated by using purified LAM and M. tuberculosis whole cells. We were able to detect 1 ng of purified LAM/ml and 104 M. tuberculosis whole cells/ml. LAM could also be detected in culture filtrate of a 3-week-old culture of M. tuberculosis. The culture filtrate contained approximately 100 μg of LAM/ml. The detection limit in sputum pretreated with N-acetyl-l-cysteine and proteinase K was 104 M. tuberculosis whole cells per ml. Thirty-one (91%) of 34 sputum samples from 18 Vietnamese patients with tuberculosis (32 smear positive and 2 smear negative) were positive in the LAM detection assay. In contrast, none of the 25 sputum samples from 21 nontuberculous patients was positive. This specific and sensitive assay for the detection of LAM in sputum is potentially useful for the diagnosis of tuberculosis. PMID:10834989

Model-based approaches to deal with detectability: a comment on Hutto (2016)

USGS Publications Warehouse

Marques, Tiago A.; Thomas, Len; Kéry, Marc; Buckland, Steve T.; Borchers, David L.; Rexstad, Eric; Fewster, Rachel M.; MacKenzie, Darryl I.; Royle, Andy; Guillera-Arroita, Gurutzeta; Handel, Colleen M.; Pavlacky, David C.; Camp, Richard J.

2017-01-01

In a recent paper, Hutto (2016a) challenges the need to account for detectability when interpreting data from point counts. A number of issues with model-based approaches to deal with detectability are presented, and an alternative suggested: surveying an area around each point over which detectability is assumed certain. The article contains a number of false claims and errors of logic, and we address these here. We provide suggestions about appropriate uses of distance sampling and occupancy modeling, arising from an intersection of design- and model-based inference.

A simulation study of fast neutron interrogation for standoff detection of improvised explosive devices

NASA Astrophysics Data System (ADS)

Heider, S. A.; Dunn, W. L.

2015-11-01

The signature-based radiation-scanning technique utilizes radiation detector responses, called "signatures," and compares these to "templates" in order to differentiate targets that contain certain materials, such as explosives or drugs, from those that do not. Our investigations are aimed at the detection of nitrogen-rich explosives contained in improvised explosive devices. We use the term "clutter" to refer to any non-explosive materials with which the interrogating radiation may interact between source and detector. To deal with the many target types and clutter configurations that may be encountered in the field, the use of "artificial templates" is proposed. The MCNP code was used to simulate 14.1 MeV neutron source beams incident on one type of target containing various clutter and sample materials. Signatures due to inelastic-scatter and prompt-capture gamma rays from hydrogen, carbon, nitrogen, and oxygen and two scattered neutron signatures were considered. Targets containing explosive materials in the presence of clutter were able to be identified from targets that contained only non-explosive ("inert") materials. This study demonstrates that a finite number of artificial templates is sufficient for IED detection with fairly good sensitivity and specificity.

Crystals and tablets in the Spanish ecstasy market 2000-2014: Are they the same or different in terms of purity and adulteration?

PubMed

Vidal Giné, Claudio; Ventura Vilamala, Mireia; Fornís Espinosa, Iván; Gil Lladanosa, Cristina; Calzada Álvarez, Nú; Fitó Fruitós, Ariadna; Rodríguez Rodríguez, Joan; Domíngo Salvany, Antonia; de la Torre Fornell, Rafael

2016-06-01

Although 3,4-methylenedioxymethamphetamine (MDMA) has a long history in recreational settings, research on its composition (purity and adulteration) has focused only on tablets even though crystal format is readily available for users. Drug specimens collected between January 2000 and December 2014 were analyzed at Energy Control's facilities. All samples were voluntarily provided by drug users. Sample identification was made with thin layer chromatography and gas chromatography coupled to mass spectrometry, and quantification with ultraviolet spectrophotometry (only in unadulterated samples). Between January 2000 and December 2014, 6200 samples purchased as ecstasy by their users were analyzed. Crystals were the most frequent format (60.6%) followed by tablets (38.8%). During the study period, the proportion of samples containing only MDMA was higher in crystals than in tablets. Compared with tablets, adulterated crystal samples contained the same number of adulterants but more combinations of different substances. Although caffeine was commonly detected as adulterant both in crystals and tablets, other substances such as phenacetin, lidocaine, dextrometorphan or methamphetamine were detected almost exclusively in crystal samples. The amount of MDMA in crystal samples remained stable unlike tablets for which a huge increase in MDMA dose was observed since 2010. Crystal samples of ecstasy showed clear differences compared to ecstasy tablets and this must be taken into account both in research and harm reduction. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Ochratoxin A Concentrations in a Variety of Grain-Based and Non-Grain-Based Foods on the Canadian Retail Market from 2009 to 2014.

PubMed

Kolakowski, Beata; O'Rourke, Sarah M; Bietlot, Henri P; Kurz, Karl; Aweryn, Barbara

2016-12-01

The extent of ochratoxin A (OTA) contamination of domestically produced foods sold across Canada was determined from 2009 to 2014 with sampling and testing occurring each fiscal year. Cereal-based, fruit-based, and soy-based food samples (n = 6,857) were analyzed. Almost half of the samples (3,200; 47%) did not contain detectable concentrations of OTA. The remaining 3,657 samples contained OTA at 0.040 to 631 ng/g. Wheat, oats, milled products of other grains (such as rye and buckwheat), and to a lesser extent corn products and their derived foods were the most significant potential sources of OTA exposure for the Canadian population. Wine, grape juice, soy products, beer, dairy-based infant formula, and licorice candy were not significant contributors to OTA consumption. Spices had the highest OTA concentrations; but because so little is ingested, these foods are not considered to be a significant source of OTA. In contrast, infant formulas and cereals can be important dietary sources of OTA. Infant cereals containing oats and infant formulas containing soy had detectable concentrations of OTA, some of which exceeded the proposed Canadian guidelines. The prevalence and concentrations of OTA in major crops (wheat, corn, and oats) varied widely across years. Because these foods were purchased at retail stores, no information was available on the OTA concentrations in the raw materials, the storage conditions before purchase of the samples, or the origin of the ingredients (may include blends of raw materials from different years and/or different geographical regions of Canada); therefore, impact of these factors could not be assessed. Overall, 2.3% of the samples exceeded the proposed Canadian OTA regulatory limits and 2.7% exceeded the current European Union (EU) OTA regulatory limits. These results are consistent with a Health Canada exposure assessment published in 2010, despite the inclusion of a wider range of products and confirm the safety of foods widely available across Canada.

Continental bottled water assessment by stir bar sorptive extraction followed by gas chromatography-tandem mass spectrometry (SBSE-GC-MS/MS).

PubMed

Guart, Albert; Calabuig, Ignacio; Lacorte, Silvia; Borrell, Antonio

2014-02-01

This study was aimed to determine the presence of 69 organic contaminants in 77 representative bottled waters collected from 27 countries all over the world. All water samples were contained in polyethylene terephthalate bottles. Target compounds were (1) environmental contaminants (including 13 polycyclic aromatic hydrocarbons (PAHs), 31 pesticides including organochlorine (OCPs), organophosphorus, and pyrethroids; 7 polychlorinated biphenyls (PCBs); and 7 triazines) and (2) plasticizers (including 6 phthalates and 5 other compounds). Samples were analyzed by stir bar sorptive extraction followed by gas chromatography-tandem mass spectrometry. PAHs, OCPs, PCBs, and triazines, which are indicators of groundwater pollution, were not detected in most of the samples, except for naphthalene (0.005-0.202 μg/L, n = 16). On the other hand, plastic components were detected in 77 % of the samples. Most frequently detected compounds were dimethyl phthalate and benzophenone at concentrations of 0.005-0.125 (n = 41) and 0.014-0.921 (n = 32), respectively. Levels detected are discussed in terms of contamination origin and geographical distribution. Target compounds were detected at low concentrations. Results obtained showed the high quality of bottled water in the different countries around the world.

Electrochemical detection of fluoroquinolone antibiotics in milk using a magneto immunosensor.

PubMed

Pinacho, Daniel G; Sánchez-Baeza, Francisco; Pividori, María-Isabel; Marco, María-Pilar

2014-08-28

An amperometric magneto-immunosensor (AMIS) for the detection of residues of fluoroquinolone antibiotics in milk samples is described for the first time. The immunosensor presented combines magnetic beads biomodified with an antibody with a broad recognition profile of fluoroquinolones, a haptenized enzyme and a magnetic graphite-epoxy composite (m-GEC) electrode. After the immunochemical reaction with specific enzyme tracer, the antibody biomodified magnetic beads are easily captured by an electrode made of graphite-epoxy composite containing a magnet, which also acts as transducer for the electrochemical detection. In spite of the complexity of milk, the use of magnetic beads allows elimination of potential interferences caused by the matrix components; hence the AMIS could perform quantitative measurements, directly in these samples, without any additional sample cleanup or extraction step. The immunosensor is able to detect up to seven different fluoroquinolones far below the MRLs defined by the UE for milk; for example ciprofloxacin is detected directly in milk with an IC50 of 0.74 µg/L and a LOD of 0.009 µg/L. This strategy offers great promise for rapid, simple, cost-effective, and on-site analysis fluoroquinolones in complex samples.

Electrochemical Detection of Fluoroquinolone Antibiotics in Milk Using a Magneto Immunosensor

PubMed Central

Pinacho, Daniel G.; Sánchez-Baeza, Francisco; Pividori, María-Isabel; Marco, María-Pilar

2014-01-01

An amperometric magneto-immunosensor (AMIS) for the detection of residues of fluoroquinolone antibiotics in milk samples is described for the first time. The immunosensor presented combines magnetic beads biomodified with an antibody with a broad recognition profile of fluoroquinolones, a haptenized enzyme and a magnetic graphite–epoxy composite (m-GEC) electrode. After the immunochemical reaction with specific enzyme tracer, the antibody biomodified magnetic beads are easily captured by an electrode made of graphite-epoxy composite containing a magnet, which also acts as transducer for the electrochemical detection. In spite of the complexity of milk, the use of magnetic beads allows elimination of potential interferences caused by the matrix components; hence the AMIS could perform quantitative measurements, directly in these samples, without any additional sample cleanup or extraction step. The immunosensor is able to detect up to seven different fluoroquinolones far below the MRLs defined by the UE for milk; for example ciprofloxacin is detected directly in milk with an IC50 of 0.74 μg/L and a LOD of 0.009 μg/L. This strategy offers great promise for rapid, simple, cost-effective, and on-site analysis fluoroquinolones in complex samples. PMID:25171120

Development of a Highly Specific Fluorescence Immunoassay for Detection of Diisobutyl Phthalate in Edible Oil Samples.

PubMed

Cui, Xiping; Wu, Panpan; Lai, Dan; Zheng, Shengwu; Chen, Yingshan; Eremin, Sergei A; Peng, Wei; Zhao, Suqing

2015-10-28

The diisobutyl phthalate (DiBP) hapten containing an amino group was synthesized successfully, and the polyclonal antibody against 4-amino phthalate-bovine serum albumin (BSA) was developed. On the basis of the polyclonal antibody, a rapid and sensitive indirect competitive fluorescence immunoassay (icFIA) has been established to detect DiBP in edible oil samples for the first time. Under the optimized conditions, the quantitative working range of the icFIA was from 10.47 to 357.06 ng/mL (R(2) = 0.991), exhibiting a detection limit of 5.82 ng/mL. In this assay, the specific results showed that other similar phthalates did not significantly interfere with the analysis, with the cross-reactivity less than 1.5%, except for that of DiBAP. Thereafter, DiBP contamination in edible oil samples was detected by icFIA, with the recovery being from 79 to 103%. Furthermore, the reliability of icFIA was validated by gas chromatography-mass spectrometry (GC-MS). Therefore, the developed icFIA is suitable for monitoring DiBP in some edible oil samples.

Identification of V-type nerve agents in vapor samples using a field-portable capillary gas chromatography/membrane-interfaced electron ionization quadrupole mass spectrometry instrument with Tri-Bed concentrator and fluoridating conversion tube.

PubMed

Ohrui, Y; Nagoya, T; Kurimata, N; Sodeyama, M; Seto, Y

2017-07-01

A field-portable gas chromatography-mass spectrometry (GC-MS) system (Hapsite ER) was evaluated for the detection of nonvolatile V-type nerve agents (VX and Russian VX (RVX)) in the vapor phase. The Hapsite ER system consists of a Tri-Bed concentrator gas sampler, a nonpolar low thermal-mass capillary GC column and a hydrophobic membrane-interfaced electron ionization quadrupole mass spectrometer evacuated by a non-evaporative getter pump. The GC-MS system was attached to a VX-G fluoridating conversion tube containing silver nitrate and potassium fluoride. Sample vapors of VX and RVX were converted into O-ethyl methylphosphonofluoridate (EtGB) and O-isobutyl methylphosphonofluoridate (iBuGB), respectively. These fluoridated derivatives were detected within 10 min. No compounds were detected when the VX and RVX samples were analyzed without the conversion tube. A vapor sample of tabun (GA) was analyzed, in which GA and O-ethyl N,N-dimethylphosphoramidofluoridate were detected. The molar recovery percentages of EtGB and iBuGB from VX and RVX vapors varied from 0.3 to 17%, which was attributed to variations in the vaporization efficiency of the glass vapor container. The conversion efficiencies of the VX-G conversion tube for VX and RVX to their phosphonate derivatives were estimated to be 40%. VX and RVX vapors were detected at concentrations as low as 0.3 mg m -3 . Gasoline vapor was found to interfere with the analyses of VX and RVX. In the presence of 160 mg m -3 gasoline, the detection limits of VX and RVX vapor were increased to 20 mg m -3 . Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Analysis of Hypodermic Needles and Syringes for the Presence of Blood and Polydimethylsiloxane (Silicone) Utilizing Microchemical Tests and Infrared Spectroscopy.

PubMed

Crowe, John B; Lanzarotta, Adam; Witkowski, Mark R; Andria, Sara E

2015-07-01

Suspect hypodermic needles and syringes were seized from an unlicensed individual who was allegedly injecting patients with silicone (polydimethylsiloxane [PDMS]) for cosmetic enhancement. Since control syringe barrels and needles often contain an interfering PDMS lubricant, a risk for false positives of foreign PDMS exists. The focus of this report was to minimize this risk and determine a quick and reliable test for the presence of blood in PDMS matrices. Using ATR-FT-IR spectroscopy, the risk for false-positive identification of foreign PDMS was reduced by (i) overfilling the sampling aperture to prevent spectral distortions and (ii) sampling a region of the suspect syringe/needle assembly where manufacturer-applied PDMS is not typically located. Analysis for blood indicated that the Teichman microchemical test was effective for detecting blood in the presence of PDMS. Overall, detecting PDMS established intent and detecting blood established that the needle containing the PDMS had been used for injection. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

Recommended Immunological Assays to Screen for Ricin-Containing Samples

PubMed Central

Simon, Stéphanie; Worbs, Sylvia; Avondet, Marc-André; Tracz, Dobryan M.; Dano, Julie; Schmidt, Lisa; Volland, Hervé; Dorner, Brigitte G.; Corbett, Cindi R.

2015-01-01

Ricin, a toxin from the plant Ricinus communis, is one of the most toxic biological agents known. Due to its availability, toxicity, ease of production and absence of curative treatments, ricin has been classified by the Centers for Disease Control and Prevention (CDC) as category B biological weapon and it is scheduled as a List 1 compound in the Chemical Weapons Convention. An international proficiency test (PT) was conducted to evaluate detection and quantification capabilities of 17 expert laboratories. In this exercise one goal was to analyse the laboratories’ capacity to detect and differentiate ricin and the less toxic, but highly homologuous protein R. communis agglutinin (RCA120). Six analytical strategies are presented in this paper based on immunological assays (four immunoenzymatic assays and two immunochromatographic tests). Using these immunological methods “dangerous” samples containing ricin and/or RCA120 were successfully identified. Based on different antibodies used the detection and quantification of ricin and RCA120 was successful. The ricin PT highlighted the performance of different immunological approaches that are exemplarily recommended for highly sensitive and precise quantification of ricin. PMID:26703725

Recommended Immunological Assays to Screen for Ricin-Containing Samples.

PubMed

Simon, Stéphanie; Worbs, Sylvia; Avondet, Marc-André; Tracz, Dobryan M; Dano, Julie; Schmidt, Lisa; Volland, Hervé; Dorner, Brigitte G; Corbett, Cindi R

2015-11-26

Ricin, a toxin from the plant Ricinus communis, is one of the most toxic biological agents known. Due to its availability, toxicity, ease of production and absence of curative treatments, ricin has been classified by the Centers for Disease Control and Prevention (CDC) as category B biological weapon and it is scheduled as a List 1 compound in the Chemical Weapons Convention. An international proficiency test (PT) was conducted to evaluate detection and quantification capabilities of 17 expert laboratories. In this exercise one goal was to analyse the laboratories' capacity to detect and differentiate ricin and the less toxic, but highly homologuous protein R. communis agglutinin (RCA120). Six analytical strategies are presented in this paper based on immunological assays (four immunoenzymatic assays and two immunochromatographic tests). Using these immunological methods "dangerous" samples containing ricin and/or RCA120 were successfully identified. Based on different antibodies used the detection and quantification of ricin and RCA120 was successful. The ricin PT highlighted the performance of different immunological approaches that are exemplarily recommended for highly sensitive and precise quantification of ricin.

Development and validation of a sensitive and fast chemiluminescent enzyme immunoassay for the detection of genetically modified maize.

PubMed

Roda, A; Mirasoli, M; Guardigli, M; Michelini, E; Simoni, P; Magliulo, M

2006-03-01

Proteins from the Cry 1 family, in particular Cry 1Ab, are commonly expressed in genetically modified Bt maize in order to control chewing insect pests. A sensitive chemiluminescent sandwich enzyme immunoassay for the detection of Cry1Ab protein from genetically modified Bt maize has been developed and validated. A Cry1Ab protein-specific antibody was immobilized on 96- or 384-well microtiter plates in order to capture the Cry1Ab toxin in the sample; the bound toxin was then detected by employing a second anti-Cry1Ab antibody and a horseradish peroxidase-labeled anti-antibody, followed by measurement of the enzyme activity with an enhanced chemiluminescent system. The chemiluminescent assay fulfilled all the requirements of accuracy and precision and exhibited limits of detection of a few pg mL(-1) Cry1Ab (3 or 5 pg mL(-1), depending on the assay format), which are significantly lower than that achievable using conventional colorimetric detection of peroxidase activity and also represent an improvement compared to previously developed Cry1Ab immunoassays. High-throughput analysis can be performed using the 384-well microtiter plate format immunoassay, which also allows one to reduce the consumption of samples and reagents. Validation of the assay, performed by analyzing certified reference materials, proved that the immunoassay is able to detect the presence of the Cry1Ab protein in certified reference samples containing as low as 0.1% of MON 810 genetically modified Bt maize. This value is below the threshold requiring mandatory labeling of foods containing genetically modified material according to the actual EU regulation.

Evaluation of a national data set for insights into sources, composition, and concentrations of per- and polyfluoroalkyl substances (PFASs) in U.S. drinking water.

PubMed

Guelfo, Jennifer L; Adamson, David T

2018-05-01

The United States Environmental Protection Agency (USEPA) completed nationwide screening of six perfluoroalkyl substances in U.S. drinking water from 2013 to 2015 under the Third Unregulated Contaminant Monitoring Rule (UCMR3). UCMR3 efforts yielded a dataset of 36,139 samples containing analytical results from >5000 public water systems (PWSs). This study used UCMR3 data to investigate three aspects of per- and polyfluoroalkyl substances (PFASs) in drinking water: the occurrence of PFAS and co-contaminant mixtures, trends in PFAS detections relative to PWS characteristics and potential release types, and temporal trends in PFAS occurrence. This was achieved through bivariate and multivariate analyses including categorical analysis, concentration ratios, and hierarchical cluster analysis. Approximately 50% of samples with PFAS detections contained ≥2 PFASs, and 72% of detections occurred in groundwater. Large PWSs (>10,000 customers) were 5.6 times more likely than small PWSs (≤10,000 customers) to exhibit PFAS detections; however, when detected, median total PFAS concentrations were higher in small PWSs (0.12 μg/L) than in large (0.053 μg/L). Bivariate and multivariate analyses of PFAS composition suggested PWSs reflect impacts due to firefighting foam use and WWTP effluent as compared to other source types for which data were available. Mann-Kendall analysis of quarterly total PFAS detection rates indicated an increasing trend over time (p = 0.03). UCMR3 data provide a foundation for tiered design of targeted sampling and analysis plans to address remaining knowledge gaps in the sources, composition, and concentrations of PFASs in U.S. drinking water. Copyright © 2018 Elsevier Ltd. All rights reserved.

Magnetic fields in single late-type giants in the Solar vicinity: How common is magnetic activity on the giant branches?

NASA Astrophysics Data System (ADS)

Konstantinova-Antova, Renada; Aurière, Michel; Charbonnel, Corinne; Drake, Natalia; Wade, Gregg; Tsvetkova, Svetla; Petit, Pascal; Schröder, Klaus-Peter; Lèbre, Agnes

2014-08-01

We present our first results on a new sample containing all single G, K and M giants down to V = 4 mag in the Solar vicinity, suitable for spectropolarimetric (Stokes V) observations with Narval at TBL, France. For detection and measurement of the magnetic field (MF), the Least Squares Deconvolution (LSD) method was applied (Donati et al. 1997) that in the present case enables detection of large-scale MFs even weaker than the solar one (the typical precision of our longitudinal MF measurements is 0.1-0.2 G). The evolutionary status of the stars is determined on the basis of the evolutionary models with rotation (Lagarde et al. 2012; Charbonnel et al., in prep.) and fundamental parameters given by Massarotti et al. (1998). The stars appear to be in the mass range 1-4 M ⊙, situated at different evolutionary stages after the Main Sequence (MS), up to the Asymptotic Giant Branch (AGB). The sample contains 45 stars. Up to now, 29 stars are observed (that is about 64% of the sample), each observed at least twice. For 2 stars in the Hertzsprung gap, one is definitely Zeeman detected. Only 5 G and K giants, situated mainly at the base of the Red Giant Branch (RGB) and in the He-burning phase are detected. Surprisingly, a lot of stars ascending towards the RGB tip and in early AGB phase are detected (8 of 13 observed stars). For all Zeeman detected stars v sin i is redetermined and appears in the interval 2-3 km/s, but few giants with MF possess larger v sin i.

Incidence of enterotoxigenic staphylococci and their toxins in foods.

PubMed

Soriano, J M; Font, G; Rico, H; Moltó, J C; Mañes, J

2002-05-01

Of 504 food samples collected from cafeterias, 19 (3.8%) yielded strains of enterotoxigenic staphylococci, and 10 (52.6%), 4 (21.1%), 3 (15.8%), and 2 (10.5%) of these strains produced enterotoxins C (SEC), D (SED), B (SEB), and A (SEA), respectively. Moreover, SEA, SEB, and SEC were isolated from three hamburger samples. Of 181 food samples collected from four restaurants before the implementation of the hazard analysis and critical control point (HACCP) system, 7 (3.9%) were found to contain enterotoxigenic strains, and SED, SEC, and SEA were produced by 4 (57.1%), 2 (28.6%), and 1 (14.3%) of these strains, respectively. One meatball sample with SEC was detected in a restaurant. After the implementation of the HACCP system in four restaurants, neither enterotoxigenic staphylococci nor enterotoxins were detected in 196 studied samples.

Sample Selection for Training Cascade Detectors.

PubMed

Vállez, Noelia; Deniz, Oscar; Bueno, Gloria

2015-01-01

Automatic detection systems usually require large and representative training datasets in order to obtain good detection and false positive rates. Training datasets are such that the positive set has few samples and/or the negative set should represent anything except the object of interest. In this respect, the negative set typically contains orders of magnitude more images than the positive set. However, imbalanced training databases lead to biased classifiers. In this paper, we focus our attention on a negative sample selection method to properly balance the training data for cascade detectors. The method is based on the selection of the most informative false positive samples generated in one stage to feed the next stage. The results show that the proposed cascade detector with sample selection obtains on average better partial AUC and smaller standard deviation than the other compared cascade detectors.

Magnetic particles for in vitro molecular diagnosis: From sample preparation to integration into microsystems.

PubMed

Tangchaikeeree, Tienrat; Polpanich, Duangporn; Elaissari, Abdelhamid; Jangpatarapongsa, Kulachart

2017-10-01

Colloidal magnetic particles (MPs) have been developed in association with molecular diagnosis for several decades. MPs have the great advantage of easy manipulation using a magnet. In nucleic acid detection, these particles can act as a capture support for rapid and simple biomolecule separation. The surfaces of MPs can be modified by coating with various polymer materials to provide functionalization for different applications. The use of MPs enhances the sensitivity and specificity of detection due to the specific activity on the surface of the particles. Practical applications of MPs demonstrate greater efficiency than conventional methods. Beyond traditional detection, MPs have been successfully adopted as a smart carrier in microfluidic and lab-on-a-chip biosensors. The versatility of MPs has enabled their integration into small single detection units. MPs-based biosensors can facilitate rapid and highly sensitive detection of very small amounts of a sample. In this review, the application of MPs to the detection of nucleic acids, from sample preparation to analytical readout systems, is described. State-of-the-art integrated microsystems containing microfluidic and lab-on-a-chip biosensors for the nucleic acid detection are also addressed. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of passive acoustic sampling methodology on detecting bats after declines from white nose syndrome

USGS Publications Warehouse

Coleman, Laci S.; Ford, W. Mark; Dobony, Christopher A.; Britzke, Eric R.

2014-01-01

Concomitant with the emergence and spread of white-nose syndrome (WNS) and precipitous decline of many bat species in North America, natural resource managers need modified and/or new techniques for bat inventory and monitoring that provide robust occupancy estimates. We used Anabat acoustic detectors to determine the most efficient passive acoustic sampling design for optimizing detection probabilities of multiple bat species in a WNS-impacted environment in New York, USA. Our sampling protocol included: six acoustic stations deployed for the entire duration of monitoring as well as a 4 x 4 grid and five transects of 5-10 acoustic units that were deployed for 6-8 night sample durations surveyed during the summers of 2011-2012. We used Program PRESENCE to determine detection probability and site occupancy estimates. Overall, the grid produced the highest detection probabilities for most species because it contained the most detectors and intercepted the greatest spatial area. However, big brown bats (Eptesicus fuscus) and species not impacted by WNS were detected easily regardless of sampling array. Endangered Indiana (Myotis sodalis) and little brown (Myotis lucifugus) and tri-colored bats (Perimyotis subflavus) showed declines in detection probabilities over our study, potentially indicative of continued WNS-associated declines. Identification of species presence through efficient methodologies is vital for future conservation efforts as bat populations decline further due to WNS and other factors.   

Anthropogenic Organic Compounds in Source and Finished Groundwater of Community Water Systems in the Piedmont Physiographic Province, Potomac River Basin, Maryland and Virginia, 2003-04

USGS Publications Warehouse

Banks, William S.L.; Reyes, Betzaida

2009-01-01

A source- and finished-water-quality assessment of groundwater was conducted in the Piedmont Physiographic Province of Maryland and Virginia in the Potomac River Basin during 2003-04 as part of the U.S. Geological Survey's National Water-Quality Assessment Program. This assessment used a two-phased approach to sampling that allowed investigators to evaluate the occurrence of more than 280 anthropogenic organic compounds (volatile organic compounds, pesticides and pesticide degradates, and other anthropogenic organic compounds). Analysis of waters from 15 of the largest community water systems in the study area were included in the assessment. Source-water samples (raw-water samples collected prior to treatment) were collected at the well head. Finished-water samples (raw water that had been treated and disinfected) were collected after treatment and prior to distribution. Phase one samples, collected in August and September 2003, focused on source water. Phase two analyzed both source and finished water, and samples were collected in August and October of 2004. The results from phase one showed that samples collected from the source water for 15 community water systems contained 92 anthropogenic organic compounds (41 volatile organic compounds, 37 pesticides and pesticide degradates, and 14 other anthropogenic organic compounds). The 5 most frequently occurring anthropogenic organic compounds were detected in 11 of the 15 source-water samples. Deethylatrazine, a degradate of atrazine, was present in all 15 samples and metolachlor ethanesulfonic acid, a degradate of metolachlor, and chloroform were present in 13 samples. Atrazine and metolachlor were present in 12 and 11 samples, respectively. All samples contained a mixture of compounds with an average of about 14 compounds per sample. Phase two sampling focused on 10 of the 15 community water systems that were selected for resampling on the basis of occurrence of anthropogenic organic compounds detected most frequently during the first phase. A total of 48 different anthropogenic organic compounds were detected in samples collected from source and finished water. There were a similar number of compounds detected in finished water (41) and in source water (39). The most commonly detected group of anthropogenic organic compounds in finished water was trihalomethanes - compounds associated with the disinfection of drinking water. This group of compounds accounted for 30 percent of the detections in source water and 44 percent of the detections in finished water, and were generally found in higher concentrations in finished water. Excluding trihalomethanes, the number of total detections was about the same in source-water samples (33) as it was in finished-water samples (35). During both phases of the study, two measurements for human-health assessment were used. The first, the Maximum Contaminant Level for drinking water, is set by the U.S. Environmental Protection Agency and represents a legally enforceable maximum concentration of a contaminant permitted in drinking water. The second, the Health-Based Screening Level, was developed by the U.S. Geological Survey, is not legally enforceable, and represents a limit for more chronic exposures. Maximum concentrations for each detected compound were compared with either the Maximum Contaminant Level or the Health-Based Screening Level when available. More than half of the compounds detected had either a Maximum Contaminant Level or a Health-Based Screening Level. A benchmark quotient was set at 10 percent (greater than or equal to 0.1) of the ratio of the detected concentration of a particular compound to its Maximum Contaminant Level, or Health-Based Screening Level. This was considered a threshold for further monitoring. During phase one, when only source water was sampled, seven compounds (chloroform, benzene, acrylonitrile, methylene chloride, atrazine, alachlor, and dieldrin) met or exceeded a benchmark quotient. No de

Eccentricity in planetary systems and the role of binarity. Sample definition, initial results, and the system of HD 211847

NASA Astrophysics Data System (ADS)

Moutou, C.; Vigan, A.; Mesa, D.; Desidera, S.; Thébault, P.; Zurlo, A.; Salter, G.

2017-06-01

We explore the multiplicity of exoplanet host stars with high-resolution images obtained with VLT/SPHERE. Two different samples of systems were observed: one containing low-eccentricity outer planets, and the other containing high-eccentricity outer planets. We find that 10 out of 34 stars in the high-eccentricity systems are members of a binary, while the proportion is 3 out of 27 for circular systems. Eccentric-exoplanet hosts are, therefore, significantly more likely to have a stellar companion than circular-exoplanet hosts. The median magnitude contrast over the 68 data sets is 11.26 and 9.25, in H and K, respectively, at 0.30 arcsec. The derived detection limits reveal that binaries with separations of less than 50 au are rarer for exoplanet hosts than for field stars. Our results also imply that the majority of high-eccentricity planets are not embedded in multiple stellar systems (24 out of 34), since our detection limits exclude the presence of a stellar companion. We detect the low-mass stellar companions of HD 7449 and HD 211847, both members of our high-eccentricity sample. HD 7449B was already detected and our independent observation is in agreement with this earlier work. HD 211847's substellar companion, previously detected by the radial velocity method, is actually a low-mass star seen face-on. The role of stellar multiplicity in shaping planetary systems is confirmed by this work, although it does not appear as the only source of dynamical excitation. Based on observations collected with SPHERE on the Very Large Telescope (ESO, Chile).

Use of $gamma$ irradiation to prevent aflatoxin production in bread

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bullerman, L.B.; Barnhart, H.M.; Hartung, T.E.

Irradiation doses of 100 and 200 Krad reduced the growth of Aspergillus parasiticus in bread stored for 10 days at 254DEC. With bread stored longer than 2 wk, mold growth in irradiated samples tended to approach the amount which occurred in the non-irradiated controls. Mold strain NRRL 3000 seemed slightly more sensitive to irradiation-than strain NRRL 2999. A 200 Krad dose prevented anatoxin production by either strain at both high and low levels of inoculation with spores in bread stored for 10 days, except in one case where a very low level of anatoxins was detected. At 100 Krad, breadmore » inoculated with 102 spores/ slice contained none to low concentrations of anatoxins after storage for 10 days, but with 106 spores/slice higher amounts of toxins were detected. When ihe inoculated bread was stored for periods up to 6 wk, the 200 Krad treatment prevented aflatoxin production in all bread samples containing 10/sup 2/ spores/ slice, and in almost all samples containing 10/sup 6/ spores/ slice. The 100 Krad treatment also prevented aflatoxin production during 6 wk of storage in bread that contained 10/sup 2/ spores/ slice. However, with 10/sup 6/ spores/ slice both strains were capable of producing very high amounts of aflatoxins after irradiation nt 100 Krad. At 1, 2 and 6 wk of storage, these amounts were greater than the unirradiated controls, suggesting possible stimulation of aflatoxin production. (auth)« less

Assessing environmental DNA detection in controlled lentic systems.

PubMed

Moyer, Gregory R; Díaz-Ferguson, Edgardo; Hill, Jeffrey E; Shea, Colin

2014-01-01

Little consideration has been given to environmental DNA (eDNA) sampling strategies for rare species. The certainty of species detection relies on understanding false positive and false negative error rates. We used artificial ponds together with logistic regression models to assess the detection of African jewelfish eDNA at varying fish densities (0, 0.32, 1.75, and 5.25 fish/m3). Our objectives were to determine the most effective water stratum for eDNA detection, estimate true and false positive eDNA detection rates, and assess the number of water samples necessary to minimize the risk of false negatives. There were 28 eDNA detections in 324, 1-L, water samples collected from four experimental ponds. The best-approximating model indicated that the per-L-sample probability of eDNA detection was 4.86 times more likely for every 2.53 fish/m3 (1 SD) increase in fish density and 1.67 times less likely for every 1.02 C (1 SD) increase in water temperature. The best section of the water column to detect eDNA was the surface and to a lesser extent the bottom. Although no false positives were detected, the estimated likely number of false positives in samples from ponds that contained fish averaged 3.62. At high densities of African jewelfish, 3-5 L of water provided a >95% probability for the presence/absence of its eDNA. Conversely, at moderate and low densities, the number of water samples necessary to achieve a >95% probability of eDNA detection approximated 42-73 and >100 L, respectively. Potential biases associated with incomplete detection of eDNA could be alleviated via formal estimation of eDNA detection probabilities under an occupancy modeling framework; alternatively, the filtration of hundreds of liters of water may be required to achieve a high (e.g., 95%) level of certainty that African jewelfish eDNA will be detected at low densities (i.e., <0.32 fish/m3 or 1.75 g/m3).

Nuclear Archeology in a Bottle: Evidence of Pre-Trinity U.S. Weapons Activities from a Waste Burial Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwantes, Jon M.; Douglas, Matthew; Bonde, Steven E.

2009-02-15

During World War II, the Hanford Site in Washington was chosen for plutonium production. In 2004, a bottle containing a sample of plutonium was recovered from a Hanford waste trench. Isotopic age dating indicated the sample was separated from the fuel pellet 64 ±2.8 years earlier. Detectable products of secondary nuclear reactions, such as 22Na, proved useful as 1) a detectable analog for alpha emitting actinides, 2) an indicator of sample splitting, and 3) a measure of the time since sample splitting. The sample origin was identified as the X-10 reactor, Oak Ridge, TN. Corroborated by historical documents, we concludedmore » this sample was part of the first batch of Pu separated at T-Plant, Hanford, the world’s first industrial-scale reprocessing facility, on December 9, 1944.« less

Characterization of Diarrheagenic Escherichia coli Isolated in Organic Waste Products (Cattle Fecal Matter, Manure and, Slurry) from Cattle’s Markets in Ouagadougou, Burkina Faso

PubMed Central

Bako, Evariste; Kagambèga, Assèta; Traore, Kuan Abdoulaye; Bagre, Touwendsida Serge; Ibrahim, Hadiza Bawa; Bouda, Soutongnooma Caroline; Bonkoungou, Isidore Juste Ouindgueta; Kaboré, Saidou; Zongo, Cheikna; Traore, Alfred Sababenejo; Barro, Nicolas

2017-01-01

Cattle farming can promote diarrheal disease transmission through waste, effluents or cattle fecal matter. The study aims to characterize the diarrheagenic Escherichia coli (DEC) isolated from cattle feces, manure in the composting process and slurry, collected from four cattle markets in Ouagadougou. A total of 585 samples (340 cattle feces, 200 slurries and 45 manures in the composting process) were collected from the four cattle markets between May 2015 and May 2016. A multiplex Polymerase Chain Reaction (PCR), namely 16-plex PCR, was used to screen simultaneously the virulence genes specific for shiga toxin-producing E. coli (STEC), enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC) and enteroaggregative E. coli (EAEC). DEC was detected in 10.76% of samples. ETEC was the most prevalent (9.91%). STEC and EAEC have been observed with the same rate (0.51%). ETEC were detected in 12.64% of cattle feces, in 6.66% of manure in the composting process and in 5% of slurry. STEC were detected in 0.58% of cattle feces and in 2.22% of manure in the composting process. EAEC was detected only in 1% of slurry and in 2.22% of manure in the composting process. ETEC strains were identified based on estIa gene and/or estIb gene and/or elt gene amplification. Of the 58 ETEC, 10.34% contained astA, 17.24% contained elt, 3.44% contained estIa and 79.31% contained estIb. The two positive EAEC strains contained only the aggR gene, and the third was positive only for the pic gene. The results show that effluent from cattle markets could contribute to the spreading of DEC in the environment in Burkina Faso. PMID:28937656

Detection limits of Legionella pneumophila in environmental samples after co-culture with Acanthamoeba polyphaga

PubMed Central

2013-01-01

Background The efficiency of recovery and the detection limit of Legionella after co-culture with Acanthamoeba polyphaga are not known and so far no investigations have been carried out to determine the efficiency of the recovery of Legionella spp. by co-culture and compare it with that of conventional culturing methods. This study aimed to assess the detection limits of co-culture compared to culture for Legionella pneumophila in compost and air samples. Compost and air samples were spiked with known concentrations of L. pneumophila. Direct culturing and co-culture with amoebae were used in parallel to isolate L. pneumophila and recovery standard curves for both methods were produced for each sample. Results The co-culture proved to be more sensitive than the reference method, detecting 102-103 L. pneumophila cells in 1 g of spiked compost or 1 m3 of spiked air, as compared to 105-106 cells in 1 g of spiked compost and 1 m3 of spiked air. Conclusions Co-culture with amoebae is a useful, sensitive and reliable technique to enrich L. pneumophila in environmental samples that contain only low amounts of bacterial cells. PMID:23442526

Detection of Mycobacterium avium subsp. paratuberculosis in bovine manure using Whatman FTA card technology and Lightcycler real-time PCR.

PubMed

Jaravata, Carmela V; Smith, Wayne L; Rensen, Gabriel J; Ruzante, Juliana M; Cullor, James S

2006-01-01

A modified forensic DNA extraction and real-time fluorescent polymerase chain reaction assay has been evaluated for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in bovine fecal samples using primers and fluorescent resonance energy transfer (FRET) probes targeting the IS900 gene sequence of MAP. DNA was successfully extracted from manure samples by utilizing the Whatman FTA card technology, which allows for simple processing and storage of samples at room temperature. The FTA cards were washed and subjected to a Chelex-100 incubation to remove any remaining polymerase chain reaction (PCR) inhibitors and to elute the DNA from the FTA card. This isolated DNA was then subjected to direct real time fluorescent PCR analysis. Detection of MAP DNA from bovine fecal samples spiked with known concentrations of viable MAP cells was obtained. The detection limits of the assay was consistently found to be between 10(2) and 10(4) colony forming units [CFU]/g, with some samples containing as low as 10 CFU/g, yielding positive assay results. This cost-efficient assay allows reporting of results as early as 4 h after fecal collection, which can be particularly useful in highthroughput herd screening.

Molecular characterization of black Aspergillus species from onion and their potential for ochratoxin A and fumonisin B2 production.

PubMed

Gherbawy, Youssuf; Elhariry, Hesham; Kocsubé, Sándor; Bahobial, Abdulaziz; Deeb, Bahig El; Altalhi, Abdulla; Varga, János; Vágvölgyi, Csaba

2015-05-01

Onion bulbs can become contaminated with various molds during the storage period, the most important causal agents being black aspergilli (Aspergillus section Nigri). Taxonomic studies have revealed that this group of Aspergillus contains many species that cannot be reliably identified using standard morphological methods. Therefore, it is necessary to define the fungus causing this problem in the onion exactly, especially since some species assigned to section Nigri are well known as ochratoxin and/or fumonisin producers. Sixty fungal isolates belonging to 10 fungal genera were isolated from 40 onion samples originated from the Taif region in Saudi Arabia. Black aspergilli were detected in 37 onion samples. Using primer pairs (awaspec and Cmd6) designed based on partial calmodulin gene sequence data, 37 isolates were identified as A. welwitschiae. The ochratoxin A and fumonisin B2 contents of the onion samples were examined. No ochratoxins were detected in the collected samples, while fumonisin B2 was detected in 37.5% of the onion samples. Eighteen of 37 isolates of Aspergillus welwitschiae were recognized as potential producers for fumonisin B2. Multiplex polymerase chain reactions designed to detect biosynthetic genes of fumonisins confirmed these results.

HPLC Separation of Sulforaphane Enantiomers in Broccoli and Its Sprouts by Transformation into Diastereoisomers Using Derivatization with (S)-Leucine.

PubMed

Okada, Makiko; Yamamoto, Atsushi; Aizawa, Sen-Ichi; Taga, Atsushi; Terashima, Hiroyuki; Kodama, Shuji

2017-01-11

Racemic sulforaphane, which was derivatized with (S)-leucine (l-leucine), was resolved by reversed phase HPLC with UV detection. The optimum mobile phase conditions were found to be 10 mM citric acid (pH 2.8) containing 22% methanol at 35 °C using detection at 254 nm. Sulforaphane enantiomers in florets and stems of five brands of broccoli and leaves and stems of three brands of broccoli sprouts were analyzed by the proposed HPLC method. Both sulforaphane enantiomers were detected in all of the samples. The S/R ratios of sulforaphane in broccoli samples were 1.5-2.6/97.4-98.5% for florets and 5.0-12.1/87.9-95.0% for stems. The S/R ratios in broccoli sprout samples were higher than those in broccoli samples and were found to be 8.3-19.7/80.3-91.7% for leaves and 37.0-41.8/58.2-63.0% for stems. (S)-Sulforaphane detected in the broccoli and its sprout samples was positively identified by separately using an HPLC with a chiral column (Chiralpak AD-RH) and mass spectrometry.

Automatic Brain Tumor Detection in T2-weighted Magnetic Resonance Images

NASA Astrophysics Data System (ADS)

Dvořák, P.; Kropatsch, W. G.; Bartušek, K.

2013-10-01

This work focuses on fully automatic detection of brain tumors. The first aim is to determine, whether the image contains a brain with a tumor, and if it does, localize it. The goal of this work is not the exact segmentation of tumors, but the localization of their approximate position. The test database contains 203 T2-weighted images of which 131 are images of healthy brain and the remaining 72 images contain brain with pathological area. The estimation, whether the image shows an afflicted brain and where a pathological area is, is done by multi resolution symmetry analysis. The first goal was tested by five-fold cross-validation technique with 100 repetitions to avoid the result dependency on sample order. This part of the proposed method reaches the true positive rate of 87.52% and the true negative rate of 93.14% for an afflicted brain detection. The evaluation of the second part of the algorithm was carried out by comparing the estimated location to the true tumor location. The detection of the tumor location reaches the rate of 95.83% of correct anomaly detection and the rate 87.5% of correct tumor location.

Eukaryotic viruses in wastewater samples from the United States

USGS Publications Warehouse

Symonds, E.M.; Griffin, Dale W.; Breitbart, M.

2009-01-01

Human fecal matter contains a large number of viruses, and current bacterial indicators used for monitoring water quality do not correlate with the presence of pathogenic viruses. Adenoviruses and enteroviruses have often been used to identify fecal pollution in the environment; however, other viruses shed in fecal matter may more accurately detect fecal pollution. The purpose of this study was to develop a baseline understanding of the types of viruses found in raw sewage. PCR was used to detect adenoviruses, enteroviruses, hepatitis B viruses, herpesviruses, morbilliviruses, noroviruses, papillomaviruses, picobirnaviruses, reoviruses, and rotaviruses in raw sewage collected throughout the United States. Adenoviruses and picobirnaviruses were detected in 100% of raw sewage samples and 25% and 33% of final effluent samples, respectively. Enteroviruses and noroviruses were detected in 75% and 58% of raw sewage samples, respectively, and both viral groups were found in 8% of final effluent samples. This study showed that adenoviruses, enteroviruses, noroviruses, and picobirnaviruses are widespread in raw sewage. Since adenoviruses and picobirnaviruses were detected in 100% of raw sewage samples, they are potential markers of fecal contamination. Additionally, this research uncovered previously unknown sequence diversity in human picobirnaviruses. This baseline understanding of viruses in raw sewage will enable educated decisions to be made regarding the use of different viruses in water quality assessments. Copyright ?? 2009, American Society for Microbiology. All Rights Reserved.

Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR.

PubMed

Cai, Yicun; He, Yuping; Lv, Rong; Chen, Hongchao; Wang, Qiang; Pan, Liangwen

2017-01-01

Meat products often consist of meat from multiple animal species, and inaccurate food product adulteration and mislabeling can negatively affect consumers. Therefore, a cost-effective and reliable method for identification and quantification of animal species in meat products is required. In this study, we developed a duplex droplet digital PCR (dddPCR) detection and quantification system to simultaneously identify and quantify the source of meat in samples containing a mixture of beef (Bos taurus) and pork (Sus scrofa) in a single digital PCR reaction tube. Mixed meat samples of known composition were used to test the accuracy and applicability of this method. The limit of detection (LOD) and the limit of quantification (LOQ) of this detection and quantification system were also identified. We conclude that our dddPCR detection and quantification system is suitable for quality control and routine analyses of meat products.

Combined raman and IR fiber-based sensor for gas detection

DOEpatents

Carter, Jerry C; Chan, James W; Trebes, James E; Angel, Stanley M; Mizaikoff, Boris

2014-06-24

A double-pass fiber-optic based spectroscopic gas sensor delivers Raman excitation light and infrared light to a hollow structure, such as a hollow fiber waveguide, that contains a gas sample of interest. A retro-reflector is placed at the end of this hollow structure to send the light back through the waveguide where the light is detected at the same end as the light source. This double pass retro reflector design increases the interaction path length of the light and the gas sample, and also reduces the form factor of the hollow structure.

Detection of methanogenic archaea in the pitchers of the Northern pitcher plant (Sarracenia purpurea ).

PubMed

Krieger, Joseph R; Kourtev, Peter S

2012-02-01

Carnivorous plants of the genus Sarracenia rely on microorganisms in their pitchers to decompose drowned insects. The environment inside pitchers is considered to be aerobic; however, there might be zones, such as at the bottom of the pitcher, where anaerobic conditions develop. Samples of the sediment at the bottom of Sarracenia purpurea pitchers were analyzed for the presence of archaea, using PCR and sequencing of the 16S rRNA gene. Archaeal DNA was detected in 20% of sampled pitchers. All sequences were closely related to Methanobrevibacter . Therefore, pitchers may contain anoxic zones inhabited by methanogens.

Estimation of Plutonium-240 Mass in Waste Tanks Using Ultra-Sensitive Detection of Radioactive Xenon Isotopes from Spontaneous Fission

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowyer, Theodore W.; Gesh, Christopher J.; Haas, Daniel A.

This report details efforts to develop a technique which is able to detect and quantify the mass of 240Pu in waste storage tanks and other enclosed spaces. If the isotopic ratios of the plutonium contained in the enclosed space is also known, then this technique is capable of estimating the total mass of the plutonium without physical sample retrieval and radiochemical analysis of hazardous material. Results utilizing this technique are reported for a Hanford Site waste tank (TX-118) and a well-characterized plutonium sample in a laboratory environment.

Water quality in Lake Lanier

DOE Office of Scientific and Technical Information (OSTI.GOV)

Callaham, M.A.

1991-04-01

Thirteen water quality tests measuring five categories of pollution were conducted twice monthly from May, 1987 to April, 1990 at eight locations on Lake Sidney Lanier to establish baseline data and detect trends. Additionally, sediment and water samples were analyzed for ten toxic metals. Sampling stations were located at or near the point of entry of streams into the Lake. Oxygen demanding pollutants were highest in urban streams and phosphorus and nitrogen concentrations were highest in streams having poultry processing operations within their watersheds. Indicators of siltation increased coincidentally with highway construction in one watershed. Fecal coliform bacteria counts decreasedmore » at Flat Creek and increased in the Chattahoochee River. Zinc and copper occurred in water samples at levels of detectability. Sediment samples from several locations contained metal concentrations which warrant further study.« less

Fumonisin mycotoxins in human hair.

PubMed

Sewram, Vikash; Mshicileli, Ndumiso; Shephard, Gordon S; Marasas, Walter F O

2003-01-01

This study shows for the first time the accumulation of fumonisin mycotoxins in human hair of population clusters exposed to contaminated maize, and thus the feasibility of human hair analysis for the assessment of past fumonisin exposure. Composite hair samples were obtained from the Bizana, Butterworth and Centane districts within the Transkei region of the Eastern Cape Province of South Africa. Following methanol extraction and strong anion exchange clean up, the fumonisins FB(1), FB(2) and FB(3) were detected using high performance liquid chromatography coupled to electrospray ionization-mass spectrometry (HPLC-ESI-MS). Hair from Centane and Butterworth showed mean levels of FB(1) of 26.7 and 23.5 microg kg(-1) hair, respectively. FB(2) was only detected in hair from Centane and in one sampling point in Butterworth, with mean levels of 6.5 and 5.7 microg kg(-1) hair, respectively. Hair samples from Bizana, on the other hand, were found to contain higher levels of FB(1) (mean 33.0 microg kg(-1) hair) and FB(2) (mean 11.1 microg kg(-1) hair). No samples contained more than trace levels of FB(3). Recoveries from spiked hair samples using this method ranged from 81% to 101%, demonstrating the applicability of hair analysis in assessing human exposure to fumonisin mycotoxins.

Signs of Perchlorates and Sulfur Containing Compounds

NASA Image and Video Library

2012-12-03

NASA Mars rover Curiosity has detected sulfur, chlorine, and oxygen compounds in fine grains scooped by the rover at a wind drift site called Rocknest. The grains were heated and analyzed using the rover Sample Analysis at Mars instrument suite.

Biochips Containing Arrays of Carbon-Nanotube Electrodes

NASA Technical Reports Server (NTRS)

Li, Jun; Meyyappan, M.; Koehne, Jessica; Cassell, Alan; Chen, Hua

2008-01-01

Biochips containing arrays of nanoelectrodes based on multiwalled carbon nanotubes (MWCNTs) are being developed as means of ultrasensitive electrochemical detection of specific deoxyribonucleic acid (DNA) and messenger ribonucleic acid (mRNA) biomarkers for purposes of medical diagnosis and bioenvironmental monitoring. In mass production, these biochips could be relatively inexpensive (hence, disposable). These biochips would be integrated with computer-controlled microfluidic and microelectronic devices in automated hand-held and bench-top instruments that could be used to perform rapid in vitro genetic analyses with simplified preparation of samples. Carbon nanotubes are attractive for use as nanoelectrodes for detection of biomolecules because of their nanoscale dimensions and their chemical properties.

The detection and prevention of unintentional consumption of DOx and 25x-NBOMe at Portugal's Boom Festival.

PubMed

Martins, Daniel; Barratt, Monica J; Pires, Cristiana Vale; Carvalho, Helena; Vilamala, Mireia Ventura; Espinosa, Iván Fornís; Valente, Helena

2017-05-01

This paper describes the misrepresentation of LSD at Portugal's Boom Festival 2014 and the prevention of unintentional consumption of DOx and 25x-NBOMe among LSD consumers attending a drug-checking service. Two hundred forty-five drug samples expected to contain LSD were submitted to the drug-checking service for chemical analysis. One hundred ten post-test questionnaires were successfully matched with test results. About 67.3% of the alleged LSD samples tested contained only LSD; 0.8% contained LSD combined with adulterants; 24.1% did not contain LSD but did contain another psychoactive substance, including 11.4% that were 2,5-dimethoxyamphetamine derivatives and 9.8% that were N-benzyl-2,5-dimethoxyphenethylamine derivatives; and no psychoactive substance was detected in 7.8%. The majority of service users who received unexpected test results regarding their alleged LSD (74.2%) reported that they did not intend to consume the drug. Following dissemination of alerts on day 2, a larger than expected proportion of all tests conducted were for LSD, when comparing the 2014 festival to 2012, where no such alert was disseminated. Although these results support the provision of integrated drug-checking services in party settings, evidence of their utility and effectiveness would be improved through future research incorporating more robust measures of outcomes following provision of drug-checking results. Copyright © 2017 John Wiley & Sons, Ltd.

Isolation and characterization of Bacteroides host strain HB-73 used to detect sewage specific phages in Hawaii.

PubMed

Vijayavel, Kannappan; Fujioka, Roger; Ebdon, James; Taylor, Huw

2010-06-01

Previous studies have shown that Escherichia coli and enterococci are unreliable indicators of fecal contamination in Hawaii because of their ability to multiply in environmental soils. In this study, the method of detecting Bacteroides phages as specific markers of sewage contamination in Hawaii's recreational waters was evaluated because these sewage specific phages cannot multiply under environmental conditions. Bacteroides hosts (GB-124, GA-17), were recovered from sewage samples in Europe and were reported to be effective in detecting phages from sewage samples obtained in certain geographical areas. However, GB-124 and GA-17 hosts were ineffective in detecting phages from sewage samples obtained in Hawaii. Bacteroides host HB-73 was isolated from a sewage sample in Hawaii, confirmed as a Bacteroides sp. and shown to recover phages from multiple sources of sewage produced in Hawaii at high concentrations (5.2-7.3 x 10(5) PFU/100 mL). These Bacteroides phages were considered as potential markers of sewage because they also survived for three days in fresh stream water and two days in marine water. Water samples from Hawaii's coastal swimming beaches and harbors, which were known to be contaminated with discharges from streams, were shown to contain moderate (20-187 CFU/100 mL) to elevated (173-816 CFU/100 mL) concentrations of enterococci. These same samples contained undetectable levels (<10 PFU/100 mL) of F+ coliphage and Bacteroides phages and provided evidence to suggest that these enterococci may not necessarily be associated with the presence of raw sewage. These results support previous conclusions that discharges from streams are the major sources of enterococci in coastal waters of Hawaii and the most likely source of these enterococci is from environmental soil rather than from sewage. 2010 Elsevier Ltd. All rights reserved.

Detection of zinc oxide and cerium dioxide nanoparticles during drinking water treatment by rapid single particle ICP-MS methods.

PubMed

Donovan, Ariel R; Adams, Craig D; Ma, Yinfa; Stephan, Chady; Eichholz, Todd; Shi, Honglan

2016-07-01

Nanoparticles (NPs) entering water systems are an emerging concern as NPs are more frequently manufactured and used. Single particle inductively coupled plasma-mass spectrometry (SP-ICP-MS) methods were validated to detect Zn- and Ce-containing NPs in surface and drinking water using a short dwell time of 0.1 ms or lower, ensuring precision in single particle detection while eliminating the need for sample preparation. Using this technique, information regarding NP size, size distribution, particle concentration, and dissolved ion concentrations was obtained simultaneously. The fates of Zn- and Ce-NPs, including those found in river water and added engineered NPs, were evaluated by simulating a typical drinking water treatment process. Lime softening, alum coagulation, powdered activated carbon sorption, and disinfection by free chlorine were simulated sequentially using river water. Lime softening removed 38-53 % of Zn-containing and ZnO NPs and >99 % of Ce-containing and CeO2 NPs. Zn-containing and ZnO NP removal increased to 61-74 % and 77-79 % after alum coagulation and disinfection, respectively. Source and drinking water samples were collected from three large drinking water treatment facilities and analyzed for Zn- and Ce-containing NPs. Each facility had these types of NPs present. In all cases, particle concentrations were reduced by a minimum of 60 % and most were reduced by >95 % from source water to finished drinking water. This study concludes that uncoated ZnO and CeO2 NPs may be effectively removed by conventional drinking water treatments including lime softening and alum coagulation.

The impact of port emissions and marine biogenics on the single-particle chemistry of marine aerosol measured on board the R/V Atlantis during the CalNEX 2010 field campaign

NASA Astrophysics Data System (ADS)

Gaston, C. J.; Quinn, P.; Bates, T. S.; Prather, K. A.

2010-12-01

Marine environments are characterized by low particle concentrations and, as such, are sensitive to changes in particle number concentration and chemistry induced by biogenic and anthropogenic influences. Measurements of both gas phase and particle phase emissions on board the R/V Atlantis during the CalNEX 2010 field campaign provided an opportunity to examine the impact of anthropogenic and marine biogenic emissions on particle chemistry along the California coast. Real-time, single-particle measurements made using an aerosol time-of-flight mass spectrometer (ATOFMS) revealed the single-particle mixing state of the sampled marine aerosols. Submicron particles (0.2-1.0 um) containing organic carbon, elemental carbon mixed with organic carbon, and unique V-containing particles previously detected in port regions were prevalent throughout the Southern California coast; most of these particles were also associated with sulfate. Measurements made in the deep water channel near Sacramento, CA revealed dramatically different particle chemistry that was characterized by organic carbon and amines. Particles measured further away from the continent toward the open ocean were influenced by marine biological activity due to a phytoplankton bloom that was occurring off the California coast. During this sampling period, unique ocean-derived particles containing internal mixtures of Mg and organic carbon were detected in addition to unique particles containing elemental S ions, which were only detected at night. An aerosol generator used to bubble seawater in order to characterize primary emissions from the ocean confirmed that the Mg-organic carbon and S-containing particles were indeed emitted from the ocean. These measurements reveal the strong impact of both port emissions as well as marine biogenic emissions on aerosol chemistry along the California coast.

Chlamydia and gonorrhoea contamination of clinic surfaces.

PubMed

Lewis, Natasha; Dube, Gail; Carter, Christine; Pitt, Rachel; Alexander, Sarah; Ison, Catherine A; Harding, Jan; Brown, Louise; Fryer, John; Hodson, James; Ross, Jonathan

2012-10-01

Nucleic acid amplification tests, with their ability to detect very small amounts of nucleic acid, have become the principle diagnostic tests for Chlamydia trachomatis (CT) and Neisseria gonorrhoeae (GC) in many sexual health clinics. The aim of this study was to investigate the extent of surface contamination with CT and GC within a city centre sexual health clinic and to evaluate the potential for contamination of containers used for the collection of self-taken swabs. Surface contamination with CT and GC was assessed by systematically sampling 154 different sites within one clinic using transcription-mediated amplification (TMA), quantitative PCR and culture. The caps of containers used by patients to collect self-taken samples were also tested for CT and GC using TMA. Of the 154 sites sampled, 20 (13.0%) tested positive on TMA. Of these, five (3.2%) were positive for CT alone, 11 (7.1%) for GC alone and four (2.6%) for both CT and GC. The proportion of GC TMA-positive test results differed by gender, with 11 (18.3%) positive results from the male patient clinic area compared with one (1.6%) from the female area (p=0.002). Positive samples were obtained from a variety of locations in the clinic, but the patient toilets were more likely to be contaminated than examination rooms (p=0.015). Quantitative PCR and culture assays were negative for all samples. 46 caps of the containers used for self-taken swabs were negative for both CT and GC on TMA testing. Surface contamination with chlamydial and gonococcal rRNA can occur within sexual health clinics, but the quantity of nucleic acid detected is low and infection risk to patients and staff is small. There remains a potential risk of contamination of patient samples leading to false-positive results.

Study on the leaching of phthalates from polyethylene terephthalate bottles into mineral water.

PubMed

Keresztes, Szilvia; Tatár, Enikő; Czégény, Zsuzsanna; Záray, Gyula; Mihucz, Victor G

2013-08-01

Carbonated and non-carbonated mineral water samples bottled in 0.5-L, 1.5-L and 2.0-L polyethylene terephthalate (PET) containers belonging to three different water brands commercialized in Hungary were studied in order to determine their phthalate content by gas chromatography-mass spectrometry. Among the six investigated phthalates, diisobutyl phthalate, di-n-butyl-phthalate, benzyl-butyl phthalate and di(2-ethyl-hexyl) phthalate (DEHP) were determined in non-carbonated samples as follows: <3.0 ng L(-1)-0.2 μg L(-1), <6.6 ng L(-1)-0.8 μg L(-1), <6.0 ng L(-1)-0.1 μg L(-1) and <16.0 ng L(-1)-1.7 μg L(-1), respectively. Any of the above-mentioned phthalate esters could be detected in carbonated mineral water samples. DEHP was the most abundant phthalate in the investigated samples. It could be detected after 44 days of storage at 22 °C and its leaching was the most pronounced when samples were stored over 1200 days. Mineral water purchased in PET bottles of 0.5L had the highest phthalate concentrations compared to those obtained for waters of the identical brand bottled in 1.5-L or 2.0-L PET containers due to the higher surface/volume ratio. No clear trend could be established for phthalate leaching when water samples were kept at higher temperatures (max. 60 °C) showing improper storage conditions. Phthalate determination by pyrolysis-gas chromatography/mass spectrometric measurements in the plastic material as well as in the aqueous phase proved the importance of the quality of PET raw material used for the production of the pre-form (virgin vs. polymer containing recycled PET). Copyright © 2013 Elsevier B.V. All rights reserved.

A new QRT-PCR assay designed for the differentiation between elements provided from Agrobacterium sp. in GMOs plant events and natural Agrobacterium sp. bacteria.

PubMed

Nabi, Nesrine; Chaouachi, Maher; Zellama, Mohamed Salem; Ben Hafsa, Ahmed; Mrabet, Besma; Saïd, Khaled; Fathia, Harzallah Skhiri

2016-04-01

The question asked in the present work was how to differentiate between contamination of field samples with and GM plants contained sequences provided from this bacterium in order to avoid false positives in the frame of the detection and the quantification of GMO. For this, new set of primers and corresponding TaqMan Minor Groove Binder (MGB) probes were designed to target Agrobacterium sp. using the tumor-morphology-shooty gene (TMS1). Final standard curves were calculated for each pathogen by plotting the threshold cycle value against the bacterial number (log (colony forming units) per milliliter) via linear regression. The method designed was highly specific and sensitive, with a detection limit of 10CFU/ml. No significant cross-reaction was observed. Results from this study showed that TaqMan real-time PCR, is potentially an effective method for the rapid and reliable quantification of Agrobacterium sp. in samples containing GMO or non GMO samples. Copyright © 2015 Elsevier Ltd. All rights reserved.

Extraction and Determination of Cyproheptadine in Human Urine by DLLME-HPLC Method.

PubMed

Maham, Mehdi; Kiarostami, Vahid; Waqif-Husain, Syed; Abroomand-Azar, Parviz; Tehrani, Mohammad Saber; Khoeini Sharifabadi, Malihe; Afrouzi, Hossein; Shapouri, Mahmoudreza; Karami-Osboo, Rouhollah

2013-01-01

Novel dispersive liquid-liquid microextraction (DLLME), coupled with high performance liquid chromatography with photodiode array detection (HPLC-DAD) has been applied for the extraction and determination of cyproheptadine (CPH), an antihistamine, in human urine samples. In this method, 0.6 mL of acetonitrile (disperser solvent) containing 30 μL of carbon tetrachloride (extraction solvent) was rapidly injected by a syringe into 5 mL urine sample. After centrifugation, the sedimented phase containing enriched analyte was dissolved in acetonitrile and an aliquot of this solution injected into the HPLC system for analysis. Development of DLLME procedure includes optimization of some important parameters such as kind and volume of extraction and disperser solvent, pH and salt addition. The proposed method has good linearity in the range of 0.02-4.5 μg mL(-1) and low detection limit (13.1 ng mL(-1)). The repeatability of the method, expressed as relative standard deviation was 4.9% (n = 3). This method has also been applied to the analysis of real urine samples with satisfactory relative recoveries in the range of 91.6-101.0%.

Polyfluoroalkyl phosphate esters and perfluoroalkyl carboxylic acids in target food samples and packaging--method development and screening.

PubMed

Gebbink, Wouter A; Ullah, Shahid; Sandblom, Oskar; Berger, Urs

2013-11-01

Polyfluoroalkyl phosphate mono-, di-, and tri-esters (mono-, di-, and triPAPs) are used to water- and grease-proof food packaging materials, and these chemicals are known precursors to perfluoroalkyl carboxylic acids (PFCAs). Existing analytical methods for PAPs lack sample clean-up steps in the sample preparation. In the present study, a method based on ultra performance liquid chromatography coupled to tandem mass spectrometry (UPLC/MS/MS) was developed and optimized for the analysis of mono-, di-, and triPAPs, including a clean-up step for the raw extracts. The method was applied to food samples and their PAP-containing packaging materials. The optimized UPLC/MS/MS method enabled the separation and identification of a total of 4 monoPAPs, 16 diPAPs, and 7 triPAPs in the technical mixture Zonyl®-RP. For sample clean-up, weak anion exchange solid phase extraction columns were tested. PAPs standard solutions spiked onto the columns were separated into a fraction containing neutral compounds (triPAPs) and a fraction with ionic compounds (mono- and diPAPs) with recoveries between 72-110%. Method limits of quantification for food samples were in the sub to low picogram per gram range. For quantitative analysis of PAPs, compound-specific labeled internal standards showed to be essential as sorption and matrix effects were observed. Mono-, di-, and/or triPAPs were detected in all food packaging materials obtained from the Swedish market. Up to nine diPAPs were detected in the food samples, with the 6:2/6:2 and 6:2/8:2 diPAPs as the dominant compounds. DiPAP concentrations in the food samples ranged from 0.9 to 36 pg/g, which was comparable to individual PFCA concentrations in the same samples. Consumption of food packed in PAP-containing materials could be an indirect source of human exposure to PFCAs.

First molecular detection and characterization of Hepatozoon and Sarcocystis spp. in field mice and voles from Japan.

PubMed

Moustafa, Mohamed Abdallah Mohamed; Shimozuru, Michito; Mohamed, Wessam; Taylor, Kyle Rueben; Nakao, Ryo; Sashika, Mariko; Tsubota, Toshio

2017-08-01

Sarcocystis and Hepatozoon species are protozoan parasites that are frequently detected in domestic and wild animals. Rodents are considered common intermediate and paratenic hosts for several Sarcocystis and Hepatozoon species. Here, blood DNA samples from a total of six rodents, including one Myodes rutilus, one Myodes rufocanus, and four Apodemus speciosus, collected from Hokkaido, Japan, were shown by conventional PCR of the 18S ribosomal RNA (rRNA) gene to contain Sarcocystis and Hepatozoon DNA. Sequencing of the DNA detected one Sarcocystis sp. in the M. rufocanus sample and two different Hepatozoon spp. in the M. rutilus and A. speciosus samples. Phylogenetic analysis showed that the detected Sarcocystis sp. sequence grouped with GenBank Sarcocystis sequences from rodents, snakes, and raccoons from Japan and China. The 18S rRNA partial gene sequences of both detected Hepatozoon spp. clustered with GenBank Hepatozoon sequences from snakes, geckos and voles in Europe, Africa, and Asia. This study provides evidence that wild rodents have a role in the maintenance of Sarcocystis and Hepatozoon species on the island of Hokkaido.

Genetic diversity of avian avulavirus 1 (Newcastle disease virus genotypes VIg and VIIb) circulating in wild birds in Kazakhstan.

PubMed

Orynbayev, Mukhit B; Fereidouni, Sasan; Sansyzbai, Abylay R; Seidakhmetova, Bakhytkul A; Strochkov, Vitaliy M; Nametov, Askar M; Sadikaliyeva, Sandugash O; Nurgazieva, Asel; Tabynov, Kaissar K; Rametov, Nurkuysa M; Sultankulova, Kulyaisan T

2018-03-20

In order to improve current understanding of the molecular epidemiology of avian avulavirus 1 (AAvV-1, formerly avian paramyxovirus 1) in wild birds in Kazakhstan, 860 cloacal swab samples were evaluated. Samples were collected from 37 families of wild birds in nine different regions in the years 2011 and 2014. Overall, 54 positive samples (4.2%) were detected from 17 different families of wild birds, and 16 AAvV-1 isolates were characterized. Three of the isolates contained the fusion protein cleavage site motif RRQKR, and 13 contained KRQKR, which is typical for pathogenic strains of AAvV-1. The AAvV-1 isolates were found to belong to the genotypes VIg and VIIb.

Method for detecting coliform organisms

NASA Technical Reports Server (NTRS)

Nishioka, K.; Nibley, D. A.; Jeffers, E. L.; Brooks, R. L. (Inventor)

1983-01-01

A method and apparatus are disclosed for determining the concentration of coliform bacteria in a sample. The sample containing the coliform bacteria is cultured in a liquid growth medium. The cultured bacteria produce hydrogen and the hydrogen is vented to a second cell containing a buffer solution in which the hydrogen dissolves. By measuring the potential change in the buffer solution caused by the hydrogen, as a function of time, the initial concentration of bacteria in the sample is determined. Alternatively, the potential change in the buffer solution can be compared with the potential change in the liquid growth medium to verify that the potential change in the liquid growth medium is produced primarily by the hydrogen gas produced by the coliform bacteria.

Occurrence of 3-MCPD fatty acid esters in human breast milk.

PubMed

Zelinková, Z; Novotný, O; Schůrek, J; Velísek, J; Hajslová, J; Dolezal, M

2008-06-01

A series of twelve breast milk samples were analysed by gas chromatography-mass spectrometry (GC/MS) operated in selected ion monitoring mode for 3-chloropropane-1,2-diol (3-MCPD). Whilst none of the samples contained 3-MCPD above the limit of detection of 3 microg kg(-1) milk, all contained high amounts of 3-MCPD esterified with higher fatty acids. The levels of 3-MCPD released by hydrolysis of these esters (bound 3-MCPD) ranged from the limit of detection (300 microg kg(-1), expressed on a fat basis) to 2195 microg kg(-1); with a mean level of bound 3-MCPD of 1014 microg kg(-1), which corresponded to 35.5 microg kg(-1) milk. The presence of bound 3-MCPD was confirmed using orthogonal gas chromatography coupled with high-speed time-of-flight mass spectrometry analysis for four randomly selected breast milk samples. Six breast milks collected from one of the nursing mothers 14-76 days after childbirth contained bound 3-MCPD within the range of 328-2078 microg kg(-1) fat (mean 930 microg kg(-1) fat). The calculated bound 3-MCPD content of these samples was within the range of 6 and 19 microg kg(-1) milk (mean of 12 microg kg(-1) milk). The major types of 3-MCPD esters were the symmetric diesters with lauric, palmitic, and oleic acids, and asymmetric diesters with palmitic acid/oleic acid among which 3-chloro-1,2-propanediol 1,2-dioleate prevailed.

Design of a portable electronic nose for real-fake detection of liquors

NASA Astrophysics Data System (ADS)

Qi, Pei-Feng; Zeng, Ming; Li, Zhi-Hua; Sun, Biao; Meng, Qing-Hao

2017-09-01

Portability is a major issue that influences the practical application of electronic noses (e-noses). For liquors detection, an e-nose must preprocess the liquid samples (e.g., using evaporation and thermal desorption), which makes the portable design even more difficult. To realize convenient and rapid detection of liquors, we designed a portable e-nose platform that consists of hardware and software systems. The hardware system contains an evaporation/sampling module, a reaction module, a control/data acquisition and analysis module, and a power module. The software system provides a user-friendly interface and can achieve automatic sampling and data processing. This e-nose platform has been applied to the real-fake recognition of Chinese liquors. Through parameter optimization of a one-class support vector machine classifier, the error rate of the negative samples is greatly reduced, and the overall recognition accuracy is improved. The results validated the feasibility of the designed portable e-nose platform.

Quantification and molecular characterization of Salmonella isolated from food samples involved in salmonellosis outbreaks in Rio Grande do Sul, Brazil

PubMed Central

Mürmann, Lisandra; dos Santos, Maria Cecília; Longaray, Solange Mendes; Both, Jane Mari Corrêa; Cardoso, Marisa

2008-01-01

Data concerning the prevalence and populations of Salmonella in foods implicated in outbreaks may be important to the development of quantitative microbial risk assessments of individual food products. In this sense, the objective of the present study was to assess the amount of Salmonella sp. in different foods implicated in foodborne outbreaks in Rio Grande do Sul occurred in 2005 and to characterize the isolated strains using phenotypic and genotypic methods. Nineteen food samples involved in ten foodborne outbreaks occurred in 2005, and positive on Salmonella isolation at the Central Laboratory of the Health Department of the State of Rio Grande do Sul, were included in this study. Food samples were submitted to estimation of Salmonella using the Most Probable Number (MPN) technique. Moreover, one confirmed Salmonella colony of each food sample was serotyped, characterized by its XbaI-macrorestriction profile, and submitted to antimicrobial resistance testing. Foods containing eggs, mayonnaise or chicken were contaminated with Salmonella in eight outbreaks. Higher counts (>107 MPN.g-1) of Salmonella were detected mostly in foods containing mayonnaise. The isolation of Salmonella from multiple food items in five outbreaks probably resulted from the cross-contamination, and the high Salmonella counts detected in almost all analyzed samples probably resulted from storing in inadequate temperature. All strains were identified as S. Enteritidis, and presented a unique macrorestriction profile, demonstrating the predominance of one clonal group in foods involved in the salmonellosis outbreaks. A low frequency of antimicrobial resistant S. Enteritidis strains was observed and nalidixic acid was the only resistance marker detected. PMID:24031261

Simultaneous Determination of Sodium Benzoate, Potassium Sorbate and Natamycin Content in Iranian Yoghurt Drink (Doogh) and the Associated Risk of Their Intake through Doogh Consumption.

PubMed

Esfandiari, Zahra; Badiey, Mohammad; Mahmoodian, Pooya; Sarhangpour, Reza; Yazdani, Elham; Mirlohi, Maryam

2013-08-01

Regarding the public health concerns over the use of food preservatives in yoghurt drink "Doogh", the aim of this study was the determination of sodium benzoate, potassium sorbate and natamycin in Doogh. Based on Iranian national standard, none of these preservatives are permitted to be used in Doogh. A total of 39 Doogh samples were analyzed through RP-HPLC in order to quantify sodium benzoate, potassium sorbate and natamaycin simultaneously. Exposure to each preservative is estimated by mean and maximum concentrations as the residue levels. The per capita Doogh consumption was calculated by the published data from official reports for Doogh annual production in Iran. All samples were shown to contain sodium benzoate while natamaycin was detected in 10.25% of the samples and potassium sorbate was not detected in any of them. Sodium benzoate concentration extremely varied among the investigated samples ranged from 0.94 to 9.77 mg/l. Due to the result of the exposure estimation, no serious public health concern would exist regarding the mentioned preservatives. The detection of sodium benzoate in all Doogh samples could indicate the natural production of benzoic acid in yoghurt. Sodium benzoate may be formed through the interaction of the added food grade salt to the Doogh formula which contains benzoic acid. The results of exposure estimation show the lack of health risk within the usage of preservatives in spite of the national regulatory agencies does not permit the preservative use.

Developing A New Sampling and Analysis Method for Hydrazine and Monomethyl Hydrazine

NASA Technical Reports Server (NTRS)

Allen, John R.

2002-01-01

Solid phase microextraction (SPME) will be used to develop a method for detecting monomethyl hydrazine (MMH) and hydrazine (Hz). A derivatizing agent, pentafluorobenzoyl chloride (PFBCl), is known to react readily with MMH and Hz. The SPME fiber can either be coated with PFBCl and introduced into a gaseous stream containing MMH, or PFBCl and MMH can react first in a syringe barrel and after a short equilibration period a SPME is used to sample the resulting solution. These methods were optimized and compared. Because Hz and MMH can degrade the SPME, letting the reaction occur first gave better results. Only MMH could be detected using either of these methods. Future research will concentrate on constructing calibration curves and determining the detection limit.

Dual liquid and gas chromatograph system

DOEpatents

Gay, D.D.

A chromatographic system is described that utilizes one detection system for gas chromatographic and micro-liquid chromatographic determinations. The detection system is a direct-current, atmospheric-pressure, helium plasma emission spectrometer. The detector utilizes a nontransparent plasma source unit which contains the plasma region and two side-arms which receive effluents from the micro-liquid chromatograph and the gas chromatograph. The dual nature of this chromatographic system offers: (1) extreme flexibility in the samples to be examined; (2) extreme low sensitivity; (3) element selectivity; (4) long-term stability; (5) direct correlation of data from the liquid and gas samples; (6) simpler operation than with individual liquid and gas chromatographs, each with different detection systems; and (7) cheaper than a commercial liquid chromatograph and a gas chromatograph.

Dual liquid and gas chromatograph system

DOEpatents

Gay, Don D.

1985-01-01

A chromatographic system that utilizes one detection system for gas chromatographic and micro-liquid chromatographic determinations. The detection system is a direct-current, atmospheric-pressure, helium plasma emission spectrometer. The detector utilizes a non-transparent plasma source unit which contains the plasma region and two side-arms which receive effluents from the micro-liquid chromatograph and the gas chromatograph. The dual nature of this chromatographic system offers: (1) extreme flexibility in the samples to be examined; (2) extremely low sensitivity; (3) element selectivity; (4) long-term stability; (5) direct correlation of data from the liquid and gas samples; (6) simpler operation than with individual liquid and gas chromatographs, each with different detection systems; and (7) cheaper than a commercial liquid chromatograph and a gas chromatograph.

The Mars Science Laboratory Organic Check Material

NASA Astrophysics Data System (ADS)

Conrad, Pamela G.; Eigenbrode, Jennifer L.; Von der Heydt, Max O.; Mogensen, Claus T.; Canham, John; Harpold, Dan N.; Johnson, Joel; Errigo, Therese; Glavin, Daniel P.; Mahaffy, Paul R.

2012-09-01

Mars Science Laboratory's Curiosity rover carries a set of five external verification standards in hermetically sealed containers that can be sampled as would be a Martian rock, by drilling and then portioning into the solid sample inlet of the Sample Analysis at Mars (SAM) suite. Each organic check material (OCM) canister contains a porous ceramic solid, which has been doped with a fluorinated hydrocarbon marker that can be detected by SAM. The purpose of the OCM is to serve as a verification tool for the organic cleanliness of those parts of the sample chain that cannot be cleaned other than by dilution, i.e., repeated sampling of Martian rock. SAM possesses internal calibrants for verification of both its performance and its internal cleanliness, and the OCM is not used for that purpose. Each OCM unit is designed for one use only, and the choice to do so will be made by the project science group (PSG).

Oxychlorine Species in Gale Crater and Broader Implications for Mars

NASA Technical Reports Server (NTRS)

Ming, Douglas W.; Sutter, Brad; Morris, Richard V.; Clark, B. C.; Mahaffy, P. H.; Archilles, C.; Wray, J. J.; Fairen, A. G.; Gellert, Ralf; Yen, Albert;

Oxychlorine species in Gale Crater and broader implications for Mars

NASA Astrophysics Data System (ADS)

Archer, Paul Douglas; Hogancamp, Joanna C.; Ming, Douglas W.; Sutter, Brad; Morris, Richard V.; Clark, Benton; Mahaffy, Paul R.; Achilles, Cherie; Wray, James J.; Gellert, Ralf; Yen, Albert; Blake, David F.; Vaniman, David T.; Glavin, Daniel P.; Eigenbrode, Jennifer L.; Trainer, Melissa G.; Navarro-González, Rafael; McKay, Christopher P.; Freissinet, Caroline; Martin, Peter

2017-10-01

Of 15 samples analyzed to date, the Sample Analysis at Mars (SAM) instrument on the Mars Science Laboratory (MSL) has detected oxychlorine compounds (perchlorate or chlorate) in 12 samples. The presence of oxychlorine species is inferred from the release of oxygen at temperatures <600 °C and HCl between 350-850 °C when a sample is heated to 850 °C. The O2 release temperature varies with sample, likely caused by different cations, grain size differences, or catalytic effects of other minerals. In the oxychlorine-containing samples, perchlorate abundances range from 0.06 ± 0.03 to 1.15 ± 0.5 wt% Cl2O7 equivalent. Comparing these results to the elemental Cl concentration measured by the Alpha Particle X-ray Spectrometer (APXS) instrument, oxychlorine species account for 5-40% of the total Cl present.The variation in oxychlorine abundance has implications for their production and preservation over time. For example, the John Klein (JK) and Cumberland (CB) samples were acquired within a few meters of each other and CB contained ~1.2 wt% Cl2O7 equivalent while JK had ~0.1 wt%. One difference between the two samples is that JK has a large number of veins visible in the drill hole wall, indicating more post-deposition alteration and removal.Finally, despite Cl concentrations similar to previous samples, the last three Murray formation samples (Oudam, Marimba, and Quela) had no detectable oxygen released during pyrolysis. This could be a result of oxygen reacting with other species in the sample during pyrolysis. Lab work has shown this is likely to have occurred in SAM but it is unlikely to have consumed all the O2 released. Another explanation is that the Cl is present as chlorides, which is consistent with data from the ChemCam (Chemical Camera) and CheMin (Chemistry and Mineralogy) instruments on MSL. For example, the Quela sample has ~1 wt% elemental Cl detected by APXS, had no detectable O2 released, and halite (NaCl) has been tentatively identified in CheMin X-ray diffraction data.These data show that oxychlorines are likely globally distributed on Mars but the distribution is heterogenous depending on the perchlorate formation mechanism (production rate), burial, and subsequent diagenesis.

Detection of the 35S promoter in transgenic maize via various isothermal amplification techniques: a practical approach.

PubMed

Zahradnik, Celine; Kolm, Claudia; Martzy, Roland; Mach, Robert L; Krska, Rudolf; Farnleitner, Andreas H; Brunner, Kurt

2014-11-01

In 2003 the European Commission introduced a 0.9% threshold for food and feed products containing genetically modified organism (GMO)-derived components. For commodities containing GMO contents higher than this threshold, labelling is mandatory. To provide a DNA-based rapid and simple detection method suitable for high-throughput screening of GMOs, several isothermal amplification approaches for the 35S promoter were tested: strand displacement amplification, nicking-enzyme amplification reaction, rolling circle amplification, loop-mediated isothermal amplification (LAMP) and helicase-dependent amplification (HDA). The assays developed were tested for specificity in order to distinguish between samples containing genetically modified (GM) maize and non-GM maize. For those assays capable of this discrimination, tests were performed to determine the lower limit of detection. A false-negative rate was determined to rule out whether GMO-positive samples were incorrectly classified as GMO-negative. A robustness test was performed to show reliable detection independent from the instrument used for amplification. The analysis of three GM maize lines showed that only LAMP and HDA were able to differentiate between the GMOs MON810, NK603, and Bt11 and non-GM maize. Furthermore, with the HDA assay it was possible to realize a detection limit as low as 0.5%. A false-negative rate of only 5% for 1% GM maize for all three maize lines shows that HDA has the potential to be used as an alternative strategy for the detection of transgenic maize. All results obtained with the LAMP and HDA assays were compared with the results obtained with a previously reported real-time PCR assay for the 35S promoter in transgenic maize. This study presents two new screening assays for detection of the 35S promoter in transgenic maize by applying the isothermal amplification approaches HDA and LAMP.

Straightforward single-calibrant quantification of seized designer drugs by liquid chromatography-chemiluminescence nitrogen detection.

PubMed

Rasanen, Ilpo; Kyber, Marianne; Szilvay, Ilmari; Rintatalo, Janne; Ojanperä, Ilkka

2014-04-01

Sixty-one different psychoactive substances were quantified by liquid chromatography-chemiluminescence nitrogen detection (LC-CLND) in 177 samples, using a single secondary standard (caffeine), in a trial concerning the quantitative purity assessment of drug-related material seized by the police in 2011-2012 and customs in 2011-2013 in Finland. The substances found were predominantly substituted phenethylamines, cathinones, tryptamines and synthetic cannabinoids, which were identified by appropriate methods prior to submitting the samples for quantification by LC-CLND. The equimolarity and expanded uncertainty of measurement by LC-CLND were on average 95% and 13%, respectively, based on 16 different substances. The median (mean) purity of stimulant/hallucinogenic drug samples seized at the border was 92.9% (87.6%) and in the street 82.0% (64.5%). The corresponding figures for powdery synthetic cannabinoid samples seized at the border and in the street were 99.0% (96.8%) and 90.0% (92.2%), respectively. There was generally only one active drug to be quantified in each sample. Seized herbal samples contained 0.15-9.2% of between one and three components. LC-CLND was found to be suitable for quantification of the nitrogen-containing drugs encountered in the study, showing sufficient N-equimolarity for both stimulant/hallucinogenic drugs and synthetic cannabinoids. The technique possesses great potential as a standard technique in forensic laboratories. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Pesticides in soils and ground water in selected irrigated agricultural areas near Havre, Ronan, and Huntley, Montana

USGS Publications Warehouse

Clark, D.W.

1990-01-01

Three areas in Montana representing a range of agricultural practices and applied pesticides, were studied to document whether agricultural pesticides are being transported into the soil and shallow groundwater in irrigated areas. Analytical scans for triazine herbicides, organic-acid herbicides, and carbamate insecticides were performed on soil and shallow groundwater samples. The results indicate pesticide residue in both types of samples. The concentrations of pesticides in the groundwater were less than Federal health-advisory limits. At the Havre Agricultural Experiment Station, eight wells were installed at two sites. All four soil samples and two of four water samples collected after application of pesticides contained detectable concentrations of atrazine or dicamba. In an area where seed potatoes are grown near Ronan, eight wells were installed at two sites. Pesticides were not detected after initial application of pesticides and irrigation water. The site was resampled after irrigation water was reapplied, and aldicarb metabolities were detected in four of five soil samples and one of five water samples. At the Huntley Agricultural Experiment Station, five wells were installed in a no-tillage corn field where atrazine was applied in 1987. Soil and water samples were collected in June and July 1988; pesticides were not detected in any samples. Results indicate residue of two pesticides in soil samples and three soluble pesticides in groundwater samples. Therefore, irrigated agricultural areas in Montana might be susceptible to transport of soluble pesticides through permeable soil to the shallow groundwater system. (USGS)

Quantitative determination of mycotoxins in urine by LC-MS/MS.

PubMed

Ahn, J; Kim, D; Kim, H; Jahng, K-Y

2010-12-01

Naturally occurring mycotoxins are responsible for a wide array of adverse health effects. The measurement of urinary mycotoxin levels is a useful means of assessing an individual's exposure, but the development of sensitive and accurate analytical methods for detecting mycotoxins and their metabolites in urine samples is challenging. Urinary mycotoxins are present in low pg ml⁻¹ concentrations, and the chromatographic identification of their metabolites can be obscured by other endogenous metabolites. We developed an analytical method focused on the selection of two appropriate multiple-reaction monitoring transition for unambiguous identification and quantification of carcinogenic aflatoxin M₁ (AFM₁), ochratoxin A (OTA) and fumonisin B₁, B₂ (FB₁, FB₂) in urine samples from a small volunteer group in a pilot study. AFM₁, OTA, FB₁ and FB₂ were concentrated selectively, interfering substances were removed using an immunoaffinity column (IAC), and mycotoxins were measured using liquid chromatography-tandem mass spectrometry (LC-MS/MS) in combination with a stable-isotope standard-dilution assay (SIDA). The method was sensitive enough to measure mycotoxins and their metabolites at pg ml⁻¹ levels in urine. The combination of LC-MS/MS and SIDA was critical to distinguishing pseudo-OTα interference from genuine OTα. Twelve urine samples contained OTA ranging from 0.013 to 0.093 ng ml⁻¹ (mean = 0.031 ng ml⁻¹). AFM₁ were detected in one sample at a 0.002 ng ml⁻¹ level, while FB₁ and FB₂ were undetectable in all 12 samples. None of the samples in this pilot study contained a detectable level of OTα, despite the presence of OTA, and this may suggest the need for further epidemiological investigation of OTA exposure in the Korean population.

Development of a low-cost method of analysis for the qualitative and quantitative analysis of butyltins in environmental samples.

PubMed

Bangkedphol, Sornnarin; Keenan, Helen E; Davidson, Christine; Sakultantimetha, Arthit; Songsasen, Apisit

2008-12-01

Most analytical methods for butyltins are based on high resolution techniques with complicated sample preparation. For this study, a simple application of an analytical method was developed using High Performance Liquid Chromatography (HPLC) with UV detection. The developed method was studied to determine tributyltin (TBT), dibutyltin (DBT) and monobutyltin (MBT) in sediment and water samples. The separation was performed in isocratic mode on an ultra cyanopropyl column with a mobile phase of hexane containing 5% THF and 0.03% acetic acid. This method was confirmed using standard GC/MS techniques and verified by statistical paired t-test method. Under the experimental conditions used, the limit of detection (LOD) of TBT and DBT were 0.70 and 0.50 microg/mL, respectively. The optimised extraction method for butyltins in water and sediment samples involved using hexane containing 0.05-0.5% tropolone and 0.2% sodium chloride in water at pH 1.7. The quantitative extraction of butyltin compounds in a certified reference material (BCR-646) and naturally contaminated samples was achieved with recoveries ranging from 95 to 108% and at %RSD 0.02-1.00%. This HPLC method and optimum extraction conditions were used to determine the contamination level of butyltins in environmental samples collected from the Forth and Clyde canal, Scotland, UK. The values obtained severely exceeded the Environmental Quality Standard (EQS) values. Although high resolution methods are utilised extensively for this type of research, the developed method is cheaper in both terms of equipment and running costs, faster in analysis time and has comparable detection limits to the alternative methods. This is advantageous not just as a confirmatory technique but also to enable further research in this field.

Se metallomics during lactic fermentation of Se-enriched yogurt.

PubMed

Palomo, María; Gutiérrez, Ana M; Pérez-Conde, M Concepción; Cámara, Carmen; Madrid, Yolanda

2014-12-01

Selenium biotransformation by lactic acid bacteria during the preparation of Se-enriched yogurt was evaluated. The study focused on the distribution of selenium in the aqueous soluble protein fraction and the detection of selenoamino acids. Screening of selenium in Tris-buffer-urea soluble fraction was carried out by sodium dodecyl sulphate polyacrylamide gel electrophoresis after pre-fractionating with asymmetric field flow fractionation using inductively coupled plasma-mass spectrometry as the detector. Selenium-containing fractions were identified by peptide mapping using nano LC-ESI/LTQMS. Proteins such as thioredoxin, glutaredoxin, albumin, β-lactoglobulin, and lactoperoxidase were identified in the selenium-containing fraction. All these proteins were detected in both the control and the selenium-enriched yogurt except chaperones, which were only detected in the control samples. Chaperones are heat-shock proteins expressed in response to elevated temperature or other cellular stresses. Selenium may have an effect on chaperones expression in Lactobacillus. For the amino acids analysis, selenocysteine was the primary seleno-containing species. Copyright © 2014 Elsevier Ltd. All rights reserved.

Mycobacterium avium subsp. avium in lymph nodes and diaphragms of pigs from one infected herd in the Czech Republic.

PubMed

Kriz, Petr; Kaevska, Marija; Slana, Iva; Bartejsova, Iva; Pavlik, Ivo

2014-01-01

This study was performed on 40 finished pigs from one herd naturally infected with Mycobacterium avium subsp. avium. The aim was to investigate the presence and amount of M. a. avium in samples of lymph nodes and diaphragm tissues collected during routine postmortem inspection using the triplex quantitative real time PCR (qPCR) method. We collected, in total, 107 samples: various lymph nodes affected by gross tuberculosis (TB)-like lesions from 17 pig carcasses, as well as samples of head and mesenteric lymph nodes from 23 carcasses without TB-like lesions. Samples of diaphragm tissues were collected from all carcasses. M. a. avium was detected in one or more tissue samples collected from half of the slaughtered pigs tested. Samples of diaphragm tissues of three pigs with detected TB-like lesions contained M. a. avium (10(2) to 10(3) cells per g of sample); the organism was not detected in diaphragm tissues from pigs without TB-like lesions. The qPCR method may be useful for quantification of M. a. avium in pigs for the purposes of foodborne risk assessment.

Pesticides in the Lower Clackamas River Basin, Oregon, 2000-01

USGS Publications Warehouse

Carpenter, Kurt D.

2004-01-01

In 2000-01, the U. S. Geological Survey sampled the Clackamas River and its major lower-basin tributaries during storm runoff conditions for 86 dissolved pesticides and selected breakdown products. Twenty-seven compounds, including 18 herbicides, 7 insecticides, and 2 pesticide breakdown products, were detected in 18 stream samples. The most commonly detected pesticides, in decreasing frequency, included atrazine, simazine, diazinon, metolachlor, and diuron, which variously occurred in 46-92% of samples collected from the tributaries. Of these, atrazine, simazine, and metolachlor, plus six other compounds, also were detected in the main-stem Clackamas River. Pesticides were detected more frequently and at higher concentrations in the four lowermost tributaries (Deep, Richardson, Rock, and Sieben Creeks). In these streams, 12 to 18 pesticides were detected per stream in samples collected during spring and fall. Pesticides always occurred with at least one other pesticide, and about half of the samples, including one sample from the Clackamas River in October 2000, contained six or more pesticides. Nine pesticides, including the insecticide diazinon and the herbicides 2,4-D, atrazine, dichlobenil, diuron, imazaquin, metolachlor, simazine, and trifluralin, were detected in five water samples of Clackamas River water. No pesticides were detected in three samples of treated Clackamas River water used for drinking-water supply. Concentrations of six compounds--carbaryl, chlorpyrifos, diazinon, dieldrin, malathion, and the breakdown product of DDT (p,p'-DDE)--exceeded established or recommended criteria for the protection of aquatic life in some of the tributaries, sometimes for multiple pesticides in one sample. Identifying the sources of pesticides detected in the Clackamas River Basin is difficult because of the diverse land use in the basin and the multiple-use nature of many of the pesticides detected. Of the 25 parent compounds detected, 22 have agricultural uses, 23 have urban uses, 16 are applied to golf courses, 11 are applied along roads and other right-of-ways, and 5 have or had forestry applications. Because only a small fraction of the thousands of pesticide products registered for use in Oregon were tested for in this study, future monitoring could benefit from knowledge of what pesticides are applied so that potential problems can be identified and managed.

Shell-vial culture, coupled with real-time PCR, applied to Rickettsia conorii and Rickettsia massiliae-Bar29 detection, improving the diagnosis of the Mediterranean spotted fever.

PubMed

Segura, Ferran; Pons, Immaculada; Sanfeliu, Isabel; Nogueras, María-Mercedes

2016-04-01

Rickettsia conorii and Rickettsia massiliae-Bar29 are related to Mediterranean spotted fever (MSF). They are intracellular microorganisms. The Shell-vial culture assay (SV) improved Rickettsia culture but it still has some limitations: blood usually contains low amount of microorganisms and the samples that contain the highest amount of them are non-sterile. The objectives of this study were to optimize SV culture conditions and monitoring methods and to establish antibiotic concentrations useful for non-sterile samples. 12 SVs were inoculated with each microorganism, incubated at different temperatures and monitored by classical methods and real-time PCR. R. conorii was detected by all methods at all temperatures since 7th day of incubation. R. massiliae-Bar29 was firstly observed at 28°C. Real-time PCR allowed to detected it 2-7 days earlier (depend on temperature) than classical methods. Antibiotics concentration needed for the isolation of these Rickettsia species from non-sterile samples was determined inoculating SV with R. conorii, R. massiliae-Bar29, biopsy or tick, incubating them with different dilutions of antibiotics and monitoring them weekly. To sum up, if a MSF diagnosis is suspected, SV should be incubated at both 28°C and 32°C for 1-3 weeks and monitored by a sensitive real-time PCR. If the sample is non-sterile the panel of antibiotics tested can be added. Copyright © 2016 Elsevier GmbH. All rights reserved.

A pressure core ultrasonic test system for on-board analysis of gas hydrate-bearing sediments under in situ pressures.

PubMed

Yang, Lei; Zhou, Weihua; Xue, Kaihua; Wei, Rupeng; Ling, Zheng

2018-05-01

The enormous potential as an alternative energy resource has made natural gas hydrates a material of intense research interest. Their exploration and sample characterization require a quick and effective analysis of the hydrate-bearing cores recovered under in situ pressures. Here a novel Pressure Core Ultrasonic Test System (PCUTS) for on-board analysis of sediment cores containing gas hydrates at in situ pressures is presented. The PCUTS is designed to be compatible with an on-board pressure core transfer device and a long gravity-piston pressure-retained corer. It provides several advantages over laboratory core analysis including quick and non-destructive detection, in situ and successive acoustic property acquisition, and remission of sample storage and transportation. The design of the unique assembly units to ensure the in situ detection is demonstrated, involving the U-type protecting jackets, transducer precession device, and pressure stabilization system. The in situ P-wave velocity measurements make the detection of gas hydrate existence in the sediments possible on-board. Performance tests have verified the feasibility and sensitivity of the ultrasonic test unit, showing the dependence of P-wave velocity on gas hydrate saturation. The PCUTS has been successfully applied for analysis of natural samples containing gas hydrates recovered from the South China Sea. It is indicated that on-board P-wave measurements could provide a quick and effective understanding of the hydrate occurrence in natural samples, which can assist further resource exploration, assessment, and subsequent detailed core analysis.

A pressure core ultrasonic test system for on-board analysis of gas hydrate-bearing sediments under in situ pressures

NASA Astrophysics Data System (ADS)

Yang, Lei; Zhou, Weihua; Xue, Kaihua; Wei, Rupeng; Ling, Zheng

2018-05-01

The enormous potential as an alternative energy resource has made natural gas hydrates a material of intense research interest. Their exploration and sample characterization require a quick and effective analysis of the hydrate-bearing cores recovered under in situ pressures. Here a novel Pressure Core Ultrasonic Test System (PCUTS) for on-board analysis of sediment cores containing gas hydrates at in situ pressures is presented. The PCUTS is designed to be compatible with an on-board pressure core transfer device and a long gravity-piston pressure-retained corer. It provides several advantages over laboratory core analysis including quick and non-destructive detection, in situ and successive acoustic property acquisition, and remission of sample storage and transportation. The design of the unique assembly units to ensure the in situ detection is demonstrated, involving the U-type protecting jackets, transducer precession device, and pressure stabilization system. The in situ P-wave velocity measurements make the detection of gas hydrate existence in the sediments possible on-board. Performance tests have verified the feasibility and sensitivity of the ultrasonic test unit, showing the dependence of P-wave velocity on gas hydrate saturation. The PCUTS has been successfully applied for analysis of natural samples containing gas hydrates recovered from the South China Sea. It is indicated that on-board P-wave measurements could provide a quick and effective understanding of the hydrate occurrence in natural samples, which can assist further resource exploration, assessment, and subsequent detailed core analysis.

Bioluminescence methods for enzymatic determinations

DOEpatents

Bostick, William D.; Denton, Mark S.; Dinsmore, Stanley R.

1982-01-01

An enzymatic method for continuous, on-line and rapid detection of diagnostically useful biomarkers, which are symptomatic of disease or trauma-related tissue damage, is disclosed. The method is characterized by operability on authentic samples of complex biological fluids which contain the biomarkers.

A 3D Microfluidic Chip for Electrochemical Detection of Hydrolysed Nucleic Bases by a Modified Glassy Carbon Electrode

PubMed Central

Vlachova, Jana; Tmejova, Katerina; Kopel, Pavel; Korabik, Maria; Zitka, Jan; Hynek, David; Kynicky, Jindrich; Adam, Vojtech; Kizek, Rene

2015-01-01

Modification of carbon materials, especially graphene-based materials, has wide applications in electrochemical detection such as electrochemical lab-on-chip devices. A glassy carbon electrode (GCE) modified with chemically alternated graphene oxide was used as a working electrode (glassy carbon modified by graphene oxide with sulphur containing compounds and Nafion) for detection of nucleobases in hydrolysed samples (HCl pH = 2.9, 100 °C, 1 h, neutralization by NaOH). It was found out that modification, especially with trithiocyanuric acid, increased the sensitivity of detection in comparison with pure GCE. All processes were finally implemented in a microfluidic chip formed with a 3D printer by fused deposition modelling technology. As a material for chip fabrication, acrylonitrile butadiene styrene was chosen because of its mechanical and chemical stability. The chip contained the one chamber for the hydrolysis of the nucleic acid and another for the electrochemical detection by the modified GCE. This chamber was fabricated to allow for replacement of the GCE. PMID:25621613

A 3D microfluidic chip for electrochemical detection of hydrolysed nucleic bases by a modified glassy carbon electrode.

PubMed

Vlachova, Jana; Tmejova, Katerina; Kopel, Pavel; Korabik, Maria; Zitka, Jan; Hynek, David; Kynicky, Jindrich; Adam, Vojtech; Kizek, Rene

2015-01-22

Modification of carbon materials, especially graphene-based materials, has wide applications in electrochemical detection such as electrochemical lab-on-chip devices. A glassy carbon electrode (GCE) modified with chemically alternated graphene oxide was used as a working electrode (glassy carbon modified by graphene oxide with sulphur containing compounds and Nafion) for detection of nucleobases in hydrolysed samples (HCl pH = 2.9, 100 °C, 1 h, neutralization by NaOH). It was found out that modification, especially with trithiocyanuric acid, increased the sensitivity of detection in comparison with pure GCE. All processes were finally implemented in a microfluidic chip formed with a 3D printer by fused deposition modelling technology. As a material for chip fabrication, acrylonitrile butadiene styrene was chosen because of its mechanical and chemical stability. The chip contained the one chamber for the hydrolysis of the nucleic acid and another for the electrochemical detection by the modified GCE. This chamber was fabricated to allow for replacement of the GCE.

Development of a magnetic bead-based method for the collection of circulating extracellular vesicles.

PubMed

Shih, Chun-Liang; Chong, Kowit-Yu; Hsu, Shih-Che; Chien, Hsin-Jung; Ma, Ching-Ting; Chang, John Wen-Cheng; Yu, Chia-Jung; Chiou, Chiuan-Chian

2016-01-25

Cells release different types of extracellular vesicles (EVs). These EVs contain biomolecules, including proteins and nucleic acids, from their parent cells, which can be useful for diagnostic applications. The aim of this study was to develop a convenient procedure to collect circulating EVs with detectable mRNA or other biomolecules. Magnetic beads coated with annexin A5 (ANX-beads), which bound to phosphatidylserine moieties on the surfaces of most EVs, were tested for their ability to capture induced apoptotic bodies in vitro and other phosphatidylserine-presenting vesicles in body fluids. Our results show that up to 60% of induced apoptotic bodies could be captured by the ANX-beads. The vesicles captured from cultured media or plasma contained amplifiable RNA. Suitable blood samples for EV collection included EDTA-plasma and serum but not heparin-plasma. In addition, EVs in plasma were labile to freeze-and-thaw cycles. In rodents xenografted with human cancer cells, tumor-derived mRNA could be detected in EVs captured from serum samples. Active proteins could be detected in EVs captured from ascites but not from plasma. In conclusion, we have developed a magnetic bead-based procedure for the collection of EVs from body fluids and proved that captured EVs contain biomolecules from their parent cells, and therefore have great potential for disease diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

Evidence of natural occurrence of the banned antibiotic chloramphenicol in herbs and grass.

PubMed

Berendsen, Bjorn; Stolker, Linda; de Jong, Jacob; Nielen, Michel; Tserendorj, Enkhtuya; Sodnomdarjaa, Ruuragchas; Cannavan, Andrew; Elliott, Christopher

2010-07-01

Chloramphenicol (CAP), a broad-spectrum antibiotic, was detected in several herb and grass samples from different geographic origins. Due to its suspected carcinogenicity and linkages with the development of aplastic anemia in humans, CAP is banned for use in food-producing animals in the European Union (EU) and many other countries. However, products of animal origin originating from Asian countries entering the European market are still found noncompliant (containing CAP) on a regular basis, even when there is no history of chloramphenicol use in these countries. A possible explanation for the continued detection of these residues is the natural occurrence of CAP in plant material which is used as animal feed, with the consequent transfer of the substance to the animal tissues. Approximately 110 samples were analyzed using liquid chromatography coupled with mass spectrometric detection. In 26 samples, the presence of CAP was confirmed using the criteria for banned substances defined by the EU. Among other plant materials, samples of the Artemisia family retrieved from Mongolia and from Utah, USA, and a therapeutic herb mixture obtained from local stores in the Netherlands proved to contain CAP at levels ranging from 0.1 to 450 microg/kg. These findings may have a major impact in relation to international trade and safety to the consumer. The results of this study demonstrate that noncompliant findings in animal-derived food products may in part be due to the natural occurrence of chloramphenicol in plant material. This has implications for the application of current EU, USA, and other legislation and the interpretation of analytical results with respect to the consideration of CAP as a xenobiotic veterinary drug residue and the regulatory actions taken upon its detection in food.

Evidence of natural occurrence of the banned antibiotic chloramphenicol in herbs and grass

PubMed Central

Berendsen, Bjorn; de Jong, Jacob; Nielen, Michel; Tserendorj, Enkhtuya; Sodnomdarjaa, Ruuragchas; Cannavan, Andrew; Elliott, Christopher

2010-01-01

Chloramphenicol (CAP), a broad-spectrum antibiotic, was detected in several herb and grass samples from different geographic origins. Due to its suspected carcinogenicity and linkages with the development of aplastic anemia in humans, CAP is banned for use in food-producing animals in the European Union (EU) and many other countries. However, products of animal origin originating from Asian countries entering the European market are still found noncompliant (containing CAP) on a regular basis, even when there is no history of chloramphenicol use in these countries. A possible explanation for the continued detection of these residues is the natural occurrence of CAP in plant material which is used as animal feed, with the consequent transfer of the substance to the animal tissues. Approximately 110 samples were analyzed using liquid chromatography coupled with mass spectrometric detection. In 26 samples, the presence of CAP was confirmed using the criteria for banned substances defined by the EU. Among other plant materials, samples of the Artemisia family retrieved from Mongolia and from Utah, USA, and a therapeutic herb mixture obtained from local stores in the Netherlands proved to contain CAP at levels ranging from 0.1 to 450 µg/kg. These findings may have a major impact in relation to international trade and safety to the consumer. The results of this study demonstrate that noncompliant findings in animal-derived food products may in part be due to the natural occurrence of chloramphenicol in plant material. This has implications for the application of current EU, USA, and other legislation and the interpretation of analytical results with respect to the consideration of CAP as a xenobiotic veterinary drug residue and the regulatory actions taken upon its detection in food. PMID:20431869

Detection of Legionella spp. by a nested-PCR assay in air samples of a wastewater treatment plant and downwind distances in Isfahan

PubMed Central

Mirzaee, Seyyed Abbas; Nikaeen, Mahnaz; Hajizadeh, Yaghob; Nabavi, BiBi Fatemeh; Hassanzadeh, Akbar

2015-01-01

Background: Wastewater contains a variety of pathogens and bio -aerosols generated during the wastewater treatment process, which could be a potential health risk for exposed individuals. This study was carried out to detect Legionella spp. in the bio -aerosols generated from different processes of a wastewater treatment plant (WWTP) in Isfahan, Iran, and the downwind distances. Materials and Methods: A total of 54 air samples were collected and analyzed for the presence of Legionella spp. by a nested- polymerase chain reaction (PCR) assay. A liquid impingement biosampler was used to capture bio -aerosols. The weather conditions were also recorded. Results: Legionella were detected in 6% of the samples, including air samples above the aeration tank (1/9), belt filter press (1/9), and 250 m downwind (1/9). Conclusion: The result of this study revealed the presence of Legionella spp. in air samples of a WWTP and downwind distance, which consequently represent a potential health risk to the exposed individuals. PMID:25802817

Chemical Isotope Labeling LC-MS for High Coverage and Quantitative Profiling of the Hydroxyl Submetabolome in Metabolomics.

PubMed

Zhao, Shuang; Luo, Xian; Li, Liang

2016-11-01

A key step in metabolomics is to perform accurate relative quantification of the metabolomes in comparative samples with high coverage. Hydroxyl-containing metabolites are an important class of the metabolome with diverse structures and physical/chemical properties; however, many of them are difficult to detect with high sensitivity. We present a high-performance chemical isotope labeling liquid chromatography mass spectrometry (LC-MS) technique for in-depth profiling of the hydroxyl submetabolome, which involves the use of acidic liquid-liquid extraction to enrich hydroxyl metabolites into ethyl acetate from an aqueous sample. After drying and then redissolving in acetonitrile, the metabolite extract is labeled using a base-activated 12 C- or 13 C-dansylation reaction. A fast step-gradient LC-UV method is used to determine the total concentration of labeled metabolites. On the basis of the concentration information, a 12 C-labeled individual sample is mixed with an equal mole amount of a 13 C-labeled pool or control for relative metabolite quantification. The 12 C-/ 13 C-labeled mixtures are individually analyzed by LC-MS, and the resultant peak pairs of labeled metabolites in MS are measured for relative quantification and metabolite identification. A standard library of 85 hydroxyl compounds containing MS, retention time, and MS/MS information was constructed for positive metabolite identification based on matches of two or all three of these parameters with those of an unknown. Using human urine as an example, we analyzed samples of 1:1 12 C-/ 13 C-labeled urine in triplicate with triplicate runs per sample and detected an average of 3759 ± 45 peak pairs or metabolites per run and 3538 ± 71 pairs per sample with 3093 pairs in common (n = 9). Out of the 3093 peak pairs, 2304 pairs (75%) could be positively or putatively identified based on metabolome database searches, including 20 pairs positively identified using the dansylated hydroxyl standards library. The majority of detected metabolites were those containing hydroxyl groups. This technique opens a new avenue for the detailed characterization of the hydroxyl submetabolome in metabolomics research.

Detection of Her2-overexpressing cancer cells using keyhole shaped chamber array employing a magnetic droplet-handling system.

PubMed

Okochi, Mina; Koike, Shinji; Tanaka, Masayoshi; Honda, Hiroyuki

2017-07-15

An on-chip gene expression analysis compartmentalized in droplets was developed for detection of cancer cells at a single-cell level. The chip consists of a keyhole-shaped reaction chamber with hydrophobic modification employing a magnetic bead-droplet-handling system with a gate for bead separation. Using three kinds of water-based droplets in oil, a droplet with sample cells, a lysis buffer with magnetic beads, and RT-PCR buffer, parallel magnetic manipulation and fusion of droplets were performed using a magnet-handling device containing small external magnet patterns in an array. The actuation with the magnet offers a simple system for droplet manipulation that allows separation and fusion of droplets containing magnetic beads. After reverse transcription and amplification by thermal cycling, fluorescence was obtained for detection of overexpressing genes. For clinical detection of gastric cancer cells in peritoneal washing, the Her2-overexpressing gastric cancer cells spiked within normal cells was detected by gene expression analysis of droplets containing an average of 2.5 cells. Our developed droplet-based cancer detection system manipulated by external magnetic force without pumps or valves offers a simple and flexible set-up for transcriptional detection of cancer cells, and will be greatly advantageous for less-invasive clinical diagnosis and prognostic prediction. Copyright © 2016 Elsevier B.V. All rights reserved.

Method and apparatus for detecting halogenated hydrocarbons

DOEpatents

Monagle, Matthew; Coogan, John J.

1997-01-01

A halogenated hydrocarbon (HHC) detector is formed from a silent discharge (also called a dielectric barrier discharge) plasma generator. A silent discharge plasma device receives a gas sample that may contain one or more HHCs and produces free radicals and excited electrons for oxidizing the HHCs in the gas sample to produce water, carbon dioxide, and an acid including halogens in the HHCs. A detector is used to sensitively detect the presence of the acid. A conductivity cell detector combines the oxidation products with a solvent where dissociation of the acid increases the conductivity of the solvent. The conductivity cell output signal is then functionally related to the presence of HHCs in the gas sample. Other detectors include electrochemical cells, infrared spectrometers, and negative ion mobility spectrometers.

Evaluation of pesticide residues in fruits and vegetables from Algeria.

PubMed

Mebdoua, Samira; Lazali, Mohamed; Ounane, Sidi Mohamed; Tellah, Sihem; Nabi, Fahima; Ounane, Ghania

2017-06-01

A total of 160 samples of 13 types of fresh fruits and vegetables from domestic production and import were analysed to detect the presence of pesticide residues. Analysis was performed by multi-residual extraction followed by gas chromatography-mass spectrometry. In 42.5% of the tested samples, no residues were found and 12.5% of samples contained pesticide residues above maximum residue limits. Risk assessment for long-term exposure was done for all pesticides detected in this study. Except chlorpyrifos and lambda-cyhalothrin, exposure to pesticides from vegetables and fruits was below 1% of the acceptable daily intake. Short-term exposure assessment revealed that in seven pesticide/commodity combinations, including three pesticides (chlorpyrifos, deltamethrin and lambda-cyhalothrin), the acute reference dose had been exceeded.

Development of high-performance chemical isotope labeling LC-MS for profiling the human fecal metabolome.

PubMed

Xu, Wei; Chen, Deying; Wang, Nan; Zhang, Ting; Zhou, Ruokun; Huan, Tao; Lu, Yingfeng; Su, Xiaoling; Xie, Qing; Li, Liang; Li, Lanjuan

2015-01-20

Human fecal samples contain endogenous human metabolites, gut microbiota metabolites, and other compounds. Profiling the fecal metabolome can produce metabolic information that may be used not only for disease biomarker discovery, but also for providing an insight about the relationship of the gut microbiome and human health. In this work, we report a chemical isotope labeling liquid chromatography-mass spectrometry (LC-MS) method for comprehensive and quantitative analysis of the amine- and phenol-containing metabolites in fecal samples. Differential (13)C2/(12)C2-dansyl labeling of the amines and phenols was used to improve LC separation efficiency and MS detection sensitivity. Water, methanol, and acetonitrile were examined as an extraction solvent, and a sequential water-acetonitrile extraction method was found to be optimal. A step-gradient LC-UV setup and a fast LC-MS method were evaluated for measuring the total concentration of dansyl labeled metabolites that could be used for normalizing the sample amounts of individual samples for quantitative metabolomics. Knowing the total concentration was also useful for optimizing the sample injection amount into LC-MS to maximize the number of metabolites detectable while avoiding sample overloading. For the first time, dansylation isotope labeling LC-MS was performed in a simple time-of-flight mass spectrometer, instead of high-end equipment, demonstrating the feasibility of using a low-cost instrument for chemical isotope labeling metabolomics. The developed method was applied for profiling the amine/phenol submetabolome of fecal samples collected from three families. An average of 1785 peak pairs or putative metabolites were found from a 30 min LC-MS run. From 243 LC-MS runs of all the fecal samples, a total of 6200 peak pairs were detected. Among them, 67 could be positively identified based on the mass and retention time match to a dansyl standard library, while 581 and 3197 peak pairs could be putatively identified based on mass match using MyCompoundID against a Human Metabolome Database and an Evidence-based Metabolome Library, respectively. This represents the most comprehensive profile of the amine/phenol submetabolome ever detected in human fecal samples. The quantitative metabolome profiles of individual samples were shown to be useful to separate different groups of samples, illustrating the possibility of using this method for fecal metabolomics studies.

Fabrication and characterization of semicircular detection electrodes for contactless conductivity detector - CE microchips.

PubMed

Lee, Chia-Yen; Chen, C M; Chang, Guan-Liang; Lin, Che-Hsin; Fu, Lung-Ming

2006-12-01

This study uses simple and reliable microfabrication techniques to fabricate CE biochips, integrating a novel contactless conductivity detector in a miniaturized detection system in a microfluidic biochip. The off-channel electrodes are deposited around side channels by Au sputtering and patterned using a standard "lift-off" process. A vacuum fusion bonding process is employed to seal the lower substrate containing the microchannels and the electrodes to an upper glass cover plate. The variations in the capacitance between the semicircular detection electrodes in the side channels are measured as different samples and ions pass through the detection region of the CE separation channel. Samples of Rhodamine B, commercial sports drinks, mineral waters, and a red wine, respectively, are mixed in different buffer solutions, separated, and successfully detected using the developed device. The semicircular detection electrodes for the contactless conductivity detector have microscale dimensions and provide a valuable contribution to the realization of the lab-on-a-chip concept.

Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

PubMed

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

Factors Affecting the Occurrence and Distribution of Pesticides in the Yakima River Basin, Washington, 2000

USGS Publications Warehouse

Johnson, Henry M.

2007-01-01

The Yakima River Basin is a major center of agricultural production. With a cultivated area of about 450,000 ha (hectares), the region is an important producer of tree fruit, grapes, hops, and dairy products as well as a variety of smaller production crops. To control pest insects, weeds, and fungal infections, about 146 pesticide active ingredients were applied in various formulations during the 2000 growing season. Forty-six streams or drains in the Yakima River Basin were sampled for pesticides in July and October of 2000. Water samples also were collected from 11 irrigation canals in July. The samples were analyzed for 75 of the pesticide active ingredients applied during the 2000 growing season - 63 percent of the pesticides were detected. An additional 14 pesticide degradates were detected, including widespread occurrence of 2 degradates of DDT. The most frequently detected herbicide was 2,4-D, which was used on a variety of crops and along rights-of-way. It was detected in 82 percent of the samples collected in July. The most frequently detected insecticide was azinphos-methyl, which was used primarily on tree fruit. It was detected in 37 percent of the samples collected in July. All occurrences of azinphos-methyl exceeded the Environmental Protection Agency recommended chronic concentration for the protection of aquatic organisms. More than 90 percent of the July samples and 79 percent of the October samples contained two or more pesticides, with a median of nine in July and five in October. The most frequently occurring herbicides in mixtures were atrazine, 2,4-D, and the degradate deethylatrazine. The most frequently occurring insecticides in mixtures were azinphos-methyl, carbaryl, and p,p'-DDE (a degradate of DDT). A greater number of pesticides and higher concentrations were found in July than in October, reflecting greater usage and water availability for transport during the summer growing and irrigation season. Most of the samples collected in October (baseflow conditions) contained at least one pesticide. The mass ratio of instream pesticide load and application (pesticide loss) was used to explore spatial and temporal patterns of pesticide occurrence. Losses of pesticides with large organic carbon-water partitioning coefficients (Koc) values, which adhere strongly to sediment and plant surfaces, were smallest in catchments where sprinkler and drip irrigation systems were widely used. In contrast, losses of pesticides with low Koc values did not relate well with irrigation method.

Analysis of Supercritical-Extracted Chelated Metal Ions From Mixed Organic-Inorganic Samples

NASA Technical Reports Server (NTRS)

Sinha, Mahadeva P. (Inventor)

1996-01-01

Organic and inorganic contaminants of an environmental sample are analyzed by the same GC-MS instrument by adding an oxidizing agent to the sample to oxidize metal or metal compounds to form metal ions. The metal ions are converted to chelate complexes and the chelate complexes are extracted into a supercritical fluid such as CO2. The metal chelate extract after flowing through a restrictor tube is directly injected into the ionization chamber of a mass spectrometer, preferably containing a refractory metal filament such as rhenium to fragment the complex to release metal ions which are detected. This provides a fast, economical method for the analysis of metal contaminants in a sample and can be automated. An organic extract of the sample in conventional or supercritical fluid solvents can be detected in the same mass spectrometer, preferably after separation in a supercritical fluid chromatograph.

Listeria spp. in Street-Vended Ready-to-Eat Foods

PubMed Central

El-Shenawy, Moustafa; El-Shenawy, Mohamed; Mañes, Jordi; Soriano, Jose M.

2011-01-01

Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin). Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food. PMID:22194742

Application of nonlinear ultrasonics to inspection of stainless steel for dry storage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ulrich, Timothy James II; Anderson, Brain E.; Remillieux, Marcel C.

This report summarized technical work conducted by LANL staff an international collaborators in support of the UFD Storage Experimentation effort. The focus of the current technical work is on the detection and imaging of a failure mechanism known as stress corrosion cracking (SCC) in stainless steel using the nonlinear ultrasonic technique known as TREND. One of the difficulties faced in previous work is in finding samples that contain realistically sized SCC. This year such samples were obtained from EPRI. Reported here are measurements made on these samples. One of the key findings is the ability to detect subsurface changes tomore » the direction in which a crack is penetrating into the sample. This result follows from last year's report that demonstrated the ability of TREND techniques to image features below the sample surface. A new collaboration was established with AGH University of Science and Technology, Krakow, Poland.« less

Pesticide concentrations in wetlands on the Lake Traverse Indian Reservation, South and North Dakota, July 2015

USGS Publications Warehouse

Carter, Janet M.; Thompson, Ryan F.

2016-05-04

During July 2015, water samples were collected from 18 wetlands on the Lake Traverse Indian Reservation in northeastern South Dakota and southeastern North Dakota and analyzed for physical properties and 54 pesticides. This study by the U.S. Geological Survey in cooperation with the Sisseton-Wahpeton Oyate was designed to provide an update on pesticide concentrations of the same 18 wetlands that were sampled for a reconnaissance-level assessment during July 2006. The purpose of this report is to present the results of the assessment of pesticide concentrations in selected Lake Traverse Indian Reservation wetlands during July 2015 and provide a comparison of pesticide concentrations between 2006 and 2015.Of the 54 pesticides that were analyzed for in the samples collected during July 2015, 47 pesticides were not detected in any samples. Seven pesticides—2-chloro-4-isopropylamino-6-amino-s-triazine (CIAT); 2,4–D; acetachlor; atrazine; glyphosate; metolachlor; and prometon—were detected in the 2015 samples with estimated concentrations or concentrations greater than the laboratory reporting level, and most pesticides were detected at low concentrations in only a few samples. Samples from all wetlands contained at least one detected pesticide. The maximum number of pesticides detected in a wetland sample was six, and the median number of pesticides detected was three.The most commonly detected pesticides in the 2015 samples were atrazine and the atrazine degradate CIAT (also known as deethylatrazine), which were detected in 14 and 13 of the wetlands sampled, respectively. Glyphosate was detected in samples from 11 wetlands, and metolachlor was detected in samples from 10 wetlands. The other detected pesticides were 2,4–D (4 wetlands), acetochlor (3 wetlands), and prometon (1 wetland).The same pesticides that were detected in the 2006 samples were detected in the 2015 samples, with the exception of simazine, which was detected only in one sample in 2006. Atrazine and CIAT were the most commonly detected pesticides in both sampling years; however, atrazine and CIAT were detected in fewer wetlands in 2015 (14 and 13 wetlands, respectively) than in 2006 (17 wetlands for both pesticides). The pesticides 2,4–D and prometon also were detected in fewer wetlands in 2015 than 2006, and simazine was only detected in 2006. In contrast, acetochlor, glyphosate, and metolachlor were detected in samples from more wetlands in 2015 than in 2006. In samples from individual wetlands, the number of pesticides detected was similar between 2006 and 2015. At least one pesticide was detected in all wetlands in 2015, and all but one wetland had pesticide detections in 2006.Concentrations of pesticides detected in samples from wetlands were compared to selected water-quality (human-health and aquatic-life) benchmarks. None of the concentrations in either 2006 or 2015 were greater than water-quality benchmarks, with the exception of atrazine. All detections of atrazine in the 2006 and 2015 samples were greater than the acute benchmark of 0.001 microgram per liter (μg/L) for vascular plants. In addition, some concentrations of 2,4–D and atrazine were within an order of magnitude of a water-quality benchmark. The 2,4–D concentrations in the 2015 samples from three wetlands were within an order of magnitude of the U.S. Environmental Protection Agency’s Maximum Contaminant Level of 70 μg/L (that is, sample concentrations were greater than 7.0 μg/L). The maximum dissolved atrazine concentration of 0.185 μg/L in the 2015 samples along with the concentrations in 2006 samples from two wetlands were within an order of magnitude of the acute benchmark of less than 1 μg/L for nonvascular plants (that is, concentrations were greater than 0.1 μg/L).

Use of DNA sequencing to detect pathogenic, saprotrophic, and stain fungi in sapwood of declining red pine (Pinus resinosa) in the Upper Midwest

Treesearch

M.T. Banik; D.L. Lindner; J. Juzwik; J.A. Glaeser

2013-01-01

An inexpensive kit was developed to collect wood samples for molecular detection of pathogenic, saprotrophic and stain fungi in declining Pinus resinosa in the Upper Midwest. The kit contained materials for "clean" collection of sapwood drill shavings, which were then subjected to PCR of the rDNA ITS region with fungal-specific primers,...

Direct detection of methicillin resistance in Staphylococcus aureus in blood culture broth by use of a penicillin binding protein 2a latex agglutination test.

PubMed

Qian, Qinfang; Venkataraman, Lata; Kirby, James E; Gold, Howard S; Yamazumi, Toshiaki

2010-04-01

We studied the utility of performing a penicillin binding protein 2a latex agglutination (PBP-LA) assay directly on Bactec blood culture broth samples containing Staphylococcus aureus to rapidly detect methicillin resistance. The sensitivity, specificity, positive predictive value, and negative predictive value of this method were 94.1%, 97.5%, 98%, and 92.9%, respectively.

Development and Initial Results of a Low Cost, Disposable, Point-of-Care Testing Device for Pathogen Detection

PubMed Central

Dugan, Lawrence C.; Baker, Brian R.; Hall, Sara B.; Ebert, Katja; Mioulet, Valerie; Madi, Mikidache; King, Donald P.

2011-01-01

Development of small footprint, disposable, fast, and inexpensive devices for pathogen detection in the field and clinic would benefit human and veterinary medicine by allowing evidence-based responses to future out breaks. We designed and tested an integrated nucleic acid extraction and amplification device employing a loop-mediated isothermal amplification (LAMP) or reverse transcriptase-LAMP assay. Our system provides a screening tool with polymerase-chain-reaction-level sensitivity and specificity for outbreak detection, response, and recovery. Time to result is ~90 min. The device utilizes a swab that collects sample and then transfers it to a disc of cellulose-based nucleic acid binding paper. The disc is positioned within a disposable containment tube with a manual loading port. In order to test for the presence of target pathogens, LAMP reagents are loaded through the tube’s port into contact with the sample containing cellulose disc. The reagents then are isothermally heated to 63°C for ~1 h to achieve sequence-specific target nucleic acid amplification. Due to the presence of a colorimetric dye, amplification induces visible color change in the reagents from purple to blue. As initial demonstrations, we detected methicillin resistant Staphylococcus aureus genomic DNA, as well as recombinant and live foot-and-mouth disease virus. PMID:21342806

Isocyanate Exposure Below Analytical Detection When a Paint Brush and Roller Are Used to Apply Moisture-Cure Polyurethane Paint.

PubMed

Reeb-Whitaker, Carolyn K; Schoonover, Todd M

2016-05-01

Isocyanate exposure is known to be hazardous when polyurethane paints are applied with a spray gun, but less is known of exposure when paint is applied with a paint brush and roller. Concentrations of 1,6-hexamethylene diisocyanate (HDI) monomer and three HDI polymers were assessed when two moisture-cure polyurethane paints containing 31-35% isocyanates were applied with a paint roller and brush. Short-term 15-min samples were taken during paint application in an indoor test environment with no ventilation (n= 12); in an outdoor test environment (n= 11); and in an outdoor in-situ assessment (n= 22). The outdoor in-situ assessment involved the painting of a bus shelter and light poles at a public transit station over two night shifts. All isocyanate samples were below analytical detection. The analytical limits of detection for HDI monomer, HDI biuret, HDI isocyanurate, and HDI uretdione were 0.005, 0.84, 0.87, and 0.88 µg, respectively. The finding that isocyanate concentrations were below detection is attributed to the use of paint roller and brush which minimize paint aerosolization and the paint formulation itself which contained <1% of volatile HDI monomer. © The Author 2016. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.

Removal of SO2 from O2-containing flue gas by activated carbon fiber (ACF) impregnated with NH3.

PubMed

Xu, Lüsi; Guo, Jia; Jin, Feng; Zeng, Hancai

2006-02-01

Adsorption of SO(2) from the O(2)-containing flue gas by granular activated carbons (GACs) and activated carbon fibers (ACFs) impregnated with NH(3) was studied in this technical note. Experimental results showed that the ACFs were high-quality adsorbents due to their unique textural properties. In the presence of moisture, the desulphurization efficiency for the ACFs was improved significantly due to the formation of sulfuric acid. After NH(3) impregnation of ACF samples, nitrogen-containing functional groups (pyridyl C(5)H(4)N- and pyrrolyl C(4)H(4)N-) were detected on the sample surface by using an X-ray photoelectron spectrometer. These functional groups accounted for the enhanced SO(2) adsorption via chemisorption and/or catalytic oxidization.

A survey of the bacteriological quality of preroasted peanut, almond, cashew, hazelnut, and brazil nut kernels received into three Australian nut-processing facilities over a period of 3 years.

PubMed

Eglezos, Sofroni; Huang, Bixing; Stuttard, Ed

2008-02-01

There is little information about bacteriological quality of preroasted kernels available in the public domain. An investigation of the bacteriological quality of preroasted peanut, almond, cashew, hazelnut, and Brazil nut kernels received into three Australian nut-processing facilities was performed over a period of 3 years. A total of 836 samples were analyzed for aerobic plate count, and 921 samples for Salmonella and Escherichia coli. The 921 samples included 653 peanut, 100 cashew, 60 almond, 60 Brazil nut, and 48 hazelnut kernels. There was no E. coli detected in any sample. Salmonella subsp. II (Fremantle) was detected in one raw almond sample. The aerobic plate count percentages of positive samples with counts above the detection level of the plating method used (100 CFU/g) for peanuts, almonds, cashews, hazelnuts, and Brazil nuts were 84, 78, 74, 50, and 45%, respectively. Of the samples containing more than this detection limit, the means were 4.5, 4.4, 3.1, 2.5, and 3.8 log CFU/g respectively. Although roasted kernel quality was not within the scope of this survey, raw microbial bioload would be expected to reduce on roasting. The bacteriological quality of preroasted peanut, almond, cashew, hazelnut, and Brazil nut kernels received into nut-processing facilities in Australia does not appear to suggest a public health concern.

ON THE STAR FORMATION PROPERTIES OF VOID GALAXIES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moorman, Crystal M.; Moreno, Jackeline; White, Amanda

2016-11-10

We measure the star formation properties of two large samples of galaxies from the SDSS in large-scale cosmic voids on timescales of 10 and 100 Myr, using H α emission line strengths and GALEX FUV fluxes, respectively. The first sample consists of 109,818 optically selected galaxies. We find that void galaxies in this sample have higher specific star formation rates (SSFRs; star formation rates per unit stellar mass) than similar stellar mass galaxies in denser regions. The second sample is a subset of the optically selected sample containing 8070 galaxies with reliable H i detections from ALFALFA. For the fullmore » H i detected sample, SSFRs do not vary systematically with large-scale environment. However, investigating only the H i detected dwarf galaxies reveals a trend toward higher SSFRs in voids. Furthermore, we estimate the star formation rate per unit H i mass (known as the star formation efficiency; SFE) of a galaxy, as a function of environment. For the overall H i detected population, we notice no environmental dependence. Limiting the sample to dwarf galaxies still does not reveal a statistically significant difference between SFEs in voids versus walls. These results suggest that void environments, on average, provide a nurturing environment for dwarf galaxy evolution allowing for higher specific star formation rates while forming stars with similar efficiencies to those in walls.« less

Occurrence of Pre- and Post-Harvest Mycotoxins and Other Secondary Metabolites in Danish Maize Silage

PubMed Central

Storm, Ida M. L. Drejer; Rasmussen, Rie Romme; Rasmussen, Peter Have

2014-01-01

Maize silage is a widely used feed product for cattle worldwide, which may be contaminated with mycotoxins, pre- and post-harvest. This concerns both farmers and consumers. To assess the exposure of Danish cattle to mycotoxins from maize silage, 99 samples of whole-crop maize (ensiled and un-ensiled) were analyzed for their contents of 27 mycotoxins and other secondary fungal metabolites by liquid chromatography-tandem mass spectrometry. The method specifically targets the majority of common pre- and post-harvest fungi associated with maize silage in Denmark. Sixty-one samples contained one or more of the 27 analytes in detectable concentrations. The most common mycotoxins were zearalenone, enniatin B nivalenol and andrastin A, found in 34%, 28%, 16% and 15% of the samples, respectively. None of the samples contained mycotoxins above the EU recommended maximum concentrations for Fusarium toxins in cereal-based roughage. Thus, the present study does not indicate that Danish maize silage in general is a cause of acute single mycotoxin intoxications in cattle. However, 31 of the samples contained multiple analytes; two samples as much as seven different fungal metabolites. Feed rations with maize silage may therefore contain complex mixtures of fungal secondary metabolites with unknown biological activity. This emphasizes the need for a thorough examination of the effects of chronic exposure and possible synergistic effects. PMID:25089350

Polonium-210 analyses of vegetables, cured and uncured tobacco, and associated soils.

PubMed

Berger, K C; Erhardt, W H; Francis, C W

1965-12-24

Analysis of the edible portion of vegetables and samples of green leaf tobacco failed to show polonium-210. The cured samples of leaf tobacco and the soils that were analyzed all contained small quantities of the element. Muck soils contained three times as much Po(210) as did mineral soils. Solutions used commonly to extract "available" forms of many mineral elements failed to extract a detectable amount of Po(2l0). Indications are that Po(210) or its radioactive precursors are not taken up from the soil directly by plant roots but rather by sorption in dead, moist plant materials at the atmosphere-plant interface.

Organophosphorus pesticide residues in vegetables from farms, markets, and a supermarket around Kwan Phayao Lake of Northern Thailand.

PubMed

Sapbamrer, Ratana; Hongsibsong, Surat

2014-07-01

This study investigated organophosphorus (OP) residues in vegetables from 27 farms, 106 markets, and 1 supermarket around Kwan Phayao Lake, Northern Thailand, between August and September 2013. Types of vegetables sampled were all vegetables cultivated or sold around the study site. The most common OP pesticides detected in farm samples were chlorpyrifos (50 %), malathion (31.8 %), monocrotophos (31.8 %), diazinon (13.6 %), omethoate (13.6 %), and dicrotophos (9.1 %). The most common OP pesticides detected in market samples were chlorpyrifos (33.9 %), diazinon (18.6 %), parathion-methyl (3.4 %), profenofos (3.4 %), primiphos-ethyl (3.4 %), and fenitrothion (1.7 %). The OP pesticides detected in supermarket samples were chlorpyrifos (33.3 %), and diazinon (66.7 %). Among the compounds detected, chlorpyrifos was detected in most of the vegetable samples from all sources. The highest chlorpyrifos level in farm samples were found in lemon balm (2.423 mg/kg) followed by Vietnamese coriander (0.835 mg/kg), and cowpea (0.027 mg/kg). The highest level in markets samples were found in garlic (7.785 mg/kg) followed by Chinese cabbage (2.864 mg/kg) and Vietnamese coriander (1.308 mg/kg). Residues from supermarket samples were found only in parsley (0.027 mg/kg). The findings showed that 16 samples (59.3 %) from farms and 14 samples (13.2 %) from markets contained OP residues at or above the maximum residue limits established by the European Union. It is concluded that awareness, safety education, and strict regulation of pesticide use are necessary.

[Concentration of biocides in indoor rooms using pyrethroids as an example].

PubMed

Walker, G; Keller, R; Beckert, J; Butte, W

1994-06-01

Pyrethroids are an analogous substance group to one of the oldest known, naturally occurring insecticides pyrethrum and have replaced a number of pesticides such as Lindane, DDT and PCP on the market. Biocides are more persistent indoors than in nature, which could lead to permanent health hazards for the people concerned. Within a few days after application pyrethroids are rarely detected in room air but can be traced for a long time on textiles, furniture and in dust particles (3, 8). The investigation results of approx. 100 analyses from dust and carpet samples show that approx. 1/3 of these samples are positive for at least one pyrethroid and contain a concentration of > 2 mg substance per kg sample. The evaluation of 35 air samples taken from rooms where substances containing pyrethroids had been used at least a month prior to the investigation (the samples were sampled on active charcoal or Chromosorb) showed that pyrethroids could no longer be traced above the detection limit of 0.05-0.1 micrograms/m3. We therefore think that when investigating a contamination of rooms by biocides it is more advisable to determine pyrethroid and its synergists in the suspended dust portion and corresponding dust sample rather than analysing air by adsorption to active charcoal, Chromosorb or other carrier materials. From the observed concentrations of biocides one could conclude that in an indoor setting secondary contamination by biocides plays a more significant role in the total-body-load than that of air contamination.

An Easy Method to Eliminate the Effect of Lupus Anticoagulants in the Coagulation Factor Assay.

PubMed

Tang, Ning; Yin, Shiyu

2016-07-01

To build and evaluate intrinsic coagulation factor assays which can eliminate the effect of lupus anticoagulants (LAC). Commercial silica clotting time confirmatory (SCT-C) reagent containing sufficient synthetic phospholipid and routine activated partial thromboplastin time (APTT) reagent were each used for one-stage detection of FVIII, FIX, and FXI activities, in samples with or without LAC, and the results were compared. For samples without LAC, consistent results of FVIII, FIX, and FXI using both SCT-C reagent and APTT reagent were obtained. For samples with LAC, the assays with SCT-C reagent not only could eliminate the effect of strong lupus anticoagulants but also needed fewer dilutions than that with routine APTT reagent. The intrinsic factor detections by SCT-C reagent are credible and convenient to be used for samples with LAC.

Sorbate and benzoate in Turkish retail foodstuffs.

PubMed

Ulca, Pelin; Atamer, Beril; Keskin, Mehtap; Senyuva, Hamide Z

2013-01-01

From 2008 to 2011, surveys were conducted to determine the levels of benzoic and sorbic acids and their respective salts in 983 retail food samples which included sauces, vegetable and fruit preparations, flavoured syrups, food supplements, cereals, bakery products, jelly, synthetic cream, sprays, mustards, jam and preserves, molasses, chewing gum, confectionery, non-alcoholic beverages, tea, wine, vinegar, brine and beers. The analysis involved methanol extraction of the foodstuff and direct determination by HPLC with UV detection. Quality assurance was employed with each batch of samples. Accuracy was ensured through regular participation in proficiency tests. Over this four-year period, a total of 23 samples (2.3%), some syrups, tomato sauces and fruit contained individual or combined levels of sorbic and benzoic acids above regulatory limits. Unauthorised use of benzoic acid was also detected in a syrup sample, bakery products and fruit preserves.

Pesticides in the nation's rivers, 1975-1980, and implications for future monitoring

USGS Publications Warehouse

Gilliom, Robert J.; Alexander, Richard B.; Smith, Richard A.

1985-01-01

Water samples were taken four times per year and bed-sediment samples two times per year during 1975-80 at 160 to 180 stations on major rivers of the United States. Samples were analyzed for 18 insecticides and 4 herbicides, which together accounted for about one-third of the total amount of all pesticides applied to major crops during 1975-80. Fewer than 10 percent of almost 3,000 water samples and fewer than 20 percent of almost 1,000 bed-sediment samples contained reportable concentrations of any of the compounds. The patterns of detection result from a combination of widely variable detection capabilities, chemical properties, and use. Most detections in water samples were of relatively persistent yet soluble compounds: atrazine (4.8 percent of samples), diazinon (1.2), and lindane (1.1). Most detections in bed-sediment samples were of the hydrophobic and persistent insecticides: DDE (17 percent of samples), DDD (12), dieldrin (12), chlordane (9.9), and DDT (8.5). Only for atrazine in water, and for DDE, DDD, DDT, and chlordane in bed sediments, were geographic patterns of detection correlated (pH<0.10) with use on farms. Detections of organochlorine insecticides in both water and bed sediments appear to have erratically but gradually decreased during 1975-80. For the 1975-79 period, more stations had downtrends than had uptrends in bed-sediment levels of organochlorines. No clear trends were evident in concentrations of organophosphate insecticides or herbicides in either water or bed sediments. Findings suggest that future pesticide monitoring efforts must be responsive to changes in pesticides used and to geographic patterns of use. Different types of monitoring approaches are necesssary for chemicals having different chemical and physical properties. Before an effective dynamic monitoring effort can be designed, however, selected case studies are needed to characterize and refine sampling and analytical capabilities for different types of chemicals, river environments, and sample types.

Dissolved pesticide concentrations entering the Sacramento-San Joaquin Delta from the Sacramento and San Joaquin Rivers, California, 2012-13

USGS Publications Warehouse

Orlando, James L.; McWayne, Megan; Sanders, Corey; Hladik, Michelle

2014-01-01

Surface-water samples were collected from the Sacramento and San Joaquin Rivers where they enter the Sacramento–San Joaquin Delta, and analyzed by the U.S. Geological Survey for a suite of 99 current-use pesticides and pesticide degradates. Samples were collected twice per month from May 2012 through July 2013 and from May 2012 through April 2013 at the Sacramento River at Freeport, and the San Joaquin River near Vernalis, respectively. Samples were analyzed by two separate laboratory methods by using gas chromatography with mass spectrometry or liquid chromatography with tandem mass spectrometry. Method detection limits ranged from 0.9 to 10.5 nanograms per liter (ng/L). A total of 37 pesticides and degradates were detected in water samples collected during the study (18 herbicides, 11 fungicides, 7 insecticides, and 1 synergist). The most frequently detected pesticides overall were the herbicide hexazinone (detected in 100 percent of the samples); 3,4-dichloroaniline (97 percent), which is a degradate of the herbicides diuron and propanil; the fungicide azoxystrobin (83 percent); and the herbicides diuron (72 percent), simazine (66 percent), and metolachlor (64 percent). Insecticides were rarely detected during the study. Pesticide concentrations varied from below the method detection limits to 984 ng/L (hexazinone). Twenty seven pesticides and (or) degradates were detected in Sacramento River samples, and the average number of pesticides per sample was six. The most frequently detected compounds in these samples were hexazinone (detected in 100 percent of samples), 3,4-dichloroaniline (97 percent), azoxystrobin (88 percent), diuron (56 percent), and simazine (50 percent). Pesticides with the highest detected maximum concentrations in Sacramento River samples included the herbicide clomazone (670 ng/L), azoxystrobin (368 ng/L), 3,4-dichloroaniline (364 ng/L), hexazinone (130 ng/L), and propanil (110 ng/L), and all but hexazinone are primarily associated with rice agriculture. In addition to the twice monthly sampling, surface-water samples were collected from the Sacramento River on 5 consecutive days following a rainfall event in the Sacramento urban area. Samples collected following this event contained an average of 11 pesticides. The insecticides carbaryl, fipronil, and imidacloprid; the herbicide DCPA; and the fungicide imazalil were only detected in the Sacramento River during this storm-runoff event, and two detections of fipronil during this period exceeded the U.S. Environmental Protection Agency Aquatic Life Benchmark (11 ng/L) for chronic toxicity to invertebrates in freshwater. In San Joaquin River samples, 26 pesticides and (or) degradates were detected, and the average number detected per sample was 9. The most frequently detected compounds in these samples were hexazinone and metolachlor (detected in 100 percent of samples); diuron (96 percent); the fungicide boscalid (96 percent); the degradates 3,4-dicloroaniline (92 percent) and NN-(3,4-Dichlorophenyl)-N’-methylurea (DCPMU; 83 percent); simazine (83 percent); and azoxystrobin (75 percent). The pesticides with the highest detected maximum concentrations were hexazinone (984 ng/L), diuron (695 ng/L), simazine (524 ng/L), the herbicide prometryn (155 ng/L), metolachlor (127 ng/L), boscalid (112 ng/L), DCPMU (111 ng/L), and the herbicide pendimethalin (108 ng/L).

Near-Patient Sampling to Assist Infection Control—A Case Report and Discussion

PubMed Central

Tang, Julian W.; Hoyle, Elizabeth; Moran, Sammy; Pareek, Manish

2018-01-01

Air sampling as an aid to infection control is still in an experimental stage, as there is no consensus about which air samplers and pathogen detection methods should be used, and what thresholds of specific pathogens in specific exposed populations (staff, patients, or visitors) constitutes a true clinical risk. This case report used a button sampler, worn or held by staff or left free-standing in a fixed location, for environmental sampling around a child who was chronically infected by a respiratory adenovirus, to determine whether there was any risk of secondary adenovirus infection to the staff managing the patient. Despite multiple air samples taken on difference days, coinciding with high levels of adenovirus detectable in the child’s nasopharyngeal aspirates (NPAs), none of the air samples contained any detectable adenovirus DNA using a clinically validated diagnostic polymerase chain reaction (PCR) assay. Although highly sensitive, in-house PCR assays have been developed to detect airborne pathogen RNA/DNA, it is still unclear what level of specific pathogen RNA/DNA constitutes a true clinical risk. In this case, the absence of detectable airborne adenovirus DNA using a conventional diagnostic assay removed the requirement for staff to wear surgical masks and face visors when they entered the child’s room. No subsequent staff infections or outbreaks of adenovirus have so far been identified. PMID:29385031

Micromechanical calorimetric sensor

DOEpatents

Thundat, Thomas G.; Doktycz, Mitchel J.

2000-01-01

A calorimeter sensor apparatus is developed utilizing microcantilevered spring elements for detecting thermal changes within a sample containing biomolecules which undergo chemical and biochemical reactions. The spring element includes a bimaterial layer of chemicals on a coated region on at least one surface of the microcantilever. The chemicals generate a differential thermal stress across the surface upon reaction of the chemicals with an analyte or biomolecules within the sample due to the heat of chemical reactions in the sample placed on the coated region. The thermal stress across the spring element surface creates mechanical bending of the microcantilever. The spring element has a low thermal mass to allow detection and measuring of heat transfers associated with chemical and biochemical reactions within a sample placed on or near the coated region. A second surface may have a different material, or the second surface and body of microcantilever may be of an inert composition. The differential thermal stress between the surfaces of the microcantilever create bending of the cantilever. Deflections of the cantilever are detected by a variety of detection techniques. The microcantilever may be approximately 1 to 200 .mu.m long, approximately 1 to 50 .mu.m wide, and approximately 0.3 to 3.0 .mu.m thick. A sensitivity for detection of deflections is in the range of 0.01 nanometers. The microcantilever is extremely sensitive to thermal changes in samples as small as 30 microliters.

Screening of Viral Pathogens from Pediatric Ileal Tissue Samples after Vaccination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hewitson, Laura; Thissen, James B.; Gardner, Shea N.

In 2010, researchers reported that the two US-licensed rotavirus vaccines contained DNA or DNA fragments from porcine circovirus (PCV). Although PCV, a common virus among pigs, is not thought to cause illness in humans, these findings raised several safety concerns. In this study, we sought to determine whether viruses, including PCV, could be detected in ileal tissue samples of children vaccinated with one of the two rotavirus vaccines. A broad spectrum, novel DNA detection technology, the Lawrence Livermore Microbial Detection Array (LLMDA), was utilized, and confirmation of viral pathogens using the polymerase chain reaction (PCR) was conducted. The LLMDA technologymore » was recently used to identify PCV from one rotavirus vaccine. Ileal tissue samples were analyzed from 21 subjects, aged 15–62 months. PCV was not detected in any ileal tissue samples by the LLMDA or PCR. LLMDA identified a human rotavirus A from one of the vaccinated subjects, which is likely due to a recent infection from a wild type rotavirus. LLMDA also identified human parechovirus, a common gastroenteritis viral infection, from two subjects. Additionally, LLMDA detected common gastrointestinal bacterial organisms from the Enterobacteriaceae , Bacteroidaceae , and Streptococcaceae families from several subjects. This study provides a survey of viral and bacterial pathogens from pediatric ileal samples, and may shed light on future studies to identify pathogen associations with pediatric vaccinations.« less