Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site.

PubMed

Kassotis, Christopher D; Iwanowicz, Luke R; Akob, Denise M; Cozzarelli, Isabelle M; Mumford, Adam C; Orem, William H; Nagel, Susan C

2016-07-01

Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby. Copyright © 2016 Elsevier B.V. All rights reserved.

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site

USGS Publications Warehouse

Kassotis, Christopher D.; Iwanowicz, Luke R.; Akob, Denise M.; Cozzarelli, Isabelle M.; Mumford, Adam; Orem, William H.; Nagel, Susan C.

2016-01-01

Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby.

Occurrence of pharmaceuticals, hormones, and organic wastewater compounds in Pennsylvania waters, 2006-09

USGS Publications Warehouse

Reif, Andrew G.; Crawford, J. Kent; Loper, Connie A.; Proctor, Arianne; Manning, Rhonda; Titler, Robert

2012-01-01

Concern over the presence of contaminants of emerging concern, such as pharmaceutical compounds, hormones, and organic wastewater compounds (OWCs), in waters of the United States and elsewhere is growing. Laboratory techniques developed within the last decade or new techniques currently under development within the U.S. Geological Survey now allow these compounds to be measured at concentrations in nanograms per liter. These new laboratory techniques were used in a reconnaissance study conducted by the U.S. Geological Survey, in cooperation with the Pennsylvania Department of Environmental Protection, to determine the occurrence of contaminants of emerging concern in streams, streambed sediment, and groundwater of Pennsylvania. Compounds analyzed for in the study are pharmaceuticals (human and veterinary drugs), hormones (natural and synthetic), and OWCs (detergents, fragrances, pesticides, industrial compounds, disinfectants, polycyclic aromatic hydrocarbons, fire retardants and plasticizers). Reconnaissance sampling was conducted from 2006 to 2009 to identify contaminants of emerging concern in (1) groundwater from wells used to supply livestock, (2) streamwater upstream and downstream from animal feeding operations, (3) streamwater upstream from and streamwater and streambed sediment downstream from municipal wastewater effluent discharges, (4) streamwater from sites within 5 miles of drinking-water intakes, and (5) streamwater and streambed sediment where fish health assessments were conducted. Of the 44 pharmaceutical compounds analyzed in groundwater samples collected in 2006 from six wells used to supply livestock, only cotinine (a nicotine metabolite) and the antibiotics tylosin and sulfamethoxazole were detected. The maximum concentration of any contaminant of emerging concern was 24 nanograms per liter (ng/L) for cotinine, and was detected in a groundwater sample from a Lebanon County, Pa., well. Seven pharmaceutical compounds including acetaminophen, caffeine, carbamazepine, and the four antibiotics tylosin, sulfadimethoxine, sulfamethoxazole, and oxytetracycline were detected in streamwater samples collected in 2006 from six paired stream sampling sites located upstream and downstream from animal-feeding operations. The highest reported concentration of these seven compounds was for the antibiotic sulfamethoxazole (157 ng/L), in a sample from the downstream site on Snitz Creek in Lancaster County, Pa. Twenty-one pharmaceutical compounds were detected in streamwater samples collected in 2006 from five paired stream sampling sites located upstream or downstream from a municipal wastewater-effluent-discharge site. The most commonly detected compounds and maximum concentrations were the anticonvulsant carbamazepine, 276 ng/L; the antihistamine diphenhydramine, 135 ng/L; and the antibiotics ofloxacin, 329 ng/L; sulfamethoxazole, 1,340 ng/L; and trimethoprim, 256 ng/L. A total of 51 different contaminants of emerging concern were detected in streamwater samples collected from 2007 through 2009 at 13 stream sampling sites located downstream from a wastewater-effluent-discharge site. The concentrations and numbers of compounds detected were higher in stream sites downstream from a wastewater-effluent-discharge site than in stream sites upstream from a wastewater-effluent-discharge site. This finding indicates that wastewater-effluent discharges are a source of contaminants of emerging concern; these contaminants were present more frequently in the streambed-sediment samples than in streamwater samples. Antibiotic compounds were often present in both the streamwater and streambed-sediment samples, but many OWCs were present exclusively in the streambed-sediment samples. Compounds with endocrine disrupting potential including detergent metabolites, pesticides, and flame retardants, were present in the streamwater and streambed-sediment samples. Killinger Creek, a stream where wastewater-effluent discharges contribute a large percentage of the total flow, stands out as a stream with particularly high numbers of compounds detected and detected at the highest concentrations measured in the reconnaissance sampling. Nineteen contaminants of emerging concern were detected in streamwater samples collected quarterly from 2007 through 2009 at 27 stream sites within 5 miles of a drinking-water intake. The number of contaminants and the concentrations detected at the stream sites within 5 miles of drinking-water intakes were generally very low (concentrations less than 50 ng/L), much lower than those at sites downstream from a wastewater-effluent discharge. The most commonly detected compounds and maximum concentrations were caffeine, 517 ng/L; carbamazepine, 95 ng/L; sulfamethoxazole, 146 ng/L; and estrone, 3.15 ng/L. The concentrations and frequencies of detection of some of the contaminants of emerging concern appear to vary by season, which could be explained by compound use, flow regime, or differences in degradation rates. Concentrations of some contaminants were associated with lower flows as a result of decreased in-stream dilution of wastewater effluents or other contamination sources. Twenty-two contaminants of emerging concern were detected once each in streamwater samples collected in 2007 and 2008 from 16 fish-health stream sites located statewide. The highest concentrations were for the OWCs, including flame retardants tri(2-butoxyethyl)phosphate (604 ng/L) and tri(2-chloroethyl)phosphate (272 ng/L) and the fragrance isoquinoline (330 ng/L). Far fewer numbers of contaminants of emerging concern were detected at the fish-health sites than at the wastewater-effluent-discharge sites. Most of the fish-health sites were not located directly downstream from a wastewater-effluent discharge, but there were multiple wastewater-effluent discharges in the drainage basins upstream from the sampling sites. No distinct pattern of contaminant occurrence could be discerned for the fish-health stream sites

Effects of backpacker use, pack stock trail use, and pack stock grazing on water-quality indicators, including nutrients, E. coli, hormones, and pharmaceuticals, in Yosemite National Park, USA

USGS Publications Warehouse

Forrester, Harrison; Clow, David W.; Roche, James W.; Heyvaert, Alan C.; Battaglin, William A.

2017-01-01

We investigated how visitor-use affects water quality in wilderness in Yosemite National Park. During the summers of 2012–2014, we collected and analyzed surface-water samples for water-quality indicators, including fecal indicator bacteria Escherichia coli, nutrients (nitrogen, phosphorus, carbon), suspended sediment concentration, pharmaceuticals, and hormones. Samples were collected upstream and downstream from different types of visitor use at weekly to biweekly intervals and during summer storms. We conducted a park-wide synoptic sampling campaign during summer 2014, and sampled upstream and downstream from meadows to evaluate the mitigating effect of meadows on water quality. At pack stock stream crossings, Escherichia coli concentrations were greater downstream from crossings than upstream (median downstream increase in Escherichia coli of three colony forming units 100 mL−1), with the greatest increases occurring during storms (median downstream increase in Escherichia coli of 32 CFU 100 mL−1). At backpacker use sites, hormones, and pharmaceuticals (e.g., insect repellent) were detected at downstream sites, and Escherichia coli concentrations were greater at downstream sites (median downstream increase in Escherichia coli of 1 CFU 100 mL−1). Differences in water quality downstream vs. upstream from meadows grazed by pack stock were not detectable for most water-quality indicators, however, Escherichia coli concentrations decreased downstream, suggesting entrapment and die-off of fecal indicator bacteria in meadows. Our results indicate that under current-use levels pack stock trail use and backpacker use are associated with detectable, but relatively minor, effects on water quality, which are most pronounced during storms.

Effects of Backpacker Use, Pack Stock Trail Use, and Pack Stock Grazing on Water-Quality Indicators, Including Nutrients, E. coli, Hormones, and Pharmaceuticals, in Yosemite National Park, USA

NASA Astrophysics Data System (ADS)

Forrester, Harrison; Clow, David; Roche, James; Heyvaert, Alan; Battaglin, William

2017-09-01

We investigated how visitor-use affects water quality in wilderness in Yosemite National Park. During the summers of 2012-2014, we collected and analyzed surface-water samples for water-quality indicators, including fecal indicator bacteria Escherichia coli, nutrients (nitrogen, phosphorus, carbon), suspended sediment concentration, pharmaceuticals, and hormones. Samples were collected upstream and downstream from different types of visitor use at weekly to biweekly intervals and during summer storms. We conducted a park-wide synoptic sampling campaign during summer 2014, and sampled upstream and downstream from meadows to evaluate the mitigating effect of meadows on water quality. At pack stock stream crossings, Escherichia coli concentrations were greater downstream from crossings than upstream (median downstream increase in Escherichia coli of three colony forming units 100 mL-1), with the greatest increases occurring during storms (median downstream increase in Escherichia coli of 32 CFU 100 mL-1). At backpacker use sites, hormones, and pharmaceuticals (e.g., insect repellent) were detected at downstream sites, and Escherichia coli concentrations were greater at downstream sites (median downstream increase in Escherichia coli of 1 CFU 100 mL-1). Differences in water quality downstream vs. upstream from meadows grazed by pack stock were not detectable for most water-quality indicators, however, Escherichia coli concentrations decreased downstream, suggesting entrapment and die-off of fecal indicator bacteria in meadows. Our results indicate that under current-use levels pack stock trail use and backpacker use are associated with detectable, but relatively minor, effects on water quality, which are most pronounced during storms.

Body morphology differs in wild juvenile Chinook salmon Oncorhynchus tshawytscha in the Willamette River, Oregon, USA

USGS Publications Warehouse

Billman, E.J.; Whitman, L.D.; Schroeder, R.K.; Sharpe, C.S.; Noakes, David L. G.; Schreck, Carl B.

2014-01-01

Body morphology of juvenile Chinook salmon Oncorhynchus tshawytscha in the upper Willamette River, Oregon, U.S.A., was analysed to determine if variation in body shape is correlated with migratory life-history tactics followed by juveniles. Body shape was compared between migrating juveniles that expressed different life-history tactics, i.e. autumn migrants and yearling smolts, and among parr sampled at three sites along a longitudinal river gradient. In the upper Willamette River, the expression of life-history tactics is associated with where juveniles rear in the basin with fish rearing in downstream locations generally completing ocean ward migrations earlier in life than fish rearing in upstream locations. The morphological differences that were apparent between autumn migrants and yearling smolts were similar to differences between parr rearing in downstream and upstream reaches, indicating that body morphology is correlated with life-history tactics. Autumn migrants and parr from downstream sampling sites had deeper bodies, shorter heads and deeper caudal peduncles compared with yearling smolts and parr from the upstream sampling site. This study did not distinguish between genetic and environmental effects on morphology; however, the results suggest that downstream movement of juveniles soon after emergence is associated with differentiation in morphology and with the expression of life-history variation.

Assessment of Surface Water Contamination from Coalbed Methane Fracturing-Derived Volatile Contaminants in Sullivan County, Indiana, USA.

PubMed

Meszaros, Nicholas; Subedi, Bikram; Stamets, Tristan; Shifa, Naima

2017-09-01

There is a growing concern over the contamination of surface water and the associated environmental and public health consequences from the recent proliferation of hydraulic fracturing in the USA. Petroleum hydrocarbon-derived contaminants of concern [benzene, toluene, ethylbenzene, and xylenes (BTEX)] and various dissolved cations and anions were spatially determined in surface waters around 15 coalbed methane fracking wells in Sullivan County, IN, USA. At least one BTEX compound was detected in 69% of sampling sites (n = 13) and 23% of sampling sites were found to be contaminated with all of the BTEX compounds. Toluene was the most common BTEX compound detected across all sampling sites, both upstream and downstream from coalbed methane fracking wells. The average concentration of toluene at a reservoir and its outlet nearby the fracking wells was ~2× higher than other downstream sites. However, one of the upstream sites was found to be contaminated with BTEX at similar concentrations as in a reservoir site nearby the fracking well. Calcium (~60 ppm) and sulfates (~175 ppm) were the dominant cations and anions, respectively, in surface water around the fracking sites. This study represents the first report of BTEX contamination in surface water from coalbed methane hydraulic fracturing wells.

Water Quality, Fish Tissue, and Bed Sediment Monitoring in Waterbodies of Fort Chaffee Maneuver Training Center, Arkansas, 2002-2004

USGS Publications Warehouse

Justus, B.G.; Stanton, Gregory P.

2005-01-01

The Fort Chaffee Maneuver Training Center is a facility used to train as many as 50,000 Arkansas National Guardsmen each year. Due to the nature of ongoing training and also to a poor understanding of environmental procedures that were practiced in the World War II era, areas within Fort Chaffee have the potential to be sources of a large number of contaminants. Because some streams flow on to Fort Chaffee, there is also the potential for sources that are off post to affect environmental conditions on post. This study evaluates constituent concentrations in water, fish tissue, and bed sediment collected from waterbodies on Fort Chaffee between September 2002 and July 2004. Constituent concentrations detected in the three media and measured at nine stream sites and four lake sites were compared to national and regional criteria when available. Two of the larger streams, Big and Vache Grasse Creeks, were sampled at multiple sites. All three sampled media were analyzed for insecticides, PCBs, explosives, and trace elements. Additionally, water samples were analyzed for nutrients and herbicides. The different constituents detected in the three sample media (water, fish tissue, and bed sediment) indicate that land-use activities both on and off post are influencing environmental conditions. Contaminants such as explosives that were sometimes detected in water samples have an obvious relation to military training; however, the occurrence and locations of some nutrients, insecticides, and trace elements suggest that land use both on and off post also could be influencing environmental conditions to some degree. Constituent concentrations at sites on Vache Grasse Creek, and particularly the most upstream site, which was located immediately downstream from an off-post wastewater-treatment facility, indicate that environmental conditions were being influenced by an off-post source. The most upstream site on Vache Grasse Creek had both the highest number of detections and the highest concentrations detected of all sites sampled. Event-mean storm concentrations and storm loads calculated from storm-flow samples at two sites each for Big and Vache Grasse Creeks indicate that storm loads were highest at the two Vache Grasse Creek sites for 24 of the 25 constituents detected. Further evaluation by normalizing storm loads at Big Creek to storm loads at Vache Grasse Creek by stream flow indicate that event loads at Vache Grasse Creek were about two or more times higher than those on Big Creek for 15 of the 25 constituents measured. Low concentrations of arsenic and lead were detected in water samples, but all detections for the two trace elements occurred in samples collected at the upstream site on Vache Grasse Creek. The nickel concentration in fish livers collected from the upstream site on Vache Grasse Creek was 45 percent higher than the median of a national study of 145 sites. Mercury concentrations in edible fish tissue, which are a widespread concern in the United States, exceeded an USEPA criterion for methylmercury of 300 ?g/kg in four of nine samples; however, concentrations are typical of mercury concentrations in fish tissues for the State of Arkansas. Constituent concentrations at some sites indicate that environmental conditions are being influenced by on-post activities. Of the 55 (excluding total organic carbon) organic constituents analyzed in water samples, only 10 were detected above the minimum detection limit but four of those were explosives. Bed-sediment samples from one site located on Grayson Creek, and nearest the administrative and residential (cantonment) area, had detections for arsenic, copper, lead, manganese, nickel, and zinc that were above background concentrations, and concentrations for arsenic and nickel at this site exceeded lowest effect level criteria established by the U.S. Environmental Protection Agency. The site on Grayson Creek also had the only detections of DDT metabolites in bed sedi

Characterization of organic composition in snow and surface waters in the Athabasca Oil Sands Region, using ultrahigh resolution Fourier transform mass spectrometry.

PubMed

Yi, Y; Birks, S J; Cho, S; Gibson, J J

2015-06-15

This study was conducted to characterize the composition of dissolved organic compounds present in snow and surface waters in the Athabasca Oil Sands Region (AOSR) with the goal of identifying whether atmospherically-derived organic compounds present in snow are a significant contributor to the compounds detected in surface waters (i.e., rivers and lakes). We used electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry (ESI-FTICR MS) to characterize the dissolved organic compound compositions of snow and surface water samples. The organic profiles obtained for the snow samples show compositional differences between samples from near-field sites (<5 km from oil sands activities) and those from more distant locations (i.e., far-field sites). There are also significant compositional differences between samples collected in near-field sites and surface water samples in the AOSR. The composition of dissolved organic compounds at the upstream Athabasca River site (i.e., Athabasca River at Athabasca) is found to be different from samples obtained from downstream sites in the vicinity of oil sands operations (i.e., Athabasca River at Fort McMurray and Athabasca River at Firebag confluence). The upstream Athabasca River sites tended to share some compositional similarities with far-field snow deposition, while the downstream Athabasca River sites are more similar to local lakes and tributaries. This contrast likely indicates the relative role of regional snowmelt contributions to the Athabasca River vs inputs from local catchments in the reach downstream of Fort McMurray. Copyright © 2015 Elsevier B.V. All rights reserved.

[Spatial distribution characteristics of the physical and chemical properties of water in the Kunes River after the supply of snowmelt during spring].

PubMed

Liu, Xiang; Guo, Ling-Peng; Zhang, Fei-Yun; Ma, Jie; Mu, Shu-Yong; Zhao, Xin; Li, Lan-Hai

2015-02-01

Eight physical and chemical indicators related to water quality were monitored from nineteen sampling sites along the Kunes River at the end of snowmelt season in spring. To investigate the spatial distribution characteristics of water physical and chemical properties, cluster analysis (CA), discriminant analysis (DA) and principal component analysis (PCA) are employed. The result of cluster analysis showed that the Kunes River could be divided into three reaches according to the similarities of water physical and chemical properties among sampling sites, representing the upstream, midstream and downstream of the river, respectively; The result of discriminant analysis demonstrated that the reliability of such a classification was high, and DO, Cl- and BOD5 were the significant indexes leading to this classification; Three principal components were extracted on the basis of the principal component analysis, in which accumulative variance contribution could reach 86.90%. The result of principal component analysis also indicated that water physical and chemical properties were mostly affected by EC, ORP, NO3(-) -N, NH4(+) -N, Cl- and BOD5. The sorted results of principal component scores in each sampling sites showed that the water quality was mainly influenced by DO in upstream, by pH in midstream, and by the rest of indicators in downstream. The order of comprehensive scores for principal components revealed that the water quality degraded from the upstream to downstream, i.e., the upstream had the best water quality, followed by the midstream, while the water quality at downstream was the worst. This result corresponded exactly to the three reaches classified using cluster analysis. Anthropogenic activity and the accumulation of pollutants along the river were probably the main reasons leading to this spatial difference.

Cryptosporidium source tracking in the Potomac River watershed - MCEARD

EPA Science Inventory

To better characterize Cryptosporidium in the Potomac River watershed, a PCR-based genotyping tool was used to analyze 64 base-flow and 28 storm-flow samples from five sites within the watershed. These sites included two water treatment plant intakes as well as three upstream si...

Effects of selenium supplementation in cattle on aquatic ecosystems in northern California

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norman, B.; Nader, G.; Oliver, M.

1992-09-15

The potential impact on aquatic ecosystems of supplementing the diets of beef cattle with selenium (Se) was studied on 4 northern California ranches. All study sites included an area of concentrated use by cattle that had diets supplemented with Se. In each case, a stream flowed through the site and provided a control sampling area upstream and a treated sampling area downstream. Specimens of water, sediment, algae, aquatic plants, aquatic invertebrates, and fish were analyzed fluorometrically for total Se content. Significant differences in Se concentration were not found between specimens from upstream control areas and those from downstream areas subjectedmore » to use by Se-treated cattle. Evidence was not found that Se supplementation in cattle at maximal permitted concentrations caused Se accumulation in associated aquatic ecosystems.« less

Assessment of potential effects of water produced from coalbed natural gas development on macroinvertebrate and algal communities in the Powder River and Tongue River, Wyoming and Montana, 2010

USGS Publications Warehouse

Peterson, David A.; Hargett, Eric G.; Feldman, David L.

2011-01-01

Ongoing development of coalbed natural gas in the Powder River structural basin in Wyoming and Montana led to formation of an interagency aquatic task group to address concerns about the effects of the resulting production water on biological communities in streams of the area. Ecological assessments, made from 2005–08 under the direction of the task group, indicated biological condition of the macroinvertebrate and algal communities in the middle reaches of the Powder was lower than in the upper or lower reaches. On the basis of the 2005–08 results, sampling of the macroinvertebrate and algae communities was conducted at 18 sites on the mainstem Powder River and 6 sites on the mainstem Tongue River in 2010. Sampling-site locations were selected on a paired approach, with sites located upstream and downstream of discharge points and tributaries associated with coalbed natural gas development. Differences in biological condition among site pairs were evaluated graphically and statistically using multiple lines of evidence that included macroinvertebrate and algal community metrics (such as taxa richness, relative abundance, functional feeding groups, and tolerance) and output from observed/expected (O/E) macroinvertebrate models from Wyoming and Montana. Multiple lines of evidence indicated a decline in biological condition in the middle reaches of the Powder River, potentially indicating cumulative effects from coalbed natural gas discharges within one or more reaches between Flying E Creek and Wild Horse Creek in Wyoming. The maximum concentrations of alkalinity in the Powder River also occurred in the middle reaches. Biological condition in the upper and lower reaches of the Powder River was variable, with declines between some site pairs, such as upstream and downstream of Dry Fork and Willow Creek, and increases at others, such as upstream and downstream of Beaver Creek. Biological condition at site pairs on the Tongue River showed an increase in one case, near the Wyoming-Montana border, and a decrease in another case, upstream of Tongue River Reservoir. Few significant differences were noted from upstream to downstream of Prairie Dog Creek, a major tributary to the Tongue River. Further study would be needed to confirm the observed patterns and choose areas to examine in greater detail.

Water quality in the Little Sac River basin near Springfield, Missouri, 1999-2001

USGS Publications Warehouse

Smith, Brenda J.

2002-01-01

The Little Sac River, north of Springfield, Missouri, flows through mainly agricultural and forest land. However, the quality of the river water is a concern because the river flows into Stockton Lake, which is a supplemental drinking water source for Springfield. Large bacterial densities and nutrient concentrations are primary concerns to the water quality of the river.A 29-river mile reach of the Little Sac River is on the 1998 list of waters of Missouri designated under section 303(d) of the Federal Clean Water Act because of fecal coliform densities larger than the Missouri Department of Natural Resources standard (hereinafter referred to as Missouri standard) of 200 colonies per 100 milliliters for whole-body contact recreation. During an investigation of the water quality in the Little Sac River by the U.S. Geological Survey, in cooperation with the Watershed Committee of the Ozarks, fecal coliform bacteria densities exceeded the Missouri standard (the standard applies from April 1 through October 31) in one sample from a site near Walnut Grove. At other sites on the Little Sac River, the Missouri standard was exceeded in two samples and equalled in one sample upstream from the Northwest Wastewater Treatment Plant (NW WTP) and in one sample immediately downstream from the NW WTP.Effluent from the NW WTP flows into the Little Sac River. Annually from April 1 through October 31, the effluent is disinfected to meet the Missouri standard for whole-body contact recreation. Fecal coliform bacteria densities in samples collected during this period generally were less than 100 colonies per 100 milliliters. For the rest of the year when the effluent was not disinfected, the bacteria densities in samples ranged from 50 (sample collected on November 1, 2000) to 10,100 colonies per 100 milliliters (both counts were non-ideal). When the effluent was disinfected and the fecal coliform bacteria density was small, samples from sites upstream and downstream from the NW WTP had a bacteria density larger than the density in the effluent. Other sources of bacteria are likely to be present in the study area in addition to the NW WTP. These potential sources include effluent from domestic septic systems and animal wastes.Nutrient concentrations in the Little Sac River immediately downstream from the NW WTP were affected by effluent from the NW WTP and possibly other sources. At two sites upstream from the NW WTP, median nitrite plus nitrate concentrations were 1.1 and 1.4 milligrams per liter. The median nitrite plus nitrate concentration for the effluent from the NW WTP was 6.4 milligrams per liter, and the median concentration decreased downstream in the Little Sac River to 2.2, 1.2, and 0.56 milligrams per liter.The effects of the effluent from the NW WTP on the water quality of the Little Sac River downstream from the NW WTP were reflected in an increase in discharge (effluent from the NW WTP can be as much as 50 percent of the flow at the site about 1.5 river miles downstream from the NW WTP), an increase in specific conductance values, an increase in several inorganic constituent concentrations, including calcium, magnesium, and sulfate, and a large increase in sodium and chloride concentrations. The effluent from the NW WTP seemed to have no effect on the pH value, temperature, and dissolved oxygen concentrations in the Little Sac River.Results of repetitive element polymerase chain reaction (rep-PCR) pattern analysis indicated that most Escherichia coli (E. coli) bacteria in water samples probably were from nonhuman sources, such as horses and cattle. The rep-PCR pattern analysis indicated that horses were an important source of E. coli downstream from the NW WTP, which was consistent with horses pastured adjacent to the sampling site. Fecal coliform bacteria loads increased upstream from the NW WTP from the most upstream site to the site immediately upstream from the NW WTP. Loads in the effluent from the NW WTP and also tho

Environmental signatures and effects of an oil and gas wastewater spill in the Williston Basin, North Dakota.

PubMed

Cozzarelli, I M; Skalak, K J; Kent, D B; Engle, M A; Benthem, A; Mumford, A C; Haase, K; Farag, A; Harper, D; Nagel, S C; Iwanowicz, L R; Orem, W H; Akob, D M; Jaeschke, J B; Galloway, J; Kohler, M; Stoliker, D L; Jolly, G D

2017-02-01

Wastewaters from oil and gas development pose largely unknown risks to environmental resources. In January 2015, 11.4ML (million liters) of wastewater (300g/L TDS) from oil production in the Williston Basin was reported to have leaked from a pipeline, spilling into Blacktail Creek, North Dakota. Geochemical and biological samples were collected in February and June 2015 to identify geochemical signatures of spilled wastewaters as well as biological responses along a 44-km river reach. February water samples had elevated chloride (1030mg/L) and bromide (7.8mg/L) downstream from the spill, compared to upstream levels (11mg/L and <0.4mg/L, respectively). Lithium (0.25mg/L), boron (1.75mg/L) and strontium (7.1mg/L) were present downstream at 5-10 times upstream concentrations. Light hydrocarbon measurements indicated a persistent thermogenic source of methane in the stream. Semi-volatile hydrocarbons indicative of oil were not detected in filtered samples but low levels, including tetramethylbenzenes and di-methylnaphthalenes, were detected in unfiltered water samples downstream from the spill. Labile sediment-bound barium and strontium concentrations (June 2015) were higher downstream from the Spill Site. Radium activities in sediment downstream from the Spill Site were up to 15 times the upstream activities and, combined with Sr isotope ratios, suggest contributions from the pipeline fluid and support the conclusion that elevated concentrations in Blacktail Creek water are from the leaking pipeline. Results from June 2015 demonstrate the persistence of wastewater effects in Blacktail Creek several months after remediation efforts started. Aquatic health effects were observed in June 2015; fish bioassays showed only 2.5% survival at 7.1km downstream from the spill compared to 89% at the upstream reference site. Additional potential biological impacts were indicated by estrogenic inhibition in downstream waters. Our findings demonstrate that environmental signatures from wastewater spills are persistent and create the potential for long-term environmental health effects. Published by Elsevier B.V.

Survival, transport, and sources of fecal bacteria in streams and survival in land-applied poultry litter in the upper Shoal Creek basin, southwestern Missouri, 2001-2002

USGS Publications Warehouse

Schumacher, John G.

2003-01-01

Densities of fecal coliform bacteria along a 5.7-mi (mile) reach of Shoal Creek extending upstream from State Highway 97 (site 3) to State Highway W (site 2) and in two tributaries along this reach exceeded the Missouri Department of Natural Resources (MDNR) standard of 200 col/100 mL (colonies per 100 milliliters) for whole-body contact recreation. A combination of techniques was used in this report to provide information on the source, transport, and survival of fecal bacteria along this reach of Shoal Creek. Results of water-quality samples collected during dye-trace and seepage studies indicated that at summer low base-flow conditions, pastured cattle likely were a substantial source of fecal bacteria in Shoal Creek at the MDNR monitoring site (site 3) at State Highway 97. Using repeat element Polymerase Chain Reaction (rep-PCR), cattle were the presumptive source of about 50 percent of the Escherichia coli (E. coli) isolates in water samples from site 3. Cattle, horses, and humans were the most common presumptive source of E. coli isolates at sites further upstream. Poultry was identified by rep-PCR as a major source of E. coli in Pogue Creek, a tributary in the upper part of the study area. Results of the rep-PCR were in general agreement with the detection and distribution of trace concentrations of organic compounds commonly associated with human wastewater, such as caffeine, the antimicrobial agent triclosan, and the pharmaceutical compounds acetaminophen and thiabendazole (a common cattle anthelmintic). Significant inputs of fecal bacteria to Shoal Creek occurred along a 1.6-mi reach of Shoal Creek immediately upstream from site 3. During a 36-hour period in July 2001, average densities of fecal coliform and E. coli bacteria increased from less than or equal to 500 col/100 mL upstream from this stream reach (sample site 2c) to 2,100 and 1,400 col/100 mL, respectively, at the MDNR sampling site. Fecal bacteria densities exhibited diurnal variability at all five sampling sites along the 5.7-mi study reach of Shoal Creek, but the trends at successive downstream sites were out of phase and could not be explained by simple advection and dispersion. At base-flow conditions, the travel time of bacteria in Shoal Creek along the 5.7-mi reach between State Highway W (site 2) and the MDNR sampling site (site 3) was about 26 hours. Substantial dispersion and dilution occurs along the upper 4.1 mi of this reach because of inflows from a number of springs and tributaries and the presence of several long pools and channel meanders. Minimal dispersion and dilution occurs along the 1.6-mi reach immediately upstream from the MDNR sampling site. Measurements of fecal bacteria decay in Shoal Creek during July 2001 indicated that about 8 percent of fecal coliform and E. coli bacteria decay each hour with an average first-order decay constant of 0.084 h-1 (per hour). Results of field test plots indicated that substantial numbers of fecal bacteria present in poul try litter can survive in fields for as much as 8 weeks after the application of the litter to the land surface. Median densities of fecal coliform and E. coli in slurry-water samples collected from fields increased from less than 60 col/100 mL before the application of turkey and broiler litter, to as large as 420,000 and 290,000 col/100 mL after the application of litter. Bacteria densities in the test plots generally decreased in a exponential manner over time with decay rates ranging from 0.085 to 0.185 d-1 (per day) for fecal coliform to between 0.100 and 0.250 d-1 for E. coli. The apparent survival of significant numbers of fecal bacteria on fields where poultry litter has been applied indicates that runoff from these fields is a potential source of fecal bacteria to vicinity streams for many weeks following litter application.

Suspended-sediment and nutrient loads for Waiakea and Alenaio Streams, Hilo, Hawaii, 2003-2006

USGS Publications Warehouse

Presley, Todd K.; Jamison, Marcael T.J.; Nishimoto, Dale C.

2008-01-01

Suspended sediment and nutrient samples were collected during wet-weather conditions at three sites on two ephemeral streams in the vicinity of Hilo, Hawaii during March 2004 to March 2006. Two sites were sampled on Waiakea Stream at 80- and 860-foot altitudes during March 2004 to August 2005. One site was sampled on Alenaio Stream at 10-foot altitude during November 2005 to March 2006. The sites were selected to represent different land uses and land covers in the area. Most of the drainage area above the upper Waiakea Stream site is conservation land. The drainage areas above the lower site on Waiakea Stream, and the site on Alenaio Stream, are a combination of conservation land, agriculture, rural, and urban land uses. In addition to the sampling, continuous-record streamflow sites were established at the three sampling sites, as well as an additional site on Alenaio Stream at altitude of 75 feet and 0.47 miles upstream from the sampling site. Stage was measured continuously at 15-minute intervals at these sites. Discharge, for any particular instant, or for selected periods of time, were computed based on a stage-discharge relation determined from individual discharge measurements. Continuous records of discharge were computed at the two sites on Waiakea Stream and the upper site on Aleniao Stream. Due to non-ideal hydraulic conditions within the channel of Alenaio Stream, a continuous record of discharge was not computed at the lower site on Alenaio Stream where samples were taken. Samples were analyzed for suspended sediment, and the nutrients total nitrogen, dissolved nitrite plus nitrate, and total phosphorus. Concentration data were converted to instantaneous load values: loads are the product of discharge and concentration, and are presented as tons per day for suspended sediment or pounds per day for nutrients. Daily-mean loads were computed by estimating concentrations relative to discharge using graphical constituent loading analysis techniques. Daily-mean loads were computed at the two Waiakea Stream sampling sites for the analyzed constituents, during the period October 1, 2003 to September 30, 2005. No record of daily-mean load was computed for the Alenaio Stream sampling site due to the problems with computing a discharge record. The maximum daily-mean loads for the upper site on Waiakea Stream for suspended sediment was 79 tons per day, and the maximum daily-mean loads for total nitrogen, dissolved nitrite plus nitrate, and total phosphorus were 1,350, 13, and 300 pounds per day, respectively. The maximum daily-mean loads for the lower site on Waiakea Stream for suspended sediment was 468 tons per day, and the maximum daily-mean loads for total nitrogen, nitrite plus nitrate, and total phosphorus were 913, 8.5, and 176 pounds per day, respectively. From the estimated continuous daily-mean load record, all of the maximum daily-mean loads occurred during October 2003 and September 2004, except for suspended sediment load for the lower site, which occurred on September 15, 2005. Maximum values were not all caused by a single storm event. Overall, the record of daily-mean loads showed lower loads during storm events for suspended sediments and nutrients at the downstream site of Waiakea Stream during 2004 than at the upstream site. During 2005, however, the suspended sediment loads were higher at the downstream site than the upstream site. Construction of a flood control channel between the two sites in 2005 may have contributed to the change in relative suspended-sediment loads.

A new sampler design for measuring sedimentation in streams

USGS Publications Warehouse

Hedrick, Lara B.; Welsh, S.A.; Hedrick, J.D.

2005-01-01

Sedimentation alters aquatic habitats and negatively affects fish and invertebrate communities but is difficult to quantify. To monitor bed load sedimentation, we designed a sampler with a 10.16-cm polyvinyl chloride coupling and removable sediment trap. We conducted a trial study of our samplers in riffle and pool habitats upstream and downstream of highway construction on a first-order Appalachian stream. Sediment samples were collected over three 6-week intervals, dried, and separated into five size-classes by means of nested sieves (U.S. standard sieve numbers 4, 8, 14, and 20). Downstream sediment accumulated in size-classes 1 and 2, and the total amount accumulated was significantly greater during all three sampling periods. Size-classes 3 and 4 had significantly greater amounts of sediment for the first two sampling periods at the downstream site. Differences between upstream and downstream sites narrowed during the 5-month sampling period. This probably reflects changes in site conditions, including the addition of more effective sediment control measures after the first 6-week period of the study. The sediment sampler design allowed for long-term placement of traps without continual disturbance of the streambed and was successful at providing repeat measures of sediment at paired sites. ?? Copyright by the American Fisheries Society 2005.

Characterization of Stormflows and Wastewater Treatment-Plant Effluent Discharges on Water Quality, Suspended Sediment, and Stream Morphology for Fountain and Monument Creek Watersheds, Colorado, 1981-2006

USGS Publications Warehouse

Mau, David P.; Stogner, Sr., Robert W.; Edelmann, Patrick

2007-01-01

In 1998, the U.S. Geological Survey, in cooperation with Colorado Springs City Engineering, began a study of the Fountain and Monument Creek watersheds to characterize water quality and suspended-sediment conditions in the watershed for different flow regimes, with an emphasis on characterizing water quality during storm runoff. Water-quality and suspended-sediment samples were collected in the Fountain and Monument Creek watersheds from 1981 through 2006 to evaluate the effects of stormflows and wastewater-treatment effluent on Fountain and Monument Creeks in the Colorado Springs, Colorado, area. Water-quality data were collected at 11 sites between 1981 and 2001, and 14 tributary sites were added in 2003 to increase spatial coverage and characterize water quality throughout the watersheds. Suspended-sediment samples collected daily at 7 sites from 1998 through 2001, 6 sites daily from 2003 through 2006, and 13 tributary sites intermittently from 2003 through 2006 were used to evaluate the effects of stormflow on suspended-sediment concentrations, discharges, and yields. Data were separated into three flow regimes: base flow, normal flow, and stormflow. Stormflow concentrations from 1998 through 2006 were compared to Colorado acute instream standards and, with the exception of a few isolated cases, did not exceed water-quality standards for inorganic constituents that were analyzed. However, stormflow concentrations of both fecal coliform and Escherichia coli (E. coli) frequently exceeded water-quality standards during 1998 through 2006 on main-stem and tributary sites by more than an order of magnitude. There were two sites on Cottonwood Creek, a tributary to Monument Creek, with elevated concentrations of dissolved nitrite plus nitrate: site 07103985 (TbCr), a tributary to Cottonwood Creek and site 07103990 (lower_CoCr), downstream from site 07103985 (TbCr), and near the confluence with Monument Creek. During base-flow and normal-flow conditions, the median concentrations of dissolved nitrite plus nitrate ranged from 5.1 to 6.1 mg/L and were 4 to 7 times larger than concentrations at the nearest upstream site on Monument Creek, site 07103970 (MoCr_Woodmen). The source of these larger dissolved nitrite plus nitrate concentrations has not been identified, but the fact that all measurements had elevated dissolved nitrite plus nitrate concentrations indicates a relatively constant source. Most stormflow concentrations of dissolved trace elements were smaller than concentrations from base-flow or normal-flow samples. However, median concentrations of total arsenic, copper, lead, manganese, nickel, and zinc generally were much larger during periods of stormflow than during base flow or normal flow. Concentrations of dissolved and total copper, total manganese, total nickel, dissolved and total selenium, and dissolved and total zinc ranged from 3 to 27 times larger at site 07103707 (FoCr_8th) than site 07103700 (FoCr_Manitou) during base flow, indicating a large source of trace elements between these two sites. Both of these sites are located on Fountain Creek, upstream from the confluence with Monument Creek. The likely source area is Gold Hill Mesa, a former tailings pile for a gold refinery located just upstream from the confluence with Monument Creek, and upstream from site 07103707 (FoCr_8th). Farther downstream in Fountain Creek, stormflow samples for total copper, manganese, lead, nickel, and zinc were larger at the downstream site near the city of Security, site 07105800 (FoCr_Security), than at the upstream site near Janitell Road, site 07105530 (FoCr_Janitell), compared with other main-stem sites and indicated a relatively large source of these metals between the two sites. Nitrogen, phosphorus, and trace-element loads substantially increased during stormflow. Suspended-sediment concentrations, discharges, and yields associated with stormflow were significantly larger than those associated with normal flow. The Apr

Water quality monitoring of an international wetland at Harike, Punjab and its impact on biological systems

NASA Astrophysics Data System (ADS)

Kaur, Jasmit; Walia, Harpreet; Mabwoga, Samson Okongo; Arora, Saroj

2017-06-01

The present study entails the investigation of mutagenic and genotoxic effect of surface water samples collected from 13 different sites of the Harike wetland using the histidine reversion point mutation assay in Salmonella typhimurium (TA98) strain and plasmid nicking assay using pBR322, respectively. The physicochemical characterization of water samples using different parameters was conducted for water quality monitoring. Heavy metal analysis was performed to quantify the toxic components present in water samples. It was observed that although the water samples of all the sites demonstrated mutagenic as well as genotoxic activity, the effect was quite significant with the water samples from sites containing water from river Satluj, i.e., site 1 (upstream Satluj river), site 2 (Satluj river) and site 3 (reservoir Satluj). The high level of pollution due to industrial effluents and agricultural run-off at these sites may engender the genotoxicity and mutagenicity of water samples.

Assessing potential effects of highway runoff on receiving-water quality at selected sites in Oregon with the Stochastic Empirical Loading and Dilution Model (SELDM)

USGS Publications Warehouse

Risley, John C.; Granato, Gregory E.

2014-01-01

6. An analysis of the use of grab sampling and nonstochastic upstream modeling methods was done to evaluate the potential effects on modeling outcomes. Additional analyses using surrogate water-quality datasets for the upstream basin and highway catchment were provided for six Oregon study sites to illustrate the risk-based information that SELDM will produce. These analyses show that the potential effects of highway runoff on receiving-water quality downstream of the outfall depends on the ratio of drainage areas (dilution), the quality of the receiving water upstream of the highway, and the concentration of the criteria of the constituent of interest. These analyses also show that the probability of exceeding a water-quality criterion may depend on the input statistics used, thus careful selection of representative values is important.

Effects of stock use and backpackers on water quality in wilderness in Sequoia and Kings Canyon National Parks, USA.

PubMed

Clow, David W; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O; Ryu, Hodon; Domingo, Jorge Santo

2013-12-01

During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli concentrations. The synoptic survey sites were categorized as minimal use, backpacker-use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E. coli) than those categorized as minimal-use (P ≤ 0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E. coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas (P ≤ 0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E. coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

Effects of Stock Use and Backpackers on Water Quality in Wilderness in Sequoia and Kings Canyon National Parks, USA

NASA Astrophysics Data System (ADS)

Clow, David W.; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O.; Ryu, Hodon; Domingo, Jorge Santo

2013-12-01

During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli concentrations. The synoptic survey sites were categorized as minimal use, backpacker-use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E. coli) than those categorized as minimal-use ( P ≤ 0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E. coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas ( P ≤ 0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E. coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

Effects of stock use and backpackers on water quality in wilderness in Sequoia and Kings Canyon National Parks, USA

USGS Publications Warehouse

Clow, David W.; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O.; Ryu, Hodon; Santo Domingo, Jorge

2013-01-01

During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water-quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water-quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli (E. coli) concentrations. The synoptic survey sites were categorized as minimal use, backpacker use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E.coli) than those categorized as minimal-use (p≤0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E.coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas (p≤0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E.coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

Hydrologic, water-quality, and meteorologic data from selected sites in the Upper Catawba River Basin, North Carolina, January 1993 through March 1994

USGS Publications Warehouse

Jaynes, M.L.

1994-01-01

Hydrologic, water-quality, and meteorologic data were collected from January 1993 through March 1994 as part of a water-quality investigation of the Upper Catawba River Basin, North Carolina. Specific objectives of the investigation were to characterize the water quality of Rhodhiss Lake, Lake Hickory, and three tributary streams, and to calibrate hydrodynamic water-quality models for the two reservoirs. Sampling locations included 11 sites in Rhodhiss Lake, 14 sites in Lake Hickory, and 3 tributary sites. Tributary sites were located at Lower Creek upstream from Rhodhiss Lake and at Upper Little River and Middle Little River upstream from Lake Hickory. During 21 sampling visits, specific conductance, pH, water temperature, dissolved-oxygen concentration, and water transparency were measured at all sampling locations. Water samples were collected for analysis of biochemical oxygen demand, fecal coliform bacteria, hardness, alkalinity, total and volatile suspended solids, suspended sediment, nutrients, total organic carbon, chlorophyll, iron, calcium, and magnesium from three sites in each reservoir and from the three tributary sites. Chemical and particle-size analyses of bottom material from Rhodhiss Lake and Lake Hickory were performed once during the study. At selected locations, automated instruments recorded water level, streamflow, water temperature, solar radiation, and air temperature at 15-minute intervals throughout the study. Hydrologic data presented in the report include monthly water-level statistics and daily mean values of discharge. Diagrams, tables, and statistical summaries of water-quality data are provided. Meteorologic data in the report include monthly precipitation, and daily mean values of solar radiation and air temperature.

Effects of streambank fencing of pasture land on benthic macroinvertebrates and the quality of surface water and shallow ground water in the Big Spring Run basin of Mill Creek watershed, Lancaster County, Pennsylvania, 1993-2001

USGS Publications Warehouse

Galeone, Daniel G.; Brightbill, Robin A.; Low, Dennis J.; O'Brien, David L.

2006-01-01

Streambank fencing along stream channels in pastured areas and the exclusion of pasture animals from the channel are best-management practices designed to reduce nutrient and suspended-sediment yields from drainage basins. Establishment of vegetation in the fenced area helps to stabilize streambanks and provides better habitat for wildlife in and near the stream. This study documented the effectiveness of a 5- to 12-foot-wide buffer strip on the quality of surface water and near-stream ground water in a 1.42-mi2 treatment basin in Lancaster County, Pa. Two miles of stream were fenced in the basin in 1997 following a 3- to 4-year pre-treatment period of monitoring surface- and ground-water variables in the treatment and control basins. Changes in surface- and ground-water quality were monitored for about 4 years after fence installation. To alleviate problems in result interpretation associated with climatic and hydrologic variation over the study period, a nested experimental design including paired-basin and upstream/downstream components was used to study the effects of fencing on surface-water quality and benthic-macroinvertebrate communities. Five surface-water sites, one at the outlet of a 1.77-mi2 control basin (C-1), two sites in the treatment basin (T-3 and T-4) that were above any fence installation, and two sites (one at an upstream tributary site (T-2) and one at the outlet (T-1)) that were treated, were sampled intensively. Low-flow samples were collected at each site (approximately 25-30 per year at each site), and stormflow was sampled with automatic samplers at all sites except T-3. For each site where stormflow was sampled, from 35 to 60 percent of the storm events were sampled over the entire study period. Surface-water sites were sampled for analyses of nutrients, suspended sediment, and fecal streptococcus (only low-flow samples), with field parameters (only low-flow samples) measured during sample collection. Benthic-macroinvertebrate samples were collected in May and September of each year; samples were collected at the outlet of the control and treatment basins and at three upstream sites, two in the treatment basin and one in the control basin. For each benthic-macroinvertebrate sample: Stream riffles and pools were sampled using the kick-net method; habitat was characterized using Rapid Bioassessment Protocols (RBP); water-quality samples were collected for nutrients and suspended sediment; stream field parameters were measured; and multiple biological metrics were calculated. The experimental design to study the effects of fencing on the quality of near-stream shallow ground water involved a nested well approach. Two well nests were in the treatment basin, one each at surface-water sites T-1 and T-2. Within each well nest, the data from one deep well and three shallow wells (no greater than 12 ft deep) were used for regional characterization of ground-water quality. At each site, two of the shallow wells were inside the eventual fence (treated wells); the other shallow well was outside the eventual fence (control well). The wells were sampled monthly, primarily during periods with little to no recharge, for laboratory analysis of nutrients and fecal streptococcus; field parameters of water quality also were measured.

Occurrence and partitioning of antibiotic compounds found in the water column and bottom sediments from a stream receiving two wastewater treatment plant effluents in northern New Jersey, 2008.

PubMed

Gibs, Jacob; Heckathorn, Heather A; Meyer, Michael T; Klapinski, Frank R; Alebus, Marzooq; Lippincott, Robert L

2013-08-01

An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and ofloxacin. Generally, there was good agreement between the decreasing order of the pseudo-partition coefficients in this study and the order reported in the literature. Published by Elsevier B.V.

Occurence of antibiotic compounds found in the water column and bottom sediments from a stream receiving two waste water treatment plant effluents in northern New Jersey, 2008

USGS Publications Warehouse

Gibs, Jacob; Heckathorn, Heather A.; Meyer, Michael T.; Klapinski, Frank R.; Alebus, Marzooq; Lippincott, Robert

2013-01-01

An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and ofloxacin. Generally, there was good agreement between the decreasing order of the pseudo-partition coefficients in this study and the order reported in the literature.

Characterization of mercury contamination in the Androscoggin River, Coos County, New Hampshire

USGS Publications Warehouse

Chalmers, Ann; Marvin-DiPasquale, Mark C.; Degnan, James R.; Coles, James; Agee, Jennifer L.; Luce, Darryl

2013-01-01

Concentrations of total mercury (THg) and MeHg in sediment, pore water, and biota in the Androscoggin River were elevated downstream from the former chloralkali facility compared with those upstream from reference sites. Sequential extraction of surface sediment showed a distinct difference in Hg speciation upstream compared with downstream from the contamination site. An upstream site was dominated by potassium hydroxide-extractable forms (for example, organic-Hg or particle-bound Hg(II)), whereas sites downstream from the point source were dominated by more chemically recalcitrant forms (largely concentrated nitric acid-extractable), indicative of elemental mercury or mercurous chloride. At all sites, only a minor fraction (less than 0.1 percent) of THg existed in chemically labile forms (for example, water extractable or weak acid extractable). All metrics indicated that a greater percentage of mercury at an upstream site was available for Hg(II)-methylation compared with sites downstream from the point source, but the absolute concentration of bioavailable Hg(II) was greater downstream from the point source. In addition, the concentration of tin-reducible inorganic reactive mercury, a surrogate measure of bioavailable Hg(II) generally increased with distance downstream from the point source. Whereas concentrations of mercury species on a sediment-dry-weight basis generally reflected the relative location of the sample to the point source, river-reach integrated mercury-species inventories and MeHg production potential (MPP) rates reflected the amount of fine-grained sediment in a given reach. THg concentrations in biota were significantly higher downstream from the point source compared with upstream reference sites for smallmouth bass, white sucker, crayfish, oligochaetes, bat fur, nestling tree swallow blood and feathers, adult tree swallow blood, and tree swallow eggs. As with tin-reducible inorganic reactive mercury, THg in smallmouth bass also increased with distance downstream from the point source. Toxicity tests and invertebrate community assessments suggested that invertebrates were not impaired at the current (2009 and 2010) levels of mercury contamination downstream from the point source. Concentrations of THg and MeHg in most water and sediment samples from the Androscoggin River were below U.S. Environmental Protection Agency (USEPA), the Canadian Council of Ministers of the Environment, and probable effects level guidelines. Surface-water and sediment samples from the Androscoggin River had similar THg concentrations but lower MeHg concentrations compared with other rivers in the region. Concentrations of THg in fish tissue were all above regional and U.S. Environmental Protection Agency guidelines. Moreover, median THg concentrations in smallmouth bass from the Androscoggin River were significantly higher than those reported in regional surveys of river and streams nationwide and in the Northeastern United States and Canada. The higher concentrations of mercury in smallmouth bass suggest conditions may be more favorable for Hg(II)-methylation and bioaccumulation in the Androscoggin River compared with many other rivers in the United States and Canada.

Change in the Structure of Escherichia coli Population and the Pattern of Virulence Genes along a Rural Aquatic Continuum

PubMed Central

Petit, Fabienne; Clermont, Olivier; Delannoy, Sabine; Servais, Pierre; Gourmelon, Michèle; Fach, Patrick; Oberlé, Kenny; Fournier, Matthieu; Denamur, Erick; Berthe, Thierry

2017-01-01

The aim of this study was to investigate the diversity of the Escherichia coli population, focusing on the occurrence of pathogenic E. coli, in surface water draining a rural catchment. Two sampling campaigns were carried out in similar hydrological conditions (wet period, low flow) along a river continuum, characterized by two opposite density gradients of animals (cattle and wild animals) and human populations. While the abundance of E. coli slightly increased along the river continuum, the abundance of both human and ruminant-associated Bacteroidales markers, as well as the number of E. coli multi-resistant to antibiotics, evidenced a fecal contamination originating from animals at upstream rural sites, and from humans at downstream urban sites. A strong spatial modification of the structure of the E. coli population was observed. At the upstream site close to a forest, a higher abundance of the B2 phylogroup and Escherichia clade strains were observed. At the pasture upstream site, a greater proportion of both E and B1 phylogroups was detected, therefore suggesting a fecal contamination of mainly bovine origin. Conversely, in downstream urban sites, A, D, and F phylogroups were more abundant. To assess the occurrence of intestinal pathogenic strains, virulence factors [afaD, stx1, stx2, eltB (LT), estA (ST), ipaH, bfpA, eae, aaiC and aatA] were screened among 651 E. coli isolates. Intestinal pathogenic strains STEC O174:H21 (stx2) and EHEC O26:H11 (eae, stx1) were isolated in water and sediments close to the pasture site. In contrast, in the downstream urban site aEPEC/EAEC and DAEC of human origin, as well as extra-intestinal pathogenic E. coli belonging to clonal group A of D phylogroup, were sampled. Even if the estimated input of STEC (Shiga toxin-producing E. coli) – released in water at the upstream pasture site – at the downstream site was low, we show that STEC could persist in sediment. These results show that, the run-off of small cattle farms contributed, as much as the wastewater effluent, in the dissemination of pathogenic E. coli in both water and sediments, even if the microbiological quality of the water was good or to average quality according to the French water index. PMID:28458656

40 CFR 1054.625 - What requirements apply under the Transition Program for Equipment Manufacturers?

Code of Federal Regulations, 2011 CFR

2011-07-01

... number to contact for further information, or a Web site that includes this contact information. (5) The... configuration. Use good engineering judgment for these measurements, which may involve sampling exhaust upstream...

Estimating bioaccessibility of trace elements in particles suspended in the Athabasca River using sequential extraction.

PubMed

Javed, Muhammad Babar; Shotyk, William

2018-05-10

Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.

Methylmercury Modulation in Amazon Rivers Linked to Basin Characteristics and Seasonal Flood-Pulse.

PubMed

Kasper, Daniele; Forsberg, Bruce R; Amaral, João H F; Py-Daniel, Sarah S; Bastos, Wanderley R; Malm, Olaf

2017-12-19

We investigated the impact of the seasonal inundation of wetlands on methylmercury (MeHg) concentration dynamics in the Amazon river system. We sampled 38 sites along the Solimões/Amazon and Negro rivers and their tributaries during distinct phases of the annual flood-pulse. MeHg dynamics in both basins was contrasted to provide insight into the factors controlling export of MeHg to the Amazon system. The export of MeHg by rivers was substantially higher during high-water in both basins since elevated MeHg concentrations and discharge occurred during this time. MeHg concentration was positively correlated to %flooded area upstream of the sampling site in the Solimões/Amazon Basin with the best correlation obtained using 100 km buffers instead of whole basin areas. The lower correlations obtained with the whole basin apparently reflected variable losses of MeHg exported from upstream wetlands due to demethylation, absorption, deposition, and degradation before reaching the sampling site. A similar correlation between %flooded area and MeHg concentrations was not observed in the Negro Basin probably due to the variable export of MeHg from poorly drained soils that are abundant in this basin but not consistently flooded.

Influence of rice field agrochemicals on the ecological status of a tropical stream.

PubMed

Rasmussen, Jes Jessen; Reiler, Emilie Marie; Carazo, Elizabeth; Matarrita, Jessie; Muñoz, Alejandro; Cedergreen, Nina

2016-01-15

Many tropical countries contain a high density of protected ecosystems, and these may often be bordered by intensive agricultural systems. We investigated the chemical and ecological status of a stream connecting an area with conventional rice production and a downstream protected nature reserve; Mata Redonda. Three sites were sampled: 1) an upstream control, 2) in the rice production area and 3) a downstream site in Mata Redonda. We sampled benthic macroinvertebrates and pesticides in water and sediments along with supporting physical and chemical data. Pesticide concentrations in water exceeded current safety thresholds at sites 2 and 3, especially during the rainy season, and sediment associated pesticide concentrations exceeded current safety thresholds in three of six samples. Importantly, the highest predicted pesticide toxicity in sediments was observed at site 3 in the Mata Redonda confirming that the nature reserve received critical levels of pesticide pollution from upstream sections. The currently used macroinvertebrate index in Costa Rica (BMWP-CR) and an adjusted version of the SPecies At Risk index (SPEAR) were not significantly correlated to any measure of anthropogenic stress, but the Average Score Per Taxon (ASPT) index was significantly correlated with the predicted pesticide toxicity (sumTUD.magna), oxygen concentrations and substrate composition. Our results suggest that pesticide pollution was likely involved in the impairment of the ecological status of the sampling sites, including site 3 in Mata Redonda. Based on our results, we give guidance to biomonitoring in Costa Rica and call for increased focus on pesticide transport from agricultural regions to protected areas. Copyright © 2015 Elsevier B.V. All rights reserved.

Water-quality data for the Ohio River from New Cumberland Dam to Pike Island Dam, West Virginia and Ohio, May-October 1993

USGS Publications Warehouse

Miller, K.F.; Messinger, Terence; Waldron, M.C.; Faulkenburg, C.W.

1996-01-01

This report contains water-quality data for the Ohio River from river mile 51.1 (3.3 miles upstream from New Cumberland Dam) to river mile 84.0 (0.2 miles upstream from Pike Island Dam) that were collected during the summer and fall of 1993. The data were collected to establish the water quality of the Ohio River and to use in assessing the proposed effects of hydropower development on the water quality of the Ohio River. Water quality was determined by a combination of repeated synoptic field measurements, continuous-record monitoring, and laboratory analyses. Synoptic measurements were made along a longitudinal transect with 18 mid-channel sampling sites; cross-sectional transects of water-quality measurements were made at 5 of these sites. Water-quality measurements also were made at two sites located on the back-channel (Ohio) side of Browns Island. At each longitudinal-transect and back-channel sampling site, measurements were made of specific conductance, pH, water temperature, and dissolved oxygen conentration. Longitudinal-transect and back-channel stations were sampled at four depths (at the surface, about 3.3 feet below the surface, middle of the water column, and near the bottom of the river). Cross-sectional transects consisted of three to four detailed vertical profiles of the same characteristics. Water samples were collected from three depths at the mid-channel vertical profile in each cross-sectional transect and were analyzed for concentrations of phytoplankton photosynthetic pigments chlorophyll a and chlorophyll b. Estimates of the depth of light penetration (Secchi-disk transparency) were made at pigment-sampling locations whenever light and river-surface conditions were appropriate. Synoptic sampling usually was completed in 12 hours or less and was repeated 10 times from May through October 1993. Continuous-record monitoring of water quality consisted of hourly measurements of specific conductance, pH, water temperature, and dissolved oxygen concentration, made at a depth of 6.6 feet upstream and downstream of New Cumberland Dam. Continuous monitors were operated from May through October 1993.

Water-quality data for the Ohio River from Willow Island Dam to Belleville Dam, West Virginia and Ohio, May-October 1993

USGS Publications Warehouse

Miller, K.F.

1996-01-01

This report contains water-quality data for the Ohio River from river mile 160.6 (1.1 mile upstream from Willow Island Dam) to river mile 203.6 (0.3 mile upstream from Belleville Dam) that were collected during the summer and fall of 1993. The data were collected to establish the water quality of the Ohio River and to use in assessing the proposed effects of hydropower development on the water quality of the Ohio River. Water quality was monitored by a combination of synoptic field measurements, laboratory analyses, and continuous- record monitoring. Field measurements of water- quality characteristics were made along a longitudinal transect with 24 mid-channel sampling sites; cross-sectional transects of water-quality measurements were made at six of these sites. Water-quality measurements also were made at six sites located on the back-channel (West Virginia) sides of Marietta, Muskingum, and Blennerhassett Islands. At each longitudinal-transect and back- channel sampling site, measurements of specific conductance, pH, water temperature, and dissolved oxygen concentration were made at three depths (about 3.3 feet below the surface of the water, middle of the water column, and near the bottom of the river). Cross-sectional transects consisted of three to four detailed vertical profiles of the same characteristics. Water samples were collected at three depths in the mid-channel vertical profile in each cross-sectional transect and were analyzed for concentrations of phytoplankton chlorophyll a and chlorophyll b. Estimates of the depth of light penetration (Secchi disk transparency) were made at phytoplankton- pigment-sampling locations whenever light and river-surface conditions were appropriate. Each synoptic sampling event was completed in 2 days or less. The entire network was sampled 10 times from May 24 to October 27, 1993. Continuous-record monitoring of water quality consisted of hourly measurments of specific conductance, pH, water temperature, and dissolved oxygen concentration that were made at a depth of 6.6 feet at the ends of the upstream and downstream wingwalls at Willow Island Dam. Continuous-record monitors were operated from May through October 1993.

Metal loading in Soda Butte Creek upstream of Yellowstone National Park, Montana and Wyoming; a retrospective analysis of previous research; and quantification of metal loading, August 1999

USGS Publications Warehouse

Boughton, G.K.

2001-01-01

Acid drainage from historic mining activities has affected the water quality and aquatic biota of Soda Butte Creek upstream of Yellowstone National Park. Numerous investigations focusing on metals contamination have been conducted in the Soda Butte Creek basin, but interpretations of how metals contamination is currently impacting Soda Butte Creek differ greatly. A retrospective analysis of previous research on metal loading in Soda Butte Creek was completed to provide summaries of studies pertinent to metal loading in Soda Butte Creek and to identify data gaps warranting further investigation. Identification and quantification of the sources of metal loading to Soda Butte Creek was recognized as a significant data gap. The McLaren Mine tailings impoundment and mill site has long been identified as a source of metals but its contribution relative to the total metal load entering Yellowstone National Park was unknown. A tracer-injection and synoptic-sampling study was designed to determine metal loads upstream of Yellowstone National Park.A tracer-injection and synoptic-sampling study was conducted on an 8,511-meter reach of Soda Butte Creek from upstream of the McLaren Mine tailings impoundment and mill site downstream to the Yellowstone National Park boundary in August 1999. Synoptic-sampling sites were selected to divide the creek into discrete segments. A lithium bromide tracer was injected continuously into Soda Butte Creek for 24.5 hours. Downstream dilution of the tracer and current-meter measurements were used to calculate the stream discharge. Stream discharge values, combined with constituent concentrations obtained by synoptic sampling, were used to quantify constituent loading in each segment of Soda Butte Creek.Loads were calculated for dissolved calcium, silica, and sulfate, as well as for dissolved and total-recoverable iron, aluminum, and manganese. Loads were not calculated for cadmium, copper, lead, and zinc because these elements were infrequently detected in mainstem synoptic samples. All of these elements were detected at high concentrations in the seeps draining the McLaren Mine tailings impoundment. The lack of detection of these elements in the downstream mainstem synoptic samples is probably because of sorption (coprecipitation and adsorption) to metal colloids in the stream.Most of the metal load that entered Soda Butte Creek was contributed by the inflows draining the McLaren Mine tailings impoundment (between 505 meters and 760 meters downstream from the tracer-injection site), Republic Creek (1,859 meters), and Unnamed Tributary (8,267 meters). Results indicate that treatment or removal of the McLaren Mine tailings impoundment would greatly reduce metal loading in Soda Butte Creek upstream of Yellowstone National Park. However, removing only that single source may not reduce metal loads to acceptable levels. The sources of metal loading in Republic Creek and Unnamed Tributary merit further investigation.

HEAVY METALS STRUCTURE BENTHIC COMUNITIES IN COLORADO MOUNTAIN STREAMS

EPA Science Inventory

The development of field sampling designs that employ multiple reference and polluted sites has been proposed as an alternative to the traditional upstream vs. downstream approach used in most biomonitoring studies. Spatially extensive monitoring programs can characterize ecologi...

Concentrations and ratios of Sr, Ba and Ca along an estuarine river to the Gulf of Mexico - implication for sea level rise effects on trace metal distribution

NASA Astrophysics Data System (ADS)

He, S.; Xu, Y. J.

2015-11-01

Strontium and barium to calcium ratios are often used as proxies for tracking animal movement across salinity gradients. As sea level rise continues, many estuarine rivers in the world face saltwater intrusion, which may cause changes in mobility and distribution of these metals upstream. Despite intensive research on metal adsorption and desorption in marine systems, knowledge of the spatiotemporal distribution of these elements along estuarine rivers is still limited. In this study, we conducted an intensive monitoring of Sr and Ba dynamics along an 88 km long estuary, the Calcasieu River in South Louisiana, USA, which has been strongly affected by saltwater intrusion. Over the period from May 2013 to August 2015, we collected monthly water samples and performed in-situ water quality measurements at six sites from the upstream to the river mouth, with a salinity range from 0.02 to 29.50 ppt. Water samples were analyzed for Sr, Ba, and Ca concentrations. In-situ measurements were made on salinity, pH, water temperature, dissolved oxygen concentration, and specific conductance. We found that the Sr and Ca concentrations and the Sr / Ca ratio all increased significantly with increasing salinity. The average Sr concentration at the site closest to the Gulf of Mexico (site 6) was 46.21 μmol L-1, which was about 130 times higher than that of the site furthest upstream (site 1, 0.35 μmol L-1). The average Ca concentration at site 6 was 8.19 mmol L-1, which was about 60 times higher than that of site 1 (0.13 mmol L-1). The average Sr / Ca ratio at site 6 (8.41 mmol mol-1) was about 3 times the average Sr / Ca ratio at site 1 (2.89 mmol mol-1). However, the spatial variation in Ba concentration was marginal, varying from 0.36 μmol L-1 at site 6 to 0.47 at site 5. The average Ba / Ca ratio at site 1 (4.82 mmol mol-1) was about 54 times the average Ba / Ca ratio at site 6 (0.09 mmol mol-1), showing a clear negative relation between the Ba / Ca ratio and increasing salinity. All the elemental concentrations and ratios had considerable seasonal variations, with significant differences among sampling months for the Sr, Ba concentrations and the Ba / Ca ratio (p < 0.01). The results from this study suggest that concentrations of Sr and Ca in the world's estuaries will very likely increase in the future as sea level rise continues. For low-gradient estuarine rivers such as the Calcasieu River in South Louisiana, USA, water chemistry upstream would experience substantial Sr and Ca enrichment, which could affect aquatic environments and biological communities.

Environmental signatures and effects of an oil and gas wastewater spill in the Williston Basin, North Dakota

USGS Publications Warehouse

Cozzarelli, Isabelle M.; Skalak, Katherine; Kent, D.B.; Engle, Mark A.; Benthem, Adam J.; Mumford, Adam; Haase, Karl B.; Farag, Aïda M.; Harper, David; Nagel, S. C.; Iwanowicz, Luke R.; Orem, William H.; Akob, Denise M.; Jaeschke, Jeanne B.; Galloway, Joel M.; Kohler, Matthias; Stoliker, Deborah L.; Jolly, Glenn D.

2017-01-01

Wastewaters from oil and gas development pose largely unknown risks to environmental resources. In January 2015, 11.4 M L (million liters) of wastewater (300 g/L TDS) from oil production in the Williston Basin was reported to have leaked from a pipeline, spilling into Blacktail Creek, North Dakota. Geochemical and biological samples were collected in February and June 2015 to identify geochemical signatures of spilled wastewaters as well as biological responses along a 44-km river reach. February water samples had elevated chloride (1030 mg/L) and bromide (7.8 mg/L) downstream from the spill, compared to upstream levels (11 mg/L and < 0.4 mg/L, respectively). Lithium (0.25 mg/L), boron (1.75 mg/L) and strontium (7.1 mg/L) were present downstream at 5–10 times upstream concentrations. Light hydrocarbon measurements indicated a persistent thermogenic source of methane in the stream. Semi-volatile hydrocarbons indicative of oil were not detected in filtered samples but low levels, including tetramethylbenzenes and di-methylnaphthalenes, were detected in unfiltered water samples downstream from the spill. Labile sediment-bound barium and strontium concentrations (June 2015) were higher downstream from the Spill Site. Radium activities in sediment downstream from the Spill Site were up to 15 times the upstream activities and, combined with Sr isotope ratios, suggest contributions from the pipeline fluid and support the conclusion that elevated concentrations in Blacktail Creek water are from the leaking pipeline. Results from June 2015 demonstrate the persistence of wastewater effects in Blacktail Creek several months after remediation efforts started. Aquatic health effects were observed in June 2015; fish bioassays showed only 2.5% survival at 7.1 km downstream from the spill compared to 89% at the upstream reference site. Additional potential biological impacts were indicated by estrogenic inhibition in downstream waters. Our findings demonstrate that environmental signatures from wastewater spills are persistent and create the potential for long-term environmental health effects.

Determination of instream metal loads using tracer-injection and synoptic-sampling techniques in Wightman Fork, southwestern Colorado, September 1997

USGS Publications Warehouse

Ortiz, Roderick F.; Bencala, Kenneth E.

2001-01-01

Spatial determinations of the metal loads in Wightman Fork can be used to identify potential source areas to the stream. In September 1997, a chloride tracer-injection study was done concurrently with synoptic water-quality sampling in Wightman Fork near the Summitville Mine site. Discharge was determined and metal concentrations at 38 sites were used to generate mass-load profiles for dissolved aluminum, copper, iron, manganese, and zinc. The U.S. Environmental Protection Agency had previously identified these metals as contaminants of concern.Metal loads increased substantially in Wightman Fork near the Summitville Mine. A large increase occurred along a 60-meter reach that is north of the North Waste Dump and generally corresponds to a region of radial faults. Metal loading from this reach was equivalent to 50 percent or more of the dissolved aluminum, copper, iron, manganese, and zinc load upstream from the outfall of the Summitville Water Treatment Facility (SWTF). Overall, sources along the entire reach upstream from the SWTF were equivalent to 15 percent of the iron, 33 percent of the copper and manganese, 58 percent of the zinc, and 66 percent of the aluminum load leaving the mine site. The largest increases in metal loading to Wightman Fork occurred as a result of inflow from Cropsy Creek. Aluminum, iron, manganese, and zinc loads from Cropsy Creek were equivalent to about 40 percent of the specific metal load leaving the mine site. Copper, iron, and manganese loads from Cropsy Creek were nearly as large or larger than the load from sources upstream from the SWTF.

[Residue Concentration and Distribution Characteristics of Perfluorinated Compounds in Surface Water from Qiantang River in Hangzhou Section].

PubMed

Zhang, Ming; Tang, Fang-liang; Yu, Ya-yun; Xu, Jian-fen; Li, Hua; Wu, Min-hua; Zhang, Wei; Pan, Jian-yang

2015-12-01

This study studied the pollution characteristics of perfluorinated compounds (PFCs) in Qiantang River in Hangzhou section (QR). Surface water samples, collected in July 2014 and January 2015 from 14 sites in QR were analyzed for 16 PFCs. All samples were prepared by solid-phase extraction with Oasis WAX cartridges and analyzed using the ultra performance liquid chromatography interfaced to tandem mass spectrometry ( UPLC-MS/MS). The results showed that 8 medium-and short-chain PFCs including C₄ and C₈ perfluorinated sulfonates (PFSAs) and C₄-C₉ perfluorinated carboxylic acids (PFCAs) were detected in the surface waters. The total concentrations of PFCs ranged from 0.98 to 609 ng · L⁻¹, while perfluorooctanoic acid (PFOA) dominated, with range of 0.59-538 ng L⁻¹, and perfluorooctane sulfonate (PFOS) was detected at lower levels, ranging from 0 to 2.48 ng · L⁻¹. The spatial distribution of PFCs varied, and the pollutant concentrations at the sampling sites located in upstream of the river such as Lanjiangkou and Jiangjunyan were relatively high, PFCs concentration showed a decreasing trend from the upstream to the downstream. According to the ratio of feature components, PFCs in surface water of QR originated largely from the input of direct sewage emissions. Taken together, the PFCs pollution was highly correlated with the upstream of Qiantang River valley's industry distribution, and most of the mass load in the investigated river was attributed to upstream running water with a minor influence from the wastewater discharges along the river basin. Overall, the results presented here indicated that greater attention should be given to the contamination of PFCs, especially for PFOA in water body of QR.

Water quality and benthic macroinvertebrate bioassessment of Gallinas Creek, San Miguel County, New Mexico, 1987-90

USGS Publications Warehouse

Garn, H.S.; Jacobi, G.Z.

1996-01-01

Upper Gallinas Creek in north-central New Mexico serves as the public water supply for the City of Las Vegas. The majority of this 84-square-mile watershed is within national forest lands managed by the U.S. Forest Service. In 1985, the Forest Service planned to conduct timber harvesting in the headwaters of Gallinas Creek. The City of Las Vegas was concerned about possible effects from logging on water quality and on water-supply treatment costs. The U.S. Geological Survey began a cooperative study in 1987 to (1) assess the baseline water-quality characteristics of Gallinas Creek upstream from the Las Vegas water-supply diversion, (2) relate water quality to State water- quality standards, and (3) determine possible causes for spatial differences in quality. During 1987-90, water-quality constituents and aquatic benthic macroinvertebrates were collected and analyzed at five sampling sites in the watershed. Specific conductance, pH, total hardness, total alkalinity, and calcium concentrations increased in a downstream direction, probably in response to differences in geology in the watershed. The water-quality standard for temperature was exceeded at the two most downstream sites probably due to a lack of riparian vegetation and low streamflow conditions. The standards for pH and turbidity were exceeded at all sites except the most upstream one. Concentrations of nitrogen species and phosphorus generally were small at all sites. The maximum total nitrogen concentration of 2.1 milligrams per liter was at the mouth of Porvenir Canyon; only one sample at this site exceeded the water-quality standard for total inorganic nitrogen. At each of the sites, 10 to 15 percent of the samples exceeded the total phosphorus standard of less than 0.1 milligram per liter. Except for aluminum and iron, almost all samples tested for trace elements contained concentrations less than the laboratory detection limit. No trace-element concentrations exceeded the State standard for domestic water supplies. Suspended-sediment concentrations appeared to increase with distance downstream; suspended sediment increased significantly from the uppermost site to the second site near the national forest boundary, most probably caused by runoff from the unpaved forest road adjacent to Gallinas Creek. The aquatic macroinvertebrate assessment indicated that the three upstream sites had good biological conditions and were nonimpaired, whereas the two downstream sites had lowered biological conditions and were slightly impaired. The water- quality and biological assessments provided similar results.

Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

PubMed Central

Gilmartin, G M; Fleming, E S; Oetjen, J

1992-01-01

The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

Occurrence of polycyclic aromatic hydrocarbons below coal-tar-sealed parking lots and effects on stream benthic macroinvertebrate communities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Scoggins, M.; McClintock, N.L.; Gosselink, L.

2007-12-15

Parking-lot pavement sealants recently have been recognized as a major source of polycyclic aromatic hydrocarbons (PAHs) in urban stream sediments in Austin, Texas. Laboratory and field studies have shown that PAHs in sediments can be toxic to aquatic organisms and can degrade aquatic communities. After identifying increases in concentrations of PAHs in sediments below seal-coated parking lots, we investigated whether the increases had significant effects on stream biota in 5 Austin streams. We sampled sediment chemistry and biological communities above and below the point at which stormwater runoff from the parking lots discharged into the streams, thus providing 5 upstreammore » reference sites and 5 downstream treatment sites. Differences between upstream and downstream concentrations of total PAH ranged from 3.9 to 32 mg/kg. Analysis of the species occurrence data from pool and riffle habitats indicated a significant decrease in community health at the downstream sites, including decreases in richness, intolerant taxa, Diptera taxa, and density. In pool sediments, Chironomidae density was negatively correlated with PAH concentrations, whereas Oligochaeta density responded positively to PAH concentrations. In general, pool taxa responded more strongly than riffle taxa to PAHs, but riffle taxa responded more broadly than pool taxa. Increases in PAH sediment-toxicity units between upstream and downstream sites explained decreases in taxon richness and density in pools between upstream and downstream sites.« less

Effects of aquifer storage and recovery activities on water quality in the Little Arkansas River and Equus Beds Aquifer, south-central Kansas, 2011–14

USGS Publications Warehouse

Stone, Mandy L.; Garrett, Jessica D.; Poulton, Barry C.; Ziegler, Andrew C.

2016-07-18

The Equus Beds aquifer in south-central Kansas is aprimary water source for the city of Wichita. The Equus Beds aquifer storage and recovery (ASR) project was developed to help the city of Wichita meet increasing current (2016) and future water demands. The Equus Beds ASR project pumps water out of the Little Arkansas River during above-base flow conditions, treats it using drinking-water quality standards as a guideline, and recharges it into the Equus Beds aquifer for later use. Phase II of the Equus Beds ASR project currently (2016) includes a river intake facility and a surface-water treatment facility with a 30 million gallon per day capacity. Water diverted from the Little Arkansas River is delivered to an adjacent presedimentation basin for solids removal. Subsequently, waste from the surface-water treatment facility and the presedimentation basin is returned to the Little Arkansas River through a residuals return line. The U.S. Geological Survey, in cooperation with the city of Wichita, developed and implemented a hydrobiological monitoring program as part of the ASR project to characterize and quantify the effects of aquifer storage and recovery activities on the Little Arkansas River and Equus Beds aquifer water quality.Data were collected from 2 surface-water sites (one upstream and one downstream from the residuals return line), 1 residuals return line site, and 2 groundwater well sites (each having a shallow and deep part): the Little Arkansas River upstream from the ASR facility near Sedgwick, Kansas (upstream surface-water site 375350097262800), about 0.03 mile (mi) upstream from the residuals return line site; the Little Arkansas River near Sedgwick, Kans. (downstream surface-water site 07144100), about 1.68 mi downstream from the residuals return line site; discharge from the Little Arkansas River ASR facility near Sedgwick, Kansas (residuals return line site 375348097262800); 25S 01 W 07BCCC01 SMW–S11 near CW36 (MW–7 shallow groundwater well site 375327097285401); 25S01 W 07BCCC02 DMW–S10 near CW36 (MW–7 deep groundwater well site 375327097285402); 25S 01W 07BCCA01 SMW–S13 near CW36 (MW–8 shallow groundwater well site 375332097284801); and 25S 01W 07BCCA02 DMW–S14 near CW36 (MW–8 deep groundwater well site 375332097284802). The U.S. Geological Survey, in cooperation with the city of Wichita, assessed the effects of the ASR Phase II facility residuals return line discharges on stream quality of the Little Arkansas River by measuring continuous physicochemical properties and collecting discrete water-quality and sediment samples for about 2 years pre- (January 2011 through April 2013) and post-ASR (May 2013 through December 2014) Phase II facility operation upstream and downstream from the ASR Phase II facility. Additionally, habitat variables were quantified and macroinvertebrate and fish communities were sampled upstream and downstream from the ASR Phase II facility during the study period. To assess the effects of aquifer recharge on Equus Beds groundwater quality, continuous physicochemical properties were measured and discrete water-quality samples were collected before and during the onset of Phase II aquifer recharge in two (shallow and deep) groundwater wells.Little Arkansas River streamflow was about 10 times larger after the facility began operating because of greater rainfall. Residuals return line release volumes were a very minimal proportion (0.06 percent) of downstream streamflow volume during the months the ASR facility was operating. Upstream and downstream continuously measured water temperature and dissolved oxygen median differences were smaller post-ASR than pre-ASR. Turbidity generally was smaller at the downstream site throughout the study period and decreased at both sites after the ASR Phase II facility began discharging despite a median residuals return line turbidity that was about an order of magnitude larger than the median turbidity at the downstream site. Upstream and downstream continuously measured turbidity median differences were larger post-ASR than pre-ASR. Median post-ASR continuously measured nitrite plus nitrate and continuously computed total suspended solids and suspended-sediment concentrations were smaller than pre-ASR likely because of higher streamflows and dilution; whereas, median continuously computed dissolved and total organic carbon concentrations were larger likely because of higher streamflows and runoff conditions.None of the discretely measured water-quality constituents (dissolved and suspended solids, primary ions, suspended sediment, nutrients, carbon, trace elements, viral and bacterial indicators, and pesticides) in surface water were significantly different between the upstream and downstream sites after the ASR Phase II facility began discharging; however, pre-ASR calcium, sodium, hardness, manganese, and arsenate concentrations were significantly larger at the upstream site, which indicates that some water-quality conditions at the upstream and downstream sites were more similar post-ASR. Most of the primary constituents that make up dissolved solids decreased at both sites after the ASR Phase II facility began operation. Discretely collected total suspended solids concentrations were similar between the upstream and downstream sites before the facility began operating but were about 27 percent smaller at the downstream site after the facility began operating, despite the total suspended solids concentrations in the residuals return line being 15 times larger than the downstream site.Overall habitat scores were indicative of suboptimal conditions upstream and downstream from the ASR Phase II facility throughout the study period. Substrate fouling and sediment deposition mean scores indicated marginal conditions at the upstream and downstream sites during the study period, demonstrating that sediment deposition was evident pre- and post-ASR and no substantial changes in these habitat characteristics were noted after the ASR Phase II facility began discharging. Macroinvertebrate community composition (evaluated using functional feeding, behavioral, and tolerance metrics) generally was similar between sites during the study period. Fewer macroinvertebrate metrics were significant between the upstream and downstream sites post-ASR (6) than pre-ASR (14), which suggests that macroinvertebate communities were more similar after the ASR facility began discharging. Upstream-downstream comparisons in macroinvertebrate aquatic-life-support metrics had no significant differences for the post-ASR time period and neither site was fully supporting for any of the Kansas Department of Health and Environment aquatic-life-support metrics (Macroinvertebrate Biotic Index; Kansas Biotic Index with tolerances for nutrients and oxygen-demanding substances; Ephemeroptera, Plecoptera, and Trichoptera [EPT] richness; and percentage of EPT species). Overall, using macroinvertebrate aquatic life-support criteria from the Kansas Department of Health and Environment, upstream and downstream sites were classified as partially supporting before and after the onset of ASR facility operations. Fish community trophic status and tolerance groups generally were similar among sites during the study period. Fish community Little Arkansas River Basin Index of Biotic Integrity scores at the upstream and downstream sites were indicative of fair-to-good conditions before the facility began operating and decreased to fair conditions after the facility began operating.Groundwater physicochemical changes concurrent with the beginning of recharge operations at the Sedgwick basin were more pronounced in shallow groundwater. No constituent concentrations in the pre-recharge period in comparison to the post-recharge period increased to concentrations exceeding drinking water regulations; however, nitrate decreased significantly from a pre-recharge exceedance of the U.S. Environmental Protection Agency maximum contaminant level to a post recharge nonexceedance. Shallow groundwater chemical concentrations or rates of detection increased after artificial recharge began for the ions potassium, chloride, and fluoride; phosphorus and organic carbon species; trace elements barium, manganese, nickel, arsenate, arsenic, and boron; agricultural pesticides atrazine, metolachlor, metribuzin, and simazine; organic disinfection byproducts bromodichloromethane and trichloromethane; and gross beta levels. Additionally, water temperature, and pH were larger after recharge began; and total solids and slime-forming bacteria concentrations and densities were smaller. Total solids, nitrate, and selenium significantly decreased; and potassium, chloride, nickel, arsenic, fluoride, phosphorus and carbon species, and gross beta levels significantly increased in shallow groundwater after artificial recharge. Results of biological activity reaction tests indicated that water quality microbiology was different before and after artificial recharge began; at times, these differences may lead to changes in dominant bacterial populations that, in turn, may lead to formation and expansion in populations that may cause bioplugging and other unwanted effects. Calcite, iron (II) hydroxide, hydroxyapatite, and similar minerals, had shifts in saturation indices that generally were from undersaturation toward equilibrium and, in some cases, toward oversaturation. These shifts toward neutral saturation indices might suggest reduced weathering of the minerals present in the Equus Beds aquifer. Chemical weathering in the shallow parts of the aquifer may be accelerated because of the increased water temperatures and the system is more vulnerable to clogged pores and mineral dissolution as the equilibrium state is affected by recharge and withdrawal. When oversaturation is indicated for iron minerals, plugging of aquifer materials may happen.

Predicting Recreational Water Quality Using Turbidity in the Cuyahoga River, Cuyahoga Valley National Park, Ohio, 2004-7

USGS Publications Warehouse

Brady, Amie M.G.; Bushon, Rebecca N.; Plona, Meg B.

2009-01-01

The Cuyahoga River within Cuyahoga Valley National Park (CVNP) in Ohio is often impaired for recreational use because of elevated concentrations of bacteria, which are indicators of fecal contamination. During the recreational seasons (May through August) of 2004 through 2007, samples were collected at two river sites, one upstream of and one centrally-located within CVNP. Bacterial concentrations and turbidity were determined, and streamflow at time of sampling and rainfall amounts over the previous 24 hours prior to sampling were ascertained. Statistical models to predict Escherichia coli (E. coli) concentrations were developed for each site (with data from 2004 through 2006) and tested during an independent year (2007). At Jaite, a sampling site near the center of CVNP, the predictive model performed better than the traditional method of determining the current day's water quality using the previous day's E. coli concentration. During 2007, the Jaite model, based on turbidity, produced more correct responses (81 percent) and fewer false negatives (3.2 percent) than the traditional method (68 and 26 percent, respectively). At Old Portage, a sampling site just upstream from CVNP, a predictive model with turbidity and rainfall as explanatory variables did not perform as well as the traditional method. The Jaite model was used to estimate water quality at three other sites in the park; although it did not perform as well as the traditional method, it performed well - yielding between 68 and 91 percent correct responses. Further research would be necessary to determine whether using the Jaite model to predict recreational water quality elsewhere on the river would provide accurate results.

Characterization of water quality and suspended sediment during cold-season flows, warm-season flows, and stormflows in the Fountain and Monument Creek watersheds, Colorado, 2007–2015

USGS Publications Warehouse

Miller, Lisa D.; Stogner, Sr., Robert W.

2017-09-01

From 2007 through 2015, the U.S. Geological Survey, in cooperation with Colorado Springs City Engineering, conducted a study in the Fountain and Monument Creek watersheds, Colorado, to characterize surface-water quality and suspended-sediment conditions for three different streamflow regimes with an emphasis on characterizing water quality during storm runoff. Data collected during this study were used to evaluate the effects of stormflows and wastewater-treatment effluent discharge on Fountain and Monument Creeks in the Colorado Springs, Colorado, area. Water-quality samples were collected at 2 sites on Upper Fountain Creek, 2 sites on Monument Creek, 3 sites on Lower Fountain Creek, and 13 tributary sites during 3 flow regimes: cold-season flow (November–April), warm-season flow (May–October), and stormflow from 2007 through 2015. During 2015, additional samples were collected and analyzed for Escherichia coli (E. coli) during dry weather conditions at 41 sites, located in E. coli impaired stream reaches, to help identify source areas and scope of the impairment.Concentrations of E. coli, total arsenic, and dissolved copper, selenium, and zinc in surface-water samples were compared to Colorado in-stream standards. Stormflow concentrations of E. coli frequently exceeded the recreational use standard of 126 colonies per 100 milliliters at main-stem and tributary sites by more than an order of magnitude. Even though median E. coli concentrations in warm-season flow samples were lower than median concentrations in storm-flow samples, the water quality standard for E. coli was still exceeded at most main-stem sites and many tributary sites during warm-season flows. Six samples (three warm-season flow and three stormflow samples) collected from Upper Fountain Creek, upstream from the confluence of Monument Creek, and two stormflow samples collected from Lower Fountain Creek, downstream from the confluence with Monument Creek, exceeded the acute water-quality standard for total arsenic of 50 micrograms per liter. All concentrations of dissolved copper, selenium, and zinc measured in samples were below the water-quality standard.Concentrations of dissolved nitrate plus nitrite generally increased from upstream to downstream during all flow periods. The largest downstream increase in dissolved nitrate plus nitrite concentration was measured between sites 07103970 and 07104905 on Monument Creek. All but one tributary that drain into Monument Creek between the two sites had higher median nitrate plus nitrite concentrations than the nearest upstream site on Monument Creek, site 07103970 (MoCr_Woodmen). Increases in the concentration of dissolved nitrate plus nitrite were also evident below wastewater treatment plants located on Fountain Creek.Most stormflow concentrations of dissolved trace elements were smaller than concentrations from cold-season flow or warm-season samples. However, median concentrations of total arsenic, lead, manganese, nickel, and zinc generally were much larger during periods of stormflow than during cold-season flow or warm-season fl. Median concentrations of total arsenic, total copper, total lead, dissolved and total manganese, total nickel, dissolved and total selenium, and dissolved and total zinc concentrations increased from 1.5 to 28.5 times from site 07103700 (FoCr_Manitou) to 07103707 (FoCr_8th) during cold-season and warm-season flows, indicating a large source of trace elements between these two sites. Both of these sites are located on Fountain Creek, upstream from the confluence with Monument Creek.Median suspended-sediment concentrations and median suspended-sediment loads increased in the downstream direction during all streamflow regimes between Monument Creek sites 07103970 (MoCr_Woodmen) and 07104905 (MoCr_Bijou); however, statistically significant increase (p-value less than 0.05) were only present during warm-season flow and stormflow. Significant increases in median suspended sediment concentrations were measured during cold-season flow and warm-season flow between Upper Fountain Creek site 07103707 (FoCr_8th) and Lower Fountain Creek site 07105500 (FoCr_Nevada) because of inflows from Monument Creek with higher suspended-sediment concentrations. Median suspended-sediment concentrations between sites 07104905 (MoCr_Bijou) and 07105500 (FoCr_Nevada) increased significantly during warm-season flow but showed no significant differences during cold-season flow and stormflow. Significant decreases in median suspended-sediment concentrations were measured between sites 07105500 (FoCr_Nevada) and 07105530 (FoCr_Janitell) during all flow regimes.Suspended-sediment concentrations, discharges, and yields associated with stormflow were significantly larger than those associated with warm-season flow. Although large spatial variations in suspended-sediment yields occurred during warm-season flows, the suspended-sediment yield associated with stormflow were as much as 1,000 times larger than the suspended-sediment yields that occurred during warm-season flow. 

Hydrogeochemical exploration: a reconnaissance study on northeastern Seward Peninsula, Alaska: Chapter A in Studies by the U.S. Geological Survey in Alaska, vol. 15

USGS Publications Warehouse

Graham, Garth E.; Taylor, Ryan D.; Buckley, Steve

2015-01-01

A reconnaissance hydrogeochemical study employing high-resolution/high-sensitivity inductively coupled plasma mass spectrometry analysis of stream and seep water samples (n= 171) was conducted in an area of limited bedrock exposure on the northeastern Seward Peninsula, Alaska. Sampling was focused in drainages around four main areas—at the Anugi Pb-Zn-Ag occurrence and in streams upstream of historically and currently mined placer gold deposits in the Candle Creek, Utica, and Monument Mountain areas. The objective of the study was to determine whether distribution of elevated metal concentrations in water samples could “see” through sediment cover and provide evidence of bedrock sources for base metals and gold. Some observations include (1) elevated Ag, As, Pb, and Zn concentrations relative to the study area as a whole in stream and seep samples from over and downstream of part of the Anugi Pb-Zn-Ag prospect; (2) abrupt downstream increases in Tl and Sb ± Au concentrations coincident with the upstream termination of productive placer deposits in the Inmachuk and Old Glory Creek drainages near Utica; (3) high K, Mo, Sb, and F throughout much of the Inmachuk River drainage near Utica; and (4) elevated As ± base metals and Au at two sites along Patterson Creek near the town of Candle and three additional contiguous sites identified when an 85th percentile cut-off was employed. Molybdenum ± gold concentrations (>90th percentile) were also measured in samples from three sites on Glacier Creek near Monument Mountain. The hydrogeochemistry in some areas is consistent with limited stream-sediment data from the region, including high Pb-Zn-Ag-As concentrations associated with Anugi, as well as historical reports of arsenopyrite-bearing veins upstream of placer operations in Patterson Creek. Chemistry of samples in the Inmachuk River-Old Glory Creek area also suggest more laterally extensive stibnite- (and gold-?) bearing veining than is currently known in the Old Glory Creek drainage. Our results indicate that hydrogeochemistry can be a useful method of geochemical exploration and offer targets for follow-up rock, soil, and subsurface sampling to ascertain the presence of mineralized bedrock.

Contribution of waste water treatment plants to pesticide toxicity in agriculture catchments.

PubMed

Le, Trong Dieu Hien; Scharmüller, Andreas; Kattwinkel, Mira; Kühne, Ralph; Schüürmann, Gerrit; Schäfer, Ralf B

2017-11-01

Pesticide residues are frequently found in water bodies and may threaten freshwater ecosystems and biodiversity. In addition to runoff or leaching from treated agricultural fields, pesticides may enter streams via effluents from wastewater treatment plants (WWTPs). We compared the pesticide toxicity in terms of log maximum Toxic Unit (log mTU) of sampling sites in small agricultural streams of Germany with and without WWTPs in the upstream catchments. We found an approximately half log unit higher pesticide toxicity for sampling sites with WWTPs (p < 0.001). Compared to fungicides and insecticides, herbicides contributed most to the total pesticide toxicity in streams with WWTPs. A few compounds (diuron, terbuthylazin, isoproturon, terbutryn and Metazachlor) dominated the herbicide toxicity. Pesticide toxicity was not correlated with upstream distance to WWTP (Spearman's rank correlation, rho = - 0.11, p > 0.05) suggesting that other context variables are more important to explain WWTP-driven pesticide toxicity. Our results suggest that WWTPs contribute to pesticide toxicity in German streams. Copyright © 2017 Elsevier Inc. All rights reserved.

Lagrangian sampling of wastewater treatment plant effluent in Boulder Creek, Colorado, and Fourmile Creek, Iowa, during the summer of 2003 and spring of 2005--Hydrological and chemical data

USGS Publications Warehouse

Barber, Larry B.; Keefe, Steffanie H.; Kolpin, Dana W.; Schnoebelen, Douglas J.; Flynn, Jennifer L.; Brown, Gregory K.; Furlong, Edward T.; Glassmeyer, Susan T.; Gray, James L.; Meyer, Michael T.; Sandstrom, Mark W.; Taylor, Howard E.; Zaugg, Steven D.

2011-01-01

This report presents methods and data for a Lagrangian sampling investigation into chemical loading and in-stream attenuation of inorganic and organic contaminants in two wastewater treatment-plant effluent-dominated streams: Boulder Creek, Colorado, and Fourmile Creek, Iowa. Water-quality sampling was timed to coincide with low-flow conditions when dilution of the wastewater treatment-plant effluent by stream water was at a minimum. Sample-collection times corresponded to estimated travel times (based on tracer tests) to allow the same "parcel" of water to reach downstream sampling locations. The water-quality data are linked directly to stream discharge using flow- and depth-integrated composite sampling protocols. A range of chemical analyses was made for nutrients, carbon, major elements, trace elements, biological components, acidic and neutral organic wastewater compounds, antibiotic compounds, pharmaceutical compounds, steroid and steroidal-hormone compounds, and pesticide compounds. Physical measurements were made for field conditions, stream discharge, and time-of-travel studies. Two Lagrangian water samplings were conducted in each stream, one in the summer of 2003 and the other in the spring of 2005. Water samples were collected from five sites in Boulder Creek: upstream from the wastewater treatment plant, the treatment-plant effluent, and three downstream sites. Fourmile Creek had seven sampling sites: upstream from the wastewater treatment plant, the treatment-plant effluent, four downstream sites, and a tributary. At each site, stream discharge was measured, and equal width-integrated composite water samples were collected and split for subsequent chemical, physical, and biological analyses. During the summer of 2003 sampling, Boulder Creek downstream from the wastewater treatment plant consisted of 36 percent effluent, and Fourmile Creek downstream from the respective wastewater treatment plant was 81 percent effluent. During the spring of 2005 samplings, Boulder Creek downstream from the wastewater treatment plant was 40 percent effluent, and Fourmile Creek downstream from that wastewater treatment plant was 28 percent effluent. At each site, 300 individual constituents were determined to characterize the water. Most of the inorganic constituents were detected in all of the stream and treatment-plant effluent samples, whereas detection of synthetic organic compounds was more limited and contaminants typically occurred only in wastewater treatment-plant effluents and at downstream sites. Concentrations ranged from nanograms per liter to milligrams per liter.

Water-quality data for the Ohio River from New Cumberland Dam to Pike Island Dam, West Virginia and Ohio, June-November 1992

USGS Publications Warehouse

Miller, Kimberly F.; Faulkenburg, C.W.; Chambers, D.B.; Waldron, M.C.

1995-01-01

This report contains water-quality data for the Ohio River, collected during the summer and fall of 1992, from river mile 51.1 (3.3 miles upstream from New Cumberland Dam) to river mile 84.0 (0.2 miles upstream from Pike Island Dam). The data were collected to assess the effects of hydropower development on water quality. Water quality was determined by a combination of repeated synoptic field measurements and laboratory analyses. Synoptic measurements were made along a longitudinal transect with 18 mid-channel sampling sites; cross-sectional transects of water quality were measured at 5 of these sites. Water-quality measurements also were made at two sites located on the back-channel (Ohio) side of Browns Island. Water temperature, dissolved oxygen concentration, pH, and specific conductance were measured at each longitudinal-transect and back-channel sampling site. Longitudinal-transect and back-channel stations were sampled at three depths (about 3.3 feet below the surface of the water, middle of the water column, and near the bottom of the river). Cross-sectional transects consisted of three or four detailed vertical pro- files of the same characteristics. Water samples were collected from three depths at the mid-channel vertical profile in each cross-sectional transect and were analyzed for concentrations of phyto- plankton photosynthetic pigments chlorophyll a and chlorophyll b. Estimates of the depth of light penetration (Secchi disk transparency) were made at pigment-sampling locations whenever light and river-surface conditions were appropriate. Synoptic sampling usually was completed in 12 hours or less and was repeated seven times between June 25 and November 6, 1992.

Logistic model of nitrate in streams of the upper-midwestern United States

USGS Publications Warehouse

Mueller, D.K.; Ruddy, B.C.; Battaglin, W.A.

1997-01-01

Nitrate in surface water can have adverse effects on aquatic life and, in drinking-water supplies, can be a risk to human health. As part of a regional study, nitrates as N (NO3-N) was analyzed in water samples collected from streams throughout 10 Midwestern states during synoptic surveys in 1989, 1990, and 1994. Data from the period immediately following crop planting at 124 sites were analyzed during logistic regression to relate discrete categories of NO3-N concentrations to characteristics of the basins upstream from the sites. The NO3-N data were divided into three categories representing probable background concentrations (10 mg L-1). Nitrate-N concentrations were positively correlated to streamflow, upstream area planted in corn (Zea mays L.), and upstream N- fertilizers application rates. Elevated NO3-N concentrations were associated with poorly drained soils and were weakly correlated with population density. Nitrate-N and streamflow data collected during 1989 and 1990 were used to calibrate the model, and data collected during 1994 were used for verification. The model correctly estimated NO3-N concentration categories for 79% of the samples in the calibration data set and 60% of the samples in the verification data set. The model was used to indicate where NO3-N concentrations might be elevated or exceed the NO3-N MCL in streams throughout the study area. The potential for elevated NO3-N concentrations was predicted to be greatest for streams in Illinois, Indiana, Iowa, and western Ohio.

Evaluation of Streamflow Gain-Loss Characteristics of Hubbard Creek, in the Vicinity of a Mine-Permit Area, Delta County, Colorado, 2007

USGS Publications Warehouse

Ruddy, Barbara C.; Williams, Cory A.

2007-01-01

In 2007, the U.S. Geological Survey, in cooperation with Bowie Mining Company, initiated a study to characterize the streamflow and streamflow gain-loss in a reach of Hubbard Creek in Delta County, Colorado, in the vicinity of a mine-permit area planned for future coal mining. Premining streamflow characteristics and streamflow gain-loss variation were determined so that pre- and postmining gain-loss characteristics could be compared. This report describes the methods used in this study and the results of two streamflow-measurement sets collected during low-flow conditions. Streamflow gain-loss measurements were collected using rhodamine WT and sodium bromide tracers at four sites spanning the mine-permit area on June 26-28, 2007. Streamflows were estimated and compared between four measurement sites within three stream subreaches of the study reach. Data from two streamflow-gaging stations on Hubbard Creek upstream and downstream from the mine-permit area were evaluated. Streamflows at the stations were continuous, and flow at the upstream station nearly always exceeded the streamflow at the downstream station. Furthermore, streamflow at both stations showed similar diurnal patterns with traveltime offsets. On June 26, streamflow from the gain-loss measurements was greater at site 1 (most upstream site) than at site 4 (most downstream site); on June 27, streamflow was greater at site 4 than at site 2; and on June 27, there was no difference in streamflow between sites 2 and 3. Data from streamflow-gaging stations 09132940 and 09132960 showed diurnal variations and overall decreasing streamflow over time. The data indicate a dynamic system, and streamflow can increase or decrease depending on hydrologic conditions. The streamflow within the study reach was greater than the streamflows at either the upstream or downstream stations. A second set of gain-loss measurements was collected at sites 2 and 4 on November 8-9, 2007. On November 8, streamflow was greater at site 4 than at site 2, and on the following day, November 9, streamflow was greater at site 2 than at site 4. Data collection on November 8 occurred while the streamflow was increasing due to contributions from stream ice melting throughout different parts of the basin. Data collection on November 9 occurred earlier in the day with less stream ice melting and more steady-state conditions, so the indication that streamflow decreased between sites 2 and 4 may be more accurate. Diurnal variations in streamflow are common at both the upper and the lower streamflow-gaging stations. The upper streamflow-gaging station shows a melt-freeze influence from tributaries to Hubbard Creek during the winter season. Downstream from the study reach, observed diurnal variation is likely due to evapotranspiration associated with dense flood-plain vegetation, which consumes water from the creek during the middle of the day. Varying diurnal patterns in streamflow, combined with possible variations in tributary inflows to Hubbard Creek in the study reach, probably account for the observed variations in streamflow at the tracer measurement sites. During both sampling periods in June and November 2007, conditions were less than ideal and not steady state. The June 27 sampling indicates that the streamflow was increasing between measurement sites 2 and 4, and the November 9 sampling indicates that the streamflow was decreasing between measurement sites 2 and 4. The data collected during the diurnal and day-to-day variations in streamflow indicated that the streamflow reach is dynamic and can be gaining, losing, or constant.

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Water-Quality Conditions of Chester Creek, Anchorage, Alaska, 1998-2001

USGS Publications Warehouse

Glass, Roy L.; Ourso, Robert T.

2006-01-01

Between October 1998 and September 2001, the U.S. Geological Survey's National Water-Quality Assessment Program evaluated the water-quality conditions of Chester Creek, a stream draining forest and urban settings in Anchorage, Alaska. Data collection included water, streambed sediments, lakebed sediments, and aquatic organisms samples from urban sites along the stream. Urban land use ranged from less than 1 percent of the basin above the furthest upstream site to 46 percent above the most downstream site. Findings suggest that water quality of Chester Creek declines in the downstream direction and as urbanization in the watershed increases. Water samples were collected monthly and during storms at a site near the stream's mouth (Chester Creek at Arctic Boulevard) and analyzed for major ions and nutrients. Water samples collected during water year 1999 were analyzed for selected pesticides and volatile organic compounds. Concentrations of fecal-indicator bacteria were determined monthly during calendar year 2000. During winter, spring, and summer, four water samples were collected at a site upstream of urban development (South Branch of South Fork Chester Creek at Tank Trail) and five from an intermediate site (South Branch of South Fork Chester Creek at Boniface Parkway). Concentrations of calcium, magnesium, sodium, chloride, and sulfate in water increased in the downstream direction. Nitrate concentrations were similar at the three sites and all were less than the drinking-water standard. About one-quarter of the samples from the Arctic Boulevard site had concentrations of phosphorus that exceeded the U.S. Environmental Protection Agency (USEPA) guideline for preventing nuisance plant growth. Water samples collected at the Arctic Boulevard site contained concentrations of the insecticide carbaryl that exceeded the guideline for protecting aquatic life. Every water sample revealed a low concentration of volatile organic compounds, including benzene, toluene, tetrachloroethylene, methyl tert-butyl ether, and chloroform. No water samples contained volatile organic compounds concentrations that exceeded any USEPA drinking-water standard or guideline. Fecal-indicator bacteria concentrations in water from the Arctic Boulevard site commonly exceeded Federal and State guidelines for water-contact recreation. Concentrations of cadmium, copper, lead, and zinc in streambed sediments increased in the downstream direction. Some concentrations of arsenic, chromium, lead, and zinc in sediments were at levels that can adversely affect aquatic organisms. Analysis of sediment chemistry in successive lakebed-sediment layers from Westchester Lagoon near the stream's mouth provided a record of water-quality trends since about 1970. Concentrations of lead have decreased from peak levels in the mid-1970s, most likely because of removing lead from gasoline and lower lead content in other products. However, concen-trations in recently-deposited lakebed sediments are still about 10 times greater than measured in streambed sediments at the upstream Tank Trail site. Zinc concentrations in lakebed sediments also increased in the early 1970s to levels that exceeded guidelines to protect aquatic life and have remained at elevated but variable levels. Pyrene, benz[a]anthracene, and phenanthrene in lakebed sediments also have varied in concentrations and have exceeded protection guidelines for aquatic life since the 1970s. Concentrations of dichloro-diphenyl-trichloroethane, polychlorinated biphenyls (PCBs), or their by-products generally were highest in lakebed sediments deposited in the 1970s. More recent sediments have concentrations that vary widely and do not show distinct temporal trends. Tissue samples of whole slimy sculpin (Cottus cognatus), a non-migratory species of fish, showed con-centrations of trace elements and organic contaminants. Of the constituents analyzed, only selenium concentra-tions showed levels of potential concern for

Suspended sediments from upstream tributaries as the source of downstream river sites

NASA Astrophysics Data System (ADS)

Haddadchi, Arman; Olley, Jon

2014-05-01

Understanding the efficiency with which sediment eroded from different sources is transported to the catchment outlet is a key knowledge gap that is critical to our ability to accurately target and prioritise management actions to reduce sediment delivery. Sediment fingerprinting has proven to be an efficient approach to determine the sources of sediment. This study examines the suspended sediment sources from Emu Creek catchment, south eastern Queensland, Australia. In addition to collect suspended sediments from different sites of the streams after the confluence of tributaries and outlet of the catchment, time integrated suspended samples from upper tributaries were used as the source of sediment, instead of using hillslope and channel bank samples. Totally, 35 time-integrated samplers were used to compute the contribution of suspended sediments from different upstream waterways to the downstream sediment sites. Three size fractions of materials including fine sand (63-210 μm), silt (10-63 μm) and fine silt and clay (<10 μm) were used to find the effect of particle size on the contribution of upper sediments as the sources of sediment after river confluences. And then samples were analysed by ICP-MS and -OES to find 41 sediment fingerprints. According to the results of Student's T-distribution mixing model, small creeks in the middle and lower part of the catchment were major source in different size fractions, especially in silt (10-63 μm) samples. Gowrie Creek as covers southern-upstream part of the catchment was a major contributor at the outlet of the catchment in finest size fraction (<10 μm) Large differences between the contributions of suspended sediments from upper tributaries in different size fractions necessitate the selection of appropriate size fraction on sediment tracing in the catchment and also major effect of particle size on the movement and deposition of sediments.

Distribution of spawning activity by anadromous fishes in an atlantic slope drainage after removal of a low-head dam

USGS Publications Warehouse

Burdick, S.M.; Hightower, J.E.

2006-01-01

In 1998, the Quaker Neck Dam was removed from the Neuse River near Goldsboro, North Carolina, restoring access to more than 120 km of potential main-stem spawning habitat and 1,488 km of potential tributary spawning habitat to anadromous fishes. We used plankton sampling and standardized electrofishing to examine the extent to which anadromous fishes utilized this restored spawning habitat in 2003 and 2004. Evidence of spawning activity was detected upstream of the former dam site for three anadromous species: American shad Alosa sapidissima, hickory shad A. mediocris, and striped bass Morone saxatilis. The percentages of eggs and larvae collected in the restored upstream habitat were greater in 2003, when spring flows were high, than in 2004. River reaches where spawning occurred were estimated from egg stage and water velocity data. Spawning of American shad and striped bass occurred primarily in main-stem river reaches that were further upstream during the year of higher spring flows. Hickory shad generally spawned in downstream reaches and in tributaries above and below the former dam site. These results demonstrate that anadromous fishes will take advantage of upper basin spawning habitat restored through dam removal as long as instream flows are adequate to facilitate upstream migration.

The impact of on-site wastewater from high density cluster developments on groundwater quality

NASA Astrophysics Data System (ADS)

Morrissey, P. J.; Johnston, P. M.; Gill, L. W.

2015-11-01

The net impact on groundwater quality from high density clusters of unsewered housing across a range of hydro(geo)logical settings has been assessed. Four separate cluster development sites were selected, each representative of different aquifer vulnerability categories. Groundwater samples were collected on a monthly basis over a two year period for chemical and microbiological analysis from nested multi-horizon sampling boreholes upstream and downstream of the study sites. The field results showed no statistically significant difference between upstream and downstream water quality at any of the study areas, although there were higher breakthroughs in contaminants in the High and Extreme vulnerability sites linked to high intensity rainfall events; these however, could not be directly attributed to on-site effluent. Linked numerical models were then built for each site using HYDRUS 2D to simulate the attenuation of contaminants through the unsaturated zone from which the resulting hydraulic and contaminant fluxes at the water table were used as inputs into MODFLOW MT3D models to simulate the groundwater flows. The results of the simulations confirmed the field observations at each site, indicating that the existing clustered on-site wastewater discharges would only cause limited and very localised impacts on groundwater quality, with contaminant loads being quickly dispersed and diluted downstream due to the relatively high groundwater flow rates. Further simulations were then carried out using the calibrated models to assess the impact of increasing cluster densities revealing little impact at any of the study locations up to a density of 6 units/ha with the exception of the Extreme vulnerability site.

Spatial and temporal patterns of micropollutants in streams and effluent of 24 WWTPs across Switzerland

NASA Astrophysics Data System (ADS)

Schönenberger, Urs; Spycher, Barbara; Kistler, David; Burdon, Frank; Reyes, Marta; Eggen, Rik; Joss, Adriano; Singer, Heinz; Stamm, Christian

2016-04-01

Treated municipal wastewater is an important source of micropollutants entering the environment. Micropollutants are a diverse range of chemicals of which concentrations vary strongly in space and time. To better quantitatively understand the spatio-temporal patterns of micropollutants in streams, we compared upstream and downstream locations at 24 wastewater treatment plants (WWTPs) across the Swiss Plateau and Jura regions. Each site represents the most upstream treatment plant in the corresponding catchment. In 2013, a broad analytical screening was applied to samples collected at 12 sites during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 at 12 additional sites were analysed for a group of approximately 60 selected organic micropollutants. The screening results demonstrate that generally, pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest share of the organic micropollutants in wastewater. Pesticides including biocides and plant protection products are also regularly found, but at lower concentrations. The opposite holds true for the concentration variability: pesticides vary the most across time and space, while pharmaceuticals exhibit more stable concentrations. Heavy metals fluctuate to a similar degree as pharmaceuticals. Principal component analyses suggest that pesticide and pharmaceutical levels at both upstream locations and in the wastewater vary independently of each other. At the upstream locations, the pesticide levels increased with the proportion of arable land in the watershed, whilst decreasing with greater cover of pasture and forest. Interestingly, the same patterns hold true for the composition of wastewater when considering land use in the catchments of the WWTPs. This suggests that pesticide-intensive agricultural crops not only impact surface water quality via diffuse pollution but also increase levels of pesticides in wastewater discharged to the streams. As a consequence, catchment land uses and effluent composition appear to be inextricably bound.

Factors affecting food chain transfer of mercury in the vicinity of the Nyanza site, Sudbury River, Massachusetts

USGS Publications Warehouse

Haines, T.A.; May, T.W.; Finlayson, R.T.; Mierzykowski, S.E.

2003-01-01

The influence of the Nyanza Chemical Waste Dump Superfund Site on the Sudbury River, Massachusetts, was assessed by analysis of sediment, fish prey organisms, and predator fish from four locations in the river system. Whitehall Reservoir is an impoundment upstream of the site, and Reservoir #2 is an impoundment downstream of the site. Cedar Street is a flowing reach upstream of the site, and Sherman Bridge is a flowing reach downstream of the site. Collections of material for analysis were made three times, in May, July, and October. Sediment was analyzed for acid-volatile sulfide (AVS), simultaneously-extracted (SEM) metals (As, Cd, Cr, Hg, Pb, Sb, Zn), and total recoverable Hg. The dominant predatory fish species collected at all sites, largemouth bass (Micropterus salmoides), was analyzed for the same suite of metals as sediment. Analysis of stomach contents of bass identified small fish (yellow perch Perca flavescens, bluegill Lepomis macrochirus, and pumpkinseed Lepomis gibbosus), crayfish, and dragonfly larvae as the dominant prey organisms. Samples of the prey were collected from the same locations and at the same times as predator fish, and were analyzed for total and methyl mercury. Results of AVS and SEM analyses indicated that sediments were not toxic to aquatic invertebrates at any site. The SEM concentrations of As, Cd, and Cr were significantly higher at Reservoir #2 than at the reference sites, and SEM As and Cd were significantly higher at Sherman Bridge than at Cedar St. Sediment total Hg was elevated only at Reservoir #2. Hg was higher at site-influenced locations in all fish species except brown bullhead (Ameiurus nebulosus). Cd was higher in bluegill, black crappie (Pomoxis nigromaculatus), and brown bullhead, and Cr was higher in largemouth bass fillet samples but not in whole-body samples. There were no seasonal differences in sediment or prey organism metals, but some metals in some fish species did vary over time in an inconsistent manner. Predator fish Hg concentration was significantly linearly related to weighted prey organism methyl Hg concentration. Largemouth bass Hg was significantly lower at Reservoir #2 in our study than in previous investigations in 1989 and 1990. High concentrations of inorganic Hg remain in river sediment as a result of operation of the Nyanza site, and fish Hg concentrations in river reaches downstream of the site are elevated compared to upstream reference sites. However, the differences are relatively small and Hg concentrations in largemouth bass from the site-influenced locations are no higher than those from some other, nearby uncontaminated sites. We hypothesize that this results from burial of contaminated sediment with cleaner material, which reduces bioavailability of contaminants and possibly reduces methylation of mercury.

Stress and recovery of aquatic organisms as related to highway construction along Turtle Creek, Boone County, West Virginia

USGS Publications Warehouse

Chisholm, James L.; Downs, Sanford C.

1978-01-01

During and after construction of Appalachian Corridor G, a divided, four-lane highway, five benthic invertebrate samples were collected at each of four sites on Turtle Creek, and, for comparative purposes, three samples were collected at each of two sites on Lick Creek, an adjacent undisturbed stream. Diversity index, generic count, and total count initially indicated severe depletion or destruction of the benthos of Turtle Creek, but, within 1 year after highway construction was completed, the benthic community of Turtle Creek was similar to that of Lick Creek. The greatest degradation occurred near the headwaters of Turtle Creek because of erratic movement of sediment resulting from high streamflow velocity. Diversity indices ranged from 0 to 3.41 near the headwaters in the original channel, but only from 0.94 to 2.42 farther downstream in a freshly cut channel. The final samples from Turtle Creek, which were similar to those taken from Lick Creek at the same time, had generic counts of 10 at the most upstream site and 16 near the mouth. A total of 147 organisms was found near the headwaters, whereas a total of 668 was found near the mouth of the stream. The total number of organisms collected at each site was proportional to the drainage area upstream from the site. As a result of tributary inflow from unaltered drainage areas and organism drift, rapid repopulation and stabilization of the benthic community occurred. Channel relocation, bank recontouring, and reseeding also accelerated the recovery of the benthic community.

Assessment of biological conditions at selected stream sites in Johnson County, Kansas, and Cass and Jackson Counties, Missouri, 2003 and 2004

USGS Publications Warehouse

Poulton, Barry C.; Rasmussen, Teresa J.; Lee, Casey J.

2007-01-01

Macroinvertebrate samples were collected at 15 stream sites representing 11 different watersheds in Johnson County, Kansas, in 2003 and 2004 to assess biological conditions in streams and relations to environmental variables. Published data from an additional seven stream sites, one in Johnson County, Kansas, and six others in adjacent Cass and Jackson Counties in Missouri also were evaluated. Multimetric scores, which integrated a combination of measures that describe various aspects of biological community abundance and diversity, were used to evaluate and compare the biological health of streams. In addition, for 15 of 16 Johnson County stream sites, environmental data (streamflow, precipitation, and land use) and water- and sediment-quality data (primarily nutrients, indicator bacteria, and organic wastewater compounds) were used in statistical analyses to evaluate relations between macroinvertebrate metrics and variables that may affect them. The information is useful for defining current conditions, evaluating conditions relative to State aquatic-life support and total maximum daily load requirements, evaluating effects of urbanization, developing effective water-quality management plans, and documenting changes in biological condition and water quality.Biological conditions in selected Johnson County streams generally reflected a gradient in the degree of human disturbances upstream from the sites, including percentage of urban and agricultural land use as well as the presence, absence, and proximity of wastewater treatment discharges. In this report, the term gradient is used to describe a continuum in the conditions (biological, environmental, or land use) observed at the study sites. Upstream Blue River sites, downstream from primarily agricultural land use, consistently scored among the sites least impacted by human disturbance, and in some metrics these sites scored higher than the State reference site (Captain Creek). The term impact, as used in this report, refers to a negative biological response at a site associated with one or more human-induced sources of disturbance or stress. However, no sites, including the Captain Creek reference site, met Kansas Department of Health and Environment criteria for full support of aquatic life during the 2 years of sample collection. Upstream sites on Kill and Cedar Creeks also consistently scored among the least impacted. Sites less than 3 miles downstream from municipal wastewater treatment facility discharges (two Indian Creek sites) and sites with no wastewater discharge but with substantial impervious surface area within their respective watersheds (Tomahawk, Turkey, and Brush Creeks) consistently scored among the sites most impacted by human disturbance.

Pharmaceuticals and other organic chemicals in selected north-central and northwestern Arkansas streams

USGS Publications Warehouse

Haggard, B.E.; Galloway, J.M.; Green, W.R.; Meyer, M.T.

2006-01-01

Recently, our attention has focused on the low level detection of many antibiotics, pharmaceuticals, and other organic chemicals in water resources. The limited studies available suggest that urban or rural streams receiving wastewater effluent are more susceptible to contamination. The purpose of this study was to evaluate the occurrence of antibiotics, pharmaceuticals, and other organic chemicals at 18 sites on seven selected streams in Arkansas, USA, during March, April, and August 2004. Water samples were collected upstream and downstream from the influence of effluent discharges in northwestern Arkansas and at one site on a relatively undeveloped stream in north-central Arkansas. At least one antibiotic, pharmaceutical, or other organic chemical was detected at all sites, except at Spavinaw Creek near Mayesville, Arkansas. The greatest number of detections was observed at Mud Creek downstream from an effluent discharge, including 31 pharmaceuticals and other organic chemicals. The detection of these chemicals occurred in higher frequency at sites downstream from effluent discharges compared to those sites upstream from effluent discharges; total chemical concentration was also greater downstream. Wastewater effluent discharge increased the concentrations of detergent metabolites, fire retardants, fragrances and flavors, and steroids in these streams. Antibiotics and associated degradation products were only found at two streams downstream from effluent discharges. Overall, 42 of the 108 chemicals targeted in this study were found in water samples from at least one site, and the most frequently detected organic chemicals included caffeine, phenol, para-cresol, and acetyl hexamethyl tetrahydro naphthalene (AHTN). ?? ASA, CSSA, SSSA.

Hydrologic Data Summary for the Northeast Creek/Fresh Meadow Estuary, Acadia National Park, Maine, 2000-2001

USGS Publications Warehouse

Caldwell, James M.; Culbertson, Charles W.

2007-01-01

The U.S. Geological Survey, in cooperation with the National Park Service, collected data in Northeast Creek estuary, Mt. Desert Island, Maine, to establish baseline water-quality conditions including estuarine nutrient concentrations. Five sampling sites in Northeast Creek were established and monitored continuously for temperature and specific conductance during May to November, 2000 and 2001. Stream stage, which was affected by ocean tidal dynamics, was recorded at the most downstream site and at one upstream site. Discrete water samples for nutrient concentrations were collected biweekly during May to November, 2000 and 2001, at the five sampling sites, and an additional site seaward of the estuary mouth. Results indicated that the salinity regime of Northeast Creek estuary is dynamic and highly regulated by strong seasonal variations in freshwater runoff, as well as limited seawater exchange caused by a constriction at the bridge, at the downstream end of the estuary. Oligohaline conditions (0.5-5 practical salinity units) occasionally extend to the estuary mouth. During other periods oligohaline and mesohaline (5-20 practical salinity units) conditions exist in some areas of the estuary; polyhaline/marine (20-35 practical salinity units) conditions occasionally exist near the mouth. A saltwater wedge in the bottom water, due to density stratification, was observed to migrate upstream as fresh surface-water inputs diminished during the onset of summer low-flow conditions. Although specific conductance ranged widely at most sites because of tidal influences, other water-quality constituents, including nutrient and chlorophyll-a concentrations, exhibited seasonal distribution patterns in which maximum levels generally occurred in early to mid-summer and again in the fall over both field seasons.

Occurrence of Organic Wastewater Compounds in the Tinkers Creek Watershed and Two Other Tributaries to the Cuyahoga River, Northeast Ohio

USGS Publications Warehouse

Tertuliani, J.S.; Alvarez, D.A.; Furlong, E.T.; Meyer, M.T.; Zaugg, S.D.; Koltun, G.F.

2008-01-01

The U.S. Geological Survey - in cooperation with the Ohio Water Development Authority; National Park Service; Cities of Aurora, Bedford, Bedford Heights, Solon, and Twinsburg; and Portage and Summit Counties - and in collaboration with the Ohio Environmental Protection Agency, did a study to determine the occurrence and distribution of organic wastewater compounds (OWCs) in the Tinkers Creek watershed in northeastern Ohio. In the context of this report, OWCs refer to a wide range of compounds such as antibiotics, prescription and nonprescription pharmaceuticals, personal-care products, household and industrial compounds (for example, antimicrobials, fragrances, surfactants, fire retardants, and so forth) and a variety of other chemicals. Canisters containing polar organic integrative sampler (POCIS) and semipermeable membrane device (SPMD) media were deployed instream for a 28-day period in Mayand June 2006 at locations upstream and downstream from seven wastewater-treatment-plant (WWTP) outfalls in the Tinkers Creek watershed, at a site on Tinkers Creek downstream from all WWTP discharges, and at one reference site each in two nearby watersheds (Yellow Creek and Furnace Run) that drain to the Cuyahoga River. Streambed-sediment samples also were collected at each site when the canisters were retrieved. POCIS and SPMDs are referred to as 'passive samplers' because they sample compounds that they are exposed to without use of mechanical or moving parts. OWCs detected in POCIS and SPMD extracts are referred to in this report as 'detections in water' because both POCIS and SPMDs provided time-weighted measures of concentration in the stream over the exposure period. Streambed sediments also reflect exposure to OWCs in the stream over a long period of time and provide another OWC exposure pathway for aquatic organisms. Four separate laboratory methods were used to analyze for 32 antibiotic, 20 pharmaceutical, 57 to 66 wastewater, and 33 hydrophobic compounds. POCIS and streambed-sediment extracts were analyzed by both the pharmaceutical and wastewater methods. POCIS extracts also were analyzed by the antibiotic method, and SPMD extracts were analyzed by the hydrophobic-compound method. Analytes associated with a given laboratory method are referred to in aggregate by the method name (for example, antibiotic-method analytes are referred to as 'antibiotic compounds') even though some analytes associated with the method may not be strictly classified as such. In addition, some compounds were included in the analyte list for more than one laboratory method. For a given sample matrix, individual compounds detected by more than one analytical method are included independently in counts for each method. A total of 12 antibiotic, 20 pharmaceutical, 41 wastewater, and 22 hydrophobic compounds were detected in water at one or more sites. Eight pharmaceutical and 37 wastewater compounds were detected in streambed sediments. The numbers of detections at reference sites tended to be in the low range of detection counts observed in the Tinkers Creek watershed for a given analytical method. Also, the total numbers of compounds detected in water and sediment at the reference sites were less than the total numbers of compounds detected at sites in the Tinkers Creek watershed. With the exception of hydrophobic compounds, it was common at most sites to have more compounds detected in samples collected downstream from WWTP outfalls than in corresponding samples collected upstream from the outfalls. This was particularly true for antibiotic, pharmaceutical, and wastewater compounds in water. In contrast, it was common to have more hydrophobic compounds detected in samples collected upstream from WWTP outfalls than downstream. Caffeine, fluoranthene, N,N-diethyl-meta-toluamide (DEET), phenanthrene, and pyrene were detected in water at all sites in the Tinkers Creek watershed, irrespective of whether the site was upstream or downs

A Reconnaissance of selected organic compounds in streams in tribal lands in Central Oklahoma, January-February 2009

USGS Publications Warehouse

Becker, Carol J.

2010-01-01

The U.S. Geological Survey worked in cooperation with the U.S. Environmental Protection Agency and the Kickapoo Tribe of Oklahoma on two separate reconnaissance projects carried out concurrently. Both projects entailed the use of passive samplers as a sampling methodology to investigate the detection of selected organic compounds at stream sites in jurisdictional areas of several tribes in central Oklahoma during January-February 2009. The focus of the project with the U.S. Environmental Protection Agency was the detection of pesticides and pesticide metabolites using Semipermeable Membrane Devices at five stream sites in jurisdictional areas of several tribes. The project with the Kickapoo Tribe of Oklahoma focused on the detection of pesticides, pesticide metabolites, polycyclic aromatic hydrocarbons, polychlorinated biphenyl compounds, and synthetic organic compounds using Semipermeable Membrane Devices and Polar Organic Chemical Integrative Samplers at two stream sites adjacent to the Kickapoo tribal lands. The seven stream sites were located in central Oklahoma on the Cimarron River, Little River, North Canadian River, Deep Fork, and Washita River. Extracts from SPMDs submerged at five stream sites, in cooperation with the U.S. Environmental Protection Agency, were analyzed for 46 pesticides and 6 pesticide metabolites. Dacthal, a pre-emergent herbicide, was detected at all five sites. Pendimethalin, also a pre-emergent, was detected at one site. The insecticides chlorpyrifos and dieldrin were detected at three sites and p,p'-DDE, a metabolite of the insecticide DDT, also was detected at three sites. SPMDs and POCIS were submerged at the upstream edge and downstream edge of the Kickapoo tribal boundaries. Both sites are downstream from the Oklahoma City metropolitan area and multiple municipal wastewater treatment plants. Extracts from the passive samplers were analyzed for 62 pesticides, 10 pesticide metabolites, 3 polychlorinated biphenyl compounds, 35 polycyclic aromatic hydrocarbons, and 49 synthetic organic compounds. Ten pesticides and four pesticide metabolites were detected at the upstream site and seven pesticides and four pesticide metabolites were detected at the downstream site. Pesticides detected at both sites were atrazine, chlorpyrifos, dacthal, dieldrin, metolachlor, pendimethalin, and trans-nonachlor. Additionally at the upstream site, heptachlor, pentachlorophenol, and prometon were detected. The pesticide metabolites p,p'-DDE, cis-chlordane, and trans-chlordane also were detected at both sites. Polychlorinated biphenyl compounds aroclor-1016/1242, aroclor-1254, and aroclor-1260 were detected at both sites. The upstream site had 16 polycyclic aromatic hydrocarbon detections and the downstream site had 8 detections. Because of chromatographic interference during analysis, a positive identification of 17 polycyclic aromatic hydrocarbons could not be made. Consequently, there may have been a greater number of these compounds detected at both sites. A total of 36 synthetic organic compounds were detected at the two sites adjacent to the Kickapoo tribal lands. The upstream site had 21 synthetic organic compound detections: three detergent metabolites, two fecal indicators, three flame retardants, seven industrial compounds, five compounds related to personal care products, and beta-sitosterol, a plant sterol. Fifteen synthetic organic compounds were detected at the downstream site and included: one fecal indicator, three flame retardants, six industrial compounds, and five compounds related to personal care products.

Distribution and speciation of metals (Cu, Zn, Cd, and Pb) in agricultural and non-agricultural soils near a stream upriver from the Pearl River, China.

PubMed

Yang, Silin; Zhou, Dequn; Yu, Huayong; Wei, Rong; Pan, Bo

2013-06-01

The distribution and chemical speciation of typical metals (Cu, Zn, Cd and Pb) in agricultural and non-agricultural soils were investigated in the area of Nanpan River, upstream of the Pearl River. The investigated four metals showed higher concentrations in agricultural soils than in non-agricultural soils, and the site located in factory district contained metals much higher than the other sampling sites. These observations suggested that human activities, such as water irrigation, fertilizer and pesticide applications might have a major impact on the distribution of metals. Metal speciation analysis presented that Cu, Zn and Cd were dominated by the residual fraction, while Pb was dominated by the reducible fraction. Because of the low mobility of the metals in the investigated area, no remarkable difference could be observed between upstream and downstream separated by the factory site. Copyright © 2013 Elsevier Ltd. All rights reserved.

Freshwater mussel shells as environmental chronicles: Geochemical and taphonomic signatures of mercury-related extirpations in the North Fork Holston River, Virginia

USGS Publications Warehouse

Brown, M.E.; Kowalewski, M.; Neves, R.J.; Cherry, D.S.; Schreiber, M.E.

2005-01-01

This study utilized freshwater mussel shells to assess mercury (Hg) contamination in the North Fork Holston River that extirpated (caused local extinctions of) a diverse mussel fauna. Shells (n = 366) were collected from five sites situated upstream (two sites), just below (one site), and downstream (two sites) of the town of Saltville, Virginia, where Hg was used to produce chlorine and caustic soda from 1950 to 1972. Shell samples were used to test the (1) utility of geochemical signatures of shells for assessing the spatial variation in Hg levels in the river relative to the contamination source and (2) value of taphonomy (postmortem shell alteration) for distinguishing sites that differ in extirpation histories. Geochemical signatures of 40 shells, analyzed using atomic absorption spectroscopy, indicated a strong longitudinal pattern. All shells from the two upstream sites had low Hg concentrations (<5-31 ??g/kg), shells directly below Saltville had variable, but dramatically higher concentrations (23-4637 ??g/kg), and shells from the two downstream sites displayed intermediate Hg levels (<5-115 ??g/kg) that declined with distance from Saltville. Two pre-industrial shells, collected at Saltville in 1917, yielded very low Hg estimates (5-6 ??g/kg). Hg signatures were consistent among mussel species, suggesting that Hg concentrations were invariant to species type; most likely, highly variable Hg levels, both across sites and through time, overwhelmed any interspecific differences in Hg acquisition. Also, a notable postmortem incorporation of Hg in mussel shells seemed unlikely, as the Hg content was not correlated with shell taphonomy (r = 0.18; p = 0.28). The taphonomic analysis (n = 366) showed that the degree of shell alteration reliably distinguished sites with different extirpation histories. At Saltville, where live mussels have been absent for at least 30 years, shells were most heavily altered and fragmented. Conversely, fresh-looking shells abounded upstream, where reproducing mussel populations are still present. In summary, relic shells offered valuable spatiotemporal data on Hg concentrations in a polluted ecosystem, and shell taphonomic signatures discriminated sites with different extirpation histories. The shell-based strategies exemplified here do not require sampling live specimens and may augment more standard strategies applied to environmental monitoring. The approach should prove especially useful in areas with unknown extirpation and pollution histories. ?? 2005 American Chemical Society.

Microbiological Water Quality in Relation to Water-Contact Recreation, Cuyahoga River, Cuyahoga Valley National Park, Ohio, 2000 and 2002

USGS Publications Warehouse

Bushon, Rebecca N.; Koltun, G.F.

2004-01-01

The microbiological water quality of a 23-mile segment of the Cuyahoga River within the Cuyahoga Valley National Park was examined in this study. This segment of the river receives discharges of contaminated water from stormwater, combined-sewer overflows, and incompletely disinfected wastewater. Frequent exceedances of Ohio microbiological water-quality standards result in a health risk to the public who use the river for water-contact recreation. Water samples were collected during the recreational season of May through October at four sites on the Cuyahoga River in 2000, at three sites on the river in 2002, and from the effluent of the Akron Water Pollution Control Station (WPCS) both years. The samples were collected over a similar range in streamflow in 2000 and 2002. Samples were analyzed for physical and chemical constituents, as well as the following microbiological indicators and pathogenic organisms: Escherichia coli (E. coli), Salmonella, F-specific and somatic coliphage, enterovirus, infectious enterovirus, hepatitis A virus, Clostridium perfringens (C. perfringens), Cryptosporidium, and Giardia. The relations of the microorganisms to each other and to selected water-quality measures were examined. All microorganisms analyzed for, except Cryptosporidium, were detected at least once at each sampling site. Concentrations of E. coli exceeded the Ohio primary-contact recreational standard (298 colonies per 100 milliliters) in approximately 87 percent of the river samples and generally were higher in the river samples than in the effluent samples. C. perfringens concentrations were positively and significantly correlated with E. coli concentrations in the river samples and generally were higher in the effluent samples than in the river samples. Several of the river samples that met the Ohio E. coli secondary-contact recreational standard (576 colonies per 100 milliliters) had detections of enterovirus, infectious enterovirus, hepatitis A virus, and Salmonella, indicating that there are still risks even when the E. coli standard is not exceeded. River samples in which the secondary-contact recreational standard for E. coli was exceeded showed a higher percentage of the co-occurrence of pathogenic organisms than samples that met the standard. This indicates that in this study area, E. coli is a useful indicator of human health risk. Detections of hepatitis A virus tended to be associated with higher median concentrations of somatic coliphage, F-specific coliphage, and infectious enterovirus. In addition, geometric mean C. perfringens concentrations tended to be higher in samples where hepatitis A virus was present than in samples where hepatitis A virus was absent. Hepatitis A virus was not detected in samples collected upstream from the Akron WPCS; all downstream detections had coincident detections in the Akron WPCS effluent, suggesting that Akron WPCS was a principal source of hepatitis A virus at the downstream sites. Geometric mean concentrations of E. coli were calculated on the basis of analytical results from at least five samples collected at each river site during May, July, and September of 2000. In each case, the Ohio geometric-mean primary-contact recreational standard of 126 col/100 mL was exceeded. E. coli concentrations were significantly correlated with streamflow and increased with streamflow at sites upstream and downstream from the Akron WPCS. This indicates that E. coli loads from sources upstream from the Akron WPCS have the potential to appreciably influence the frequency of attainment of recreational water-quality standards at downstream locations.

Contaminants in ospreys from the Pacific Northwest: I. Trends and Patterns in polychlorinated dibenzo-p-dioxins and -dibenzofurans in eggs and plasma

USGS Publications Warehouse

Elliott, J.E.; Machmer, M.M.; Henny, Charles J.; Wilson, L.K.; Norstrom, R.J.

1998-01-01

Osprey (Pandion haliaetus) eggs were collected from 1991 to 1997 at nests (na??=a??121) upstream and downstream of bleached kraft pulp mills and at reference sites in the Fraser and Columbia River drainage systems of British Columbia, Washington, and Oregon. Blood samples were collected from nestling ospreys during the 1992 breeding season on the Thompson River. Samples were analyzed for polychlorinated dibenzo-p-dioxins (PCDDs) and -dibenzofurans (PCDFs). Mean concentrations of 2,3,7,8-TCDD were significantly higher in eggs collected in 1991 at downstream compared to upstream nests near pulp mills at Kamloops and Castlegar, British Columbia. There were no significant temporal trends in 2,3,7,8-TCDD, -TCDF or other measured compounds at a sample of nests monitored between 1991 and 1994 downstream of the Castlegar pulp mill, despite changes in bleaching technology (CIO2 substitution). However, by 1997 concentrations of 2,3,7,8-TCDD and -TCDF were significantly lower than previous years in nests sampled downstream at both Castlegar and Kamloops. An unusual pattern of higher chlorinated PCDDs and PCDFs was found in many of the osprey eggs collected in this study, and considerable individual variation in the pattern existed among eggs from the same site. For example, eggs from four different nests at one study area (Quesnel) on the Fraser River had concentrations of 1,2,3,4,6,7,8-HpCDD ranging from <1 to 1,100 ng/kg and OCDD from <1 to 7,000 ng/kg wet weight. Higher mean concentrations of HpCDD and OCDD were found in eggs from the Thompson River, a tributary of the Fraser, compared to the Columbia River, and concentrations were generally higher at nests upstream of pulp mills. In plasma samples, 1,2,3,4,6,7,8-HpCDD and OCDD were the main compounds detected, with no significant differences measured between samples upstream versus downstream or earlier versus later in the breeding season. Use of chlorophenolic wood preservatives by lumber processors was considered the main source of higher chlorinated PCDD/Fs throughout the systems, based on patterns of trace PCDFs in eggs and significant correlations between egg concentrations of pentachlorophenol and both HpCDD (ra??=a??0.891, pa??

Contaminants in ospreys from the Pacific Northwest: I. Trends and patterns in polychlorinated dibenzo-p-dioxins and -dibenzofurans in eggs and plasma.

PubMed

Elliott, J E; Machmer, M M; Henny, C J; Wilson, L K; Norstrom, R J

1998-11-01

Osprey (Pandion haliaetus) eggs were collected from 1991 to 1997 at nests (n = 121) upstream and downstream of bleached kraft pulp mills and at reference sites in the Fraser and Columbia River drainage systems of British Columbia, Washington, and Oregon. Blood samples were collected from nestling ospreys during the 1992 breeding season on the Thompson River. Samples were analyzed for polychlorinated dibenzo-p-dioxins (PCDDs) and -dibenzofurans (PCDFs). Mean concentrations of 2,3,7,8-TCDD were significantly higher in eggs collected in 1991 at downstream compared to upstream nests near pulp mills at Kamloops and Castlegar, British Columbia. There were no significant temporal trends in 2,3,7,8-TCDD, -TCDF or other measured compounds at a sample of nests monitored between 1991 and 1994 downstream of the Castlegar pulp mill, despite changes in bleaching technology (CIO2 substitution). However, by 1997 concentrations of 2, 3,7,8-TCDD and -TCDF were significantly lower than previous years in nests sampled downstream at both Castlegar and Kamloops. An unusual pattern of higher chlorinated PCDDs and PCDFs was found in many of the osprey eggs collected in this study, and considerable individual variation in the pattern existed among eggs from the same site. For example, eggs from four different nests at one study area (Quesnel) on the Fraser River had concentrations of 1,2,3,4,6,7,8-HpCDD ranging from <1 to 1,100 ng/kg and OCDD from <1 to 7,000 ng/kg wet weight. Higher mean concentrations of HpCDD and OCDD were found in eggs from the Thompson River, a tributary of the Fraser, compared to the Columbia River, and concentrations were generally higher at nests upstream of pulp mills. In plasma samples, 1,2,3,4,6,7,8-HpCDD and OCDD were the main compounds detected, with no significant differences measured between samples upstream versus downstream or earlier versus later in the breeding season. Use of chlorophenolic wood preservatives by lumber processors was considered the main source of higher chlorinated PCDD/Fs throughout the systems, based on patterns of trace PCDFs in eggs and significant correlations between egg concentrations of pentachlorophenol and both HpCDD (r = 0.891, p < 0.01) and OCDD (r = 0.870, p < 0.01).

Occurrence of organic wastewater compounds in effluent-dominated streams in Northeastern Kansas

USGS Publications Warehouse

Lee, C.J.; Rasmussen, T.J.

2006-01-01

Fifty-nine stream-water samples and 14 municipal wastewater treatment facility (WWTF) discharge samples in Johnson County, northeastern Kansas, were analyzed for 55 compounds collectively described as organic wastewater compounds (OWCs). Stream-water samples were collected upstream, in, and downstream from WWTF discharges in urban and rural areas during base-flow conditions. The effect of secondary treatment processes on OWC occurrence was evaluated by collecting eight samples from WWTF discharges using activated sludge and six from WWTFs samples using trickling filter treatment processes. Samples collected directly from WWTF discharges contained the largest concentrations of most OWCs in this study. Samples from trickling filter discharges had significantly larger concentrations of many OWCs (p-value < 0.05) compared to samples collected from activated sludge discharges. OWC concentrations decreased significantly in samples from WWTF discharges compared to stream-water samples collected from sites greater than 2000??m downstream. Upstream from WWTF discharges, base-flow samples collected in streams draining predominantly urban watersheds had significantly larger concentrations of cumulative OWCs (p-value = 0.03), caffeine (p-value = 0.01), and tris(2-butoxyethyl) phosphate (p-value < 0.01) than those collected downstream from more rural watersheds.

Spread of hybridization between native westslope cutthroat trout, Oncorhynchus clarki lewisi, and nonnative rainbow trout, Oncorhynchus mykiss

USGS Publications Warehouse

Hitt, Nathaniel P.; Frissell, Christopher A.; Muhlfeld, Clint C.; Fred W. Allendorf,

2003-01-01

We examined spatial and temporal patterns of hybridization between native westslope cutthroat trout, Oncorhynchus clarki lewisi, and nonnative rainbow trout, O. mykiss, in streams of the Flathead River system in Montana, U.S.A. We detected hybridization in 24 of 42 sites sampled from 1998 to 2001. We found new Oncorhynchus mykiss introgression in seven of 11 sample populations that were determined to be nonhybridized in 1984. Patterns of spatial autocorrelation and linkage disequilibrium indicated that hybridization is spreading among sites and is advancing primarily via post-F1 hybrids. Although hybridized populations were distributed widely throughout the study area, the genetic contribution from O. mykiss decreased with increasing upstream distance from the Flathead River mainstem, suggesting that O. mykiss introgression is spreading in an upstream direction. The spread of hybridization may be constrained more by demographic than by environmental factors, given that (i) hybridized populations generally encompassed the range of environmental variability in nonhybridized populations, and (ii) hybridization status was more strongly associated with neighborhood statistics than measured environmental gradients.

Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

PubMed Central

Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

2003-01-01

The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

Decreased fish diversity found near marble industry effluents in River Barandu, Pakistan.

PubMed

Mulk, Shahi; Korai, Abdul Latif; Azizullah, Azizullah; Khattak, Muhammad Nasir Khan

2016-01-01

In a recently published study we observed that effluents from marble industry affected physicochemical characteristics of River Barandu in District Buner, Pakistan. These changes in water quality due to marble effluents may affect fish community. The present study was therefore conducted to evaluate the impacts of marble industry effluents on fish communities in River Barandu using abundance, richness, diversity and evenness of fish species as end point criteria. The fish samples were collected by local fishermen on monthly basis from three selected sites (upstream, effluents/industrial, and downstream sites). During the study period, a total of 18 fish species were found belonging to 4 orders, 5 families and 11 genera. The Cyprinidae was observed to be the dominant family at all the three selected sites. Lower abundance and species diversity was observed at the industrial (22%) and downstream sites (33%) as compared to the upstream site (45%). Effluents of marble industry were associated with lower abundance of species in River Barandu. It is recommended that industries should be shifted away from the vicinity of river and their effluents must be treated before discharging to prevent further loss of fish abundance and diversity in the River.

Invasion and Colonisation of a Tropical Stream by an Exotic Loricariid Fish: Indices of Gradual Displacement of the Native Common Pleco (Hypostomus punctatus) by the Red Fin Dwarf Pleco (Parotocinclus maculicauda) over Fifteen Years

PubMed Central

Mazzoni, Rosana; Costa da Silva, Raquel; Pinto, Míriam Plaza

2015-01-01

The introduction of invasive species represents a major threat to the integrity of stream-dwelling fish populations worldwide, and this issue is receiving increasing attention from scientists, in particular because of potential impact on biodiversity. In this study, we analysed the dispersal of an exotic loricariid fish the red fin dwarf pleco (Parotocinclus maculicauda) in a stream of the Atlantic Forest biome in coastal south-eastern Brazil and evaluated the effects of this invasion on the native loricariid common pleco (Hypostomus punctatus). Specimens were collected at eight sites located along the course of the stream over a 15-year period. The distribution and density of the two species were determined by the Successive Removal Method. The introduction of P. maculicauda occurred in the medium sector of the stream, and during the course of the study, the species dispersed to new sites further upstream. By the end of the study, it was found at all points upstream from the original site. Hypostomus punctatus was registered at all sample sites both before and after the introduction of P. maculicauda, but its density decreased at all upstream sites after the arrival of the exotic species. Our analysis shows that colonisation by P. maculicauda seems to have a negative effect on H. punctatus densities. The maintenance of H. punctatus densities at the sites not colonised by P. maculicauda reinforces the conclusion that the colonisation of the stream by the exotic species had deleterious effects on the density of the resident H. punctatus populations, either by direct or indirect action. PMID:26440412

Organochlorine chemical residues in bluegills and common carp from the irrigated San Joaquin Valley floor, California

USGS Publications Warehouse

Saiki, Michael K.; Schmitt, Christopher J.

1986-01-01

Samples of bluegills (Lepomis macrochirus) and common carp (Cyprinus carpio) collected from the San Joaquin River and two tributaries (Merced River and Salt Slough) in California were analyzed for 21 organochlorine chemical residues by gas chromatography to determine if pesticide contamination was confined to downstream sites exposed to irrigated agriculture, or if nonirrigated upstream sites were also contaminated. Residues ofp,p′-DDE were detected in all samples of both species. Six other contaminants were also present in both species at one or more of the collection sites: chlordane (cis-chlordane +trans-nonachlor);p,p′-DDD;o,p′-DDT;p,p′-DDT; DCPA (dimethyl tetrachloroterephthalate); and dieldrin. Concentrations of most of these residues were generally higher in carp than in bluegills; residues of other compounds were found only in carp: α-BHC (α-benzenehexachloride), Aroclor® 1260, and toxaphene. Concentrations of most organochlorines in fish increased from upstream to downstream. Water quality variables that are influenced by irrigation return flows (e.g., conductivity, turbidity, and total alkalinity) also increased from upstream to downstream and were significantly correlated (P < 0.05) with organochlorine residue levels in the fish. In carp, concentrations of two residues-⌆DDT (p,p′-DDD +p,p′-DDE + +p,p′-DDT; 1.43 to 2.21 mg/kg wet weight) and toxaphene (3.12 mg/kg wet weight)-approached the highest levels reported by the National Pesticide Monitoring Program for fish from other intensively farmed watersheds of the United States in 1980 to 1981, and surpassed criteria for whole-body residue concentrations recomended by the National Academy of Sciences and National Academy of Engineers for the protection of piscivorous wildlife.

Occurrence of phosphorus, nitrate, and suspended solids in streams of the Cheney Reservoir Watershed, south-central Kansas, 1997-2000

USGS Publications Warehouse

Milligan, Chad R.; Pope, Larry M.

2001-01-01

Improving water quality of Cheney Reservoir in south-central Kansas is an important objective of State and local water managers. The reservoir serves as a water supply for about 350,00 people in the Wichita area and an important recreational resource for the area. In 1992, a task force was formed to study and prepare a plan to identify and mitigate potential sources of stream contamination in the Cheney Reservoir watershed. This task force was established to develop stream-water-quality goals to aid in the development and implementation of best-management practices in the watershed. In 1996, the U.S. Geological Survey entered into a cooperative study with the city of Wichita to assess the water quality in the Cheney Reservoir watershed. Water-quality constituents of particular concern in the Cheney Reservoir watershed are phosphorus, nitrate, and total suspended solids. Water-quality samples were collected at five streamflow-gaging sites upstream from the reservoir and at the outflow of the reservoir. The purpose of this report is to present the results of a 4-year (1997-2000) data-collection effort to quantify the occurrence of phosphorus, nitrate, and suspended solids during base-flow, runoff, and long-term streamflow conditions (all available data for 1997-2000) and to compare these results to stream-water-quality goals established by the Cheney Reservoir Task Force. Mean concentrations of each of the constituents examined during this study exceeded the Cheney Reservoir Task Force stream-water-quality goal for at least one of the streamflow conditions evaluated. Most notably, mean base-flow and mean long-term concentrations of total phosphorus and mean base-flow concentrations of dissolved nitrate exceeded the goals of 0.05, 0.10, and 0.25 milligram per liter, respectively, at all five sampling sites upstream from the reservoir. Additionally, the long-term stream-water-quality goal for dissolved nitrate was exceeded by the mean concentration at one upstream sampling site, and the base-flow total suspended solids goal (20 milligrams per liter) and long-term total suspended solids goal (100 milligrams per liter) were each exceeded by mean concentrations at three upstream sampling sites. Generally, it seems unlikely that water-quality goals for streams in the Cheney Reservoir watershed will be attainable for mean base-flow and mean long-term total phosphorus and total suspended solids concentrations and for mean base-flow dissolved nitrate concentrations as long as current (2001) watershed conditions and practices persist. However, future changes in these conditions and practices that mitigate the transport of these consitutents may modify this conclusion.

Seasonal and spatial variations of glyphosate residues in surface waters of El Crespo stream, Buenos Aires province, Argentina.

NASA Astrophysics Data System (ADS)

Perez, Debora; Okada, Elena; Aparicio, Virginia; Menone, Mirta; Costa, Jose Luis

2017-04-01

El Crespo stream is located inside a small watershed (52,000 Ha) which is only influenced by farming activities without urban or industrial impact. The watershed can be divided in two areas, the southern area (upstream), mainly composed of intensive crops and the northern area (downstream) used only for extensive livestock. In this sense, "El Crespo" stream in an optimal site for monitoring screening of pesticide residues. The objective of this work was to determine the seasonal and spatial variations of glyphosate (GLY), in surface waters of "El Crespo" stream. We hypothesized that in surface waters of "El Crespo" stream the levels of GLY vary depending of the season and rainfall events. The water sampling was carried out from October to June (2014-2015) in two sites: upstream (US) and downstream (DS), before and after rain events. The water samples were collected by triplicate in 1 L polypropylene bottles and stored at -20°C until analysis. GLY was extracted from unfiltered water samples with a buffer solution (100 mM Na2B4O7•10H2O/100 mM K3PO4, pH=9) and derivatized with 9-fluorenylmethylchloroformate (1 mg/mL in acetonitrile). Afterwards samples were analyzed using liquid chromatography coupled to a tandem mass spectrometer (UPLC-MS/MS). The detection limit (LD) was 0.1 μg/L and the quantification limit (QL) was 0.5 μg/L. The rainfall regime was obtained from the database of INTA Balcarce. GLY was detected in 92.3% of the analyzed samples. In the US site, were GLY is regularly applied, the highest GLY concentration was registered in October (2.15 ± 0.16 μg/L); from November to June, the GLY levels decreased from 1.97 ± 0.17 μg/L to

A benthic-macroinvertebrate index of biotic integrity and assessment of conditions in selected streams in Chester County, Pennsylvania, 1998-2009

USGS Publications Warehouse

Reif, Andrew G.

2012-01-01

The Stream Conditions of Chester County Biological Monitoring Network (Network) was established by the U.S. Geological Survey and the Chester County Water Resources Authority in 1969. Chester County encompasses 760 square miles in southeastern Pennsylvania and has a rapidly expanding population. Land-use change has occurred in response to this continual growth, as open space, agricultural lands, and wooded lands have been converted to residential and commercial lands. In 1998, the Network was modified to include 18 fixed-location sites and 9 flexible-location sites. Sites were sampled annually in the fall (October-November) during base-flow conditions for water chemistry, instream habitat, and benthic macroinvertebrates. A new set of 9 flexible-location sites was selected each year. From 1998 to 2009, 213 samples were collected from the 18 fixed-location sites and 107 samples were collected from the 84 flexible-location sites. Eighteen flexible-location sites were sampled more than once over the 12-year period; 66 sites were sampled only once. Benthic-macroinvertebrate data from samples collected during 1998-2009 were used to establish the Chester County Index of Biotic Integrity (CC-IBI). The CC-IBI was based on the methods and metrics outlined in the Pennsylvania Department of Environmental Protection's "A Benthic Index of Biotic Integrity for Wadeable Freestone Streams in Pennsylvania." The resulting CC-IBI consists of scores for benthic-macroinvertebrate samples collected from sites in the Network that related to reference conditions in Chester County. Mean CC-IBI scores for 18 fixed-location sites ranged from 37.21 to 88.92. Thirty-nine percent of the 213 samples collected at the 18 fixed-location sites had a CC-IBI score less than 50; 33 percent, 50 to 70; 28 percent, greater than 70. CC-IBI scores from the 107 flexible-location samples ranged from 23.48 to 99.96. Twenty-five percent of the 107 samples collected at the flexible-location sites had a CC-IBI score less than 50; 33 percent, 50 to 70; and 42 percent, greater than 70. Factors that were found to affect CC-IBI scores are nutrient concentrations, habitat conditions, and percent of wooded and urban land use. A positive relation was determined between mean CC-IBI scores and mean total habitat scores for the 18 fixed-location sites. CC-IBI scores were most strongly affected by stream bank vegetative protection, embeddedness, riparian zone width, and sediment deposition. The highest CC-IBI scores were associated with sites that had greater than 28 percent wooded-wetland-water land use, less than 5 percent urban land use, and no municipal wastewater discharges within 10 miles upstream from the sampling site. The lowest CC-IBI scores were associated with sites where urban land use was greater than 15 percent or a municipal wastewater discharge was within 10 miles upstream from the sampling reach. The Mann Kendall test for trends was used to determine trends in CC-IBI scores and concentrations of nitrate, orthophosphate, and chloride for the 18 fixed-location sites. A positive trend in CC-IBI was determined for six sites, and a negative trend was determined for one site. Positive trends in nitrate concentrations were determined for 4 of the 18 fixed-location sites, and a negative trend in orthophosphate concentrations was determined for 1 of the 18 fixed-location sites. Positive trends in chloride concentrations were determined for 16 of the 18 fixed-location sites.

Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

USGS Publications Warehouse

Juracek, Kyle E.

2011-01-01

Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 691,000 pounds per square mile per year. In general, no pronounced changes in channel width were evident at six streamgage sites located upstream from the reservoir. At the Barnes and Marysville streamgage sites, located upstream from the reservoir, long-term channel-bed degradation followed by stability was indicated. At the Frankfort streamgage site, located upstream from the reservoir, channel-bed aggradation of 1.65 feet from 1969 to 1989 followed by channel-bed degradation of 2.4 feet from 1989 to 2010 was indicated and may represent the passage of a sediment pulse caused by historical disturbances (for example, channelization) in the upstream basin. With the exception of the Frankfort streamgage site, current (2010) conditions at four streamgages located upstream from the reservoir were typified by channel-bed stability. At the Manhattan streamgage site, located downstream from the reservoir, high-flow releases associated with the 1993 flood widened the channel about 60 feet (30 percent). The channel bed at this site degraded 4.2 feet from 1960 to 1998 and since has been relatively stable. For the purpose of computing suspended-sediment concentration and load, the use of turbidity data in a regression model can provide more reliable and reproducible estimates than a regression model that uses discharge as the sole independent variable. Moreover, the use of discharge only to compute suspended-sediment concentration and load may result in overprediction. Stream channel banks, compared to channel beds, likely are a more important source of sediment to Kanopolis and Tuttle Creek Lakes from the upstream basins. Other sediment sources include surface-soil erosion in the basins and shoreline erosion in the reservoirs.

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

Klamath River Water Quality Data from Link River Dam to Keno Dam, Oregon, 2008

USGS Publications Warehouse

Sullivan, Annett B.; Deas, Michael L.; Asbill, Jessica; Kirshtein, Julie D.; Butler, Kenna D.; Vaughn, Jennifer

2009-01-01

This report documents sampling and analytical methods and presents field data from a second year of an ongoing study on the Klamath River from Link River Dam to Keno Dam in south central Oregon; this dataset will form the basis of a hydrodynamic and water quality model. Water quality was sampled weekly at six mainstem and two tributary sites from early April through early November, 2008. Constituents reported herein include field-measured water-column parameters (water temperature, pH, dissolved oxygen concentration, specific conductance); total nitrogen and phosphorus; particulate carbon and nitrogen; total iron; filtered orthophosphate, nitrite, nitrite plus nitrate, ammonia, organic carbon, and iron; specific UV absorbance at 254 nanometers; chlorophyll a; phytoplankton and zooplankton enumeration and species identification; and bacterial abundance and morphological subgroups. Sampling program results indicated: *Most nutrient and carbon concentrations were lowest in spring, increased starting in mid-June, remained elevated in the summer, and decreased in fall. Dissolved nitrite plus nitrate had a different seasonal cycle and was below detection or at low concentration in summer. *Although total nitrogen and total phosphorus concentrations did not show large differences from upstream to downstream, filtered ammonia and orthophosphate concentrations increased in the downstream direction and particulate carbon and particulate nitrogen generally decreased in the downstream direction. *Large bacterial cells made up most of the bacteria biovolume, though cocci were the most numerous bacteria type. Cocci, with diameters of 0.1 to 0.2 micrometers, were smaller than the filter pore sizes used to separate dissolved from particulate matter. *Phytoplankton biovolumes were dominated by diatoms in spring and by the blue-green alga Aphanizomenon flos-aquae after mid-June. Another blue-green, Anabaena flos-aquae, was noted in samples from late May to late June. Phytoplankton biovolumes generally were highest at the upstream Link River and Railroad Bridge sites and decreased in the downstream direction. *Zooplankton densities were largest in late April. Populations were dominated by rotifers and copepods in early spring, and by rotifers and cladocerans in summer, with cladocerans most common at the most upstream site.

Recovery of benthic-invertebrate communities in the White River near Indianapolis, Indiana, USA, following implementation of advanced treatment of municipal wastewater

USGS Publications Warehouse

Crawford, Charles G.; Wangsness, David J.

1992-01-01

The City of Indianapolis, Indiana, USA, completed construction of advanced-wastewater-treatment systems to enlarge and upgrade existing secondary-treatment processes at the City’s two municipal wastewater-treatment plants in 1983. These plants discharge their effluent to the White River. A study was begun in 1981 to evaluate the effects of municipal wastewater on the quality of the White River near Indianapolis. As part of this study, benthic-invertebrate samples were collected from one riffle upstream and two riffles downstream from the treatment plants annually from 1981 through 1987 (2 times before and 5 times after the plant improvements became operational). Samples were collected during periods of late-summer or early-fall low streamflow with a Surber sampler. Upstream from the wastewater-treatment plants, mayflies and caddisflies were the predominant organisms in the benthic-invertebrate community (from 32 to 93 percent of all organisms; median value is 67 percent) with other insects and mollusks also present. Before implementation of advanced wastewater-treatment, the benthic-invertebrate community downstream from the wastewater treatment plants was predominantly chironomids and oligochaetes (more than 98 percent of all organisms)-organisms that generally are tolerant of organic wastes. Few intolerant species, such as mayflies or caddisflies were found. Following implementation of advanced wastewater treatment, mayflies and caddisflies became numerically dominant in samples collected downstream from the plants. By 1986, these organisms accounted for more than 90 percent of all organisms found at the two downstream sites. The diversity of benthic invertebrates found in these samples resembled that at the upstream site. The improvement in the quality of municipal wastewater effluent resulted in significant improvements in the water quality of the White River downstream from Indianapolis. These changes in river quality, in turn, have resulted in a shift from mostly pollution-tolerant to mostly pollution-intolerant organisms in the benthic-invertebrate community of the White River downstream from Indianapolis. The recovery was not immediate, however, with one of the downstream sites requiring 3 years before pollution-intolerant organisms became numerically dominant.

Assessment of hydrology, water quality, and trace elements in selected placer-mined creeks in the birch creek watershed near central, Alaska, 2001-05

USGS Publications Warehouse

Kennedy, Ben W.; Langley, Dustin E.

2007-01-01

Executive Summary The U.S. Geological Survey, in cooperation with the Bureau of Land Management, completed an assessment of hydrology, water quality, and trace-element concentrations in streambed sediment of the upper Birch Creek watershed near Central, Alaska. The assessment covered one site on upper Birch Creek and paired sites, upstream and downstream from mined areas, on Frying Pan Creek and Harrison Creek. Stream-discharge and suspended-sediment concentration data collected at other selected mined and unmined sites helped characterize conditions in the upper Birch Creek watershed. The purpose of the project was to provide the Bureau of Land Management with baseline information to evaluate watershed water quality and plan reclamation efforts. Data collection began in September 2001 and ended in September 2005. There were substantial geomorphic disturbances in the stream channel and flood plain along several miles of Harrison Creek. Placer mining has physically altered the natural stream channel morphology and removed streamside vegetation. There has been little or no effort to re-contour waste rock piles. During high-flow events, the abandoned placer-mine areas on Harrison Creek will likely contribute large quantities of sediment downstream unless the mined areas are reclaimed. During 2004 and 2005, no substantial changes in nutrient or major-ion concentrations were detected in water samples collected upstream from mined areas compared with water samples collected downstream from mined areas on Frying Pan Creek and Harrison Creek that could not be attributed to natural variation. This also was true for dissolved oxygen, pH, and specific conductance-a measure of total dissolved solids. Sample sites downstream from mined areas on Harrison Creek and Frying Pan Creek had higher median suspended-sediment concentrations, by a few milligrams per liter, than respective upstream sites. However, it is difficult to attach much importance to the small downstream increase, less than 10 milligrams per liter, in median suspended-sediment concentration for either basin. During low-flow conditions in 2004 and 2005, previously mined areas investigated on Harrison Creek and on Frying Pan Creek did not contribute substantial suspended sediments to sample sites downstream from the mined areas. No substantial mining-related water- or sediment-quality problems were detected at any of the sites investigated in the upper Birch Creek watershed during low-flow conditions. Average annual streamflow and precipitation were near normal in 2002 and 2003. Drought conditions, extreme forest fire impact, and low annual streamflow set apart the 2004 and 2005 summer seasons. Daily mean streamflow for upper Birch Creek varied throughout the period of record-from maximums of about 1,000 cubic feet per second to minimums of about 20 cubic feet per second. Streamflow increased and decreased rapidly in response to rainfall and rapid snowmelt events because the steep slopes, thin soil cover, and permafrost areas in the watershed have little capacity to retain runoff. Median suspended-sediment concentrations for the 115 paired samples from Frying Pan Creek and 101 paired samples from Harrison Creek were less than the 20 milligrams per liter total maximum daily load. The total maximum daily load was set by the U.S. Environmental Protection Agency for the upper Birch Creek basin in 1996. Suspended-sediment paired-sample data were collected using automated samplers in 2004 and 2005, primarily during low-flow conditions. Suspended-sediment concentrations in grab samples from miscellaneous sites ranged from less than 1 milligram per liter during low-flow conditions to 1,386 milligrams per liter during a high-flow event on upper Birch Creek. Streambed-sediment samples were collected at six sites on Harrison Creek, two sites on Frying Pan Creek, and one site on upper Birch Creek. Trace-element concentrations of mercury, lead, and zinc in streambed sedimen

Levels of pesticides residues in the White Nile water in the Sudan.

PubMed

Nesser, Gibreel A A; Abdelbagi, Azhari O; Hammad, Ahmed Mohammed Ali; Tagelseed, Mirghani; Laing, Mark D

2016-06-01

Twenty-two commonly used pesticides were monitored during autumn, winter, and summer of 2004-2005 in 27 water samples from three sites along the White Nile in Sudan (former Sudan). Sites were selected to reflect pesticides gathered from drainage canals in central Sudan and from upstream sources. Collected samples were extracted and subjected to gas chromatographic analysis. Pesticides levels were measured in nanograms per liter. Pesticides residues were detected in 96 % of the samples with a total residue burden of 4132.6 ng L(-1), and an overall mean concentration and range of 50.99 and not detected-1570 ng L(-1), respectively. Ororganochlorines were the most frequently detected contaminants, which were found in 70 % of the samples, causing a total burden of 2852.8 ng L(-1), followed by pyrethroids 15 % of the samples, with a total burden of 926.5 ng L(-1). The tested herbicides were detected in ˂4 % of the samples with a total burden of 353.3 ng L(-1), while organophosphorus levels were below the detection limit. The most frequent contaminants were the following: heptachlor and its epoxide (52 % of samples), followed by DDTs (dichlorodiphenyltrichloroethanes) (DDT and DDE, in 19 % of the samples), cypermethrin and fenvalerate (in 11 % of the samples), and pendimethalin (in <4 % of the samples). Residues of hexachlorocyclohexane (HCH) isomers (α, β, γ and δ), endosulfan (α and β), p, p-DDD, λ cyhalothrin, deltamethrin, and oxyfluorfen were not detected in the analyzed samples. Generally, levels were least in autumn, and followed by summer and winter. Sources of contamination might include agricultural lands in central Sudan and upstream sources. Both recent and old contaminations were indicated.

Characterization of nutrients and fecal indicator bacteria at a concentrated swine feeding operation in Wake County, North Carolina, 2009-2011

USGS Publications Warehouse

Harden, Stephen L.; Rogers, Shane W.; Jahne, Michael A.; Shaffer, Carrie E.; Smith, Douglas G.

2012-01-01

Study sites were sampled for laboratory analysis of nutrients, total suspended solids (TSS), and (or) fecal indicator bacteria (FIB). Nutrient analyses included measurement of dissolved ammonia, total and dissolved ammonia + organic nitrogen, dissolved nitrate + nitrite, dissolved orthophosphate, and total phosphorus. The FIB analyses included measurement of Escherichia coli and enterococci. Samples of wastewater at the swine facility were collected from a pipe outfall from the swine housing units, two storage lagoons, and the spray fields for analysis of nutrients, TSS, and FIB. Soil samples collected from a spray field were analyzed for FIB. Monitoring locations were established for collecting discharge and water-quality data during storm events at three in-field runoff sites and two sites on the headwater stream (one upstream and one downstream) next to the swine facility. Stormflow samples at the five monitoring locations were collected for four storm events during 2009 to 2010 and analyzed for nutrients, TSS, and FIB. Monthly water samples also were collected during base-flow conditions at all four stream sites for laboratory analysis of nutrients, TSS, and (or) FIB.

The Effect of Landuse and Other External Factors on Water Quality Within two Creeks in Northern Kentucky

NASA Astrophysics Data System (ADS)

Boateng, S.

2006-05-01

The purpose of this study was to monitor the water quality in two creeks in Northern Kentucky. These are the Banklick Creek in Kenton County and the Woolper Creek in Boone County, Kentucky. The objective was to evaluate the effect of landuse and other external factors on surface water quality. Landuse within the Banklick watershed is industrial, forest and residential (urban) whereas that of Woolper Creek is agricultural and residential (rural). Two testing sites were selected along the Banklick Creek; one site was upstream the confluence with an overflow stream from an adjacent lake; the second site was downstream the confluence. Most of the drainage into the lake is over a near-by industrial park and the urban residential areas of the cities of Elsmere and Erlanger, Kentucky. Four sampling locations were selected within the Woolper Creek watershed to evaluate the effect of channelization and subsequent sedimentation on the health of the creek. Water quality parameters tested for include dissolved oxygen, phosphates, chlorophyll, total suspended sediments (TSS), pH, oxidation reduction potential (ORP), nitrates, and electrical conductivity. Sampling and testing were conducted weekly and also immediately after storm events that occurred before the regular sampling dates. Sampling and testing proceeded over a period of 29 weeks. Biological impact was determined, only in Woolper Creek watershed, by sampling benthic macroinvertebrates once every four weeks. The results showed significant differences in the water quality between the two sites within the Banklick Creek. The water quality may be affected by the stream overflow from the dammed lake. Also, channelization in the Woolper Creek seemed to have adverse effects on the water quality. A retention pond, constructed to prevent sediments from flowing into the Woolper Creek, did not seem to be effective. This is because the water quality downstream of the retention pond was significantly worse than that of the upstream site. The benthic macroinvertebrates sampled indicate worse water quality downstream of the sediment retention pond. Overall, landuse and the channelization have some effect on the water quality in the two creeks.

Cryptosporidium source tracking in the Potomac River watershed.

PubMed

Yang, Wenli; Chen, Plato; Villegas, Eric N; Landy, Ronald B; Kanetsky, Charles; Cama, Vitaliano; Dearen, Theresa; Schultz, Cherie L; Orndorff, Kenneth G; Prelewicz, Gregory J; Brown, Miranda H; Young, Kim Roy; Xiao, Lihua

2008-11-01

To better characterize Cryptosporidium in the Potomac River watershed, a PCR-based genotyping tool was used to analyze 64 base flow and 28 storm flow samples from five sites in the watershed. These sites included two water treatment plant intakes, as well as three upstream sites, each associated with a different type of land use. The uses, including urban wastewater, agricultural (cattle) wastewater, and wildlife, posed different risks in terms of the potential contribution of Cryptosporidium oocysts to the source water. Cryptosporidium was detected in 27 base flow water samples and 23 storm flow water samples. The most frequently detected species was C. andersoni (detected in 41 samples), while 14 other species or genotypes, almost all wildlife associated, were occasionally detected. The two common human-pathogenic species, C. hominis and C. parvum, were not detected. Although C. andersoni was common at all four sites influenced by agriculture, it was largely absent at the urban wastewater site. There were very few positive samples as determined by Environmental Protection Agency method 1623 at any site; only 8 of 90 samples analyzed (9%) were positive for Cryptosporidium as determined by microscopy. The genotyping results suggest that many of the Cryptosporidium oocysts in the water treatment plant source waters were from old calves and adult cattle and might not pose a significant risk to human health.

Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

NASA Astrophysics Data System (ADS)

Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

2004-12-01

Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

Nutrients, suspended sediment, and pesticides in waters of the Red River of the North Basin, Minnesota, North Dakota, and South Dakota, 1970-90

USGS Publications Warehouse

Tornes, L.H.; Brigham, M.E.

1994-01-01

A relatively large fraction of stream samples had detectable quantities of 2,4-D, a- and y-HCH, and atrazine. These samples covered time spans of as much as 15 years and were from sites downstream from large drainage basins; however, concentrations were well below US EPA MCLs. One county-level study showed higher 2,4-D concentrations at upstream sites than at the outlet from a small basin. This indicates that downstream sites may fail to show impaired water-quality and the fate of pesticides used in the basin. Following the 1972 ban on DDT, concentrations of DDT in fish samples from the Red River of the North quickly decreased. Fish concentrations of DDE and DDD decreased more slowly. Low levels of DDE and DDD were detected in fish 14 years after the DDT ban.

Sediment loads and transport at constructed chutes along the Missouri River - Upper Hamburg Chute near Nebraska City, Nebraska, and Kansas Chute near Peru, Nebraska

USGS Publications Warehouse

Densmore, Brenda K.; Rus, David L.; Moser, Matthew T.; Hall, Brent M.; Andersen, Michael J.

2016-02-04

Comparisons of concentrations and loads from EWI samples collected from different transects within a study site resulted in few significant differences, but comparisons are limited by small sample sizes and large within-transect variability. When comparing the Missouri River upstream transect to the chute inlet transect, similar results were determined in 2012 as were determined in 2008—the chute inlet affected the amount of sediment entering the chute from the main channel. In addition, the Kansas chute is potentially affecting the sediment concentration within the Missouri River main channel, but small sample size and construction activities within the chute limit the ability to fully understand either the effect of the chute in 2012 or the effect of the chute on the main channel during a year without construction. Finally, some differences in SSC were detected between the Missouri River upstream transects and the chute downstream transects; however, the effect of the chutes on the Missouri River main-channel sediment transport was difficult to isolate because of construction activities and sampling variability.

Spatial heterogeneity in parasite infections at different spatial scales in an intertidal bivalve.

PubMed

Thieltges, David W; Reise, Karsten

2007-01-01

Spatial heterogeneities in the abundance of free-living organisms as well as in infection levels of their parasites are a common phenomenon, but knowledge on parasitism in invertebrate intermediate hosts in this respect is scarce. We investigated the spatial pattern of four dominant trematode species which utilize a common intertidal bivalve, the cockle Cerastoderma edule, as second intermediate host in their life cycles. Sampling of cockles from the same cohort at 15 sites in the northern Wadden Sea (North Sea) over a distance of 50 km revealed a conspicuous spatial heterogeneity in infection levels in all four species over the total sample as well as among and within sampling sites. Whereas multiple regression analyses indicated the density of first intermediate upstream hosts to be the strongest determinant of infection levels in cockles, the situation within sites was more complex with no single strong predictor variable. However, host size was positively and host density negatively correlated with infection levels and there was an indication of differential susceptibility of cockle hosts. Small-scale differences in physical properties of the habitat in the form of residual water at low tide resulted in increased infection levels of cockles which we experimentally transferred into pools. A complex interplay of these factors may be responsible for within-site heterogeneities. At larger spatial scales, these factors may be overridden by the strong effect of upstream hosts. In contrast to first intermediate trematode hosts, there was no indication for inter-specific interactions. In other terms, the recruitment of trematodes in second intermediate hosts seems to be largely controlled by pre-settlement processes both among and within host populations.

Fecal-indicator bacteria in the Allegheny, Monongahela, and Ohio Rivers and selected tributaries, Allegheny County, Pennsylvania, 2001-2005

USGS Publications Warehouse

Buckwalter, Theodore F.; Zimmerman, Tammy M.; Fulton, John W.

2006-01-01

Concentrations of fecal-indicator bacteria were determined in 1,027 water-quality samples collected from July 2001 through August 2005 during dry- (72-hour dry antecedent period) and wet-weather (48-hour dry antecedent period and at least 0.3 inch of rain in a 24-hour period) conditions in the Allegheny, Monongahela, and Ohio Rivers (locally referred to as the Three Rivers) and selected tributaries in Allegheny County. Samples were collected at five sampling sites on the Three Rivers and at eight sites on four tributaries to the Three Rivers having combined sewer overflows. Water samples were analyzed for three fecal-indicator organisms fecal coliform, Escherichia coli (E. coli), and enterococci bacteria. Left-bank and right-bank surface-water samples were collected in addition to a cross-section composite sample at each site. Concentrations of fecal coliform, E. coli, and enterococci were detected in 98.6, 98.5, and 87.7 percent of all samples, respectively. The maximum fecal-indicator bacteria concentrations were collected from Sawmill Run, a tributary to the Ohio River; Sawmill Run at Duquesne Heights had concentrations of fecal coliform, E. coli, and enterococci of 410,000, 510,000, and 180,000 col/100 mL, respectively, following a large storm. The samples collected in the Three Rivers and selected tributaries frequently exceeded established recreational standards and criteria for bacteria. Concentrations of fecal coliform exceeded the Pennsylvania water-quality standard (200 col/100 mL) in approximately 63 percent of the samples. Sample concentrations of E. coli and enterococci exceeded the U.S. Environmental Protection Agency (USEPA) water-quality criteria (235 and 61 col/100 mL, respectively) in about 53 and 47 percent, respectively, of the samples. Fecal-indicator bacteria were most strongly correlated with streamflow, specific conductance, and turbidity. These correlations most frequently were observed in samples collected from tributary sites. Fecal-indicator bacteria concentrations and turbidity were correlated to the location of sample collection in the cross section. Most differences were between bank and composite samples; differences between right-bank and left-bank samples were rarely observed. The Allegheny River sites had more significant correlations than the Monongahela or Ohio River sites. Comparisons were made between fecal-indicator bacteria in composite samples collected during dry-weather, wet-weather day-one, wet-weather day-two (tributary sites only), and wet-weather day-three (Three Rivers sites only) events in the Three Rivers and selected tributary sites. The lowest median bacteria concentrations generally were observed in the dry-weather composite samples. All median bacteria concentrations in dry-weather composite samples in the five Three Rivers sites were below water-quality standards and criteria; bacteria concentrations in the upstream tributary sites rarely met all standards or criteria. Only Turtle Creek, Thompson Run, and Chartiers Creek had at least one median bacteria concentration below water-quality standards or criteria. Median bacteria concentrations in the composite samples generally were higher the day after a wet-weather event compared to dry-weather composite samples and other wet-weather composite samples collected. In the five Three Rivers sites, median bacteria concentrations 3 days after a wet-weather event in composite samples tended to fall below the water-quality standards and criteria; in the eight tributary sites, median bacteria concentrations in the dry-weather and wet-weather composite samples generally were above the water-quality standards or criteria. Composite samples collected at the upstream sites on the Three Rivers and selected tributaries generally had lower median bacteria concentrations than composite samples collected at the downstream sites during dry- and wet-weather events. Higher concentrations downstream may be because o

Hydrologic and water-quality data from Mountain Island Lake, North Carolina, 1994-97

USGS Publications Warehouse

Sarver, K.M.; Steiner, B.C.

1998-01-01

Continuous-record water-level gages were established at three sites on Mountain Island Lake and one site downstream from Mountain Island Dam. The water level of Mountain Island Lake is controlled by Duke Power Company releases at Cowans Ford Dam (upstream) and Mountain Island Dam (downstream). Water levels on Mountain Island Lake measured just downstream from Cowans Ford Dam fluctuated 11.15 feet during the study. Water levels just upstream from the Mountain Island Lake forebay fluctuated 6.72 feet during the study. About 3 miles downstream from Mountain Island Dam, water levels fluctuated 5.31 feet. Sampling locations included 14 sites in Mountain Island Lake, plus one downstream river site. At three sites, automated instruments recorded water temperature, dissolved-oxygen concentration, and specific conductance at 15-minute intervals throughout the study. Water temperatures recorded continuously during the study ranged from 4.2 to 35.2 degrees Celsius, and dissolved-oxygen concentrations ranged from 2.1 to 11.8 milligrams per liter. Dissolved-oxygen concentrations generally were inversely related to water temperature, with lowest dissolved-oxygen concentrations typically recorded in the summer. Specific conductance values recorded continuously during the study ranged from 33 to 89 microsiemens per centimeter; however, mean monthly values were fairly consistent throughout the study at all sites (50 to 61 microsiemens per centimeter). In addition, vertical profiles of water temperature, dissolved-oxygen concentration, specific conductance, and pH were measured at all sampling locations during 24 site visits. Water-quality constituent concentrations were determined for seven reservoir sites and the downstream river site during 17 sampling trips. Water-quality samples were routinely analyzed for biochemical oxygen demand, fecal coliform bacteria, hardness, alkalinity, total and volatile suspended solids, nutrients, total organic carbon, chlorophyll, iron, calcium, and magnesium; the samples were analyzed less frequently for trace metals, volatile organic compounds, semivolatile organic compounds, and pesticides. Maximum dissolved nitrite plus nitrate concentrations determined during the study were 0.348 milligram per liter in the mainstem sites and 2.77 milligrams per liter in the coves. Maximum total phosphorus concentrations were 0.143 milligram per liter in the mainstem sites and 0.600 milligram per liter in the coves. Fecal coliform and chlorophyll a concentrations were less than or equal to 160 colonies per 100 milliliters and 13 micrograms per liter, respectively, in all samples. Trace metals detected in at least one sample included arsenic, chromium, copper, lead, nickel, zinc, and antimony. Concentrations of all trace metals (except zinc) were 5.0 micrograms per liter or less; the maximum zinc concentration was 80 micrograms per liter. One set of bottom material samples was collected from Gar Creek and McDowell Creek for chemical analysis and analyzed for nutrients, trace metals, organochlorine pesticides, and semivolatile organic compounds. The only organochlorine pesticide identified in either sample was p,p'-DDE at an estimated concentration of 0.8 microgram per kilogram. Twenty semivolatile organic compounds, mainly polyaromatic hydrocarbons and plasticizers, were identified.

Silver concentrations and selected hydrologic data in the Upper Colorado River basin, 1991-92

USGS Publications Warehouse

Johncox, D.A.

1993-01-01

The U.S. Geological Survey, in cooperation with the Colorado River Water Conservation District and the Northern Colorado Water Conservancy District, collected water and sediment samples in May and September 1991 and 1992 from nine stream-sampling sites and three lake-sampling sites within the Upper Colorado River Basin upstream from Kremmling, Colorado. Data were collected to determine the present (1992) conditions of the Upper Colorado River Basin regarding silver concentrations in the water and sediment. Lake-water and stream-water samples were analyzed for concentrations of total recoverable silver, dissolved silver, and suspended solids. Lake- and stream-bottom material was analyzed for concentrations of total recoverable silver. Additional data collected were streamflow, specific conductance, pH, and water temperature. Transparency (Secchi-disk measurements) also was measured in the lakes.

Black liquor and the hangover effect: fish assemblage recovery dynamics following a pulse disturbance

PubMed Central

Piller, Kyle R; Geheber, Aaron D

2015-01-01

Anthropogenic perturbations impact aquatic systems causing wide-ranging responses, from assemblage restructuring to assemblage recovery. Previous studies indicate the duration and intensity of disturbances play a role in the dynamics of assemblage recovery. In August 2011, the Pearl River, United States, was subjected to a weak black liquor spill from a paper mill which resulted in substantial loss of fish in a large stretch of the main channel. We quantified resilience and recovery of fish assemblage structure in the impacted area following the event. We compared downstream (impacted) assemblages to upstream (unimpacted) assemblages to determine initial impacts on structure. Additionally, we incorporated historic fish collections (1988–2011) to examine impacts on assemblage structure across broad temporal scales. Based on NMDS, upstream and downstream sites generally showed similar assemblage structure across sample periods with the exception of the 2 months postdischarge, where upstream and downstream sites visually differed. Multivariate analysis of variance (PERMANOVA) indicated significant seasonal variation among samples, but found no significant interaction between impacted and unimpacted assemblages following the discharge event. However, multivariate dispersion (MVDISP) showed greater variance among assemblage structure following the discharge event. These results suggest that 2 months following the disturbance represent a time period of stochasticity in regard to assemblage structure dynamics, and this was followed by rapid recovery. We term this dynamic the “hangover effect” as it represents the time frame from the cessation of the perturbation to the assemblage's return to predisturbance conditions. The availability and proximity of tributaries and upstream refugia, which were not affected by the disturbance, as well as the rapid recovery of abiotic parameters likely played a substantial role in assemblage recovery. This study not only demonstrates rapid recovery in an aquatic system, but further demonstrates the value of continuous, long-term, data collections which enhance our understanding of assemblage dynamics. PMID:26120432

Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

PubMed

Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

2008-06-01

The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

Quality of water and time of travel in Little Copiah Creek near Crystal Springs, Mississippi

USGS Publications Warehouse

Kalkhoff, S.J.

1981-01-01

An intensive quality of water study was conducted on Little Copiah Creek in the vicinity of Crystal Springs, Miss., from August 19 to August 21, 1980. The quality of water in Little Copiah Creek improved 7 miles downstream of a source of wastewater inflow. The mean total nitrogen concentration decreased from 17 to 1.1 milligrams per liter and the mean total phosphorus concentrations decreased from 5.8 to 0.39 milligrams per liter. The maximum five-day biochemical oxygen demand decreased from 14 to 1.4 milligrams per liter while the dissolved-oxygen concentration increased from 2.0 to 6.9 milligrams per liter. The maximum fecal coliform and fecal streptococcus densities at the upstream sampling site were 2,200 and 6,700 colonies per 100 milliliter, respectively, and were observed to decrease downstream to 160 and 1,500 colonies per 100 milliliters. The mean stream temperatures decreased downstream only slightly from 26.5 to 25.0 Celsius and the pH of the water ranged from 7.2 to 7.4 units upstream and 6.5 to 7.0 units at the downstream site. The average rate of dye travel through the upstream 2.3 mile reach was 0.08 miles per hour during the study. (USGS)

Flow variations and macroinvertebrate community responses in a small groundwater-dominated stream in south east England

USGS Publications Warehouse

Bendix, J.; Hupp, C.R.

2000-01-01

Changes in the macroinvertebrate community in response to flow variations in the Little Stour River, Kent, UK, were examined over a 6 year period (1992-1997). This period included the final year of the 1988-1992 drought, followed by some of the wettest conditions recorded this century and a second period of drought between 1996 and 1997. Each year, samples were collected from 15 sites during late-summer base-flow conditions. Correspondence analysis identified clear differences between samples from upstream and downstream sites, and between drought and non-drought years. Step-wise multiple regression was used to identify hydrological indicators of community variation. Several different indices were used to describe the macroinvertebrate community, including macroinvertebrate community abundance, number of families and species, and individual species. Site characteristics were fundamental in accounting for variation in the unstandardized macroinvertebrate community. However, when differences between sites were controlled, hydrological conditions were found to play a dominant role in explaining ecological variation. Indices of high discharge (or their absence), 4-7 months prior to sampling (i.e. winter-spring), were found to be the most important variables for describing the late-summer community The results are discussed in relation to the role of flow variability in shaping instream communities and management implications. Copyright ?? 2000 John Wiley & Sons, Ltd.Changes in the macroinvertebrate community in response to flow variations in the Little Stour River, Kent, UK, were examined over a 6 year period (1992-1997). This period included the final year of the 1988-1992 drought, followed by some of the wettest conditions recorded this century and a second period of drought between 1996 and 1997. Each year, samples were collected from 15 sites during late-summer base-flow conditions. Correspondence analysis identified clear differences between samples from upstream and downstream sites, and between drought and non-drought years. Step-wise multiple regression was used to identify hydrological indicators of community variation. Several different indices were used to describe the macroinvertebrate community, including macroinvertebrate community abundance, number of families and species, and individual species. Site characteristics were fundamental in accounting for variation in the unstandardized macroinvertebrate community. However, when differences between sites were controlled, hydrological conditions were found to play a dominant role in explaining ecological variation. Indices of high discharge (or their absence), 4-7 months prior to sampling (i.e. winter-spring), were found to be the most important variables for describing the late-summer community. The results are discussed in relation to the role of flow variability in shaping instream communities and management implications.

Effects of nonpoint and selected point contaminant sources on stream-water quality and relation to land use in Johnson County, northeastern Kansas, October 2002 through June 2004

USGS Publications Warehouse

Lee, Casey J.; Mau, D.P.; Rasmussen, T.J.

2005-01-01

Water and sediment samples were collected by the U.S. Geological Survey in 12 watersheds in Johnson County, northeastern Kansas, to determine the effects of nonpoint and selected point contaminant sources on stream-water quality and their relation to varying land use. The streams studied were located in urban areas of the county (Brush, Dykes Branch, Indian, Tomahawk, and Turkey Creeks), developing areas of the county (Blue River and Mill Creek), and in more rural areas of the county (Big Bull, Captain, Cedar, Kill, and Little Bull Creeks). Two base-flow synoptic surveys (73 total samples) were conducted in 11 watersheds, a minimum of three stormflow samples were collected in each of six watersheds, and 15 streambed-sediment sites were sampled in nine watersheds from October 2002 through June 2004. Discharge from seven wastewater treatment facilities (WWTFs) were sampled during base-flow synoptic surveys. Discharge from these facilities comprised greater than 50 percent of streamflow at the farthest downstream sampling site in six of the seven watersheds during base-flow conditions. Nutrients, organic wastewater-indicator compounds, and prescription and nonprescription pharmaceutical compounds generally were found in the largest concentrations during base-flow conditions at sites at, or immediately downstream from, point-source discharges from WWTFs. Downstream from WWTF discharges streamflow conditions were generally stable, whereas nutrient and wastewater-indicator compound concentrations decreased in samples from sites farther downstream. During base-flow conditions, sites upstream from WWTF discharges had significantly larger fecal coliform and Escherichia coli densities than downstream sites. Stormflow samples had the largest suspended-sediment concentrations and indicator bacteria densities. Other than in samples from sites in proximity to WWTF discharges, stormflow samples generally had the largest nutrient concentrations in Johnson County streams. Discharge from WWTFs with trickling-filter secondary treatment processes had the largest concentrations of many potential contaminants during base-flow conditions. Samples from two of three trickling-filter WWTFs exceeded Kansas Department of Health and Environment pH- and temperature-dependent chronic aquatic-life criteria for ammonia when early-life stages of fish are present. Discharge from trickling-filter facilities generally had the most detections and largest concentrations of many organic wastewater-indicator compounds in Johnson County stream-water samples. Caffeine (stimulant), nonylphenol-diethoxylate (detergent surfactant), and tris(2-butoxyethyl) phosphate (floor polish, flame retardant, and plasticizer) were found at concentrations larger than maximum concentrations in comparable studies. Land use and seasonality affected the occurrence and magnitude of many potential water-quality contaminants originating from nonpoint sources. Base-flow samples from urban sites located upstream from WWTF discharges had larger indicator bacteria densities and wastewater-indicator compound concentrations than did base-flow samples from sites in nonurban areas. Dissolved-solids concentrations were the largest in winter stormflow samples from urban sites and likely were due to runoff from road-salt application. One sample from an urban watershed had a chloride concentration of 1,000 milligrams per liter, which exceeded the Kansas Department of Health and Environment's acute aquatic-life use criterion (860 milligrams per liter) likely due to effects from road-salt application. Pesticide concentrations were the largest in spring stormflow samples collected in nonurban watersheds. Although most wastewater-indicator compounds were found at the largest concentrations in samples from WWTF discharges, the compounds 9-10, anthraquinone (bird repellent), caffeine (stimulant), carbazole (component of coal tar, petroleum products), nonylphenol-diethoxylate (detergent surfactant),

Corticosterone stress response in tree swallows nesting near polychlorinated biphenyl- and dioxin-contaminated rivers

USGS Publications Warehouse

Franceschini, M.D.; Custer, Christine M.; Custer, T.W.; Reed, J.M.; Romero, L.M.

2008-01-01

We assayed baseline and stress-induced corticosterone concentrations from adult female and nestling tree swallows, Tachycineta bicolor, from New England, USA, sites with different levels of contamination with polychlorinated biphenyls (PCBs) and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Corticosterone was compared over 2 years from a highly contaminated PCB site along the Housatonic River (Berkshire County, MA, USA), a midrange contaminated site upstream, and a reference site. Adult females (n = 29), sampled only in 2003, showed an inverted-U association with PCBs, with higher stress-induced corticosterone with midrange contamination than at the high-contamination site. In nestlings, stress-induced corticosterone was highest for the highly contaminated site compared with the other sites in 2003 (n = 53, 29 nests), with no difference among sites in 2004 (n = 93, 27 nests). In 2004, we began testing mechanisms underlying these changes in nestlings at the high- and low-PCB sites. Corticosterone response to dexamethasone injection (used to test negative feedback) was not different between sites, but stress-induced corticosterone was reduced at the contaminated site after adrenocorticotropin hormone injection (used to test adrenal responsiveness), suggesting an inhibited ability to mount a stress response. We also compared nestlings from a stretch of the Woonasquatucket River, Rhode Island, USA, heavily contaminated with TCDD (n = 80, 43 nests) with nestlings from an upstream site that had lower levels of TCDD and the Berkshire County reference site. Although there were no stress-induced differences, baseline corticosterone was lower at the higher TCDD site than at the reference site. Altogether these findings suggest that tree swallows chronically exposed to high PCB and TCDD levels exhibit altered baseline and stress-induced corticosterone responses, but the patterns of alteration might not be predictable. ?? 2008 SETAC.

Cryptosporidium Source Tracking in the Potomac River Watershed▿

PubMed Central

Yang, Wenli; Chen, Plato; Villegas, Eric N.; Landy, Ronald B.; Kanetsky, Charles; Cama, Vitaliano; Dearen, Theresa; Schultz, Cherie L.; Orndorff, Kenneth G.; Prelewicz, Gregory J.; Brown, Miranda H.; Young, Kim Roy; Xiao, Lihua

2008-01-01

To better characterize Cryptosporidium in the Potomac River watershed, a PCR-based genotyping tool was used to analyze 64 base flow and 28 storm flow samples from five sites in the watershed. These sites included two water treatment plant intakes, as well as three upstream sites, each associated with a different type of land use. The uses, including urban wastewater, agricultural (cattle) wastewater, and wildlife, posed different risks in terms of the potential contribution of Cryptosporidium oocysts to the source water. Cryptosporidium was detected in 27 base flow water samples and 23 storm flow water samples. The most frequently detected species was C. andersoni (detected in 41 samples), while 14 other species or genotypes, almost all wildlife associated, were occasionally detected. The two common human-pathogenic species, C. hominis and C. parvum, were not detected. Although C. andersoni was common at all four sites influenced by agriculture, it was largely absent at the urban wastewater site. There were very few positive samples as determined by Environmental Protection Agency method 1623 at any site; only 8 of 90 samples analyzed (9%) were positive for Cryptosporidium as determined by microscopy. The genotyping results suggest that many of the Cryptosporidium oocysts in the water treatment plant source waters were from old calves and adult cattle and might not pose a significant risk to human health. PMID:18776033

Identification of American shad spawning sites and habitat use in the Pee Dee River, North Carolina and South Carolina

USGS Publications Warehouse

Harris, Julianne E.; Hightower, Joseph E.

2011-01-01

We examined spawning site selection and habitat use by American shad Alosa sapidissima in the Pee Dee River, North Carolina and South Carolina, to inform future management in this flow-regulated river. American shad eggs were collected in plankton tows, and the origin (spawning site) of each egg was estimated; relocations of radio-tagged adults on spawning grounds illustrated habitat use and movement in relation to changes in water discharge rates. Most spawning was estimated to occur in the Piedmont physiographic region within a 25-river-kilometer (rkm) section just below the lowermost dam in the system; however, some spawning also occurred downstream in the Coastal Plain. The Piedmont region has a higher gradient and is predicted to have slightly higher current velocities and shallower depths, on average, than the Coastal Plain. The Piedmont region is dominated by large substrates (e.g., boulders and gravel), whereas the Coastal Plain is dominated by sand. Sampling at night (the primary spawning period) resulted in the collection of young eggs (≤1.5 h old) that more precisely identified the spawning sites. In the Piedmont region, most radio-tagged American shad remained in discrete areas (average linear range = 3.6 rkm) during the spawning season and generally occupied water velocities between 0.20 and 0.69 m/s, depths between 1.0 and 2.9 m, and substrates dominated by boulder or bedrock and gravel. Tagged adults made only small-scale movements with changes in water discharge rates. Our results demonstrate that the upstream extent of migration and an area of concentrated spawning occur just below the lowermost dam. If upstream areas have similar habitat, facilitating upstream access for American shad could increase the spawning habitat available and increase the population's size.

Bioavailability of Pb and Zn from mine tailings as indicated by erythrocyte aminolevulinic acid dehydratase (ALA-D) activity in suckers (Pisces: catostomidae)

USGS Publications Warehouse

Schmitt, Christopher J.; Dwyer, F. James; Finger, Susan E.

1984-01-01

The activity of the erythrocyte enzyme δ-aminolevulinic acid dehydratase (ALA-D) was measured in 35 catostomids (black redhorse, Moxostoma duquesnei; golden redhorse, M. erythrurum; northern hogsucker, Hypentelium nigricans) collected from three sites on a stream contaminated with Pb-, Cd-, and Zn-rich mine tailings and from an uncontaminated site upstream. Enzyme activity was expressed in terms of hemoglobin (Hb), DNA, and protein concentrations; these variables can be determined in the laboratory on once-frozen blood samples. Concentrations of Pb and Zn in blood and of Pb in edible tissues were significantly higher, and ALA-D activity was significantly lower, at all three contaminated sites than upstream. At the most contaminated site, ALA-D activity was 62–67% lower than upstream. Lead concentrations in the edible tissues and in blood were positively correlated (r = 0.80), whereas ALA-D activity was negatively correlated with Pb in blood (r = −0.70) and in edible tissues (r = −0.59). Five statistically significant relations between Pb and Zn in blood and ALA-D activity were determined. The two models that explained the highest percentage (> 74%) of the total variance also included factors related to Hb concentration. All five significant models included negative coefficients for variables that represented Pb in blood and positive coefficients for Zn in blood. The ALA-D assay with results standardized to Hb concentration represents an expedient alternative to the more traditional hematocrit standardization, and the measurement of ALA-D activity by this method can be used to document exposure of fish to environmental Pb.

Occurrence of pharmaceuticals and other organic wastewater constituents in selected streams in northern Arkansas, 2004

USGS Publications Warehouse

Galloway, Joel M.; Haggard, Brian E.; Meyers, Michael T.; Green, W. Reed

2005-01-01

The U.S. Geological Survey, in cooperation with the University of Arkansas and the U.S. Department of Agriculture, Agricultural Research Service, collected data in 2004 to determine the occurrence of pharmaceuticals and other organic wastewater constituents, including many constituents of emerging environmental concern, in selected streams in northern Arkansas. Samples were collected in March and April 2004 from 17 sites located upstream and downstream from wastewater- treatment plant effluent discharges on 7 streams in northwestern Arkansas and at 1 stream site in a relatively undeveloped basin in north-central Arkansas. Additional samples were collected at three of the sites in August 2004. The targeted organic wastewater constituents and sample sites were selected because wastewater-treatment plant effluent discharge provides a potential point source of these constituents and analytical techniques have improved to accurately measure small amounts of these constituents in environmental samples. At least 1 of the 108 pharmaceutical or other organic wastewater constituents was detected at all sites in 2004, except at Spavinaw Creek near Maysville, Arkansas. The number of detections generally was greater at sites downstream from municipal wastewater-treatment plant effluent discharges (mean = 14) compared to sites not influenced by wastewatertreatment plants (mean = 3). Overall, 42 of the 108 constituents targeted in the collected water-quality samples were detected. The most frequently detected constituents included caffeine, phenol, para-cresol, and acetyl hexamethyl tetrahydro naphthalene.

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

Data on surface-water quality and quantity, lower Edgewood Creek basin, Douglas County, Nevada, 1984-85

USGS Publications Warehouse

La Camera, R. J.; Browning, S.B.

1988-01-01

Selected hydrologic data were collected from August 1984 through July 1985 at three sites on the lower part of Edgewood Creek, and at a recently constructed sediment-catchment basin that captures and retains runoff from developed areas in the lower Edgewood Creek drainage. The data were collected to quantify the discharge of selected constituents downstream from recent and planned watershed restoration projects, and to Lake Tahoe. Contained in this report are the results of quantitative analyses of 39 water samples for: total and dissolved ammonium, organic nitrogen, nitrite, nitrate, phosphorus, and orthophosphorus; suspended sediment; total iron, manganese, and zinc; and dissolved temperature, specific conductance, pH, and dissolved oxygen; summary statistics (means and standard deviations), and computations of instantaneous loads. On the basis of mean values, about 80% of the total nitrogen load at each of the three Edgewood Creek sites is in the form of organic nitrogen, 12% is in the form of nitrate nitrogen, 7% is in the form of ammonium nitrogen, and 1% is in the form of nitrite nitrogen. The percentage of total phosphorus load in the form of orthophosphorus at the three stream sites varies somewhat with time, but is generally greater at the two downstream sites than at the upstream site. In addition, the percentage of the total phosphorus load that is present in the dissolved state generally is greater at the two downstream sites than at the upstream site. (Lantz-PTT)

Synthesis of natural flows at selected sites in the upper Missouri River basin, Montana, 1928-89

USGS Publications Warehouse

Cary, L.E.; Parrett, Charles

1996-01-01

Natural monthly streamflows were synthesized for the years 1928-89 for 43 sites in the upper Missouri River Basin upstream from Fort Peck Lake in Montana. The sites are represented as nodes in a streamflow accounting model being developed by the Bureau of Reclamation. Recorded and historical flows at most sites have been affected by human activities including reservoir storage, diversions for irrigation, and municipal use. Natural flows at the sites were synthesized by eliminating the effects of these activities. Recorded data at some sites do not include the entire study period. The missing flows at these sites were estimated using a statistical procedure. The methods of synthesis varied, depending on upstream activities and information available. Recorded flows were transferred to nodes that did not have streamflow-gaging stations from the nearest station with a sufficient length of record. The flows at one node were computed as the sum of flows from three upstream tributaries. Monthly changes in reservoir storage were computed from monthend contents. The changes in storage were corrected for the effects of evaporation and precipitation using pan-evaporation and precipitation data from climate stations. Irrigation depletions and consumptive use by the three largest municipalities were computed. Synthesized natural flow at most nodes was computed by adding algebraically the upstream depletions and changes in reservoir storage to recorded or historical flow at the nodes.

Environmental effects of the Big Rapids dam remnant removal, Big Rapids, Michigan, 2000-02

USGS Publications Warehouse

Healy, Denis F.; Rheaume, Stephen J.; Simpson, J. Alan

2003-01-01

The U.S. Geological Survey (USGS), in cooperation with the city of Big Rapids, investigated the environmental effects of removal of a dam-foundation remnant and downstream cofferdam from the Muskegon River in Big Rapids, Mich. The USGS applied a multidiscipline approach, which determined the water quality, sediment character, and stream habitat before and after dam removal. Continuous water-quality data and discrete water-quality samples were collected, the movement of suspended and bed sediment were measured, changes in stream habitat were assessed, and streambed elevations were surveyed. Analyses of water upstream and downstream from the dam showed that the dam-foundation remnant did not affect water quality. Dissolved-oxygen concentrations downstream from the dam remnant were depressed for a short period (days) during the beginning of the dam removal, in part because of that removal effort. Sediment transport from July 2000 through March 2002 was 13,800 cubic yards more at the downstream site than the upstream site. This increase in sediment represents the remobilized sediment upstream from the dam, bank erosion when the impoundment was lowered, and contributions from small tributaries between the sites. Five habitat reaches were monitored before and after dam-remnant removal. The reaches consisted of a reference reach (A), upstream from the effects of the impoundment; the impoundment (B); and three sites below the impoundment where habitat changes were expected (C, D, and E, in downstream order). Stream-habitat assessment reaches varied in their responses to the dam-remnant removal. Reference reach A was not affected. In impoundment reach B, Great Lakes and Environmental Assessment Section (GLEAS) Procedure 51 ratings went from fair to excellent. For the three downstream reaches, reach C underwent slight habitat degradation, but ratings remained good; reach D underwent slight habitat degradation with ratings changing from excellent to good; and, in an area affected by a 1966 sediment release, reach E habitat rated fair in April 2000 and remained fair in September 2001. The most noticeable habitat change in the three reaches downstream from the dam site was a measurable increase in siltation and embeddedness. Bed-elevation profiles show that bed material upstream from the dam site was remobilized as suspended sediment and bedload, and was redeposited in the reaches below the cofferdam. Deposition was greater in the deep, slow-moving pools than the shallow, fast-moving riffles. For the most part, where deposition took place, deposits were less than 1 foot in thickness. In the year following the removal of the cofferdam, much of the sediment deposited below the dam was moved out of the study reach.

Impact of refined petroleum spills on water quality, macro-invertebrate and microbial communities of a tropical aquatic environment.

PubMed

Chukwu, L O; Nwachukwu, S C U

2005-07-01

Water quality characteristics, benthic macro-invertebrates and microbial communities of three first order streams in South West Nigeria were investigated to assess the effects of refined petroleum five months after spillage. All physical and chemical conditions except temperature and pH were significantly different (P<0.01) at the upstream control stations and impacted stations reflecting the perturbational stress. The benthic macro-invertebrate fauna were dominated by arthropods, but the faunal spectrum was dissimilar at all the stations studied. Sampling stations at the epicentre of the spill showed considerable reduction in faunal compositions and relative abundance. Generally, the microbial density and diversity were highest in both soil and water samples from impacted sites than in control sites. There was a significantly higher proportion (P < 0.05) of hydrocarbon utilizers in soil than in water samples in all stations except in samples from stations (P<0.05).

Impact of an urban multi-metal contamination gradient: metal bioaccumulation and tolerance of river biofilms collected in different seasons.

PubMed

Faburé, Juliette; Dufour, Marine; Autret, Armelle; Uher, Emmanuelle; Fechner, Lise C

2015-02-01

The aim of this study was to investigate the repeatability and seasonal variability of the biological response of river biofilms chronically exposed to a multi-metal pressure in an urban contamination gradient. Biofilms were grown on immersed plastic membranes at three sites on the Seine river upstream (site 1) and downstream (sites 2 and 3) from Paris (France). They were collected in four different seasons (autumn, spring, summer and winter). Biofilm tolerance to Cu, Ni, Pb and Zn was measured using a PICT (Pollution-Induced Community Tolerance) approach with a previously developed short-term toxicity test based on β-glucosidase (heterotrophic) activity. Metal concentrations in the river and also in the biofilm samples (total and non-exchangeable bioaccumulated metals) were also monitored. Biofilm-accumulated metal concentrations reflected the increase of the multi-metal exposure along the urban gradient. These concentrations were strongly correlated with dissolved and particulate organic carbon and with the total metal fraction in the river water, which recalls the significant influence of the environmental parameters on metal uptake processes in river biofilms. Overall, natural biofilms allow monitoring water quality by integrating the variations of a diffuse metal contamination overtime. Tolerance levels globally increased from site 1 to site 3 reflecting the metal pollution gradient measured in the river water collected at the three sites. Cu tolerance tended to increase during warm seasons but no clear seasonal tendency could be found for Ni, Pb and Zn. Furthermore, principal component analysis clearly discriminated samples collected upstream (site 1) from samples collected downstream (sites 2 and 3) along the first principal component which was correlated to the metal gradient. Samples collected in winter were also separated from the others along the second principal component correlated to parameters like water temperature and Total Suspended Solids concentration. This study shows that chronic in situ exposure to environmental metal concentrations has a significant impact on natural biofilms. Biofilm tolerance to metals and biofilm metal bioaccumulation both reflect metal exposure levels although they remain low when compared to Environmental Quality Standards from the European Water Framework Directive. Yet temperature appears as an important environmental variable shaping community structure and response to toxic exposure which shows that the sampling date is an important parameter to consider when using natural river biofilms to assess the impacts of urban pressure. Copyright © 2014 Elsevier B.V. All rights reserved.

Characterization of the Kootenai River Algae Community and Primary Productivity Before and After Experimental Nutrient Addition, 2004–2007 [Chapter 2, Kootenai River Algal Community Characterization, 2009 KTOI REPORT].

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holderman, Charlie; Bonners Ferry, ID; Anders, Paul

2009-07-01

The Kootenai River ecosystem (spelled Kootenay in Canada) has experienced numerous ecological changes since the early 1900s. Some of the largest impacts to habitat, biological communities, and ecological function resulted from levee construction along the 120 km of river upstream from Kootenay Lake, completed by the 1950s, and the construction and operation of Libby Dam on the river near Libby Montana, completed in 1972. Levee construction isolated tens of thousands of hectares of historic functioning floodplain habitat from the river channel downstream in Idaho and British Columbia (B.C.) severely reducing natural biological productivity and habitat diversity crucial to large river-floodplainmore » ecosystem function. Libby Dam greatly reduces sediment and nutrient transport to downstream river reaches, and dam operations cause large changes in the timing, duration, and magnitude of river flows. These and other changes have contributed to the ecological collapse of the post-development Kootenai River ecosystem and its native biological communities. In response to large scale loss of nutrients, experimental nutrient addition was initiated in the North Arm of Kootenay Lake in 1992, in the South Arm of Kootenay Lake in 2004, and in the Kootenai River at the Idaho-Montana border during 2005. This report characterizes baseline chlorophyll concentration and accrual (primary productivity) rates and diatom and algal community composition and ecological metrics in the Kootenai River for four years, one (2004) before, and three (2005 through 2007) after nutrient addition. The study area encompassed a 325 km river reach from the upper Kootenay River at Wardner, B.C. (river kilometer (rkm) 445) downstream through Montana and Idaho to Kootenay Lake in B.C. (rkm 120). Sampling reaches included an unimpounded reach furthest upstream and four reaches downstream from Libby Dam affected by impoundment: two in the canyon reach (one with and one without nutrient addition), a braided reach, and a meandering reach. The study design included 14 sampling sites: an upstream, unimpounded reference site (KR-14), four control (non-fertilized) canyon sites downstream from Libby Dam, but upstream from nutrient addition (KR-10 through KR-13), two treatment sites referred to collectively as the nutrient addition zone (KR-9 and KR-9.1, located at and 5 km downstream from the nutrient addition site), two braided reach sites (KR-6 and KR-7), and four meander reach sites (KR-1 through KR-4). A series of qualitative evaluations and quantitative analyses were used to assess baseline conditions and effects of experimental nutrient addition treatments on chlorophyll, primary productivity, and taxonomic composition and metric arrays for the diatom and green algae communities. Insufficient density in the samples precluded analyses of bluegreen algae taxa and metrics for pre- and post-nutrient addition periods. Chlorophyll a concentration (mg/m{sup 2}), chlorophyll accrual rate (mg/m{sup 2}/30d), total chlorophyll concentration (chlorophyll a and b) (mg/m{sup 2}), and total chlorophyll accrual rate (mg/m{sup 2}/30d) were calculated. Algal taxa were identified and grouped by taxonomic order as Cyanophyta (blue-greens), Chlorophyta (greens), Bacillariophyta (diatoms), Chrysophyta (goldens), and dominant species from each sample site were identified. Algal densities (number/ml) in periphyton samples were calculated for each sample site and sampling date. Principal Component Analysis (PCA) was performed to reduce the dimension of diatom and algae data and to determine which taxonomic groups and metrics were contributing significantly to the observed variation. PCA analyses were tabulated to indicate eigenvalues, proportion, and cumulative percent variation, as well as eigenvectors (loadings) for each of the components. Biplot graphic displays of PCA axes were also generated to characterize the pattern and structure of the underlying variation. Taxonomic data and a series of biological and ecological metrics were used with PCA for diatoms and algae. Algal metrics included a suite of abundance, diversity, richness, dominance, and other measures, whereas additional trophic status and chemical limnology metrics, Van Dam indices and morphological groupings were employed in diatom PCAs. Analysis of Variance (ANOVA) was carried out using chlorophyll metrics and taxa and metric arrays for the diatom and green algae community data for comparing site differences from 2004 through 2007. Clear, statistically significant, biological responses from chlorophyll metrics, and taxa and metrics of the diatom and algal communities were revealed following experimental nutrient addition in the Kootenai River. Chlorophyll metric responses were more often significant and generally greater in magnitude than diatom and green algae taxa and metric responses.« less

Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

PubMed Central

Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

2011-01-01

Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

Summary of Environmental Monitoring and Assessment Program (EMAP) activities in South Dakota, 2000-2004

USGS Publications Warehouse

Heakin, Allen J.; Neitzert, Kathleen M.; Shearer, Jeffrey S.

2006-01-01

The U.S. Environmental Protection Agency (USEPA) initiated data-collection activities for the Environmental Monitoring and Assessment Program-West (EMAP-West) in South Dakota during 2000. The objectives of the study were to develop the monitoring tools necessary to produce unbiased estimates of the ecological condition of surface waters across a large geographic area of the western United States, and to demonstrate the effectiveness of those tools in a large-scale assessment. In 2001, the U.S. Geological Survey (USGS) and the South Dakota Department of Game, Fish and Parks (GF&P) established a cooperative agreement and assumed responsibility for completing the remaining assessments for the perennial, wadable streams of the EMAP-West in the State. Stream assessment sites were divided into two broad categories-the first category of sites was randomly selected and assigned by the USEPA for South Dakota. The second category consisted of sites that were specifically selected because they appeared to have reasonable potential for representing the best available physical, chemical, and biological conditions in the State. These sites comprise the second category of assessment sites and were called 'reference' sites and were selected following a detailed evaluation process. Candidate reference site data will serve as a standard or benchmark for assessing the overall ecological condition of the randomly selected sites. During 2000, the USEPA completed 22 statewide stream assessments in South Dakota. During 2001-2003, the USGS and GF&P completed another 42 stream assessments bringing the total of randomly selected stream assessments within South Dakota to 64. In addition, 18 repeat assessments designed to meet established quality-assurance/quality-control requirements were completed at 12 of these 64 sites. During 2002-2004, the USGS in cooperation with GF&P completed stream assessments at 45 candidate reference sites. Thus, 109 sites had stream assessments completed in South Dakota for EMAP-West (2000-2004). Relatively early in the EMAP-West stream-assessment process, it became apparent that for some streams in south-central South Dakota, in-stream conditions varied considerably over relatively short distances of only a few miles. These changes appeared to be a result of geomorphic changes associated with changes in the underlying geology. For these streams, moving stream assessment sites short distances upstream or downstream had the potential to provide substantially different bioassessment data. In order to obtain a better understanding of how geology influences stream conditions, two streams located in south-central South Dakota were chosen for multiple stream sampling at sites located along their longitudinal profile at points where notable changes in geomorphology were observed. Subsequently, three sites on Bear-in-the-Lodge Creek and three sites on Black Pipe Creek were selected for multiple stream sampling using EMAP-West protocols so that more could be learned about geologic influences on stream conditions. Values for dissolved oxygen and specific conductance generally increased from upstream to downstream locations on Bear-in-the-Lodge Creek. Values for pH and water temperature generally decreased from upstream to downstream locations. Decreasing water temperature could be indicative of ground-water inflows. Values for dissolved oxygen, pH, and water temperature generally increased from upstream to downstream locations on Black Pipe Creek. The increase in temperature at the lower sites is a result of less dense riparian cover, and the warmer water also could account for the lower concentrations of dissolved oxygen found in the lower reaches of Black Pipe Creek. Values for specific conductance were more than three times greater at the lower site (1,342 microsiemens per centimeter (?S/cm)) than at the upper site (434 ?S/cm). The increase probably occurs when the stream transitions from contacting the underlying Ar

Determining sources of dissolved organic carbon and disinfection byproduct precursors to the McKenzie River, Oregon

USGS Publications Warehouse

Kraus, Tamara E.C.; Anderson, Chauncey W.; Morgenstern, Karl; Downing, Bryan D.; Pellerin, Brian A.; Bergamaschi, Brian A.

2010-01-01

This study was conducted to determine the main sources of dissolved organic carbon (DOC) and disinfection byproduct (DBP) precursors to the McKenzie River, Oregon (USA). Water samples collected from the mainstem, tributaries, and reservoir outflows were analyzed for DOC concentration and DBP formation potentials (trihalomethanes [THMFPs] and haloacetic acids [HAAFPs]). In addition, optical properties (absorbance and fluorescence) of dissolved organic matter (DOM) were measured to provide insight into DOM composition and assess whether optical properties are useful proxies for DOC and DBP precursor concentrations. Optical properties indicative of composition suggest that DOM in the McKenzie River mainstem was primarily allochthonous - derived from soils and plant material in the upstream watershed. Downstream tributaries had higher DOC concentrations than mainstem sites (1.6 ?? 0.4 vs. 0.7 ?? 0.3 mg L-1) but comprised <5% of mainstem flows and had minimal effect on overall DBP precursor loads. Water exiting two large upstream reservoirs also had higher DOC concentrations than the mainstem site upstream of the reservoirs, but optical data did not support in situ algal production as a source of the added DOC during the study. Results suggest that the first major rain event in the fall contributes DOM with high DBP precursor content. Although there was interference in the absorbance spectra in downstream tributary samples, fluorescence data were strongly correlated to DOC concentration (R 2 = 0.98), THMFP (R2 = 0.98), and HAAFP (R2 = 0.96). These results highlight the value of using optical measurements for identifying the concentration and sources of DBP precursors in watersheds, which will help drinking water utilities improve source water monitoring and management programs. Copyright ?? 2010 by the American Society of Agronomy.

Irrigation drainage studies of the Angostura Reclamation Unit and the Belle Fourche Reclamation Project, western South Dakota : results of 1994 sampling and comparisons with 1988 data

USGS Publications Warehouse

Sando, Steven K.; Williamson, Joyce E.; Dickerson, Kimberly K.; Wesolowski, Edwin A.

2001-01-01

The U.S. Department of the Interior started the National Irrigation Water Quality Program in 1985 to identify the nature and extent of irrigation-induced water-quality problems that might exist in the western U.S. The Angostura Reclamation Unit (ARU) and Belle Fourche Reclamation Project (BFRP) in western South Dakota were included as part of this program. The ARU and BFRP reconnaissance studies were initiated in 1988, during below-normal streamflow conditions in both study areas. Surface water, bottom sediment, and fish were resampled in 1994 at selected sites in both study areas during generally near-normal streamflow conditions to compare with 1988 study results. Concentrations of major ions in water for both the ARU and BFRP study areas are high relative to national baseline levels. Major-ion concentrations for both areas generally are lower for 1994 than for 1988, when low-flow conditions prevailed, but ionic proportions are similar between years. For ARU, dissolved-solids concentrations probably increase slightly downstream from Angostura Reservoir; however, the available data sets are insufficient to confidently discern effects of ARU operations on dissolved-solids loading. For BFRP, dissolved-solids concentrations are slightly higher at sites that are affected by irrigation drainage; again, however, the data are inconclusive to determine whether BFRP operations increase dissolved-solids loading. Most trace-element concentrations in water samples for both study areas are similar between 1988 and 1994, and do not show strong relations with discharge. ARU operations probably are not contributing discernible additional loads of trace elements to the Cheyenne River. For BFRP, concentrations of some trace elements are slightly higher at sites downstream from irrigation operations than at a site upstream from irrigation operations. BFRP operations might contribute to trace-element concentrations in the Belle Fourche River, but available data are insufficient to quantify increases. For both study areas, concentrations of several trace elements occasionally exceed National Irrigation Water Quality Program guidelines. Selenium routinely occurs in concentrations that could be problematic at sites upstream and downstream from both study areas. Elevated selenium concentrations at sites upstream from irrigation operations indicate that naturally occurring selenium concentrations are relatively high in and near the study areas. While ARU operations probably do not contribute discernible additional loads of selenium to the Cheyenne River, BFRP operations might contribute additional selenium loads to the Belle Fourche River. Concentrations of most trace elements in bottom sediment, except arsenic and selenium, are similar to typical concentrations for western U.S. soils for both study areas. Bottom-sediment arsenic and selenium (1988) concentrations in both study areas can reach levels that might be of concern; however, there is insufficient information to determine whether irrigation operations contribute to these elevated concentrations. Concentrations of most trace elements in fish in both study areas are less than values known to adversely affect fish or birds, although there are occasional exceedances of established criteria. However, selenium concentrations in fish samples routinely are within the National Irrigation Water Quality Program level of concern, and also commonly exceed the dietary guideline for avian consumers for both study areas. Selenium concentrations in fish samples generally are higher at sites downstream from irrigation operations. For BFRP, arsenic and mercury concentrations are elevated in fish samples from site B-18, which is influenced by mine tailings.

Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

PubMed

Li, Shisheng; Smerdon, Michael J

2004-04-02

Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

Photographic techniques for characterizing streambed particle sizes

USGS Publications Warehouse

Whitman, Matthew S.; Moran, Edward H.; Ourso, Robert T.

2003-01-01

We developed photographic techniques to characterize coarse (>2-mm) and fine (≤2-mm) streambed particle sizes in 12 streams in Anchorage, Alaska. Results were compared with current sampling techniques to assess which provided greater sampling efficiency and accuracy. The streams sampled were wadeable and contained gravel—cobble streambeds. Gradients ranged from about 5% at the upstream sites to about 0.25% at the downstream sites. Mean particle sizes and size-frequency distributions resulting from digitized photographs differed significantly from those resulting from Wolman pebble counts for five sites in the analysis. Wolman counts were biased toward selecting larger particles. Photographic analysis also yielded a greater number of measured particles (mean = 989) than did the Wolman counts (mean = 328). Stream embeddedness ratings assigned from field and photographic observations were significantly different at 5 of the 12 sites, although both types of ratings showed a positive relationship with digitized surface fines. Visual estimates of embeddedness and digitized surface fines may both be useful indicators of benthic conditions, but digitizing surface fines produces quantitative rather than qualitative data. Benefits of the photographic techniques include reduced field time, minimal streambed disturbance, convenience of postfield processing, easy sample archiving, and improved accuracy and replication potential.

Urbanization is a major influence on microplastic ingestion by sunfish in the Brazos River Basin, Central Texas, USA.

PubMed

Peters, Colleen A; Bratton, Susan P

2016-03-01

Microplastics, degraded and weathered polymer-based particles, and manufactured products ranging between 50 and 5000 μm in size, are found within marine, freshwater, and estuarine environments. While numerous peer-reviewed papers have quantified the ingestion of microplastics by marine vertebrates, relatively few studies have focused on microplastic ingestion by freshwater organisms. This study documents microplastic and manufactured fiber ingestion by bluegill (Lepomis macrochirus) and longear (Lepomis megalotis) sunfish (Centrarchidae) from the Brazos River Basin, between Lake Whitney and Marlin, Texas, USA. Fourteen sample sites were studied and categorized into urban, downstream, and upstream areas. A total of 436 sunfish were collected, and 196 (45%) stomachs contained microplastics. Four percent (4%) of items sampled were debris on the macro size scale (i.e. >5 mm) and consisted of masses of plastic, metal, Styrofoam, or fishing material, while 96% of items sampled were in the form of microplastic threads. Fish length was statistically correlated to the number of microplastics detected (p = 0.019). Fish collected from urban sites displayed the highest mean number of microplastics ingested, followed by downstream and upstream sites. Microplastics were associated with the ingestion of other debris items (e.g. sand and wood) and correlated to the ingestion of fish eggs, earthworms, and mollusks, suggesting that sunfish incidentally ingest microplastics during their normal feeding methods. The high frequency of microplastic ingestion suggest that further research is needed to determine the residence time of microplastics within the stomach and gut, potential for food web transfer, and adverse effects on wildlife and ecosystemic health. Copyright © 2016 Elsevier Ltd. All rights reserved.

Legacy of a Chemical Factory Site: Contaminated Groundwater Impacts Stream Macroinvertebrates.

PubMed

Rasmussen, Jes J; McKnight, Ursula S; Sonne, Anne Th; Wiberg-Larsen, Peter; Bjerg, Poul L

2016-02-01

Legislative and managing entities of EU member states face a comprehensive task because the chemical and ecological impacts of contaminated sites on surface waters must be assessed. The ecological assessment is further complicated by the low availability or, in some cases, absence of ecotoxicity data for many of the compounds occurring at contaminated sites. We studied the potential impact of a contaminated site, characterised by chlorinated solvents, sulfonamides, and barbiturates, on benthic macroinvertebrates in a receiving stream. Most of these compounds are characterised by low or unknown ecotoxicity, but they are continuously discharged into the stream by way of a long-lasting source generating long-term chronic exposure of the stream biota. Our results show that taxonomical density and diversity of especially sediment dwelling taxa were reduced by >50 % at the sampling sites situated in the primary inflow zone of the contaminated GW. Moreover, macroinvertebrate communities at these sampling sites could be distinguished from those at upstream control sites and sites situated along a downstream dilution gradient using multidimensional scaling. Importantly, macroinvertebrate indices currently used did not identify this impairment, thus underpinning an urgent need for developing suitable tools for the assessment of ecological effects of contaminated sites in streams.

Low-head sea lamprey barrier effects on stream habitat and fish communities in the Great Lakes basin

USGS Publications Warehouse

Dodd, H.R.; Hayes, D.B.; Baylis, J.R.; Carl, L.M.; Goldstein, J.D.; McLaughlin, R.L.; Noakes, D.L.G.; Porto, L.M.; Jones, M.L.

2003-01-01

Low-head barriers are used to block adult sea lamprey (Petromyzon marinus) from upstream spawning habitat. However, these barriers may impact stream fish communities through restriction of fish movement and habitat alteration. During the summer of 1996, the fish community and habitat conditions in twenty-four stream pairs were sampled across the Great Lakes basin. Seven of these stream pairs were re-sampled in 1997. Each pair consisted of a barrier stream with a low-head barrier and a reference stream without a low-head barrier. On average, barrier streams were significantly deeper (df = 179, P = 0.0018) and wider (df = 179, P = 0.0236) than reference streams, but temperature and substrate were similar (df = 183, P = 0.9027; df = 179, P = 0.999). Barrier streams contained approximately four more fish species on average than reference streams. However, streams with low-head barriers showed a greater upstream decline in species richness compared to reference streams with a net loss of 2.4 species. Barrier streams also showed a peak in richness directly downstream of the barriers, indicating that these barriers block fish movement upstream. Using S??renson's similarity index (based on presence/absence), a comparison of fish community assemblages above and below low-head barriers was not significantly different than upstream and downstream sites on reference streams (n = 96, P > 0.05), implying they have relatively little effect on overall fish assemblage composition. Differences in the frequency of occurrence and abundance between barrier and reference streams was apparent for some species, suggesting their sensitivity to barriers.

Water quality and ecological condition of urban streams in Independence, Missouri, June 2005 through December 2008

USGS Publications Warehouse

Christensen, D.; Harris, Thomas E.; Niesen, Shelley L.

2010-01-01

To identify the sources of selected constituents in urban streams and better understand processes affecting water quality and their effects on the ecological condition of urban streams and the Little Blue River in Independence, Missouri the U.S. Geological Survey in cooperation with the City of Independence Water Pollution Control Department initiated a study in June 2005 to characterize water quality and evaluate the ecological condition of streams within Independence. Base-flow and stormflow samples collected from five sites within Independence, from June 2005 to December 2008, were used to characterize the physical, chemical, and biologic effects of storm runoff on the water quality in Independence streams and the Little Blue River. The streams draining Independence-Rock Creek, Sugar Creek, Mill Creek, Fire Prairie Creek, and the Little Blue River-drain to the north and the Missouri River. Two small predominantly urban streams, Crackerneck Creek [12.9-square kilometer (km2) basin] and Spring Branch Creek (25.4-km2 basin), were monitored that enter into the Little Blue River between upstream and downstream monitoring sites. The Little Blue River above the upstream site is regulated by several reservoirs, but streamflow is largely uncontrolled. The Little Blue River Basin encompasses 585 km2 with about 168 km2 or 29 percent of the basin lying within the city limits of Independence. Water-quality samples also were collected for Rock Creek (24.1-km2 basin) that drains the western part of Independence. Data collection included streamflow, physical properties, dissolved oxygen, chloride, metals, nutrients, common organic micro-constituents, and fecal indicator bacteria. Benthic macroinvertebrate community surveys and habitat assessments were conducted to establish a baseline for evaluating the ecological condition and health of streams within Independence. Additional dry-weather screenings during base flow of all streams draining Independence were conducted to identify point-source discharges and other sources of potential contamination. Regression models were used to estimate continuous and annual flow-weighted concentrations, loadings, and yields for chloride, total nitrogen, total phosphorus, suspended sediment, and Escherichia coli bacteria densities. Base-flow and stormflow water-quality samples were collected at five sites within Independence. Base-flow samples for Rock Creek and two tributary streams to the Little Blue River exceeded recommended U.S. Environmental Protection Agency standards for the protection of aquatic life for total nitrogen and total phosphorus in about 90 percent of samples, whereas samples collected at two Little Blue River sites exceeded both the total nitrogen and total phosphorus standards less often, about 30 percent of the time. Dry-weather screening identified a relatively small number (14.0 percent of all analyses) of potential point-source discharges for total chlorine, phenols, and anionic surfactants. Stormflow had larger median measured concentrations of total common organic micro-constituents than base flow. The four categories of common organic micro-constituents with the most total detections in stormflow were pesticides (100 percent), polyaromatic hydrocarbons and combustion by-products (99 percent), plastics (93 percent), and stimulants (91 percent). Most detections of common organic micro-constituents were less than 2 micrograms per liter. Median instantaneous Escherichia coli densities for stormflow samples showed a 21 percent increase measured at the downstream site on the Little Blue River from the sampled upstream site. Using microbial source-tracking methods, less than 30 percent of Escherichia coli bacteria in samples were identified as having human sources. Base-flow and stormflow data were used to develop regression equations with streamflow and continuous water-quality data to estimate daily concentrations, loads, and yields of various water-quality contaminants.

Distribution of trace metals at Hopewell Furnace National Historic Site, Berks and Chester Counties, Pennsylvania

USGS Publications Warehouse

Sloto, Ronald A.; Reif, Andrew G.

2011-01-01

Hopewell Furnace, located approximately 50 miles northwest of Philadelphia, was a cold-blast, charcoal iron furnace that operated for 113 years (1771 to 1883). The purpose of this study by the U.S. Geological Survey, in cooperation with the National Park Service, was to determine the distribution of trace metals released to the environment from an historical iron smelter at Hopewell Furnace National Historic Site (NHS). Hopewell Furnace used iron ore from local mines that contained abundant magnetite and accessory sulfide minerals enriched in arsenic, cobalt, copper, and other metals. Ore, slag, cast iron furnace products, soil, groundwater, stream base flow, streambed sediment, and benthic macroinvertebrates were sampled for this study. Soil samples analyzed in the laboratory had concentrations of trace metals low enough to meet Pennsylvania Department of Environmental Protection standards for non-residential use. Groundwater samples from the supply well met U.S. Environmental Protection Agency drinking-water regulations. Concentrations of metals in surface-water base flow at the five stream sampling sites were below continuous concentration criteria for protection of aquatic organisms. Concentrations of metals in sediment at the five stream sites were below probable effects level guidelines for protection of aquatic organisms except for copper at site HF-3. Arsenic, copper, lead, zinc, and possibly cobalt were incorporated into the cast iron produced by Hopewell Furnace. Manganese was concentrated in slag along with iron, nickel, and zinc. The soil near the furnace has elevated concentrations of chromium, copper, iron, lead, and zinc compared to background soil concentrations. Concentrations of toxic elements were not present at concentrations of concern in water, soil, or stream sediments, despite being elevated in ore, slag, and cast iron furnace products. The base-flow surface-water samples indicated good overall quality. The five sampled sites generally had low concentrations of nutrients and major ions but had elevated concentrations of iron, manganese, and strontium when compared to sites sampled in adjacent watersheds. The background site on Baptism Creek generally had the lowest concentrations and yields of constituents. Low concentrations of nutrients and major ions at all five sites indicate that measured concentrations can be attributed to general land use and geology and not to point sources. Streambed-sediment sampling results indicated higher concentrations of all metals except nickel at sites on French Creek compared to the background site on Baptism Creek. Concentrations of aluminum, cadmium, and nickel were highest in sediment from the sampling site upstream from Hopewell Furnace. The highest concentrations of arsenic, boron, cobalt, copper, iron, lead, manganese, mercury, and zinc were detected at the site just below Hopewell Furnace, which indicates that the source of these metals may be in Hopewell Furnace NHS. The invertebrate community at the background site on Baptism Creek was dominated by pollution sensitive taxa indicating a healthy, diverse benthic-macroinvertebrate community. Benthic-macroinvertebrate communities at sampling sites on French Creek indicated disturbed communities when compared to the background site on Baptism Creek and that the overall stream quality immediately above and below Hopewell Furnace NHS is degraded. The benthic-macroinvertebrate communities were dominated by pollution-tolerant taxa, and taxa were less diverse than at the background site. Habitat conditions at the upstream site on French Creek were good but were degraded at downstream sites on French Creek. The major habitat issues at these sites were related to a lack of stable substrate, erosion, and deposition. Water quality and streambed-sediment quality do not indicate that the degraded benthic-macroinvertebrate communities are the result of poor water quality. Habitat conditions (erosion and sedimentation) and physical alterations (water temperature) from the outfall of Hopewell Lake are the most likely causes of the impaired communities.

Recommendations for a wind profiling network to support Space Shuttle launches

NASA Technical Reports Server (NTRS)

Zamora, R. J.

1992-01-01

The feasibility is examined of a network of clear air radar wind profilers to forecast wind conditions before Space Shuttle launches during winter. Currently, winds are measured only in the vicinity of the shuttle launch site and wind loads on the launch vehicle are estimated using these measurements. Wind conditions upstream of the Cape are not monitored. Since large changes in the wind shear profile can be associated with weather systems moving over the Cape, it may be possible to improve wind forecasts over the launch site if wind measurements are made upstream. A radar wind profiling system is in use at the Space Shuttle launch site. This system can monitor the wind profile continuously. The existing profiler could be combined with a number of radars located upstream of the launch site. Thus, continuous wind measurements would be available upstream and at the Cape. NASA-Marshall representatives have set the requirements for radar wind profiling network. The minimum vertical resolution of the network must be set so that the wind shears over the depths greater than or = 1 km will be detected. The network should allow scientists and engineers to predict the wind profile over the Cape 6 hours before a Space Shuttle launch.

Toxicity evaluation of natural samples from the vicinity of rice fields using two trophic levels.

PubMed

Marques, Catarina R; Pereira, Ruth; Gonçalves, Fernando

2011-09-01

An ecotoxicological screening of environmental samples collected in the vicinity of rice fields followed a combination of physical and chemical measurements and chronic bioassays with two freshwater trophic levels (microalgae: Pseudokirchneriella subcapitata and Chlorella vulgaris; daphnids: Daphnia longispina and Daphnia magna). As so, water and sediment/soil elutriate samples were obtained from three sites: (1) in a canal reach crossing a protected wetland upstream, (2) in a canal reach surrounded by rice fields and (3) in a rice paddy. The sampling was performed before and during the rice culture. During the rice cropping, the whole system quality decreased comparatively to the situation before that period (e.g. nutrient overload, the presence of pesticides in elutriates from sites L2 and L3). This was reinforced by a significant inhibition of both microalgae growth, especially under elutriates. Contrary, the life-history traits of daphnids were significantly stimulated with increasing concentrations of water and elutriates, for both sampling periods.

Analysis of chemical contamination within a canal in a Mexican border colonia.

PubMed

Owens, Janel E; Niemeyer, Emily D

2006-04-01

This study examines urban pollution within Derechos Humanos, a colonia popular in Matamoros, Tamaulipas, Mexico. General water quality indicators (coliform bacteria, total dissolved solids, ecologically relevant cations and anions), heavy metals (copper, lead, nickel, zinc, iron and cadmium), and volatile organic compounds (benzene, toluene, ethylbenzene, styrene, and dichlorobenzene and xylene isomers) were quantified within a wastewater canal running adjacent to the community. Water samples were collected at multiple sites along the banks of the canal and evidence of anthropogenic emissions existed at each sampling location. Sample site 2, approximately 10 m upstream of the colonia, contained both the widest range of hazardous pollutants and the greatest number exceeding US Environmental Protection Agency surface water standards. At each sampling location, high concentrations of total coliform (> 10(4) colonies/100 mL sample), lead (ranging from 0.05 to 0.40 mg/L), nickel (levels from 0.21 to 1.45 mg/L), and benzene (up to 9.80 mg/L) were noted.

Effects of the H-3 Highway Stormwater Runoff on the Water Quality of Halawa Stream, Oahu, Hawaii, November 1998 to August 2004

USGS Publications Warehouse

Wolff, Reuben H.; Wong, Michael F.

2008-01-01

Since November 1998, water-quality data have been collected from the H-3 Highway Storm Drain C, which collects runoff from a 4-mi-long viaduct, and from Halawa Stream on Oahu, Hawaii. From January 2001 to August 2004, data were collected from the storm drain and four stream sites in the Halawa Stream drainage basin as part of the State of Hawaii Department of Transportation Storm Water Monitoring Program. Data from the stormwater monitoring program have been published in annual reports. This report uses these water-quality data to explore how the highway storm-drain runoff affects Halawa Stream and the factors that might be controlling the water quality in the drainage basin. In general, concentrations of nutrients, total dissolved solids, and total suspended solids were lower in highway runoff from Storm Drain C than at stream sites upstream and downstream of Storm Drain C. The opposite trend was observed for most trace metals, which generally occurred in higher concentrations in the highway runoff from Storm Drain C than in the samples collected from Halawa Stream. The absolute contribution from Storm Drain C highway runoff, in terms of total storm loads, was much smaller than at stations upstream and downstream, whereas the constituent yields (the relative contribution per unit drainage basin area) at Storm Drain C were comparable to or higher than storm yields at stations upstream and downstream. Most constituent concentrations and loads in stormwater runoff increased in a downstream direction. The timing of the storm sampling is an important factor controlling constituent concentrations observed in stormwater runoff samples. Automated point samplers were used to collect grab samples during the period of increasing discharge of the storm throughout the stormflow peak and during the period of decreasing discharge of the storm, whereas manually collected grab samples were generally collected during the later stages near the end of the storm. Grab samples were analyzed to determine concentrations and loads at a particular point in time. Flow-weighted time composite samples from the automated point samplers were analyzed to determine mean constituent concentrations or loads during a storm. Chemical analysis of individual grab samples from the automated point sampler at Storm Drain C demonstrated the ?first flush? phenomenon?higher constituent concentrations at the beginning of runoff events?for the trace metals cadmium, lead, zinc, and copper, whose concentrations were initially high during the period of increasing discharge and gradually decreased over the duration of the storm. Water-quality data from Storm Drain C and four stream sites were compared to the State of Hawaii Department of Health (HDOH) water-quality standards to determine the effects of highway storm runoff on the water quality of Halawa Stream. The geometric-mean standards and the 10- and 2-percent-of-the-time concentration standards for total nitrogen, nitrite plus nitrate, total phosphorus, total suspended solids, and turbidity were exceeded in many of the comparisons. However, these standards were not designed for stormwater sampling, in which constituent concentrations would be expected to increase for short periods of time. With the aim of enhancing the usefulness of the water-quality data, several modifications to the stormwater monitoring program are suggested. These suggestions include (1) the periodic analyzing of discrete samples from the automated point samplers over the course of a storm to get a clearer profile of the storm, from first flush to the end of the receding discharge; (2) adding an analysis of the dissolved fractions of metals to the sampling plan; (3) installation of an automatic sampler at Bridge 8 to enable sampling earlier in the storms; (4) a one-time sampling and analysis of soils upstream of Bridge 8 for base-line contaminant concentrations; (5) collection of samples from Halawa Stream during low-flow conditions

Water quality and the composition of fish and macroinvertebrate communities in the Devils and Pecos Rivers within and upstream from the Amistad National Recreation Area, Texas, 2005-7

USGS Publications Warehouse

Moring, J. Bruce

2012-01-01

The total number of fish species collected was the same in the Devils River and Pecos River, but the species found in the two rivers varied slightly. The number of fish species generally increased from the site farthest upstream to the site farthest downstream in the Devils River, and decreased between the site farthest upstream and site farthest downstream in the Pecos River. The redbreast sunfish was the most abundant species collected in the Devils River, and the blacktail shiner was the most abundant species collected in the Pecos River. Comparing the species from each river, the percentage of omnivorous fish species was larger at the more downstream sites closer to Amistad Reservoir, and the percentage of species tolerant of environmental stressors was larger in the Pecos River. The fish community, assessed on the basis of the number of shared species among the sites sampled, was more similar to the fish community at the other sites on the same river than it was to the fish community from any other site in the other river. More macroinvertebrate taxa were collected in the Devils River than in the Pecos River. The largest number of macroinvertebrate taxa were from the site second farthest downstream on the Devils River, and the smallest numbers of macroinvertebrate taxa were from the farthest downstream site on the Pecos River. Mayflies were more common in the Devils River, and caddisflies were less common than mayflies at most sites. Net-spinning caddisflies were more common at the Devils River sites. The combined percent of mayfly, caddisfly, and stonefly taxa was generally larger at the Pecos River sites. Riffle beetles were the most commonly collected beetle taxon among all sites, and water-penny beetles were only collected at the Pecos River sites. A greater number of true midge taxa were collected more than any other taxa at the genus and species taxonomic level. Non-insect macroinvertebrate taxa were more common at the Devils River sites. Corbicula sp. (presumably the introduced Asian clam) was found at sites in both rivers, and amphipods were more abundant in the Devils River. The Margalef species richness index, based on aquatic insect taxa only, was larger at the Devils River sites than at the Pecos River sites. The Hilsenhoff's biotic index was largest at the site farthest downstream in the Devils River and smallest at the site second farthest downstream in the Pecos River. Overall similarity among sites based on the number of shared macroinvertebrate taxa indicated that each site is more similar to other sites on the same river than to sites on the other river.

Effects of grade control structures on the macroinvertebrate assemblage of an agriculturally impacted stream

USGS Publications Warehouse

Litvan, M.E.; Stewart, T.W.; Pierce, C.L.; Larson, C.J.

2008-01-01

Nearly 400 rock rip-rap grade control structures (hereafter GCS) were recently placed in streams of western Iowa, USA to reduce streambank erosion and protect bridge infrastructure and farmland. In this region, streams are characterized by channelized reaches, highly incised banks and silt and sand substrates that normally support low macroinvertebrate abundance and diversity. Therefore, GCS composed of rip-rap provide the majority of coarse substrate habitat for benthic macroinvertebrates in these streams. We sampled 20 sites on Walnut Creek, Montgomery County, Iowa to quantify macroinvertebrate assemblage characteristics (1) on GCS rip-rap and at sites located (2) 5-50 m upstream of GCS, (3) 5-50 m downstream of GCS and (4) at least 1 km from any GCS (five sites each). Macroinvertebrate biomass, numerical densities and diversity were greatest at sites with coarse substrates, including GCS sites and one natural riffle site and relatively low at remaining sites with soft substrates. Densities of macroinvertebrates in the orders Ephemeroptera, Trichoptera, Diptera, Coleoptera and Acariformes were abundant on GCS rip-rap. Increases in macroinvertebrate biomass, density and diversity at GCS may improve local efficiency of breakdown of organic matter and nutrient and energy flow, and provide enhanced food resources for aquatic vertebrates. However, lack of positive macroinvertebrate responses immediately upstream and downstream of GCS suggest that positive effects might be restricted to the small areas of streambed covered by GCS. Improved understanding of GCS effects at both local and ecosystem scales is essential for stream management when these structures are present. Copyright ?? 2007 John Wiley & Sons, Ltd.

Fish assemblages in a western Iowa stream modified by grade control structures

USGS Publications Warehouse

Litvan, M.E.; Pierce, C.L.; Stewart, T.W.; Larson, C.J.

2008-01-01

Over 400 riprap grade control structures (GCSs) have been built in streams of western Iowa to reduce erosion and protect bridges, roads, and farmland. In conjunction with a companion study evaluating fish passage over GCSs in Turkey Creek, we evaluated the differences in fish assemblage and habitat characteristics in reaches immediately downstream from GCSs (GCS sites) and reaches at least 1 km from any GCS (non-GCS sites). The GCS sites were characterized by greater proportions of pool habitat, maximum depths, fish biomass, and abundance of juvenile largemouth bass Micropterus salmoides than were non-GCS sites. Index of biotic integrity (IBI) scores were poor or fair (<43 on a 0-100 scale) and not significantly different between the GCS and non-GCS sites. Additionally, we investigated both the longitudinal changes in fish assemblages in this GCS-fragmented stream and the changes in fish assemblages after slope modifications of three GCSs to facilitate fish passage. Thirteen fish species were present throughout the study area, whereas another 15 species exhibited truncated distributions not extending to the most upstream sampling location. After modification of the GCSs, IBI scores increased at seven of nine sites (mean increase =4.6 points). Also, channel catfish Ictalurus punctatus were detected 7.3 km upstream at sites where, 2 years before GCS modification, they had been absent from collections. Given the number and distribution of GCSs in western Iowa streams, understanding the effects of these structures is vital to the conservation and management of fish assemblages in this and other regions where GCSs or similar structures are used. ?? Copyright by the American Fisheries Society 2008.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Thermal effects of dams in the Willamette River basin, Oregon

USGS Publications Warehouse

Rounds, Stewart A.

2010-01-01

Methods were developed to assess the effects of dams on streamflow and water temperature in the Willamette River and its major tributaries. These methods were used to estimate the flows and temperatures that would occur at 14 dam sites in the absence of upstream dams, and river models were applied to simulate downstream flows and temperatures under a no-dams scenario. The dams selected for this study include 13 dams built and operated by the U.S. Army Corps of Engineers (USACE) as part of the Willamette Project, and 1 dam on the Clackamas River owned and operated by Portland General Electric (PGE). Streamflows in the absence of upstream dams for 2001-02 were estimated for USACE sites on the basis of measured releases, changes in reservoir storage, a correction for evaporative losses, and an accounting of flow effects from upstream dams. For the PGE dam, no-project streamflows were derived from a previous modeling effort that was part of a dam-relicensing process. Without-dam streamflows were characterized by higher peak flows in winter and spring and much lower flows in late summer, as compared to with-dam measured flows. Without-dam water temperatures were estimated from measured temperatures upstream of the reservoirs (the USACE sites) or derived from no-project model results (the PGE site). When using upstream data to estimate without-dam temperatures at dam sites, a typical downstream warming rate based on historical data and downstream river models was applied over the distance from the measurement point to the dam site, but only for conditions when the temperature data indicated that warming might be expected. Regressions with measured temperatures from nearby or similar sites were used to extend the without-dam temperature estimates to the entire 2001-02 time period. Without-dam temperature estimates were characterized by a more natural seasonal pattern, with a maximum in July or August, in contrast to the measured patterns at many of the tall dam sites where the annual maximum temperature typically occurred in September or October. Without-dam temperatures also tended to have more daily variation than with-dam temperatures. Examination of the without-dam temperature estimates indicated that dam sites could be grouped according to the amount of streamflow derived from high-elevation, spring-fed, and snowmelt-driven areas high in the Cascade Mountains (Cougar, Big Cliff/Detroit, River Mill, and Hills Creek Dams: Group A), as opposed to flow primarily derived from lower-elevation rainfall-driven drainages (Group B). Annual maximum temperatures for Group A ranged from 15 to 20 degree(s)C, expressed as the 7-day average of the daily maximum (7dADM), whereas annual maximum 7dADM temperatures for Group B ranged from 21 to 25 degrees C. Because summertime stream temperature is at least somewhat dependent on the upstream water source, it was important when estimating without-dam temperatures to use correlations to sites with similar upstream characteristics. For that reason, it also is important to maintain long-term, year-round temperature measurement stations at representative sites in each of the Willamette River basin's physiographic regions. Streamflow and temperature estimates downstream of the major dam sites and throughout the Willamette River were generated using existing CE-QUAL-W2 flow and temperature models. These models, originally developed for the Willamette River water-temperature Total Maximum Daily Load process, required only a few modifications to allow them to run under the greatly reduced without-dam flow conditions. Model scenarios both with and without upstream dams were run. Results showed that Willamette River streamflow without upstream dams was reduced to levels much closer to historical pre-dam conditions, with annual minimum streamflows approximately one-half or less of dam-augmented levels. Thermal effects of the dams varied according to the time of year, from cooling in mid-summer to warm

Water-quality conditions and streamflow gain and loss of the South Prong of Spavinaw Creek basin, Benton County, Arkansas

USGS Publications Warehouse

Joseph, Robert L.; Green, W. Reed

1994-01-01

A study of the South Prong of Spavinaw Creek Basin conducted baween July 14 and July 23. 1993. described the surface- and ground-water quality of the basin and the streamflow gain and loss. Water samples were collected from 10 sites on the mainstem of the South Prong of Spavinaw Creek and from 4 sites on tributaries during periods of low to moderate streamflow (less than 11 cubic feet per second). Water samples were collected from 4 wells and 10 springs located in the basin. In 14 surface-water samples, nitrite plus nitrate concentrations ranged from 0.75 to 4.2 milligrams per liter as nitrogen (mg/L). Orthophosphorus concentrations ranged from 0 03 to O. 15 mg/L as phosphorus. Fecal coliform bacteria counts ranged from 61 to 1,400 colonies per 100 milliliters (col/lOO mL), with a median of 120 col/100 mL. Fecal streptococci bacteria counts ranged from 70 to greater than 2,000 col/100 mL with a median of 185 col/lOO mL. Analysis for selected metals collected at one surface-water sites indicates that concentrations were usually below the reporting limit. Diel dissolved oxygen concentrations and temperatures were measured at an upstream and downstream site on the mainstem of the stream. At the upstream site, dissolved oxygen concentrations ranged from 7.2 to 83 mg/L and temperatures ranged from 15.5 to 17.0 C. Dissolved oxygen concentrations were higher and temperature values were lower at lhe upstream site, which is located close to two springs that produce all of the flow at that site. Dissolved nitrite plus nitrate was present in all four wells sampled in the basin with concentrations ranging from 0.04 to 3.5 mg/L as nitrogen. Orthophosphorus was present in concentrations ranging from less than 0.01 to 0.07 mg/L as phosphorus. Volatile organic compound analyses in two wells indicate that toluene was present in both wells and chloroform was present in one well. All other volatile organic compounds were found to be below the reporting limits. Analysis for common constituents and selected metals indicated that fluoride concentrations in one well exceeded the U.S. Environmental Protection Agency's primary maximum contamination levels for drinking water. Analyses of water samples collected from springs indicate that nitrite plus nitrate concen- trations ranged from 0.43 to 3.9 mg/L as nitrogen. Dissolved ammonia plus organic nitrogen concentrations ranged from less than 0.20 to 0.64 mg/L as nitrogen. Dissolved ammonia plus organic nitrogen concentrations ranged from less than 0.20 to 0.64 mg/L at nitrogen. Orthophosphorus concentrations ranged from 0.02 to 0.09 mg/L as phosphorus. Fecal coliform bacteria counts ranged from less than 3 to more than 2,000 col/100 mL, with a median of 370 col/100 mL. Fecal streptococci bacteria counts ranged from less than 4 to greater than 2,000 col/100 mL with a median of 435 col/100 mL. Streamflow in nine reaches of the mainstream increased an average of 20 percent. Six losing reaches were identified during the study, one located on the mainstem and the other five located on tributaries to the mainstem.

Immediate changes in stream channel geomorphology, aquatic habitat, and fish assemblages following dam removal in a small upland catchment

NASA Astrophysics Data System (ADS)

Magilligan, F. J.; Nislow, K. H.; Kynard, B. E.; Hackman, A. M.

2016-01-01

Dam removal is becoming an increasingly important component of river restoration, with > 1100 dams having been removed nationwide over the past three decades. Despite this recent progression of removals, the lack of pre- to post-removal monitoring and assessment limits our understanding of the magnitude, rate, and sequence of geomorphic and/or ecological recovery to dam removal. Taking advantage of the November 2012 removal of an old ( 190 year-old) 6-m high, run-of-river industrial dam on Amethyst Brook (26 km2) in central Massachusetts, we identify the immediate eco-geomorphic responses to removal. To capture the geomorphic responses to dam removal, we collected baseline data at multiple scales, both upstream ( 300 m) and downstream (> 750 m) of the dam, including monumented cross sections, detailed channel-bed longitudinal profiles, embeddedness surveys, and channel-bed grain size measurements, which were repeated during the summer of 2013. These geomorphic assessments were combined with detailed quantitative electrofishing surveys of stream fish richness and abundance above and below the dam site and throughout the watershed and visual surveys of native anadromous sea lamprey (Petromyzon marinus) nest sites. Post-removal assessments were complicated by two events: (1) upstream knickpoint migration exhumed an older (ca. late eighteenth century) intact wooden crib dam 120 m upstream of the former stone dam, and (2) the occurrence of a 10-20 year RI flood 6 months after removal that caused further upstream incision and downstream aggradation. Now that the downstream reach has been reconnected to upstream sediment supply, the predominant geomorphic response was bed aggradation and associated fining (30-60% reduction). At dam proximal locations, aggradation ranged from 0.3 to > 1 m where a large woody debris jam enhanced aggradation. Although less pronounced, distal locations still showed aggradation with a mean depth of deposition of 0.20 m over the 750-m downstream reach. Post-removal, but pre-flood, bed surveys indicate 2 m of incision had migrated 25 m upstream of the former reservoir before encountering the exhumed dam, which now acts as the new grade control, limiting progressive headcutting. Approximately 1000 m3 of sediment was evacuated in the first year, with 67% of the volume occurring by pre-flood, process-driven (e.g., changes in base level) controls. The combination of changes in channel-bed sedimentology, the occurrence of a large magnitude flood, and the emergence of the new crib dam that is a likely barrier to fish movement was associated with major reductions in abundance and richness in sites downstream and immediately upstream adjacent to the former dam in post-removal sampling. At the same time, we documented the presence of four species of fish, including sea lamprey, which were not present above the dam prior to removal, indicating that upstream passage has been achieved; and we also documented lamprey spawning activity at sites immediately below the dam, which had previously been unsuitable owing to an excessively coarse and armored riverbed. Our results point to the importance of interactions between dam removal and flood disturbance effects, with important implications for short- and long-term monitoring and assessment of dam impacts to river systems.

Using spatial, seasonal, and diel drift patterns of larval Lost River suckers Deltistes luxatus (Cypriniformes: Catostomidae) and shortnose suckers Chasmistes brevirostris (Cypriniformes: Catostomidae) to help identify a site for a water withdrawal structure on the Williamson River, Oregon

USGS Publications Warehouse

Ellsworth, Craig M.; Tyler, Torrey J.; VanderKooi, Scott P.

2010-01-01

A small irrigation diversion dam near Chiloquin, Oregon, was removed and replaced with a pump station to improve fish passage for Lost River suckers (Deltistes luxatus) and shortnose suckers (Chasmistes brevirostris) entering the Sprague River on their spawning migrations. During the developmental phase of the pump station, a need was identified to better understand the larval drift characteristics of these endangered catostomids in order to reduce entrainment into the irrigation system. The spatial, seasonal, and diel distribution of drifting larvae was measured during the 2004 spawning season at two proposed sites on the Williamson River where the pump station could be located. Larval drift for both species coincided with the irrigation season making them subject to entrainment into the irrigation system. Drift occurred almost exclusively at night with larvae entering the drift at sunset and exiting the drift at sunrise. Nighttime larval densities were concentrated near the surface and at midchannel at both sites. Densities were generally greater on the side of mid-channel with greater flow. During early morning sampling we detected a general shift in larval drift from surface to subsurface drift. We also observed an increase in larval densities towards the shore opposite from the proposed pump station at the upper site whereas larval densities remained high at midchannel at the lower site. During daytime sampling, the few larvae that were collected were distributed throughout the water column at both pump sites. This study found that larvae drifting during all time periods were generally distributed further across the cross section, deeper in the water column, and closer to where the proposed water withdrawal structure would be built at the downstream site when compared to the upstream site. Recommendations were provided to locate the withdrawal facility at the upstream site and operate it in a manner such that larval entrainment would likely be minimized.

Evaluation of wastewater contaminant transport in surface waters using verified Lagrangian sampling

USGS Publications Warehouse

Antweiler, Ronald C.; Writer, Jeffrey H.; Murphy, Sheila F.

2014-01-01

Contaminants released from wastewater treatment plants can persist in surface waters for substantial distances. Much research has gone into evaluating the fate and transport of these contaminants, but this work has often assumed constant flow from wastewater treatment plants. However, effluent discharge commonly varies widely over a 24-hour period, and this variation controls contaminant loading and can profoundly influence interpretations of environmental data. We show that methodologies relying on the normalization of downstream data to conservative elements can give spurious results, and should not be used unless it can be verified that the same parcel of water was sampled. Lagrangian sampling, which in theory samples the same water parcel as it moves downstream (the Lagrangian parcel), links hydrologic and chemical transformation processes so that the in-stream fate of wastewater contaminants can be quantitatively evaluated. However, precise Lagrangian sampling is difficult, and small deviations – such as missing the Lagrangian parcel by less than 1 h – can cause large differences in measured concentrations of all dissolved compounds at downstream sites, leading to erroneous conclusions regarding in-stream processes controlling the fate and transport of wastewater contaminants. Therefore, we have developed a method termed “verified Lagrangian” sampling, which can be used to determine if the Lagrangian parcel was actually sampled, and if it was not, a means for correcting the data to reflect the concentrations which would have been obtained had the Lagrangian parcel been sampled. To apply the method, it is necessary to have concentration data for a number of conservative constituents from the upstream, effluent, and downstream sites, along with upstream and effluent concentrations that are constant over the short-term (typically 2–4 h). These corrections can subsequently be applied to all data, including non-conservative constituents. Finally, we show how data from other studies can be corrected.

Evaluation of wastewater contaminant transport in surface waters using verified Lagrangian sampling.

PubMed

Antweiler, Ronald C; Writer, Jeffrey H; Murphy, Sheila F

2014-02-01

Contaminants released from wastewater treatment plants can persist in surface waters for substantial distances. Much research has gone into evaluating the fate and transport of these contaminants, but this work has often assumed constant flow from wastewater treatment plants. However, effluent discharge commonly varies widely over a 24-hour period, and this variation controls contaminant loading and can profoundly influence interpretations of environmental data. We show that methodologies relying on the normalization of downstream data to conservative elements can give spurious results, and should not be used unless it can be verified that the same parcel of water was sampled. Lagrangian sampling, which in theory samples the same water parcel as it moves downstream (the Lagrangian parcel), links hydrologic and chemical transformation processes so that the in-stream fate of wastewater contaminants can be quantitatively evaluated. However, precise Lagrangian sampling is difficult, and small deviations - such as missing the Lagrangian parcel by less than 1h - can cause large differences in measured concentrations of all dissolved compounds at downstream sites, leading to erroneous conclusions regarding in-stream processes controlling the fate and transport of wastewater contaminants. Therefore, we have developed a method termed "verified Lagrangian" sampling, which can be used to determine if the Lagrangian parcel was actually sampled, and if it was not, a means for correcting the data to reflect the concentrations which would have been obtained had the Lagrangian parcel been sampled. To apply the method, it is necessary to have concentration data for a number of conservative constituents from the upstream, effluent, and downstream sites, along with upstream and effluent concentrations that are constant over the short-term (typically 2-4h). These corrections can subsequently be applied to all data, including non-conservative constituents. Finally, we show how data from other studies can be corrected. © 2013.

Spawning chronology, nest site selection and nest success of smallmouth bass during benign streamflow conditions

USGS Publications Warehouse

Dauwalter, D.C.; Fisher, W.L.

2007-01-01

We documented the nesting chronology, nest site selection and nest success of smallmouth bass Micropterus dolomieu in an upstream (4th order) and downstream (5th order) reach of Baron Fork Creek, Oklahoma. Males started nesting in mid-Apr. when water temperatures increased to 16.9 C upstream, and in late-Apr. when temperatures increased to 16.2 C downstream. Streamflows were low (77% upstream to 82% downstream of mean Apr. streamflow, and 12 and 18% of meanjun. streamflow; 47 and 55 y of record), and decreased throughout the spawning period. Larger males nested first upstream, as has been observed in other populations, but not downstream. Upstream, progeny in 62 of 153 nests developed to swim-up stage. Downstream, progeny in 31 of 73 nests developed to swim-up. Nesting densities upstream (147/km) and downstream (100/km) were both higher than any densities previously reported. Males selected nest sites with intermediate water depths, low water velocity and near cover, behavior that is typical of smallmouth bass. Documented nest failures resulted from human disturbance, angling, and longear sunfish predation. Logistic exposure models showed that water velocity at the nest was negatively related and length of the guarding male was positively related to nest success upstream. Male length and number of degree days were both positively related to nest success downstream. Our results, and those of other studies, suggest that biological factors account for most nest failures during benign (stable, low flow) streamflow conditions, whereas nest failures attributed to substrate mobility or nest abandonment dominate when harsh streamflow conditions (spring floods) coincide with the spawning season.

Examining spatial patterns in polycyclic aromatic compounds measured in stream macroinvertebrates near a small subarctic oil and gas operation.

PubMed

Korosi, J B; Eickmeyer, D C; Chin, K S; Palmer, M J; Kimpe, L E; Blais, J M

2016-03-01

The Cameron River runs through a small, remote petrochemical development in the Cameron Hills (Northwest Territories, Canada). In order to evaluate the exposure of aquatic biota to contaminants from oil and gas activities, we measured polycyclic aromatic compounds (PACs) in macroinvertebrates collected from sites and tributaries along the Cameron River, including upstream and downstream of the development, and sites located near drilled wells (developed). Macroinvertebrate tissue PAC burdens ranged from 0.2-2.8 μg g(-1) lipid for unsubstituted compounds, and from 4.2-63.2 μg g(-1) lipid for alkylated compounds, relatively low compared to similar studies from more industrialized regions in North America. There was no significant difference in tissue PAC burdens between upstream, downstream, or developed sites (p = 0.12), although alkyl PACs in five out of seven developed sites were higher than the regional average. Petrogenic PACs were dominant in most samples, including alkyl fluorines, alkyl phenanthrene/anthracenes, and alkyl dibenzothiophenes. Minimal changes in PAC composition in macroinvertebrate tissues were detected along the Cameron River, with the exception of the two sites furthest downstream that had high concentrations of C3-C4 naphthalene. Overall, our results suggest that oil and gas development in the Cameron Hills has not resulted in substantial increases in PAC bioaccumulation in stream macroinvertebrates, although the potential that alkyl naphthalenes are being transported downstream from the development warrants further attention.

Trend analyses of sediment data for the DEC project

USGS Publications Warehouse

Rebich, Richard Allen

1995-01-01

Daily stream discharge, suspended-sediment concentration, and suspended-sediment discharge data were collected at eight sites in six watersheds of the Demonstration Erosion Control project in the Yazoo River Basin in north-central Mississippi during the period July 1985 through September 1991. The project is part of an ongoing interagency program of planning, design, construction, monitoring, and evaluation to alleviate flooding, erosion, sedimentation, and water-quality problems for watersheds located in the bluff hills upstream of the Mississippi River alluvial plain. This paper presents preliminary results of trend analyses for stream discharge and sediment data for the eight project sites. More than 550 stream discharge measurements and 20,000 suspended-sediment samples have been collected at the eight sites since 1985.

Water Quality and Biological Characteristics of the Middle Fork of the Saline River, Arkansas, 2003-06

USGS Publications Warehouse

Galloway, Joel M.; Petersen, James C.; Shelby, Erica L.; Wise, Jim A.

2008-01-01

The Middle Fork of the Saline River has many qualities that have been recognized by State and Federal agencies. The Middle Fork provides habitat for several rare aquatic species and is part of a larger stream system (the Upper Saline River) that is known for relatively high levels of species richness and relatively high numbers of species of concern. Water-quality samples were collected and streamflow was measured by the U.S. Geological Survey at three sites in the Middle Fork Basin between October 2003 and October 2006. The Arkansas Department of Environmental Quality collected discrete synoptic water-quality samples from eight sites between January 2004 and October 2006. The Arkansas Department of Environmental Quality also sampled fish (September-October 2003) and benthic macroinvertebrate communities (September 2003-December 2005) at five sites. Streamflow varied annually among the three streamflow sites from October 2003 to October 2006. The mean annual streamflow for Brushy Creek near Jessieville (MFS06) was 0.72 cubic meters per second for water years 2004-2006. The Middle Fork below Jessieville (MFS05) had a mean annual streamflow of 1.11 cubic meters per second for water years 2004-2006. The Middle Fork near Owensville (MFS02), the most downstream site, had a mean annual streamflow of 3.01 cubic meters per second. The greatest streamflows at the three sites generally occurred in the winter and spring and the least in the summer. Nutrient dynamics in the Middle Fork are controlled by activities in the basin and processes that occur in the stream. Point sources and nonpoint sources of nutrients occur in the Middle Fork Basin that could affect the water-quality. Nitrogen and phosphorus concentrations generally were greatest in Mill Creek (MFS04E) and in the Middle Fork immediately downstream from the confluence with Mill Creek (MFS04) with decreasing concentrations at sites farther downstream in Middle Fork. The site in Mill Creek is located downstream from a wastewater-treatment plant discharge and concentrations at sites farther downstream probably had lesser concentrations because of dilution effects and from algal uptake. Nutrient concentrations generally were significantly greater during high-flow conditions compared to base-flow conditions. Flow-weighted nutrient concentrations were computed for the three streamflow sites and were compared to 82 relatively undeveloped sites identified across the Nation, to the Alum Fork of the Saline River near Reform, Arkansas, and to the Illinois River south of Siloam Springs, Arkansas, a site influenced by numerous point and nonpoint sources of nutrients. Annual flow-weighted nutrient concentrations for MFS06, MFS05, and MFS02 were greater than relatively undeveloped sites, but were substantially less than the Illinois River south of Siloam Springs. Fecal indicator bacteria concentrations were slightly greater at MFS06 and MFS05 compared to concentrations at MFS02 for October 2003 to October 2006. MFS05 had the greatest E.coli concentrations and MFS06 had the greatest fecal coliform concentrations. Overall, fecal indicator bacteria concentrations were significantly greater for samples collected during high-flow conditions compared to samples collected during low-flow conditions at all three sites. Suspended-sediment concentrations did not vary significantly among MFS06, MFS05, and MFS02 for all the samples collected from October 2003 to October 2006. Suspended-sediment concentrations were significantly greater in samples collected during high-flow conditions compared to samples collected during base-flow conditions. Synoptic samples indicated varied total suspended-solids distributions from upstream to downstream in the Middle Fork between January 2004 and October 2006. Overall, total suspended-solids values were the greatest at site MFS02 and decreased at sites upstream and downstream. Turbidity measured when water-quality samples were

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

Effects of water-control structures on hydrologic and water-quality characteristics in selected agricultural drainage canals in eastern North Carolina

USGS Publications Warehouse

Treece, M.W.; Jaynes, M.L.

1994-01-01

November of water into and out of tidally affected canals in eastern North Carolina was documented before and after the installation of water-control structures. Water levels in five of the canals downstream from the water-control structures were controlled primarily by water-level fluctuations in estuarine receiving waters. Water-control structures also altered upstream water levels in all canals. Water levels were lowered upstream from tide gates, but increased upstream from flashboard risers. Both types of water-control structures attenuated the release of runoff following rainfall events, but in slightly different ways. Tide gates appeared to reduce peak discharge rates associated with rainfall, and flashboard risers lengthened the duration of runoff release. Tide gates had no apparent effect on pH, dissolved oxygen, suspended-sediment, or total phosphorus concentrations downstream from the structures. Specific conductance measured from composite samples collected with automatic samples increased downstream of tide gates after installation. Median concentrations of nitrite plus nitrate nitrogen were near the minimum detection level throughout the study; however, the number of observations of concentrations exceeding 0.1 milligram per liter dropped significantly after tide gates were installed. Following tide-gate installation, instantaneous loadings of nitrite plus nitrate nitrogen were significantly reduced at one test site, but this reduction was not observed at the other test site. Loadings of other nutrient species and suspended sediment did not change at the tide-gate test sites after tide-gate installation. Specific conductance was lower in the Beaufort County canals than in the Hyde County canals. Although there was a slight increase in median values at the flashboard-riser sites, the mean and maximum values declined substantially downstream from the risers following installation. This decline of specific conductance in the canals occurred despite a large increase of specific conductance in the tidal creek. Flashboard risers had no significant effect on concentrations of dissolved oxygen, suspended sediment, total ammonia plus organic nitrogen, or phosphorus. Maximum concentrations of ammonia nitrogen were smaller at both test sites after riser installation. In addition, concentrations of nitrite plus nitrate nitrogen exceeding 1.0 milligram per liter rarely occurred at the flashboard-riser test sites following installation of the risers. Median loadings of nitrite plus nitrate nitrogen and total nitrogen decreased at one riser test site following flashboard-riser installation. Tide gates and flashboard risers were associated with reductions in concentrations and export of nitrite plus nitrate nitrogen; however, these changes should be interpreted cautiously because reductions were not observed consistently at every site. The hydrology and baseline water-quality characteristics of the two study areas differ, making comparisons of the effectiveness of the two types of water-control structures difficult to interpret. The effects of water-control structures on the hydrology of the drainage canals are more meaningful than the changes in water quality. Tide gates and flashboard risers altered the hydrologic characteristics of the drainage canals and created an environment favorable for nutrient loss or transformation. Both structures retained agricultural drainage upstream, which increased potential storage for infiltration and reduced the potential for surface runoff, sediment, and nutrient transport, and higher peak outflow rates.

Barriers impede upstream spawning migration of flathead chub

USGS Publications Warehouse

Walters, David M.; Zuellig, Robert E.; Crockett, Harry J.; Bruce, James F.; Lukacs, Paul M.; Fitzpatrick, Ryan M.

2014-01-01

Many native cyprinids are declining throughout the North American Great Plains. Some of these species require long reaches of contiguous, flowing riverine habitat for drifting eggs or larvae to develop, and their declining populations have been attributed to habitat fragmentation or barriers (e.g., dams, dewatered channels, and reservoirs) that restrict fish movement. Upstream dispersal is also needed to maintain populations of species with passively drifting eggs or larvae, and prior researchers have suggested that these fishes migrate upstream to spawn. To test this hypothesis, we conducted a mark–recapture study of Flathead Chub Platygobio gracilis within a 91-km reach of continuous riverine habitat in Fountain Creek, Colorado. We measured CPUE, spawning readiness (percent of Flathead Chub expressing milt), and fish movement relative to a channel-spanning dam. Multiple lines of evidence indicate that Flathead Chub migrate upstream to spawn during summer. The CPUE was much higher at the base of the dam than at downstream sites; the seasonal increases in CPUE at the dam closely tracked seasonal increases in spawning readiness, and marked fish moved upstream as far as 33 km during the spawning run. The upstream migration was effectively blocked by the dam. The CPUE of Flathead Chub was much lower upstream of the OHDD than at downstream sites, and <0.2% of fish marked at the dam were recaptured upstream. This study provides the first direct evidence of spawning migration for Flathead Chub and supports the general hypothesis that barriers limit adult dispersal of these and other plains fishes.

Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

PubMed

Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

2009-01-01

Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

Long term trends of fish after liming of Swedish streams and lakes

NASA Astrophysics Data System (ADS)

Holmgren, Kerstin; Degerman, Erik; Petersson, Erik; Bergquist, Björn

2016-12-01

Thousands of Swedish acidified lakes and streams have been regularly limed for about 30 years. Standard sampling of fish assemblages in lakes and streams was an important part of monitoring the trends after liming, i.e. sampling with multi-mesh gillnets in lakes (EN 14757) and electrofishing in streams (EN 14011). Monitoring data are nationally managed, in the National Register of Survey test-fishing and the Swedish Electrofishing Register. We evaluated long-term data from 1029 electrofishing sites in limed streams and gillnet sampling in 750 limed lakes, along with reference data from 195 stream sites and 101 lakes with no upstream liming in their catchments. The median year of first liming was 1986 for both streams and lakes. The proportion of limed stream sites with no fish clearly decreased with time, mean species richness and proportion of sites with brown trout (Salmo trutta) recruits increased. There were no consistent trends in fish occurrence or species richness at non-limed sites, but occurrence of brown trout recruits also increased in acid as well as neutral reference streams. Abundance of brown trout, perch (Perca fluviatilis) and roach (Rutilus rutilus) increased significantly more at limed sites than at non-limed reference sites sampled before and after 1986. The mean species richness did not change consistently in limed lakes, but decreased in low alkalinity reference lakes, and fish abundance decreased significantly in limed as well as in non-limed lakes.

Monitoring to assess progress toward meeting the total maximum daily load for phosphorus in the Assabet River, Massachusetts: phosphorus loads, 2008 through 2010

USGS Publications Warehouse

Zimmerman, Marc J.; Savoie, Jennifer G.

2013-01-01

Wastewater discharges to the Assabet River contribute substantial amounts of phosphorus, which support accumulations of nuisance aquatic plants that are most evident in the river’s impounded reaches during the growing season. To restore the Assabet River’s water quality and aesthetics, the U.S. Environmental Protection Agency required the major wastewater-treatment plants in the drainage basin to reduce the amount of phosphorus discharged to the river by 2012. From October 2008 to December 2010, the U.S. Geological Survey, in cooperation with the Massachusetts Department of Environmental Protection and in support of the requirements of the Total Maximum Daily Load for Phosphorus, collected weekly flow-proportional, composite samples for analysis of concentrations of total phosphorus and orthophosphorus upstream and downstream from each of the Assabet River’s two largest impoundments: Hudson and Ben Smith. The purpose of this monitoring effort was to evaluate conditions in the river before enhanced treatment-plant technologies had effected reductions in phosphorus loads, thereby defining baseline conditions for comparison with conditions following the mandated load reductions. The locations of sampling sites with respect to the impoundments enabled examination of the impoundments’ effects on phosphorus sequestration and on the transformation of phosphorus between particulate and dissolved forms. The study evaluated the differences between loads upstream and downstream from the impoundments throughout the sampling period and compared differences during two seasonal periods of relevance to aquatic plants: April 1 through October 31, the growing season, and November 1 through March 31, the nongrowing season, when existing permit limits allowed average monthly wastewater-treatment-plant-effluent concentrations of 0.75 milligram per liter (growing season) or 1.0 milligram per liter (nongrowing season) for total phosphorus. At the four sampling sites during the growing season, median weekly total phosphorus loads ranged from 110 to 190 kilograms (kg) and median weekly orthophosphorus loads ranged from 17 to 41 kg. During the nongrowing season, median weekly total phosphorus loads ranged from 240 to 280 kg and median weekly orthophosphorus loads ranged from 56 to 66 kg. During periods of low and moderate streamflow, estimated loads of total phosphorus upstream from the Hudson impoundment generally exceeded those downstream during the same sampling periods throughout the study; orthophosphorus loads downstream from the impoundment were typically larger than those upstream. When storm runoff substantially increased the streamflow, loads of total phosphorus and orthophosphorus both tended to be larger downstream than upstream. At the Ben Smith impoundment, both total phosphorus and orthophosphorus loads were generally larger downstream than upstream during low and moderate streamflow, but the differences were not as pronounced as they were at the Hudson impoundment. High flows were also associated with substantially larger total phosphorus and orthophosphorus loads downstream than those entering the impoundment from upstream. In comparing periods of growing- and nongrowing-season loads, the same patterns of loads entering and leaving were observed at both impoundments. That is, at the Hudson impoundment, total phosphorus loads entering the impoundment were greater than those leaving it, and orthophosphorus loads leaving the impoundment were greater than those entering it. At the Ben Smith impoundment, both total phosphorus and orthophosphorus loads leaving the impoundment were greater than those entering it. However, the loads were greater during the nongrowing seasons than during the growing seasons, and the net differences between upstream and downstream loads were about the same. The results indicate that some of the particulate fraction of the total phosphorus loads is sequestered in the Hudson impoundment, where particulate phosphorus probably undergoes some physical and biogeochemical transformations to the dissolved form orthophosphorus. The orthophosphorus may be taken up by aquatic plants or transported out of the impoundments. The results for the Ben Smith impoundment are less clear and suggest net export of total phosphorus and orthophosphorus. Differences between results from the two impoundments may be attributable in part to differences in their sizes, morphology, unmonitored tributaries, riparian land use, and processes within the impoundments that have not been quantified for this study.

Comparison of vapor concentrations of volatile organic compounds with ground-water concentrations of selected contaminants in sediments beneath the Sudbury River, Ashland, Massachusetts, 2000

USGS Publications Warehouse

Campbell, J.P.; Lyford, F.P.; Willey, Richard E.

2002-01-01

A mixed plume of contaminants in ground water, including volatile organic compounds (VOCs), semi-volatile organic compounds (SVOCs), and metals, near the former Nyanza property in Ashland, Massachusetts, discharges to the Sudbury River upstream and downstream of Mill Pond and a former mill raceway. Polyethylene-membrane vapor-diffusion (PVD) samplers were installed in river-bottom sediments to determine if PVD samplers provide an alternative to ground-water sampling from well points for identifying areas of detectable concentrations of contaminants in sediment pore water near the ground-water and surface-water interface. In August and September 2000, the PVD samplers were installed near well points at depths of 8 to 12 inches in both fine and coarse sediments, whereas the well points were installed at depths of 1 to 5 feet in coarse sediments only. Comparison between vapor and water samples at 29 locations upstream from Mill Pond show that VOC vapor concentrations from PVD samplers in coarse river-bottom sediments are more likely to correspond to ground-water concentrations from well points than PVD samplers installed in fine sediments. Significant correlations based on Kendall's Tau were shown between vapor and ground-water concentrations for trichloroethylene and chlorobenzene for PVD samplers installed in coarse sediments where the fine organic layer that separated the two sampling depths was 1 foot or less in thickness. VOC concentrations from vapor samples also were compared to VOC, SVOC, and metals concentrations from ground-water samples at 10 well points installed upstream and downstream from Mill Pond, and in the former mill raceway. Chlorobenzene vapor concentrations correlated significantly with ground-water concentrations for 5 VOCs, 2 SVOCs, and 10 metals. Trichloroethylene vapor concentrations did not correlate with any of the other ground-water constituents analyzed at the 10 well points. Chlorobenzene detected by use of PVD samplers appears to be a strong indicator of the presence of VOCs, SVOCs, and metals in ground water sampled from well points at this site. Results from PVD samplers indicate that contaminant concentrations in water from well points installed 1 to 5 ft below fine sediments may not reflect concentrations in pore water less than 1 foot below the river bottom. There is insufficient information available to determine if VOC concentrations detected in PVD samplers are useful for identifying detectable aqueous concentrations of SVOCs and metals in sediment pore water at this site. Samples of pore water from a similar depth as PVD samplers are needed for confirmation of this objective.

In vitro micronuclei tests to evaluate the genotoxicity of surface water under the influence of tanneries.

PubMed

Lemos, A O; Oliveira, N C D; Lemos, C T

2011-06-01

Leather manufacturing has a high potential for environmental pollution due to hides and chemicals that are not completely absorbed during the tanning process. This study aims to investigate the mutagenic potential of surface water samples from Cadeia and Feitoria rivers (RS, Brazil) in areas influenced by tanneries and leather footwear industry. Micronucleus assays using V79 cells and human lymphocytes were used. Cells were exposed to surface water collected bimonthly from three sites for a year, totaling six samples. Significant MN induction in human lymphocytes was shown by 83% of samples from sites FEI001 and CAD001 located downstream from the industrial area, followed by FEI004 (33%), upstream. Only a single sample from site FEI004 showed a positive response for MN in V79 cells. Thirteen discordant and five concordant responses were found between the two in vitro tests. Mutagenic agents were found at the sites where chemical quality was worst, corroborating studies on chronic toxicity, oxidative stress and mutagenicity performed in this area. The assay using human lymphocytes was more sensitive than V79 cells to detect the contaminants from this area, showing that it is an excellent biomarker of environmental genotoxicity. Copyright © 2011 Elsevier Ltd. All rights reserved.

Toxicity risk assessment of mercury, DDT and arsenic legacy pollution in sediments: A triad approach under low concentration conditions.

PubMed

Marziali, L; Rosignoli, F; Drago, A; Pascariello, S; Valsecchi, L; Rossaro, B; Guzzella, L

2017-09-01

The determination of sediment toxicity is challenging due to site-specific factors affecting pollutants distribution and bioavailability, especially when contamination levels are close to expected non-effect concentrations. Different lines of evidence and sensitive tools are necessary for a proper toxicity risk assessment. We examined the case study of the Toce River (Northern Italy), where past industrial activities determined Hg, DDT and As enrichment in sediments. A triad approach comprising chemical, ecotoxicological and ecological analyses (benthic invertebrates) was carried out for risk assessment of residual contamination in river sediments. A "blank" site upstream from the industrial site was selected to compare the other sites downstream. Sediment, water and benthic invertebrate samplings were carried out following standard protocols. Results emphasized that despite the emissions of the industrial site ceased about 20years ago, sediments in the downstream section of the river remain contaminated by Hg, DDT and As with concentrations exceeding Threshold Effect Concentrations. A chronic whole-sediment test with Chironomus riparius showed decreased development rate and a lower number of eggs per mass in the contaminated sediments. Benthic community was analyzed with the calculation of integrated (STAR_ICMi) and stressor-specific metrics (SPEAR pesticide and mean sensitivity to Hg), but no significant differences were found between upstream and downstream sites. On the other hand, multivariate analysis (partial Redundancy Analysis and variation partitioning) emphasized a slight impact on invertebrate community, accounting for 5% variation in taxa composition. Results show that legacy contaminants in sediments, even at low concentrations, may be bioavailable and possibly toxic for benthic invertebrates. At low concentration levels, sensitive and site-specific tools need to be developed for a proper risk analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Sediment transport and water-quality characteristics and loads, White River, northwestern Colorado, water years 1975-88

USGS Publications Warehouse

Tobin, R.L.

1993-01-01

Streamflow, sediment, and water-quality data are summarized for 6 sites on the White River, Colorado for water years 1975-88. Correlation techniques were used to estimate annual data for unmeasured years. Annual stream discharge in the main stem of the White River ranged from about 200,000 to about 1 million acre-feet. Generally, bedload was less than/= 3.3 percent of total sediment load. Annual suspended-sediment loads ranged from about 2,100 tons at the upstream sites on the North Fork and South Fork of the White River to about 2 million tons at the most downstream site. Average annual suspended-sediment loads ranged from about 11,000 tons at the upstream sites to about 705,000 tons at the most downstream site. Annual capacity losses in a 50,000 acre-ft reservoir could range from less than 0.01 percent near upstream sites to about 2.5 percent near downstream sites. Maximum water temperatures in the White River ranged from less than 20 to 25 C in summer. Specific conductance ranged from 200 to 1,000 microsiemens/cm. Generally, values of pH ranged from 7.6 to 8.8, and concentrations of dissolved oxygen were greater than 6.0 mg/L. In small streamflows, values of pH and dissolved oxygen were affected by biologic processes. Composition of dissolved solids in the White River was mostly calcium, bicarbonate, and(or) sulfate. Changes in the composition of dissolved solids caused by the changes in the concentrations of sodium and sulfate were greatest in small stream discharges. Annual loads of dissolved solids ranged from 21,100 tons in the South Fork to about 480,000 tons at the most downstream site. Total solids transport in the White River was mostly as dissolved solids at upstream sites and mostly as suspended sediment at downstream sites. Concentration ranges of nutrients and trace constituents were determined.

Analyzing legacy U.S. Geological Survey geochemical databases using GIS: applications for a national mineral resource assessment

USGS Publications Warehouse

Yager, Douglas B.; Hofstra, Albert H.; Granitto, Matthew

2012-01-01

This report emphasizes geographic information system analysis and the display of data stored in the legacy U.S. Geological Survey National Geochemical Database for use in mineral resource investigations. Geochemical analyses of soils, stream sediments, and rocks that are archived in the National Geochemical Database provide an extensive data source for investigating geochemical anomalies. A study area in the Egan Range of east-central Nevada was used to develop a geographic information system analysis methodology for two different geochemical datasets involving detailed (Bureau of Land Management Wilderness) and reconnaissance-scale (National Uranium Resource Evaluation) investigations. ArcGIS was used to analyze and thematically map geochemical information at point locations. Watershed-boundary datasets served as a geographic reference to relate potentially anomalous sample sites with hydrologic unit codes at varying scales. The National Hydrography Dataset was analyzed with Hydrography Event Management and ArcGIS Utility Network Analyst tools to delineate potential sediment-sample provenance along a stream network. These tools can be used to track potential upstream-sediment-contributing areas to a sample site. This methodology identifies geochemically anomalous sample sites, watersheds, and streams that could help focus mineral resource investigations in the field.

Occurrence and sources of Escherichia coli in metropolitan St. Louis streams, October 2004 through September 2007

USGS Publications Warehouse

Wilkison, Donald H.; Davis, Jerri V.

2010-01-01

The occurrence and sources of Escherichia coli (E. coli), one of several fecal indicator bacteria, in metropolitan St. Louis streams known to receive nonpoint source runoff, occasional discharges from combined and sanitary sewers, and treated wastewater effluent were investigated from October 2004 through September 2007. Three Missouri River sites, five Mississippi River sites, and six small basin tributary stream sites were sampled during base flow and storm events for the presence of E. coli and their sources. E. coli host-source determinations were conducted using local library based genotypic methods. Human fecal contamination in stream samples was additionally confirmed by the presence of Bacteroides thetaiotaomicron, an anaerobic, enteric bacterium with a high occurrence in, and specificity to, humans. Missouri River E. coli densities and loads during base flow were approximately 10 times greater than those in the Mississippi River above its confluence with the Missouri River. Although substantial amounts of E. coli originated from within the study area during base flow and storm events, considerable amounts of E. coli in the Missouri River, as well as in the middle Mississippi River sections downstream from its confluence with the Missouri River, originated in Missouri River reaches upstream from the study area. In lower Mississippi River reaches, bacteria contributions from the numerous combined and sanitary sewer overflows within the study area, as well as contributions from nonpoint source runoff, greatly increased instream E. coli densities. Although other urban factors cannot be discounted, average E. coli densities in streams were strongly correlated with the number of upstream combined and sanitary sewer overflow points, and the percentage of upstream impervious cover. Small basin sites with the greatest number of combined and sanitary sewer overflows (Maline Creek and the River des Peres) had larger E. coli densities, larger loads, and a greater percentage of E. coli attributable to humans than other small basin sites; however, even though small basin E. coli densities typically were much larger than in large river receiving streams, small basins contributed, on average, only a small part (a maximum of 16 percent) of the total E. coli load to larger rivers. On average, approximately one-third of E. coli in metropolitan St. Louis streams was identified as originating from humans. Another one-third of the E. coli was determined to have originated from unidentified sources; dogs and geese contributed lesser amounts, 10 and 20 percent, of the total instream bacteria. Sources of E. coli were largely independent of hydrologic conditions-an indication that sources remained relatively consistent with time.

Water-Quality Assessment of the Yellowstone River Basin, Montana and Wyoming-Water Quality of Fixed Sites, 1999-2001

USGS Publications Warehouse

Miller, Kirk A.; Clark, Melanie L.; Wright, Peter R.

2005-01-01

The National Water-Quality Assessment Program of the U.S. Geological Survey initiated an assessment in 1997 of the quality of water resources in the Yellowstone River Basin. Water-quality samples regularly were collected during 1999-2001 at 10 fixed sites on streams representing the major environmental settings of the basin. Integrator sites, which are heterogeneous in land use and geology, were established on the mainstem of the Yellowstone River (4 sites) and on three major tributaries?Clarks Fork Yellowstone River (1 site), the Bighorn River (1 site), and the Powder River (1 site). Indicator sites, which are more homogeneous in land use and geology than the integrator sites, were located on minor tributaries with important environmental settings?Soda Butte Creek in a mineral resource area (1 site), the Tongue River in a forested area (1 site), and the Little Powder River in a rangeland area (1 site). Water-quality sampling frequency generally was at least monthly and included field measurements and laboratory analyses of fecal-indicator bacteria, major ions, dissolved solids, nutrients, trace elements, pesticides, and suspended sediment. Median concentrations of fecal coliform and Escherichia coli were largest for basins that were predominantly rangeland and smallest for basins that were predominantly forested. Concentrations of fecal coliform and Escherichia coli significantly varied by season (p-value <0.001); the smallest median concentrations were during January?March and the largest median concentrations were during April?June. Fecal-coliform concentrations exceeded the U.S. Environmental Protection Agency recommended limit for a single sample of 400 colonies per 100 milliliters in 2.6 percent of all samples. Escherichia coli concentrations exceeded the U.S. Environmental Protection Agency recommended limit for a single sample of 298 colonies per 100 milliliters for moderate use, full-body contact recreation in 7.6 percent of all samples. Variations in water type in the basin are reflective of the diverse geologic terrain in the Yellowstone River Basin. The water type of Soda Butte Creek and the Tongue River was calcium bicarbonate. These two sites are in forested and mountainous areas where igneous rocks and Paleozoic-era and Mesozoic-era sedimentary rocks are the dominant geologic groups. The water type of the Little Powder River was sodium sulfate. The Little Powder River originates in the plains, and geology of the basin is nearly homogenous with Tertiary-period sedimentary rocks. Water type of the Yellowstone River changed from a mixed-cation bicarbonate type upstream to a mixed-cation sulfate type downstream. Dissolved-solids concentrations ranged from fairly dilute in Soda Butte Creek, which had a median concentration of 118 milligrams per liter, to concentrated in the Little Powder River, which had a median concentration of 2,840 milligrams per liter. Nutrient concentrations generally were small and reflect the relatively undeveloped conditions in the basin; however, some correlations were made with anthropogenic factors. Median dissolved-nitrate concentrations in all samples from the fixed sites ranged from 0.04 milligram per liter to 0.54 milligram per liter. Flow-weighted mean dissolved-nitrate concentrations were positively correlated with increasing agricultural land use and rangeland on alluvial deposits upstream from the sites and negatively correlated with increasing forested land. Ammonia concentrations generally were largest in samples collected from the Yellowstone River at Corwin Springs, Montana, which is downstream from Yellowstone National Park and receives discharge from geothermal waters that are high in ammonia. Median total-phosphorus concentrations ranged from 0.007 to 0.18 milligram per liter. Median total-phosphorus concentrations exceeded the U.S. Environmental Protection Agency's recommended goal of 0.10 milligram per liter for preventing nuisance plant growth for samples collec

Contemporary Land Change Alters Fish Communities in a San Francisco Bay Watershed, California, U.S.A.

PubMed Central

Cervantes-Yoshida, Kristina; Leidy, Robert A.; Carlson, Stephanie M.

2015-01-01

Urbanization is one of the leading threats to freshwater biodiversity, and urban regions continue to expand globally. Here we examined the relationship between recent urbanization and shifts in stream fish communities. We sampled fishes at 32 sites in the Alameda Creek Watershed, near San Francisco, California, in 1993–1994 and again in 2009, and we quantified univariate and multivariate changes in fish communities between the sampling periods. Sampling sites were classified into those downstream of a rapidly urbanizing area (“urbanized sites”), and those found in less impacted areas (“low-impacted sites”). We calculated the change from non-urban to urban land cover between 1993 and 2009 at two scales for each site (the total watershed and a 3km buffer zone immediately upstream of each site). Neither the mean relative abundance of native fish nor nonnative species richness changed significantly between the survey periods. However, we observed significant changes in fish community composition (as measured by Bray-Curtis dissimilarity) and a decrease in native species richness between the sampling periods at urbanized sites, but not at low-impacted sites. Moreover, the relative abundance of one native cyprinid (Lavinia symmetricus) decreased at the urbanized sites but not at low-impacted sites. Increased urbanization was associated with changes in the fish community, and this relationship was strongest at the smaller (3km buffer) scale. Our results suggest that ongoing land change alters fish communities and that contemporary resurveys are an important tool for examining how freshwater taxa are responding to recent environmental change. PMID:26580560

Data Validation Package - June 2015 Groundwater and Surface Water Sampling at the Green River, Utah, Disposal Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linard, Joshua; Price, Jeffrey

2015-08-01

Groundwater samples were collected during the 2015 sampling event from point-of-compliance (POC) wells 0171, 0173, 0176, 0179, 0181, and 0813 to monitor the disposition of contaminants in the middle sandstone unit of the Cedar Mountain Formation. Groundwater samples also were collected from alluvium monitoring wells 0188, 0189, 0192, 0194, and 0707, and basal sandstone monitoring wells 0182, 0184, 0185, and 0588 as a best management practice. Surface locations 0846 and 0847 were sampled to monitor for degradation of water quality in the backwater area of Brown’s Wash and in the Green River immediately downstream of Brown’s Wash. The Green Rivermore » location 0801 is upstream from the site and is sampled to determine background-threshold values (BTVs). Sampling and analyses were conducted as specified in Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites (LMS/PRO/S04351, continually updated, http://energy.gov/lm/downloads/sampling-and- analysis-plan-us-department-energy-office-legacy-management-sites). Water levels were measured at each sampled well. The analytical data and associated qualifiers can be viewed in environmental database reports and are also available for viewing with dynamic mapping via the GEMS (Geospatial Environmental Mapping System) website at http://gems.lm.doe.gov/#. All six POC wells are completed in the middle sandstone unit of the Cedar Mountain Formation and are monitored to measure contaminant concentrations for comparison to proposed alternate concentration limits (ACLs), as provided in Table 1. Contaminant concentrations in the POC wells remain below their respective ACLs.« less

Dissolved pesticide concentrations detected in storm-water runoff at selected sites in the San Joaquin River basin, California, 2000-2001

USGS Publications Warehouse

Orlando, James L.; Kuivila, Kathryn; Whitehead, Andrew

2003-01-01

As part of a collaborative study involving the United States Geological Survey Toxics Substances Hydrology Project (Toxics Project) and the University of California, Davis, Bodega Marine Laboratory (BML), water samples were collected at three sites within the San Joaquin River Basin of California and analyzed for dissolved pesticides. Samples were collected during, and immediately after, the first significant rainfall (greater than 0.5 inch per day) following the local application of dormant spray, organophosphate insecticides during the winters of 2000 and 2001. All samples were collected in conjunction with fish-caging experiments conducted by BML researchers. Sites included two locations potentially affected by runoff of agricultural chemicals (San Joaquin River near Vernalis, California, and Orestimba Creek at River Road near Crows Landing, California, and one control site located upstream of pesticide input (Orestimba Creek at Orestimba Creek Road near Newman, California). During these experiments, fish were placed in cages and exposed to storm runoff for up to ten days. Following exposure, the fish were examined for acetylcholinesterase concentrations and overall genetic damage. Water samples were collected throughout the rising limb of the stream hydrograph at each site for later pesticide analysis. Concentrations of selected pesticides were measured in filtered water samples using solid-phase extraction (SPE) and gas chromatography-mass spectrometry (GC/MS) at the U.S. Geological Survey organic chemistry laboratory in Sacramento, California. Results of these analyses are presented.

Water-quality conditions at selected landfills in Mecklenburg County, North Carolina, 1986-92

USGS Publications Warehouse

Ferrell, G.M.; Smith, D.G.

1995-01-01

Water-quality conditions at five municipal landfills in Mecklenburg County, North Carolina, were studied during 1986-92. Analytical results of water samples from monitoring wells and streams at and near the landfills were used to evaluate effects of leachate on surface and ground water. Ground-water levels at monitoring wells were used to determine directions of ground-water flow at the landfills. Data from previous studies were used for analysis of temporal trends in selected water-quality properties and chemical constituents. Effects of leachate, such as large biochemical- and chemical-oxygen demands, generally were evident in small streams originating within the landfills, whereas effects of leachate generally were not evident in most of the larger streams. In larger streams, surface-water quality upstream and downstream from most of the landfills was similar. However, the chemical quality of water in Irwin Creek appears to have been affected by the Statesville Road landfill. Concentrations of several constituents indicative of leachate were larger in samples collected from Irwin Creek downstream from the Statesville Road landfill than in samples collected from Irwin Creek upstream from the landfill. The effect of leachate on ground-water quality generally was largest in water from wells adjacent to waste-disposal cells. Concentrations of most constituents considered indicative of leachate generally were smaller with increasing distance from waste-disposal cells. Water samples from offsite wells generally indicated no effect or very small effects of leachate. Action levels designated by the Mecklenburg County Engineering Department and maximum contaminant levels established by the U.S. Environmental Protection Agency were exceeded in some samples from the landfills. Ground-water samples exceeded action levels and maximum contaminant levels more commonly than surface-water samples. Iron and manganese were the constituents that most commonly exceeded action levels in water samples from the landfills. Synthetic organic compounds were detected more commonly and in larger concentrations in ground-water samples than in surface-water samples. Concentrations of synthetic organic compounds detected in water samples from monitoring sites at the landfills generally were much less than maximum contaminant levels. However, concentrations of some chlorinated organic compounds exceeded maximum contaminant levels in samples from several monitoring wells at the Harrisburg Road and York Road landfills. Trend analysis indicated statistically significant temporal changes in concentrations of selected water-quality constituents and properties at some of the monitoring sites. Trends detected for the Holbrooks Road and Statesville Road landfills generally indicated an improvement in water quality and a decrease in effects of leachate at most monitoring sites at these landfills from 1979 to 1992. Water-quality trends detected for monitoring sites at the Harrisburg Road and York Road landfills, the largest landfills in the study, differed in magnitude and direction. Upward trends generally were detected for sites near recently closed waste-disposal cells, whereas downward trends generally were detected for sites near older waste-disposal cells. Temporal trends in water quality generally reflected changes in degradation processes associated with the aging of landfill wastes.

Untreated urban waste contaminates Indian river sediments with resistance genes to last resort antibiotics.

PubMed

Marathe, Nachiket P; Pal, Chandan; Gaikwad, Swapnil S; Jonsson, Viktor; Kristiansson, Erik; Larsson, D G Joakim

2017-11-01

Efficient sewage treatment is critical for limiting environmental transmission of antibiotic-resistant bacteria. In many low and middle income countries, however, large proportions of sewage are still released untreated into receiving water bodies. In-depth knowledge of how such discharges of untreated urban waste influences the environmental resistome is largely lacking. Here, we highlight the impact of uncontrolled discharge of partially treated and/or untreated wastewater on the structure of bacterial communities and resistome of sediments collected from Mutha river flowing through Pune city in India. Using shotgun metagenomics, we found a wide array (n = 175) of horizontally transferable antibiotic resistance genes (ARGs) including carbapenemases such as NDM, VIM, KPC, OXA-48 and IMP types. The relative abundance of total ARGs was 30-fold higher in river sediments within the city compared to upstream sites. Forty four ARGs, including the tet(X) gene conferring resistance to tigecycline, OXA-58 and GES type carbapenemases, were significantly more abundant in city sediments, while two ARGs were more common at upstream sites. The recently identified mobile colistin resistance gene mcr-1 was detected only in one of the upstream samples, but not in city samples. In addition to ARGs, higher abundances of various mobile genetic elements were found in city samples, including integron-associated integrases and ISCR transposases, as well as some biocide/metal resistance genes. Virulence toxin genes as well as bacterial genera comprising many pathogens were more abundant here; the genus Acinetobacter, which is often associated with multidrug resistance and nosocomial infections, comprised up to 29% of the 16S rRNA reads, which to our best knowledge is unmatched in any other deeply sequenced metagenome. There was a strong correlation between the abundance of Acinetobacter and the OXA-58 carbapenemase gene. Our study shows that uncontrolled discharge of untreated urban waste can contribute to an overall increase of the abundance and diversity of ARGs in the environment, including those conferring resistance to last-resort antibiotics. Copyright © 2017 Elsevier Ltd. All rights reserved.

Monitoring the impact of urban effluents on mineral contents of water and sediments of four sites of the river Ravi, Lahore.

PubMed

Shakir, Hafiz Abdullah; Qazi, Javed Iqbal; Chaudhry, Abdul Shakoor

2013-12-01

We assessed the impact of urban effluents on the concentrations of selected minerals (Cd, Cr, Cu, Fe, Pb, Zn, Mn, Ni, and Hg) in river Ravi before and after its passage through Lahore city. Water and sediment samples were collected from three lowly to highly polluted downstream sites (Shahdera (B), Sunder (C), and Balloki (D)) alongside the least polluted upstream site (Siphon (A)) during high and low river flow seasons. All the mineral concentrations increased up to site C but stabilized at site D, showing some recovery as compared to the third sampling site. The trend of mean mineral concentration was significantly higher during the low than the high flow season at all the sites. The mean Hg concentrations approached 0.14 and 0.12 mg/l at site A which increased (%) up to 107 and 25% at site B, 1,700 and 1,317% at site C, and 1,185 and 1,177% at site D during low and high river flows, respectively. All mineral concentrations were much higher in the sediment than the water samples. Mean Cd (917%), Cr (461%), Cu (300%), Fe (254%), Pb (179%), Zn (170%), Mn (723%), Ni (853%), and Hg (1,699%) concentrations were higher in riverbed sediments sampled from site C in comparison with the sample collected at site A during low flow season. The domestic and industrial discharges from Lahore city have created undesirable water qualities during the low river flow season. As majority of the mineral levels in the river Ravi were higher than the permissible and safe levels, this is of immediate concern for riverine fish consumers and the users of water for recreation and even irrigation. The use of these waters may pose health risks, and therefore, urgent intervention strategies are needed to minimize river water pollution and its impact on fish-consuming communities of this study area and beyond.

Localization of TFIIB binding regions using serial analysis of chromatin occupancy

PubMed Central

Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon

2007-01-01

Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859

The concentration and chemical speciation of arsenic in the Nanpan River, the upstream of the Pearl River, China.

PubMed

Yang, Silin; Zhao, Ning; Zhou, Dequn; Wei, Rong; Yang, Bin; Pan, Bo

2016-04-01

The concentration and chemical speciation of arsenic (As) in different environmental matrixes (water, sediment, agricultural soils, and non-agricultural soils) were investigated in the Nanpan River area, the upstream of Pearl River, China. The results did not show any obvious transport of As along the flow direction of the river (from upstream to downstream). Total As concentrations in sediment were significantly different from those in agricultural soil. According to the comparison to quality standards, the As in sediments of the studied area have potential ecological risks and a minority of the sampling sites of agricultural soils in the studied area were polluted with As. As speciations were analyzed using sequential extraction and the percentage of non-residual fraction in sediment predominated over residual fraction. We thus believe that As in the studied area was with low mobility and bioavailability in sediment, agricultural soils, and non-agricultural soils. However, the bioavailability and mobility of As in sediment were higher than in both agricultural and non-agricultural soils, and thus, special attention should be paid for the risk assessment of As in the river in future studies.

Sources, spatial variation, and speciation of heavy metals in sediments of the Tamagawa River in Central Japan.

PubMed

Shikazono, N; Tatewaki, K; Mohiuddin, K M; Nakano, T; Zakir, H M

2012-01-01

Sediments of the Tamagawa River in central Japan were studied to explain the spatial variation, to identify the sources of heavy metals, and to evaluate the anthropogenic influence on these pollutants in the river. Sediment samples were collected from 20 sites along the river (five upstream, four midstream, and 11 downstream). Heavy metal concentrations, viz. chromium, nickel, copper, zinc, lead, cadmium, and molybdenum, in the samples were measured using inductively coupled plasma-mass spectroscopy. The chemical speciations of heavy metals in the sediments were identified by the widely used five-step Hall method. Lead isotopes were analyzed to identify what portion is contributed by anthropogenic sources. The total heavy metal concentrations were compared with global averages for continental crust (shale) and average values for Japanese river sediments. The mean heavy metal concentrations were higher in downstream sediments than in upstream and midstream samples, and the concentrations in the silt samples were higher than those in the sand samples. Speciation results demonstrate that, for chromium and nickel, the residual fractions were dominant. These findings imply that the influence of anthropogenic chromium and nickel contamination is negligible, while copper, zinc, and lead were mostly extracted in the non-residual fraction (metals in adsorbed/exchangeable/carbonate forms or bound to amorphous Fe oxyhydroxides, crystalline Fe oxides, or organic matter), indicating that these elements have high chemical mobility. The proportion of lead (Pb) isotopes in the downstream silt samples indicates that Pb accumulation is primarily derived from anthropogenic sources.

Didymosphenia geminata in the Upper Esopus Creek: Current Status, Variability, and Controlling Factors

PubMed Central

George, Scott Daniel; Baldigo, Barry Paul

2015-01-01

In May of 2009, the bloom-forming diatom Didymosphenia geminata was first identified in the Upper Esopus Creek, a key tributary to the New York City water-supply and a popular recreational stream. The Upper Esopus receives supplemental flows from the Shandaken Portal, an underground aqueduct delivering waters from a nearby basin. The presence of D. geminata is a concern for the local economy, water supply, and aquatic ecosystem because nuisance blooms have been linked to degraded stream condition in other regions. Here we ascertain the extent and severity of the D. geminata invasion, determine the impact of supplemental flows from the Portal on D. geminata, and identify potential factors that may limit D. geminata in the watershed. Stream temperature, discharge, and water quality were characterized at select sites and periphyton samples were collected five times at 6 to 20 study sites between 2009 and 2010 to assess standing crop, diatom community structure, and density of D. geminata and all diatoms. Density of D. geminata ranged from 0–12 cells cm-2 at tributary sites, 0–781 cells cm-2 at sites upstream of the Portal, and 0–2,574 cells cm-2 at sites downstream of the Portal. Survey period and Portal (upstream or downstream) each significantly affected D. geminata cell density. In general, D. geminata was most abundant during the November 2009 and June 2010 surveys and at sites immediately downstream of the Portal. We found that D. geminata did not reach nuisance levels or strongly affect the periphyton community. Similarly, companion studies showed that local macroinvertebrate and fish communities were generally unaffected. A number of abiotic factors including variable flows and moderate levels of phosphorous and suspended sediment may limit blooms of D. geminata in this watershed. PMID:26148184

Water Quality in the Blue River Basin, Kansas City Metropolitan Area, Missouri and Kansas, July 1998 to October 2004

USGS Publications Warehouse

Wilkison, Donald H.; Armstrong, Daniel J.; Norman, Richard D.; Polton, Barry C.; Furlong, Edward T.; Zaugg, Steven D.

2006-01-01

Water-quality data were collected from sites in the Blue River Basin from July 1998 to October. Sites upstream from wastewater-treatment plants or the combined sewer system area had lower concentrations of total nitrogen, phosphorus, organic wastewater compounds, and pharmaceuticals, and more diverse aquatic communities. Sites downstream from wastewater-treatment plants had the largest concentrations and loads of nutrients, organic wastewater compounds, and pharmaceuticals. Approximately 60 percent of the total nitrogen and phosphorus in Blue River originated from the Indian Creek, smaller amounts from the upper Blue River (from 28 to 16 percent), and less than 5 percent from Brush Creek. Nutrient yields from the Indian Creek and the middle Blue River were significantly greater than yields from the upper Blue River, lower Brush Creek, the outside control site, and other U.S. urban sites. Large concentrations of nutrients led to eutrophication of impounded Brush Creek reaches. Bottom sediment samples collected from impoundments generally had concentrations of organic wastewater and pharmaceutical compounds equivalent to or greater than, concentrations observed in streambed sediments downstream from wastewater-treatment plants. Bacteria in streams largely was the result of nonpoint-source contributions during storms. Based on genetic source-tracking, average contributions of in-stream Esherichia coli bacteria in the basin from dogs ranged from 26-32 percent of the total concentration, and human sources ranged from 28-42 percent. Macro invertebrate diversity was highest at sites with the largest percentage of upstream land use devoted to forests and grasslands. Declines in macro invertebrate community metrics were correlated strongly with increases in several, inter-related urbanization factors.

Water quality in the Blue River basin, Kansas City metropolitan area, Missouri and Kansas, July 1998 to October 2004

USGS Publications Warehouse

Wilkison, Donald H.; Armstrong, Daniel J.; Norman, Richard D.; Poulton, Barry C.; Furlong, Edward T.; Zaugg, Steven D.

2006-01-01

Water-quality data were collected from sites in the Blue River Basin from July 1998 to October. Sites upstream from wastewater-treatment plants or the combined sewer system area had lower concentrations of total nitrogen, phosphorus, organic wastewater compounds, and pharmaceuticals, and more diverse aquatic communities. Sites downstream from wastewater-treatment plants had the largest concentrations and loads of nutrients, organic wastewater compounds, and pharmaceuticals. Approximately 60 percent of the total nitrogen and phosphorus in Blue River originated from the Indian Creek, smaller amounts from the upper Blue River (from 28 to 16 percent), and less than 5 percent from Brush Creek. Nutrient yields from the Indian Creek and the middle Blue River were significantly greater than yields from the upper Blue River, lower Brush Creek, the outside control site, and other U.S. urban sites. Large concentrations of nutrients led to eutrophication of impounded Brush Creek reaches. Bottom sediment samples collected from impoundments generally had concentrations of organic wastewater and pharmaceutical compounds equivalent to or greater than, concentrations observed in streambed sediments downstream from wastewater-treatment plants. Bacteria in streams largely was the result of nonpoint-source contributions during storms. Based on genetic source-tracking, average contributions of in-stream Esherichia coli bacteria in the basin from dogs ranged from 26-32 percent of the total concentration, and human sources ranged from 28-42 percent. Macro invertebrate diversity was highest at sites with the largest percentage of upstream land use devoted to forests and grasslands. Declines in macro invertebrate community metrics were correlated strongly with increases in several, inter-related urbanization factors.

Distribution of dissolved pesticides and other water quality constituents in small streams, and their relation to land use, in the Willamette River Basin, Oregon, 1996

USGS Publications Warehouse

Anderson, Chauncey W.; Wood, Tamara M.; Morace, Jennifer L.

1997-01-01

Water quality samples were collected at sites in 16 randomly selected agricultural and 4 urban subbasins as part of Phase III of the Willamette River Basin Water Quality Study in Oregon during 1996. Ninety-five samples were collected and analyzed for suspended sediment, conventional constituents (temperature, dissolved oxygen, pH, specific conductance, nutrients, biochemical oxygen demand, and bacteria) and a suite of 86 dissolved pesticides. The data were collected to characterize the distribution of dissolved pesticide concentrations in small streams (drainage areas 2.6? 13 square miles) throughout the basin, to document exceedances of water quality standards and guidelines, and to identify the relative importance of several upstream land use categories (urban, agricultural, percent agricultural land, percent of land in grass seed crops, crop diversity) and seasonality in affecting these distributions. A total of 36 pesticides (29 herbicides and 7 insecticides) were detected basinwide. The five most frequently detected compounds were the herbicides atrazine (99% of samples), desethylatrazine (93%), simazine (85%), metolachlor (85%), and diuron (73%). Fifteen compounds were detected in 12?35% of samples, and 16 compounds were detected in 1?9% of samples. Water quality standards or criteria were exceeded more frequently for conventional constituents than for pesticides. State of Oregon water quality standards were exceeded at all but one site for the indicator bacteria E. coli, 3 sites for nitrate, 10 sites for water temperature, 4 sites for dissolved oxygen, and 1 site for pH. Pesticide concentrations, which were usually less than 1 part per billion, exceeded State of Oregon or U.S. Environmental Protection Agency aquatic life toxicity criteria only for chlorpyrifos, in three samples from one site; such criteria have been established for only two other detected pesticides. However, a large number of unusually high concentrations (1?90 parts per billion) were detected, indicating that pesticides in the runoff sampled in these small streams were more highly concentrated than in the larger streams sampled in previous studies. These pulses could have had short term toxicological implications for the affected streams; however, additional toxicological assessment of the detected pesticides was limited because of a lack of available information on the response of aquatic life to the observed pesticide concentrations. Six pesticides, including atrazine, diuron, and metolachlor, had significantly higher (p<0.08 for metolachlor, p<0.05 for the other five) median concentrations at agricultural sites than at urban sites. Five other compounds ?carbaryl, diazinon, dichlobenil, prometon, and tebuthiuron?had significantly higher (p<0.05) concentrations at the urban sites than at the agricultural sites. Atrazine, metolachlor, and diuron also had significantly higher median concentrations at southern agricultural sites (dominated by grass seed crops) than northern agricultural sites. Other compounds that had higher median concentrations in the south included 2,4-D and metribuzin, which are both used on grass seed crops, and triclopyr, bromacil, and pronamide. A cluster analysis of the data grouped sites according to their pesticide detections in a manner that was almost identical to a grouping made solely on the basis of their upstream land use patterns (urban, agricultural, crop diversity, percentage of basin in agricultural production). In this way inferences about pesticide associations with different land uses could be drawn, illustrating the strength of these broad land use categories in determining the types of pesticides that can be expected to occur. Among the associations observed were pesticides that occurred at a group of agricultural sites, but which have primarily noncropland uses such as vegetation control along rights-of-way. Also, the amount of forested land in a basin was negatively associated with pesticide occurrence, sugges

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Limnology of Blue Mesa, Morrow Point, and Crystal Reservoirs, Curecanti National Recreation area, during 1999, and a 25-year retrospective of nutrient conditions in Blue Mesa Reservoir, Colorado

USGS Publications Warehouse

Bauch, Nancy J.; Malick, Matt

2003-01-01

The U.S. Geological Survey and the National Park Service conducted a water-quality investigation in Curecanti National Recreation Area in Colorado from April through December 1999. Current (as of 1999) limnological characteristics, including nutrients, phytoplankton, chlorophyll-a, trophic status, and the water quality of stream inflows and reservoir outflows, of Blue Mesa, Morrow Point, and Crystal Reservoirs were assessed, and a 25-year retrospective of nutrient conditions in Blue Mesa Reservoir was conducted. The three reservoirs are in a series on the Gunnison River, with an upstream to downstream order of Blue Mesa, Morrow Point, and Crystal Reservoirs. Physical properties and water-quality samples were collected four times during 1999 from reservoir, inflow, and outflow sites in and around the recreation area. Samples were analyzed for nutrients, phytoplankton and chlorophyll-a (reservoir sites only), and suspended sediment (stream inflows only). Nutrient concentrations in the reservoirs were low; median total nitrogen and phosphorus concentrations were less than 0.4 and 0.06 milligram per liter, respectively. During water-column stratification, samples collected at depth had higher nutrient concentrations than photic-zone samples. Phytoplankton community and density were affected by water temperature, nutrients, and water residence time. Diatoms were the dominant phytoplankton throughout the year in Morrow Point and Crystal Reservoirs and during spring and early winter in Blue Mesa Reservoir. Blue-green algae were dominant in Blue Mesa Reservoir during summer and fall. Phytoplankton density was highest in Blue Mesa Reservoir and lowest in Crystal Reservoir. Longer residence times and warmer temperatures in Blue Mesa Reservoir were favorable for phytoplankton growth and development. Shorter residence times and cooler temperatures in the downstream reservoirs probably limited phytoplankton growth and development. Median chlorophyll-a concentrations were higher in Blue Mesa Reservoir than Morrow Point or Crystal Reservoirs. Blue Mesa Reservoir was mesotrophic in upstream areas and oligotrophic downstream. Both Morrow Point and Crystal Reservoirs were oligotrophic. Trophic-state index values were determined for total phosphorus, chlorophyll-a, and Secchi depth for each reservoir by the Carlson method; all values ranged between 29 and 55. Only the upstream areas in Blue Mesa Reservoir had total phosphorus and chlorophyll-a indices above 50, reflecting mesotrophic conditions. Nutrient inflows to Blue Mesa Reservoir, which were derived primarily from the Gunnison River, varied on a seasonal basis, whereas nutrient inflows to Morrow Point and Crystal Reservoirs, which were derived primarily from deep water releases from the respective upstream reservoir, were steady throughout the sampling period. Total phosphorus concentrations were elevated in many stream inflows. A comparison of current (as of 1999) and historical nutrient, chlorophyll-a, and trophic conditions in Blue Mesa Reservoir and its tributaries indicated that the trophic status in Blue Mesa Reservoir has not changed over the last 25 years, and more recent nutrient enrichment has not occurred.

Water-quality trends and constituent-transport analysis for selected sampling sites in the Milltown Reservoir/Clark Fork River Superfund Site in the upper Clark Fork Basin, Montana, water years 1996–2015

USGS Publications Warehouse

Sando, Steven K.; Vecchia, Aldo V.

2016-07-20

During the extended history of mining in the upper Clark Fork Basin in Montana, large amounts of waste materials enriched with metallic contaminants (cadmium, copper, lead, and zinc) and the metalloid trace element arsenic were generated from mining operations near Butte and milling and smelting operations near Anaconda. Extensive deposition of mining wastes in the Silver Bow Creek and Clark Fork channels and flood plains had substantial effects on water quality. Federal Superfund remediation activities in the upper Clark Fork Basin began in 1983 and have included substantial remediation near Butte and removal of the former Milltown Dam near Missoula. To aid in evaluating the effects of remediation activities on water quality, the U.S. Geological Survey began collecting streamflow and water-quality data in the upper Clark Fork Basin in the 1980s.Trend analysis was done on specific conductance, selected trace elements (arsenic, copper, and zinc), and suspended sediment for seven sampling sites in the Milltown Reservoir/Clark Fork River Superfund Site for water years 1996–2015. The most upstream site included in trend analysis is Silver Bow Creek at Warm Springs, Montana (sampling site 8), and the most downstream site is Clark Fork above Missoula, Montana (sampling site 22), which is just downstream from the former Milltown Dam. Water year is the 12-month period from October 1 through September 30 and is designated by the year in which it ends. Trend analysis was done by using a joint time-series model for concentration and streamflow. To provide temporal resolution of changes in water quality, trend analysis was conducted for four sequential 5-year periods: period 1 (water years 1996–2000), period 2 (water years 2001–5), period 3 (water years 2006–10), and period 4 (water years 2011–15). Because of the substantial effect of the intentional breach of Milltown Dam on March 28, 2008, period 3 was subdivided into period 3A (October 1, 2005–March 27, 2008) and period 3B (March 28, 2008–September 30, 2010) for the Clark Fork above Missoula (sampling site 22). Trend results were considered statistically significant when the statistical probability level was less than 0.01.In conjunction with the trend analysis, estimated normalized constituent loads (hereinafter referred to as “loads”) were calculated and presented within the framework of a constituent-transport analysis to assess the temporal trends in flow-adjusted concentrations (FACs) in the context of sources and transport. The transport analysis allows assessment of temporal changes in relative contributions from upstream source areas to loads transported past each reach outflow.Trend results indicate that FACs of unfiltered-recoverable copper decreased at the sampling sites from the start of period 1 through the end of period 4; the decreases ranged from large for one sampling site (Silver Bow Creek at Warm Springs [sampling site 8]) to moderate for two sampling sites (Clark Fork near Galen, Montana [sampling site 11] and Clark Fork above Missoula [sampling site 22]) to small for four sampling sites (Clark Fork at Deer Lodge, Montana [sampling site 14], Clark Fork at Goldcreek, Montana [sampling site 16], Clark Fork near Drummond, Montana [sampling site 18], and Clark Fork at Turah Bridge near Bonner, Montana [sampling site 20]). For period 4 (water years 2011–15), the most notable changes indicated for the Milltown Reservoir/Clark Fork River Superfund Site were statistically significant decreases in FACs and loads of unfiltered-recoverable copper for sampling sites 8 and 22. The period 4 changes in FACs of unfiltered-recoverable copper for all other sampling sites were not statistically significant.Trend results indicate that FACs of unfiltered-recoverable arsenic decreased at the sampling sites from period 1 through period 4 (water years 1996–2015); the decreases ranged from minor (sampling sites 8–20) to small (sampling site 22). For period 4 (water years 2011–15), the most notable changes indicated for the Milltown Reservoir/Clark Fork River Superfund Site were statistically significant decreases in FACs and loads of unfiltered-recoverable arsenic for sampling site 8 and near statistically significant decreases for sampling site 22. The period 4 changes in FACs of unfiltered-recoverable arsenic for all other sampling sites were not statistically significant.Trend results indicate that FACs of suspended sediment decreased at the sampling sites from period 1 through period 4 (water years 1996–2015); the decreases ranged from moderate (sampling site 8) to small (sampling sites 11–22). For period 4 (water years 2011–15), the changes in FACs of suspended sediment were not statistically significant for any sampling sites.The reach of the Clark Fork from Galen to Deer Lodge is a large source of metallic contaminants and suspended sediment, which strongly affects downstream transport of those constituents. Mobilization of copper and suspended sediment from flood-plain tailings and the streambed of the Clark Fork and its tributaries within the reach results in a contribution of those constituents that is proportionally much larger than the contribution of streamflow from within the reach. Within the reach from Galen to Deer Lodge, unfiltered-recoverable copper loads increased by a factor of about 4 and suspended-sediment loads increased by a factor of about 5, whereas streamflow increased by a factor of slightly less than 2. For period 4 (water years 2011–15), unfiltered-recoverable copper and suspended-sediment loads sourced from within the reach accounted for about 41 and 14 percent, respectively, of the loads at Clark Fork above Missoula (sampling site 22), whereas streamflow sourced from within the reach accounted for about 4 percent of the streamflow at sampling site 22. During water years 1996–2015, decreases in FACs and loads of unfiltered-recoverable copper and suspended sediment for the reach generally were proportionally smaller than for most other reaches.Unfiltered-recoverable copper loads sourced within the reaches of the Clark Fork between Deer Lodge and Turah Bridge near Bonner (just upstream from the former Milltown Dam) were proportionally smaller than contributions of streamflow sourced from within the reaches; these reaches contributed proportionally much less to copper loading in the Clark Fork than the reach between Galen and Deer Lodge. Although substantial decreases in FACs and loads of unfiltered-recoverable copper and suspended sediment were indicated for Silver Bow Creek at Warm Springs (sampling site 8), those substantial decreases were not translated to downstream reaches between Deer Lodge and Turah Bridge near Bonner. The effect of the reach of the Clark Fork from Galen to Deer Lodge as a large source of copper and suspended sediment, in combination with little temporal change in those constituents for the reach, contributes to this pattern.With the removal of the former Milltown Dam in 2008, substantial amounts of contaminated sediments that remained in the Clark Fork channel and flood plain in reach 9 (downstream from Turah Bridge near Bonner) became more available for mobilization and transport than before the dam removal. After the removal of the former Milltown Dam, the Clark Fork above Missoula (sampling site 22) had statistically significant decreases in FACs of unfiltered-recoverable copper in period 3B (March 28, 2008, through water year 2010) that continued in period 4 (water years 2011–15). Also, decreases in FACs of unfiltered-recoverable arsenic and suspended sediment were indicated for period 4 at this site. The decrease in FACs of unfiltered-recoverable copper for sampling site 22 during period 4 was proportionally much larger than the decrease for the Clark Fork at Turah Bridge near Bonner (sampling site 20). Net mobilization of unfiltered-recoverable copper and arsenic from sources within reach 9 are smaller for period 4 than for period 1 when the former Milltown Dam was in place, providing evidence that contaminant source materials have been substantially reduced in reach 9.

Relationships of field habitat measurements, visual habitat indices, and land cover to benthic macroinvertebrates in urbanized streams of the Santa Clara Valley, California

USGS Publications Warehouse

Fend, S.V.; Carter, J.L.; Kearns, F.R.

2005-01-01

We evaluated several approaches for measuring natural and anthropogenic habitat characteristics to predict benthic macroinvertebrate assemblages over a range of urban intensity at 85 stream sites in the Santa Clara Valley, California. Land cover was summarized as percentage urban land cover and impervious area within upstream buffers and the upstream subwatersheds. Field measurements characterized water chemistry, channel slope, sediment, and riparian canopy. In . addition to applying the visual-based habitat assessment in U.S. Environmental Protection Agency's rapid bioassessment protocol, we developed a simplified urban habitat assessment index based on turbidity, fine sediment deposition, riparian condition, and channel modification. Natural and anthropogenic habitat variables covaried along longitudinal stream gradients and were highly correlated with elevation. At the scale of the entire watershed, benthic macroinvertebrate measures were equally correlated with variables expressing natural gradients and urbanization effects. When natural gradients were reduced by partitioning sites into ecoregion subsection groupings, habitat variables most highly correlated with macroinvertebrate measures differed between upland and valley floor site groups. Among the valley floor sites, channel slope and physical modification of channel and riparian habitats appeared more important than upstream land cover or water quality in determining macroinvertebrate richness and ordination scores. Among upland sites, effects of upstream reservoir releases on habitat quality appeared important. Rapid habitat evaluation methods appeared to be an effective method for describing habitat features important to benthic macroinvertebrates when adapted for the region and the disturbance of interest. ?? 2005 by the American Fisheries Society.

Reconnaissance investigation of water quality, bottom sediment, and biota associated with irrigation drainage in and near Humboldt Wildlife Management Area, Churchill and Pershing Counties, Nevada, 1990-91

USGS Publications Warehouse

Seiler, R.L.; Ekechukwu, G.A.; Hallock, R.J.

1993-01-01

A reconnaissance investigation was begun in 1990 to determine whether the quality of irrigation drainage in and near the Humboldt Wildlife Management Area, Nevada, has caused or has the potential to cause harmful effects on human health, fish, and wildlife or to impair beneficial uses of water. Samples of surface and ground water, bottom sediment, and biota collected from sites upstream and downstream from the Lovelock agricultural area were analyzed for potentially toxic trace elements. Also analyzed were radioactive substances, major dissolved constitu- ents, and nutrients in water, as well as pesticide residues in bottom sediment and biota. In samples from areas affected by irrigation drainage, the following constituents equaled or exceeded baseline concentrations or recommended standards for protection of aquatic life or propagation of wildlife--in water: arsenic, boron, dissolved solids, mercury, molybdenum, selenium, sodium, and un-ionized ammonia; in bottom sediment; arsenic and uranium; and in biota; arsenic, boron, and selenium. Selenium appears to be biomagnified in the Humboldt Sink wetlands. Biological effects observed during the reconnaissance included reduced insect diversity in sites receiving irrigation drainage and acute toxicity of drain water and sediment to test organisms. The current drought and upstream consumption of water for irrigation have reduced water deliveries to the wetlands and caused habitat degradation at Humboldt Wildlife Management Area. During this investigation. Humboldt and Toulon Lakes evaporated to dryness because of the reduced water deliveries.

Sediment transport to and from small impoundments in northeast Kansas, March 2009 through September 2011

USGS Publications Warehouse

Foster, Guy M.; Lee, Casey J.; Ziegler, Andrew C.

2012-01-01

The U.S. Geological Survey, in cooperation with the Kansas Water Office, investigated sediment transport to and from three small impoundments (average surface area of 0.1 to 0.8 square miles) in northeast Kansas during March 2009 through September 2011. Streamgages and continuous turbidity sensors were operated upstream and downstream from Atchison County, Banner Creek, and Centralia Lakes to study the effect of varied watershed characteristics and agricultural practices on sediment transport in small watersheds in northeast Kansas. Atchison County Lake is located in a predominantly agricultural basin of row crops, with wide riparian buffers along streams, a substantial amount of tile drainage, and numerous small impoundments (less than 0.05 square miles; hereafter referred to as “ponds”). Banner Creek Lake is a predominantly grassland basin with numerous small ponds located in the watershed, and wide riparian buffers along streams. Centralia Lake is a predominantly agricultural basin of row crops with few ponds, few riparian buffers along streams, and minimal tile drainage. Upstream from Atchison County, Banner Creek, and Centralia Lakes 24, 38, and 32 percent, respectively, of the total load was transported during less than 0.1 percent (approximately 0.9 days) of the time. Despite less streamflow in 2011, larger sediment loads during that year indicate that not all storm events transport the same amount of sediment; larger, extreme storms during the spring may transport much larger sediment loads in small Kansas watersheds. Annual sediment yields were 360, 400, and 970 tons per square mile per year at Atchison County, Banner, and Centralia Lake watersheds, respectively, which were less than estimated yields for this area of Kansas (between 2,000 and 5,000 tons per square mile per year). Although Centralia and Atchison County Lakes had similar percentages of agricultural land use, mean annual sediment yields upstream from Centralia Lake were about 2.7 times those at Atchison County or Banner Creek Lakes. These data indicate larger yields of sediment from watersheds with row crops and those with fewer small ponds, and smaller yields in watersheds which are primarily grassland, or agricultural with substantial tile drainage and riparian buffers along streams. These results also indicated that a cultivated watershed can produce yields similar to those observed under the assumed reference (or natural) condition. Selected small ponds were studied in the Atchison County Lake watershed to characterize the role of small ponds in sediment trapping. Studied ponds trapped about 8 percent of the sediment upstream from the sediment-sampling site. When these results were extrapolated to the other ponds in the watershed, differences in the extent of these ponds was not the primary factor affecting differences in yields among the three watersheds. However, the selected small ponds were both 45 years old at the time of this study, and have reduced capacity because of being filled in with sediments. Additionally, trapping efficiency of these small ponds decreased over five observed storms, indicating that processes that suspended or resuspended sediments in these shallow ponds, such as wind and waves, affected their trapping efficiencies. While small ponds trapped sediments in small storms, they could be a source of sediment in larger or more closely spaced storm events. Channel slope was similar at all three watersheds, 0.40, 0.46, and 0.31 percent at Atchison County, Banner Creek, and Centralia Lake watersheds, respectively. Other factors, such as increased bank and stream erosion, differences in tile drainage, extent of grassland, or riparian buffers, could be the predominant factors affecting sediment yields from these basins. These results show that reference-like sediment yields may be observed in heavily agricultural watersheds through a combination of field-scale management activities and stream channel protection. When computing loads using published erosion rates obtained by single-point survey methodology, streambank contributions from the main stem of Banner Creek are three times more than the sediment load observed by this study at the sediment sampling site at Banner Creek, 2.6 times more than the sediment load observed by this study at the sediment sampling site at Clear Creek (upstream from Atchison County Lake), and are 22 percent of the load observed by this study at the sediment sampling site at Black Vermillion River above Centralia Lake. Comparisons of study sites to similarly sized urban and urbanizing watersheds in Johnson County, Kansas indicated that sediment yields from the Centralia Lake watershed were similar to those in construction-affected watersheds, while much smaller sediment yields in the Atchison County and Banner Creek watersheds were comparable to stable, heavily urbanized watersheds. Comparisons of study sites to larger watersheds upstream from Tuttle Creek Lake indicate the Black Vermillion River watershed continues to have high sediment yields despite 98 percent of sediment from the Centralia watershed (a headwater of the Black Vermillion River) being trapped in Centralia Lake. Estimated trapping efficiencies for the larger watershed lakes indicated that Banner Creek and Centralia Lakes trapped 98 percent of incoming sediment, whereas Atchison County Lake trapped 72 percent of incoming sediment during the 3-year study period.

Mercury accumulation in biota of Thunder Creek, Saskatchewan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Munro, D.J.; Gummer, W.D.

Collection of biological organisms was undertaken to investigate the bioaccumulation of mercury in the food chain, the results of which are reported. Two sites were selected on Thunder Creek; the control or background site, site number 2, is located approximately 2.5 km upstream, from site number 1. The selection of organisms for analysis was based on the presence and abundance of each at both locations. Only crayfish (Orconcetes virilis) pearl dace (Semotilus margarita) and brook stickleback (Culaea inconstans) were found to be sufficiently abundant. The importance of the data obtained is the significant difference in concentration between the upstream andmore » downstream sites on Thunder Creek. This difference shows that more mercury is available to the biological community at site number 1 than at site number 2 confirming that mercury in the contaminated sediments is being methylated and taken up into the food chain.« less

Polycyclic aromatic hydrocarbons, aliphatic hydrocarbons, trace elements and monooxygenase activity in birds nesting on the North Platte River, Casper, Wyoming, USA

USGS Publications Warehouse

Custer, T.W.; Custer, Christine M.; Dickerson, K.; Allen, K.; Melancon, M.J.; Schmidt, L.J.

2001-01-01

Tree swallow (Tachycineta bicolor) and house wren (Troglodytes aedon) eggs and chicks were collected near a refinery site on the North Platte River, Casper, Wyoming, USA and at a reference site 10 km upstream. Total polycylic aromatic hydrocarbon (PAH) concentrations in swallow and wren chicks were higher at the refinery site than at the reference site. Polycylic aromatic hydrocarbon concentrations in sediment and chick dietary samples were consistent with these findings. The general lack of methylated PAHs in sediment, diet, and bird carcasses suggested that the PAHs were derived from combustion and not from petroleum. The predominance of odd numbered aliphatic hydrocarbons and the low ratios (≤ 0.25) of pristane: n-C17 and phytane: n-C18 in chick and diet samples also suggested that swallow and wren chicks were not being chronically exposed to petroleum. Mean ethoxyresorufin-O-dealkylase and benzyloxyresorufin-O-dealkylase activities in tree swallow livers averaged nine times higher at the refinery site than at the reference site and were probably induced by exposure to PAHs. Trace element concentrations in eggs and livers of swallows and wrens were similar or greater at the reference site than at the refinery site. Selenium, strontium, and boron concentrations were elevated in eggs and livers of swallows and wrens at both the refinery and reference sites.

Optimization Review, Black Butte Mine Superfund Site, Lane County, Oregon

EPA Pesticide Factsheets

The BBM Superfund Site (the site) is located in Lane County, Oregon, approximately 35 miles southeast of Eugene and approximately 10 miles upstream from the Cottage Grove Reservoir (CGR). Mercury mining and processing operations were active at the site...

Nutrients in Streams and Rivers Across the Nation -- 1992-2001

USGS Publications Warehouse

Mueller, David K.; Spahr, Norman E.

2006-01-01

Nutrient compounds of nitrogen and phosphorus were investigated in streams and rivers sampled as part of the U.S. Geological Survey National Water-Quality Assessment (NAWQA) Program. Nutrient data were collected in 20 NAWQA study units during 1992-95, 16 study units during 1996-98, and 15 study units during 1999-2001. To facilitate comparisons among sampling sites with variable sampling frequency, daily loads were determined by using regression models that relate constituent transport to streamflow and time. Model results were used to compute mean annual loads, yields, and concentrations of ammonia, nitrate, total nitrogen, orthophosphate, and total phosphorus, which were compared among stream and river sampling sites. Variations in the occurrence and distribution of nutrients in streams and rivers on a broad national scale reflect differences in the sources of nutrient inputs to the upstream watersheds and in watershed characteristics that affect movement of those nutrients. Sites were classified by watershed size and by land use in the upstream watershed: agriculture, urban, and undeveloped (forest or rangeland). Selection of NAWQA urban sites was intended to avoid effects of major wastewater-treatment plants and other point sources, but in some locations this was not feasible. Nutrient concentrations and yields generally increased with anthropogenic development in the watershed. Median concentrations and yields for all constituents at sites downstream from undeveloped areas were less than at sites downstream from agricultural or urban areas. Concentrations of ammonia, orthophosphate, and total phosphorus at agricultural and urban sites were not significantly different; however, concentrations of nitrate and total nitrogen were higher at agricultural than at urban sites. Total nitrogen concentrations at agricultural sites were higher in areas of high nitrogen input or enhanced transport, such as irrigation or artificial drainage that can rapidly move water from cropland to streams (Midwest, Northern Plains, and western areas of the United States). Concentrations were lower in the Southeast, where more denitrification occurs during transport of nitrogen compounds in shallow ground water. At urban sites, high concentrations of ammonia and orthophosphate were more prevalent downstream from wastewater-treatment plants. At sites with large watersheds and high mean-annual streamflow ('large-watershed' sites), concentrations of most nutrients were significantly less than at sites downstream from agricultural or urban areas. Total nitrogen concentrations at large-watershed sites were higher in Midwest agricultural areas and lower in the Western United States, where agricultural and urban development is less extensive. Total phosphorus concentrations at large-watershed sites were higher in areas of greater potential erosion and low overall runoff such as the arid areas in the West. Although not as distinct as seasonal patterns of streamflow, geographic patterns of seasonally high and low concentrations of total nitrogen and total phosphorus were identified in the data. Seasonal patterns in concentrations of total nitrogen generally mirror seasonal patterns in streamflow in the humid Eastern United States but are inverse to seasonal patterns in streamflow in the semiarid interior West. Total phosphorus concentrations typically have the opposite regional relation with streamflow; high concentrations coincide with high streamflows in the interior West. In the NAWQA Program, sites downstream from relatively undeveloped areas were selected to provide a baseline for comparison to sites with potential effects of urban development and agriculture. Concentrations of nitrate, total nitrogen, and total phosphorus at NAWQA undeveloped sites were found to be greater than values reported by other studies for conditions of essentially no development (background conditions). Concentrations at NAWQA undeveloped sites represent conditions

Reservoirs override seasonal variability of phytoplankton communities in a regulated Mediterranean river.

PubMed

Tornés, E; Pérez, M C; Durán, C; Sabater, S

2014-03-15

Water hydrology, temperature and transparency, as well as nutrient retention downstream of the reservoirs alter the temporal and spatial distribution patterns of phytoplankton communities in regulated rivers. The seasonal dynamics of phytoplankton communities in the Ebro was analysed in contrasting water flow periods in sections upstream and downstream of three large reservoirs, as well as in an intermediate site. Phytoplankton communities changed in response to seasonal variations in the areas not influenced by the reservoirs, but the phytoplankton distribution downstream of the reservoirs was driven by their particular hydrodynamics. The change in environmental conditions promoted by reservoirs influenced the pattern of replacement between diatoms and green algae of the upstream section. Differences in the phytoplankton community structure, abundance and environmental variables between upstream and downstream sites were maximal during low flow periods. Chlorophytes and dinoflagellates were present during low flow periods upstream of the reservoirs and in the intermediate site. Cocconeis cf. placentula characterized the downstream section, associated to the presence of macrophytes in that section. The present study sheds light on the consequences of river regulation under potential scenarios of climate change, and results could be used to anticipate ecological problems in large regulated rivers under these circumstances. Copyright © 2013 Elsevier B.V. All rights reserved.

Responses of riparian reptile communities to damming and urbanization

USGS Publications Warehouse

Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.

2013-01-01

Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.

Analysis of ambient conditions and simulation of hydrodynamics and water-quality characteristics in Beaver Lake, Arkansas, 2001 through 2003

USGS Publications Warehouse

Galloway, Joel M.; Green, W. Reed

2006-01-01

Beaver Lake is a large, deep-storage reservoir located in the upper White River Basin in northwestern Arkansas. The purpose of this report is to describe the ambient hydrologic and water-quality conditions in Beaver Lake and its inflows and describe a two-dimensional model developed to simulate the hydrodynamics and water quality of Beaver Lake from 2001 through 2003. Water-quality samples were collected at the three main inflows to Beaver Lake; the White River near Fayetteville, Richland Creek at Goshen, and War Eagle Creek near Hindsville. Nutrient concentrations varied among the tributaries because of land use and contributions of nutrients from point sources. The median concentrations of total ammonia plus organic nitrogen were greater for the White River than Richland and War Eagle Creeks. The greatest concentrations of nitrite plus nitrate and total nitrogen, however, were observed at War Eagle Creek. Phosphorus concentrations were relatively low, with orthophosphorus and dissolved phosphorus concentrations mostly below the laboratory reporting limit at the three sites. War Eagle Creek had significantly greater median orthophosphorus and total phosphorus concentrations than the White River and Richland Creek. Dissolved organic-carbon concentrations were significantly greater at the White River than at War Eagle and Richland Creeks. The White River also had significantly greater turbidity than War Eagle Creek and Richland Creek. The temperature distribution in Beaver Lake exhibits the typical seasonal cycle of lakes and reservoirs located within similar latitudes. Beaver Lake is a monomictic system, in which thermal stratification occurs annually during the summer and fall and complete mixing occurs in the winter. Isothermal conditions exist throughout the winter and early spring. Nitrogen concentrations varied temporally, longitudinally, and vertically in Beaver Lake for 2001 through 2003. Nitrite plus nitrate concentrations generally decreased from the upstream portion of Beaver Lake to the downstream portion and generally were greater in the hypolimnion. Total ammonia plus organic nitrogen concentrations also decreased from the upstream end of Beaver Lake to the downstream end and were substantially greater in the hypolimnion of Beaver Lake. Phosphorus concentrations mostly were near or below laboratory detection limits in the epilimnion and metalimnion in Beaver Lake and were substantially greater in the hypolimnion in the upstream and middle parts of the reservoir. Measured total and dissolved organic carbon in Beaver Lake was relatively uniform spatially, longitudinally, and vertically in the reservoir from January 2001 through December 2003. Chlorophyll a concentrations measured at sites in the upstream portion of the lake were significantly greater than at the other sites in the downstream portion of Beaver Lake. During the study period, water clarity in Beaver Lake was significantly greater at the downstream end of the reservoir than at the upstream end. The greatest Secchi depths at the downstream end of the reservoir generally were observed in 2001 compared to 2002 and 2003, but did not have a seasonal pattern as observed at sites in the middle and upstream portion of the reservoir. Similar to Secchi depth results, turbidity results indicated greater water clarity in the downstream portion of Beaver Lake compared to the upstream portion. Turbidity also was greater in the hypolimnion than in the epilimnion in the reservoir during the stratification season. A two-dimensional, laterally averaged, hydrodynamic, and water-quality model using CE-QUAL-W2 Version 3.1 was developed for Beaver Lake and calibrated based on vertical profiles of temperature and dissolved oxygen, and water-quality constituent concentrations collected at various depths at four sites in the reservoir from April 2001 to April 2003. Simulated temperatures and dissolved-oxygen concentrations compared reasonably well with measured t

Barrage fishponds: Reduction of pesticide concentration peaks and associated risk of adverse ecological effects in headwater streams.

PubMed

Gaillard, Juliette; Thomas, Marielle; Iuretig, Alain; Pallez, Christelle; Feidt, Cyril; Dauchy, Xavier; Banas, Damien

2016-03-15

Constructed wetlands have been suggested as pesticide risk mitigation measures. Yet, in many agricultural areas, ponds or shallow lakes are already present and may contribute to the control of non-point source contamination by pesticides. In order to test this hypothesis, we investigated the influence of extensively managed barrage fishponds (n = 3) on the dissolved concentrations of 100 pesticides in headwater streams over the course of a year. Among the 100 pesticides, 50 different substances were detected upstream and 48 downstream. Highest measured concentration upstream was 26.5 μg/L (2-methyl-4-chlorophenoxyacetic acid, MCPA) and 5.19 μg/L (isoproturon) downstream. Fishponds were found to reduce peak exposure levels as high pesticide concentrations (defined here as ≥ 1 μg/L) generally decreased by more than 90% between upstream and downstream sampling sites. The measured concentrations in the investigated streams were compared to laboratory toxicity data for standard test organisms (algae, invertebrates and fish) using the toxic unit approach. When considering the threshold levels set by the European Union within the first tier risk assessment procedure for pesticide registration (commission regulation (EU) N° 546/2011), regulatory threshold exceedances were observed for 22 pesticides upstream from fishponds and for 9 pesticides downstream. Therefore, the investigated barrage fishponds contributed to the reduction of pesticide peak concentrations and potential risk of adverse effects for downstream ecosystems. Copyright © 2016 Elsevier Ltd. All rights reserved.

Quality of water and bed material in streams of Logan Township, Gloucester County, New Jersey, 1984

USGS Publications Warehouse

Hochreiter, J.J.; Kozinski, Jane

1985-01-01

The surface water and surficial-bed material at seven stations on three streams in Logan Township, Gloucester County, New Jersey, were sampled in the fall of 1984. Samples of water were analyzed for volatile organic compounds, trace metals, and organochlorine and organophosphorous compounds. Surficial-bed material was analyzed for extractable trace metals and organochlorine compounds. Water samples from two closely spaced sampling locations along Raccoon Creek contained elevated concentrations of methylene chloride (455 and 1800 micrograms/L, respectively), a volatile organic solvent. Bed-material samples taken from Little Timber and Birch Creeks contained elevated levels of trace metals and organochlorine compounds, including polychlorinated biphenyls (PCB's). Contaminant concentrations in bed-material samples taken from Raccoon Creek were much lower than those found previously by the U.S. Geological Survey in 1980. Only a trace of PCB 's was detected in any bed material sample taken from Racoon Creek. Gas chromatographic flame-ionization detector scans, performed on solvent extracts of all water and sediment samples, were useful in characterizing the presence or absence of organic contaminants in those samples. Changes in the character of organic contamination along the reaches of two streams were apparent when the fingerprints of chromatograms representing upstream sites were compared to those representing downstream sites. (Author 's abstract)

Effects of Highway Road Salting on the Water Quality of Selected Streams in Chittenden County, Vermont, November 2005-2007

USGS Publications Warehouse

Denner, Jon C.; Clark, Stewart F.; Smith, Thor E.; Medalie, Laura

2010-01-01

A study of road-deicing chloride (Cl) concentrations and loads was conducted at three streams in Chittenden County, VT, from November 2005 to 2007. This study was done by the U.S. Geological Survey, in cooperation with the Vermont Agency of Transportation. The streams, Alder Brook, Allen Brook, and Mill Brook, were selected to represent different land uses in the upstream watershed, different road types and densities, and different geometric patterns of the roadway draining to the receiving stream to assess the relative contribution of and differences in state road-salt applications to stream Cl concentrations and loads. Water-quality samples were collected and specific conductance was measured continuously at paired stations upstream and downstream from State highways and related to Cl concentrations to assist in determining the effects of road-salting operations during winter maintenance on the levels of Cl in the streams. Mean concentrations of Cl ranged from 8.2 to 72 mg/L (milligrams per liter) in the water-quality samples collected at sampling stations upstream from State highway bridges and from 7.9 to 80 mg/L in those collected at sampling stations downstream of highway bridges. Mean Cl loads ranged from 1,100 to 4,090 lb/d (pounds per day) at upstream stations and from 1,110 to 4,200 lb/d at downstream stations. Estimated mean annual Cl loads ranged from 402,000 to 1,490,000 lb/yr (pounds per year) at upstream stations and from 405,000 to 1,530,000 lb/yr at downstream stations. Mean Cl concentrations in samples collected at the three paired stations were lowest at Mill Brook at VT 117 near Essex Junction, VT (7.9 mg/L) and highest at Allen Brook at VT 2A near Essex Junction, VT (80.7 mg/L). None of the monitored Cl concentrations in the water-quality samples collected at the three paired sampling stations exceeded either of the U.S. Environmental Protection Agency's (USEPA) recommended chronic and acute Cl toxicity criteria of 230 and 860 mg/L, respectively. A fourth stream site, a small tributary draining to Alder Brook between the upstream and downstream stations, was monitored from December 2006 to November 2007. This tributary collected runoff from a state highway and an interchange before flowing through a wetlands retention basin. The mean Cl concentration in water-quality samples collected at the tributary was 449 mg/L. The USEPA recommended chronic toxicity criterion of 230 mg/L was exceeded about 65 percent of the monitoring period. The USEPA recommended acute toxicity criterion of 860 mg/L was not exceeded. Estimated Cl loads below the State highway bridges exceeded loads above the bridges at all three paired stations during both years of the study. The differences in the annual loads between the upstream and downstream stations were 0.7, 3.0 and 14 percent at Mill, Allen, and Alder Brooks, respectively. Almost all of the difference (92 percent) at Alder Brook was due to the tributary. Cl applied by the State of Vermont for deicing purposes represented less than 20 percent of the annual estimated Cl load in all 3 streams below the state highways. The highest monthly Cl loads during the first year of the study were observed in January 2006 at all three stream stations because of an early snowmelt event. The highest monthly Cl loads during the second year of the study were observed in April 2007 at all three streams during spring snowmelt and were followed by decrease in Cl loading through the summer. Generally, the relation of Cl loads to runoff was similar at all three streams. In July and October 2007, loads increased slightly with an increase in runoff, indicating that Cl in the soils and groundwater may be contributing to the Cl levels during the summer and fall, well after the road-salting season. Cl loads in all three streams appear to be due primarily to sources in the watersheds upstream of the state highway bridge where road salt was applied and (or) Cl retained in soils and streambed

Concentrations and transport of atrazine in the Delaware River-Perry Lake system, northeast Kansas, July 1993 through September 1995

USGS Publications Warehouse

Pope, L.M.; Brewer, L.D.; Foley, G.A.; Morgan, S.C.

1996-01-01

A study of the distribution and transport of atrazine in surface water in the 1,117 square-mile Delaware River Basin in northeast Kansas was conducted from July 1992 through September 1995. The purpose of this report is to present information to assess the present (1992-95) conditions and possible future changes in the distribution and magnitude of atrazine concentrations, loads, and yields spatially, temporally, and in relation to hydrologic conditions and land-use characteristics. A network of 11 stream-monitoring and sample-collection sites was established within the basin. Stream- water samples were collected during a wide range of hydrologic conditions throughout the study. Nearly 5,000 samples were analyzed by enzyme- linked immunosorbent assay (ELISA) for triazine herbicide concentrations. Daily mean triazine herbicide concentrations were calculated for all sampling sites and subsequently used to estimate daily mean atrazine concentrations with a linear- regression relation between ELISA-derived triazine concentrations and atrazine concentrations determined by gas chromatography/mass spectrometry for 141 dual-analyzed surface-water samples. During May, June, and July, time-weighted, daily mean atrazine concentrations in streams in the Delaware River Basin commonly exceeded the value of 3.0-ug/L (micrograms per liter) annual mean Maximum Contaminant Level (MCL) established by the U.S. Environmental Protection Agency for drinking-water supplies. Time-weighted, daily mean concentrations equal to or greater than 20 ug/L were not uncommon. However, most time- weighted, daily mean concentrations were less than 1.0 ug/L from August through April. The largest time-weighted, monthly mean atrazine concentrations occurred during May, June, and July. Most monthly mean concentrations between August and April were less than 0.50 ug/L. Large differences were documented in monthly mean concentrations within the basin. Sites receiving runoff from the northern and northeastern parts of the Delaware River Basin had the largest monthly and annual mean atrazine concentrations. Time- weighted, annual mean atrazine concentrations did not exceed the MCL in water from any sampling site for either the 1993 or 1994 crop years (April-March); however, concentrations were during 1994 than during 1993. Time-weighted, annual mean concentrations in water from among the 11 sampling sites during the 1993 crop year ranged from 0.27 to 1.5 ug/L and from 0.36 to 2.8 ug/L during the 1994 crop year. Furthermore, concentrations in samples from the outflow of Perry Lake were larger during the first 6 months of the 1995 crop year than during the previous year. Flow-weighted, annual mean atrazine concentrations were larger than time-weighted, annual mean concentrations in water from all sampling sites upstream of Perry Lake, and samples from several sites had concentrations were substantially larger than the MCL. This difference explained why time-weighted, annual mean concentrations in the outflow of Perry Lake were larger than corresponding time-weighted concentrations in water from sampling sites upstream of Perry Lake. Flow- weighted, annual mean concentrations in water from among the 11 sampling sites during the 1993 crop year ranged from 1.0 to 4.4 ug/L and from 1.0 to 8.9 ug/L during the 1994 crop year. Statistically significant linear-regression equations were identified relating the percentage of subbasin in cropland to time- and flow-weighted, average annual mean atrazine concentrations. The relations indicate that time-weighted, average annual mean atrazine concentrations may not exceed the MCL in water from subbasins with at least about 70-percent cropland. However, flow-weighted, average annual mean atrazine concentrations may exceed the MCL when the percentage of cropland is greater than about 40 percent. Approximately 90 percent of the annual atrazine load is transport from May through July. Atrazine loads and yields were larger during the 1993 cro

Biological assessment and streambed-sediment chemistry of streams in the Indianapolis metropolitan area, Indiana, 2003–2008

USGS Publications Warehouse

Voelker, David C.

2012-01-01

During 2003–2008, the U.S. Geological Survey sampled 13 sites in the Indianapolis metropolitan area in Indiana for benthic invertebrates, fish communities, and streambed-sediment chemistry. Data from seven White River sites and six tributary sites complement surface-water chemistry data collected by the Indianapolis Department of Public Works. The information is being used to assess changes in water quality in conjunction with the City's programs to reduce combined sewer overflows and other point and nonpoint sources of pollution in the Indianapolis area. During the study, 233 benthic-invertebrate taxa were identified from which the Ephemeroptera, Plecoptera, and Trichoptera (EPT) Index, the Hilsenhoff Biotic Index (HBI), and the Invertebrate Community Index (ICI) were calculated. EPT index scores ranged from 2 to 16 on the White River and from 2 to 17 on the tributaries. EPT index scores indicate that these pollution-intolerant taxa are more prevalent upstream from and away from the combined-sewer areas of Indianapolis. HBI scores from sites on the White River ranged from 4.67 (good) to 9.55 (very poor), whereas on the tributaries, scores ranged from 4.21 (very good) to 8.14 (poor). Lower HBI scores suggest that less organic pollution was present and, like the EPT scores, indicate better conditions where combined-sewer overflows (CSOs) are not present. Similarly, ICI scores indicated better conditions upstream from the CSO outfalls on the White River. White River scores ranged from 12 to 46, where higher ICI scores indicate better conditions in the benthic-invertebrate community. ICI scores at the tributary sites ranged from 12 to 52, with the highest scores on streams without CSOs.

Determination of heavy metal contents in water, sediments, and fish tissues of Shizothorax plagiostomus in river Panjkora at Lower Dir, Khyber Pakhtunkhwa, Pakistan.

PubMed

Ahmad, Kabir; Azizullah, Azizullah; Shama, Shama; Khattak, Muhammad Nasir Khan

2014-11-01

The present study was conducted to investigate the contamination of water, sediments, and fish tissues with heavy metals in river Panjkora at Lower Dir, Khyber Pakhtunkhwa, Pakistan. Water, sediments, and fish (Shizothorax plagiostomus) samples were collected from September 2012 to January 2013 at three different sites (upstream site at Sharigut, sewage site at Timergara, and downstream site at Sadoo) of river Panjkora. The concentrations of heavy metals in water were in the order Zn > Cu ≈ Pb > Ni ≈ Cd with mean values of 0.30, 0.01, 0.01, 0.0 and 0.0 mg/l, respectively, which were below the maximum permissible limits of WHO for drinking water. In sediments, heavy metals were found in the order Cu > Zn > Ni > Pb > Cd with mean concentrations of 50.6, 38.7, 9.3, 8, and 0.4 mg/kg, respectively. Ni and Cd were not found in any fish tissues, but Zn, Cu, and Pb were detected with the mean concentration ranges of 0.04-1.19, 0.03-0.12, and 0.01-0.09 μg/g, respectively. The present study demonstrates that disposal of waste effluents causes a slight increase in the concentration of heavy metals in river Panjkora as revealed by variation in metal concentrations from upstream to downstream site. Sewage disposal was also found to change physicochemical characteristics of Panjkora water. At present, water and fish of river Panjkora are safe for human consumption, but the continuous sewage disposal may create problems in the future.

Microbial Community Response to Carbon Substrate Amendment in Mercury Impacted Sediments: Implications on Microbial Methylation of Mercury.

NASA Astrophysics Data System (ADS)

Elias, D. A.; Somenahally, A. C.; Moberly, J. G.; Hurt, R. A., Jr.; Brown, S. D.; Podar, M.; Palumbo, A. V.; Gilmour, C. C.

2015-12-01

Methylmercury (MeHg) is a neurotoxic and bio-accumulative product of the microbial methylation of inorganic mercury (Hg(II)). Methylating organisms are now known to exist in almost all anaerobic niches including fermentation, Fe(III)- and sulfate- reduction as well as methanogenesis. The study objective was to determine the effect of different carbon sources on the microbial community and methylating populations in particular along a Hg contaminated creek. Sediment cores from upstream and downstream at the Hg contaminated East Fork Poplar Creek (EFPC), Oak Ridge TN, and a background site were sectioned by depth, and Hg-methylation potential (HgMP) assays were performed using stable isotope spikes. Sediments from the lowest depth possessed the highest in-situ activity. Replicate samples were amended with different carbon substrates (cellulose, acetate, propionate, lactate, ethanol and methanol), spiked with stable isotopes for HgMP assays and incubated for 24hrs. Sequencing of the 16S rRNA gene was performed to determine alterations in Bacterial and Archaeal population dynamics. Additionally, bioinformatics and our new qualitative and quantitative hgcAB primers were utilized to determine microbial community structure alterations and correlate organism and gene abundance with altered MeHg generation. HgMP was significantly reduced in cellulose amended sediments while acetate and propionate slightly decreased HgMP in both sites. Methanol, ethanol and lactate increased the HgMP in EFPC downstream while cellulose amendment significantly decreased the Proteobacteria, and the Firmicutes increased but none are currently known to produce MeHg. Geobacter bemidjiensis in particular significantly decreased in cellulose amended sediments in all three sites from being predominant in-situ. This suggests that in EFPC downstream and background sites, the prevalent Hg-methyaltors might be Deltaprotebacteria, since upstream, cellulose amendment did not reduce HgMP even though relative composition of Deltaproteobacteria decreased significantly. Hence the phylogenetic distribution of Hg-methylating bacteria upstream may be much broader. Most Archaea belonged to either Euryarchaeota or Crenarchaeota, but there were no consistent trends with specific groups among the treatments.

Effect of wastewater treatment facility closure on endocrine disrupting chemicals in a Coastal Plain stream

USGS Publications Warehouse

Bradley, Paul M.; Journey, Celeste A.; Clark, Jimmy M.

2016-01-01

Wastewater treatment facility (WWTF) closures are rare environmental remediation events; offering unique insight into contaminant persistence, long-term wastewater impacts, and ecosystem recovery processes. The U.S. Geological Survey assessed the fate of select endocrine disrupting chemicals (EDC) in surface water and streambed sediment one year before and one year after closure of a long-term WWTF located within the Spirit Creek watershed at Fort Gordon, Georgia. Sample sites included a WWTF-effluent control located upstream from the outfall, three downstream effluent-impacted sites located between the outfall and Spirit Lake, and one downstream from the lake's outfall. Prior to closure, the 2.2-km stream segment downstream from the WWTF outfall was characterized by EDC concentrations significantly higher (α = 0.05) than at the control site; indicating substantial downstream transport and limited in-stream attenuation of EDC, including pharmaceuticals, estrogens, alkylphenol ethoxylate (APE) metabolites, and organophosphate flame retardants (OPFR). Wastewater-derived pharmaceutical, APE metabolites, and OPFR compounds were also detected in the outflow of Spirit Lake, indicating the potential for EDC transport to aquatic ecosystems downstream of Fort Gordon under effluent discharge conditions. After the WWTF closure, no significant differences in concentrations or numbers of detected EDC compounds were observed between control and downstream locations. The results indicated EDC pseudo-persistence under preclosure, continuous supply conditions, with rapid attenuation following WWTF closure. Low concentrations of EDC at the control site throughout the study and comparable concentrations in downstream locations after WWTF closure indicated additional, continuing, upstream contaminant sources within the Spirit Creek watershed. 

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

An assessment of stream water quality of the Rio San Juan, Nuevo Leon, Mexico, 1995-1996.

PubMed

Flores Laureano, José Santos; Návar, José

2002-01-01

Good water quality of the Rio San Juan is critical for economic development of northeastern Mexico. However, water quality of the river has rapidly degraded during the last few decades. Societal concerns include indications of contamination problems and increased water diversions for agriculture, residential, and industrial water supplies. Eight sampling sites were selected along the river where water samples were collected monthly for 10 mo (October 1995-July 1996). The concentration of heavy metals and chemical constituents and measurements of bacteriological and physical parameters were determined on water samples. In addition, river discharge was recorded. Constituent concentrations in 18.7% of all samples exceeded at least one water quality standard. In particular, concentrations of fecal and total coliform bacteria, sulfate, detergent, dissolved solids, Al, Ba, Cr, Fe, and Cd, exceeded several water quality standards. Pollution showed spatial and temporal variations and trends. These variations were statistically explained by spatial and temporal changes of constituent inputs and discharge. Samples collected from the site upstream of El Cuchillo reservoir had large constituent concentrations when discharge was small; this reservoir supplies domestic and industrial water to the city of Monterrey.

Water-quality, discharge, and biologic data for streams and springs in the Highland Rim Escarpment of southeastern Bedford County, Tennessee

USGS Publications Warehouse

Hollyday, E.F.; Byl, T.D.

1995-01-01

From November 1994 through April 1995, streams and springs in 9 drainage basins were observed and sampled at 176 sites to obtain information on environmental quality near the Quail Hollow landfill, Bedford County, Tennessee. Reconnaissance data were collected to establish a regional pattern. Water samples from 26 seepage sites were analyzed to determine water-quality conditions. During the reconnaissance, conductivity ranged regionally from 17 to 617 microsiemens per centimeter. The greatest biologic diversity was in Bennett Branch, followed by Daniel Hollow, Prince, Powell and Renegar, County Line, and Anthony Branches, Hurricane Creek, and Anderton Branch, respectively. In general, conductivity was less than 50 microsiemens per centimeter at and upstream of the Chattanooga Shale but increased downstream to between 200 and 300 microsiemens per centimeter. Of the constituents and properties analyzed, only pH and four metals at six sites had values that were not within the limits set by the State of Tennessee for drinking water. Chloride and dissolved manganese concentrations were highest for a spring and a seep adjacent to the landfill. Scans indicated the presence of about 37 unidentified organic compounds at these same two sites.

Assessment of water quality, benthic invertebrates, and periphyton in the Threemile Creek basin, Mobile, Alabama, 1999-2003

USGS Publications Warehouse

McPherson, Ann K.; Gill, Amy C.; Moreland, Richard S.

2005-01-01

The U.S. Geological Survey conducted a 4-year investigation of water quality and aquatic-community structure in Threemile Creek, an urban stream that drains residential areas in Mobile, Alabama. Water-quality samples were collected between March 2000 and September 2003 at four sites on Threemile Creek, and between March 2000 and October 2001 at two tributary sites that drain heavily urbanized areas in the watershed. Stream samples were analyzed for major ions, nutrients, fecal-indicator bacteria, and selected organic wastewater compounds. Continuous measurements of dissolved-oxygen concentrations, water temperature, specific conductance, and turbidity were recorded at three sites on Threemile Creek during 1999?2003. Aquatic-community structure was evaluated by conducting one survey of the benthic invertebrate community and multiple surveys of the algal community (periphyton). Benthic invertebrate samples were collected in July 2000 at four sites on Threemile Creek; periphyton samples were collected at four sites on Threemile Creek and the two tributary sites during 2000 ?2003. The occurrence and distribution of chemical constituents in the water column provided an initial assessment of water quality in the streams; the structure of the benthic invertebrate and algal communities provided an indication of the cumulative effects of water quality on the aquatic biota. Information contained in this report can be used by planners and resource managers in the evaluation of proposed total maximum daily loads and other restoration efforts that may be implemented on Threemile Creek. The three most upstream sites on Threemile Creek had similar water chemistry, characterized by a strong calcium-bicarbonate component; the most downstream site on Threemile Creek was affected by tidal fluctuations and mixing from Mobile Bay and had a strong sodium-chloride component. The water chemistry at the tributary site on Center Street was characterized by a strong sodium-chloride component; the water chemistry at the second tributary site, Toulmins Spring Branch, was characterized by a strong calcium component without a dominant anionic species. The ratios of sodium to chloride at the tributary at Center Street were higher than typical values for seawater, indicating that sources other than seawater (such as leaking or overflowing sewer systems or industrial discharge) likely are contributors to the increased levels of sodium and chloride. Concentrations of fluoride and boron also were elevated at this site, indicating possible anthropogenic sources. Dissolved-oxygen concentrations were not always within levels established by the Alabama Department of Environmental Management; continuous monitors recorded dissolved-oxygen concentrations that were repeatedly less than the minimum criterion (3.0 milligrams per liter) at the most downstream site on Threemile Creek. Water temperature exceeded the recommended criterion (32.2 degrees Celsius) at five of six sites in the Threemile Creek basin. The pH values were within established criteria (6.0 ? 8.5) at sites on Threemile Creek; however, pH values ranged from 7.2 to 10.0 at the tributary at Center Street and from 6.6 to 9.9 at Toulmins Spring Branch. Nutrient concentrations in the Threemile Creek basin reflect the influences of both land use and the complex hydrologic systems in the lower part of the basin. Nitrite-plus-nitrate concentrations exceeded U.S. Environmental Protection Agency ecoregion nutrient criteria in 88 percent of the samples. In 45 percent of the samples, total phosphorus concentrations exceeded the U.S. Environmental Protection Agency goal of 0.1 milligram per liter for preventing nuisance aquatic growth. Ratios of nitrogen to phosphorus indicate that both nutrients have limiting effects. Median concentrations of enterococci and fecal coliform bacteria were highest at the two tributary sites and lowest at the most upstream site on Threemile Creek. In general, concentrations o

Eco-Design of River Fishways for Upstream Passage: Application for Hanfeng Dam, Pengxi River, China

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Gary E.; Rainey, William S.

2012-05-20

This paper provides a scientific approach to eco-design of river fishways to allow upstream movement of fish past new and existing dams in China. This eco-design approach integrates principles of fish ecology/behavior and engineering, a scientific field also known as bio-engineering or eco-hydraulics. We define a fishway as a structure or mechanism to convey fish upstream past a dam. Man-made or natural stream beds can be part of the fishway mechanism. Fish include bony and non-bony fishes, and upstream passage is the concern here, not downstream passage. The problem is dams block access to upstream habitat used for spawning, rearing,more » and refuge, i.e., dams decrease habitat connectivity. A solution to alleviate this problem is to design fishways, preferably while the dam is being designed, but if necessary, as retrofits afterward to provide a route that fish can and will use to pass safely upstream without undue delay. Our eco-design approach for fishways involves eight steps: 1) identify the primary species of importance; 2) understand basic ecology and behavior of these fish; 3) characterize the environmental conditions where passage is or will be blocked; 4 identify fishway alternatives and select a preferred alternative; 5) establish eco-design criteria for the fishway, either from management agencies or, if necessary, developed specifically for the given site; 6) where needed, identify and perform research required to resolve critical uncertainties and finalize the eco-design criteria; 7) apply the eco-design criteria and site-specific considerations to design the fishway, involving peer-review by local stakeholders in the process; 8) build the fishway, monitor its effectiveness, and apply the lessons learned. Example fishways are described showing a range of eco-designs depending on the dam site and fish species of concern. We apply the eco-design principles to recommend an approach and next steps for a fishway to pass fish upstream at Hanfeng Dam, an existing regulating dam forming Hanfeng Lake on the Pengxi River near Kaixian, China.« less

Assessment of aquatic macroinvertebrate communities in the Autauga Creek watershed, Autauga County, Alabama, 2009

USGS Publications Warehouse

Mooty, Will S.; Gill, Amy C.

2011-01-01

Only four families within the Ephemeroptera, Plecoptera, and Trichoptera orders were found during a 1999 survey of aquatic macroinvertebrates in Autauga Creek, Autauga County, Alabama, by the Alabama Department of Environmental Management. The low number of taxa of Ephemeroptera, Plecoptera, and Trichoptera families indicated that the aquatic macroinvertebrate community was in poor condition, and the creek was placed on the Alabama Department of Environmental Management 303(d) list. The U.S. Geological Survey conducted a study in 2009 to provide data for the Alabama Department of Environmental Management and other water management agencies to re-evaluate aquatic macroinvertebrate communities in Autauga Creek to see if they meet Alabama Department of Environmental Management water-quality criteria. Aquatic macroinvertebrate communities were evaluated at three sites in the Autauga Creek watershed. Macroinvertebrates were sampled at two sites on Autauga Creek and one on Bridge Creek, the largest tributary to Autauga Creek. Water-quality field parameters were assessed at 11 sites. During the 2009 sampling, 12 families within the orders of Ephemeroptera, Plecoptera, Trichoptera were found at the Alabama Department of Environmental Management's assessment site whereas only four were found in 1999. The upstream site on Autauga Creek had consistently higher numbers of taxa than the Bridge Creek site and the lower site on Autauga Creek which is the Alabama Department of Environmental Management's assessment site. Chironomid richness was noticeably higher on the two Autauga Creek sites than the Bridge Creek site.

Metals transport in the Sacramento River, California, 1996-1997; Volume 2: Interpretation of metal loads

USGS Publications Warehouse

Alpers, Charles N.; Antweiler, Ronald C.; Taylor, Howard E.; Dileanis, Peter D.; Domagalski, Joseph L.

2000-01-01

Metals transport in the Sacramento River, northern California, from July 1996 to June 1997 was evaluated in terms of metal loads from samples of water and suspended colloids that were collected on up to six occasions at 13 sites in the Sacramento River Basin. Four of the sampling periods (July, September, and November 1996; and May-June 1997) took place during relatively low-flow conditions and two sampling periods (December 1996 and January 1997) took place during high-flow and flooding conditions, respectively. This study focused primarily on loads of cadmium, copper, lead, and zinc, with secondary emphasis on loads of aluminum, iron, and mercury.Trace metals in acid mine drainage from abandoned and inactive base-metal mines, in the East and West Shasta mining districts, enter the Sacramento River system in predominantly dissolved form into both Shasta Lake and Keswick Reservoir. The proportion of trace metals that was dissolved (as opposed to colloidal) in samples collected at Shasta and Keswick dams decreased in the order zinc ≈ cadmium > copper > lead. At four sampling sites on the Sacramento River--71, 256, 360, and 412 kilometers downstream of Keswick Dam--trace-metal loads were predominantly colloidal during both high- and low-flow conditions. The proportion of total cadmium, copper, lead, and zinc loads transported to San Francisco Bay and the Sacramento-San Joaquin Delta estuary (referred to as the Bay-Delta) that is associated with mineralized areas was estimated by dividing loads at Keswick Dam by loads 412 kilometers downstream at Freeport and the Yolo Bypass. During moderately high flows in December 1996, mineralization-related total (dissolved + colloidal) trace-metal loads to the Bay-Delta (as a percentage of total loads measured downstream) were cadmium, 87 percent; copper, 35 percent; lead, 10 percent; and zinc, 51 percent. During flood conditions in January 1997 loads were cadmium, 22 percent; copper, 11 percent; lead, 2 percent; and zinc, 15 percent. During irrigation drainage season from rice fields (May-June 1997) loads were cadmium, 53 percent; copper, 42 percent; lead, 20 percent; and zinc, 75 percent. These estimates must be qualified by the following factors: (1) metal loads at Colusa in December 1996 and at Verona in May-June 1997 generally exceeded those determined at Freeport during those sampling periods. Therefore, the above percentages represent maximum estimates of the apparent total proportion of metals from mineralized areas upstream of Keswick Dam; and (2) for logistics reasons, the Sacramento River was sampled at Tower Bridge instead of at Freeport during January 1997.Available data suggest that trace metal loads from agricultural drainage may be significant during certain flow conditions in areas where metals such as copper and zinc are added as agricultural amendments. Copper loads for sampling periods in July and September 1996 and in May-June 1997 show increases of dissolved and colloidal copper and in colloidal zinc between Colusa and Verona, the reach of the Sacramento River along which the Colusa Basin Drain, the Sacramento Slough, and other agricultural return flows are tributaries. Monthly sampling of these two agricultural drains by the USGS National Water-Quality Assessment Program shows seasonal variations in metal concentrations, reaching maximum concentrations of 4 to 6 micrograms per liter in "dissolved" (0.45-micrometer filtrate) copper concentrations in May 1996, December 1996, and June 1997. The total (dissolved plus colloidal) load of copper from the Colusa Basin Drain in June 1997 was 18 kilograms per day, whereas the copper load in Spring Creek, which drains the inactive mines on Iron Mountain, was 20 kilograms per day during the same sampling period. For comparison, during the January 1997 flood, the copper load in Spring Creek was about 1,100 kilograms per day and the copper load in the Yolo Bypass was about 7,300 kilograms per day. The data clearly indicate that most copper and zinc loads during the January 1997 flood entered the Sacramento River upstream of Colusa, and upstream of the influence of the most intense agricultural drainage return flows in the Sacramento River watershed.This study has demonstrated that some trace metals of environmental significance (cadmium, copper, and zinc) in the Sacramento River are transported largely in dissolved form at upstream sites (below Shasta Dam, below Keswick Dam, and at Bend Bridge) proximal to the mineralized areas of the West Shasta and East Shasta mining districts. In contrast, these trace metals are transported largely in colloidal form at downstream sites (Colusa, Verona, Freeport, and Yolo Bypass). Aluminum, iron, and lead were observed to be transported predominantly in the colloidal phase at all mainstem Sacramento River sampling sites during all sampling periods in this study. Despite continuous water treatment, which has removed 85 to 90 percent of the cadmium, copper, and zinc from the mine drainage at Iron Mountain, Spring Creek remains a significant source of these metals to the Sacramento River system.

Investigation of water quality and aquatic-community structure in Village and Valley Creeks, City of Birmingham, Jefferson County, Alabama, 2000-01

USGS Publications Warehouse

McPherson, Ann K.; Abrahamsen, Thomas A.; Journey, Celeste A.

2002-01-01

The U.S. Geological Survey conducted a 16-month investigation of water quality, aquatic-community structure, bed sediment, and fish tissue in Village and Valley Creeks, two urban streams that drain areas of highly intensive residential, commercial, and industrial land use in Birmingham, Alabama. Water-quality data were collected between February 2000 and March 2001 at four sites on Village Creek, three sites on Valley Creek, and at two reference sites near Birmingham?Fivemile Creek and Little Cahaba River, both of which drain less-urbanized areas. Stream samples were analyzed for major ions, nutrients, fecal bacteria, trace and major elements, pesticides, and selected organic constituents. Bed-sediment and fish-tissue samples were analyzed for trace and major elements, pesticides, polychlorinated biphenyls, and additional organic compounds. Aquatic-community structure was evaluated by conducting one survey of the fish community and in-stream habitat and two surveys of the benthic-invertebrate community. Bed-sediment and fish-tissue samples, benthic-invertebrates, and habitat data were collected between June 2000 and October 2000 at six of the nine water-quality sites; fish communities were evaluated in April and May 2001 at the six sites where habitat and benthic-invertebrate data were collected. The occurrence and distribution of chemical constituents in the water column and bed sediment provided an initial assessment of water quality in the streams. The structure of the aquatic communities, the physical condition of the fish, and the chemical analyses of fish tissue provided an indication of the cumulative effects of water quality on the aquatic biota. Water chemistry was similar at all sites, characterized by strong calcium-bicarbonate component and magnesium components. Median concentrations of total nitrogen and total phosphorus were highest at the headwaters of Valley Creek and lowest at the reference site on Fivemile Creek. In Village Creek, median concentrations of nitrite and ammonia increased in a downstream direction. In Valley Creek, median concentrations of nitrate, nitrite, ammonia, organic nitrogen, suspended phosphorus, and orthophosphate decreased in a downstream direction. Median concentrations of Escherichia coli and fecal coliform bacteria were highest at the most upstream site of Valley Creek and lowest at the reference site on Fivemile Creek. Concentrations of enterococci exceeded the U.S. Environmental Protection Agency criterion in 80 percent of the samples; concentrations of Escherichia coli exceeded the criterion in 56 percent of the samples. Concentrations of bacteria at the downstream sites on Village and Valley Creeks were elevated during high flow rather than low flow, indicating the presence of nonpoint sources. Surface-water samples were analyzed for chemical compounds that are commonly found in wastewater and urban runoff. The median number of wastewater indicators was highest at the most upstream site on Valley Creek and lowest at the reference site on Fivemile Creek. Concentrations of total recoverable cadmium, copper, lead, and zinc in surface water exceeded acute and chronic aquatic life criteria in up to 24 percent of the samples that were analyzed for trace and major elements. High concentrations of trace and major elements in the water column were detected most frequently during high flow, indicating the presence of nonpoint sources. Of the 24 pesticides detected in surface water, 17 were herbicides and 7 were insecticides. Atrazine, simazine, and prometon were the most commonly detected herbicides; diazinon, chlorpyrifos, and carbaryl were the most commonly detected insecticides. Concentrations of atrazine, carbaryl, chlorpyrifos, diazinon, and malathion periodically exceeded criteria for the protection of aquatic life. Trace-element priority pollutants, pesticides, and other organic compounds were detected in higher concentrations in bed sediment at the Village and Valley Creek sites t

Effects of high salinity wastewater discharges on unionid mussels in the Allegheny River, Pennsylvania

USGS Publications Warehouse

Kathleen Patnode,; Hittle, Elizabeth A.; Robert Anderson,; Lora Zimmerman,; Fulton, John W.

2015-01-01

We examined the effect of high salinity wastewater (brine) from oil and natural gas drilling on freshwater mussels in the Allegheny River, Pennsylvania, during 2012. Mussel cages (N = 5 per site) were deployed at two sites upstream and four sites downstream of a brine treatment facility on the Allegheny River. Each cage contained 20 juvenile northern riffleshell mussels Epioblasma torulosa rangiana). Continuous specific conductance and temperature data were recorded by water quality probes deployed at each site. To measure the amount of mixing throughout the entire study area, specific conductance surveys were completed two times during low-flow conditions along transects from bank to bank that targeted upstream (reference) reaches, a municipal wastewater treatment plant discharge upstream of the brine-facility discharge, the brine facility, and downstream reaches. Specific conductance data indicated that high specific conductance water from the brine facility (4,000–12,000 µS/cm; mean 7,846) compared to the reference reach (103–188 µS/cm; mean 151) is carried along the left descending bank of the river and that dilution of the discharge via mixing does not occur until 0.5 mi (805 m) downstream. Juvenile northern riffleshell mussel survival was severely impaired within the high specific conductance zone (2 and 34% at and downstream of the brine facility, respectively) and at the municipal wastewater treatment plant (21%) compared to background (84%). We surveyed native mussels (family Unionidae) at 10 transects: 3 upstream, 3 within, and 4 downstream of the high specific conductance zone. Unionid mussel abundance and diversity were lower for all transects within and downstream of the high conductivity zone compared to upstream. The results of this study clearly demonstrate in situ toxicity to juvenile northern riffleshell mussels, a federally endangered species, and to the native unionid mussel assemblage located downstream of a brine discharge to the Allegheny River.

Effects of urbanization, construction activity, management practices, and impoundments on suspended-sediment transport in Johnson County, northeast Kansas, February 2006 through November 2008

USGS Publications Warehouse

Lee, Casey J.; Ziegler, Andrew C.

2010-01-01

The U.S. Geological Survey, in cooperation with the Johnson County, Kansas, Stormwater Management Program, investigated the effects of urbanization, construction activity, management practices, and impoundments on suspended-sediment transport in Johnson County from February 2006 through November 2008. Streamgages and continuous turbidity sensors were operated at 15 sites within the urbanizing 57-square-mile Mill Creek Basin, and 4 sites downstream from the other largest basins (49 to 66 square miles) in Johnson County. The largest sediment yields in Johnson County were observed downstream from basins with increased construction activity. Sediment yields attributed to the largest (68 acre) active construction site in the study area were 9,300 tons per square mile in 2007 and 12,200 tons per square mile in 2008; 5 to 55 times larger than yields observed at other sampling sites. However, given erodible soils and steep slopes at this site, sediment yields were relatively small compared to the range in historic values from construction sites without erosion and sediment controls in the United States (2,300 to 140,000 tons per square mile). Downstream from this construction site, a sediment forebay and wetland were constructed in series upstream from Shawnee Mission Lake, a 120-acre reservoir within Shawnee Mission Park. Although the original intent of the sediment forebay and constructed wetland were unrelated to upstream construction, they were nonetheless evaluated in 2008 to characterize sediment removal before stream entry into the lake. The sediment forebay was estimated to reduce 33 percent of sediment transported to the lake, whereas the wetland did not appear to decrease downstream sediment transport. Comparisons of time-series data and relations between turbidity and sediment concentration indicate that larger silt-sized particles were deposited within the sediment forebay, whereas smaller silt and clay-sized sediments were transported through the wetland and into the lake. Data collected at sites up and downstream from the constructed wetland indicated that hydraulic retention alone did not substantially reduce sediment loading to Shawnee Mission Lake. Mean-daily turbidity values at sampling sites downstream from basins with increased construction activity were compared to U.S. Environmental Protection Agency turbidity criteria designed to reduce discharge of pollutants from construction sites. The U.S. Environmental Protection Agency numeric turbidity criteria specifies that effluent from construction sites greater than 20 acres not exceed a mean-daily turbidity value of 280 nephelometric turbidity units beginning in 2011; this criteria will apply to sites greater than 10 acres beginning in 2014. Although numeric criteria would not have been applicable to data from sampling sites in Johnson County because they were not directly downstream from construction sites and because individual states still have to determine additional details as to how this criteria will be enforced, comparisons were made to characterize the potential of construction site effluent in Johnson County to exceed U.S. Environmental Protection Agency Criteria, even under extensive erosion and sediment controls. Numeric criteria were exceeded at sampling sites downstream from basins with increased construction activity for multiple days during the study period, potentially indicating the need for additional erosion and sediment controls and (or) treatment to bring discharges from construction sites into compliance with future numeric turbidity criteria. Among sampling sites in the Mill Creek Basin, sediment yields from the urbanizing Clear Creek Basin were approximately 2 to 3 times those from older, more stable urban or rural basins. Sediments eroded from construction sites adjacent to or surrounding streams appear to be more readily transported downstream, whereas sediments eroded from construction sites in headwater areas are more likely to

Water-quality conditions near the confluence of the Snake and Boise Rivers, Canyon County, Idaho

USGS Publications Warehouse

Wood, Molly S.; Etheridge, Alexandra

2011-01-01

Total Maximum Daily Loads (TMDLs) have been established under authority of the Federal Clean Water Act for the Snake River-Hells Canyon reach, on the border of Idaho and Oregon, to improve water quality and preserve beneficial uses such as public consumption, recreation, and aquatic habitat. The TMDL sets targets for seasonal average and annual maximum concentrations of chlorophyll-a at 14 and 30 micrograms per liter, respectively. To attain these conditions, the maximum total phosphorus concentration at the mouth of the Boise River in Idaho, a tributary to the Snake River, has been set at 0.07 milligrams per liter. However, interactions among chlorophyll-a, nutrients, and other key water-quality parameters that may affect beneficial uses in the Snake and Boise Rivers are unknown. In addition, contributions of nutrients and chlorophyll-a loads from the Boise River to the Snake River have not been fully characterized. To evaluate seasonal trends and relations among nutrients and other water-quality parameters in the Boise and Snake Rivers, a comprehensive monitoring program was conducted near their confluence in water years (WY) 2009 and 2010. The study also provided information on the relative contribution of nutrient and sediment loads from the Boise River to the Snake River, which has an effect on water-quality conditions in downstream reservoirs. State and site-specific water-quality standards, in addition to those that relate to the Snake River-Hells Canyon TMDL, have been established to protect beneficial uses in both rivers. Measured water-quality conditions in WY2009 and WY2010 exceeded these targets at one or more sites for the following constituents: water temperature, total phosphorus concentrations, total phosphorus loads, dissolved oxygen concentration, pH, and chlorophyll-a concentrations (WY2009 only). All measured total phosphorus concentrations in the Boise River near Parma exceeded the seasonal target of 0.07 milligram per liter. Data collected during the study show seasonal differences in all measured parameters. In particular, surprisingly high concentrations of chlorophyll-a were measured at all three main study sites in winter and early spring, likely due to changes in algal populations. Discharge conditions and dissolved orthophosphorus concentrations are key drivers for chlorophyll-a on a seasonal and annual basis on the Snake River. Discharge conditions and upstream periphyton growth are most likely the key drivers for chlorophyll-a in the Boise River. Phytoplankton growth is not limited or driven by nutrient availability in the Boise River. Lower discharges and minimal substrate disturbance in WY2010 in comparison with WY2009 may have caused prolonged and increased periphyton and macrophyte growth and a reduced amount of sloughed algae in suspension in the summer of WY2010. Chlorophyll-a measured in samples commonly is used as an indicator of sestonic algae biomass, but chlorophyll-a concentrations and fluorescence may not be the most appropriate surrogates for algae growth, eutrophication, and associated effects on beneficial uses. Assessment of the effects of algae growth on beneficial uses should evaluate not only sestonic algae, but also benthic algae and macrophytes. Alternatively, continuous monitoring of dissolved oxygen detects the influence of aquatic plant respiration for all types of algae and macrophytes and is likely a more direct measure of effects on beneficial uses such as aquatic habitat. Most measured water-quality parameters in the Snake River were statistically different upstream and downstream of the confluence with the Boise River. Higher concentrations and loads were measured at the downstream site (Snake River at Nyssa) than the upstream site (Snake River near Adrian) for total phosphorus, dissolved orthophosphorus, total nitrogen, dissolved nitrite and nitrate, suspended sediment, and turbidity. Higher dissolved oxygen concentrations and pH were measured at the upstream site (Snake River near Adrian) than the downstream site (Snake River at Nyssa). Contributions from the Boise River measured at Parma do not constitute all of the increase in nutrient and sediment loads in the Snake River between the upstream and downstream sites. Surrogate models were developed using a combination of continuously monitored variables to estimate concentrations of nutrients and suspended sediment when samples were not possible. The surrogate models explained from 66 to 95 percent of the variability in nutrient and suspended sediment concentrations, depending on the site and model. Although the surrogate models could not always represent event-based changes in modeled parameters, they generally were successful in representing seasonal and annual patterns. Over a longer period, the surrogate models could be a useful tool for measuring compliance with state and site-specific water-quality standards and TMDL targets, for representing daily and seasonal variability in constituents, and for assessing effects of phosphorus reduction measures within the watershed.

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

Stream water chemistry in watersheds receiving different atmospheric inputs of H+, NH4+, NO3-, and SO42-1

USGS Publications Warehouse

Stottlemyer, R.

1997-01-01

Weekly precipitation and stream water samples were collected from small watersheds in Denali National Park, Alaska, the Fraser Experimental Forest, Colorado, Isle Royale National Park, Michigan, and the Calumet watershed on the south shore of Lake Superior, Michigan. The objective was to determine if stream water chemistry at the mouth and upstream stations reflected precipitation chemistry across a range of atmospheric inputs of H+, NH4+, NO3-, and SO42-. Volume-weighted precipitation H+, NH4+, NO3-, and SO42- concentrations varied 4 to 8 fold with concentrations highest at Calumet and lowest in Denali. Stream water chemistry varied among sites, but did not reflect precipitation chemistry. The Denali watershed, Rock Creek, had the lowest precipitation NO3- and SO42- concentrations, but the highest stream water NO3and SO42- concentrations. Among sites, the ratio of mean monthly upstream NO3- concentration to precipitation NO3- concentration declined (p 90 percent inputs) across inputs ranging from 0.12 to > 6 kg N ha-1 y-1. Factors possibly accounting for the weak or non-existent signal between stream water and precipitation ion concentrations include rapid modification of meltwater and precipitation chemistry by soil processes, and the presence of unfrozen soils which permits winter mineralization and nitrification to occur.

Changes in Rice Pesticide Use and Surface Water Concentrations in the Sacramento River Watershed, California

USGS Publications Warehouse

Orlando, James L.; Kuivila, Kathryn

2004-01-01

Pesticides applied to rice fields in California are transported into the Sacramento River watershed by the release of rice field water. Despite monitoring and mitigation programs, concentrations of two rice pesticides, molinate and thiobencarb, continue to exceed the surface-water concentration performance goals established by the Central Valley Regional Water Quality Control Board. There have been major changes in pesticide use over the past decade, and the total amount of pesticides applied remains high. Molinate use has declined by nearly half, while thiobencarb use has more than doubled; carbofuran has been eliminated and partially replaced by the pyrethroid pesticide lambda-cyhalothrin. A study was conducted in 2002 and 2003 by the U.S. Geological Survey to determine if the changes in pesticide use on rice resulted in corresponding changes in pesticide concentrations in surface waters. During the rice growing season (May-July), water samples, collected weekly at three sites in 2002 and two sites in 2003, were analyzed for pesticides using both solid-phase and liquid-liquid extraction in combination with gas chromatography/mass spectrometry. Analytes included lambda-cyhalothrin, molinate, thiobencarb, and two degradation products of molinate: 2-keto-molinate and 4-keto-molinate. Molinate, thiobencarb, and 4-keto-molinate were detected in all samples, 2-keto-molinate was detected in less than half of the samples, and lambda-cyhalothrin was not detected in any samples. At two of the sites sampled in 2002 (Colusa Basin Drain 1 and Sacramento Slough), concentrations of molinate were similar, but thiobencarb concentrations differed by a factor of five. Although concentrations cannot be estimated directly from application amounts in different watersheds, the ratio of molinate to thiobencarb concentrations can be compared with the ratio of molinate to thiobencarb use in the basins. The higher concentration ratio in the Sacramento Slough Basin, compared with the ratio in the basin area feeding the Colusa Basin Drain 1, is consistent with the higher use ratio, suggesting that differences in application amounts can explain the observed concentration differences. The samples from the downstream site (Tower) sampled in 2002 had the lowest concentrations of pesticides. Performance goals were exceeded for either molinate or thiobencarb in six samples from the upstream sites, but not in any samples from the downstream Tower site. In 2003, concentrations at upstream sites were much lower than the previous year with only one sample containing thiobencarb at a concentration above the performance goal. Lower concentrations could be partially due to delays in rice planting and pesticide application owing to spring rainstorms. Historical data is available on peak concentrations of molinate and thiobencarb measured at Colusa Basin Drain 5 (one of our sites in 2003) since 1981. Implementing holding times for pesticide-treated rice field water in the early 1980s succeeded in decreasing concentrations in surface waters. Detailed pesticide use data is available since 1991 and changing use patterns for molinate and thiobencarb can explain some, but not all, of the trends in peak pesticide concentrations. A stronger relationship is seen between the lengths of time that performance goals were exceeded and the amount of a pesticide applied within a basin. Different extraction and analytical techniques were used to improve the recovery and lower the method detection limit for lambda-cyhalothrin. Recoveries of lambda-cyhalothrin from solid-phase extraction cartridges typically vary, so subsamples were processed by liquid-liquid extraction. The advantage of using a larger sample volume (3 L instead of 1 L) to lower detection limits was offset by poor recovery during the cleanup step using an activated carbon column. Results suggest that as the concentrations of dissolved organic carbon in the sample increase, the recovery g

The effects of land use on fluvial sediment chemistry for the conterminous U.S. - Results from the first cycle of the NAWQA Program: Trace and major elements, phosphorus, carbon, and sulfur

USGS Publications Warehouse

Horowitz, A.J.; Stephens, V.C.

2008-01-01

In 1991, the U.S. Geological Survey (USGS) began the first cycle of its National Water Quality Assessment (NAWQA) Program. The Program encompassed 51 river basins that collectively accounted for more than 70% of the total water use (excluding power generation), and 50% of the drinking water supply in the U.S. The basins represented a variety of hydrologic settings, rock types (geology), land-use categories, and population densities. One aspect of the first cycle included bed sediment sampling; sites were chosen to represent baseline and important land-use categories (e.g., agriculture, urban) in each basin. In total, over 1200 bed sediment samples were collected. All samples were size-limited (< 63????m) to facilitate spatial and/or temporal comparisons, and subsequently analyzed for a variety of chemical constituents including major (e.g., Fe, Al,) and trace elements (e.g., Cu, Zn, Cd), nutrients (e.g., P), and carbon. The analyses yielded total (??? 95% of the concentrations present), rather than total-recoverable chemical data. Land-use percentages, upstream underlying geology, and population density were determined for each site and evaluated to asses their relative influence on sediment chemistry. Baseline concentrations for the entire U.S. also were generated from a subset of all the samples, and are based on material collected from low population (??? 27??p km- 2) density, low percent urban (??? 5%), agricultural or undeveloped areas. The NAWQA baseline values are similar to those found in other national and global datasets. Further, it appears that upstream/underlying rock type has only a limited effect (mostly major elements) on sediment chemistry. The only land-use category that appears to substantially affect sediment chemistry is percent urban, and this result is mirrored by population density; in fact, the latter appears more consistent than the former.

Flame Spread Along Free Edges of Thermally Thin Samples in Microgravity

NASA Technical Reports Server (NTRS)

Mell, W. E.; Olson, S. L.; Kashiwagi, T.

2000-01-01

The effects of imposed flow velocity on flame spread along open edges of a thermally thin cellulosic sample in microgravity are studied experimentally and theoretically. In this study, the sample is ignited locally at the middle of the 4 cm wide sample and subsequent flame spread reaches both open edges of the sample. The following flame behaviors are observed in the experiments and predicted by the numerical calculation; in order of increased imposed flow velocity: (1) ignition but subsequent flame spread is not attained, (2) flame spreads upstream (opposed mode) without any downstream flame, and (3) the upstream flame and two separate downstream flames traveling along the two open edges (concurrent mode). Generally, the upstream and downstream edge flame spread rates are faster than the central flame spread rate for an imposed flow velocity of up to 5 cm/s. This is due to greater oxygen supply from the outer free stream to the edge flames than the central flames, For the upstream edge flame, the greater oxygen supply results in a flame spread rate that is nearly independent of, or decreases gradually, with the imposed flow velocity. The spread rate of the downstream edge, however, increases significantly with the imposed flow velocity.

Bacterial indicator occurrence and the use of an F+ specific RNA coliphage assay to identify fecal sources in Homosassa Springs, Florida

USGS Publications Warehouse

Griffin, Dale W.; Stokes, Rodger; Rose, J.B.; Paul, J.H.

2000-01-01

A microbiological water quality study of Homosassa Springs State Wildlife Park (HSSWP) and surrounding areas was undertaken. Samples were collected in November of 1997 (seven sites) and again in November of 1998 (nine sites). Fecal bacterial concentrations (total and fecal coliforms, Clostridium perfringens, and enterococci) were measured as relative indicators of fecal contamination. F+-specific coliphage genotyping was performed to determine the source of fecal contamination at the study sites. Bacterial levels were considerably higher at most sites in the 1997 sampling compared to the 1998 sampling, probably because of the greater rainfall that year. In November of 1997, 2 of the 7 sites were in violation of all indicator standards and guidance levels. In November of 1998, 1 of 9 sites was in violation of all indicator standard and guidance levels. The highest concentrations of all fecal indicators were found at a station downstream of the animal holding pens in HSSWP. The lowest levels of indicators were found at the Homosassa Main Spring vent. Levels of fecal indicators downstream of HSSWP (near the point of confluence with the river) were equivalent to those found in the Southeastern Fork and areas upstream of the park influences. F+ specific RNA coliphage analysis indicated that fecal contamination at all sites that tested positive was from animal sources (mammals and birds). These results suggest that animal (indigenous and those in HSSWP) and not human sources influenced microbial water quality in the area of Homosassa River covered by this study.

From Midges to Spiders: Mercury Biotransport in Riparian Zones Near the Buffalo River Area of Concern (AOC), USA.

PubMed

Pennuto, C M; Smith, M

2015-12-01

Riparian communities can receive environmental contaminants from adjacent aquatic 'donor' habitats. We investigated mercury biotransport from aquatic to terrestrial habitats via aquatic insect emergence and uptake by riparian spiders at sites within and upstream of the Buffalo River Area of Concern (AOC), a site with known sediment Hg contamination. Mercury concentration in emerging midges was roughly 10× less than contaminated sediment levels with the AOC, but biomagnification factors from midges to spiders ranged from 2.0 to 2.65 between sites. There was a significantly negative body mass:total mercury relationship in spiders (p < 0.001), indicating that mercury depuration is rapid or tissue dilution occurs in these riparian predators. Spiders contained significantly more mercury than their midge prey and spiders upstream of the AOC had higher mercury concentrations than spiders from within the AOC. Collectively, these data indicate that riparian spiders can be good mercury sentinels in urban environments, and that riparian communities upstream from the AOC may be at greater risk to mercury than has been previously considered.

Correlating field and laboratory rates of particle abrasion, Rio Medio, Sangre de Cristo Mountains, New Mexico

NASA Astrophysics Data System (ADS)

Polito, P. J.; Sklar, L. S.

2006-12-01

River bed sediments commonly fine downstream due to a combination of particle abrasion, selective transport of finer grains, and fining of the local sediment supply from hillslopes and tributaries. Particle abrasion rates can be directly measured in the laboratory using tumbling barrels and annular flumes, however, scaling experimental particle abrasion rates to the field has proven difficult due to the confounding effects of selective transport and local supply variations. Here we attempt to correlate laboratory and field rates of particle abrasion in a field setting where these confounding effects can be controlled. The Rio Medio, which flows westward from the crest of the Sangre de Cristo Mountains in north central New Mexico, is one of several streams studied by John P. Miller in the early 1960's. Several kilometers downstream of its headwaters, the river crosses the Picuris-Pecos fault. Upstream of the fault the river receives quartzite, sandstone and shale clasts from the Ortega Formation, while downstream sediments are supplied by the Embudo Granite. Because the upstream lithologies are not resupplied downstream of the fault, any observed fining of these clasts should be due only to abrasion and selective transport. We hypothesize that we can account for the effects of selective transport by comparing relative fining rates for the different upstream lithologies from both the field and a laboratory tumbler. By correlating laboratory abrasion rates with rock strength, we can predict the relative fining rates due solely to abrasion expected in the field; differences between the predicted and observed fining rates could then be attributed to selective transport. We used point counts to measure bed surface sediment grain size distributions at 15 locations along a 25 kilometer reach of the Rio Medio, beginning just downstream of the fault and ending upstream of a developed area with disturbed channel conditions. We recorded intermediate particle diameter as well as lithologic composition for 100 clasts at each location. To better characterize the size distribution of poorly represented lithologies we also measured every grain we could find of these minority lithologies within a one square meter area on adjacent bar top surfaces. At each sampling site we also measured channel gradient, and bank-full width and depth. We collected gravel samples for laboratory tumbling experiments and larger bedrock blocks from which we extracted cores for the Brazilian tensile splitting strength test. Preliminary results show very rapid fining of the weak sedimentary rocks downstream of the fault, much less rapid fining of the quartzite and a net downstream coarsening of the granitic sediments, which dominate the bed in the downstream end of the study reach. This enigmatic downstream coarsening may be a legacy of Pliestocene glaciation, which is evident in the landscape upstream of the fault. Outburst floods or debris flows from upstream moraines may have delivered large quantities of coarse sediments to downstream reaches, which are now relatively immobile. Despite these complications, the Rio Medio site may yet provide sufficient information to test our proposed method for scaling laboratory particle abrasion rates to the field.

Sources and transport of contaminants of emerging concern: A two-year study of occurrence and spatiotemporal variation in a mixed land use watershed.

PubMed

Fairbairn, David J; Karpuzcu, M Ekrem; Arnold, William A; Barber, Brian L; Kaufenberg, Elizabeth F; Koskinen, William C; Novak, Paige J; Rice, Pamela J; Swackhamer, Deborah L

2016-05-01

The occurrence and spatiotemporal variation of 26 contaminants of emerging concern (CECs) were evaluated in 68 water samples in 2011-2012 in the Zumbro River watershed, Minnesota, U.S.A. Samples were collected across a range of seasonal/hydrological conditions from four stream sites that varied in associated land use and presence of an upstream wastewater treatment plant (WWTP). Selected CECs included human/veterinary pharmaceuticals, personal care products, pesticides, phytoestrogens, and commercial/industrial compounds. Detection frequencies and concentrations varied, with atrazine, metolachlor, acetaminophen, caffeine, DEET, and trimethoprim detected in more than 70% of samples, acetochlor, mecoprop, carbamazepine, and daidzein detected in 30%-50% of samples, and 4-nonylphenol, cotinine, sulfamethoxazole, erythromycin, tylosin, and carbaryl detected in 10%-30% of samples. The remaining target CECs were not detected in water samples. Three land use-associated trends were observed for the detected CECs. Carbamazepine, 4-nonylphenol, erythromycin, sulfamethoxazole, tylosin, and carbaryl profiles were WWTP-dominated, as demonstrated by more consistent loading and significantly greater concentrations downstream of the WWTP and during low-flow seasons. In contrast, acetaminophen, trimethoprim, DEET, caffeine, cotinine, and mecoprop patterns demonstrated both seasonally-variable non-WWTP-associated and continual WWTP-associated influences. Surface water studies of CECs often target areas near WWTPs. This study suggests that several CECs often characterized as effluent-associated have additional important sources such as septic systems or land-applied biosolids. Finally, agricultural herbicide (atrazine, acetochlor, and metolachlor) profiles were strongly influenced by agricultural land use and seasonal application-runoff, evident by significantly greater concentrations and loadings at upstream sites and in early summer when application and precipitation rates are greatest. Our results indicate that CEC monitoring studies should consider a range of land uses, seasonality, and transport pathways in relation to concentrations and loadings. This knowledge can augment CEC monitoring programs to result in more accurate source, occurrence, and ecological risk characterizations, more precisely targeted mitigation initiatives, and ultimately, enhanced environmental decision-making. Copyright © 2016 Elsevier B.V. All rights reserved.

Responses of macroinvertebrate community metrics to a wastewater discharge in the Upper Blue River of Kansas and Missouri, USA

USGS Publications Warehouse

Poulton, Barry C.; Graham, Jennifer L.; Rasmussen, Teresa J.; Stone, Mandy L.

2015-01-01

The Blue River Main wastewater treatment facility (WWTF) discharges into the upper Blue River (725 km2), and is recently upgraded to implement biological nutrient removal. We measured biotic condition upstream and downstream of the discharge utilizing the macroinvertebrate protocol developed for Kansas streams. We examined responses of 34 metrics to determine the best indicators for discriminating site differences and for predicting biological condition. Significant differences between sites upstream and downstream of the discharge were identified for 15 metrics in April and 12 metrics in August. Upstream biotic condition scores were significantly greater than scores at both downstream sites in April (p = 0.02), and in August the most downstream site was classified as non-biologically supporting. Thirteen EPT taxa (Ephemeroptera, Plecoptera, Trichoptera) considered intolerant of degraded stream quality were absent at one or both downstream sites. Increases in tolerance metrics and filtering macroinvertebrates, and a decline in ratio of scrapers to filterers all indicated effects of increased nutrient enrichment. Stepwise regressions identified several significant models containing a suite of metrics with low redundancy (R2 = 0.90 - 0.99). Based on the rapid decline in biological condition downstream of the discharge, the level of nutrient removal resulting from the facility upgrade (10% - 20%) was not enough to mitigate negative effects on macroinvertebrate communities.

Antibiotic resistance of native and faecal bacteria isolated from rivers, reservoirs and sewage treatment facilities in Victoria, south-eastern Australia.

PubMed

Boon, P I; Cattanach, M

1999-03-01

The incidence of resistance to ampicillin, chloramphenicol, kanamycin, nalidixic acid, neomycin and streptomycin was significantly greater (P < 0.001) in native heterotrophic bacteria than in Escherichia coli isolated from a range of sites along the Yarra River in south-eastern Australia. There was no significant difference in the incidence of resistance between native and faecal bacteria to tetracycline. Both groups were almost totally resistant to penicillin. Multivariate analyses indicated little clear spatial pattern in the incidence of resistance in native bacteria from upstream vs downstream sites along the Yarra River. In contrast, E. coli isolated from upstream (rural) sites tended to have a lower incidence of resistance than isolates from downstream (urban) sites. These findings have implications for the use of antibiotic resistance as a bacteriological water quality parameter.

Contamination sources and distribution patterns of pharmaceuticals and personal care products in Alpine rivers strongly affected by tourism.

PubMed

Mandaric, Ladislav; Diamantini, Elena; Stella, Elisa; Cano-Paoli, Karina; Valle-Sistac, Jennifer; Molins-Delgado, Daniel; Bellin, Alberto; Chiogna, Gabriele; Majone, Bruno; Diaz-Cruz, M Silvia; Sabater, Sergi; Barcelo, Damia; Petrovic, Mira

2017-07-15

Knowledge regarding the impact of tourism on the emergence of pharmaceuticals and personal care products (PPCPs) in Alpine river waters is limited and scarce. Therefore, a study on the occurrence patterns and spatiotemporal variability of 105 PPCPs in an Alpine river basin located in the Trentino-Alto Adige region (North-Eastern Italy) has been conducted. We observed that the total concentration of analyzed PPCPs was generally higher in all sampling sites during winter than in the summer. The analysis of tourist data revealed that during both sampling campaigns the number of tourists was lower in the downstream sites in comparison with the upstream area of the basin (Val di Sole). Particularly, sampling sites located near important tourist resorts have shown the highest abundance of the PPCPs during winter, being analgesics/anti-inflammatories, antihypertensives and antibiotics the most abundant pharmaceutically active compounds (PhACs). Diclofenac showed the highest concentration amongst PhACs, reaching concentrations up to 675ngL -1 in the sampling site situated downstream of the Tonale wastewater treatment plant (WWTP). Antihypertensives were found at concentrations >300ngL -1 , while antibiotics were quantified up to 196ngL -1 , respectively. Amongst personal care products (PCPs), the most abundant compound was octyl-dimethyl-p-aminobenzoic acid (ODPABA) with concentrations reaching up to 748ngL -1 in the sampling site situated within the Rotaliana district. In general, concentrations and detection frequencies were higher in water than in the sediment samples. The most frequently detected PhACs in sediments from both sampling campaigns were antibiotics, while amongst PCPs in sediments, octocrylene (OC) showed the highest concentration in both sampling campaigns. As a result, this study highlights the potential impact of tourism on the water quality of the Alpine aquatic ecosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

Estimation of constituent concentrations, densities, loads, and yields in lower Kansas River, northeast Kansas, using regression models and continuous water-quality monitoring, January 2000 through December 2003

USGS Publications Warehouse

Rasmussen, Teresa J.; Ziegler, Andrew C.; Rasmussen, Patrick P.

2005-01-01

The lower Kansas River is an important source of drinking water for hundreds of thousands of people in northeast Kansas. Constituents of concern identified by the Kansas Department of Health and Environment (KDHE) for streams in the lower Kansas River Basin include sulfate, chloride, nutrients, atrazine, bacteria, and sediment. Real-time continuous water-quality monitors were operated at three locations along the lower Kansas River from July 1999 through September 2004 to provide in-stream measurements of specific conductance, pH, water temperature, turbidity, and dissolved oxygen and to estimate concentrations for constituents of concern. Estimates of concentration and densities were combined with streamflow to calculate constituent loads and yields from January 2000 through December 2003. The Wamego monitoring site is located 44 river miles upstream from the Topeka monitoring site, which is 65 river miles upstream from the DeSoto monitoring site, which is 18 river miles upstream from where the Kansas River flows into the Missouri River. Land use in the Kansas River Basin is dominated by grassland and cropland, and streamflow is affected substantially by reservoirs. Water quality at the three monitoring sites varied with hydrologic conditions, season, and proximity to constituent sources. Nutrient and sediment concentrations and bacteria densities were substantially larger during periods of increased streamflow, indicating important contributions from nonpoint sources in the drainage basin. During the study period, pH remained well above the KDHE lower criterion of 6.5 standard units at all sites in all years, but exceeded the upper criterion of 8.5 standard units annually between 2 percent of the time (Wamego in 2001) and 65 percent of the time (DeSoto in 2003). The dissolved oxygen concentration was less than the minimum aquatic-life-support criterion of 5.0 milligrams per liter less than 1 percent of the time at all sites. Dissolved solids, a measure of the dissolved material in water, exceeded 500 milligrams per liter about one-half of the time at the three Kansas River sites. Larger dissolved-solids concentrations upstream likely were a result of water inflow from the highly mineralized Smoky Hill River that is diluted by tributary flow as it moves downstream. Concentrations of total nitrogen and total phosphorus at the three monitoring sites exceeded the ecoregion water-quality criteria suggested by the U.S. Environmental Protection Agency during the entire study period. Median nitrogen and phosphorus concentrations were similar at all three sites, and nutrient load increased moving from the upstream to downstream sites. Total nitrogen and total phosphorus yields were nearly the same from site to site indicating that nutrient sources were evenly distributed throughout the lower Kansas River Basin. About 11 percent of the total nitrogen load and 12 percent of the total phosphorus load at DeSoto during 2000-03 originated from wastewater-treatment facilities. Escherichia coli bacteria densities were largest at the middle site, Topeka. On average, 83 percent of the annual bacteria load at DeSoto during 2000-03 occurred during 10 percent of the time, primarily in conjunction with runoff. The average annual sediment loads at the middle and downstream monitoring sites (Topeka and DeSoto) were nearly double those at the upstream site (Wamego). The average annual sediment yield was largest at Topeka. On average, 64 percent of the annual suspended-sediment load at DeSoto during 2000-03 occurred during 10 percent of the time. Trapping of sediment by reservoirs located on contributing tributaries decreases transport of sediment and sediment-related constituents. The average annual suspended-sediment load in the Kansas River at DeSoto during 2000-03 was estimated at 1.66 million tons. An estimated 13 percent of this load consisted of sand-size particles, so approximately 216,000 tons of sand were transported

Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

PubMed Central

Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

1998-01-01

Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

PubMed Central

2014-01-01

Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

Landscape controls on mercury in streamwater at Acadia National Park, USA

USGS Publications Warehouse

Peckenham, J.M.; Kahl, J.S.; Nelson, S.J.; Johnson, K.B.; Haines, T.A.

2007-01-01

Fall and spring streamwater samples were analyzed for total mercury (Hg) and major ions from 47 locations on Mount Desert Island in Maine. Samples were collected in zones that were burned in a major wildfire in 1947 and in zones that were not burned. We hypothesized that Hg concentrations in streamwater would be higher from unburned sites than burned watersheds, because fire would volatilize stored Hg. The Hg concentrations, based on burn history, were not statistically distinct. However, significant statistical associations were noted between Hg and the amount of wetlands in the drainage systems and with streamwater dissolved organic carbon (DOC). An unexpected result was that wetlands mobilized more Hg by generating more DOC in total, but upland DOC was more efficient at transporting Hg because it transports more Hg per unit DOC. Mercury concentrations were higher in samples collected at lower elevations. Mercury was positively correlated with relative discharge, although this effect was not distinguished from the DOC association. In this research, sample site elevation and the presence of upstream wetlands and their associated DOC affected Hg concentrations more strongly than burn history. ?? Springer Science + Business Media B.V. 2007.

Survival, growth, and movement of subadult humpback chub, Gila cypha, in the Little Colorado River, Arizona

USGS Publications Warehouse

Dzul, Maria C.; Yackulic, Charles B.; Stone, Dennis M.; Van Haverbeke, David R.

2016-01-01

Ecologists estimate vital rates, such as growth and survival, to better understand population dynamics and identify sensitive life history parameters for species or populations of concern. Here, we assess spatiotemporal variation in growth, movement, density, and survival of subadult humpback chub living in the Little Colorado River, Grand Canyon, AZ from 2001–2002 and 2009–2013. We divided the Little Colorado River into three reaches and used a multistate mark-recapture model to determine rates of movement and differences in survival and density between sites for different cohorts. Additionally, site-specific and year-specific effects on growth were evaluated using a linear model. Results indicate that summer growth was higher for upstream sites compared with downstream sites. In contrast, there was not a consistent spatial pattern across years in winter growth; however, river-wide winter growth was negatively related to the duration of floods from 1 October to 15 May. Apparent survival was estimated to be lower at the most downstream site compared with the upstream sites; however, this could be because in part of increased emigration into the Colorado River at downstream sites. Furthermore, the 2010 cohort (i.e. fish that are age 1 in 2010) exhibited high apparent survival relative to other years. Movement between reaches varied with year, and some years exhibited preferential upstream displacement. Improving understanding of spatiotemporal effects on age 1 humpback chub survival can help inform current management efforts to translocate humpback chub into new locations and give us a better understanding of the factors that may limit this tributary's carrying capacity for humpback chub.

Water Quality of Combined Sewer Overflows, Stormwater, and Streams, Omaha, Nebraska, 2006-07

USGS Publications Warehouse

Vogel, Jason R.; Frankforter, Jill D.; Rus, David L.; Hobza, Christopher M.; Moser, Matthew T.

2009-01-01

The U.S. Geological Survey, in cooperation with the City of Omaha, investigated the water quality of combined sewer overflows, stormwater, and streams in the Omaha, Nebraska, area by collecting and analyzing 1,175 water samples from August 2006 through October 2007. The study area included the drainage area of Papillion Creek at Capeheart Road near Bellevue, Nebraska, which encompasses the tributary drainages of the Big and Little Papillion Creeks and Cole Creek, along with the Missouri River reach that is adjacent to Omaha. Of the 101 constituents analyzed during the study, 100 were detected in at least 1 sample during the study. Spatial and seasonal comparisons were completed for environmental samples. Measured concentrations in stream samples were compared to water-quality criteria for pollutants of concern. Finally, the mass loads of water-quality constituents in the combined sewer overflow discharges, stormwater outfalls, and streams were computed and compared. The results of the study indicate that combined sewer overflow and stormwater discharges are affecting the water quality of the streams in the Omaha area. At the Papillion Creek Basin sites, Escherichia coli densities were greater than 126 units per 100 milliliters in 99 percent of the samples (212 of 213 samples analyzed for Escherichia coli) collected during the recreational-use season from May through September (in 2006 and 2007). Escherichia coli densities in 76 percent of Missouri River samples (39 of 51 samples) were greater than 126 units per 100 milliliters in samples collected from May through September (in 2006 and 2007). None of the constituents with human health criteria for consumption of water, fish, and other aquatic organisms were detected at levels greater than the criteria in any of the samples collected during this study. Total phosphorus concentrations in water samples collected in the Papillion Creek Basin were in excess of the U.S. Environmental Protection Agency's proposed criterion in all but four stream samples (266 of 270). Similarly, only 2 of 84 Missouri River samples had total phosphorus concentrations less than the proposed criterion. The proposed total nitrogen criterion for the Corn Belt and Northern Great Plains ecoregion was surpassed in 80 percent of the water samples collected from the stream sites. Samples with total nitrogen concentrations greater than the proposed criterion were most common at Papillion Creek and Big Papillion Creek sites, where the proposed criterion was surpassed in 90 and 96 percent of the samples collected, respectively. Elevated concentrations of total nitrogen were less common at the Missouri River sites, with 33 percent of the samples analyzed having concentrations that surpassed the proposed nutrient criterion for total nitrogen. The three constituents with measured concentrations greater than their respective health-based screening levels were nickel, zinc, and dichlorvos. Differences in water quality during the beginning, middle, and end of the combined sewer overflow discharge and the stream hydrograph rise, peak, and recession were investigated. Concentrations from the ending part of the combined sewer overflow hydrograph were significantly different than those from the beginning and middle parts for 3 and 11 constituents, respectively. No constituents were significantly different between the beginning and middle parts of the combined sewer overflow discharge hydrograph. For the stream site upstream from combined sewer overflow outfalls on Cole Creek, the constituents with geometric mean values for the hydrograph rise that were at least twice those for the values of the peak and recession were specific conductance, magnesium, nitrite, N,N-diethyl-meta-toluamide (DEET), methyl salicylate, p-cresol, and Escherichia coli. Similarly, the constituents where the hydrograph peak was at least twice that for the rise and recession at the upstream Cole Creek site were total suspended solids, silver, an

Multivariate analysis of heavy metal contents in soils, sediments and water in the region of Meknes (central Morocco).

PubMed

Tahri, M; Benyaïch, F; Bounakhla, M; Bilal, E; Gruffat, J J; Moutte, J; Garcia, D

2005-03-01

Concentrations of Al, Fe, Cr, Cu, Ni, Pb and Zn in soils, sediments and water samples collected along the Oued Boufekrane river (Meknes, central Morocco) were determined. In soils, a homogeneous distribution of metal concentrations was observed throughout the study area except for Pb, which presents high enrichment at sites located at the vicinity of a main highway. In sediments, high enrichment, with respect to upstream sites, were observed downstream of the city of Meknes for Al, Cr, Fe and Ni and inside the city for Cu, Zn and Pb. In water samples, the metal contents showed to correlate with their homologues in sediments suggesting that the metal contents in water and sediments have identical origins. Descriptive statistics and multivariate analysis (principal factor method, PFM) were used to assist the interpretation of elemental data. This allowed the determination of the correlations between the metals and the identification of three main factor loadings controlling the metal variability in soils and sediments.

Methodological issues and preliminary results from a combined sediment fingerprinting and radioisotope dating approach to explore changes in sediment sources with land-use change in the Brantian Catchment, Borneo.

NASA Astrophysics Data System (ADS)

Walsh, Rory; Higton, Sam; Marshall, Jake; Bidin, Kawi; Blake, William; Nainar, Anand

2015-04-01

This paper reports some methodological issues and early results of a project investigating the erosional impacts of land use changes (multiple selective logging and progressive, partial conversion to oil palm) over the last 25-40 years in the 600km2 Brantian river catchment in Sabah, Borneo. A combined sediment fingerprinting and radioisotope dating approach is being applied to sediment cores taken in stream hierarchical fashion across the intermediate catchment scale. Changes in sediment sources and sedimentation rates over time can be captured by changes in the relative importance of geochemical elements with depth in downstream sediment cores, which in turn can be linked to parallel changes in upstream cores by the application of unmixing models and statistical techniques. Radioisotope analysis of the sediment cores allows these changes to be dated and sedimentation rates to be estimated. Work in the neighbouring Segama catchment had successfully demonstrated the potential of such an approach in a rainforest environment (Walsh et al. 2011). The paper first describes steps taken to address methodological issues. The approach relies on taking continuous sediment cores which have aggraded progressively over time and remain relatively undisturbed and uncontaminated. This issue has been tackled (1) through careful core sampling site selection with a focus on lateral bench sites and (2) deployment of techniques such as repeat-measurement erosion bridge transects to assess the contemporary nature of sedimentation to validate (or reject) candidate sites. The issue of sediment storage and uncertainties over lag times has been minimised by focussing on sets of above- and below-confluence sites in the intermediate zone of the catchment, thus minimising sediment transit times between upstream contributing and downstream destination core sites. This focus on the intermediate zone was also driven by difficulties in finding suitable core sites in the mountainous headwaters area due to the prevalence of steep, incised channels without even narrow floodplains. Preliminary results are reported from (1) a field visit to investigate potential sampling sites in July 2014 and (2) initial analysis of a sediment core at a promising lateral bench site. Marked down-profile geochemistry changes of the core indicate a history of phases of high deposition and lateral growth of the channel caused by mobilisation of sediment linked to logging and clearance upstream. Recent channel bed degradation suggests the system has been adjusting a decline in sediment supply with forest recovery since logging in 2005, but a renewed sedimentation phase heralded by > 10 cm deposition at the site in a flood in July 2014 appears to have started linked to partial forest clearance for oil palm. These preliminary results support the ability of a combined fingerprinting and dating approach to reflect the spatial history of land-use change in a catchment undergoing disturbance. Walsh R. P. D. , Bidin K., Blake W.H., Chappell N.A., Clarke M.A., Douglas I., Ghazali R., Sayer A.M., Suhaimi J., Tych W. & Annammala K.V. (2011) Long-term responses of rainforest erosional systems at different spatial scales to selective logging and climatic change. Philosophical Transactions of the Royal Society B, 366, 3340-3353.

Geophysical bed sediment characterization of the Androscoggin River from the former Chlor-Alkali Facility Superfund Site, Berlin, New Hampshire, to the state border with Maine, August 2009

USGS Publications Warehouse

Degnan, James R.; Teeple, Andrew; Johnston, Craig M.; Marvin-DiPasquale, Mark C.; Luce, Darryl

2011-01-01

The former Chlor-Alkali Facility in Berlin, New Hampshire, was listed on the U.S. Environmental Protection Agency National Priorities List in 2005 as a Superfund site. The Chlor-Alkali Facility lies on the east bank of the Androscoggin River. Elemental mercury currently discharges from that bank into the Androscoggin River. The nature, extent, and the speciation of mercury and the production of methyl mercury contamination in the adjacent Androscoggin River is the subject of continuing investigations. The U.S. Geological Survey, in cooperation with Region I of the U.S. Environmental Protection Agency, used geophysical methods to determine the distribution, thickness, and physical properties of sediments in the Androscoggin River channel at a small area of an upstream reference reach and downstream from the site to the New Hampshire–Maine State border. Separate reaches of the Androscoggin River in the study area were surveyed with surface geophysical methods including ground-penetrating radar and step-frequency electromagnetics. Results were processed to assess sediment characteristics including grain size, electrical conductivity, and pore-water specific conductance. Specific conductance measured during surface- and pore-water sampling was used to help interpret the results of the geophysical surveys. The electrical resistivity of sediment samples was measured in the laboratory with intact pore water for comparison with survey results. In some instances, anthropogenic features and land uses, such as roads and power lines affected the detection of riverbed properties using geophysical methods; when this occurred, the data were removed. Through combining results, detailed riverbed sediment characterizations were made. Results from ground-penetrating radar surveys were used to image and measure the depth to the riverbed, depth to buried riverbeds, riverbed thickness and to interpret material-type variations in terms of relative grain size. Fifty two percent of the riverbed in the study area was covered with gravel and finer sediments. The electrically resistive river water and sediment in this study area were conducive to the penetration of the ground-penetrating radar and step-frequency electromagnetic signals and allowed for effective sediment characterization by geophysical methods. The reach between the former Chlor-Alkali Facility and the Riverside Dam, had small areas of fine sediment (estimated 11 percent of riverbed area), found on the upstream left bank and the downstream right bank, with an electromagnetic conductivity (31.4 millisiemens per meter (mS/m) maximum) that was higher than the upstream reference reach. The greatest electromagnetic conductivity (195 mS/m), pore-water specific conductance (324 mS/m) and lab measured sediment conductivity of (76.8 mS/m, measured with a direct-current resistivity test box) in the study were measured approximately 1 mile (mi) downstream of the site from a sandbar on the left bank. Reaches adjacent to and within 2 mi downstream from the site had elevated electromagnetic conductivity despite having lower estimated percentages of riverbed area covered in sediment (11, 25, and 61 percent, respectively) than the reference reach (97). Typically finer grained sediment with similar mineralogy will be more conductive. The Shelburne Reservoir is approximately 8 mi downstream from the site had the second greatest pore-water specific conductance measured, 45.8 mS/m. Many of the locations with the largest step-frequency electromagnetic values have not been sampled for pore water and sediment.

Are catchment-wide erosion rates really "Catchment-Wide"? Effects of grain size on erosion rates determined from 10Be

NASA Astrophysics Data System (ADS)

Reitz, M. A.; Seeber, L.; Schaefer, J. M.; Ferguson, E. K.

2012-12-01

Early studies pioneering the method for catchment wide erosion rates by measuring 10Be in alluvial sediment were taken at river mouths and used the sand size grain fraction from the riverbeds in order to average upstream erosion rates and measure erosion patterns. Finer particles (<0.0625 mm) were excluded to reduce the possibility of a wind-blown component of sediment and coarser particles (>2 mm) were excluded to better approximate erosion from the entire upstream catchment area (coarse grains are generally found near the source). Now that the sensitivity of 10Be measurements is rapidly increasing, we can precisely measure erosion rates from rivers eroding active tectonic regions. These active regions create higher energy drainage systems that erode faster and carry coarser sediment. In these settings, does the sand-sized fraction fully capture the average erosion of the upstream drainage area? Or does a different grain size fraction provide a more accurate measure of upstream erosion? During a study of the Neto River in Calabria, southern Italy, we took 8 samples along the length of the river, focusing on collecting samples just below confluences with major tributaries, in order to use the high-resolution erosion rate data to constrain tectonic motion. The samples we measured were sieved to either a 0.125 mm - 0.710 mm fraction or the 0.125 mm - 4 mm fraction (depending on how much of the former was available). After measuring these 8 samples for 10Be and determining erosion rates, we used the approach by Granger et al. [1996] to calculate the subcatchment erosion rates between each sample point. In the subcatchments of the river where we used grain sizes up to 4 mm, we measured very low 10Be concentrations (corresponding to high erosion rates) and calculated nonsensical subcatchment erosion rates (i.e. negative rates). We, therefore, hypothesize that the coarser grain sizes we included are preferentially sampling a smaller upstream area, and not the entire upstream catchment, which is assumed when measurements are based solely on the sand sized fraction. To test this hypothesis, we used samples with a variety of grain sizes from the Shillong Plateau. We sieved 5 samples into three grain size fractions: 0.125 mm - 710 mm, 710 mm - 4 mm, and >4 mm and measured 10Be concentrations in each fraction. Although there is some variation in the grain size fraction that yields the highest erosion rate, generally, the coarser grain size fractions have higher erosion rates. More significant are the results when calculating the subcatchment erosion rates, which suggest that even medium sized grains (710 mm - 4 mm) are sampling an area smaller than the entire upstream area; this finding is consistent with the nonsensical results from the Neto River study. This result has numerous implications for the interpretations of 10Be erosion rates: most importantly, an alluvial sample may not be averaging the entire upstream area, even when using the sand size fraction - resulting erosion rates more pertinent for that sample point rather than the entire catchment.

Risk Assessment and Prediction of Heavy Metal Pollution in Groundwater and River Sediment: A Case Study of a Typical Agricultural Irrigation Area in Northeast China

PubMed Central

Zhong, Shuang; Geng, Hui; Zhang, Fengjun; Liu, Zhaoying; Wang, Tianye; Song, Boyu

2015-01-01

The areas with typical municipal sewage discharge river and irrigation water function were selected as study sites in northeast China. The samples from groundwater and river sediment in this area were collected for the concentrations and forms of heavy metals (Cr(VI), Cd, As, and Pb) analysis. The risk assessment of heavy metal pollution was conducted based on single-factor pollution index (I) and Nemerow pollution index (NI). The results showed that only one groundwater sampling site reached a polluted level of heavy metals. There was a high potential ecological risk of Cd on the N21-2 sampling site in river sediment. The morphological analysis results of heavy metals in sediment showed that the release of heavy metals can be inferred as one of the main pollution sources of groundwater. In addition, the changes in the concentration and migration scope of As were predicted by using the Groundwater Modeling System (GMS). The predicted results showed that As will migrate downstream in the next decade, and the changing trend of As polluted areas was changed with As content districts because of some pump wells downstream to form groundwater depression cone, which made the solute transfer upstream. PMID:26366176

Didymosphenia geminata in the Upper Esopus Creek: current status, variability, and controlling factors

USGS Publications Warehouse

George, Scott D.; Baldigo, Barry P.

2015-01-01

In May of 2009, the bloom-forming diatom Didymosphenia geminata was first identified in the Upper Esopus Creek, a key tributary to the New York City water-supply and a popular recreational stream. The Upper Esopus receives supplemental flows from the Shandaken Portal, an underground aqueduct delivering waters from a nearby basin. The presence of D.geminata is a concern for the local economy, water supply, and aquatic ecosystem because nuisance blooms have been linked to degraded stream condition in other regions. Here we ascertain the extent and severity of the D. geminata invasion, determine the impact of supplemental flows from the Portal on D. geminata, and identify potential factors that may limitD. geminata in the watershed. Stream temperature, discharge, and water quality were characterized at select sites and periphyton samples were collected five times at 6 to 20 study sites between 2009 and 2010 to assess standing crop, diatom community structure, and density of D. geminata and all diatoms. Density of D. geminata ranged from 0–12 cells cm-2 at tributary sites, 0–781 cells cm-2 at sites upstream of the Portal, and 0–2,574 cells cm-2 at sites downstream of the Portal. Survey period and Portal (upstream or downstream) each significantly affected D. geminata cell density. In general, D. geminata was most abundant during the November 2009 and June 2010 surveys and at sites immediately downstream of the Portal. We found that D. geminata did not reach nuisance levels or strongly affect the periphyton community. Similarly, companion studies showed that local macroinvertebrate and fish communities were generally unaffected. A number of abiotic factors including variable flows and moderate levels of phosphorous and suspended sediment may limit blooms of D. geminatain this watershed.

Diatom assemblage responses to changing environment in the conspicuously eutrophic Kiuruvesi lake route, central-eastern Finland

NASA Astrophysics Data System (ADS)

Tammelin, Mira; Kauppila, Tommi

2016-04-01

Lakes and their water quality have been affected by anthropogenic actions for centuries. The most intensive changes have often occurred since the mid-19th century. Industrialization, modern agriculture, forest ditching and artificial lowering of water level are examples of these changes that have usually resulted in the deterioration of lake water quality. Many organisms, such as diatoms, are sensitive to these changes in their environmental conditions. Therefore, a marked species turnover is often seen between the pre and post human impact diatom assemblages. This turnover can be rapidly assessed simultaneously from many lakes by using multivariate methods and top-bottom sampling. Our study area consists of three adjacent lake routes in the grass cultivation and dairy production area of central-eastern Finland, where slash-and-burn cultivation and artificial water level lowering were common practice during the past centuries. The centermost Iisalmi lake route is particularly interesting because of the conspicuously eutrophic lakes in its Kiuruvesi subroute. We used the top-bottom approach to sample pre and post human impact samples from 47 lakes (50 sampling sites) located in the three lake routes. In addition, stratigraphic samples from the long cores of three lakes (one larger central basin and two small upstream lakes) in the Kiuruvesi subroute were studied in more detail. Multivariate methods were used to assess diatom assemblage change within the long cores and between the pre-disturbance and modern samples. The results indicate that most study lakes have undergone a marked shift in their diatom assemblages since the onset of human impact in the area. The lake routes are characterized by differing pre-impact diatom assemblages. However, human influence has reduced their natural variation. Similar diatom species are common in the modern samples of the heavily impacted lakes in all three lake routes. The detailed examination of the diatom assemblage turnover in the three Kiuruvesi route lakes portrays different trajectories in each lake. The central basin has changed less than the upstream lakes. Two of the lakes have assemblage change trajectories that suggest increased nutrients, electrical conductivity, and pH. Unexpectedly, one of the upstream lakes shows an opposite trajectory, which might result from lowering water depth and improved living conditions for benthic diatoms.

Neglected sources of pharmaceuticals in river water--footprints of a Reggae festival.

PubMed

Daneshvar, Atlasi; Svanfelt, Jesper; Kronberg, Leif; Weyhenmeyer, Gesa A

2012-02-01

Wastewater treatment plants (WWTPs) are commonly considered as the main source of pharmaceuticals in surface waters. Here, however, we show that an open-air festival, attracting approximately 10,000 visitors per year at the shores of River Fyris upstream of Uppsala WWTP, can temporarily result in a higher pharmaceutical input into the river water than the WWTP. Studying the influence of Uppsala Reggae festival on the occurrence of ten commonly used acidic and basic pharmaceuticals upstream, in the effluent, and downstream of the Uppsala WWTP, we found that occasional heavy rainfalls during the festival in 2008 severely increased the mass flows of all pharmaceuticals at the WWTP upstream site. Also, strong increases in ammonium (210-fold), nitrate (21-fold), and total nitrogen (21-fold) mass flows were observed. The pharmaceutical mass flows at the upstream site were up to 3.4 times higher than those observed in the WWTP effluent. In contrast, in 2009, the festival was not accompanied with rainfalls and no major additional input of pharmaceuticals and nitrogen was observed. The findings of this study give new insights into risk assessments and are relevant for monitoring programmes.

Two alternative ways of start site selection in human norovirus reinitiation of translation.

PubMed

Luttermann, Christine; Meyers, Gregor

2014-04-25

The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

Distribution and abundance of stream fishes in relation to barriers: implications for monitoring stream recovery after barrier removal

USGS Publications Warehouse

Zydlewski, Joseph D.; Coghlan, Stephen M.; Gardner, C.; Saunders, R.

2011-01-01

Dams are ubiquitous in coastal regions and have altered stream habitats and the distribution and abundance of stream fishes in those habitats by disrupting hydrology, temperature regime and habitat connectivity. Dam removal is a common restoration tool, but often the response of the fish assemblage is not monitored rigorously. Sedgeunkedunk Stream, a small tributary to the Penobscot River (Maine, USA), has been the focus of a restoration effort that includes the removal of two low-head dams. In this study, we quantified fish assemblage metrics along a longitudinal gradient in Sedgeunkedunk Stream and also in a nearby reference stream. By establishing pre-removal baseline conditions and associated variability and the conditions and variability immediately following removal, we can characterize future changes in the system associated with dam removal. Over 2 years prior to dam removal, species richness and abundance in Sedgeunkedunk Stream were highest downstream of the lowest dam, lowest immediately upstream of that dam and intermediate farther upstream; patterns were similar in the reference stream. Although seasonal and annual variation in metrics within each site was substantial, the overall upstream-to-downstream pattern along the stream gradient was remarkably consistent prior to dam removal. Immediately after dam removal, we saw significant decreases in richness and abundance downstream of the former dam site and a corresponding increase in fish abundance upstream of the former dam site. No such changes occurred in reference sites. Our results show that by quantifying baseline conditions in a small stream before restoration, the effects of stream restoration efforts on fish assemblages can be monitored successfully. These data set the stage for the long-term assessment of Sedgeunkedunk Stream and provide a simple methodology for assessment in other restoration projects.

Diel changes in metal concentrations in a geogenically acidic river: Rio Agrio, Argentina

NASA Astrophysics Data System (ADS)

Parker, Stephen R.; Gammons, Christopher H.; Pedrozo, Fernando L.; Wood, Scott A.

2008-12-01

Rio Agrio in Patagonia, Argentina is a geogenically acidic stream that derives its low-pH waters from condensation of acidic gases near its headwaters on the flanks of the active Copahue Volcano. This study reports the results of three diel (24-h) water samplings in three different pH regimes (3.2, 4.4 and 6.3) along the river. Changes in the concentration and speciation of Fe dominated the diel chemical changes at all three sites, although the timing and intensity of these cycles were different in each reach. At the two acidic sampling sites, total dissolved Fe and dissolved Fe(III) concentrations decreased during the day and increased at night, whereas dissolved Fe(II) showed the reverse pattern. These cycles are explained by Fe(III) photoreduction, as well as enhanced rates of precipitation of hydrous ferric oxide (HFO) during the warm afternoon hours. A strong correlation was observed between Fe(III) and As at the furthest upstream (pH 3.2) site, most likely due to co-precipitation of As with HFO. At the downstream (pH 6.3) location, Fe(II) concentrations increased at night, as did concentrations of rare earth elements and dissolved Al. Photoreduction does not appear to be an important process at pH 6.3, although it may be indirectly responsible for the observed diel cycle of Fe(II) due to advection of photochemically produced Fe(II) from acidic upstream waters. The results of this study of a naturally-acidic river are very similar to diel trends recently obtained from mining-impacted streams receiving acid rock drainage. The results are also used to explore the link between geochemistry and microbiology in acidic eco-systems. For example, Fe(III) photoreduction produces chemical potential energy (in the form of metastable Fe 2+) that helps support the bacterial community in this unique extreme environment.

Determination of bioavailable contaminants in the lower Missouri River following the flood of 1993

USGS Publications Warehouse

Petty, J.D.; Poulton, B.C.; Charbonneau, C.S.; Huckins, J.N.; Jones, S.B.; Cameron, J.T.; Prest, H.F.

1998-01-01

The semipermeable membrane device (SPMD) technology was employed to determine the presence of bioavailable organochlorine pesticides (OCs), polychlorinated biphenyls (PCBs), and polyaromatic hydrocarbons (PAHs)in the water of the main stem of the lower Missouri River and three of its tributaries. The SPMDs were deployed in 1994 following the extensive flood of 1993. Specifically, the SPMDs were deployed for 28 days at Wilson State Park, IA; Nebraska City, NE; Parkville, MO; the Kansas River in Kansas City, KS; Napoleon, MO; the Grand River; Glasgow, MO; the Missouri River upstream from the confluence of the Gasconade River; the Gasconade River, and Hermann, MO. Contaminant residues were found at all sites and at higher concentrations than found in the earlier pre-flood sampling. For example, in the present study, dieldrin was found to range from a low of 110 ng/sample in the Gasconade River to a high of 2000 ng/sample at Glasgow, while in the pre- flood sampling, dieldrin ranged from a low of 64 ng/sample at Sioux City to a high of 800 ng/sample at Glasgow. In contrast to the 1992 sampling, residues of PCBs were found at all 1994 sampling sites except the Gasconade River. Samples from Wilson State Park and the Grand River had 3100 and 2700 ng of PCBs/sample, respectively. These two concentrations are about an order of magnitude higher than the older sites and are likely indicative of point source inputs. PAHs were present in SPMD samples from three sites near Kansas City. The contaminant residues sequestered by the SPMDs represent an estimation of the bioavailable (via respiration) contaminants present in the main stem of the lower Missouri River and three of its major tributaries following an extensive flood event.The semipermeable membrane device (SPMD) technology was employed to determine the presence of bioavailable organochlorine pesticides, polychlorinated biphenyls, and polyaromatic hydrocarbons in the water of the main stem of the lower Missouri River and three of its tributaries. The SPMD were deployed in 1994 following an extensive flood in 1993. Contaminants residues were found at all sites and at higher concentrations than found in the earlier pre-flood sampling.

Evaluation of stream flow effects on smolt survival in the Yakima River Basin, Washington, 2012-2014

USGS Publications Warehouse

Courter, Ian; Garrison, Tommy; Kock, Tobias J.; Perry, Russell W.

2015-01-01

The influence of stream flow on survival of emigrating juvenile (smolts) Pacific salmon Oncorhynchus spp. and steelhead trout O. mykiss is of key management interest. However, few studies have quantified flow effects on smolt migration survival, and available information does not indicate a consistent flow-survival relationship within the typical range of flows under management control. It is hypothesized that smolt migration and dam passage survival are positively correlated with stream flow because higher flows increase migration rates, potentially reducing exposure to predation, and reduce delays in reservoirs. However, available empirical data are somewhat equivocal concerning the influence of flow on smolt survival and the underlying mechanisms driving this relationship. Stream flow effects on survival of emigrating anadromous salmonids in the Yakima Basin have concerned water users and fisheries managers for over 20 years, and previous studies do not provide sufficient information at the resolution necessary to inform water operations, which typically occur on a small spatiotemporal scale. Using a series of controlled flow releases from 2012-2014, combined with radio telemetry, we quantified the relationship between flow and smolt survival from Roza Dam 208 km downstream to the Yakima River mouth, as well as for specific routes of passage at Roza Dam. A novel multistate mark-recapture model accounted for weekly variation in flow conditions experienced by radio-tagged fish. Groups of fish were captured and radio-tagged at Roza Dam and released at two locations, upstream at the Big Pines Campground (river kilometer [rkm] 211) and downstream in the Roza Dam tailrace (rkm 208). A total of 904 hatchery-origin yearling Chinook salmon O. tshawytscha were captured in the Roza Dam fish bypass, radio-tagged and released upstream of Roza Dam. Two hundred thirty seven fish were released in the tailrace of Roza Dam. Fish released in the tailrace of Roza Dam were tagged concurrently with fish released upstream of the dam using identical tagging methods. Tagging and release events were conducted to target a range of flow conditions indicative of flows observed during the typical migration period (March-May) for juvenile spring Chinook salmon in the Yakima River. Three, five and four separate upstream releases were conducted in 2012, 2013, and 2014 respectively, and at least 43 fish were released alive on each occasion. The release sample sizes in 2014 were much larger (~130) compared to previous years for the purpose of increasing precision of survival estimates across the range of flows tested. Migration movements of radio-tagged spring Chinook salmon smolts were monitored with an array of telemetry receiver stations (fixed sites) that extended 208 rkm downstream from the forebay of Roza Dam to the mouth of the Yakima River. Fixed monitoring sites included the forebay of Roza Dam (rkm 208), the tailrace of Roza Dam (rkm 207.9), the mouth of Wenas Creek (rkm 199.2), the mouth of the Naches River (two sites, rkm 189.4), Sunnyside Dam (two sites, rkm 169.1), Prosser Dam (rkm 77.2), and the mouth of the Yakima River (two sites, rkm2 3). This array segregated the study area into four discrete reaches in which survival of tagged fish was estimated. Aerial and underwater antennas were also used to monitor tagged fish at Roza Dam. Aerial antennas were located in the forebay, on the East gate, on the West gate, and in the tailrace of Roza Dam. Underwater antennas were located in the fish bypass, upstream of the East gate, and upstream of the West gate to collect route-specific passage data for tagged fish. Additional years of data collection and analysis could alter or improve our understanding of the influence of flow and other environmental factors on smolt survival in the Yakima River. Nevertheless, during 2012-2014, yearling hatchery Chinook salmon smolt emigration survival was significantly associated with stream flow in the

Concentration and spatial distribution of lead in soil used for ammunition destruction.

PubMed

do Nascimento Guedes, Jair; do Amaral Sobrinho, Nelson Moura Brasil; Ceddia, Marcos Bacis; Vilella, André Luis Oliveira; Tolón-Becerra, Alfredo; Lastra-Bravo, Xavier Bolívar

2012-10-01

Studies on heavy metal contamination in soils used for ammunition disposal and destruction are still emerging. The present study aimed to evaluate the contamination level and spatial distribution of lead in disposal and destruction areas. This site was used for ammunition disposal and destruction activities for 20 years. The ammunition destruction site (1,296 ha), a sampling system that followed a sampling grid (5 m × 5 m) with 30 points was adopted and samples were collected at the following five depths with a total of 150 samples. During the collection procedure, each sampling grid point was georeferenced using a topographic global positioning system. Data were validated through semivariogram and kriging models using Geostat software. The results demonstrated that the average lead value was 163 mg kg(-1), which was close to the investigation limit and the contamination levels were higher downstream than upstream. The results showed that there was lead contamination at the destruction site and that the contamination existed mainly at the surface layer depth. However, high lead concentrations were also found at deeper soil depths in the destruction area due to frequent detonations. According to the planimetry data, the areas that require intervention significantly decreased with increasing depths in the following order: 582.7 m(2) in the 0-20 cm layer; 194.6 m(2) in the 20-40 cm layer; 101.6 m(2) in the 40-60 cm layer; and 45.3 m(2) in the 60-80 cm layer.

Chemical data and lead isotopic compositions of geochemical baseline samples from streambed sediments and smelter slag, lead isotopic compositions in fluvial tailings, and dendrochronology results from the Boulder River watershed, Jefferson County, Montana

USGS Publications Warehouse

Unruh, Daniel M.; Fey, David L.; Church, Stan E.

2000-01-01

IntroductionAs a part of the U.S. Geological Survey Abandoned Mine Lands Initiative, metal-mining related wastes in the Boulder River study area in northern Jefferson County, Montana, have been evaluated for their environmental effects. The study area includes a 24-km segment of the Boulder River in and around Basin, Montana and three principal tributaries to the Boulder River: Basin Creek, Cataract Creek, and High Ore Creek. Mine and prospect waste dumps and mill wastes are located throughout the drainage basins of these tributaries and in the Boulder River. Mine-waste material has been transported into and down streams, where it has mixed with and become incorporated into the streambed sediments. In some localities, mine waste material was placed directly in stream channels and was transported downstream forming fluvial tailings deposits along the stream banks. Water quality and aquatic habitat have been affected by trace-element-contaminated sediment that moves from mine wastes into and down streams during snowmelt and storm runoff events within the Boulder River watershed.Present-day trace element concentrations in the streambed sediments and fluvial tailings have been extensively studied. However, in order to accurately evaluate the impact of mining on the stream environments, it is also necessary to evaluate the pre-mining trace-element concentrations in the streambed sediments. Three types of samples have been collected for estimation of pre-mining concentrations: 1) streambed sediment samples from the Boulder River and its tributaries located upstream from historical mining activity, 2) stream terrace deposits located both upstream and downstream of the major tributaries along the Boulder River, and 3) cores through sediment in overbank deposits, in abandoned stream channels, or beneath fluvial tailings deposits. In this report, we present geochemical data for six stream-terrace samples and twelve sediment-core samples and lead isotopic data for six terrace and thirteen core samples. Sample localities are in table 1 and figures 1 and 2, and site and sample descriptions are in table 2.Geochemical data have been presented for cores through fluvial tailings on High Ore Creek, on upper Basin Creek, and on Jack Creek and Uncle Sam Gulch. Geochemical and lead isotopic data for modern streambed-sediment samples have been presented by Fey and others.Lead isotopic determinations in bed sediments have been shown to be an effective tool for evaluating the contributions from various sources to the metals in bed sediments. However, in order to make these calculations, the lead isotopic compositions of the contaminant sources must also be known. Consequently, we have determined the lead isotopic compositions of five streambed-sediment samples heavily contaminated with fluvial mine waste immediately downstream from large mines in the Boulder River watershed in order to determine the lead isotopic signatures of the contaminants. Summary geochemical data for the contaminants are presented here and geochemical data for the streambed-sediment samples are given by Fey and others.Downstream from the Katie mill site and Jib tailings, fluvial deposits of mill tailings are present on a 10-m by 50-m bar in the Boulder River below the confluence with Basin Creek. The source of these tailings is not known, but fluvial tailings are also present immediately downstream from the Katie mill site, which is immediately upstream from the confluence with Basin Creek. Nine cores of fluvial tailings from this bar were analyzed.Dendrochronology samples were taken at several stream terrace localities to provide age control on the stream terrace deposits. Trees growing on the surfaces of stream terraces provide a minimum age for the terrace deposits, although floods subsequent to the trees' growth could have deposited post-mining overbank deposits around the trees. Historical data were also used to provide estimates of minimum ages of cultural features and to bracket the age of events.

Floodplain influence on carbon speciation and fluxes from the lower Pearl River, Mississippi

NASA Astrophysics Data System (ADS)

Cai, Yihua; Shim, Moo-Joon; Guo, Laodong; Shiller, Alan

2016-08-01

To investigate the floodplain influence on carbon speciation and export to the northern Gulf of Mexico, water samples were collected monthly from two sites in the East Pearl River (EPR) basin during 2006-2008. Additionally, four spatial surveys in the river basin between those two sites were also conducted. Compared with the upstream sampling site at Bogalusa, MS, dissolved inorganic carbon (DIC) and particulate organic carbon (POC) concentrations were 36% and 55% lower, respectively, and dissolved organic carbon (DOC) concentration was 49% higher at the downstream Stennis Space Center (SSC) site. In addition, the bulk DOC pool at SSC had a higher colloidal fraction than at Bogalusa (75% vs. 68%). Detailed spatial surveys revealed the differences between the upstream and downstream stations resulted both from input from Hobolochitto Creek, a tributary of the EPR, and from influence of the swamp-rich floodplain. The contributions from Hobolochitto Creek to the carbon pool in the EPR basin were lowest during a high flow event and reached a maximum during the dry season. Meanwhile, the floodplain in the EPR basin acted as a significant sink for DOC, POC and particulate nitrogen during summer and for suspended sediment during a high flow event. However, the floodplain was converted into a source of suspended sediment, DOC, and POC to the EPR during winter, revealing a dynamic nature and seasonality in the floodplain influence. Consistent with its dominant forest coverage, abundant wetlands along the river corridor, and mild anthropogenic disturbance, the Pearl River basin above Bogalusa generally had higher yields of DOC and POC (1903 and 1386 kg-C km-2 yr-1, respectively), but a lower yield of DIC (2126 kg-C km-2 yr-1) compared to other North American rivers. An estimation based on a mass balance approach suggests the interactions between floodplain and the main river stem could reduce the annual DIC and POC export fluxes from downstream of the EPR by 24% and 40%, respectively, but enhance the annual riverine DOC export by 25%. Similar scenarios likely occur in other wetland-rich coastal rivers and are capable of significantly altering the current estimation of riverine carbon export.

Reproductive success of belted kingfishers on the upper Hudson River.

PubMed

Bridge, Eli S; Kelly, Jeffrey F

2013-08-01

Belted kingfishers (Megaceryle alcyon) are predators in many North American aquatic ecosystems; as such, they are prone to bioaccumulation of certain environmental contaminants. In 2002 and 2004, kingfisher eggs collected near the upper Hudson River in New York had elevated concentrations of polychlorinated biphenyls (PCBs), and the kingfisher population in this area was reported to be at risk because of PCB exposure. From 2007 to 2009, the authors monitored 69 kingfisher nests on the Hudson River to track both nest success and survival of individual nestlings. The study site consisted of 2 adjacent sections of the Hudson River, 1 upstream and 1 downstream of a historic PCB source. The authors compared models of nest success that differentially incorporated the following 4 variables that they deemed most likely to affect reproductive output: 1) river section (upstream vs downstream of PCB source), 2) year, 3) hatch date, and 4) abandonment by 1 parent. After ranking models according to Akaike's information criterion for small sample sizes, it was clear that parental abandonment was the most important of the factors examined. River section was not an important parameter, and overall nesting success was slightly higher in the PCB-contaminated section than in the upstream area. These findings support the conclusion that kingfisher productivity is not adversely impacted by PCB contamination in the upper Hudson River. Copyright © 2013 SETAC.

Modification of suburban carbon and nitrogen fluxes by a coupled channel/floodplain system assessed using in situ sensors

NASA Astrophysics Data System (ADS)

Wollheim, W. M.; Pellerin, B. A.; Saraceno, J.; Hopkinson, C.; Hope, A.; Morse, N.

2010-12-01

Biogeochemical fluxes in human dominated streams and rivers are highly impacted, but effects can be attenuated downstream through natural ecosystem processes. We deployed in situ nitrate, fdom, and chlorophyll sensors to characterize biogeochemical fluxes draining a suburban catchment, and modifications by a channel-floodplain system located immediately downstream. The upstream site reflects the suburban signal; the downstream site reflects the influence of the channel/floodplain on the suburban signal. FDOM showed a diurnal signal at both sites, but was stronger downstream, likely indicating new DOC production within the channel-floodplain system, which contained a small pond. In situ chlorophyll concentrations were also highly correlated with FDOM. FDOM showed a stronger storm response upstream than downstream, indicating terrestrial sources are mobilized by storms and subsequent dampening of the pulse by the floodplain. Nitrate concentrations consistently dropped from 0.6 to 0.7 mg/l upstream to less than 0.4 mg/l downstream, indicating likely nitrogen retention or removal over a relatively short distance (~500m). Use of in situ sensors is likely to greatly advance our understanding of biogeochemical processes in aquatic systems.

A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

PubMed Central

Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

2000-01-01

Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

Sources and Transport of Nutrients, Organic Carbon, and Chlorophyll-a in the San Joaquin River Upstream of Vernalis, California, during Summer and Fall, 2000 and 2001

USGS Publications Warehouse

Kratzer, Charles R.; Dileanis, Peter D.; Zamora, Celia; Silva, Steven R.; Kendall, Carol; Bergamaschi, Brian A.; Dahlgren, Randy A.

2004-01-01

Oxidizable materials from the San Joaquin River upstream of Vernalis can contribute to low dissolved oxygen episodes in the Stockton Deep Water Ship Channel that can inhibit salmon migration in the fall. The U.S. Geological Survey collected and analyzed samples at four San Joaquin River sites in July through October 2000 and June through November 2001, and at eight tributary sites in 2001. The data from these sites were supplemented with data from samples collected and analyzed by the University of California at Davis at three San Joaquin River sites and eight tributary sites as part of a separate study. Streamflows in the San Joaquin River were slightly above the long-term average in 2000 and slightly below average in 2001. Nitrate loads at Vernalis in 2000 were above the long-term average, whereas loads in 2001 were close to average. Total nitrogen loads in 2000 were slightly above average, whereas loads in 2001 were slightly below average. Total phosphorus loads in 2000 and 2001 were well below average. These nutrient loads correspond with the flow-adjusted concentration trends--nitrate concentrations significantly increased since 1972 (p 0.05). Loading rates of nutrients and dissolved organic carbon increased in the San Joaquin River in the fall with the release of wetland drainage into Mud Slough and with increased reservoir releases on the Merced River. During August 2000 and September 2001, the chlorophyll-a loading rates and concentrations in the San Joaquin River declined and remained low during the rest of the sampling period. The most significant tributary sources of nutrients were the Tuolumne River, Harding Drain, and Mud Slough. The most significant tributary sources of dissolved organic carbon were Salt Slough, Mud Slough, and the Tuolumne and Stanislaus Rivers. Compared with nutrients and dissolved organic carbon, the tributaries were minor sources of chlorophyll-a, suggesting that most of the chlorophyll-a was produced in the San Joaquin River rather than its tributaries. On the basis of the carbon-to-nitrogen ratios and the d13C of particulate organic matter in the San Joaquin River and tributaries, the particulate organic matter in the river was mostly phytoplankton. On the basis of the d15N values of the particulate organic matter, and of total dissolved nitrogen and nitrate, the nitrate in the San Joaquin River probably was a significant nutrient source for the phytoplankton. The range of d15N and d18O values of nitrate in the San Joaquin River and tributaries suggest that animal waste or sewage was a significant source of nitrate in the river at the time the samples were collected.

Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

PubMed Central

Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

1997-01-01

GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

The effect of residential and agricultural runoff on the microbiology of a Hawaiian ahupua'a.

PubMed

Frank, Kiana

2005-01-01

The objective of this project was to study the relationship between environmental runoff and the incidence of antibiotic-resistant microorganisms (ARMO) in freshwater streams. Five water systems along the windward coast of the island of O'ahu were evaluated. Samples were collected from sites upstream of residential or agricultural areas, throughout these areas, and at sites of entrance into oceans or bays. It was hypothesized that the incidence of ARMO would increase as the stream received runoff from residential and agricultural areas. The percentage of ARMO did not increase as the streams passed through residential or agricultural areas. Surprisingly, pristine sites, well upstream from residential or agricultural areas, contained bacteria resistant to at least one antibiotic. Areas most affected by runoff did not show a significant increase in the incidence of antibiotic-resistant organisms, suggesting that the incidence of antibiotic resistance is not simply a function of contamination with agricultural or residential runoff. The correlation of antibiotic resistance with heavy metal resistance was evaluated, because others (Fasim et al., 1999; Lazar et al., 2002; Nies, 1999) have shown that antibiotic and heavy metal resistance are each carried on extrachromosomal plasmids. The vast majority of ARMO were also resistant to concentrations of heavy metals reported in the sediments of indicator streams (Waihee, system III), suggesting that an antibiotic-resistant bacterium has a high probability of having dual resistance to a heavy metal. A 3.2-kb plasmid (pSTAMP) was isolated from a bacterium with dual antibiotic and heavy metal resistance. Further analysis of the plasmid is currently in progress.

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

Identification of compounds bound to suspended solids causing sub-lethal toxic effects in Daphnia magna. A field study on re-suspended particles during river floods in Ebro River.

PubMed

Rivetti, Claudia; Gómez-Canela, Cristian; Lacorte, Silvia; Díez, Sergi; Lázaro, Wilkinson L; Barata, Carlos

2015-04-01

Identifying chemicals causing adverse effects in organisms present in water remains a challenge in environmental risk assessment. This study aimed to assess and identify toxic compounds bound to suspended solids re-suspended during a prolonged period of flushing flows in the lower part of Ebro River (NE, Spain). This area is contaminated with high amounts of organochlorine and mercury sediment wastes. Chemical characterization of suspended material was performed by solid phase extraction using a battery of non-polar and polar solvents and analyzed by GC-MS/MS and LC-MS/MS. Mercury content was also determined for all sites. Post-exposure feeding rates of Daphnia magna were used to assess toxic effects of whole and filtered water samples and of re-constituted laboratory water with re-suspended solid fractions. Organochlorine and mercury residues in the water samples increased from upstream to downstream locations. Conversely, toxic effects were greater at the upstream site than downstream of the superfund Flix reservoir. A further analysis of the suspended solid fraction identified a toxic component eluted within the 80:20 methanol:water fraction. Characterization of that toxic component fraction by LC-MS/MS identified the phytotoxin anatoxin-a, whose residue levels were correlated with observed feeding inhibition responses. Further feeding inhibition assays conducted in the lab using anatoxin-a produced from Planktothrix agardhii, a filamentous cyanobacteria, confirmed field results. This study provides evidence that in real field situation measured contaminant residues do not always agree with toxic effects. Copyright © 2015 Elsevier B.V. All rights reserved.

Occurrence and transport of diazinon in the Sacramento River, California, and selected tributaries during three winter storms, January-February 2000

USGS Publications Warehouse

Dileanis, Peter D.; Bennett, Kevin P.; Domagalski, Joseph L.

2002-01-01

The organophosphate pesticide diazinon is applied as a dormant orchard spray in the Sacramento Valley, California, during the winter when the area receives a majority of its annual rainfall. Dormant spray pesticides, thus, have the potential to wash off the areas of application and migrate with storm runoff to streams in the Sacramento River Basin. Previous monitoring studies have shown that rain and associated runoff from winter storms plays an important role in the transport of diazinon from point of application to the Sacramento River and tributaries. Between January 30 and February 25, 2000, diazinon concentrations in the Sacramento River and selected tributaries were monitored on 5 consecutive days during each of three winter storms that moved through the Sacramento Valley after diazinon had been applied to orchards in the basin. Water samples were collected at 17 sites chosen to represent the effect of upstream land use at local and regional scales. Most samples were analyzed using an enzyme-linked immunosorbent assay (ELISA). Analysis by gas chromatography with electron capture detector and thermionic specific detector (GC/ECD/TSD) and gas chromatography with mass spectrometry (GC/MS) was done on split replicates from over 30 percent of the samples to confirm ELISA results and to provide lower analytical reporting limits at selected sites [30 ng/L (nanogram per liter) for ELISA, 20 ng/L for GC/ECD/TSD, and 2 ng/L for GC/MS]. Concentrations determined from ELISA analyses were consistently higher than concentrations for split samples analyzed by gas chromatography methods. Because of bias between diazinon concentrations using ELISA and gas chromatography methods, results from ELISA analyses were not compared to water-quality criteria. Load calculations using the ELISA analyses are similarly biased. Because the bias was consistent, however, the ELISA data is useful in site-to-site comparisons used to rank the relative levels and contributions of diazinon from individual subbasins in the watershed. Concentrations of diazinon in 138 samples analyzed by gas chromatography methods ranged from below detection (2 ng/L) to 2,890 ng/L with a median of 44 ng/L. Thirty percent of the samples had concentrations greater than 80 ng/L, which is considered by California as the criterion maximum concentration for the protection of aquatic habitat. Concentrations were highest in small tributaries and canals draining subbasins with predominantly agricultural land use and in a channel draining the Yuba City urban area. Load estimates using concentrations derived from GC/MS analyses indicate that about 30 percent of the diazinon in the lower Sacramento River is from the Feather River Basin. Loads estimated using ELISA analyses show a similar, but slightly higher fraction of the total load coming from that basin. The source of over half the total load measured at Sacramento River at Alamar appears to have originated in the part of the drainage basin upstream of the city of Colusa. Of the diazinon reported applied to agricultural land in Sacramento Valley (about 42,500 pounds active ingredient) just before and during the monitoring period, about 0.4 percent appeared to be transported to the lower Sacramento River during the period of monitoring. A similar percent of applied diazinon was estimated to have entered the Feather River from upstream sources. Diazinon use in the study area during the 1999-2000 dormant spray season was unusually low, about 60 percent of the average of the previous 4 years. Therefore, diazinon loadings may be higher in subsequent years, should use increase and pesticide management practices remain the same. Although diazinon was the most frequently detected pesticide and the pesticide detected at the highest concentrations, 10 other pesticides were detected in the samples collected. These included the insecticides methidathion and chlorpyrifos, and the herbicides simazine, molinate and thiobencarb.

Mapping and Eradication Prioritization Modeling of Red Sesbania ( Sesbania punicea) Populations

NASA Astrophysics Data System (ADS)

Robison, Ramona; Barve, Nita; Owens, Christina; Skurka Darin, Gina; DiTomaso, Joseph M.

2013-07-01

Red sesbania is an invasive South American shrub that has rapidly expanded its range along California waterways, emphasizing the need to prioritize eradication sites at a regional scale. To accomplish this, we updated baseline location data in summer 2010 using field surveys throughout the state. We collected relevant GPS attribute data for GIS analysis and eradication prioritization modeling. The regional survey identified upstream and downstream extents for each watershed, as well as outliers in urban areas. We employed the Weed Heuristics: Invasive Population Prioritization for Eradication Tool (WHIPPET) to prioritize red sesbania sites for eradication, and revised the WHIPPET model to consider directional propagule flow of a riparian species. WHIPPET prioritized small populations isolated from larger infestations, as well as outliers in residential areas. When we compared five experts' assessments of a stratified sample of the red sesbania populations to WHIPPET's prioritization results, there was a positive, but nonsignificant, correlation. The combination of WHIPPET and independent expert opinion suggests that small, isolated populations and upstream source populations should be the primary targets for eradication. Particular attention should be paid to these small populations in watersheds where red sesbania is a new introduction. The use of this model in conjunction with evaluation by the land manager may help prevent the establishment of new seed sources and protect uninfested riparian corridors and their adjacent watersheds.

Mapping and eradication prioritization modeling of red sesbania (Sesbania punicea) populations.

PubMed

Robison, Ramona; Barve, Nita; Owens, Christina; Skurka Darin, Gina; DiTomaso, Joseph M

2013-07-01

Red sesbania is an invasive South American shrub that has rapidly expanded its range along California waterways, emphasizing the need to prioritize eradication sites at a regional scale. To accomplish this, we updated baseline location data in summer 2010 using field surveys throughout the state. We collected relevant GPS attribute data for GIS analysis and eradication prioritization modeling. The regional survey identified upstream and downstream extents for each watershed, as well as outliers in urban areas. We employed the Weed Heuristics: Invasive Population Prioritization for Eradication Tool (WHIPPET) to prioritize red sesbania sites for eradication, and revised the WHIPPET model to consider directional propagule flow of a riparian species. WHIPPET prioritized small populations isolated from larger infestations, as well as outliers in residential areas. When we compared five experts' assessments of a stratified sample of the red sesbania populations to WHIPPET's prioritization results, there was a positive, but nonsignificant, correlation. The combination of WHIPPET and independent expert opinion suggests that small, isolated populations and upstream source populations should be the primary targets for eradication. Particular attention should be paid to these small populations in watersheds where red sesbania is a new introduction. The use of this model in conjunction with evaluation by the land manager may help prevent the establishment of new seed sources and protect uninfested riparian corridors and their adjacent watersheds.

Bioaccumulation of polycyclic aromatic hydrocarbons in bivalves from Sugarland Run and the Potomac River

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barber, T.R.; Lauren, D.J.; Dimitry, J.A.

1995-12-31

A bioaccumulation study was conducted following a release of Fuel Oil {number_sign}2 into Sugarland Run, a small northern Virginia stream. Caged clams (Corbicula sp.) were placed in 3 downstream locations and 2 upstream reference areas for an exposure period of approximately 28 days. In addition, resident clams from the Potomac River were sampled at the start of the study and at 4 and 8 weeks. Chemical fingerprinting techniques were employed to identify spill-related polycyclic aromatic hydrocarbons (PAHs) and to differentiate these compounds from background sources of contamination. The greatest concentration of spill-related PAHs (2 and 3-ring compounds) were measured inmore » clams placed immediately downstream of the spill site, and tissue concentrations systematically decreased with distance from the spill site. PAHs that were not related to Fuel Oil {number_sign}2 were found in all clams and accounted for up to 90% of the total body burden at downstream locations. Furthermore, the highest concentrations of 4-, 5-, and 6-ring PAH were found at the upstream reference location, and indicated an important source of PAHs into the environment. Body burdens measured in this study were compared to ambient concentrations reported for bivalves from a variety of environments. Tissue concentrations were also compared to concentrations that have been reported to cause adverse biological effects.« less

Inorganic chemistry of water and bed sediment in selected tributaries of the south Umpqua River, Oregon, 1998

USGS Publications Warehouse

Hinkle, Stephen R.

1999-01-01

Ten sites on small South Umpqua River tributaries were sampled for inorganic constituents in water and streambed sediment. In aqueous samples, high concentrations (concentrations exceeding U.S. Environmental Protection Agency criterion continuous concentration for the protection of aquatic life) of zinc, copper, and cadmium were detected in Middle Creek at Silver Butte, and the concentration of zinc was high at Middle Creek near Riddle. Similar patterns of trace-element occurrence were observed in streambed-sediment samples.The dissolved aqueous load of zinc carried by Middle Creek along the stretch between the upper site (Middle Creek at Silver Butte) and the lower site (Middle Creek near Riddle) decreased by about 0.3 pounds per day. Removal of zinc from solution between the upper and lower sites on Middle Creek evidently was occurring at the time of sampling. However, zinc that leaves the aqueous phase is not necessarily permanently lost from solution. For example, zinc solubility is pH-dependent, and a shift between solid and aqueous phases towards release of zinc to solution in Middle Creek could occur with a perturbation in stream-water pH. Thus, at least two potentially significant sources of zinc may exist in Middle Creek: (1) the upstream source(s) producing the observed high aqueous zinc concentrations and (2) the streambed sediment itself (zinc-bearing solid phases and/or adsorbed zinc). Similar behavior may be exhibited by copper and cadmium because these trace elements also were present at high concentrations in streambed sediment in the Middle Creek Basin.

Fish assemblages in the Upper Esopus Creek, NY: Current status, variability, and controlling factors

USGS Publications Warehouse

Baldigo, Barry P.; George, Scott D.; Keller, Walter T

2015-01-01

The Upper Esopus Creek receives water diversions from a neighboring basin through the Shandaken Tunnel (the portal) from the Schoharie Reservoir. Although the portal is closed during floods, mean flows and turbidity of portal waters are generally greater than in Esopus Creek above their confluence. These conditions could potentially affect local fish assemblages, yet such effects have not been assessed in this highly regulated stream. We studied water quality, hydrology, temperature, and fish assemblages at 18 sites in the Upper Esopus Creek during 2009–2011 to characterize the effects of the portal input on resident-fish assemblages and to document the status of the fishery resource. In general, fish-community richness increased by 2–3 species at mainstem sites near the portal, and median density and biomass of fish communities at sites downstream of the portal were significantly lower than they were at sites upstream of the portal. Median densities of Salmo trutta (Brown Trout) and all trout species were significantly lower than at mainstem sites downstream from the portal—25.1 fish/0.1 ha and 148.9 fish/0.1 ha, respectively—than at mainstem sites upstream from the portal—68.8 fish/0.1 ha and 357.7 fish/0.1 ha, respectively—yet median biomass for Brown Trout and all trout did not differ between sites from both reaches. The median density of young-of-year Brown Trout at downstream sites (9.3 fish/0.1 ha) was significantly lower than at upstream sites (33.9 fish/0.1 ha). Waters from the portal appeared to adversely affect the density and biomass of young-of-year Brown Trout, but lower temperatures and increased flows also improved habitat quality for mature trout at downstream sites during summer. These findings, and those from companion studies, indicate that moderately turbid waters from the portal had few if any adverse impacts on trout populations and overall fish communities in the Upper Esopus Creek during this study.

[Spatiotemporal variation characteristics of heavy metals pollution in the water, soil and sediments environment of the Lean River-Poyang Lake Wetland].

PubMed

Jian, Min-Fei; Li, Ling-Yu; Xu, Peng-Fei; Chen, Pu-Qing; Xiong, Jian-Qiu; Zhou, Xue-Ling

2014-05-01

Overlying water, sediments, surface soils in the typical wetland areas of Lean River and Poyang Lake which were rich in non-ferrous metal mineral resources on both sides of the river, were chosen for monitoring heavy metals including copper, lead and cadmium of base flow in average season, flood season, and dry season in 2012. Statistical analysis methods were coupled to characterize the spatiotemporal variation of heavy metals pollution and identify the main sources. The results indicated that the concentrations of copper were the highest in all samples of each sampling sites in the Lean River-Poyang Lake wetland. And the content values of copper, lead and cadmium in different samples of different sampling sites also showed that the content values of copper were higher than those of lead, and the content values of lead were also higher than those of cadmium. The results also showed that the heavy metals pollution of copper, lead and cadmium in flood season was the heaviest whereas the heavy metals pollution in dry season was comparatively light. The results of the contents of the three kinds of heavy metals elements in different sampling sites of the watersheds of lean River showed that the contents of copper in the samples from the upstream sampling sites of Lean River were higher than those of other samples from other sites. And the contents of lead in the samples from the downstream sampling sites of Lean River were higher than those of other samples from other sampling sites. The contents of cadmium in the samples from the midstream sampling sites of Lean River were higher than those of other samples from other sites. The first principal component representing copper pollution explained 36. 99% of the total variance of water quality. The second principal component concerning representing lead pollution explained 30. 12% of the total variance. The correlation analysis results showed that there were significant positive correlations among the contents of copper in sediments and the contents of copper in overlying water. And there was also significant positive correlation between the contents of copper in sediments and the contents of copper in the surface soils. And the correlation analysis showed that there were significant positive correlations among the contents of cadmium in sediments and the contents of cadmium in surface soils. The above results reflected that the copper pollution or cadmium sources of water, soil and sediments were consistent, which were mainly from heavy metal acidic waste of mining emissions. The correlations between other components were not very obvious, which reflected the sources of pollutants were different.

Effects Of Leaky Sewers On Groundwater Quality

NASA Astrophysics Data System (ADS)

Leschik, S.; Musolff, A.; Reinstorf, F.; Strauch, G.; Oswald, S. E.; Schirmer, M.

2007-12-01

The impact of urban areas on groundwater quality has become an emerging research field in hydrogeology. Urban subsurface infrastructures like sewer networks are often leaky, so untreated wastewater may enter the urban aquifer. The transport of wastewater into the groundwater is still not well understood under field conditions. In the research platform WASSER Leipzig (Water And Sewershed Study of Environmental Risk in Leipzig- Germany) the effects of leaky sewers on the groundwater quality are investigated. The research is focused on the occurrence and transport of so-called "xenobiotics" such as pharmaceuticals and personal care product additives. Xenobiotics may pose a threat on human health, but can also be considered a marker for an urban impact on water resources. A new test site was established in Leipzig to quantify mass fluxes of xenobiotics into the groundwater from a leaky sewer. Corresponding to the leaks which were detected by closed circuit television inspections, monitoring wells were installed up- and downstream of the sewer. Concentrations of eight xenobiotics (technical-nonylphenol, bisphenol-a, caffeine, galaxolide, tonalide, carbamazepine, phenazone, ethinylestradiol) obtained from first sampling programmes were found to be highly heterogeneous, but a relation between the position of the sampling points and the sewer could not be clearly identified. However, concentrations of sodium, chloride, potassium and nitrate increased significantly downstream of the sewer which may be due to wastewater exfiltration, since no other source is known on the water flowpath from the upstream to the downstream wells. Because of the highly heterogeneous spatial distribution of xenobiotics at the test site, a monitoring concept was developed comprising both high-resolution sampling and an integral approach to obtain representative average concentrations. Direct-push techniques were used to gain insight into the fine-scale spatial distribution of the target compounds. An integral pumping test was performed to determine the total xenobiotic mass fluxes along control planes down- and upstream of the leaky sewer. The new monitoring concept helped to obtain robust estimates of xenobiotic mass fluxes into the groundwater.

Questa baseline and pre-mining ground-water quality investigation. 20. Water chemistry of the Red River and selected seeps, tributaries, and precipitation, Taos County, New Mexico, 2000-2004

USGS Publications Warehouse

Verplanck, P.L.; McCleskey, R. Blaine; Nordstrom, D. Kirk

2006-01-01

As part of a multi-year project to infer the pre-mining ground-water quality at Molycorp's Questa mine site, surface-water samples of the Red River, some of its tributaries, seeps, and snow samples were collected for analysis of inorganic solutes and of water and sulfate stable isotopes in selected samples. The primary aim of this study was to document diel, storm event, and seasonal variations in water chemistry for the Red River and similar variations in water chemistry for Straight Creek, a natural analog site similar in topography, hydrology, and geology to the mine site for inferring pre-mining water-quality conditions. Red River water samples collected between 2000 and 2004 show that the largest variations in water chemistry occur during late summer rainstorms, often monsoonal in nature. Within hours, discharge of the Red River increased from 8 to 102 cubic feet per second and pH decreased from 7.80 to 4.83. The highest concentrations of metals (iron, aluminum, zinc, manganese) and sulfate also occur during such events. Low-pH and high-solute concentrations during rainstorm runoff are derived primarily from alteration 'scar' areas of naturally high mineralization combined with steep topography that exposes continually altered rock because erosion is too rapid for vegetative growth. The year 2002 was one of the driest on record, and Red River discharge reflected the low seasonal snow pack. No snowmelt peak appeared in the hydrograph record, and a late summer storm produced the highest flow for the year. Snowmelt was closer to normal during 2003 and demonstrated the dilution effect of snowmelt on water chemistry. Two diel sampling events were conducted for the Red River, one during low flow and the other during high flow, at two locations, at the Red River gaging station and just upstream from Molycorp's mill site. No discernible diel trends were observed except for dissolved zinc and manganese at the upstream site during low flow. Straight Creek drainage water was sampled periodically from 2001 to 2004 at the down stream end of surface drainage near the point at which it disappeared into the debris fan. This water has a minimal range in pH (2.7 to 3.2) but a substantial concentration range in many solutes; for example, sulfate concentrations varied from 525 to 2,660 mg/L. Many elements covary with sulfate suggesting that dilution is the primary control of the range in solute concentrations. A transect of water samples higher in the scar area were collected in October of 2003. They had a lower range in pH (2.44 to 3.05) and higher solute concentrations than those collected periodically from lower in the catchment. Water isotopes for the upper transect samples indicated slight evaporation, and in part, may account for the higher solute concentrations. Drainage waters also were collected from Hottentot, Junebug, Hansen, Little Hansen, and Goat Hill Gulch drainages. Most constituents from other scar drainage waters showed ranges of concentration similar to those of the Straight Creek waters. An exception was water collected from Goat Hill Gulch, which has some of the highest concentrations of any surface-water sample collected but also contained waste-rock leachates.

Suspended sediment and bedload in the First Broad River Basin in Cleveland County, North Carolina, 2008-2009

USGS Publications Warehouse

Hazell, William F.; Huffman, Brad A.

2011-01-01

A study was conducted to characterize sediment transport upstream and downstream from a proposed dam on the First Broad River near the town of Lawndale in Cleveland County, North Carolina. Streamflow was measured continuously, and 381 suspended-sediment samples were collected between late March 2008 and September 2009 at two monitoring stations on the First Broad River to determine the suspended-sediment load at each site for the period April 2008-September 2009. In addition, 22 bedload samples were collected at the two sites to describe the relative contribution of bedload to total sediment load during selected events. Instantaneous streamflow, suspended-sediment, and bedload samples were collected at Knob Creek near Lawndale, North Carolina, to describe general suspended-sediment and bedload characteristics at this tributary to the First Broad River. Suspended- and bedload-sediment samples were collected at all three sites during a variety of flow conditions. Streamflow and suspended-sediment measurements were compared with historical data from a long-term (1959-2009) streamflow station located upstream from Lawndale. The mean streamflow at the long-term streamflow station was approximately 60 percent less during the study period than the long-term annual mean streamflow for the site. Suspended-sediment concentrations and continuous records of streamflow were used to estimate suspended-sediment loads and yields at the two monitoring stations on the First Broad River for the period April 2008-September 2009 and for a complete annual cycle (October 2008-September 2009), also known as a water year. Total suspended-sediment loads during water year 2009 were 18,700 and 36,500 tons at the two sites. High-flow events accounted for a large percentage of the total load, suggesting that the bulk of the total suspended-sediment load was transported during these events. Suspended-sediment yields during water year 2009 were 145 and 192 tons per square mile at the two monitoring stations. Historically, the estimated mean annual suspended-sediment yield at the long-term streamflow station during the period 1970-1979 was 250 tons per square mile, with an estimated mean annual suspended-sediment load of 15,000 tons. Drought conditions throughout most of the study period were a potential factor in the smaller yields at the monitoring stations compared to the yields estimated at the long-term streamflow station in the 1970s. During an extreme runoff event on January 7, 2009, bedload was 0.4 percent, 0.8 percent, and 0.1 percent of the total load at the three study sites, which indicates that during extreme runoff conditions the percentage of the total load that is bedload is not significant. The percentages of the total load that is bedload during low-flow conditions ranged from 0.1 to 90.8, which indicate that the bedload is variable both spatially and temporally.

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

PubMed Central

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

PubMed

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

Assessing dissolved carbon transport and transformation along an estuarine river with stable isotope analyses

NASA Astrophysics Data System (ADS)

He, Songjie; Xu, Y. Jun

2017-10-01

Estuaries play an important role in the dynamics of dissolved carbon from rivers to coastal oceans. However, our knowledge of dissolved carbon transport and transformation in mixing zones of the world's coastal rivers is still limited. This study aims to determine how dissolved inorganic carbon (DIC) and dissolved organic carbon (DOC) concentrations and stable isotopes (δ13CDIC and δ13CDOC) change along an 88-km long estuarine river, the Calcasieu River in Louisiana, southern USA, with salinity ranging from 0.02 to 21.92. The study is expected to elucidate which processes most likely control carbon dynamics in a freshwater-saltwater mixing system, and to evaluate the net metabolism of this estuary. Between May 2015 and February 2016, water samples were collected and in-situ measurements on ambient water conditions were performed during five field trips at six sites from upstream to downstream of the Calcasieu River, which enters the Northern Gulf of Mexico (NGOM). The DIC concentration and δ13CDIC increased rapidly with increasing salinity in the mixing zone. The average DIC concentration and δ13CDIC at the site closest to the NGOM (site 6) were 1.31 mM and -6.34‰, respectively, much higher than those at the site furthest upstream (site 1, 0.42 mM and -20.83‰). The DIC concentrations appeared to be largely influenced by conservative mixing, while high water temperature may have played a role in deviating DIC concentration from the conservative line due likely to increased respiration and decomposition. The δ13CDIC values were close to those suggested by the conservative mixing model for May, June and November, but lower than those for July and February, suggesting that an estuarine river can fluctuate from a balanced to a heterotrophic system (i.e., production/respiration (P/R) < 1) seasonally. Unlike the DIC longitudinal trend, the DOC concentrations in the river estuary decreased from upstream to downstream, but to a much smaller degree. The DOC concentrations consistently showed a deviation from those suggested by the conservative mixing model, which may have been a consequence of in-stream photosynthesis. This river estuary consistently showed depleted δ13CDOC values (i.e., from -30.56‰ to -25.92‰), suggesting that the DOC source in the mixing zone was highly terrestrially derived. However, in this relatively small isotopic range, δ13CDOC alone has limitations in differentiating carbon produced by aquatic photosynthesis from carbon produced by terrestrial photosynthesis in a river-ocean continuum.

Use of a Fish Transportation Barge for Increasing Returns of Steelhead Imprinted for Homing, Final Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harmon, Jerrel R.

1989-08-01

The objective of this 7-year National Fisheries Service study, which began is 1982, was to determine if transporting juvenile steelhead (Oncorhynchus mykiss) by truck and barge from Dworshak National Fish Hatchery (NFH), on the Clearwater River, to a release site on the Columbia River below Bonneville Dam would result in increased returns of adults to the various fisheries and to the hatchery homing site. During 1982 and 1983, over 500,000 marked juvenile steelhead were serially released as controls from the hatchery or barged as test fish to below Bonneville Dam. Recoveries of marked adults to various recovery sites are complete.more » Fish released in 1983 showed a stronger homing ability and more rapid upstream migration than test fish released in 1982. Most adults from both control and test releases in 1983 and control releases in 1982 migrated a considerable distance upstream and overwintered in the Snake and Clearwater Rivers--behavior similar to Clearwater River fish previously transported from Lower Granite Dam. In contrast, many of the adults from test releases in 1982 failed to migrate upstream during the fall, overwintered in the Columbia River, and migrated upstream the following spring. Survival of control fish released at Dworshak NFH in late April 1982 was substantially higher than survival of those released in mid-May. Survival and homing of control fish released in late April and early May 1983 were over 10 times that for fish released in late May. Return of adults from normal hatchery releases in 1982 was the highest ever observed at Dworshak NFH.« less

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

Temporal and spatial patterns of wetland sedimentation, West Tennessee

USGS Publications Warehouse

Hupp, C.R.; Bazemore, D.E.

1993-01-01

Dendrogeomorphic techniques were used to describe and interpret patterns of sedimentation rates at two forested wetland sites in West Tennessee. Fifty-five sampling stations were established along transects upstream and downstream from bridge structures, and 515 trees were examined for depth of sediment accretion and cored for age determination. Temporal variation in sedimentation rate may be related more to stream channelization and agricultural activity than to bridge and causeway construction. Sedimentation rates have increased substantially in the last 28 years, although channelized streams may have overall lower rates than unchannelized streams. Comparisons of sedimentation rates from deposition over artificial markers (short term) with those determined from tree-ring analysis (long-term) indicate that trends are similar where hydrogeomorphic conditions have not been altered substantially. No tendency for increased sedimentation upstream from bridges was observed. Deposition rates were inversely correlated with elevation and degree of ponding. Downstream deposition of sand splays appears to be related to flow constrictions and may be extensive. Mean overall rates of sedimentation (between 0.24 and 0.28 cm year-1), determined dendrogeomorphically, are comparable with other published rates. ?? 1993.

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Olsen, Todd Andrew; Brandt, Craig C.; Brooks, Scott C.

Mercury (Hg) methylation and methylmercury (MMHg) demethylation activity of periphyton biofilms from East Fork Poplar Creek, Tennessee, USA (EFPC) were measured during 2014-2015 using stable Hg isotopic rate assays. 201Hg II and MM 202Hg were added to intact periphyton samples and the formation of MM 201Hg and loss of MM 202Hg were monitored over time and used to calculate first-order rate constants for methylation and demethylation, respectively. The influence of location, temperature/season, light exposure and biofilm structure on methylation and demethylation were examined. Between-site differences in net methylation for samples collected from an upstream versus downstream location were driven bymore » differences in the demethylation rate constant (k d). In contrast, the within-site seasonal difference in net methylation was driven by changes in the methylation rate constant (k m). Samples incubated in the dark had lower net methylation due to km values that were 60% less than those incubated in the light. Disrupting the biofilm structure decreased km by 50% and resulted in net demethylating conditions. Overall, the measured rates resulted in a net excess of MMHg generated which could account for 27-85% of the MMHg flux in EFPC and suggests intact, actively photosynthesizing periphyton biofilms harbor zones of MMHg production.« less

Bed Sediment Monitoring of Multiple Contiguous Small Dam Removals

NASA Astrophysics Data System (ADS)

Galster, J. C.; Wyrick, J. R.

2010-12-01

Dam removal is crucial for reconnecting river habitats, restoring passage of fish and other aquatic organisms, and restoring the free flow of water and sediment. However, removal of obsolete dams is often resisted due to concerns of releasing sediment and initiating channel instability. Two dams on the Musconetcong River in northern New Jersey have been removed as part of a watershed-wide effort to remove or breach all major obstructions to restore the river to its original free-flowing state. The two dams were consecutively situated 1 kilometer apart and their removals provided an opportunity to study the geomorphic response in the form of bed elevation changes and sediment size through pre- and post-removal monitoring. Initial geomorphic surveys of the riverbed in the vicinity of and between the two dams have shown areas of erosion and deposition. These surveys have established a set of control points along the river channel between the two dams, and confirm the downstream movement of a sediment plume and localized areas of erosion. At the upstream dam, comparisons pre- and post-dam removal surveys show greater than 100 cubic meters of sediment being both eroded and deposited within the site. Most but not all of the erosion occurred around the newly exposed sediment bar upstream of the former dam, where the thalweg has reestablished itself following the dam’s removal. Areas that were excavated during removal have experienced deposition. Most of the deposition occurred downstream and on the left-hand bank. Due to the two low flow culverts in the former dam, a mid-channel sediment bar formed but has subsequently eroded. At the downstream dam site, erosion has removed up to 1.1 m of sediment from the bed in places while depositing up to 0.5 m sediment in others. As sediment from the former impoundment migrated through the project site, areas excavated during the removal became areas of deposition following the removal, and; alternately, areas in the channel margins where sediments were placed experienced gradual erosion. Grain size analysis shows a coarsening of the riverbed over the first nine months since removal. Grain size analyses were done upstream and downstream of the dam sites as well as at two locations between the sites. Pebble counts were completed using the random walk method at each of the six sites. The largest change in grain sizes at the four sites occurred upstream of the downstream dam site, where there was a significant coarsening of the sediment from October 2008 to June 2009. This has most likely occurred from the increase in energy upstream of the dam post-removal, which has transported many of the fine-grained sediments downstream. Downstream of this dam site sediment size has not significantly changed, suggesting that the fine sediments have been transported downstream far enough to leave the site. Surveys of the channel thalweg above and below both dams also show a pulse of sediment migrating slowing from the uppermost impoundment areas. Long-term monitoring of the channel thalweg may reveal reach-level changes in channel slope.

Trends in chlorinated hydrocarbon levels in Hudson River basin sediments.

PubMed

Bopp, R F; Chillrud, S N; Shuster, E L; Simpson, H J; Estabrooks, F D

1998-08-01

Analysis of sections from dated sediment cores were used to establish geographic distributions and temporal trends of chlorinated hydrocarbon contaminant levels in sediments from natural waters of the Hudson River basin. Radiometric dating was based primarily on the depth distribution of 137(Cs) in the cores and on the occurrence of detectable levels of 7(Be) in surface sediment samples. Eighteen sampling sites included several along the main stem of the Hudson, its major tributaries, and components of the New York/New Jersey (NY/NJ) harbor complex. Drinking-water reservoirs were sampled to place upper limits on atmospheric inputs. Core sections were analyzed for polychlorinated biphenyls (PCBs), 1,1,1-trichloro-2,2-bis(p-chlorophenyl) ethane (DDT)-derived compounds, chlordane, and dioxins. Sediment concentrations of most contaminants at most sites have decreased significantly since the mid-1960s. The data provide a basinwide perspective on major point-source inputs of PCBs to the upper Hudson River and of 2,3,7,8-tetrachlorodibenzo-p-dioxin and DDT to the lower Passaic River. Evidence was found for significant but poorly characterized sources of PCBs and chlordane to the western NY/NJ harbor, and of highly chlorinated dioxins to the upstream sites on the main stem of the Hudson. The results indicate that analysis of dated sediment samples is a most effective and efficient monitoring tool for the study of large-scale geographic and temporal trends in levels of particle-associated contaminants.

Occurrence of organic wastewater-indicator compounds in urban streams of the Atlanta area, Georgia, 2003-2006

USGS Publications Warehouse

Lawrence, Stephen J.; LaFontaine, Jacob H.

2010-01-01

The similarity in the pattern and distribution of OWICs in samples at sites upstream and downstream from known CSO outfalls indicates that CSOs were not the dominant source of OWICs during the study period. Other sources may include non-sewage discharges-both permitted, permitted but out of compliance, and non-permitted, contaminated groundwater from leaking sewer lines or septic systems, sanitary-sewer overflows, or dry-weather runoff from outdoor water use. These OWICs may be better suited for identifying sewage-contaminated groundwater than sewage-contaminated surface water because groundwater is not typically affected by the OWICs that are more common in urban runoff.

Preimpoundment water quality of the Wild Rice River, Norman County, Minnesota

USGS Publications Warehouse

Tornes, L.H.

1980-01-01

Water samples have been collected at two sites on the Wild Rice River since September 1974 to establish baseline water-quality characteristics before construction of a reservoir for recreation and flood control near Twin Valley, Minn. A decline in water quality between the sites is shown by mean total phosphorus concentrations, which increase from 0.06 to 0.10 milligram per liter downstream, and mean turbidity, which increases from 12 to 24 units downstream. Phosphorus and ammonia concentrations, as high as 0.31 and 2.7 milligrams per liter, respectively, could be the result of domestic waste input to the river upstream from Hendrum. Biochemical oxygen demand concentrations were significantly higher during spring runoff than during the rest of the year. Four out of 90 bacteria samples taken at Twin Valley indicate the presence of human fecal material, though bacteria densities do not exceed recommendations of the U.S. Environmental Protection Agency for public-water supplies. The dominace of organic-pollution tolerant phytoplankton in 49 out of 78 samples also indicates degradation of the river quality at Twin Valley. Nutrient concentrations at Twin Valley have no apparent effect on phytoplankton concentrations. None of the consitituents sampled were found to exceed recommended concentrations for public-water supplies.

Water quality assessment in the "German River of the years 2014/2015": how a case study on the impact of a storm water sedimentation basin displayed impairment of fish health in the Argen River (Southern Germany).

PubMed

Thellmann, Paul; Kuch, Bertram; Wurm, Karl; Köhler, Heinz-R; Triebskorn, Rita

2017-01-01

The present work investigates the impact of discharges from a storm water sedimentation basin (SSB) receiving runoff from a connected motorway in southern Germany. The study lasted for almost two years and was aimed at assessing the impact of the SSB on the fauna of the Argen River, which is a tributary of Lake Constance. Two sampling sites were examined up- and downstream of the SSB effluent. A combination of different diagnostic methods (fish embryo test with the zebrafish, histopathology, micronucleus test) was applied to investigate health impairment and genotoxic effects in indigenous fish as well as embryotoxic potentials in surface water and sediment samples of the Argen River, respectively, in samples of the SSB effluent. In addition, sediment samples from the Argen River and tissues of indigenous fish were used for chemical analyses of 33 frequently occurring pollutants by means of gas chromatography. Furthermore, the integrity of the macrozoobenthos community and the fish population were examined at both investigated sampling sites. The chemical analyses revealed a toxic burden with trace substances (originating from traffic and waste water) in fish and sediments from both sampling sites. Fish embryo tests with native sediment and surface water samples resulted in various embryotoxic effects in exposed zebrafish embryos (Fig. 1). In addition, the health condition of the investigated fish species (e.g., severe alterations in the liver and kidney) provided clear evidence of water contamination at both Argen River sites (Fig. 2). At distinct points in time, some parameters (fish development, kidney and liver histopathology) indicated stronger effects at the sampling site downstream of the SSB effluent than at the upstream site. Our results clearly showed that the SSB cannot be assigned as the main source of pollutants that are released into the investigated Argen River section. Moreover, we showed that there is moderate background pollution with substances originating from waste waters and traffic which still should be taken seriously, particularly with regard to the impairment of fish health at both investigated field sites. Since the Argen is a tributary of Lake Constance, our results call for a management plan to ensure and improve the river's ecological stability.

Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.

PubMed

Zhao, Xiaoyan; Sze, Sing-Hoi

2011-05-01

One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.

Temporal trends and spatial patterns in nutrient export along the Mississippi River and its Tributaries

NASA Astrophysics Data System (ADS)

Stewart, B.; Li, L.

2017-12-01

The Mississippi River, the largest river in the U. S., exports excessive nutrients from the land to the sea, causing the problem of hypoxia in the Gulf of Mexico. In this research, we examined nutrient export along the Mississippi River and its tributaries to understand its trends and patterns and to identify the major factors contributing to these trends. We examined nutrient data from 1950 - 2017 for four sites along the Mississippi River and four tributary sites from the U. S. Geological Survey. The species included: total nitrogen, organic nitrogen, ammonia, nitrate, orthophosphate, and phosphorous. We analyzed the power law relationship of concentration and discharge, for which the export of nutrient species exhibited several trends. Both nitrogen (N) and phosphorous (P) species exhibited mostly chemodynamic behavior. This is in contrast to previous observations in smaller agricultural land where N and P export was mostly chemostatic with no significant change in concentration as discharge varies, suggesting possible scaling effects at different spatial scales. We also compared the average annual concentration over time at each site. The N concentration decreased from upstream to downstream, likely due to greater agricultural activities in the upstream Mississippi river and possible denitrification along the river. The N concentration also increased with time. The P species, however, fluctuated from site to site with no clear spatial patterns, but consistently exhibited higher concentrations at upstream sites with greater agricultural activities. The P species also fluctuated over time, likely due to patterns in discharge and agricultural activities. The results of this research can be further explored by calculating the total export of nutrients into the Gulf of Mexico to determine limits and drivers of nutrient export for better water management, thus helping prevent hypoxia and eutrophication within the Mississippi River basin.

Surface-water characteristics and quality on the Osage Reservation, Osage County, Oklahoma, 1999

USGS Publications Warehouse

Abbott, Marvin M.; Tortorelli, Robert L.

2002-01-01

Concern about the effects of early oil-industry practices of surface disposal of produced-brine water prompted an investigation of the surface-water quality on the Osage Reservation. About 38,600 oil wells have been drilled on the Osage Reservation since drilling began in 1896. The Osage Reservation comprises three major drainage basins. The Caney River Basin is in the northeast, the Bird Creek Basin is in the southeast, and the Salt Creek Basin in the west. Variations in streamflow on the Osage Reservation during a year primarily result from variations in the quantity and frequency of rainfall, evapotranspiration, and reservoir operations. Most streams do not flow during low rainfall periods in late summer, early fall, and in winter. Percent of mean annual discharge is largest during March through June, averaging 54 to 62 percent and smallest during December, January, July, and August, averaging only 14 to 21 percent. The basin areas of Caney River in the reservation (251 square miles), Salt Creek (273 square miles), and Sand Creek (227 square miles) are about the same and the basin areas of the Bird Creek Basin (418 square miles) and Homily Creek Basin (383 square miles) are similar in area. One hundred forty surface-water sites were sampled once during either February, March or August 1999. The surface-drainage areas, incremental basins, between sample sites along a stream, range in size from 0.26 to 123 square miles with a median of 8.6 square miles. Total number of oil wells upgradient of the samples sites is 31,432 or 80 percent of the total in the reservation. The total number of oil wells in the Caney River Basin in the reservation (2,975 wells), Salt Creek Basin (4,619 wells), and Sand Creek Basin (3,858 wells) are about the same and the total number of oil wells in the Bird Creek Basin (8,858 wells) and Hominy Creek Basin (7,842 wells) are similar. The number of oil wells per square mile in the incremental basins ranges for 0.86 to 154. Surface-water quality monitoring had been conducted previously at two sites included in this study. Dissolved chloride concentrations for the two samples collected during 1999 were equaled or exceeded at both sites by the historical data. There is no statistically significant difference between the distribution of the dissolved chloride concentrations from the surface water and nearby ground-water samples. The surface-water quality samples had significantly lesser concentrations of dissolved solids, sulfate, and nitrite plus nitrate as nitrogen than the ground-water samples. Chloride yield, reported in tons per day per square mile, is the chloride load divided by the basin area upstream of the sample site. The mean of the chloride yields for all the samples was 0.07 ton per day per square mile. Many sample locations where yields were greater than 0.07 ton per day per square mile were areas where dissolved chloride concentrations from surface-water samples were greater than 250 milligrams per liter in an earlier water-quality investigation. An investigation of possible relations between the surface-water quality data and the oil-well construction data for the incremental basins and for 1-mile radial distance upstream in the incremental basins was conducted. The oil-well data also were grouped by the time periods of activity into pre-1930, 1930 to 1970, and post-1970. These groups attempt to account for differences in industry drilling and producing practices associated with various periods. No statistically significant correlations were found between the surface-water quality data and the oil-well construction data.

Gasoline-Related Compounds in Lakes Mead and Mohave, Nevada, 2004-06

USGS Publications Warehouse

Lico, Michael S.; Johnson, B. Thomas

2007-01-01

The distribution of man-made organic compounds, specifically gasoline-derived compounds, was investigated from 2004 to 2006 in Lakes Mead and Mohave and one of its tributary streams, Las Vegas Wash. Compounds contained in raw gasoline (benzene, toluene, ethylbenzene, xylenes; also known as BTEX compounds) and those produced during combustion of gasoline (polycyclic aromatic hydrocarbon compounds; also known as PAH compounds) were detected at every site sampled in Lakes Mead and Mohave. Water-quality analyses of samples collected during 2004-06 indicate that motorized watercraft are the major source of these organic compounds to the lakes. Concentrations of BTEX increase as the boating season progresses and decrease to less than detectable levels during the winter when few boats are on the water. Volatilization and microbial degradation most likely are the primary removal mechanisms for BTEX compounds in the lakes. Concentrations of BTEX compounds were highest at sampling points near marinas or popular launching areas. Methyl tert-butyl ether (MTBE) was detected during 2004 but concentrations decreased to less than the detection level during the latter part of the study; most likely due to the removal of MTBE from gasoline purchased in California. Distribution of PAH compounds was similar to that of BTEX compounds, in that, concentrations were highest at popular boating areas and lowest in areas where fewer boats traveled. PAH concentrations were highest at Katherine Landing and North Telephone Cove in Lake Mohave where many personal watercraft with carbureted two-stroke engines ply the waters. Lake-bottom sediment is not a sink for PAH as indicated by the low concentrations detected in sediment samples from both lakes. PAH compounds most likely are removed from the lakes by photochemical degradation. PAH compounds in Las Vegas Wash, which drains the greater Las Vegas metropolitan area, were present in relatively high concentrations in sediment from the upstream reaches. Concentrations of PAH compounds were low in water and sediment samples collected farther downstream, thus the bottom sediment in the upstream part of the wash may be an effective trap for these compounds. Bioavailable PAH compounds were present in all samples as determined using the Fluoroscan method. Microtox acute toxicity profiles indicated that Callville Bay in Lake Mead and the two Lake Mohave sites had only minor evidence that toxic compounds are present.

Pattern variation of fish fingerling abundance in the Na Thap Tidal river of Southern Thailand: 2005-2015

NASA Astrophysics Data System (ADS)

Donroman, T.; Chesoh, S.; Lim, A.

2018-04-01

This study aimed to investigate the variation patterns of fish fingerling abundance based on month, year and sampling site. Monthly collecting data set of the Na Thap tidal river of southern Thailand, were obtained from June 2005 to October 2015. The square root transformation was employed for maintaining the fingerling data normality. Factor analysis was applied for clustering number of fingerling species and multiple linear regression was used to examine the association between fingerling density and year, month and site. Results from factor analysis classified fingerling into 3 factors based on saline preference; saline water, freshwater and ubiquitous species. The results showed a statistically high significant relation between fingerling density, month, year and site. Abundance of saline water and ubiquitous fingerling density showed similar pattern. Downstream site presented highest fingerling density whereas almost of freshwater fingerling occurred in upstream. This finding confirmed that factor analysis and the general linear regression method can be used as an effective tool for predicting and monitoring wild fingerling density in order to sustain fish stock management.

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

PubMed

Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

2012-07-01

The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

PubMed

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

The monitoring of organic waste pollution in the sibelis river

NASA Astrophysics Data System (ADS)

Huda, Thorikul; Jannah, Wirdatul

2017-03-01

Has conducted monitoring of organic waste pollution in the River Sibelis of Tegal City of Central Java. Organic wastes that pollute River Sibelis can degrade the quality of well water along the river. Monitoring carried out in the upstream and downstream by chemical oxygen demand (COD) and biochemical oxygen demand (BOD) parameters. COD test methods by titration and the results are used to determine the test sample comparison with the volume of diluent required for analysts BOD. COD test results on the upstream and downstream Sibelis River respectively 58.13 mg/L and 73.97 mg / L so that the ratio of the test sample with diluent volume for BOD analysis is 20: 280 (Sawyer, 1978). BOD test principle is based on the reduction of dissolved oxygen zero day (DO0) and five days (DO5). The result of observation BOD samples at upstream and downstream Sibelis Rivers are 10.7212 mg / L and 5.3792 mg / L respectively. Quality control of BOD testing conducted with measurement accuracy and precision and obtained result are 85.36% and 0.27% respectively. The result of uncertainty measurement for BOD testing at upstream and downstream are ±0.4469 mg/L and ±0.22188 mg/L.

Water-quality reconnaissance and streamflow gain and loss of Yocum Creek basin, Carroll County, Arkansas

USGS Publications Warehouse

Joseph, Robert L.; Green, W. Reed

1994-01-01

A study of the Yocum Creek Basin conducted between July 27 and August 3, 1993, described the surface- and ground-water quality of the basin and the streamflow gain and loss. Water samples were collected from 12 sites on the main stem of Yocum Creek and 2 tributaries during periods of low to moderate streamflow (less than 40 cubic feet per second). Water samples were collected from 5 wells and 12 springs located in the basin. In 14 surface- water samples, nitrite plus nitrate concentrations ranged from 1.3 to 3.8 milligrams per liter as nitrogen. Orthophosphorus concentrations ranged from 0.01 to 0.06 milligrams per liter as phosphorous. Fecal coliform bacteria counts ranged from 9 to 220 colonies per 100 milliliters, with a median of 49 colonies per 100 milliliters. Fecal streptococci bacteria counts ranged from 37 to 1,500 colonies per 100 milliliters with a median of 420 colonies per 100 milliliters. Analyses for selected metals collected near the mouth of Yocum Creek indicate that metals are not present in significant concen- trations in surface-water samples. Diel dissolved oxygen concentrations and temperatures were measured at two sites on the mainstem of the stream. At the upstream site, dissolved oxygen concentrations ranged from 6.2 to 9.9 milligrams per liter and temperatures ranged from 18.5 to 23.0 degrees Celsius. Dissolved oxygen concentrations were higher and tempentture values were lower at the upstream site than those at the downstream site. Five wells were sampled in the basin and dissolved ammonia was present in concentrations ranging from 0.01 to 0.07 milligrams per liter as nitrogen. Dissolved nitrite plus nitrate was present in wells, with concen- trations ranging from less than 0.02 to 6.0 milligrams per liter as nitrogen. Volatile organic compound samples were collected at two wells and two springs. Chloroform was the only volatile organic compound found to be above the detection limit. Analysis indicated that 0.2 micrograms per liter of chloroform was present in one spring-water sample. In springs sampled, nitrite plus nitrate concen- trations ranged from 1.4 to 7.0 milligrams per llter as nitrogen. Dissolved ammonia plus organic nitrogen concentrations ranged from less than 0.2 to 0.49 milligrams per liter as nitrogen. Orthophosphorus concentrations ranged from 0.01 to 0.07 milligrams per liter as phosphorus. Fecal colfform bacteria counts ranged from 3 to 200 colonies per 100 milliliters, with a median of 18 colonies per 100 milliliters. Fecal streptococci bacteria counts ranged from 110 to more than 2,000 colonies per 100 milliliters with a median of 350 colonies per 100 milliliters. Large producing springs 1ocated in the mid to upper reaches of the basin contribute most of the flow to Yocum Creek. Streamflow increased an average of 29 percent on the mainstem of the stream. One losing reach was discovered on the mainstem of the stream and two losing reaches on tributaries to the mainstem. Surface flow steadily decreased along these reaches to the point where surface flow was not present, and the streambed became dry. These observations suggest that significant interaction exists between the underlying Springfield aquifer and surface flow in the Yocum Creek Basin.

Resolving the variability of CDOM fluorescence to differentiate the sources and fate of DOM in Lake Taihu and its tributaries.

PubMed

Yao, Xin; Zhang, Yunlin; Zhu, Guangwei; Qin, Boqiang; Feng, Longqing; Cai, Linlin; Gao, Guang

2011-01-01

Taihu Basin is the most developed area in China, which economic development has resulted in pollutants being produced and discharged into rivers and the lake. Lake Taihu is located in the center of the basin, which is characterized by a complex network of rivers and channels. To assess the sources and fate of dissolved organic matter (DOM) in surface waters, we determined the components and abundance of chromophoric dissolved organic matter (CDOM) within Lake Taihu and 66 of its tributaries, and 22 sites along transects from two main rivers. In Lake Taihu, there was a relative less spatial variation in CDOM absorption a(CDOM)(355) with a mean of 2.46 ± 0.69 m⁻¹ compared to the mean of 3.36 ± 1.77 m⁻¹ in the rivers. Two autochthonous tryptophan-like components (C1 and C5), two humic-like components (C2 and C3), and one autochthonous tyrosine-like component (C4) were identified using the parallel factor analysis (PARAFAC) model. The C2 and C3 had a direct relationship with a(CDOM)(355), dissolved organic carbon (DOC), and chemical oxygen demand (COD). The separation of lake samples from river samples, on both axes of the Principal Component Analysis (PCA), showed the difference in DOM fluorophores between these various environments. Components C1 and C5 concurrently showed positive factor 1 loadings, while C4 was close to the negative factor 1 axis. Components C2 and C3 showed positive second factor loadings. The major contribution of autochthonous tryptophan-like components to lake samples is due to the autochthonous production of CDOM in the lake ecosystems. The results also showed that the differences in geology and associated land use control CDOM dynamics, such as the high levels of CDOM with terrestrial characteristics in the northwestern upstream rivers and low levels of CDOM with increased microbial characteristics in the southwestern upstream rivers. Most of river samples from the downstream regions in the eastern and southeastern plains had a similar relative abundance of humic-like fluorescence, with less of the tryptophan-like and more of the tyrosine-like contributions than did samples from upstream regions. Copyright © 2010 Elsevier Ltd. All rights reserved.

Pharmaceutical compounds in Merrimack River water used for public supply, Lowell, Massachusetts, 2008-09

USGS Publications Warehouse

Massey, Andrew J.; Waldron, Marcus C.

2011-01-01

This report presents results of a study conducted by the U.S. Geological Survey (USGS), in cooperation with the Massachusetts Department of Environmental Protection, to determine the occurrence of 14 commonly used human-health pharmaceutical compounds and fecal-indicator bacteria in Merrimack River water used as a drinking-water source by 135,000 residents in eastern Massachusetts. The study was designed to complement the USGS National Water-Quality Assessment Program's Source Water-Quality Assessment, which identifies patterns of occurrence of 280 primarily unregulated organic wastewater contaminants in source water used by community water systems and determines whether these patterns also occur in treated drinking water prior to distribution. The study involved periodic collection and analysis of raw Merrimack River water and treated drinking water over the course of 1 year. Water samples were collected periodically without regard to flow regime or antecedent weather conditions at the Lowell Regional Water Utility's Merrimack River intake upstream from Lowell, Mass. The same parcel of water was then sampled as finished water following treatment. Despite the presence of many potential sources of contamination in the drinking-water source area, only 2 of the 14 pharmaceutical analytes were detected at reportable concentrations in the source-water samples, and these occurred in only one set of periodic samples. Acetaminophen, a nonprescription analgesic, and caffeine were detected in the September source-water samples at concentrations of 0.084 and 0.068 micrograms per liter, respectively. Three other compounds-carbamazepine, an antiepileptic; cotinine, a metabolite of nicotine; and diphenhydramine, a nonprescription antihistamine-were detected in source-water samples, but at concentrations too low to be reliably quantified. None of the 14 pharmaceuticals was found in the finished water at a reportable concentration, defined as two times the long-term detection limit used by the analytical laboratory. In addition to the pharmaceutical analyses, measurements of fecal-indicator bacteria (Escherichia coli) concentrations and several physical characteristics were made on all source-water samples. Values for these constituents were consistently within State standards. It is possible that the monthly sampling schedule missed hydrologic events that would have transported greater concentrations of sewage contaminants to the sampling site, or that the large flow volume of the river at the study site effectively diluted the contaminant signal, but it is also likely that recent efforts to separate stormwater- and wastewater-discharge systems in the reaches upstream from the Lowell Regional Water Utility have greatly reduced the potential for sewage contamination at the intake.

Leaf Litter Decomposition as a Functional Assessment of a Natural Stream Channel Design Project

NASA Astrophysics Data System (ADS)

Gentry, A.; Word, D.; Carreiro, M.; Jack, J.

2005-05-01

In October 2003, a 965m reach of Wilson Creek (Bernheim Research Forest, Kentucky, USA) was relocated, and meanders and riffle-pool sequences were restored, providing a unique opportunity to measure the re-establishment of post-restoration stream functions. Leaf litter bags were placed across riffles in the restored reach, in an upstream reference site and in two reference streams. Bags were collected for nine months, and mass loss, N dynamics and fungal ergosterol were measured. Daily mass loss rates in the restored and reference riffles in Wilson Creek were faster (k= -0.00759 and k= -0.00855, respectively) than those of the two reference streams (k= -0.00511 and k= -0.00308). This is equivalent to litter mean residence times of 132 days for the restored reach in Wilson, 117 days in the upstream reference site, and 196 and 325 days for the reference streams. It appears that the decay rate in the restored reach is similar to the upstream portion of Wilson Creek, indicating rapid mass loss recovery in the restored reach. We also determined that same-stream reference sites are important for evaluating the restoration of stream functions, because of high decay rate variation among nearby streams within the same watershed.

Seasonal variation of benthic macro invertebrates from Tons River of Garhwal Himalaya Uttarakhand.

PubMed

Negi, R K; Mamgain, Sheetal

2013-11-15

Present investigation was carried out to assess the seasonal variation of benthic macro-invertebrates from the Tons river, a tributary of Yamuna River in Garhwal Himalaya, Uttrakhand during December, 2007 to November, 2009. The seasonal benthic diversity was correlated with various physic-chemical parameters which documented that the macrobenthic diversity is mostly regulated by the dissolved oxygen in the water while temperature and free CO2 were found to be inversely correlated with the benthic fauna. Maximum diversity of benthos was reported at the upstream site ('H' 0.204) during the winter season while it was recorded minimum during the rainy season at all the sites. Maximum diversity is reported during the winter season at all the sites. The benthic fauna is represented by three phylum, 4 classes and 10 orders with Insecta emerging as the most dominant class. Maximum genera were reported from midstream site as it acts as ecotone between upstream and downstream.

Terrestrial Contributions to the Aquatic Food Web in the Middle Yangtze River

PubMed Central

Wang, Jianzhu; Gu, Binhe; Huang, Jianhui; Han, Xingguo; Lin, Guanghui; Zheng, Fawen; Li, Yuncong

2014-01-01

Understanding the carbon sources supporting aquatic consumers in large rivers is essential for the protection of ecological integrity and for wildlife management. The relative importance of terrestrial and algal carbon to the aquatic food webs is still under intensive debate. The Yangtze River is the largest river in China and the third longest river in the world. The completion of the Three Gorges Dam (TGD) in 2003 has significantly altered the hydrological regime of the middle Yangtze River, but its immediate impact on carbon sources supporting the river food web is unknown. In this study, potential production sources from riparian and the main river channel, and selected aquatic consumers (invertebrates and fish) at an upstream constricted-channel site (Luoqi), a midstream estuarine site (Huanghua) and a near dam limnetic site (Maoping) of the TGD were collected for stable isotope (δ13C and δ15N) and IsoSource analyses. Model estimates indicated that terrestrial plants were the dominant carbon sources supporting the consumer taxa at the three study sites. Algal production appeared to play a supplemental role in supporting consumer production. The contribution from C4 plants was more important than that of C3 plants at the upstream site while C3 plants were the more important carbon source to the consumers at the two impacted sites (Huanghua and Maoping), particularly at the midstream site. There was no trend of increase in the contribution of autochthonous production from the upstream to the downstream sites as the flow rate decreased dramatically along the main river channel due to the construction of TGD. Our findings, along with recent studies in rivers and lakes, are contradictory to studies that demonstrate the importance of algal carbon in the aquatic food web. Differences in system geomorphology, hydrology, habitat heterogeneity, and land use may account for these contradictory findings reported in various studies. PMID:25047656

Terrestrial contributions to the aquatic food web in the middle Yangtze River.

PubMed

Wang, Jianzhu; Gu, Binhe; Huang, Jianhui; Han, Xingguo; Lin, Guanghui; Zheng, Fawen; Li, Yuncong

2014-01-01

Understanding the carbon sources supporting aquatic consumers in large rivers is essential for the protection of ecological integrity and for wildlife management. The relative importance of terrestrial and algal carbon to the aquatic food webs is still under intensive debate. The Yangtze River is the largest river in China and the third longest river in the world. The completion of the Three Gorges Dam (TGD) in 2003 has significantly altered the hydrological regime of the middle Yangtze River, but its immediate impact on carbon sources supporting the river food web is unknown. In this study, potential production sources from riparian and the main river channel, and selected aquatic consumers (invertebrates and fish) at an upstream constricted-channel site (Luoqi), a midstream estuarine site (Huanghua) and a near dam limnetic site (Maoping) of the TGD were collected for stable isotope (δ13C and δ15N) and IsoSource analyses. Model estimates indicated that terrestrial plants were the dominant carbon sources supporting the consumer taxa at the three study sites. Algal production appeared to play a supplemental role in supporting consumer production. The contribution from C4 plants was more important than that of C3 plants at the upstream site while C3 plants were the more important carbon source to the consumers at the two impacted sites (Huanghua and Maoping), particularly at the midstream site. There was no trend of increase in the contribution of autochthonous production from the upstream to the downstream sites as the flow rate decreased dramatically along the main river channel due to the construction of TGD. Our findings, along with recent studies in rivers and lakes, are contradictory to studies that demonstrate the importance of algal carbon in the aquatic food web. Differences in system geomorphology, hydrology, habitat heterogeneity, and land use may account for these contradictory findings reported in various studies.

Spatial and temporal trends and flow dynamics of glyphosate and other pesticides within an agricultural watershed in Argentina.

PubMed

Pérez, Débora J; Okada, Elena; De Gerónimo, Eduardo; Menone, Mirta L; Aparicio, Virginia C; Costa, José L

2017-12-01

In the present study, we evaluated the spatial and temporal trends of current-use pesticides in surface water and sediments as well as their relationship with hydrological stream dynamics within the agricultural watershed of El Crespo stream (Buenos Aires Province, Argentina). We sampled 2 contrasting sites: site 1 (upstream), surrounded by agricultural lands, and site 2 (downstream), surrounded by natural grasslands. Most of the applied pesticides (glyphosate, 2,4-D, atrazine, tebuconazole, and imidacloprid) were detected at high frequencies in surface water samples at both sites. However, only glyphosate and aminomethylphosphonic acid (AMPA) were present at high concentrations and had a significant spatial-temporal trend. The highest concentrations were found during spring 2014 at site 1, in association with the intense rains that occurred in that season. The fact that glyphosate and AMPA concentrations were higher than the rest of the studied compounds is closely related to the land use within the watershed, as glyphosate was the most applied herbicide during the fallow period of glyphosate-resistant crops (soybean, maize). The pesticide mixture had a significant spatial-temporal trend, reaching the highest levels during storm flow events in spring 2014. The intensive rains in spring 2014 could be the main factor influencing stream hydrology and pesticide behavior at El Crespo watershed. The estimated annual pesticide losses were 3.11 g/ha at site 1 and 0.72 g/ha at site 2. This result indicates that an attenuation process could be decreasing pesticide loads during downstream transport from site 1 to site 2. Environ Toxicol Chem 2017;36:3206-3216. © 2017 SETAC. © 2017 SETAC.

Spawning migration movements of Lost River and shortnose suckers in the Williamson and Sprague Rivers, Oregon, following the removal of Chiloquin Dam-2009 Annual Report

USGS Publications Warehouse

Ellsworth, Craig M.; VanderKooi, Scott P.

2011-01-01

The Chiloquin Dam was located at river kilometer (rkm) 1.3 on the Sprague River near the town of Chiloquin, Oregon. The dam was identified as a barrier that potentially inhibited or prevented the upstream spawning migrations and other movements of endangered Lost River suckers (Deltistes luxatus), shortnose suckers (Chasmistes brevirostris), and other fish in the Sprague River. Our research objectives in 2009 were to evaluate adult catostomid spawning migration patterns using radio telemetry to identify and describe shifts in spawning area distribution and migration behavior following the removal of Chiloquin Dam in 2008. We attached external radio transmitters to 58 Lost River suckers and 59 shortnose suckers captured at the Williamson River fish weir. A total of 17 radio-tagged Lost River suckers and one radio-tagged shortnose sucker were detected approaching the site of the former Chiloquin Dam but only two radio-tagged fish (one male Lost River sucker and one female Lost River sucker) were detected crossing upstream of the dam site. A lower proportion of radio-tagged shortnose suckers were detected migrating into the Sprague River when compared with previous years. Detections on remote passive integrated transponder (PIT) tag arrays located in the Sprague River show that although the proportion of fish coming into the Sprague River is small when compared to the number of fish crossing the Williamson River fish weir, the number of fish migrating upstream of the Chiloquin Dam site increased exponentially in the first year since its removal. These data will be used in conjunction with larval production and adult spawning distribution data to evaluate the effectiveness of dam removal in order to provide increased access to underutilized spawning habitat located further upstream in the Sprague River and to reduce the crowding of spawning fish below the dam site.

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Water quality in the Withers Swash Basin, with emphasis on enteric bacteria, Myrtle Beach, South Carolina, 1991-93

USGS Publications Warehouse

Guimaraes, W.B.

1995-01-01

Water samples were collected in 1991-93 from Withers Swash and its two tributaries (the Mainstem and KOA Branches) in Myrtle Beach, S.C., and analyzed for physical properties, organic and inorganic constituents, and fecal coliform and streptococcus bacteria. Samples were collected during wet- and dry-weather conditions to assess the water quality of the streams before and after storm runoff. Water samples were analyzed for over 200 separate physical, chemical, and biological constituents. Concentrations of 11 constituents violated State criteria for shellfish harvesting waters, and State Human Health Criteria. The 11 constituents included concentrations of dissolved oxygen, arsenic, lead, cadmium, mercury, chlordane, dieldrin, 1,1,1-trichloroethane, 1,1-dichloroethylene, trichloroethylene, and fecal coliform bacteria. Water samples were examined for the presence of enteric bacteria (fecal coliform and fecal streptococcus) at 46 sites throughout the Withers Swash Basin and 5 sites on the beach and in the Atlantic Ocean. Water samples were collected just upstream from all confluences in order to determine sources of bacterial contamination. Temporally and spatially high concentrations of enteric bacteria were detected throughout the Withers Swash Basin; however, these sporadic bacteria concentrations made it difficult to determine a single source of the contamination. These enteric bacteria concentrations are probably derived from a number of sources in the basin including septic tanks, garbage containers, and the feces of waterfowl and domestic animals.

Biodegradation of 17β-Estradiol, Estrone and Testosterone in Stream Sediments

NASA Astrophysics Data System (ADS)

Bradley, P. M.; Chapelle, F. H.; Barber, L. B.; McMahon, P. B.; Gray, J. L.; Kolpin, D. W.

2009-12-01

The potentials for in situ biodegradation of 17β-estradiol (E2), estrone (E1), and testosterone (T) were investigated in three, hydrologically-distinct, WWTP-impacted streams in the United States. Relative differences in the mineralization of [4-14C] substrates were assessed in oxic microcosms containing sediment or water-only from locations upstream and downstream of the WWTP outfall in each system. Upstream samples provided insight into the biodegradative potential of sediment microbial communities that were not under the immediate impact of WWTP effluent. Upstream sediment from all three systems demonstrated significant mineralization of the “A” ring of E2, E1 and T, with the potential of T biodegradation consistently greater than of E2 and no systematic difference in the potentials of E2 and E1. Downstream samples provided insight into the impacts of effluent on reproductive hormone biodegradation. Significant “A” ring mineralization was also observed in downstream sediment, with the potentials for E1 and T mineralization being substantially depressed relative to upstream samples. In marked contrast, the potentials for E2 mineralization immediately downstream of the WWTP outfalls were more than double that of upstream samples. E2 mineralization was also observed in water, albeit at insufficient rate to prevent substantial downstream transport in the water column. The results of this study indicate that, in combination with sediment sorption processes which effectively scavenge hydrophobic contaminants from the water column and immobilize them in the vicinity of the WWTP outfall, aerobic biodegradation of reproductive hormones can be an environmentally important mechanism for non-conservative (destructive) attenuation of hormonal endocrine disruptors in effluent-impacted streams.

Northeastern Florida Bay estuarine creek data, water years 1996-2000

USGS Publications Warehouse

Hittle, Clinton D.; Zucker, Mark A.

2004-01-01

From October 1995 to September 2000 (water years 1996-2000), continuous 15-minute stage, water velocity, salinity, and water temperature data were collected at seven estuarine creeks that flow into northeastern Florida Bay. These creeks include West Highway Creek, Stillwater Creek, Trout Creek, Mud Creek, Taylor River, Upstream Taylor River, and McCormick Creek. Discharge was computed at 15-minute intervals using mean water velocity and the cross-sectional area of the channel. Fifteen-minute unit values are presented for comparison of the quantity, quality, timing, and distribution of flows through the creeks. Revised discharge estimation formulas are presented for three noninstrumented sites (East Highway Creek, Oregon Creek and Stillwater Creek) that utilize an improved West Highway discharge rating. Stillwater Creek and Upstream Taylor River were originally noninstrumented sites; both were fully instrumented in 1999. Discharge rating equations are presented for these sites and were developed using a simple linear regression.

2015 Long-Term Hydrologic Monitoring Program Sampling and Analysis Results at Rio Blanco, Colorado

DOE Office of Scientific and Technical Information (OSTI.GOV)

Findlay, Rick; Kautsky, Mark

2015-12-01

The U.S. Department of Energy (DOE) Office of Legacy Management conducted annual sampling at the Rio Blanco, Colorado, Site for the Long-Term Hydrologic Monitoring Program (LTHMP) on May 20–21, 2015. This report documents the analytical results of the Rio Blanco annual monitoring event, the trip report, and the data validation package. The groundwater and surface water monitoring samples were shipped to the GEL Group Inc. laboratories for conventional analysis of tritium and analysis of gamma-emitting radionuclides by high-resolution gamma spectrometry. A subset of water samples collected from wells near the Rio Blanco site was also sent to GEL Group Inc.more » for enriched tritium analysis. All requested analyses were successfully completed. Samples were collected from a total of four onsite wells, including two that are privately owned. Samples were also collected from two additional private wells at nearby locations and from nine surface water locations. Samples were analyzed for gamma-emitting radionuclides by high-resolution gamma spectrometry, and they were analyzed for tritium using the conventional method with a detection limit on the order of 400 picocuries per liter (pCi/L). Four locations (one well and three surface locations) were analyzed using the enriched tritium method, which has a detection limit on the order of 3 pCi/L. The enriched locations included the well at the Brennan Windmill and surface locations at CER-1, CER-4, and Fawn Creek 500 feet upstream.« less

Ground-water-quality assessment of the Carson River basin, Nevada and California; analysis of available water-quality data through 1987

USGS Publications Warehouse

Welch, A.H.; Plume, R.W.; Frick, E.A.; Hughes, J.L.

1989-01-01

Data on groundwater quality, hydrogeology, and land and water use for the Carson River basin, Nevada and California were analyzed as part of the U. S. Geological Survey National Water-Quality Assessment program. The basin consists of six hydrographic areas--a mountainous headwaters area and five downstream areas interconnected by the Carson River. Each valley contains one or more basin-fill aquifers. The data on groundwater quality came from several agencies and were screened to verify site location and to avoid analyses of treated water. The screened data are stored in the U. S. Geological Survey National Water Information System data base. Differences in sample-collection and preservation procedures among some of the data-collection agencies restrict use of the data to a descriptive analysis. Drinking water standards were employed as the basis for evaluating reported concentrations. Frequencies with which primary or secondary standards are exceeded increase from upstream parts of the basin to downstream parts. Primary standards commonly exceeded are fluoride in upstream areas and arsenic and fluoride in downstream areas. Secondary standards commonly exceeded are iron and manganese in upstream areas and chloride, dissolved solids, iron, manganese, and sulfate in downstream areas. The poorer-quality groundwater generally is a result of natural geochemical reactions, rather than the introduction of chemicals by man. Limited data indicate, however , that manmade organic compounds are present, mostly at or near urban land. (USGS)

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

Distribution and abundance of Millicoma Dace in the Coos River Basin, Oregon

USGS Publications Warehouse

Scheerer, Paul D.; Peterson, James T.; Clements, Shaun

2017-01-01

The Millicoma Dace Rhinichthys cataractae is a form of Longnose Dace endemic to the Coos River drainage in southwestern Oregon. Sparse species records in the Oregon State University Ichthyology Collection and database and infrequent recent encounters prompted surveys to assess the current status and distribution of the species. In 2014, we surveyed locations that had historically supported Millicoma Dace using backpack electrofishing to describe their current distribution and abundance at these locations. In 2015, we extended these surveys further upstream in the South Coos River basin, outside of the documented historical range. We used an N-mixture model to estimate abundance and capture probability for Millicoma Dace at each sampling location. We evaluated the effects of habitat covariates on both capture probability and abundance at each sample site. We found Millicoma Dace were widespread throughout their historical range and in the South Coos River sites outside of their documented historical range. We only found Millicoma Dace associated with native fishes; we did not collect any nonnative fish during our surveys. We collected Millicoma Dace exclusively from swift-water habitats, which were relatively uncommon in the basin, and found them typically associated with cobble or boulder substrates. Millicoma Dace were most abundant in the South Fork Coos and West Fork Millicoma River subbasins. We estimated capture probabilities for Millicoma Dace ranging from 9% when substrate was dominated by bedrock to 28% when substrate was dominated by cobble or gravel. Abundance estimates ranged from 1 to 560 dace per sampling location with a total estimated abundance (sum of site estimates) of over 3200 dace for the sites we sampled.

Dissolved Strontium and Barium in Fresh and Saltwater: a 2-year Study in the Calcasieu River to the Gulf of Mexico

NASA Astrophysics Data System (ADS)

He, S.; Xu, Y. J.

2016-02-01

Strontium and barium to calcium ratios are often used as proxies for tracking animal movement across salinity gradients. As sea level rise continues, many estuarine rivers face saltwater intrusion, which may cause changes in mobility and distribution of these metals upstream. Despite intensive research on metal adsorption and desorption in marine systems, knowledge of the spatiotemporal distribution of these elements along estuarine rivers is still limited. In this study, we conducted an intensive monitoring of Sr and Ba dynamics along an 88-km long estuary, the Calcasieu River, which has been strongly affected by saltwater intrusion. Over the period from May 2013 to July 2015, we collected monthly water samples and performed in-situ water quality measurements at six sites from the upstream to the river mouth. Water samples were analyzed for dissolved Sr, Ba, and Ca concentrations. In-situ measurements of salinity, pH, water temperature, dissolved oxygen concentration, and specific conductance were taken. Our preliminary data showed that the Sr and Ca concentrations and the Sr/Ca ratio all increased significantly with decreasing distance to the Gulf of Mexico, while the Ba/Ca ratio decreased with decreasing distance to the Gulf. The spatial variation in Ba concentration was marginal. The Sr and Ca concentrations and ratios were positively related to salinity, while Ba/Ca was negatively related to salinity. All the elemental concentrations and ratios had considerable seasonal and interannual variations. There were significant differences among sampling months for all the elemental concentrations and ratios (p<0.05), and there were significant differences among sampling years for the Sr and Ca concentrations and the Ba/Ca ratio (p<0.05).

Antidepressant pharmaceuticals in two U.S. effluent-impacted streams: Occurrence and fate in water and sediment and selective uptake in fish neural tissue

USGS Publications Warehouse

Schultz, M.M.; Furlong, E.T.; Kolpin, D.W.; Werner, S.L.; Schoenfuss, H.L.; Barber, L.B.; Blazer, V.S.; Norris, D.O.; Vajda, A.M.

2010-01-01

Antidepressant pharmaceuticals are widely prescribed in the United States; release of municipal wastewater effluent is a primary route introducing them to aquatic environments, where little is known about their distribution and fate. Water, bed sediment, and brain tissue from native white suckers (Catostomus commersoni)were collected upstream and atpoints progressively downstream from outfalls discharging to two effluentimpacted streams, Boulder Creek (Colorado) and Fourmile Creek (Iowa). A liquid chromatography/tandem mass spectrometry method was used to quantify antidepressants, including fluoxetine, norfluoxetine (degradate), sertraline, norsertraline (degradate), paroxetine, Citalopram, fluvoxamine, duloxetine, venlafaxine, and bupropion in all three sample matrices. Antidepressants were not present above the limit of quantitation in water samples upstream from the effluent outfalls but were present at points downstream at ng/L concentrations, even at the farthest downstream sampling site 8.4 km downstream from the outfall. The antidepressants with the highest measured concentrations in both streams were venlafaxine, bupropion, and Citalopram and typically were observed at concentrations of at least an order of magnitude greater than the more commonly investigated antidepressants fluoxetine and sertraline. Concentrations of antidepressants in bed sediment were measured at ng/g levels; venlafaxine and fluoxetine were the predominant chemicals observed. Fluoxetine, sertraline, and their degradates were the principal antidepressants observed in fish brain tissue, typically at low ng/g concentrations. Aqualitatively different antidepressant profile was observed in brain tissue compared to streamwater samples. This study documents that wastewater effluent can be a point source of antidepressants to stream ecosystems and that the qualitative composition of antidepressants in brain tissue from exposed fish differs substantially from the compositions observed in streamwater and sediment, suggesting selective uptake. ?? 2010 American Chemical Society.

Effects of wastewater effluent discharge and treatment facility upgrades on environmental and biological conditions of Indian Creek, Johnson County, Kansas, June 2004 through June 2013

USGS Publications Warehouse

Graham, Jennifer L.; Stone, Mandy L.; Rasmussen, Teresa J.; Foster, Guy M.; Poulton, Barry C.; Paxson, Chelsea R.; Harris, Theodore D.

2014-01-01

Indian Creek is one of the most urban drainage basins in Johnson County, Kansas, and environmental and biological conditions of the creek are affected by contaminants from point and other urban sources. The Johnson County Douglas L. Smith Middle Basin (hereafter referred to as the “Middle Basin”) and Tomahawk Creek Wastewater Treatment Facilities (WWTFs) discharge to Indian Creek. In summer 2010, upgrades were completed to increase capacity and include biological nutrient removal at the Middle Basin facility. There have been no recent infrastructure changes at the Tomahawk Creek facility; however, during 2009, chemically enhanced primary treatment was added to the treatment process for better process settling before disinfection and discharge with the added effect of enhanced phosphorus removal. The U.S. Geological Survey, in cooperation with Johnson County Wastewater, assessed the effects of wastewater effluent on environmental and biological conditions of Indian Creek by comparing two upstream sites to four sites located downstream from the WWTFs using data collected during June 2004 through June 2013. Environmental conditions were evaluated using previously and newly collected discrete and continuous data and were compared with an assessment of biological community composition and ecosystem function along the upstream-downstream gradient. This study improves the understanding of the effects of wastewater effluent on stream-water and streambed sediment quality, biological community composition, and ecosystem function in urban areas. After the addition of biological nutrient removal to the Middle Basin WWTF in 2010, annual mean total nitrogen concentrations in effluent decreased by 46 percent, but still exceeded the National Pollutant Discharge Elimination System (NPDES) wastewater effluent permit concentration goal of 8.0 milligrams per liter (mg/L); however, the NPDES wastewater effluent permit total phosphorus concentration goal of 1.5 mg/L or less was achieved at the Middle Basin WWTF. At the Tomahawk Creek WWTF, after the addition of chemically enhanced primary treatment in 2009, effluent discharges also had total phosphorus concentrations below 1.5 mg/L. After the addition of biological nutrient removal, annual total nitrogen and phosphorus loads from the Middle Basin WWTF decreased by 42 and 54 percent, respectively, even though effluent volume increased by 11 percent. Annual total phosphorus loads from the Tomahawk Creek WWTF after the addition of chemically enhanced primary treatment decreased by 54 percent despite a 33-percent increase in effluent volume. Total nitrogen and phosphorus from the WWTFs contributed between 30 and nearly 100 percent to annual nutrient loads in Indian Creek depending on streamflow conditions. In-stream total nitrogen primarily came from wastewater effluent except during years with the highest streamflows. Most of the in-stream total phosphorus typically came from effluent during dry years and from other urban sources during wet years. During 2010 through 2013, annual mean discharge from the Middle Basin WWTF was about 75 percent of permitted design capacity. Annual nutrient loads likely will increase when the facility is operated at permitted design capacity; however, estimated maximum annual nutrient loads from the Middle Basin WWTF were 27 to 38 percent lower than before capacity upgrades and the addition of biological nutrient removal to treatment processes. Thus, the addition of biological nutrient removal to the Middle Basin wastewater treatment process should reduce overall nutrient loads from the facility even when the facility is operated at permitted design capacity. The effects of wastewater effluent on the water quality of Indian Creek were most evident during below-normal and normal streamflows (about 75 percent of the time) when wastewater effluent represented about 24 percent or more of total streamflow. Wastewater effluent had the most substantial effect on nutrient concentrations in Indian Creek. Total and inorganic nutrient concentrations at the downstream sites during below-normal and normal streamflows were 10 to 100 times higher than at the upstream sites, even after changes in treatment practices at the WWTFs. Median total phosphorus concentrations during below-normal and normal streamflows at a downstream site were 43 percent lower following improvements in wastewater treatment processes. Similar decreases in total nitrogen were not observed, likely because total nitrogen concentrations only decreased in Middle Basin effluent and wastewater contributed a higher percentage to streamflows when nutrient samples were collected during the after-upgrade period. The wastewater effluent discharges to Indian Creek caused changes in stream-water quality that may affect biological community structure and ecosystem processes, including higher concentrations of bioavailable nutrients (nitrate and orthophosphorus) and warmer water temperatures during winter months. Other urban sources of contaminants also caused changes in stream-water quality that may affect biological community structure and ecosystem processes, including higher turbidities downstream from construction areas and higher specific conductance and chloride concentrations during winter months. Chloride concentrations exceeded acute and chronic exposure criteria at all Indian Creek study sites, regardless of wastewater influence, for weeks or months during winter. Streambed sediment chemistry was affected by wastewater (elevated nutrient and organic wastewater-indicator compound concentrations) and other contaminants from urban sources (elevated polyaromatic hydrocarbon concentrations). Overall habitat conditions were suboptimal or marginal at all sites; general decline in habitat conditions along the upstream-downstream gradient likely was caused by the cumulative effects of urbanization with increasing drainage basin size. Wastewater effluent likely affected algal periphyton biomass and community composition, primary production, and community respiration in Indian Creek. Functional stream health, evaluated using a preliminary framework based on primary production and community respiration, was mildly or severely impaired at most downstream sites relative to an urban upstream Indian Creek site. The mechanistic cause of the changes in these biological variables are unclear, though elevated nutrient concentrations were positively correlated with algal biomass, primary production, and community respiration. Macroinvertebrate communities indicated impairment at all sites, and Kansas Department of Health and Environment aquatic life support scores indicated conditions nonsupporting of aquatic life, regardless of wastewater influences. Urban influences, other than wastewater effluent discharge, likely control macroinvertebrate community structure in Indian Creek. Changes in treatment processes at the Middle Basin and Tomahawk Creek WWTFs improved wastewater effluent quality and decreased nutrient loads, but wastewater effluent discharges still had negative effects on the environmental and biological conditions at downstream Indian Creek sites. Wastewater effluent discharge into Indian Creek likely contributed to changes in measures of ecosystem structure (streamflow, water and streambed-sediment chemistry, algal biomass, and algal periphyton community composition) and function (primary production and community respiration) along the upstream-downstream gradient. Wastewater effluent discharges maintained streamflows and increased nutrient concentrations, algal biomass, primary production, and community respiration at the downstream sites. Functional stream health was severely impaired downstream from the Middle Basin WWTF and mildly impaired downstream from the Tomahawk WWTF relative to the urban upstream site. As distance from the Middle Basin WWTF increased, nutrient concentrations, algal biomass, primary production, and community respiration decreased, and functional stream health was no longer impaired 9.5 kilometers downstream from the discharge relative to the urban upstream site. Therefore, although wastewater effluent caused persistent changes in environmental and biological conditions and functional stream health at sites located immediately downstream from WWTF effluent discharges, some recovery to conditions more similar to the urban upstream site occurred within a relatively short distance.

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

Physiological changes in largemouth bass exposed to paper mill effluents under laboratory and field conditions

USGS Publications Warehouse

Sepulveda, M.S.; Gallagher, E.P.; Gross, T.S.

2004-01-01

We report here on studies designed to asses the effects of paper mill effluents on non-reproductive functions of free-ranging and captive Florida largemouth bass (Micropterus salmoides floridanus) This was accomplished by conducting an outdoor tank study, in which fish were exposed to well water or to 10%, 20%, 40%, and 80% full strength effluent for 28 or 56 days, and by sampling largemouth bass from sites within the St. Johns River, Florida, upstream and downstream from a paper mill plant. Blood and plasma samples from fish from the tank study and from fish sampled from the ambient sites were analyzed for over 20 variables. We also determined liver and spleen weights and examined them histologically. The most significant finding from the tank study was an increase in the concentration of albumin and hepatosomatic index for bass exposed to ???20% effluents for 56 days. Spleenosomatic index and number of melanomacrophage centers were decreased in bass from effluent-dominated sites (Palatka and Rice Creek), whereas concentrations of calcium, phosphorous, glucose, and creatinine were elevated in fish from these sites, compared to fish from reference streams. Fish from Rice Creek also had fewer red blood cells, and male bass from Palatka had lower concentrations of cholesterol. Plasma concentrations of albumin and hepatic concentrations of glutathione were elevated in males from Palatka, and both females and males from Rice Creek had higher concentrations of globulin. These results indicate a complex pattern of effects of paper mill effluents on several physiological functions. However, despite the myriad of treatment and site-related effects, most physiological parameters fell within normal ranges when compared to reports on largemouth bass and other freshwater species.

Geochemical baseline studies and relations between water quality and streamflow in the upper Blackfoot Watershed, Montana: data for July 1997-December 1998

USGS Publications Warehouse

Nagorski, Sonia A.; Moore, Johnnie N.; Smith, David B.

2001-01-01

We used ultraclean sampling techniques to study the solute (operationally defined as <0.2 ?m) surface water geochemistry at five sites along the Upper Blackfoot River and four sites along the Landers Fork, some in more detail and more regularly than others. We collected samples also from Hogum Creek, a tributary to the Blackfoot, from Copper Creek, a tributary to the Landers Fork, and from ground water seeps contributing to the flow along the Landers Fork. To better define the physical dynamics of the hydrologic system and to determine geochemical loads, we measured streamflow at all the sites where we took samples for water quality analysis. The Upper Blackfoot River, which drains historic mines ca. 20 Km upstream of the study area, had higher trace metal concentrations than did the Landers Fork, which drains the pristine Scapegoat Wilderness area. In both rivers, many of the major elements were inversely related to streamflow, and at some sites, several show a hysteresis effect in which the concentrations were lower on the rising limb of the hydrograph than on the falling limb. However, many of the trace elements followed far more irregular trends, especially in the Blackfoot River. Elements such as As, Cu, Fe, Mn, S, and Zn exhibited complex and variable temporal patterns, which included almost no response to streamflow differences, increased concentrations following a summer storm and at the start of snowmelt in the spring, and/or increased concentrations throughout the course of spring runoff. In summary, complex interactions between the timing and magnitude of streamflow with physical and chemical processes within the watershed appeared to greatly influence the geochemistry at the sites, and streamflow values alone were not good predictors of solute concentrations in the rivers.

Applications of turbidity monitoring to forest management in California.

PubMed

Harris, Richard R; Sullivan, Kathleen; Cafferata, Peter H; Munn, John R; Faucher, Kevin M

2007-09-01

Many California streams have been adversely affected by sedimentation caused by historic and current land uses, including timber harvesting. The impacts of timber harvesting and logging transportation systems on erosion and sediment delivery can be directly measured, modeled, or inferred from water quality measurements. California regulatory agencies, researchers, and land owners have adopted turbidity monitoring to determine effects of forest management practices on suspended sediment loads and water quality at watershed, project, and site scales. Watershed-scale trends in sediment discharge and responses to current forest practices may be estimated from data collected at automated sampling stations that measure turbidity, stream flow, suspended sediment concentrations, and other water quality parameters. Future results from these studies will provide a basis for assessing the effectiveness of modern forest practice regulations in protecting water quality. At the project scale, manual sampling of water column turbidity during high stream flow events within and downstream from active timber harvest plans can identify emerging sediment sources. Remedial actions can then be taken by managers to prevent or mitigate water quality impacts. At the site scale, manual turbidity sampling during storms or high stream flow events at sites located upstream and downstream from new, upgraded, or decommissioned stream crossings has proven to be a valuable way to determine whether measures taken to prevent post-construction erosion and sediment production are effective. Turbidity monitoring at the project and site scales is therefore an important tool for adaptive management. Uncertainty regarding the effects of current forest practices must be resolved through watershed-scale experiments. In the short term, this uncertainty will stimulate increased use of project and site-scale monitoring.

Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

NASA Astrophysics Data System (ADS)

Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

1994-07-01

We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

Characterization of water quality and biological communities, Fish Creek, Teton County, Wyoming, 2007-08

USGS Publications Warehouse

Eddy-Miller, Cheryl A.; Peterson, David A.; Wheeler, Jerrod D.; Leemon, Daniel J.

2010-01-01

Fish Creek, a tributary to the Snake River, is about 25 river kilometers long and is located in Teton County in western Wyoming near the town of Wilson. Public concern about nuisance growths of aquatic plants in Fish Creek have been increasing in recent years. To address this concern, the U.S. Geological Survey conducted a study in cooperation with the Teton Conservation District to characterize the water quality and biological communities in Fish Creek. Water-quality samples were collected for analyses of physical properties and water chemistry (nutrients, nitrate isotopes, and wastewater chemicals) between March 2007 and October 2008 from seven surface-water sites and three groundwater wells. During this same period, aquatic plant and macroinvertebrate samples were collected and habitat characteristics were measured at the surface-water sites. The main objectives of this study were to (1) evaluate nutrient concentrations (that influence biological indicators of eutrophication) and potential sources of nutrients by using stable isotope analysis and other indicator chemicals (such as caffeine and disinfectants) that could provide evidence of anthropogenic sources, such as wastewater or septic tank contamination in Fish Creek and adjacent groundwater, and (2) characterize the algal, macrophyte, and macroinvertebrate communities and habitat of Fish Creek. Nitrate was the dominant species of dissolved nitrogen present in all samples and was the only bioavailable species detected at concentrations greater than the laboratory reporting level in all surface-water samples. Average concentrations of dissolved nitrate in surface water were largest in samples collected from the two sites with seasonal flow near Teton Village and decreased downstream; the smallest concentration was at downstream site A-Wck. Concentrations of dissolved nitrate in groundwater were consistently greater than concentrations in corresponding surface-water sites during the same sampling event. Orthophosphate was the primary dissolved species of phosphorus present in all surface-water and groundwater samples. The average concentration of dissolved orthophosphate in surface water was largest in samples collected from near Teton Village; samples from all other sites had similar average concentrations. Concentrations of dissolved orthophosphate in groundwater also were typically greater than concentrations in corresponding surface-water sites during the same sampling event. The aquatic plant communities in Fish Creek typically were composed of a mixture of macrophytes, macroalgae, microalgae, and moss. The composition of the aquatic plant community in Fish Creek appeared to shift in the downstream direction in 2007. On average, the proportion of macrophytes ranged from about 1 percent at site A-R1U, the most upstream site, to 54 percent of the plant community at site A-R6D, the farthest downstream site sampled during 2007. The downstream increase in macrophytes was accompanied by a downstream decrease in microalgae. The average proportion of microalgae ranged from 80 percent at site A-R1U to 24 percent at site A-R6D. The proportion of the macroalgae Cladophora in the aquatic plant community was relatively high at sites A-Wck and A-R3D in both 2007 and 2008.

Assessing the effects of tertiary treated wastewater reuse on a Mediterranean river (Llobregat, NE Spain): pathogens and indicators [corrected].

PubMed

Rubiano, María-Eugenia; Agulló-Barceló, Míriam; Casas-Mangas, Raquel; Jofre, Juan; Lucena, Francisco

2012-05-01

Need, coupled with advances in water treatment technology, is motivating a growing interest in augmenting drinking water supplies with reclaimed water. Using reclaimed water to increase the flow of the Llobregat River upstream the water catchment site of the complex multi-step drinking water treatment plant of Sant Joan Despí has been considered. The impact of reclaimed water discharges on the load of E. coli, spores of sulphite-reducing clostridia, somatic coliphages, cytopathogenic enteroviruses, and total and infectious Cryptosporidium oocysts in the Llobregat River water was assessed to gain information for funded decisions in potential future emergencies. Enterovirus and Cryptosporidium oocysts were concentrated from great water volumes prior to enumeration, whereas indicators were enumerated directly from the samples. Both indicators and pathogens were enumerated by cultural techniques that determine infectious microbes. Densities of both indicators and pathogens in reclaimed water, despite that it was disinfected by UV irradiation alone or by UV irradiation plus chlorination, were significantly lower than their densities in the river water, both upstream and downstream the reclaimed water release site in the river. Results gathered indicate that discharging reclaimed water into the river does not increment the load of indicators and pathogens of the river water. Then, in emergency situations due to severe water shortages after prolonged droughts, at least from the infectious diseases point of view, the risks of augmenting drinking water supplies with reclaimed water can be satisfactorily and safely managed.

Copper speciation in variably toxic sediments at the Ely Copper Mine, Vermont, United States

USGS Publications Warehouse

Kimball, Bryn E.; Foster, Andrea L.; Seal, Robert R.; Piatak, Nadine M.; Webb, Samuel M.; Hammarstrom, Jane M.

2016-01-01

At the Ely Copper Mine Superfund site, Cu concentrations exceed background values in both streamwater (160–1200 times) and sediments (15–79 times). Previously, these sediment samples were incubated with laboratory test organisms, and they exhibited variable toxicity for different stream sites. In this study we combined bulk- and microscale techniques to determine Cu speciation and distribution in these contaminated sediments on the basis of evidence from previous work that Cu was the most important stressor in this environment and that variable observed toxicity could have resulted from differences in Cu speciation. Copper speciation results were similar at microscopic and bulk scales. The major Cu species in the more toxic samples were sorbed or coprecipitated with secondary Mn (birnessite) and Fe minerals (jarosite and goethite), which together accounted for nearly 80% of the total Cu. The major Cu species in the less toxic samples were Cu sulfides (chalcopyrite and a covellite-like phase), making up about 80–95% of the total Cu, with minor amounts of Cu associated with jarosite or goethite. These Cu speciation results are consistent with the toxicity results, considering that Cu sorbed or coprecipitated with secondary phases at near-neutral pH is relatively less stable than Cu bound to sulfide at lower pH. The more toxic stream sediment sites were those that contained fewer detrital sulfides and were upstream of the major mine waste pile, suggesting that removal and consolidation of sulfide-bearing waste piles on site may not eliminate all sources of bioaccessible Cu.

Measured and predicted environmental concentrations of carbamazepine, diclofenac, and metoprolol in small and medium rivers in northern Germany.

PubMed

Meyer, Wibke; Reich, Margrit; Beier, Silvio; Behrendt, Joachim; Gulyas, Holger; Otterpohl, Ralf

2016-08-01

This study evaluated the impact of secondary municipal effluent discharge on carbamazepine, diclofenac, and metoprolol concentrations in small and medium rivers in northern Germany and compared the measured environmental concentrations (MECs) to the predicted environmental concentrations (PECs) calculated with four well-established models. During a 1-year sampling period, secondary effluent grab samples were collected at four wastewater treatment plants (WWTPs) together with grab samples from the receiving waters upstream and downstream from the wastewater discharge points. The carbamazepine, diclofenac, and metoprolol concentrations were analyzed with high-performance liquid chromatography-tandem mass spectrometry (HPLC/MS-MS) after solid phase extraction. In the secondary effluents, 84-790 ng/L carbamazepine, 395-2100 ng/L diclofenac, and 745-5000 ng/L metoprolol were detected. The carbamazepine, diclofenac, and metoprolol concentrations analyzed in the rivers downstream from the secondary effluent discharge sites ranged from <5 to 68, 370, and 520 ng/L, respectively. Most of the downstream pharmaceutical concentrations were markedly higher than the corresponding upstream concentrations. The impact of wastewater discharge on the MECs in rivers downstream from the WWTPs was clearly demonstrated, but the correlations of the MECs with dilution factors were poor. The smallest rivers exhibited the largest maximum MECs and the widest ranges of MECs downstream from the wastewater discharge point. Three of the four tested models were conservative, as they showed higher PECs than the MECs in the rivers downstream from the WWTPs. However, the most detailed model underestimated the diclofenac concentrations.

Proceedings of a workshop on American Eel passage technologies

USGS Publications Warehouse

Haro, Alexander J.

2013-01-01

Recent concerns regarding a decline in recruitment of American eels (Anguilla rostrata) have prompted efforts to restore this species to historic habitats by providing passage for both upstream migrant juveniles and downstream migrant adults at riverine barriers, including low-head and hydroelectric dams (Castonguay et al. 1994, Haro et al. 2000). These efforts include development of management plans and stock assessment reviews in both the US and Canada (COSEWIC 2006, Canadian Eel Working Group 2009, DFO 2010, MacGregor et al. 2010, ASMFC 2000, ASMFC 2006, ASMFC 2008, Williams and Threader 2007), which target improvement of upstream and downstream passage for eels, as well as identification and prioritization of research needs for development of new and more effective passage technologies for American eels. Traditional upstream fish passage structures, such as fishways and fish lifts, are often ineffective passing juvenile eels, and specialized passage structures for this species are needed. Although designs for such passage structures are available and diverse (Knights and White 1998, Porcher 2002, FAO/DVWK 2002, Solomon and Beach 2004a,b, Environment Agency UK 2011), many biologists, managers, and engineers are unfamiliar with eel pass design and operation, or unaware of the technical options available for upstream eel passage, Better coordination is needed to account for eel passage requirements during restoration efforts for other diadromous fish species. Also, appropriately siting eel passes at hydropower projects is critical, and siting can be difficult and complex due to physical restrictions in access to points of natural concentrations of eels, dynamic hydraulics of tailrace areas, and presence of significant competing flows from turbine outfalls or spill. As a result, some constructed eel passes are sited poorly and may pass only a fraction of the number of eels attempting to pass the barrier. When sited and constructed appropriately, however, eel passes can effectively pass thousands of individuals in a season (Appendix D). technologies for preventing impingement and entrainment mortality and injury of downstream migrant eels at hydropower projects are not well developed. Traditional downstream fish passage mitigative techniques originally developed for salmonids and other species are frequently ineffective passing eels (Richkus and Dixon 2003, EPRI 2001, Bruijs and Durif 2009). Large hydropower projects, with high project flows or intake openings that cannot be fitted with racks or screens with openings small enough to exclude eels, pose significant passage problems for this species, and turbine impingement and entrainment mortality of eels can be as high as 100%. Spill mortality and injury may also be significant for eels, given their tendency to move during high flow events when projects typically spill large amounts of flow. Delays in migration of eels that have difficulty locating and utilizing bypass entrances can also be significant. Therefore, downstream passage technologies are at a much more nebulous state of development than upstream passage technologies, and require further evaluation and improvement before rigorous design guidelines can be established. There have been few studies conducted to evaluate effectiveness of current mitigative measures for both upstream and downstream passage of eels. Research is needed to determine eel migratory timing, behavior, and appropriate mitigation technologies for specific sites and eel life history stages. Both upstream and downstream eel passage structures can be difficult to evaluate in terms of performance, and examples of how evaluation and monitoring can be accomplished were reviewed at the workshop.

Biological and chemical characterization of metal bioavailability in sediments from Lake Roosevelt, Columbia River, Washington, USA

USGS Publications Warehouse

Besser, J.M.; Brumbaugh, W.G.; Ivey, C.D.; Ingersoll, C.G.; Moran, P.W.

2008-01-01

We studied the bioavailability and toxicity of copper, zinc, arsenic, cadmium, and lead in sediments from Lake Roosevelt (LR), a reservoir on the Columbia River in Washington, USA that receives inputs of metals from an upstream smelter facility. We characterized chronic sediment toxicity, metal bioaccumulation, and metal concentrations in sediment and pore water from eight study sites: one site upstream in the Columbia River, six sites in the reservoir, and a reference site in an uncontaminated tributary. Total recoverable metal concentrations in LR sediments generally decreased from upstream to downstream in the study area, but sediments from two sites in the reservoir had metal concentrations much lower than adjacent reservoir sites and similar to the reference site, apparently due to erosion of uncontaminated bank soils. Concentrations of acid-volatile sulfide in LR sediments were too low to provide strong controls on metal bioavailability, and selective sediment extractions indicated that metals in most LR sediments were primarily associated with iron and manganese oxides. Oligochaetes (Lumbriculus variegatus) accumulated greatest concentrations of copper from the river sediment, and greatest concentrations of arsenic, cadmium, and lead from reservoir sediments. Chronic toxic effects on amphipods (Hyalella azteca; reduced survival) and midge larvae (Chironomus dilutus; reduced growth) in whole-sediment exposures were generally consistent with predictions of metal toxicity based on empirical and equilibrium partitioning-based sediment quality guidelines. Elevated metal concentrations in pore waters of some LR sediments suggested that metals released from iron and manganese oxides under anoxic conditions contributed to metal bioaccumulation and toxicity. Results of both chemical and biological assays indicate that metals in sediments from both riverine and reservoir habitats of Lake Roosevelt are available to benthic invertebrates. These findings will be used as part of an ongoing ecological risk assessment to determine remedial actions for contaminated sediments in Lake Roosevelt. ?? 2007 Springer Science+Business Media, LLC.

In situ impact assessment of wastewater effluents by integrating multi-level biomarker responses in the pale chub (Zacco platypus).

PubMed

Kim, Woo-Keun; Jung, Jinho

2016-06-01

The integration of biomarker responses ranging from the molecular to the individual level is of great interest for measuring the toxic effects of hazardous chemicals or effluent mixtures on aquatic organisms. This study evaluated the effects of wastewater treatment plant (WWTP) effluents on the freshwater pale chub Zacco platypus by using multi-level biomarker responses at molecular [mRNA expression of catalase (CAT), superoxide dismutase (SOD), glutathione S-transferase (GST), and metallothionein (MT)], biochemical (enzyme activities of CAT, SOD, GST, and concentration of MT), and physiological [condition factor (CF) and liver somatic index (LSI)] levels. The mRNA expression levels of GST and MT in Z. platypus from a site downstream of a WWTP significantly increased by 2.2- and 4.5-fold (p<0.05) when compared with those from an upstream site. However, the enzyme activities of CAT, SOD, and GST in fish from the downstream site significantly decreased by 43%, 98%, and 13%, respectively (p<0.05), except for an increase in MT concentration (41%). In addition, a significant increase in LSI (46%) was observed in Z. platypus from the downstream site (p<0.05). Concentrations of Cu, Zn, Cd, and Pb in the liver of Z. platypus were higher (530%, 353%, 800%, and 2,200%, respectively) in fish from a downstream site than in fish from an upstream location, and several multi-level biomarker responses were significantly correlated with the accumulated metals in Z. platypus (p<0.05). Integrated biomarker responses at molecular, biochemical, and physiological levels (multi-level IBR) were much higher (about 4-fold) at the downstream site than at the upstream site. This study suggests that the multi-level IBR approach is very useful for quantifying in situ adverse effects of WWTP effluents. Copyright © 2016 Elsevier Inc. All rights reserved.

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

PubMed

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Effect of hepatic venous sphincter contraction on transmission of central venous pressure to lobar and portal pressure.

PubMed

Lautt, W W; Legare, D J; Greenway, C V

1987-11-01

In dogs anesthetized with pentobarbital, central vena caval pressure (CVP), portal venous pressure (PVP), and intrahepatic lobar venous pressure (proximal to the hepatic venous sphincters) were measured. The objective was to determine some characteristics of the intrahepatic vascular resistance sites (proximal and distal to the hepatic venous sphincters) including testing predictions made using a recent mathematical model of distensible hepatic venous resistance. The stimulus used was a brief rise in CVP produced by transient occlusion of the thoracic vena cava in control state and when vascular resistance was elevated by infusions of norepinephrine or histamine, or by nerve stimulation. The percent transmission of the downstream pressure rise to upstream sites past areas of vascular resistance was elevated. Even small increments in CVP are partially transmitted upstream. The data are incompatible with the vascular waterfall phenomenon which predicts that venous pressure increments are not transmitted upstream until a critical pressure is overcome and then further increments would be 100% transmitted. The hepatic sphincters show the following characteristics. First, small rises in CVP are transmitted less than large elevations; as the CVP rises, the sphincters passively distend and allow a greater percent transmission upstream, thus a large rise in CVP is more fully transmitted than a small rise in CVP. Second, the amount of pressure transmission upstream is determined by the vascular resistance across which the pressure is transmitted. As nerves, norepinephrine, or histamine cause the hepatic sphincters to contract, the percent transmission becomes less and the distensibility of the sphincters is reduced. Similar characteristics are shown for the "presinusoidal" vascular resistance and the hepatic venous sphincter resistance.(ABSTRACT TRUNCATED AT 250 WORDS)

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

DOE Office of Scientific and Technical Information (OSTI.GOV)

none,

Oak Ridge Associated Universities (ORAU), under the Oak Ridge Institute for Science and Education (ORISE) contract, collected split surface water samples with Nuclear Fuel Services (NFS) representatives on June 12, 2013. Representatives from the U.S. Nuclear Regulatory Commission (NRC) and the Tennessee Department of Environment and Conservation were also in attendance. Samples were collected at four surface water stations, as required in the approved Request for Technical Assistance number 11-018. These stations included Nolichucky River upstream (NRU), Nolichucky River downstream (NRD), Martin Creek upstream (MCU), and Martin Creek downstream (MCD). Both ORAU and NFS performed gross alpha and gross betamore » analyses, and Table 1 presents the comparison of results using the duplicate error ratio (DER), also known as the normalized absolute difference. A DER ≤ 3 indicates at a 99% confidence interval that split sample results do not differ significantly when compared to their respective one standard deviation (sigma) uncertainty (ANSI N42.22). The NFS split sample report specifies 95% confidence level of reported uncertainties (NFS 2013). Therefore, standard two sigma reporting values were divided by 1.96. In conclusion, most DER values were less than 3 and results are consistent with low (e.g., background) concentrations. The gross beta result for sample 5198W0014 was the exception. The ORAU gross beta result of 6.30 ± 0.65 pCi/L from location NRD is well above NFS's non-detected result of 1.56 ± 0.59 pCi/L. NFS's data package includes no detected result for any radionuclide at location NRD. At NRC's request, ORAU performed gamma spectroscopic analysis of sample 5198W0014 to identify analytes contributing to the relatively elevated gross beta results. This analysis identified detected amounts of naturally-occurring constituents, most notably Ac-228 from the thorium decay series, and does not suggest the presence of site-related contamination.« less

Invertebrates as indicators for chemical stress in sewage-influenced stream systems: toxic and endocrine effects in gammarids and reactions at the community level in two tributaries of Lake Constance, Schussen and Argen.

PubMed

Peschke, Katharina; Geburzi, Jonas; Köhler, Heinz-R; Wurm, Karl; Triebskorn, Rita

2014-08-01

The present study investigates the impact of releases from waste water treatment plants and storm water overflow basins on gammarids and other macrozoobenthos. The study relates to a recent upgrading of a waste water treatment plant (Langwiese) at the Schussen river, an important tributary to Lake Constance. Samples were taken at different sites at the Schussen river upstream and downstream of a storm water overflow basin and the waste water treatment plant Langwiese and, in parallel, at the Argen river, a less polluted reference stream. We assessed the influence of water quality on the distribution of macrozoobenthos and on the health of gammarid populations by a variety of ecotoxicological methods including biomarkers prior to the expansion of the waste water treatment plant. Through histopathological studies, the impact of parasites on host tissue health was evaluated. Analyses of heat shock protein (hsp70) levels allowed us to draw conclusions about the proteotoxicity-related stress status of the organisms. Furthermore, gammarid populations from all sites were investigated in respect to sex ratio, parasitism rate, and fecundity. Macrozoobenthos community integrity was determined by means of the saprobic index and the abundance as well as by the number of taxa. In gammarids, the sex ratio was significantly shifted towards females, fecundity was significantly decreased, and the hsp70 level was significantly increased downstream of the waste water treatment plant Langwiese, compared to the upstream sampling site. Similarly, these effects could be detected downstream of three small storm water overflow basins. In the macrozoobenthos communities, the abundance of taxa, the number of taxa, the number of ephemeroptera, plecoptera, and trichoptera taxa (EPT-taxa), and the number of sensitive taxa decreased downstream of the storm water overflow basin Mariatal as well as downstream of the waste water treatment plant Langwiese. Our study showed, that waste water treatment plants and storm water overflow basins affected macroinvertebrate communities and the health of gammarids. Copyright © 2014 Elsevier Inc. All rights reserved.

Streamflow gains and losses and selected water-quality observations in five subreaches of the Rio Grande/Rio Bravo del Norte from near Presidio to Langtry, Texas, Big Bend area, United States and Mexico, 2006

USGS Publications Warehouse

Raines, Timothy H.; Turco, Michael J.; Connor, Patrick J.; Bennett, Jeffery B.

2012-01-01

Few historical streamflow and water-quality data are available to characterize the segment of the Rio Grande/Rio Bravo del Norte (hereinafter Rio Grande) extending from near Presidio to near Langtry, Texas. The U.S. Geological Survey, in cooperation with the National Park Service and the Texas Commission on Environmental Quality, collected water-quality and streamflow data from the Rio Grande from near Presidio to near Langtry, Texas, to characterize the streamflow gain and loss and selected constituent concentrations in a 336.3-mile reach of the Rio Grande from near Presidio to near Langtry, Texas. Streamflow was measured at 38 sites and water-quality samples were collected at 20 sites along the Rio Grande in February, March, and June 2006. Streamflow gains and losses over the course of the stream were measured indirectly by computing the differences in measured streamflow between sites along the stream. Water-quality data were collected and analyzed for salinity, dissolved solids, major ions, nutrients, trace elements, and stable isotopes. Selected properties and constituents were compared to available Texas Commission on Environmental Quality general use protection criteria or screening levels. Summary statistics of selected water-quality data were computed for each of the five designated subreaches. Streamflow gain and loss and water-quality constituent concentration were compared for each subreach, rather than the entire segment because of the temporal variation in sample collection caused by controlled releases upstream. Subreach A was determined to be a losing reach, and subreaches B, C, D, and E were determined to be gaining reaches. Compared to concentrations measured in upstream subreaches, downstream subreaches exhibited evidence of dilution of selected constituent concentrations. Subreaches A and B had measured total dissolved solids, chloride, and sulfate exceeding the Texas Commission on Environmental Quality general use protection criteria. Subreaches C, D, and E did not exceed the general use protection criteria for any constituent concentration criteria, but dissolved oxygen concentrations did not meet the general use criteria in these subreaches.

Mount St. Helens Long-Term Sediment Management Plan for Flood Risk Reduction

DTIC Science & Technology

2010-06-01

one dredge would direct pump to the Wasser Winters disposal site, located along the southern bank of the Cowlitz River mouth. The average annual...dredge would pipeline pump either upstream to disposal site 20cde or downstream to the Wasser Winters site. Pumping distances would not exceed 6.0...estimates referenced the Wasser Winters upland preparation estimates and were based on the relationship between acreage and effort. Total site

Hexabromocyclododecane Flame Retardant Isomers in Sediments from Detroit River and Lake Erie of the Laurentian Great Lakes of North America.

PubMed

Letcher, Robert J; Lu, Zhe; Chu, Shaogang; Haffner, G Douglas; Drouillard, Ken; Marvin, Christopher H; Ciborowski, Jan J H

2015-07-01

Sediments collected in 2004 from along the Detroit River (n = 19) and across all of Lake Erie (n = 18) were analyzed for isomers of the flame retardant chemical, hexabromocyclododecane (HBCD), using liquid chromatography-tandem mass spectrometry. Sediment samples had ΣHBCD concentrations ranging from not detected to 1.6 ng/g d.w. γ-HBCD (56 %-100 % of ΣHBCDs) was the predominate isomer, observed in 7 of 19 samples from the Detroit River and 6 of 18 samples from Lake Erie (all within the western basin). α-HBCD was found in 4 Detroit River and 2 Lake Erie western basin sites, while β-HBCD was only in two Detroit River samples. High ΣHBCD concentrations (>100 ng/g d.w.) were found in two sludge samples from two Windsor, ON, wastewater treatment plants that feed into the Detroit River upstream. HBCD contamination into the Detroit River is a major input vector into Lake Erie and with an apparent sediment dilution effect moving towards the eastern basin.

Community and Ecosystem-Level Impacts of an Emergent Macrophyte on the Ventura River, California.

NASA Astrophysics Data System (ADS)

Simpson, J.; Leydecker, A.; Melack, J.

2005-05-01

Ludwigia hexapetala is a pervasive, emergent vascular plant on the lower Ventura River. Presence of this plant appears to facilitate growth of shade-tolerant diatoms, while indirectly inhibiting filamentous green macroalgae. Four sites on the river were monitored during 2003; three downstream of a wastewater treatment plant, where Ludwigia is present, and one upstream site where it is absent. Filamentous algae occurred at all four sites, but declined rapidly at the below-treatment plant sites as growth and cover of vascular plants increased. By late summer, percent cover at these sites was dominated by Ludwigia, while the upstream site was consistently dominated by green macroalgae. Submerged plant parts provided substrate for diatom colonization, roughly doubling benthic diatom biomass (measured as chlorophyll a) at the downstream sites. Presence of the Ludwigia population also had strong ecosystem-level effects. The wastewater effluent produced typical stream water nitrate concentrations of 100-200 uM. Nitrate uptake rates downstream of the treatment plant inputs averaged 5 kg N/km/day, and direct uptake by Ludwigia could account for 20-40% of this nitrate drawdown. Further nitrate removal from the water column may be indirectly facilitated by the presence of Ludwigia through facilitation of diatom population growth.

3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

PubMed Central

Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

2016-01-01

Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

Effects of land use, stream habitat, and water quality on biological communities of wadeable streams in the Illinois River Basin of Arkansas, 2011 and 2012

USGS Publications Warehouse

Petersen, James C.; Justus, B.G.; Meredith, Bradley J.

2014-01-01

The Illinois River Basin includes an area of diverse land use in northwestern Arkansas. Land-use data collected in 2006 indicate that most of the land in the basin is agricultural. The agricultural land is used primarily for production of poultry and cattle. Eighteen sites were selected from the list of candidate sites based on drainage area, land use, presence or absence of an upstream wastewater-treatment plant, water quality, and other information gathered during the reconnaissance. An important consideration in the process was to select sites along gradients of forest to urban land use and forest to agricultural land use. Water-quality samples were collected for analysis of nutrients, and a multiparameter field meter was used to measure water temperature, specific conductance, pH, and dissolved oxygen. Streamflow was measured immediately following the water-quality sampling. Macroalgae coverage was estimated and periphyton, macroinvertebrate, and fish communities were sampled at each site. Stream habitat also was assessed. Many types of land-use, water-quality, and habitat factors affected one or more aspects of the biological communities. Several macroinvertebrate and fish metrics changed in response to changes in percent forest; sites that would be considered most disturbed, based on these metrics, are sites with the highest percentages of urban land use in their associated basins. The presence of large mats of macroalgae was one of the most noticeable biological characteristics in several streams within the Illinois River Basin. The highest macroalgae percent cover values were recorded at four sites downstream from wastewater-treatment plants. Macroalgae percent cover was strongly correlated only with bed substrate size, canopy closure, and specific conductance. Periphyton metrics were most often and most strongly correlated with riparian shading, specific conductance, substrate turbidity, percent agriculture, poultry house density, and unpaved road density; some of these factors were strongly correlated with percent forest, percent urban, or percent agriculture. Total biovolume of periphyton was not strongly correlated with any of the land use, habitat, or water-quality factors assessed in the present study. Although algal growth typically increases with higher nutrient concentrations and less shading, the standing crop of periphyton on rocks can be reduced by herbivorous macroinvertebrates and fish, which may explain why total biovolume in Ozark streams was not strongly affected by water-quality (or other habitat) factors. A macroinvertebrate index and several macroinvertebrate metrics were adversely affected by increasing urban and agricultural land use and associated environmental factors. Factors most commonly affecting the index and metrics included factors associated with water quality, stream geometry, sediment, land-use percentages, and road density. In general, the macroinvertebrate index was higher (indicative of least disturbance) at sites with greater percentages of forest in their basins, lower percentages of urban land in their basins, and lower paved road density. Upstream wastewater-treatment plants affected several metrics. For example, three of the five lowest macroinvertebrate index scores, two of the five lowest percent predator values, and two of the five highest percent gatherer-collector values were at sites downstream from wastewater-treatment plants. The Ozark Highlands fish index of biotic integrity and several fish metrics were adversely affected by increasing urban and agricultural land use and associated factors. Factors affecting these metrics included factors associated with nutrients, sediment, and shading. In general, the fish index of biotic integrity was higher at sites with higher percentages of forest in their basins, lower percentages of urban land in their basins, higher unpaved road density, and lower paved and total road density. Upstream wastewater-treatment plants seemed to affect some fish community metrics substantially but had little effect on other metrics. For example, three of the five lowest relative abundances of lithophilic spawner minus stonerollers and four of the five highest stoneroller abundances were at sites downstream from wastewater-treatment plants. Interpretations of the results of the study described in this report are limited by a number of factors. These factors individually and collectively add to uncertainty and variability in the responses to various environmental stresses. Notwithstanding the limiting factors, the biological responses of macroalgae cover and periphyton, macroinvertebrate, and fish metrics to environmental variables provide multiple lines of evidence that biological communities of these streams are affected by recent and ongoing land-use practices. For several biological metrics there appears to be a threshold of about 40 to 50 percent forest where values of these metrics change in magnitude. However, the four sites with more than 50 percent forest in their basins were the four sites sampled in late May–early June of 2012 (rather than July–August of 2011). The relative influence of season and forest percentage on the biological communities at these sites is unknown.

[Case study on health risk assessment based on site-specific conceptual model].

PubMed

Zhong, Mao-Sheng; Jiang, Lin; Yao, Jue-Jun; Xia, Tian-Xiang; Zhu, Xiao-Ying; Han, Dan; Zhang, Li-Na

2013-02-01

Site investigation was carried out on an area to be redeveloped as a subway station, which is right downstream of the groundwater of a former chemical plant. The results indicate the subsurface soil and groundwater in the area are both polluted heavily by 1,2-dichloroethane, which was caused by the chemical plant upstream with the highest concentration was 104.08 mg.kg-1 for soil sample at 8.6 m below ground and the highest concentration was 18500 microg.L-1 for groundwater. Further, a site-specific contamination conceptual model, giving consideration to the specific structure configuration of the station, was developed, and the corresponding risk calculation equation was derived. The carcinogenic risks calculated with models developed on the generic site conceptual model and derived herein on the site-specific conceptual model were compared. Both models indicate that the carcinogenic risk is significantly higher than the acceptable level which is 1 x 10(-6). The comparison result reveals that the risk calculated with the former models for soil and groundwater are higher than the one calculated with the latter models by 2 times and 1.5 times, respectively. The finding in this paper indicates that the generic risk assessment model may underestimate the risk if specific site conditions and structure configuration are not considered.

Trends in chlorinated hydrocarbon levels in Hudson River basin sediments.

PubMed Central

Bopp, R F; Chillrud, S N; Shuster, E L; Simpson, H J; Estabrooks, F D

1998-01-01

Analysis of sections from dated sediment cores were used to establish geographic distributions and temporal trends of chlorinated hydrocarbon contaminant levels in sediments from natural waters of the Hudson River basin. Radiometric dating was based primarily on the depth distribution of 137(Cs) in the cores and on the occurrence of detectable levels of 7(Be) in surface sediment samples. Eighteen sampling sites included several along the main stem of the Hudson, its major tributaries, and components of the New York/New Jersey (NY/NJ) harbor complex. Drinking-water reservoirs were sampled to place upper limits on atmospheric inputs. Core sections were analyzed for polychlorinated biphenyls (PCBs), 1,1,1-trichloro-2,2-bis(p-chlorophenyl) ethane (DDT)-derived compounds, chlordane, and dioxins. Sediment concentrations of most contaminants at most sites have decreased significantly since the mid-1960s. The data provide a basinwide perspective on major point-source inputs of PCBs to the upper Hudson River and of 2,3,7,8-tetrachlorodibenzo-p-dioxin and DDT to the lower Passaic River. Evidence was found for significant but poorly characterized sources of PCBs and chlordane to the western NY/NJ harbor, and of highly chlorinated dioxins to the upstream sites on the main stem of the Hudson. The results indicate that analysis of dated sediment samples is a most effective and efficient monitoring tool for the study of large-scale geographic and temporal trends in levels of particle-associated contaminants. Images Figure 1 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:9703496

Chemical characteristics, including stable-isotope ratios, of surface water and ground water from selected sources in and near East Fork Armells Creek basin, southeastern Montana, 1985

USGS Publications Warehouse

Ferreira, R.F.; Lambing, J.H.; Davis, R.E.

1989-01-01

Water samples were collected from 29 sites to provide synoptic chemical data, including stable-isotope ratios, for an area of active surface coal mining and to explore the effectiveness of using the data to chemically distinguish water from different aquifers. Surface-water samples were collected from one spring, four sites on East Armells Creek, one site on Stocker Creek, and two fly-ash ponds. Streamflows in East Fork Armells Creek ranged from no flow in several upstream reaches to 2.11 cu ft/sec downstream from Colstrip, Montana. Only one tributary, Stocker Creek, was observed to contribute surface flow in the study area. Groundwater samples were collected from wells completed in Quaternary alluvium or mine spoils, Rosebud overburden, Rosebud coal bed, McKay coal bed, and sub-McKay deposits of the Tongue River Member, Paleocene Fort Union Formation. Dissolved-solids concentrations, in mg/L, were 840 at the spring, 3,100 to 5,000 in the streams, 13,000 to 22,000 in the ash ponds, and 690 to 4 ,100 in the aquifers. With few exceptions, water from the sampled spring, streams, and wells had similar concentrations of major constituents and trace elements and similar stable-isotope ratios. Water from the fly-ash ponds had larger concentrations of dissolved solids, boron, and manganese and were isotopically more enriched in deuterium and oxygen-18 than water from other sources. Water from individual aquifers could not be distinguished by either ion-composition diagrams or statistical cluster analyses. (USGS)

Beaver lodge location on the upstream Loire River.

PubMed

Fustec, Joëlle; Cormier, Jean-Paul; Lodé, Thierry

2003-08-01

In the part of the Loire River recently colonized by Eurasian beavers, we compared habitat characteristics among sites with lodges, sites with cut trees and sites without beaver. The absence of sandbank and canopy cover (by 10-15-m tall trees, by tall Salicaceae, and by bushy Salicaceae) appeared as good predictors for lodge settling. Based on this model, the number of proper lodge sites was estimated for the next downstream 36 kilometers stretch. The number of favourable sites decreases as anthropization increases.

Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

PubMed Central

Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

2005-01-01

Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

PubMed Central

Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

2000-01-01

The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

EPA Science Inventory

Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a baseline of fish from refer...

USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

EPA Science Inventory

Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a basline of fish from refere...

Method of and apparatus for testing the integrity of filters

DOEpatents

Herman, R.L.

1985-05-07

A method of and apparatus are disclosed for testing the integrity of individual filters or filter stages of a multistage filtering system including a diffuser permanently mounted upstream and/or downstream of the filter stage to be tested for generating pressure differentials to create sufficient turbulence for uniformly dispersing trace agent particles within the airstream upstream and downstream of such filter stage. Samples of the particle concentration are taken upstream and downstream of the filter stage for comparison to determine the extent of particle leakage past the filter stage. 5 figs.

Method of and apparatus for testing the integrity of filters

DOEpatents

Herman, Raymond L [Richland, WA

1985-01-01

A method of and apparatus for testing the integrity of individual filters or filter stages of a multistage filtering system including a diffuser permanently mounted upstream and/or downstream of the filter stage to be tested for generating pressure differentials to create sufficient turbulence for uniformly dispersing trace agent particles within the airstream upstream and downstream of such filter stage. Samples of the particle concentration are taken upstream and downstream of the filter stage for comparison to determine the extent of particle leakage past the filter stage.

Methods of and apparatus for testing the integrity of filters

DOEpatents

Herman, R.L.

1984-01-01

A method of and apparatus for testing the integrity of individual filters or filter stages of a multistage filtering system including a diffuser permanently mounted upstream and/or downstream of the filter stage to be tested for generating pressure differentials to create sufficient turbulence for uniformly dispersing trace agent particles within the airstram upstream and downstream of such filter stage. Samples of the particel concentration are taken upstream and downstream of the filter stage for comparison to determine the extent of particle leakage past the filter stage.

Characterization of streamflow, suspended sediment, and nutrients entering Galveston Bay from the Trinity River, Texas, May 2014–December 2015

USGS Publications Warehouse

Lucena, Zulimar; Lee, Michael T.

2017-02-21

The U.S. Geological Survey (USGS), in cooperation with the Texas Water Development Board and the Galveston Bay Estuary Program, collected streamflow and water-quality data at USGS streamflow-gaging stations in the lower Trinity River watershed from May 2014 to December 2015 to characterize and improve the current understanding of the quantity and quality of freshwater inflow entering Galveston Bay from the Trinity River. Continuous streamflow records at four USGS streamflow-gaging stations were compared to quantify differences in streamflow magnitude between upstream and downstream reaches of the lower Trinity River. Water-quality conditions were characterized from discrete nutrient and sedi­ment samples collected over a range of hydrologic conditions at USGS streamflow-gaging station 08067252 Trinity River at Wallisville, Tex. (hereinafter referred to as the “Wallisville site”), approximately 4 river miles upstream from where the Trinity River enters Galveston Bay.Based on streamflow records, annual mean outflow from Livingston Dam into the lower Trinity River was 2,240 cubic feet per second (ft3/s) in 2014 and 22,400 ft3/s in 2015, the second lowest and the highest, respectively, during the entire period of record (1966–2015). During this study, only about 54 percent of the total volume measured at upstream sites was accounted for at the Wallisville site as the Trinity River enters Galveston Bay. This difference in water volumes between upstream sites and the Wallisville site indicates that at high flows a large part of the volume released from Lake Livingston does not reach Galveston Bay through the main channel of the Trinity River. These findings indicate that water likely flows into wetlands and water bodies surrounding the main channel of the Trinity River before reaching the Wallisville site and is being stored or discharged through other channels that flow directly into Galveston Bay.To characterize suspended-sediment concentrations and loads in Trinity River inflow to Galveston Bay, a regression model was developed to estimate suspended-sediment concentrations by using acoustic backscatter data as a surrogate. The model yielded an adjusted coefficient of determination value of 0.92 and a root mean square error of 1.65 milligrams per liter (mg/L). The mean absolute percentage error between measured and estimated suspended-sediment concentration was 35 percent. During this study, estimated suspended-sediment concentrations ranged from 2 to 701 mg/L, with a mean of 97 mg/L. Suspended-sediment concentrations varied in response to changes in discharge, with peak suspended-sediment concentrations occurring 1 to 2 days before the peak discharge for each event. The total suspended-sediment load at the Wallisville site during May 2014–December 2015 was approximately 2,200,000 tons, with a minimum monthly suspended-sediment load of 100 tons in October 2014 and a maximum monthly load of 441,000 tons in November 2015.Results from nutrient samples collected at the Wallisville site indicate that total nitrogen and total phosphorus concen­trations fluctuated at a similar rate, with the highest nutrient concentrations occurring during periods of high flow corresponding to releases from Lake Livingston. The mean concen­trations of total nitrogen and total phosphorus were approxi­mately 75 percent higher during high flow releases than during periods of low flow, overshadowing variations in nutrient concentrations caused by seasonality at the Wallisville site.Results from the study indicate nutrient delivery to Galveston Bay from the main channel of the Trinity River is likely controlled primarily by high-flow releases from Lake Livingston. For most samples collected at the Wallisville site, organic nitrogen was the predominant form of nitrogen; however, when discharge increased because of releases from Lake Livingston, the percentage of organic nitrogen typically decreased and the percentage of nitrate increased. The concentrations of total phosphorus also increased during high-flow events, likely as a result of suspended sediment within Lake Livingston releases and mobilization of sediment particles in the river channel and flood plain during these periods of high flow. The predominant source of phosphorous to Galveston Bay from the Trinity River is in particulate form closely tied to suspended-sediment concentrations. The changes in nutrient concentration and composition caused by releases from Lake Livingston during this study indicate the reservoir may play an important role in the delivery of nutrients into Galveston Bay. Further study is required to better understand the processes in Lake Livingston influencing the characteristics of nutrient and sediment inflow to Galveston Bay. With phosphorous concentrations correlated to suspended-sediment concentra­tions (coefficient of determination value of 0.75) and with the concentrations of nutrients changing as the discharge changes, the diversion of water and suspended sediment into surround­ing wetlands and channels outside of the main channel of the Trinity River may play a large role in regulating nutrient inputs into Galveston Bay.

An Investigation into Heavy Metal Contamination and Mobilization in the Lower Rouge River, Michigan

NASA Astrophysics Data System (ADS)

Shihadeh, M.; Forrester, J.; Napieralski, J. A.

2010-12-01

Similar to many densely populated watersheds in the Great Lakes Basin, the Rouge River in Michigan drains a heavily urbanized watershed, which, over time, has accumulated a substantial amount of contamination due to decades of manufacturing and refining industries. Statistically significant levels of heavy metals have been found in the bed sediment of the Rouge; however, little is known about the mobilization of these contaminated bed sediments. The goal of this study was to ascertain the extent to which these potentially contaminated sediments are mobilized and transported downstream. Suspended sediment samples were collected at four sites along the lower Rouge River using composite depth integrated sediment samples three times per week, resulting in a total of twenty samples from each site. Turbidity was measured simultaneously using a YSI datalogger at all sampling locations. Sediment was also extracted from floodplain soil pits and silted vegetation, as well as river bed sediment cores along stream channel cross-sections. Heavy metal concentrations (As, Cd, Cr, Cu, Fe, Pb, Hg, Ni, Se, Zn) were analyzed using ICP-MS and compared against both background characteristics for Michigan soils and EPA Hazardous Criteria Limits. As expected, a positive correlation exists between turbidity and heavy metal concentrations. Even in the sampling sites furthest upstream, heavy metal concentrations exceeded background soil characteristics, with a few also exceeding hazardous criteria limits. The heavy metal concentrations found in the Lower Rouge affirm the elevated pollution classification of the river, depict the overall influence of industrialization on stream health, and verify that contaminated sediments are being deposited in aquatic and floodplain environments during variable flow or high discharge events. Results from this study emphasize the need to remediate bed sediments in the Rouge and suggest that there may be significant bioaccumulation potential for organisms inhabiting the floodplain corridor.

Phytoestrogens and mycotoxins in Iowa streams: An examination of underinvestigated compounds in agricultural basins

USGS Publications Warehouse

Kolpin, Dana W.; Hoerger, Corinne C.; Meyer, Michael T.; Wettstein, Felix E.; Hubbard, Laura E.; Bucheli, Thomas D.

2010-01-01

This study provides the first broad-scale investigation on the spatial and temporal occurrence of phytoestrogens and mycotoxins in streams in the United States. Fifteen stream sites across Iowa were sampled five times throughout the 2008 growing season to capture a range of climatic and crop-growth conditions. Basin size upstream from sampling sites ranged from 7 km2 to >836,000 km2 Atrazine (herbicide) also was measured in all samples as a frame-of-reference agriculturally derived contaminant. Target compounds were frequently detected in stream samples: atrazine (100%), formononetin (80%), equol (45%), deoxynivalenol (43%), daidzein (32%), biochanin A (23%), zearalenone (13%), and genistein (11%). The nearly ubiquitous detection of formononetin (isoflavone) suggests a widespread agricultural source, as one would expect with the intense row crop and livestock production present across Iowa. Conversely, the less spatially widespread detections of deoxynivalenol (mycotoxin) suggest a more variable source due to the required combination of proper host and proper temperature and moisture conditions necessary to promote Fusarium spp. infections. Although atrazine concentrations commonly exceeded 100 ng L-1 (42/75 measurements), only deoxynivalenol (6/56 measurements) had concentrations that occasionally exceeded this level. Temporal patterns in concentrations varied substantially between atrazine, formononetin, and deoxynivalenol, as one would expect for contaminants with different source inputs and processes of formation and degradation. The greatest phytoestrogen and mycotoxin concentrations were observed during spring snowmelt conditions. Phytoestrogens and mycotoxins were detected at all sampling sites regardless of basin size. The ecotoxicological effects from long-term, low-level exposures to phytoestrogens and mycotoxins or complex chemicals mixtures including these compounds that commonly take place in surface water are poorly understood and have yet to be systematically investigated in environmental studies.

Phytoestrogens and mycotoxins in Iowa streams: An examination of underinvestigated compounds in agricultural basins

USGS Publications Warehouse

Kolpin, D.W.; Hoerger, C.C.; Meyer, M.T.; Wettstein, F.E.; Hubbard, L.E.; Bucheli, T.D.

2010-01-01

This study provides the first broad-scale investigation on the spatial and temporal occurrence of phytoestrogens and mycotoxins in streams in the United States. Fifteen stream sites across Iowa were sampled five times throughout the 2008 growing season to capture a range of climatic and crop-growth conditions. Basin size upstream from sampling sites ranged from 7 km2 to >836,000 km2. Atrazine (herbicide) also was measured in all samples as a frame-ofreference agriculturally derived contaminant. Target compounds were frequently detected in stream samples: atrazine (100%), formononetin (80%), equol (45%), deoxynivalenol (43%), daidzein (32%), biochanin A (23%), zearalenone (13%), and genistein (11%). Th e nearly ubiquitous detection of formononetin (isoflavone) suggests a widespread agricultural source, as one would expect with the intense row crop and livestock production present across Iowa. Conversely, the less spatially widespread detections of deoxynivalenol (mycotoxin) suggest a more variable source due to the required combination of proper host and proper temperature and moisture conditions necessary to promote Fusarium spp. infections. Although atrazine concentrations commonly exceeded 100 ng L-1 (42/75 measurements), only deoxynivalenol (6/56 measurements) had concentrations that occasionally exceeded this level. Temporal patterns in concentrations varied substantially between atrazine, formononetin, and deoxynivalenol, as one would expect for contaminants with different source inputs and processes of formation and degradation. The greatest phytoestrogen and mycotoxin concentrations were observed during spring snowmelt conditions. Phytoestrogens and mycotoxins were detected at all sampling sites regardless of basin size. The ecotoxicological effects from long-term, low-level exposures to phytoestrogens and mycotoxins or complex chemicals mixtures including these compounds that commonly take place in surface water are poorly understood and have yet to be systematically investigated in environmental studies. Copyright ?? 2010 by the American Society of Agronomy.

Spatial and temporal distribution of Au and other trace elements in an estuary using the diffusive gradients in thin films technique and grab sampling

NASA Astrophysics Data System (ADS)

Lucas, Andrew R.; Salmon, S. Ursula; Rate, Andrew W.; Larsen, Sarah; Kilminster, Kieryn

2015-12-01

This study reports the first surface water evaluation of the temporal and spatial variability of Au in an estuary, using recently developed modifications to the diffusive gradients in thin films (DGT) and grab sampling techniques. At the two study sites in the Swan River estuary that were more marine in character, the DGT-measured concentrations of Au (26.3 and 31.3 ng/L) were within the range of total concentrations measured on individual days (13.2-30.6 ng/L and 11.2-37.2 ng/L, respectively). In contrast, at an upstream site, Au concentrations measured by DGT were significantly lower than totals (3.9 ng/L for DGT, compared with 13.2-28.8 ng/L for grab sampling), likely due to either size exclusion of colloids (>70 nm) by DGT or formation of a dissolved, non-DGT-labile Au species (<0.45 μm). DGT-measured concentrations of other metals (Cu, Co, Cr, U, V, Mo and As) were also lower than total concentrations, although in contrast to DGT-measured Au, this phenomenon occurred at all sites. Furthermore, daily grab samples for Au, taken over the 10-day deployment (which included a rain event), showed that Au concentrations could spike substantially (from 15.1 ng/L to 37.2 ng/L) over intervals as short as one day. The combination of simultaneous deployment of different DGT devices and grab sampling represents a new development in efforts to understand the transport and fate of Au together with other elements in dynamic environments such as estuaries.

The effect of sewage effluent on the physico-chemical and biological characteristics of the Sand River, Limpopo, South Africa

NASA Astrophysics Data System (ADS)

Seanego, K. G.; Moyo, N. A. G.

Population growth in urban areas is putting pressure on sewage treatment plants. The improper treatment of sewage entering the aquatic ecosystems causes deterioration of the water quality of the receiving water body. The effect of sewage effluent on the Sand River was assessed. Eight sampling sites were selected, site 1 and 2 were upstream of the sewage treatment plant along the urbanised area of Polokwane, whilst sites 3, 4, 5, 6, 7 and 8 were downstream. The physico-chemical parameters and coliform counts in the water samples were determined. The suitability of the water for irrigation was also determined. Hierarchical average linkage cluster analysis produced two clusters, grouping two sites above the sewage treatment works and six sites downstream of the sewage effluent discharge point. Principal component analysis (PCA) identified total nitrogen, total phosphorus, conductivity and salinity as the major factors contributing to the variability of the Sand River water quality. These factors are strongly associated with the downstream sites. Canonial correspondence analysis (CCA) indicated the macroinvertebrates, Chironomidae, Belastomatidae, Chaoborus and Hirudinea being strongly associated with nitrogen, phosphorus, conductivity and temperature. Escherichia coli levels in the Polokwane wastewater treatment works maturation ponds, could potentially lead to contamination of the Polokwane aquifer. The Sodium Adsorption Ratio was between 1.5 and 3.0 and residual sodium carbonate was below 1.24 Meq/l, indicating that the Sand River water is still suitable for irrigation. The total phosphorus concentrations fluctuated across the different site. Total nitrogen concentrations showed a gradual decrease downstream from the point of discharge. This shows that the river still has a good self-purification capacity.

The use of passive membrane samplers to assess organic contaminant inputs at five coastal sites in west Maui, Hawaii

USGS Publications Warehouse

Campbell, Pamela L.; Prouty, Nancy G.; Storlazzi, Curt; D'antonio, Nicole

2017-07-26

Five passive membrane samplers were deployed for 28 continuous days at select sites along and near the west Maui coastline to assess organic compounds and contaminant inputs to diverse, shallow coral reef ecosystems. Daily and weekly fluctuations in such inputs were captured on the membranes using integrative sampling. The distribution of organic compounds observed at these five coastal sites showed considerable variation; with high concentrations of terrestrially sourced organic compounds such as C29 sterols and high molecular weight n-alkanes at the strongly groundwater-influenced Kahekili vent site. In comparison, the coastal sites were presumably influenced more by seasonal surface and stream water runoff and therefore had marine-sourced organic compounds and fewer pharmaceuticals and personal care products. The direct correlation to upstream land-use practices was not obvious and may require additional wet-season sampling. Pharmaceuticals and personal care products as well as flame retardants were detected at all sites, and the Kahekili vent site had the highest number of detections. Planned future work must also determine the organic compound and contaminant concentrations adsorbed onto water column particulate matter, because it may also be an important vector for contaminant transport to coral reef ecosystems. The impact of contaminants per individual (such as fecundity and metabolism) as well as per community (such as species abundance and diversity) is necessary for an accurate assessment of environmental stress. Results presented herein provide current contaminant inputs to select nearshore environments along the west Maui coastline captured during the dry season, and they can be useful to aid potential future evaluations and (or) comparisons.

Periphyton Biofilms Influence Net Methylmercury Production in an Industrially Contaminated System.

PubMed

Olsen, Todd A; Brandt, Craig C; Brooks, Scott C

2016-10-18

Mercury (Hg) methylation and methylmercury (MMHg) demethylation activity of periphyton biofilms from the industrially contaminated East Fork Poplar Creek, Tennessee (EFPC) were measured during 2014-2016 using stable Hg isotopic rate assays. 201 Hg II and MM 202 Hg were added to intact periphyton samples in ambient streamwater and the formation of MM 201 Hg and loss of MM 202 Hg were monitored over time and used to calculate first-order rate potentials for methylation and demethylation. The influences of location, temperature/season, light exposure and biofilm structure on methylation and demethylation potentials were examined. Between-site differences in net methylation for samples collected from an upstream versus downstream location were driven by differences in the demethylation rate potential (k d ). In contrast, the within-site temperature-dependent difference in net methylation was driven by changes in the methylation rate potential (k m ). Samples incubated in the dark had lower net methylation due to lower k m values than those incubated in the light. Disrupting the biofilm structure decreased k m and resulted in lower net methylation. Overall, the measured rates resulted in a net excess of MMHg generated which could account for 3.71-7.88 mg d -1 MMHg flux in EFPC and suggests intact, actively photosynthesizing periphyton biofilms harbor zones of MMHg production.

Periphyton biofilms influence net methylmercury production in an industrially contaminated system

DOE PAGES

Olsen, Todd Andrew; Brandt, Craig C.; Brooks, Scott C.

2016-09-12

Mercury (Hg) methylation and methylmercury (MMHg) demethylation activity of periphyton biofilms from East Fork Poplar Creek, Tennessee, USA (EFPC) were measured during 2014-2015 using stable Hg isotopic rate assays. 201Hg II and MM 202Hg were added to intact periphyton samples and the formation of MM 201Hg and loss of MM 202Hg were monitored over time and used to calculate first-order rate constants for methylation and demethylation, respectively. The influence of location, temperature/season, light exposure and biofilm structure on methylation and demethylation were examined. Between-site differences in net methylation for samples collected from an upstream versus downstream location were driven bymore » differences in the demethylation rate constant (k d). In contrast, the within-site seasonal difference in net methylation was driven by changes in the methylation rate constant (k m). Samples incubated in the dark had lower net methylation due to km values that were 60% less than those incubated in the light. Disrupting the biofilm structure decreased km by 50% and resulted in net demethylating conditions. Overall, the measured rates resulted in a net excess of MMHg generated which could account for 27-85% of the MMHg flux in EFPC and suggests intact, actively photosynthesizing periphyton biofilms harbor zones of MMHg production.« less

Loosely bound oxytetracycline in riverine sediments from two tributaries of the Chesapeake Bay

USGS Publications Warehouse

Simon, N.S.

2005-01-01

The fate of antibiotics that bind to riverine sediment is not well understood. A solution used in geochemical extraction schemes to determine loosely bound species in sediments, 1 M MgCl2 (pH 8), was chosen to determine loosely bound, and potentially bioavailable, tetracycline antibiotics (TCs), including oxytetracycline (5-OH tetracycline) (OTC) in sediment samples from two rivers on the eastern shore of the Chesapeake Bay. Bottom sediments were collected at sites upstream from, at, and downstream from municipal sewage-treatment plants (STPs) situated on two natural waterways, Yellow Bank Stream, MD, and the Pocomoke River, MD. Concentrations of easily desorbed OTC ranged from 0.6 to approximately 1.2 ??g g-1 dry wt sediment in Yellow Bank Stream and from 0.7 to approximately 3.3 ??g g-1 dry wt sediment in the Pocomoke River. Concentrations of easily desorbable OTC were generally smaller in sediment upstream than in sediment downstream from the STP in the Pocomoke River. STPs and poultry manure are both potential sources of OTC to these streams. OTC that is loosely bound to sediment is subject to desorption. Other researchers have found desorbed TCs to be biologically active compounds.

Ecology of an estuarine mysid shrimp in the Columbia River (USA)

USGS Publications Warehouse

Haskell, C.A.; Stanford, J.A.

2006-01-01

The estuarine mysid, Neomysis mercedis, has colonized John Day and other run-of-the-river Reservoirs of the Columbia River, over 400 km from the estuary. In John Day Reservoir N. mercedis numbers peaked (2 m-3) in August in areas near the dam in association with lower water velocity and softer bottom than at the upstream sampling sites. Neomysis broods were primarily released in late spring and early fall. Gut content analysis showed that Neomysis feeds mostly on cladoceran zooplankton and rotifers in John Day Reservoir. Diel vertical migration was documented, with daytime distribution restricted to the bottom and preferentially to the soft-textured sediments in the deepest areas. Common pelagic fishes in the reservoir, especially juvenile American shad (Alosa sapidissima) and chinook salmon (Oncorhynchus tshawytscha), are daytime zooplankton feeders that cannot prey on Neomysis owing to mysid diel vertical migration. Thus, Neomysis has become an important food web component in John Day Reservoir. We also collected N. mercedis further upstream in Lower Granite Reservoir, where another estuarine crustacean, Corophium salmonis, also is reported, underscoring the need to better understand the role of these estuarine invertebrates in the trophic ecology of the Columbia River. Copyright ?? 2006 John Wiley & Sons, Ltd.

Water-quality and biological conditions in selected tributaries of the Lower Boise River, southwestern Idaho, water years 2009-12

USGS Publications Warehouse

Etheridge, Alexandra B.; MacCoy, Dorene E.; Weakland, Rhonda J.

2014-01-01

Water-quality conditions were studied in selected tributaries of the lower Boise River during water years 2009–12, including Fivemile and Tenmile Creeks in 2009, Indian Creek in 2010, and Mason Creek in 2011 and 2012. Biological samples, including periphyton biomass and chlorophyll-a, benthic macroinvertebrates, and fish were collected in Mason Creek in October 2011. Synoptic water-quality sampling events were timed to coincide with the beginning and middle of the irrigation season as well as the non-irrigation season, and showed that land uses and irrigation practices affect water quality in the selected tributaries. Large increases in nutrient and sediment concentrations and loads occurred over relatively short stream reaches and affected nutrient and sediment concentrations downstream of those reaches. Escherichia coli (E. coli) values increased in study reaches adjacent to pastured lands or wastewater treatment plants, but increased E. coli values at upstream locations did not necessarily affect E. coli values at downstream locations. A spatial loading analysis identified source areas for nutrients, sediment, and E. coli, and might be useful in selecting locations for water-quality improvement projects. Effluent from wastewater treatment plants increased nutrient loads in specific reaches in Fivemile and Indian Creeks. Increased suspended-sediment loads were associated with increased discharge from irrigation returns in each of the studied tributaries. Samples collected during or shortly after storms showed that surface runoff, particularly during the winter, may be an important source of nutrients in tributary watersheds with substantial agricultural land use. Concentrations of total phosphorus, suspended sediment, and E. coli exceeded regulatory water-quality targets or trigger levels at one or more monitoring sites in each tributary studied, and exceedences occurred during irrigation season more often than during non-irrigation season. As with water-quality sampling results, bottom-sediment samples analyzed for contaminants of emerging concern indicated that adjacent land uses can affect in-stream conditions. Contaminants of emerging concern were detected in four categories: urban compounds, industrial compounds, fecal steroids, and personal care products. Compounds in one or more of the four contaminant categories were detected at higher concentrations in upstream sites than in downstream sites in the tributaries and in the lower Boise River. High concentrations of compounds in upstream locations indicated that adjacent land use might be an important factor in contributing contaminants of emerging concern to the lower Boise River watershed. Expanded monitoring at Mason Creek near the mouth included a streamgage, a continuous water-quality monitor, and monthly water-quality sample collection. Data collected during expanded monitoring efforts at Mason Creek near the mouth provided information to develop and compare water-quality models. Regression models were developed using turbidity, discharge, and seasonality as surrogates to estimate concentrations of water-quality constituents. Daily streamflow also was used in a load model to estimate daily loads of water-quality constituents. Surrogate regression models may be useful for long-term monitoring and generally performed better than other models to estimate concentrations and loads of total phosphorus, total nitrogen, and suspended sediment in Mason Creek. Biological sampling results from Mason Creek showed low periphyton biomass and chlorophyll-a concentrations compared to those historically measured in the Boise River near Parma, Idaho, during October and November. The most abundant invertebrate found in Mason Creek was the highly tolerant and invasive New Zealand mudsnail (Potamopyrgus antipodarum). The presence of small rainbow trout (90 millimeters) may indicate salmonid spawning in Mason Creek. The rangeland-fish-index score of 58 for Mason Creek is comparable to rangeland-fish-index scores calculated for the Boise River near Middleton, indicating intermediate biotic condition.

Bromine incorporation factors for trihalomethane formation for the Mississippi, Missouri, and Ohio Rivers

USGS Publications Warehouse

Rathbun, R.E.

1996-01-01

The bromine incorporation factor describes the distribution of the four trihalomethane compounds in the mixture formed when a natural water is chlorinated. This factor was determined for the Mississippi, Missouri, and Ohio Rivers by chlorinating water samples at three levels each of pH and free chlorine concentration. Samples were collected during the summer, fall, and spring seasons of the year at 12 sites on the Mississippi River from Minneapolis, MN, to New Orleans, LA, and on the Missouri and Ohio Rivers 1.6 kilometers upstream from their confluences with the Mississippi. The bromine incorporation factor increased as the bromide concentration increased, and decreased as the pH, initial free-chlorine and dissolved organic-carbon concentrations increased. Variation of the bromine incorporation factor with distance along the Mississippi River approximately paralleled the variation of the bromide concentration with distance along the river, with the Missouri River samples having the highest bromine incorporation factors for all combinations of pH and free-chlorine concentration.

Streamflow, specific-conductance, and temperature data for Bayou and Little Bayou Creeks near Paducah, Kentucky, August 15 and 16, 1989

USGS Publications Warehouse

Evaldi, R.D.; McClain, D.L.

1989-01-01

Discharge, temperature, and specific conductance measurements were made August 15 and 16, 1989, at 74 main channel sites and seven flowing tributaries on Bayou and Little Bayou Creeks, Kentucky in the vicinity of the Paducah Gaseous Diffusion Plant. These measurements were made during base flow conditions to provide data for analysis of the interaction of surface and groundwater. The discharge of Bayou Creek was 0.30 cfs at the most upstream site, and 5.8 cfs at the most downstream site. Total measured tributary inflow of Bayou Creek was 5.7 cfs. Specific conductance values in the Bayou Creek watershed ranged from 208 to 489 microsiemens/cm, and water temperature ranged from 20.0 to 32.6 C. The discharge of Little Bayou Creek was 0.65 cfs at the most upstream site, and 1.8 cfs at the most downstream site. Total measured tributary inflow of Little Bayou Creek was 0.38 cfs. Specific conductance values in the Little Bayou Creek watershed ranged from 211 to 272 microsiemens/cm, and water temperature ranged from 14.5 to 24.9 C. (USGS)

Effects of wastewater effluent discharge and treatment facility upgrades on environmental and biological conditions of the upper Blue River, Johnson County, Kansas and Jackson County, Missouri, January 2003 through March 2009

USGS Publications Warehouse

Graham, Jennifer L.; Stone, Mandy L.; Rasmussen, Teresa J.; Poulton, Barry C.

2010-01-01

The Johnson County Blue River Main Wastewater Treatment Facility discharges into the upper Blue River near the border between Johnson County, Kansas and Jackson County, Missouri. During 2005 through 2007 the wastewater treatment facility underwent upgrades to increase capacity and include biological nutrient removal. The effects of wastewater effluent on environmental and biological conditions of the upper Blue River were assessed by comparing an upstream site to two sites located downstream from the wastewater treatment facility. Environmental conditions were evaluated using previously and newly collected discrete and continuous data, and were compared with an assessment of biological community composition and ecosystem function along the upstream-downstream gradient. This evaluation is useful for understanding the potential effects of wastewater effluent on water quality, biological community structure, and ecosystem function. In addition, this information can be used to help achieve National Pollution Discharge Elimination System (NPDES) wastewater effluent permit requirements after additional studies are conducted. The effects of wastewater effluent on the water-quality conditions of the upper Blue River were most evident during below-normal and normal streamflows (about 75 percent of the time), when wastewater effluent contributed more than 20 percent to total streamflow. The largest difference in water-quality conditions between the upstream and downstream sites was in nutrient concentrations. Total and inorganic nutrient concentrations at the downstream sites during below-normal and normal streamflows were 4 to 15 times larger than at the upstream site, even after upgrades to the wastewater treatment facility were completed. However, total nitrogen concentrations decreased in wastewater effluent and at the downstream site following wastewater treatment facility upgrades. Similar decreases in total phosphorus were not observed, likely because the biological phosphorus removal process was not optimized until after the study was completed. Total nitrogen and phosphorus from the wastewater treatment facility contributed a relatively small percentage (14 to 15 percent) to the annual nutrient load in the upper Blue River, but contributed substantially (as much as 75 percent) to monthly loads during seasonal low-flows in winter and summer. During 2007 and 2008, annual discharge from the wastewater treatment facility was about one-half maximum capacity, and estimated potential maximum annual loads were 1.6 to 2.4 times greater than annual loads before capacity upgrades. Even when target nutrient concentrations are met, annual nutrient loads will increase when the wastewater treatment facility is operated at full capacity. Regardless of changes in annual nutrient loads, the reduction of nutrient concentrations in the Blue River Main wastewater effluent will help prevent further degradation of the upper Blue River. The Blue River Main Wastewater Treatment Facility wastewater effluent caused changes in concentrations of several water-quality constituents that may affect biological community structure and function including larger concentrations of bioavailable nutrients (nitrate and orthophosphorus) and smaller turbidities. Streambed-sediment conditions were similar along the upstream-downstream gradient and measured constituents did not exceed probable effect concentrations. Habitat conditions declined along the upstream-downstream gradient, largely because of decreased canopy cover and riparian buffer width and increased riffle-substrate fouling. Algal biomass, primary production, and the abundance of nutrient-tolerant diatoms substantially increased downstream from the wastewater treatment facility. Likewise, the abundance of intolerant macroinvertebrate taxa and Kansas Department of Health and Environment aquatic-life-support scores, derived from macroinvertebrate data, significantly decreased downstream from the wastewater

Assessing inundation hazards to nuclear powerplant sites using geologically extended histories of riverine floods, tsunamis, and storm surges

USGS Publications Warehouse

O'Connor, Jim; Atwater, Brian F.; Cohn, Timothy A.; Cronin, Thomas M.; Keith, Mackenzie K.; Smith, Christopher G.; Mason, Jr., Robert R.

2014-01-01

A screening of the 104 nuclear powerplants in the United States licensed by the Nuclear Regulatory Commission (at 64 sites) indicates several sites for which paleoflood studies likely would provide additional flood-frequency information. Two sites—Duane Arnold, Iowa, on the Cedar River; and David-Besse, Ohio, on the Toussaint River—have geologic conditions suitable for creating and preserving stratigraphic records of flooding and few upstream dams that may complicate flood-frequency analysis. One site—Crystal River, Florida1, on the Withlacoochee River and only 4 kilometers from the coast—has high potential as a candidate for assessing riverine and marine inundation hazards. Several sites on the Mississippi River have high geologic potential, but upstream dams almost certainly now regulate peak flows. Nevertheless, studies on the Mississippi River to evaluate long-term flood frequency may provide results applicable to a wide spectrum of regional hazard issues. Several sites in the southeastern United States have high geologic potential, and studies at these sites also may be helpful in evaluating hazards from outburst floods from landslide dams (river blockages formed by mass movements), which may be a regional hazard. For all these sites, closer investigation and field reconnaissance would be needed to confirm suitable deposits and settings for a complete paleoflood analysis. Similar screenings may help identify high-potential sites for geologic investigations of tsunami and storm-surge hazards.

Y-12 National Security Complex Biological Monitoring and Abatement Program 2007 Calendar Yeare Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peterson, M.J.; Greeley, M. S. Jr.; Morris, G. W.

2008-07-01

The National Pollutant Discharge Elimination System (NPDES) permit issued for the Oak Ridge Y-12 National Security Complex (Y-12 Complex) which became effective May 1, 2006, continued a requirement for a Biological Monitoring and Abatement Program (BMAP). The BMAP was originally developed in 1985 to demonstrate that the effluent limitations established for the Y-12 Complex protected the classified uses of the receiving stream (East Fork Poplar Creek: EFPC), in particular, the growth and propagation of aquatic life (Loar et al. 1989). The objectives of the current BMAP are similar, specifically to assess stream ecological conditions relative to regulatory limits and criteria,more » to assess ecological impacts as well as recovery in response to Y-12 operations, and to investigate the causes of continuing impacts. The BMAP consists of three tasks that reflect complementary approaches to evaluating the effects of the Y-12 Complex discharges on the biotic integrity of EFPC. These tasks include: (1) bioaccumulation monitoring, (2) benthic macroinvertebrate community monitoring, and (3) fish community monitoring. As required by the NPDES permit, the BMAP benthic macroinvertebrate community monitoring task includes studies to annually evaluate the receiving stream's biological integrity in comparison to TN Water Quality Criteria. BMAP monitoring is currently being conducted at five primary EFPC sites, although sites may be excluded or added depending upon the specific objectives of the various tasks. Criteria used in selecting the sites include: (1) location of sampling sites used in other studies, (2) known or suspected sources of downstream impacts, (3) proximity to U.S. Department of Energy (DOE) Oak Ridge Reservation (ORR) boundaries, (4) appropriate habitat distribution, and (5) access. The primary sampling sites include upper EFPC at kilometers (EFKs) 24.4 and 23.4 [upstream and downstream of Lake Reality (LR) respectively]; EFK 18.7 (also EFK 18.2 and 19), located off the ORR and below an area of intensive commercial and light industrial development; EFK 13.8, located upstream from the Oak Ridge Wastewater Treatment Facility (ORWTF); and EFK 6.3 located approximately 1.4 km below the ORR boundary (Fig. 1.1). Actual sampling locations on EFPC may differ slightly by task according to specific requirements of the task. Brushy Fork (BF) at kilometer (BFK) 7.6 and Hinds Creek at kilometer (HCK) 20.6 are the most commonly used reference sites for the Y-12 BMAP. Additional sites off the ORR are also occasionally used for reference, including Beaver Creek, Bull Run, Cox Creek, and Paint Rock Creek (Fig. 1.2). Summaries of the sampling designs for the three primary tasks of the Y-12 Complex BMAP for EFPC are presented in Tables 1.1-1.3. This report covers the 2007 study period, although data collected outside this time period are included as appropriate. To address the biological monitoring requirements for Bear Creek and McCoy Branch, CERCLA-funded data is summarized in Appendix A (for Bear Creek) and Appendix B (for McCoy Branch). Data for these two watersheds is provided herein to address Section IX of the NPDES Permit for Y-12, where 'Results of these CERCLA programs can be used to meet the biological monitoring requirements of this permit'. For potential comparison with instream biological measures, a summary of the toxicity testing results for Y-12 outfalls into upper EFPC is provided in Appendix C (these results have been previously reported).« less

Prevalence of pansteatitis in African sharptooth catfish, Clarias gariepinus (Burchell), in the Kruger National Park, South Africa.

PubMed

Huchzermeyer, K David A

2012-11-09

Pansteatitis was confirmed in sharptooth catfish, Clarias gariepinus (Burchell), from three main locations within the Kruger National Park (KNP); the Olifants River Gorge, Engelhard Dam on the Letaba River and from the Sabie River in the Sabiepoort. An increasing prevalence of pansteatitis was observed in catfish during repeated samplings from the Olifants Gorge from 2009 to 2011 and co-existence of old and recent lesions indicated on-going incitement of pansteatitis. Only a low prevalence of pansteatitis was observed in catfish sampled from the Olifants River upstream of the Gorge in the KNP and no pansteatitis was observed in catfish sampled from a rain-filled dam not connected to the Olifants River. Common to both the Olifants Gorge and the Sabiepoort is the damming of the rivers in Mozambique to form lakes Massingir and Corumana respectively. Anthropogenic activities resulting in potential pollution of the rivers differ greatly between these two catchments, providing argument against a primary pollution-related aetiology of the pansteatitis found at these two sites. Compared with other sites, analysis of stomach contents of catfish from the Olifants Gorge and the Sabiepoort strongly suggested that consumption of a predominantly fish diet was associated with the development of pansteatitis in these fish. In a farmed population of catfish used as positive control, development of pansteatitis could be ascribed to consumption of rancid fish waste from a trout slaughterhouse. In the Olifants Gorge, alien invasive silver carp, Hypophthalmychthys molitrix (Valenciennes), seasonally migrate upstream out of Lake Massingir to spawn. This schooling species is an obligate phytoplankton feeder with consequent high levels of adipose tissue n-3 polyunsaturated fatty acids. In the Olifants Gorge, at least, this may explain seasonal exposure to levels of polyunsaturated fats in the diets of catfish and crocodiles to which these animals are not adapted. The possible roles of diet, membrane lipid composition and metabolic rate of fish, sediment pollution and seasonal drop in environmental temperature in the pathogenesis of pansteatitis in the catfish are discussed. Further studies are needed to verify some of these speculations.

Water-quality assessment of the Rio Grande Valley, Colorado, New Mexico, and Texas; occurrence and distribution of selected pesticides and nutrients at selected surface-water sites in the Mesilla Valley, 1994-95

USGS Publications Warehouse

Healy, D.F.

1996-01-01

The Rio Grande Valley study unit of the U.S. Geological Survey National Water-Quality Assessment Program conducted a two-phase synoptic study of the occurrence and distribution of pesticides and nutrients in the surface water of the Mesilla Valley, New Mexico and Texas. Phase one, conducted in April-May 1994 during the high-flow irrigation season, consisted of a 6-week time- series sampling event during which 17 water-column samples were collected at 3 main-stem sites on the Rio Grande and a synoptic irrigation-run sampling event during which 19 water-column samples were collected at 7 main-stem sites, 10 drain sites, and 2 sites at the discharges of wastewater-treatment plants. Three samples are included in both the time-series and irrigation-run events. Phase two, conducted in January 1995 during the low-flow non-irrigation season, consisted of a non-irrigation synoptic sampling event during which 18 water-column samples were collected at seven main-stem sites, nine drain sites, and two sites at the discharges of wastewater-treatment plants and a bed- material sampling event during which 6 bed-material samples were collected at six sites near the mouths of drains that discharge to the Rio Grande. The 51 water-column samples were analyzed for 78 pesticides and metabolites and 8 nutrients along with other constituents. The six bed-material samples were analyzed for 21 pesticides and metabolites, gross polychlorinated biphenyls, and gross polychlorinated naphthalenes. The presence of dissolved pesticides in the surface water of the Mesilla Valley is erratic. A total of 100 detections of 17 different pesticides were detected in 44 of the water-column samples. As many as 38 percent of these detections may be attributed to pesticide use upstream from the valley or to nonagricultural pesticide use within the valley. There were 29 detections of 10 different pesticides in 17 samples during the irrigation run and 41 detections of 13 pesticides in 16 samples during the non-irrigation run. Nine pesticides were detected during both phases of the study. The most commonly detected pesticides in the water-column samples were DCPA, which was detected in 29 samples, and metolachlor, which was detected in 17 of the samples. DCPA was detected throughout the Mesilla Valley, whereas metolachlor was detected mainly in the northern and central parts of the valley. The maximum pesticide concentration found during the study was 0.75 microgram per liter of carbofuran, which was detected at the East Side Drain site during the irrigation run. No water-column pesticide concentration exceeded U.S. Environmental Protection Agency's drinking-water standards or any applicable Federal or State criteria or guidelines. A total of 21 occurrences of six pesticides and metabolites were found in the bed-material samples. Chlordane, diazinon, and methyl parathion were detected once each, whereas DDD, DDE, and DDT were detected at all six bed-material sites. Water-column samples for the analysis of nutrient concentrations were collected at all sampling sites during both phases of the study. The concentrations of each nutrient ranged from at or below the individual minimum reporting level to as much as two or three orders of magnitude larger than the minimum reporting level. The concentration of each nutrient was left skewed with most of the values toward the lower end of the range. The larger concentrations of each nutrient, except dissolved nitrite plus nitrate, were associated with wastewater-treatment- plant sites 4 and 16. The larger concentrations of dissolved nitrite plus nitrate were generally associated with the non- irrigation run; however, the largest concentration was at site 4 during the irrigation run. During this study, the Mesilla Valley as a unit was a source of nutrients to the Rio Grande. Wi

Computational Fluid Dynamics Simulations of Hemodynamics in Plaque Erosion

PubMed Central

Campbell, Ian C.; Timmins, Lucas H.; Giddens, Don P.; Virmani, Renu; Veneziani, Alessandro; Rab, S. Tanveer; Samady, Habib; McDaniel, Michael C.; Finn, Aloke V.; Taylor, W. Robert; Oshinski, John N.

2013-01-01

Purpose We investigated whether local hemodynamics were associated with sites of plaque erosion and hypothesized that patients with plaque erosion have locally elevated WSS magnitude in regions where erosion has occurred. Methods We generated 3D, patient-specific models of coronary arteries from biplane angiographic images in 3 human patients with plaque erosion diagnosed by optical coherence tomography (OCT). Using computational fluid dynamics, we simulated pulsatile blood flow and calculated both wall shear stress (WSS) and oscillatory shear index (OSI). We also investigated anatomic features of plaque erosion sites by examining branching and local curvature in x-ray angiograms of barium-perfused autopsy hearts. Results Neither high nor low magnitudes of mean WSS were associated with sites of plaque erosion. OSI and local curvature were also not associated with erosion. Anatomically, 8 of 13 hearts had a nearby bifurcation upstream of the site of plaque erosion. Conclusions This study provides preliminary evidence that neither hemodynamics nor anatomy are predictors of plaque erosion, based upon a very unique dataset. Our sample sizes are small, but this dataset suggests that high magnitudes of wall shear stress, one potential mechanism for inducing plaque erosion, are not necessary for erosion to occur. PMID:24223678

The influence of sawmill wood wastes on the distribution and population of macroinvertebrates at Benin River, Niger Delta area, Nigeria.

PubMed

Arimoro, Francis O; Osakwe, Emeka I

2006-05-01

The impact of sawmill wood wastes on the distribution of benthic macroinvertebrates at the Sapele section of Benin River, Niger Delta, Nigeria, was investigated from March 2005 to August 2005. A total of 434 individuals were collected by kick-sampling method, representing 21 taxa of benthic macroinvertebrates. Three stations, 1, 2, and 3, were selected from upstream of the site, receiving wood wastes discharge, the impacted site and its down stream, respectively. Among the water quality variables, conductivity, dissolved oxygen, biochemical oxigen demand (BOD(5)), nitrate-nitrogen, phosphate-phosphorus, transparency, and alkalinity were significantly different (P<0.05) among the stations. Orthogonal comparison by Duncan's multiple range test showed that station 2 (the impacted site) was the cause of the difference. More sensitive species such as Ephemeroptera or Plecoptera were completely absent from station 2, the impacted site. Species abundance was similar in station 1 and 3, indicating that the wood wastes must have adversely affected the distribution of these macroinvertebrates, especially the intolerant species. The wood waste discharge not only altered the water chemistry, but also stimulated the abundance of less-sensitive macroinvertebrate species.

Toxic substances in surface waters and sediments--A study to assess the effects of arsenic-contaminated alluvial sediment in Whitewood Creek, South Dakota

USGS Publications Warehouse

Kuwabara, James S.; Fuller, Christopher C.

2003-01-01

Field measurements and bioassay experiments were done to investigate the effects of arsenic and phosphorus interactions on sorption of these solutes by the benthic flora (periphyton and submerged macrophytes) in Whitewood Creek, a stream in western South Dakota. Short-term (24-hour) sorption experiments were used to determine arsenic transport characteristics for algae (first-order rate constants for solute sorption, biomass, and accumulation factors) collected in the creek along a transect beginning upstream from a mine discharge point and downgradient through a 57-kilometer reach. Temporal changes in biomass differed significantly between and within sampling sites. Arsenic concentrations in plant tissue increased with distance downstream, but temporal changes in concentrations in tissues differed considerably from site to site. Cultures of Achnanthes minutissima (Bacillariophyceae) and Stichococcus sp. (Chlorophyceae) were isolated from four sites along a longitudinal concentration gradient of dissolved arsenic within the study reach and were maintained at ambient solute concentrations. Arsenic accumulation factors and sorption-rate constants for these isolates were determined as a function of dissolved arsenate and orthophosphate. Cell surfaces of algal isolates exhibited preferential orthophosphate sorption over arsenate. Initial sorption of both arsenate and orthophosphate followed first-order mass transfer for each culturing condition. Although sorption-rate constants increased slightly with increased dissolved-arsenate concentration, algae, isolated from a site with elevated dissolved arsenic in the stream channel, had a significantly slower rate of arsenic sorption compared with the same species isolated from an uncontaminated site upstream. In diel studies, amplitudes of the pH cycles increased with measured biomass except at a site immediately downstream from water-treatment-plant discharge. Inorganic pentavalent arsenic dominated arsenic speciation at all sites?not a surprising result for the well-oxygenated water column along this reach. Concentration fluctuations in dissolved-arsenic species lagged pH fluctuations by approximately 3 hours at the most downstream site, but no discernible lag was observed at an artificially pooled area with an order of magnitude higher biomass. Furthermore, the amplitudes of diel fluctuations in arsenic species were greater at the pooled area than at the most downstream site. Lack of correspondence between changes in dissolved-orthophosphate concentrations and arsenic species may have resulted from preferential sorption of orthophosphate over arsenate by the biomass. Based on carbon-fixation estimates, the phosphorus demand from photosynthetic activity required water-column concentrations to be supplemented by another source such as phosphate regeneration within the benthic community or desorption of particle-bound phosphate.

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

PubMed

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

A data-mining framework for exploring the multi-relation between fish species and water quality through self-organizing map.

PubMed

Tsai, Wen-Ping; Huang, Shih-Pin; Cheng, Su-Ting; Shao, Kwang-Tsao; Chang, Fi-John

2017-02-01

The steep slopes of rivers can easily lead to large variations in river water quality during typhoon seasons in Taiwan, which may poses significant impacts on riverine eco-hydrological environments. This study aims to investigate the relationship between fish communities and water quality by using artificial neural networks (ANNs) for comprehending the upstream eco-hydrological system in northern Taiwan. We collected a total of 276 heterogeneous datasets with 8 water quality parameters and 25 fish species from 10 sampling sites. The self-organizing feature map (SOM) was used to cluster, analyze and visualize the heterogeneous datasets. Furthermore, the structuring index (SI) was adopted to determine the relative importance of each input variable of the SOM and identify the indicator factors. The clustering results showed that the SOM could suitably reflect the spatial characteristics of fishery sampling sites. Besides, the patterns of water quality parameters and fish species could be distinguishably (visually) classified into three eco-water quality groups: 1) typical upstream freshwater fishes that depended the most on dissolved oxygen (DO); 2) typical middle-lower reach riverine freshwater fishes that depended the most on total phosphorus (TP) and ammonia nitrogen; and 3) low lands or pond (reservoirs) freshwater fishes that depended the most on water temperature, suspended solids and chemical oxygen demand. According to the results of the SI, the representative indicators of water quality parameters and fish species consisted of DO, TP and Onychostoma barbatulum. This grouping result suggested that the methodology can be used as a guiding reference to comprehensively relate ecology to water quality. Our methods offer a cost-effective alternative to more traditional methods for identifying key water quality factors relating to fish species. In addition, visualizing the constructed topological maps of the SOM could produce detailed inter-relation between water quality and the fish species of stream habitat units. Copyright © 2016 Elsevier B.V. All rights reserved.

Estimated sediment thickness, quality, and toxicity to benthic organisms in selected impoundments in Massachusetts

USGS Publications Warehouse

Breault, Robert F.; Sorenson, Jason R.; Weiskel, Peter K.

2013-01-01

The U.S. Geological Survey and the Massachusetts Department of Fish and Game, Division of Ecological Restoration, collaborated to collect baseline information on the quantity and quality of sediment impounded behind selected dams in Massachusetts, including sediment thickness and the occurrence of contaminants potentially toxic to benthic organisms. The thicknesses of impounded sediments were measured, and cores of sediment were collected from 32 impoundments in 2004 and 2005. Cores were chemically analyzed, and concentrations of 32 inorganic elements and 108 organic compounds were quantified. Sediment thicknesses varied considerably among the 32 impoundments, with an average thickness of 3.7 feet. Estimated volumes also varied greatly, ranging from 100,000 cubic feet to 81 million cubic feet. Concentrations of toxic contaminants as well as the number of contaminants detected above analytical quantification levels (also known as laboratory reporting levels) varied greatly among sampling locations. Based on measured contaminant concentrations and comparison to published screening thresholds, bottom sediments were predicted to be toxic to bottom-dwelling (benthic) organisms in slightly under 30 percent of the impoundments sampled. Statistically significant relations were found between several of the contaminants and individual indicators of urban land use and industrial activity in the upstream drainage areas of the impoundments. However, models developed to estimate contaminant concentrations at unsampled sites from upstream landscape characteristics had low predictive power, consistent with the long and complex land-use history that is typical of many drainage areas in Massachusetts.

Streamflow losses along the Balcones Fault Zone, Nueces River basin, Texas

USGS Publications Warehouse

Land, L.F.; Boning, C.W.; Harmsen, Lynn; Reeves, R.D.

1983-01-01

Statistical evaluations of historical daily flow records for the streams that have gaging stations upstream and downstream from the recharge zone provided mathematical relationships that expressed downstream flow in terms of other significant parameters. For each stream, flow entering the recharge zone is most significant in defining downstream flow; for some streams, antecedent flows at the upstream site and ground-water levels are also significantly related to downstream flow. The analyses also determined the discharges required upstream from the recharge zone to sustain flow downstream from that zone. These discharges ranged from 355 cubic feet per second for the combined Frio and Dry Frio Rivers to 33 cubic feet per second for the Nueces River. The entire flows of lesser magnitude are generally lost to recharge to the aquifer.

40 CFR 1065.376 - Chiller NO2 penetration.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 33 2014-07-01 2014-07-01 false Chiller NO2 penetration. 1065.376... Chiller NO2 penetration. (a) Scope and frequency. If you use a chiller to dry a sample upstream of a NOX measurement instrument, but you don't use an NO2-to-NO converter upstream of the chiller, you must perform...

Seasonal and spatial variability of nutrients and pesticides in streams of the Willamette Basin, Oregon, 1993-95

USGS Publications Warehouse

Rinella, F.A.; Janet, M.L.

1998-01-01

From April 1993 to September 1995, the U.S. Geological Survey conducted a study of the occurrence and distribution of nutrients and pesticides in surface water of the Willamette and Sandy River Basins, Oregon, as part of the U.S. Geological Survey National Water-Quality Assessment (NAWQA) Program. About 260 samples were collected at 51 sites during the study; of these, more than 60 percent of the pesticide samples and more than 70 percent of the nutrient samples were collected at 7 sites in a fixed-station network (primary sites) to characterize seasonal water-quality variability related to a variety of land-use activities. Samples collected at the remain ing 44 sites were used primarily to characterize spatial water- quality variability in agricultural river subbasins located throughout the study area.This report describes concentrations of 4 nutrient species (total nitrogen, filtered nitrite plus nitrate, total phosphorus, and soluble reactive phosphorus) and 86 pesticides and pesticide degradation products in streams, during high- and low-flow conditions, receiving runoff from urban, agricultural, forested, and mixed-use lands. Although most nutrient and pesticide concentrations were relatively low, some concentrations exceeded maximum contaminant levels for drinking water and water-quality criteria for chronic toxicity established for the protection of freshwater aquatic life. The largest number of exceedances generally occurred at sites receiving predominantly agricultural inputs. Total nitrogen, filtered nitrite plus nitrate, total phosphorus, and soluble reactive phosphorus concentrations were detected in 89 to 98 percent of the samples; atrazine, simazine, metolachlor, and desethylatrazine were detected in 72 to 94 percent of the samples. Fifty different pesticides and degradation products was detected during the 2-1/2 year study.Seasonally, peak nutrient and pesticide concentrations at the seven primary sites were observed during winter and spring rains. With the exception of soluble reactive phosphorus, peak nutrient concentrations were recorded at agricultural sites during winter rains, whereas peak pesticide concentrations occurred at agricultural sites during spring rains.Spatially, although nutrients were detected slightly more often in samples from the northern Willamette Basin relative to the southern Willamette Basin, concentration distributions in the two areas were similar. About 75 percent more pesticides were detected in the northern basin; however, two-thirds of the pesticide detections in the southern basin were larger in concentration than for the same pesticides detected in the northern basin.Nutrient and pesticide concentrations were associated with percent of upstream drainage area in forest, urbanization, and agriculture. Nutrient concentrations at forested sites were among the smallest observed at any of the sites sampled. In addition, only one pesticide and one pesticide degradation product were detected at forested sites, at concentrations near the method detection limits. The highest nutrient concentrations were observed at agricultural sites. Further, the largest numbers of different pesticides detected were at agricultural sites, at concentrations generally larger than at most other land-use sites. Three pesticides--dichlobenil, prometon, and tebuthiuron--were detected more frequently at a site receiving predominantly urban inputs.

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

Assessment of De Facto Wastewater Reuse across the US: trends between 1980 and 2008.

PubMed

Rice, Jacelyn; Wutich, Amber; Westerhoff, Paul

2013-10-01

De facto wastewater reuse is the incidental presence of treated wastewater in a water supply source. In 1980 the EPA identified drinking water treatment plants (DWTPs) impacted by upstream wastewater treatment plant (WWTP) discharges and found the top 25 most impacted DWTPs contained between 2% and 16% wastewater discharges from upstream locations (i.e., de facto reuse) under average streamflow conditions. This study is the first to provide an update to the 1980 EPA analysis. An ArcGIS model of DWTPs and WWTPs across the U.S. was created to quantify de facto reuse for the top 25 cities in the 1980 EPA study. From 1980 to 2008, de facto reuse increased for 17 of the 25 DWTPs, as municipal flows upstream of the sites increased by 68%. Under low streamflow conditions, de facto reuse in DWTP supplies ranged from 7% to 100%, illustrating the importance of wastewater in sustainable water supplies. Case studies were performed on four cities to analyze the reasons for changes in de facto reuse over time. Three of the four sites have greater than 20% treated wastewater effluent within their drinking water source for streamflow less than the 25th percentile historic flow.

High metal reactivity and environmental risks at a site contaminated by glass waste.

PubMed

Augustsson, A; Åström, M; Bergbäck, B; Elert, M; Höglund, L O; Kleja, D B

2016-07-01

This study addresses the reactivity and risks of metals (Ba, Cd, Co, Cr, Cu, Ni, Pb, Zn, As and Sb) at a Swedish site with large glass waste deposits. Old glassworks sites typically have high total metal concentrations, but as the metals are mainly bound within the glass waste and considered relatively inert, environmental investigations at these kinds of sites are limited. In this study, soil and landfill samples were subjected to a sequential chemical extraction procedure. Data from batch leaching tests and groundwater upstream and downstream of the waste deposits were also interpreted. The sequential extraction revealed that metals in <2 mm soil/waste samples were largely associated with geochemically active fractions, indicating that metals are released from pristine glass and subsequently largely retained in the surrounding soil and/or on secondary mineral coatings on fine glass particles. From the approximately 12,000 m(3) of coarse glass waste at the site, almost 4000 kg of Pb is estimated to have been lost through corrosion, which, however, corresponds to only a small portion of the total amount of Pb in the waste. Metal sorption within the waste deposits or in underlying soil layers is supported by fairly low metal concentrations in groundwater. However, elevated concentrations in downstream groundwater and in leachates of batch leaching tests were observed for several metals, indicating on-going leaching. Taken together, the high metal concentrations in geochemically active forms and the high amounts of as yet uncorroded metal-rich glass, indicate considerable risks to human health and the environment. Copyright © 2016. Published by Elsevier Ltd.

Human pharmaceuticals in Portuguese rivers: The impact of water scarcity in the environmental risk.

PubMed

Pereira, André M P T; Silva, Liliana J G; Laranjeiro, Célia S M; Meisel, Leonor M; Lino, Celeste M; Pena, Angelina

2017-12-31

Pharmaceuticals occurrence and environmental risk assessment were assessed in Portuguese surface waters, evaluating the impact of wastewater treatment plants (WWTPs) and river flow rates. Twenty three pharmaceuticals from 6 therapeutic groups, including metabolites and 1 transformation product, were analysed in 72 samples collected from 20 different sites, upstream and downstream the selected WWTPs, in two different seasons. Analysis was performed by solid phase extraction followed by liquid chromatography coupled to tandem mass spectroscopy. Pharmaceuticals were detected in 27.8% of the samples. Selective serotonin reuptake inhibitors (SSRIs), anti-inflammatories and antibiotics presented the highest detection frequencies (27.8, 23.6 and 23.6%, respectively) and average concentrations (37.9, 36.1 and 33.5ngL -1 , respectively). When assessing the impact of WWTPs, an increase of 21.4% in the average concentrations was observed in the samples located downstream these facilities, when compared with the upstream samples. Increased detection frequencies and concentrations were observed at lower flow rates, both when comparing summer and winter campaigns and by evaluating the different rivers. Risk quotients (RQs) higher than one were found for two pharmaceuticals, concerning two trophic levels. However, since Iberian rivers are highly influenced by water scarcity, in drought periods, the flow rates in these rivers can decrease at least ten times from the lowest value observed in the sampling campaigns. In these conditions, RQs higher than 1 would be observed for 5 pharmaceuticals, additionally, all the detected pharmaceuticals (11) would present RQs higher than 0.1. These results emphasize that the river flow rate represents an important parameter influencing pharmaceuticals concentrations, highlighting the ecotoxicological pressure, especially due to water scarcity in drought periods. This should be a priority issue in the environmental policies for minimizing its impact in the aquatic environment. Copyright © 2017 Elsevier B.V. All rights reserved.

Remedial Investigation of Hanford Site Releases to the Columbia River - 13603

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, J.A.; Hulstrom, L.C.; Sands, J.P.

2013-07-01

In south-central Washington State, the Columbia River flows through the U.S. Department of Energy Hanford Site. A primary objective of the Hanford Site cleanup mission is protection of the Columbia River, through remediation of contaminated soil and groundwater that resulted from its weapons production mission. Within the Columbia River system, surface water, sediment, and biota samples related to potential Hanford Site hazardous substance releases have been collected since the start of Hanford operations. The impacts from release of Hanford Site radioactive substances to the Columbia River in areas upstream, within, and downstream of the Hanford Site boundary have been previouslymore » investigated as mandated by the U.S. Department of Energy requirements under the Atomic Energy Act. The Remedial Investigation Work Plan for Hanford Site Releases to the Columbia River [1] was issued in 2008 to initiate assessment of the impacts under the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 [2]. The work plan established a phased approach to characterize contaminants, assess current risks, and determine whether or not there is a need for any cleanup actions. Field investigation activities over a 120-mile stretch of the Columbia River began in October 2008 and were completed in 2010. Sampled media included surface water, pore water, surface and core sediment, island soil, and fish (carp, walleye, whitefish, sucker, small-mouth bass, and sturgeon). Information and sample results from the field investigation were used to characterize current conditions within the Columbia River and assess whether current conditions posed a risk to ecological or human receptors that would merit additional study or response actions under CERCLA. The human health and ecological risk assessments are documented in reports that were published in 2012 [3, 4]. Conclusions from the risk assessment reports are being summarized and integrated with remedial investigation/feasibility study (RI/FS) reports developed for upland areas, riparian areas, and groundwater in the Hanford Site River Corridor. The RI/FS reports will evaluate the impacts to soil, groundwater, and river sediments and lead to proposed cleanup actions and records of decision to address releases from the Hanford Site reactor operations. (authors)« less

Runoff of genotoxic compounds in river basin sediment under the influence of contaminated soils.

PubMed

da Costa, Thatiana Cappi; de Brito, Kelly Cristina Tagliari; Rocha, Jocelita Aparecida Vaz; Leal, Karen Alam; Rodrigues, Maria Lucia Kolowski; Minella, Jean Paolo Gomes; Matsumoto, Silvia Tamie; Vargas, Vera Maria Ferrão

2012-01-01

Contaminated sites must be analyzed as a source of hazardous compounds in the ecosystem. Contaminant mobility in the environment may affect sources of surface and groundwater, elevating potential risks. This study looked at the genotoxic potential of samples from a contaminated site on the banks of the Taquari River, RS, Brazil, where potential environmental problems had been identified (pentachlorophenol, creosote and hydrosalt CCA). Samplers were installed at the site to investigate the drainage material (water and particulate soil matter) collected after significant rainfall events. Organic extracts of this drained material, sediment river samples of the Taquari River (interstitial water and sediment organic extracts) were evaluated by the Salmonella/microsome assay to detect mutagenicity and by Allium cepa bioassays (interstitial water and whole sediment samples) to detect chromosomal alterations. Positive mutagenicity results in the Salmonella/microsome assay of the material exported from the area indicate that contaminant mixtures may have drained into the Taquari River. This was confirmed by the similarity of mutagenic responses (frameshift indirect mutagens) of organic extracts from soil and river sediment exported from the main area under the influence of the contaminated site. The Allium cepa test showed significant results of cytotoxicity, mutagenic index and chromosome aberration in the area under the same influence. However, it also showed the same similarity in positive results at an upstream site, which probably meant different contaminants. Chemical compounds such as PAHs, PCF and chromium, copper and arsenic were present in the runoff of pollutants characteristically found in the area. The strategy employed using the Salmonella/microsome assay to evaluate effects of complex contaminant mixtures, together with information about the main groups of compounds present, allowed the detection of pollutant dispersion routes from the contaminated site to the Taquari River sediment. Copyright © 2011 Elsevier Inc. All rights reserved.

Occurrence and Distribution of Organic Wastewater Compounds in Rock Creek Park, Washington, D.C., 2007-08

USGS Publications Warehouse

Phelan, Daniel J.; Miller, Cherie V.

2010-01-01

The U.S. Geological Survey, and the National Park Service Police Aviation Group, conducted a high-resolution, low-altitude aerial thermal infrared survey of the Washington, D.C. section of Rock Creek Basin within the Park boundaries to identify specific locations where warm water was discharging from seeps or pipes to the creek. Twenty-three stream sites in Rock Creek Park were selected based on the thermal infrared images. Sites were sampled during the summers of 2007 and 2008 for the analysis of organic wastewater compounds to verify potential sources of sewage and other anthropogenic wastewater. Two sets of stormwater samples were collected, on June 27-28 and September 6, 2008, at the Rock Creek at Joyce Road water-quality station using an automated sampler that began sampling when a specified stage threshold value was exceeded. Passive-sampler devices that accumulate organic chemicals over the duration of deployment were placed in July 2008 at the five locations that had the greatest number of detections of organic wastewater compounds from the June 2007 base-flow sampling. During the 2007 base-flow synoptic sampling, there were ubiquitous low-level detections of dissolved organic wastewater indicator compounds such as DEET, caffeine, HHCB, and organophosphate flame retardants at more than half of the 23 sites sampled in Rock Creek Park. Concentrations of DEET and caffeine in the tributaries to Rock Creek were variable, but in the main stem of Rock Creek, the concentrations were constant throughout the length of the creek, which likely reflects a distributed source. Organophosphate flame retardants in the main stem of Rock Creek were detected at estimated concentrations of 0.2 micrograms per liter or less, and generally did not increase with distance downstream. Overall, concentrations of most wastewater indicators in whole-water samples in the Park were similar to the concentrations found at the upstream sampling station at the Maryland/District of Columbia boundary. Polycyclic aromatic hydrocarbons were the dominant organic compounds found in the stormwater samples at the Joyce Road station. Polycyclic aromatic hydrocarbons were consistently found in higher concentrations either in sediment or in whole-water samples than in the dissolved samples collected during base-flow conditions at the 23 synoptic sites, or in the Joyce Road station stormwater samples.

Toxicity and bioavailability of metals in the Missouri River adjacent to a lead refinery

USGS Publications Warehouse

Chapman, Duane C.; Allert, Ann L.; Fairchild, James F.; May, Thomas W.; Schmitt, Christopher J.; Callahan, Edward V.

2001-01-01

This study is an evaluation of the potential environmental impacts of contaminated groundwater from the ASARCO metals refining facility adjacent to the Missouri River in Omaha, Nebraska. Surface waters, sediments, and sediment pore waters were collected from the Burt-Izard drain, which transects the facility, and from the Missouri River adjacent to the facility. Groundwater was also collected from the facility. Waters and sediments were analyzed for inorganic contaminants, and the toxicity of the waters was evaluated with the Ceriodaphnia dubia 7-day test. Concentrations of several elemental contaminants were highly elevated in the groundwater, but not in river sediment pore waters. Lead concentrations were moderately elevated in whole sediment at one site, but lead concentrations in pore waters were low due to apparent sequestration by acid-volatile sulfides. The groundwater sample was highly toxic to C. dubia, causing 100% mortality. Even at the lowest groundwater concentration tested (6.25%) C. dubia survival was reduced; however, at that concentration, reproduction was not significantly different from upstream porewater reference samples. Sediment pore waters were not toxic, except reproduction in pore water collected from one downstream site was somewhat reduced. The decrease in reproduction could not be attributed to measured elemental contaminants.

The impact of traditional coffee processing on river water quality in Ethiopia and the urgency of adopting sound environmental practices.

PubMed

Beyene, Abebe; Kassahun, Yared; Addis, Taffere; Assefa, Fassil; Amsalu, Aklilu; Legesse, Worku; Kloos, Helmut; Triest, Ludwig

2012-11-01

Although waste from coffee processing is a valuable resource to make biogas, compost, and nutrient-rich animal food, it is usually dumped into nearby water courses. We carried out water quality assessment at 44 sampling sites along 18 rivers that receive untreated waste from 23 coffee pulping and processing plants in Jimma Zone, Ethiopia. Twenty upstream sampling sites free from coffee waste impact served as control, and 24 downstream sampling sites affected by coffee waste were selected for comparison. Physicochemical and biological results revealed a significant river water quality deterioration as a result of disposing untreated coffee waste into running water courses. During coffee-processing (wet) season, the highest organic load (1,900 mg/l), measured as biochemical oxygen demand, depleted dissolved oxygen (DO) to a level less than 0.01 mg/l, and thus curtailed nitrification. During off season, oxygen started to recuperate and augmented nitrification. The shift from significantly elevated organic load and reduced DO in the wet season to increased nitrate in the off season was found to be the determining factor for the difference in macroinvertebrate community structure as verified by ordination analysis. Macroinvertebrate diversity was significantly reduced in impacted sites during the wet season contrary to the off season. However, there was a significant difference in the ratio of sensitive to pollution-tolerant taxa in the off season, which remained depreciated in the longer term. This study highlights the urgency of research exploring on the feasibility of adopting appropriate pollution abatement technologies to implement ecologically sound coffee-processing systems in coffee-growing regions of Ethiopia.

An evaluation of methods for estimating decadal stream loads

NASA Astrophysics Data System (ADS)

Lee, Casey J.; Hirsch, Robert M.; Schwarz, Gregory E.; Holtschlag, David J.; Preston, Stephen D.; Crawford, Charles G.; Vecchia, Aldo V.

2016-11-01

Effective management of water resources requires accurate information on the mass, or load of water-quality constituents transported from upstream watersheds to downstream receiving waters. Despite this need, no single method has been shown to consistently provide accurate load estimates among different water-quality constituents, sampling sites, and sampling regimes. We evaluate the accuracy of several load estimation methods across a broad range of sampling and environmental conditions. This analysis uses random sub-samples drawn from temporally-dense data sets of total nitrogen, total phosphorus, nitrate, and suspended-sediment concentration, and includes measurements of specific conductance which was used as a surrogate for dissolved solids concentration. Methods considered include linear interpolation and ratio estimators, regression-based methods historically employed by the U.S. Geological Survey, and newer flexible techniques including Weighted Regressions on Time, Season, and Discharge (WRTDS) and a generalized non-linear additive model. No single method is identified to have the greatest accuracy across all constituents, sites, and sampling scenarios. Most methods provide accurate estimates of specific conductance (used as a surrogate for total dissolved solids or specific major ions) and total nitrogen - lower accuracy is observed for the estimation of nitrate, total phosphorus and suspended sediment loads. Methods that allow for flexibility in the relation between concentration and flow conditions, specifically Beale's ratio estimator and WRTDS, exhibit greater estimation accuracy and lower bias. Evaluation of methods across simulated sampling scenarios indicate that (1) high-flow sampling is necessary to produce accurate load estimates, (2) extrapolation of sample data through time or across more extreme flow conditions reduces load estimate accuracy, and (3) WRTDS and methods that use a Kalman filter or smoothing to correct for departures between individual modeled and observed values benefit most from more frequent water-quality sampling.

An evaluation of methods for estimating decadal stream loads

USGS Publications Warehouse

Lee, Casey; Hirsch, Robert M.; Schwarz, Gregory E.; Holtschlag, David J.; Preston, Stephen D.; Crawford, Charles G.; Vecchia, Aldo V.

2016-01-01

Effective management of water resources requires accurate information on the mass, or load of water-quality constituents transported from upstream watersheds to downstream receiving waters. Despite this need, no single method has been shown to consistently provide accurate load estimates among different water-quality constituents, sampling sites, and sampling regimes. We evaluate the accuracy of several load estimation methods across a broad range of sampling and environmental conditions. This analysis uses random sub-samples drawn from temporally-dense data sets of total nitrogen, total phosphorus, nitrate, and suspended-sediment concentration, and includes measurements of specific conductance which was used as a surrogate for dissolved solids concentration. Methods considered include linear interpolation and ratio estimators, regression-based methods historically employed by the U.S. Geological Survey, and newer flexible techniques including Weighted Regressions on Time, Season, and Discharge (WRTDS) and a generalized non-linear additive model. No single method is identified to have the greatest accuracy across all constituents, sites, and sampling scenarios. Most methods provide accurate estimates of specific conductance (used as a surrogate for total dissolved solids or specific major ions) and total nitrogen – lower accuracy is observed for the estimation of nitrate, total phosphorus and suspended sediment loads. Methods that allow for flexibility in the relation between concentration and flow conditions, specifically Beale’s ratio estimator and WRTDS, exhibit greater estimation accuracy and lower bias. Evaluation of methods across simulated sampling scenarios indicate that (1) high-flow sampling is necessary to produce accurate load estimates, (2) extrapolation of sample data through time or across more extreme flow conditions reduces load estimate accuracy, and (3) WRTDS and methods that use a Kalman filter or smoothing to correct for departures between individual modeled and observed values benefit most from more frequent water-quality sampling.

75 FR 65509 - Notice of Lodging of Consent Decree Under the Comprehensive Environmental Response, Compensation...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-25

... is hereby given that on October 14, 2010 a proposed Consent Decree with Georgia-Pacific Consumer... Green Bay Superfund Site in northeastern Wisconsin (the ``Site''). The proposed Consent Decree would... from a line across the River slightly upstream of the company's paper mill in the City of Green Bay...

Radiocarbon dating, chronologic framework, and changes in accumulation rates of holocene estuarine sediments from Chesapeake Bay

USGS Publications Warehouse

Colman, Steven M.; Baucom, P.C.; Bratton, J.F.; Cronin, T. M.; McGeehin, J.P.; Willard, D.; Zimmerman, A.R.; Vogt, P.R.

2002-01-01

Rapidly accumulating Holocene sediments in estuaries commonly are difficult to sample and date. In Chesapeake Bay, we obtained sediment cores as much as 20 m in length and used numerous radiocarbon ages measured by accelarator mass spectrometry methods to provide the first detailed chronologies of Holocene sediment accumulation in the bay. Carbon in these sediments is a complex mixture of materials from a variety of sources. Analyses of different components of the sediments show that total organic carbon ages are largely unreliable, because much of the carbon (including coal) has been transported to the bay from upstream sources and is older than sediments in which it was deposited. Mollusk shells (clams, oysters) and foraminifera appear to give reliable results, although reworking and burrowing are potential problems. Analyses of museum specimens collected alive before atmospheric nuclear testing suggest that the standard reservoir correction for marine samples is appropriate for middle to lower Chesapeake Bay. The biogenic carbonate radiocarbon ages are compatible with 210 Pb and 137 Cs data and pollen stratigraphy from the same sites. Post-settlement changes in sediment transport and accumulation is an important environmental issue in many estuaries, including the Chesapeake. Our data show that large variations in sediment mass accumulation rates occur among sites. At shallow water sites, local factors seem to control changes in accumulation rates with time. Our two relatively deep-water sites in the axial channel of the bay have different long-term average accumulation rates, but the history of sediment accumulation at these sites appears to reflect overall conditions in the bay. Mass accumulation rates at the two deep-water sites rapidly increased by about fourfold coincident with widespread land clearance for agriculture in the Chesapeake watershed.

Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny

PubMed Central

Orengo, Dorcas J.; Aguadé, Montserrat

2017-01-01

The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426

Persistence and stability of fish community structure in a southwest New York stream

USGS Publications Warehouse

Hansen, Michael J.; Ramm, Carl W.

1994-01-01

We used multivariate and nonparametric statistics to examine persistence and stability of fish species in the upper 43 km of French Creek, New York. Species occurred in upstream and downstream groups in 1937 that persisted in 1979. However, the downstream group expanded its range in the drainage from 1937 to 1979 at the expense of the upstream group. A dam prevented further upstream expansion of the downstream group. Ranks of species abundances were stable, as tests of group similarity were significant. The abundances and distributions of benthic species were stable across seven sampling dates in 1980 despite several floods and repeated removals by sampling that could have altered community structure. We conclude that the fish community in French Creek persisted and was stable over the 42-yr interval, 1937-1979, and that abundances of benthic species were stable in summer 1980.

Quantification of a potent mutagenic 4-amino-3,3'-dichloro-5,4'-dinitrobiphenyl (ADDB) and the related chemicals in water from the Waka River in Wakayama, Japan.

PubMed

Mizuno, Tomoko; Takamura-Enya, Takeji; Watanabe, Tetsushi; Hasei, Tomohiro; Wakabayashi, Keiji; Ohe, Takeshi

2007-06-15

4-Amino-3,3'-dichloro-5,4'-dinitrobiphenyl (ADDB) is a novel chemical exerting strong mutagenicity, especially in the absence of metabolic activation. In addition to mutagenicity, ADDB may also disrupt the endocrine system in vitro. ADDB may be discharged from chemical plants near the Waka River and could be unintentionally formed via post-emission modification of drainage water containing 3,3'-dichlorobenzidine (DCB), which is a precursor in the manufacture of polymers and dye intermediates in chemical plants. The main purpose of this study was to make a comprehensive survey of the behaviour and levels of ADDB and suspected starting material or intermediates of ADDB, i.e., DCB, 3,3'-dichloro-4,4'-dinitrobiphenyl (DDB), and 4-amino-3,3'-dichloro-4'-nitrobipheny (ADNB) in Waka River water samples. We also postulated the formation pathway of ADDB. Water samples were collected at five sampling sites from the Waka River four times between March 2003 and December 2004. Samples were passed through Supelpak2 columns, and adsorbed materials were then extracted with methanol. Extracts were used for quantification of ADDB and the related chemicals by HPLC on reverse-phase columns; mutagenicity was evaluated in the Salmonella assay using the O-acetyltransferase-overexpressing strain YG1024. High levels of ADDB, DCB, DDB, and ADNB (12.0, 20,400, 134.8, and 149.4ng/L-equivalent) were detected in the samples collected at the site where wastewater was discharged from chemical plants into the river. These water samples also showed stronger mutagenicity in YG1024 both with and without S9 mix than the other water samples collected from upstream and downstream sites. The results suggest that ADDB is unintentionally formed from DCB via ADNB in the process of wastewater treatment of drainage water containing DCB from chemical plants.

Reconnaissance of toxic substances in the Jordan River, Salt Lake County, Utah

USGS Publications Warehouse

Thompson, Kendall R.

1984-01-01

A reconnaissance of toxic substances in the Jordan River, Salt Lake County, Utah, was made during July, 1980 to October, 1982 as part of a larger study of the river that included studies of sanitary quality, dissolved oxygen, and turbidity. Samples for toxic substances were collected at five sites on the Jordan River, at three major tributaries, and at six storm drains. The toxic substance that most frequently exceeded State standards was total mercury. About 78 percent of the 138 samples for total mercury exceeded the State standard of 0.05 microgram per liter. Other toxic substances that exceeded State standards were: Ammonia-18 percent of the samples analyzed, cadmium--9 percent, copper-9 percent, zinc--6 percent, and lead--2 percent. One sample for cyanide and one for iron also exceeded State standards. The diversity of toxic substances with concentrations large enough to cause them to be problems increased from the upstream sampling site at the Jordan Narrows to the next two downstream sites at 9000 South and 5800 South Streets. Concentrations of trace elements in stream-bottom materials also increased in a downstream direction. Substantial increases first were observed at 5800 South Street, and they were sustained throughout the downstream study area. Iron is transported in the greatest quantity of all the trace elements studied, with a mean load of 110 pounds per day. Notable loads of barium, boron, lead , and zinc also are transported by the river. DDD, DDE, DDT, dieldrin, heptachlor, methoxychlor, PCB, and 2,4-D were detected in bottom materials; and DDE, Silvex, and 2,4-D were detected in water samples. Of 112 organic compounds in the Environmental Protection Agency 's priority pollutant list, only chloroform was detected in the storm drains that empty into the Joran River. Several metals and phenol also were detected in the samples for priority pollutants. (USGS)

Low density polyethylene (LDPE) passive samplers for the investigation of polychlorinated biphenyl (PCB) point sources in rivers.

PubMed

Estoppey, Nicolas; Omlin, Julien; Schopfer, Adrien; Esseiva, Pierre; Vermeirssen, Etiënne L M; Delémont, Olivier; De Alencastro, Luiz F

2015-01-01

This study aims to provide a passive sampling approach which can be routinely used to investigate polychlorinated biphenyl (PCB) sources in rivers. The approach consists of deploying low density polyethylene (LDPE) strips downstream and upstream of potential PCB sources as well as in their water discharges. Concentrations of indicator PCBs (iPCBs) absorbed in samplers (Cs) from upstream and downstream sites are compared with each other to reveal increases of PCB levels. Cs measured in water discharges are used to determine if released amounts of PCBs are compatible with increases revealed in the river. As water velocity can greatly vary along a river stretch and influences the uptake at each site in a different way, differences in velocity have to be taken into account to correctly interpret Cs. LDPE strips were exposed to velocities between 1.6 and 37 cm s−1 using a channel system built in the field. Relationships between velocity and Cs were established for each iPCB to determine the expected change in Cs due to velocity variations. For PCBs 28 and 52, this change does not exceed a factor 2 for velocity variations in the range from 1.6 to 100 cm s−1 (extrapolated data above 37 cm s−1). For PCBs 101, 138, 153 and 180, this change only exceeds a factor 2 in the case of large velocity variations. The approach was applied in the Swiss river Venoge to first conduct a primary investigation of potential PCB sources and then conduct thorough investigations of two suspected sources.

Water-quality reconnaissance of the Middle and North Branch Park River watersheds, northeastern North Dakota

USGS Publications Warehouse

Ackerman, D.J.

1980-01-01

In order to design a network to monitor the effects of works of improvement in the Middle and North Branch Park River watersheds, and to determine the major factors controlling water-quality conditions in the watersheds, an evaluation of sediment transport, water chemistry, and biology was conducted during the spring and early summer of 1978.Major factors controlling water quality are geology, stream gradient, ground-water seepage, and the duration of streamflow.Sediment loads originate on the Pembina Escarpment. The coarse silt and sand parts of these loads are deposited on the Lake Agassiz Plain. Transport of sediment is lowered and flow duration is increased on the Middle Branch Park River due to the presence of small dams. Observations suggest that bedload transport is a significant process, particularly in the upstream reaches. However, no quantitative bedload data were collected.During periods of low flow, analyses of water from the rivers in both watersheds show downstream increases in sodium and chloride due to ground-water seepage or the unregulated flow of wells. Diversity of benthic invertebrates indicates water-quality conditions are better on the Middle Branch Park River than on the North Branch, and are better at upstream sites than at downstream sites. A program through which the Soil Conservation Service can monitor the effects of present and future works of improvement on the watersheds was designed. The monitoring program consists of intensive sampling at four locations for sediment and water chemistry during spring and early summer runoff events and by profiles of water chemistry during summer base runoff.

Coupling GIS and multivariate approaches to reference site selection for wadeable stream monitoring.

PubMed

Collier, Kevin J; Haigh, Andy; Kelly, Johlene

2007-04-01

Geographic Information System (GIS) was used to identify potential reference sites for wadeable stream monitoring, and multivariate analyses were applied to test whether invertebrate communities reflected a priori spatial and stream type classifications. We identified potential reference sites in segments with unmodified vegetation cover adjacent to the stream and in >85% of the upstream catchment. We then used various landcover, amenity and environmental impact databases to eliminate sites that had potential anthropogenic influences upstream and that fell into a range of access classes. Each site identified by this process was coded by four dominant stream classes and seven zones, and 119 candidate sites were randomly selected for follow-up assessment. This process yielded 16 sites conforming to reference site criteria using a conditional-probabilistic design, and these were augmented by an additional 14 existing or special interest reference sites. Non-metric multidimensional scaling (NMS) analysis of percent abundance invertebrate data indicated significant differences in community composition among some of the zones and stream classes identified a priori providing qualified support for this framework in reference site selection. NMS analysis of a range standardised condition and diversity metrics derived from the invertebrate data indicated a core set of 26 closely related sites, and four outliers that were considered atypical of reference site conditions and subsequently dropped from the network. Use of GIS linked to stream typology, available spatial databases and aerial photography greatly enhanced the objectivity and efficiency of reference site selection. The multi-metric ordination approach reduced variability among stream types and bias associated with non-random site selection, and provided an effective way to identify representative reference sites.

Water-quality data analysis of the upper Gunnison River watershed, Colorado, 1989-99

USGS Publications Warehouse

Gurdak, Jason J.; Greve, Adrienne I.; Spahr, Norman E.

2002-01-01

Water-quality data from October 1969 to December 1999 for both surface water and ground water in the upper Gunnison River watershed were retrieved and compiled from the U.S. Geological Survey National Water Information System and the U.S. Environmental Protection Agency Storage and Retrieval databases. Analyses focused primarily on a subset of these data from October 1989 to December 1999. The upper Gunnison River watershed is located west of the Continental Divide in the Southern Rocky Mountains physiographic province. Surface-water-quality data were compiled for 482 sites in the upper Gunnison River watershed. Most values of surface-water temperature, dissolved oxygen, and pH were within Colorado Department of Public Health and Environment (CDPHE) in-stream standards. Calcium bicarbonate type water was the most spatially dominant water type in the basin. Nutrients were most commonly sampled along the Slate River and East River near Crested Butte and along the Gunnison River from the confluence of the East and Taylor Rivers to the western edge of the watershed. Median ammonia concentrations were low, with many concentrations less than laboratory reporting levels. All nitrate concentrations met the CDPHE in-stream standard of 10 milligrams per liter. More than 30 percent of stream sites with total phosphorus data (23 of 61 sites) had concentrations greater than the U.S. Environmental Protection Agency (USEPA) recommendation for controlling eutrophication. Ammonia concentrations at a site on the Slate River near Crested Butte had a statistically significant upward trend for the 1995?99 period. The Slate River near Crested Butte site is located immediately downstream from the towns of Crested Butte and Mount Crested Butte and may reflect recent population growth or other land-use changes. However, the rate of change of the trend is small (0.017 milligram per liter per year). Although a multiple comparison test showed nitrate concentrations were statistically different between agriculture and forest sites and between agriculture and urban land-use classified sites, median concentrations were low among all land-use settings. Median concentrations of total phosphorus were greatest in rangeland areas and least in urban areas. No significant differences were identified for median concentrations of total phosphorus in agriculture and forest land-use areas. Median concentrations of arsenic, lead, mercury, selenium, and silver were low or below reporting levels throughout the watershed. Aluminum, cadmium, copper, lead, manganese, and zinc concentrations were elevated near the town of Crested Butte and on Henson Creek upstream from Lake City, which may be explained by upstream areas of historical mining. Samples for six trace elements exceeded standards: cadmium, copper, lead, manganese, silver, and zinc. A downward trend (3 micrograms per liter per year) was identified for the dissolved iron concentration at a site on the Gunnison River at County Road 32 downstream from the city of Gunnison. Streambed-sediment samples from areas affected by historical mining also had elevated concentrations of some trace elements. Chlorophyll-a concentrations in samples from Blue Mesa Reservoir and streams in the Crested Butte and Gunnison areas were typical of unenriched to moderately enriched conditions. Median concentrations of 5-day biochemical oxygen demand concentrations for sites between Crested Butte and Blue Mesa Reservoir were less than 2 milligrams per liter. Occasional high (greater than 200 counts per 100 milliliters) concentrations for fecal coliform were determined at selected sites within the study area. However, median concentrations were less than 100 counts per 100 milliliters except for the Squaw Creek and Cimarron River areas in the western part of the watershed. Ground-water-quality data have been collected by the U.S. Geological Survey from 99 wells. Many wells were completed in aquifers composed of H

Trends in suspended-sediment concentration at selected stream sites in Kansas, 1970-2002

USGS Publications Warehouse

Putnam, James E.; Pope, Larry M.

2003-01-01

Knowledge of erosion, transport, and deposition of sediment relative to streams and impoundments is important to those involved directly or indirectly in the development and management of water resources. Monitoring the quantity of sediment in streams and impoundments is important because: (1) sediment may degrade the water quality of streams for such uses as municipal water supply, (2) sediment is detrimental to the health of some species of aquatic animals and plants, and (3) accumulation of sediment in water-supply impoundments decreases the amount of storage and, therefore, water available for users. One of the objectives of the Kansas Water Plan is to reduce the amount of sediment in Kansas streams by 2010. During the last 30 years, millions of dollars have been spent in Kansas watersheds to reduce sediment transport to streams. Because the last evaluation of trends in suspended-sediment concentrations in Kansas was completed in 1985, 14 sediment sampling sites that represent 10 of the 12 major river basins in Kansas were reestablished in 2000. The purpose of this report is to present the results of time-trend analyses at the reestablished sediment data-collection sites for the period of about 1970?2002 and to evaluate changes in the watersheds that may explain the trends. Time-trend tests for 13 of 14 sediment sampling sites in Kansas for the period from about 1970 to 2002 indicated that 3 of the 13 sites tested had statistically significant decreasing suspended-sediment concentrations; however, only 2 sites, Walnut River at Winfield and Elk River at Elk Falls, had trends that were statistically significant at the 0.05 probability level. Increasing suspended-sediment concentrations were indicated at three sites although none were statistically significant at the 0.05 probability level. Samples from five of the six sampling sites located upstream from reservoirs indicated decreasing suspended-sediment concentrations. Watershed impoundments located in the respective river basins may contribute to the decreasing suspended-sediment trends exhibited at most of the sampling sites because the impoundments are designed to trap sediment. Both sites that exhibited statistically significant decreasing suspended-sediment concentrations have a large number of watershed impoundments located in their respective drainage basins. The relation between percentage of the watershed affected by impoundments and trend in suspended-sediment concentration for 11 sites indicated that, as the number of impoundments in the watershed increases, suspended-sediment concentration decreases. Other conser-vation practices, such as terracing of farm fields and contour farming, also may contribute to the reduced suspended-sediment concentrations if their use has increased during the period of analysis. Regression models were developed for 13 of 14 sediment sampling sites in Kansas and can be used to estimate suspended-sediment concentration if the range in stream discharge for which they were developed is not exceeded and if time trends in suspended-sediment concentrations are not significant. For those sites that had a statistically significant trend in suspended-sediment concentration, a second regression model was developed using samples collected during 2000?02. Past and current studies by the U.S. Geological Survey have shown that regression models can be developed between in-stream measurements of turbidity and laboratory-analyzed sediment samples. Regression models were developed for the relations between discharge and suspended-sediment concentration and turbidity and suspended-sediment concentration for 10 sediment sampling sites using samples collected during 2000?02.

Evaluating the effect of river restoration techniques on reducing the impacts of outfall on water quality

NASA Astrophysics Data System (ADS)

Mant, Jenny; Janes, Victoria; Terrell, Robert; Allen, Deonie; Arthur, Scott; Yeakley, Alan; Morse, Jennifer; Holman, Ian

2015-04-01

Outfalls represent points of discharge to a river and often contain pollutants from urban runoff, such as heavy metals. Additionally, erosion around the outfall site results in increased sediment generation and the release of associated pollutants. Water quality impacts from heavy metals pose risks to the river ecosystem (e.g. toxicity to aquatic habitats). Restoration techniques including establishment of swales, and the re-vegetation and reinforcement of channel banks aim to decrease outfall flow velocities resulting in deposition of pollutants and removal through plant uptake. Within this study the benefits of river restoration techniques for the removal of contaminants associated with outfalls have been quantified within Johnson Creek, Portland, USA as part of the EPSRC funded Blue-Green Cities project. The project aims to develop new strategies for protecting hydrological and ecological values of urban landscapes. A range of outfalls have been selected which span restored and un-restored channel reaches, a variety of upstream land-uses, and both direct and set-back outfalls. River Habitat Surveys were conducted at each of the sites to assess the level of channel modification within the reach. Sediment samples were taken at the outfall location, upstream, and downstream of outfalls for analysis of metals including Nickel, Lead, Zinc, Copper, Iron and Magnesium. These were used to assess the impact of the level of modification at individual sites, and to compare the influence of direct and set-back outfalls. Concentrations of all metals in the sediments found at outfalls generally increased with the level of modification at the site. Sediment in restored sites had lower metal concentrations both at the outfall and downstream compared to unrestored sites, indicating the benefit of these techniques to facilitate the effective removal of pollutants by trapping of sediment and uptake of contaminants by vegetation. However, the impact of restoration measures varied between metal types. Restored sites also showed lower variability in metal concentrations than un-restored sites, which is linked to greater bank stability and hence lower bank erosion rates within restored sites as eroding banks were noted to be a source of metal contaminants. The success of pollutant removal by set-back outfalls was varied due to additional factors including the distance between the set-back outfall and the main channel, vegetation type, density and age. The study highlights the ability of restoration techniques to reduce metal contaminant concentrations at outfalls, and provides an indication of the potential benefits from wider application of similar techniques.

Drinking water treatment response following a Colorado wildfire.

PubMed

Hohner, Amanda K; Cawley, Kaelin; Oropeza, Jill; Summers, R Scott; Rosario-Ortiz, Fernando L

2016-11-15

Wildfires can greatly alter the vegetation, soils, and hydrologic processes of watersheds serving as drinking water supplies, which may negatively influence source water quality and treatment. To address wildfire impacts on treatment, a drinking water intake below a burned watershed and an upstream, unburned reference site were monitored following the High Park wildfire (2012) in the Cache la Poudre watershed of northern Colorado, USA. Turbidity, nutrients, dissolved organic matter (DOM) character, coagulation treatability, and disinfection byproduct formation were evaluated and compared to pre-fire data. Post-fire paired spatial differences between the treatment plant intake and reference site for turbidity, nitrogen, and phosphorus increased by an order of magnitude compared to pre-fire differences. Fluorescence index (FI) values were significantly higher at the intake compared to the reference site (Δ = 0.04), and higher than pre-fire years, suggesting the wildfire altered the DOM character of the river. Total trihalomethane (TTHM) and haloacetonitrile (HAN4) formation at the intake were 10.1 μg L -1 and 0.91 μg L -1 higher than the reference site. Post-fire water was amenable to conventional treatment at a 10 mg L -1 higher average alum dose than reference samples. The intake was also monitored following rainstorms. Post-rainstorm samples showed the maximum observed FI values (1.52), HAN4 (3.4 μg mg C -1 ) and chloropicrin formation yields (3.6 μg mg C -1 ), whereas TTHM and haloacetic acid yields were not elevated. Several post-rainstorm samples presented treatment challenges, and even at high alum doses (65 mg L -1 ), showed minimal dissolved organic carbon removal (<10%). The degraded water quality of the post-rainstorm samples is likely attributed to the combined effects of runoff from precipitation and greater erosion following wildfire. Wildfire impacts cannot be separated from rainfall effects due to the lack of post-rainstorm samples from the reference site. Results suggest for this study region, wildfire may have consequences for influent water quality, coagulant dosing, and DBP speciation. Copyright © 2016 Elsevier Ltd. All rights reserved.

CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker

PubMed Central

Molano, Monica; Tabrizi, Sepehr N.; Garland, Suzanne M.; Roberts, Jennifer M.; Machalek, Dorothy A.; Phillips, Samuel; Chandler, David; Hillman, Richard J.; Grulich, Andrew E.; Jin, Fengyi; Poynten, I. Mary; Templeton, David J.; Cornall, Alyssa M.

2016-01-01

Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL. PMID:27529629

CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker.

PubMed

Molano, Monica; Tabrizi, Sepehr N; Garland, Suzanne M; Roberts, Jennifer M; Machalek, Dorothy A; Phillips, Samuel; Chandler, David; Hillman, Richard J; Grulich, Andrew E; Jin, Fengyi; Poynten, I Mary; Templeton, David J; Cornall, Alyssa M

2016-01-01

Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL.

Headwater Influences on Downstream Water Quality

PubMed Central

Oakes, Robert M.

2007-01-01

We investigated the influence of riparian and whole watershed land use as a function of stream size on surface water chemistry and assessed regional variation in these relationships. Sixty-eight watersheds in four level III U.S. EPA ecoregions in eastern Kansas were selected as study sites. Riparian land cover and watershed land use were quantified for the entire watershed, and by Strahler order. Multiple regression analyses using riparian land cover classifications as independent variables explained among-site variation in water chemistry parameters, particularly total nitrogen (41%), nitrate (61%), and total phosphorus (63%) concentrations. Whole watershed land use explained slightly less variance, but riparian and whole watershed land use were so tightly correlated that it was difficult to separate their effects. Water chemistry parameters sampled in downstream reaches were most closely correlated with riparian land cover adjacent to the smallest (first-order) streams of watersheds or land use in the entire watershed, with riparian zones immediately upstream of sampling sites offering less explanatory power as stream size increased. Interestingly, headwater effects were evident even at times when these small streams were unlikely to be flowing. Relationships were similar among ecoregions, indicating that land use characteristics were most responsible for water quality variation among watersheds. These findings suggest that nonpoint pollution control strategies should consider the influence of small upland streams and protection of downstream riparian zones alone is not sufficient to protect water quality. PMID:17999108

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

40 CFR 1066.125 - Data updating, recording, and control.

Code of Federal Regulations, 2014 CFR

2014-07-01

... minimum recording frequency, such as for sample flow rates from a CVS that does not have a heat exchanger... exhaust flow rate from a CVS with a heat exchanger upstream of the flow measurement 1 Hz. 40 CFR 1065.545§ 1066.425 Diluted exhaust flow rate from a CVS without a heat exchanger upstream of the flow measurement...

Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

PubMed Central

González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina

2018-01-01

Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs from environmental hotspots such as discharge sites of pharmaceutical effluents. PMID:29387045

Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

PubMed Central

Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

1993-01-01

The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

Bedload entrainment in low-gradient paraglacial coastal rivers of Maine, U.S.A.: Implications for habitat restoration

NASA Astrophysics Data System (ADS)

Snyder, Noah P.; Castele, Michael R.; Wright, Jed R.

2009-02-01

The rivers of coastal Maine flow through mainstem lakes and long low-gradient reaches that break the continuum of bedload transport expected in nonparaglacial landscapes. Stream erosion of glacial deposits supplies coarse sediment to these systems. The land use history includes intensive timber harvest and associated dam construction, which may have altered the frequency of substrate-mobilizing events. These watersheds are vital habitat for the last remaining wild anadromous Atlantic salmon in the United States. Future adjustments in channel morphology and habitat quality (via natural stream processes or restoration projects) depend on erosion, transport, and deposition of coarse sediment. These factors motivate our study of competence at four sites in the Sheepscot and Narraguagus watersheds. Three of the four sites behaved roughly similarly, with particle entrainment during intervals that include winter ice and spring flood conditions, and relatively minor bed mobilization during moderate floods in the summer and fall (with a recurrence interval of 2-3 years). The fourth site, on the Sheepscot River mainstem, exhibits more vigorous entrainment of marked particles and more complex three-dimensional channel morphology. This contrast is partially due to local geomorphic conditions that favor high shear stresses (particularly relatively steep gradient), but also likely to nourishment of the bedload saltation system by recruitment from an eroding glacial deposit upstream. Our results suggest that the frequency and magnitude of bedload transport are reach specific, depending on factors including local channel geometry, upstream sediment supply and transport, and formation of anchor ice. This presents a challenge for stream practitioners in this region: different reaches may require contrasting management strategies. Our results underscore the importance of understanding channel processes at a given site and assessing conditions upstream and downstream as a prerequisite for conducting habitat restoration projects.

Trihalomethane and nonpurgeable total organic-halide formation potentials of the Mississippi river

USGS Publications Warehouse

Rathbun, R.E.

1996-01-01

Trihalomethane and nonpurgeable total organic-hallide formation potentials were determined for water samples from 12 sites along the Mississippi River from Minneapolis, MN, to New Orleans, LA, for the summer and fall of 1991 and the spring of 1992. The formation potentials increased with distance upstream, approximately paralleling the increase of the dissolved organic- carbon concentration. The pH and the dissolved organic-carbon and free- chlorine concentrations were significant variables in the prediction of the formation potentials. The trihalomethane formation potential increased as the pH increased, whereas the nonpurgeable total organic-halide formation potential decreased. All formation potentials increased as the dissolved organic-carbon and free-chlorine concentrations increased, with the dissolved organic-carbon concentration having a much greater effect.

Comparison of methods for the removal of organic carbon and extraction of chromium, iron and manganese from an estuarine sediment standard and sediment from the Calcasieu River estuary, Louisiana, U.S.A.

USGS Publications Warehouse

Simon, N.S.; Hatcher, S.A.; Demas, C.

1992-01-01

U.S. National Bureau of Standards (NBS) estuarine sediment 1646 from the Chesapeake Bay, Maryland, and surface sediment collected at two sites in the Calcasieu River estuary, Louisiana, were used to evaluate the dilute hydrochloric acid extraction of Cr, Fe and Mn from air-dried and freeze-dried samples that had been treated by one of three methods to remove organic carbon. The three methods for the oxidation and removal of organic carbon were: (1) 30% hydrogen peroxide; (2) 30% hydrogen peroxide plus 0.25 mM pyrophosphate; and (3) plasma oxidation (low-temperature ashing). There was no statistically significant difference at the 95% confidence level between air- and freeze-dried samples with respect to the percent of organic carbon removed by the three methods. Generally, there was no statistically significant difference at the 95% confidence level between air- and freeze-dried samples with respect to the concentration of Cr, Fe and Mn that was extracted, regardless of the extraction technique that was used. Hydrogen peroxide plus pyrophosphate removed the most organic carbon from sediment collected at the site in the Calcasieu River that was upstream from industrial outfalls. Plasma oxidation removed the most organic carbon from the sediment collected at a site in the Calcasieu River close to industrial outfalls and from the NBS estuarine sediment sample. Plasma oxidation merits further study as a treatment for removal of organic carbon. Operational parameters can be chosen to limit the plasma oxidation of pyrite which, unlike other Fe species, will not be dissolved by dilute hydrochloric acid. Preservation of pyrite allows the positive identification of Fe present as pyrite in sediments. ?? 1992.

Reconnaissance investigation of water quality, bottom sediment, and biota associated with irrigation drainage in the Sun River area, west-central Montana, 1986-87

USGS Publications Warehouse

Knapton, J.R.; Jones, W.E.; Sutphin, J.W.

1988-01-01

The Sun River area was selected for a reconnaissance investigation of irrigation drainage because sufficient information existed to indicate that potential problems of a toxic nature might exist. The area of study included the Sun River Irrigation Project, Freeze-out Lake Game Management Area, and Benton Lake National Wildlife Refuge. Water, bottom sediment , and biota were sampled at selected sites and analyzed for inorganic and organic constituents that could be toxic at large concentrations. Although selenium was of primary concern, other trace elements and selected pesticides were also analyzed. Some water quality problems have been prevalent for many years in the Sun River Irrigation Projects, including the Sun River and Muddy Creek. However, during this study, most sampling sites were free of concentrations of toxic constituents that are in excess of established criteria and standards. There was little change in arsenic, boron, mercury, and selenium concentrations in fish and invertebrates at Sun River sampling sites upstream and downstream from the irrigation project. Presently, the most serious threat within the irrigation project appears to be from nitrate in groundwater. Water from some wells contains nitrate concentration in excess of drinking water standards (10 mg/L) established for the State of Montana. The largest selenium concentrations in water and bottom sediment were from seeps that surround Benton Lake, with maximum concentrations of 580 mg/L in water and biological samples. Several eared-grebe livers from Freezeout Lake and several coot livers and eggs from Benton Lake had selenium concentrations indicative of contamination. (See also W89-07064) (Author 's abstract)

Water-Quality Characterization of Surface Water in the Onondaga Lake Basin, Onondaga County, New York, 2005-08

USGS Publications Warehouse

Coon, William F.; Hayhurst, Brett A.; Kappel, William M.; Eckhardt, David A.V.; Szabo, Carolyn O.

2009-01-01

Water-resources managers in Onondaga County, N.Y., have been faced with the challenge of improving the water-quality of Onondaga Lake. To assist in this endeavor, the U.S. Geological Survey undertook a 3-year basinwide study to assess the water quality of surface water in the Onondaga Lake Basin. The study quantified the relative contributions of nonpoint sources associated with the major land uses in the basin and also focused on known sources (streams with large sediment loads) and presumed sinks (Onondaga Reservoir and Otisco Lake) of sediment and nutrient loads, which previously had not been evaluated. Water samples were collected and analyzed for nutrients and suspended sediment at 26 surface-water sites and 4 springs in the 285-square-mile Onondaga Lake Basin from October 2005 through December 2008. More than 1,060 base-flow, stormflow, snowmelt, spring-water, and quality-assurance samples collected during the study were analyzed for ammonia, nitrite, nitrate-plus-nitrite, ammonia-plus-organic nitrogen, orthophosphate, phosphorus, and suspended sediment. The concentration of total suspended solids was measured in selected samples. Ninety-one additional samples were collected, including 80 samples from 4 county-operated sites, which were analyzed for suspended sediment or total suspended solids, and 8 precipitation and 3 snowpack samples, which were analyzed for nutrients. Specific conductance, salinity, dissolved oxygen, and water temperature were periodically measured in the field. The mean concentrations of selected constituents in base-flow, stormflow, and snowmelt samples were related to the land use or land cover that either dominated the basin or had a substantial effect on the water quality of the basin. Almost 40 percent of the Onondaga Lake Basin is forested, 30 percent is in agricultural uses, and almost 21 percent, including the city of Syracuse, is in developed uses. The data indicated expected relative differences among the land types for concentrations of nitrate, ammonia-plus-organic nitrogen, and orthophosphate. The data departed from the expected relations for concentrations of phosphorus and suspended sediment, and plausible explanations for these departures were posited. Snowmelt concentrations of dissolved constituents generally were greater and those of particulate constituents were less than concentrations of these constituents in storm runoff. Presumably, the snowpack acted as a short-term sink for dissolved constituents that had accumulated from atmospheric deposition, and streambed erosion and resuspension of previously deposited material, rather than land-surface erosion, were the primary sources of particulate constituents in snowmelt flows. Longitudinal assessments documented the changes in the median concentrations of constituents in base flows and event flows (combined stormflow and snowmelt) from upstream to downstream monitoring sites along the two major tributaries to Onondaga Lake - Onondaga Creek and Ninemile Creek. Median base-flow concentrations of ammonia and phosphorus and event concentrations of ammonia increased in the downstream direction in both streams. Whereas median event concentrations of other constituents in Onondaga Creek displayed no consistent trends, concentrations of ammonia-plus-organic nitrogen, orthophosphate, phosphorus, and suspended sediment in Ninemile Creek decreased from upstream to downstream sites. Springs discharging from the Onondaga and Bertie Limestone had measureable effects on water temperatures in the receiving streams and increased salinity and values of specific conductance in base flows. Loads of selected nutrients and suspended sediment transported in three tributaries of Otisco Lake were compared with loads from 1981-83. Loads of ammonia-plus-organic nitrogen and orthophosphate decreased from 1981-83 to 2005-08, but those of nitrate-plus-nitrite, phosphorus, and suspended sediment increased. The largest load increase was for suspende

Polychlorinated Biphenyls (PCBs) in Catfish and Carp Collected from the Rio Grande Upstream and Downstream of Los Alamos National Laboratory: Revision 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilbert J. Gonzales

2008-05-12

Concern has existed for years that the Los Alamos National Laboratory (LANL), a complex of nuclear weapons research and support facilities, has released polychlorinated biphenyls (PCBs) to the environment that may have reached adjacent bodies of water through canyons that connect them. In 1997, LANL's Ecology Group began measuring PCBs in fish in the Rio Grande upstream and downstream of ephemeral streams that cross LANL and later began sampling fish in Abiquiu and Cochiti reservoirs, which are situated on the Rio Chama and Rio Grande upstream and downstream of LANL, respectively. In 2002, we electroshocked channel catfish (Ictalurus punctatus) andmore » common carp (Carpiodes carpio) in the Rio Grande upstream and downstream of LANL and analyzed fillets for PCB congeners. We also sampled soils along the Rio Chama and Rio Grande drainages to discern whether a background atmospheric source of PCBs that could impact surface water adjacent to LANL might exist. Trace concentrations of PCBs measured in soil (mean = 4.7E-05 {micro}g/g-ww) appear to be from background global atmospheric sources, at least in part, because the bimodal distribution of low-chlorinated PCB congeners and mid-chlorinated PCB congeners in the soil samples is interpreted to be typical of volatilized PCB congeners that are found in the atmosphere and dust from global fallout. Upstream catfish (n = 5) contained statistically (P = 0.047) higher concentrations of total PCBs (mean = 2.80E-02 {micro}g/g-ww) than downstream catfish (n = 10) (mean = 1.50E-02 {micro}g/g-ww). Similarly, upstream carp (n = 4) contained higher concentrations of total PCBs (mean = 7.98E-02 {micro}g/g-ww) than downstream carp (n = 4) (3.07E-02 {micro}g/g-ww); however, the difference was not statistically significant (P = 0.42). The dominant PCB homologue in all fish samples was hexachlorobiphenyls. Total PCB concentrations in fish in 2002 are lower than 1997; however, differences in analytical methods and other uncertainties exist. A review of historical quantitative PCB data for fish from the Rio Grande and Abiquiu and Cochiti reservoirs does not indicate a distinct contribution of PCBs from LANL to fish in the Rio Grande or Cochiti. Analysis of homologue patterns for fish does not provide sufficient evidence of a LANL contribution. Nevertheless, concentrations of PCBs in fillets of fish sampled from the Rio Grande are indicative of potential adverse chronic health impact from consumption of these fish on a long-term basis.« less

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory : determination of gasoline oxygenates, selected degradates, and BTEX in water by heated purge and trap/gas chromatography/mass spectrometry

USGS Publications Warehouse

Rose, Donna L.; Sandstrom, Mark W.

2003-01-01

Devils Lake rose dramatically during the 1990's, causing extensive flood damages. Because of the potential for continued flooding, the U.S. Army Corps of Engineers has been conducting studies to evaluate the feasibility of constructing and operating an outlet from Devils Lake. The occurrence of mercury in lakes, wetlands, and rivers and the potential for increased loading of mercury into the Sheyenne River as a result of a Devils Lake outlet needed to be evaluated as part of the studies. Sixteen lake, wetland, and river sites in the Devils Lake, Sheyenne River, Red River of the North, and Red Lake River Basins were sampled and analyzed for mercury constituents and other selected properties and constituents relevant to mercury aquatic chemistry. For the lake and wetland sites, whole-water methylmercury concentrations ranged from less than 0.04 to 3.53 nanograms per liter and whole-water total mercury concentrations ranged from 0.38 to 7.02 nanograms per liter. Conditions favorable for methylation of mercury generally exist at the lake and wetland sites, as indicated by larger dissolved methylmercury concentrations in near-bottom samples than in near-surface samples and by relatively large ratios of methylmercury to total mercury (generally greater than 10 percent for the summer sampling period). Total mercury concentrations were larger for the summer sampling period than for the winter sampling period for all lake and wetland sites. A wetland site in the upper Devils Lake Basin had the largest mercury concentrations for the lake and wetland sites. For the river sites, whole-water methylmercury concentrations ranged from 0.15 to 1.13 nanograms per liter and whole-water total mercury concentrations ranged from 2.00 to 26.90 nanograms per liter. Most of the mercury for the river sites occurred in particulate inorganic phase. Summer ratios of whole-water methylmercury to whole-water total mercury were 35 percent for Starkweather Coulee (a wetland-dominated site), near or less than 10 percent for the Sheyenne River sites, and less than 8 percent for the Red River of the North and Red Lake River sites. Although the number of samples collected during this investigation is small, results indicated an outlet from Devils Lake probably would not have adverse effects on mercury concentrations in the Sheyenne River upstream from Lake Ashtabula. However, because discharges in the Sheyenne River would increase during some periods, loads of mercury entering Lake Ashtabula also would increase. Lake Ashtabula probably serves as a sink for suspended sediment and mercury. Thus, a Devils Lake outlet probably would not have substantial effects on mercury concentrations and loads in the downstream part of the Sheyenne River or in the Red River of the North. More substantial effects could occur for Lake Ashtabula.

Reconnaissance of mercury in lakes, wetlands, and rivers in the Red River of the North Basin, North Dakota, March through August 2001

USGS Publications Warehouse

Sando, Steven K.; Wiche, G.J.; Lundgren, R.F.; Sether, Bradley A.

2003-01-01

Devils Lake rose dramatically during the 1990's, causing extensive flood damages. Because of the potential for continued flooding, the U.S. Army Corps of Engineers has been conducting studies to evaluate the feasibility of constructing and operating an outlet from Devils Lake. The occurrence of mercury in lakes, wetlands, and rivers and the potential for increased loading of mercury into the Sheyenne River as a result of a Devils Lake outlet needed to be evaluated as part of the studies.Sixteen lake, wetland, and river sites in the Devils Lake, Sheyenne River, Red River of the North, and Red Lake River Basins were sampled and analyzed for mercury constituents and other selected properties and constituents relevant to mercury aquatic chemistry. For the lake and wetland sites, whole-water methylmercury concentrations ranged from less than 0.04 to 3.53 nanograms per liter and whole-water total mercury concentrations ranged from 0.38 to 7.02 nanograms per liter. Conditions favorable for methylation of mercury generally exist at the lake and wetland sites, as indicated by larger dissolved methylmercury concentrations in near-bottom samples than in near-surface samples and by relatively large ratios of methylmercury to total mercury (generally greater than 10 percent for the summer sampling period). Total mercury concentrations were larger for the summer sampling period than for the winter sampling period for all lake and wetland sites. A wetland site in the upper Devils Lake Basin had the largest mercury concentrations for the lake and wetland sites.For the river sites, whole-water methylmercury concentrations ranged from 0.15 to 1.13 nanograms per liter and whole-water total mercury concentrations ranged from 2.00 to 26.90 nanograms per liter. Most of the mercury for the river sites occurred in particulate inorganic phase. Summer ratios of whole-water methylmercury to whole-water total mercury were 35 percent for Starkweather Coulee (a wetland-dominated site), near or less than 10 percent for the Sheyenne River sites, and less than 8 percent for the Red River of the North and Red Lake River sites.Although the number of samples collected during this investigation is small, results indicated an outlet from Devils Lake probably would not have adverse effects on mercury concentrations in the Sheyenne River upstream from Lake Ashtabula. However, because discharges in the Sheyenne River would increase during some periods, loads of mercury entering Lake Ashtabula also would increase. Lake Ashtabula probably serves as a sink for suspended sediment and mercury. Thus, a Devils Lake outlet probably would not have substantial effects on mercury concentrations and loads in the downstream part of the Sheyenne River or in the Red River of the North. More substantial effects could occur for Lake Ashtabula.

Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

PubMed

Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

2003-04-01

Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

Analysis of ground-water flow in the Madison aquifer using fluorescent dyes injected in Spring Creek and Rapid Creek near Rapid City, South Dakota, 2003-04

USGS Publications Warehouse

Putnam, Larry D.; Long, Andrew J.

2007-01-01

The Madison aquifer, which contains fractures and solution openings in the Madison Limestone, is used extensively for water supplies for the city of Rapid City and other suburban communities in the Rapid City, S. Dak., area. The 48 square-mile study area includes the west-central and southwest parts of Rapid City and the outcrops of the Madison Limestone extending from south of Spring Creek to north of Rapid Creek. Recharge to the Madison Limestone occurs when streams lose flow as they cross the outcrop. The maximum net loss rate for Spring and Rapid Creek loss zones are 21 and 10 cubic feet per second (ft3/s), respectively. During 2003 and 2004, fluorescent dyes were injected in the Spring and Rapid Creek loss zones to estimate approximate locations of preferential flow paths in the Madison aquifer and to measure the response and transit times at wells and springs. Four injections of about 2 kilograms of fluorescein dye were made in the Spring Creek loss zone during 2003 (sites S1, S2, and S3) and 2004 (site S4). Injection at site S1 was made in streamflow just upstream from the loss zone over a 12-hour period when streamflow was about equal to the maximum loss rate. Injections at sites S2, S3, and S4 were made in specific swallow holes located in the Spring Creek loss zone. Injection at site R1 in 2004 of 3.5 kilograms of Rhodamine WT dye was made in streamflow just upstream from the Rapid Creek loss zone over about a 28-hour period. Selected combinations of 27 wells, 6 springs, and 3 stream sites were monitored with discrete samples following the injections. For injections at sites S1-S3, when Spring Creek streamflow was greater than or equal to 20 ft3/s, fluorescein was detected in samples from five wells that were located as much as about 2 miles from the loss zone. Time to first arrival (injection at site S1) ranged from less than 1 to less than 10 days. The maximum fluorescein concentration (injection at site S1) of 120 micrograms per liter (ug/L) at well CO, which is located adjacent to the loss zone, was similar to the concentration in the stream. Fluorescein arrived at well NON (injection at site S1), which is located about 2 miles northeast of the loss zone, within about 1.6 days, and the maximum concentration was 44 ug/L. For injection at site S4, when streamflow was about 12 ft3/s, fluorescein was detected in samples from six wells and time to first arrival ranged from 0.2 to 16 days. Following injection at site S4 in 2004, the length of time that dye remained in the capture zone of well NON, which is located approximately 2 miles from the loss zone, was almost an order of magnitude greater than in 2003. For injection at site R1, Rhodamine WT was detected at well DRU and spring TI-SP with time to first arrival of about 0.5 and 1.1 days and maximum concentrations of 6.2 and 0.91 ug/L, respectively. Well DRU and spring TI-SP are located near the center of the Rapid Creek loss zone where the creek has a large meander. Measurable concentrations were observed for spring TI-SP as many as 109 days after the dye injection. The direction of a conduit flow path in the Spring Creek area was to the northeast with ground-water velocities that ranged from 770 to 6,500 feet per day. In the Rapid Creek loss zone, a conduit flow path east of the loss zone was not evident from the dye injection.

Influence of riffle characteristics, surficial geology, and natural barriers on the distribution of the channel darter, Percina copelandi, in the Lake Ontario basin

USGS Publications Warehouse

Reid, S.M.; Carl, L.M.; Lean, J.

2005-01-01

The channel darter, Percina copelandi, is a small benthic fish with a wide but disjunct distribution across central North America. The development of conservation and recovery strategies for Canadian populations is limited by a lack of knowledge regarding ecology, population size and other factors that affect its distribution and abundance. We sampled five rivers in the Lake Ontario basin to test whether the distribution of P. copelandi reflected riffle habitat characteristics or landscape-scale factors such as surficial geology and natural barriers (waterfalls). At most sites yielding P. copelandi, riffles flowed into deep sand bottomed run or pool habitats. Despite a lack of association with local surficial geology or riffle habitat characteristics, both the upstream limits of P. copelandi occurrence and distribution of suitable habitats reflected the distribution of waterfalls, chutes and bedrock outcroppings. In contrast to P. copelandi, distributions of Etheostoma flabellare, P. caprodes and Rhinichthys cataractae reflected among site differences in riffle habitat. ?? Springer 2005.

Assessment of macroinvertebrate communities in adjacent urban stream basins, Kansas City, Missouri, metropolitan area, 2007 through 2011

USGS Publications Warehouse

Christensen, Eric D.; Krempa, Heather M.

2013-01-01

Wastewater-treatment plant discharges during base flow, which elevated specific conductance and nutrient concentrations, combined sewer overflows, and nonpoint sources likely contributed to water-quality impairment and lower aquatic-life status at the Blue River Basin sites. Releases from upstream reservoirs to the Little Blue River likely decreased specific conductance, suspended-sediment, and dissolved constituent concentrations and may have benefitted water quality and aquatic life of main-stem sites. Chloride concentrations in base-flow samples, attributable to winter road salt application, had the highest correlation with the SUII (Spearman’s ρ equals 0.87), were negatively correlated with the SCI (Spearman’s ρ equals -0.53) and several pollution sensitive Ephemeroptera plus Plecoptera plus Trichoptera abundance and percent richness metrics, and were positively correlated with pollution tolerant Oligochaeta abundance and percent richness metrics. Study results show that the easily calculated SUII and the selected modeled multimetric indices are effective for comparing urban basins and for evaluation of water quality in the Kansas City metropolitan area.

Bioindicators from Mosquitofish (Gambusia affinis) Sampled from the Imperial Valley in Southern California

USGS Publications Warehouse

Jenkins, Jill A.; Draugelis-Dale, Rassa O.

2006-01-01

The Sonny Bono Salton Sea National Wildlife Refuge (SSNWR) is located 64 km north of the Mexican border at the southern end of the Salton Sea in California's Imperial Valley. Freshwater ponds and managed habitats at the SSNWR, Calipatria, Calif. are supplied with Colorado River water that carries compounds from upstream sources. Components include municipal and industrial discharges, agricultural drainage, and sewage plant inputs. Aquatic animals in these ecosystems are continuously exposed to multiple constituents, several of which have been demonstrated to be associated with hormonal disturbances. We investigated possible endocrine impacts to fish in the Imperial Valley, Calif., by addressing the null hypothesis that aquatic species in impacted sites did not exhibit evidence of endocrine disruption as compared with those from nonimpacted sites. The results presented are intended to provide managers with science-based information and interpretations about the condition of the animals in their ecosystems for the minimization of potential adverse effects to trust fish and wildlife resources and for the maximization of available water resources.

The possible influence of upstream upper-level baroclinic processes on the development of the QE II storm

NASA Technical Reports Server (NTRS)

Uccellini, L. W.

1986-01-01

An analysis of the QE II storm of September 9-11, 1978 presents evidence for the existence of upper-level baroclinic processes upstream of the rapidly developing cyclone. The analysis shows that a deepening shortwave trough was located 400 to 500 km upstream of the site of the storm 12 h prior to rapid cyclogenesis. The trough was associated with: (1) a polar jet marked by 65 m/s winds in its core and significant vertical and horizontal wind shear, (2) positive vorticity advection and divergence at the 300 mb level, and (3) an intense frontal zone that extended from 300 mb down to the surface. It also appears that a tropopause fold likely extruded stratospheric air down to the 700-800 mb level, 400-500 km upstream of the surface low and 12 h prior to the explosive development phase of the cyclone. These findings raise questions about Gyakum's (1983) assertion that the QE II storm developed in an area in which the baroclinic support was confined to the lower troposphere and the related assertion by Anthes et al. (1983) that upper-level forcing upstream of the area of rapid cyclogenesis was weak and apparently not important in this case.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

USDA-ARS?s Scientific Manuscript database

The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

PubMed

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Intestinal Parasitic Infections and Environmental Water Contamination in a Rural Village of Northern Lao PDR.

PubMed

Ribas, Alexis; Jollivet, Chloé; Morand, Serge; Thongmalayvong, Boupha; Somphavong, Silaphet; Siew, Chern-Chiang; Ting, Pei-Jun; Suputtamongkol, Saipin; Saensombath, Viengsaene; Sanguankiat, Surapol; Tan, Boon-Huan; Paboriboune, Phimpha; Akkhavong, Kongsap; Chaisiri, Kittipong

2017-10-01

A field survey studying intestinal parasites in humans and microbial pathogen contamination at environment was performed in a Laotian rural village to identify potential risks for disease outbreaks. A parasitological investigation was conducted in Ban Lak Sip village, Luang Prabang, Lao PDR involving fecal samples from 305 inhabitants as well as water samples taken from 3 sites of the local stream. Water analysis indicated the presence of several enteric pathogens, i.e., Aeromonas spp., Vibrio spp., E. coli H7, E. coli O157: H7, verocytotoxin-producing E. coli (VTEC), Shigella spp., and enteric adenovirus. The level of microbial pathogens contamination was associated with human activity, with greater levels of contamination found at the downstream site compared to the site at the village and upstream, respectively. Regarding intestinal parasites, the prevalence of helminth and protozoan infections were 68.9% and 27.2%, respectively. Eight helminth taxa were identified in fecal samples, i.e., 2 tapeworm species (Taenia sp. and Hymenolepis diminuta), 1 trematode (Opisthorchis sp.), and 5 nematodes (Ascaris lumbricoides, Trichuris trichiura, Strongyloides stercoralis, trichostrongylids, and hookworms). Six species of intestinal protists were identified, i.e., Blastocystis hominis, Cyclospora spp., Endolimax nana, Entamoeba histolytica/E. dispar, Entamoeba coli, and Giardia lamblia. Questionnaires and interviews were also conducted to determine risk factors of infection. These analyses together with a prevailing infection level suggested that most of villagers were exposed to parasites in a similar degree due to limited socio-economic differences and sharing of similar practices. Limited access to effective public health facilities is also a significant contributing factor.

Intestinal Parasitic Infections and Environmental Water Contamination in a Rural Village of Northern Lao PDR

PubMed Central

Ribas, Alexis; Jollivet, Chloé; Morand, Serge; Thongmalayvong, Boupha; Somphavong, Silaphet; Siew, Chern-Chiang; Ting, Pei-Jun; Suputtamongkol, Saipin; Saensombath, Viengsaene; Sanguankiat, Surapol; Tan, Boon-Huan; Paboriboune, Phimpha; Akkhavong, Kongsap; Chaisiri, Kittipong

2017-01-01

A field survey studying intestinal parasites in humans and microbial pathogen contamination at environment was performed in a Laotian rural village to identify potential risks for disease outbreaks. A parasitological investigation was conducted in Ban Lak Sip village, Luang Prabang, Lao PDR involving fecal samples from 305 inhabitants as well as water samples taken from 3 sites of the local stream. Water analysis indicated the presence of several enteric pathogens, i.e., Aeromonas spp., Vibrio spp., E. coli H7, E. coli O157: H7, verocytotoxin-producing E. coli (VTEC), Shigella spp., and enteric adenovirus. The level of microbial pathogens contamination was associated with human activity, with greater levels of contamination found at the downstream site compared to the site at the village and upstream, respectively. Regarding intestinal parasites, the prevalence of helminth and protozoan infections were 68.9% and 27.2%, respectively. Eight helminth taxa were identified in fecal samples, i.e., 2 tapeworm species (Taenia sp. and Hymenolepis diminuta), 1 trematode (Opisthorchis sp.), and 5 nematodes (Ascaris lumbricoides, Trichuris trichiura, Strongyloides stercoralis, trichostrongylids, and hookworms). Six species of intestinal protists were identified, i.e., Blastocystis hominis, Cyclospora spp., Endolimax nana, Entamoeba histolytica/E. dispar, Entamoeba coli, and Giardia lamblia. Questionnaires and interviews were also conducted to determine risk factors of infection. These analyses together with a prevailing infection level suggested that most of villagers were exposed to parasites in a similar degree due to limited socio-economic differences and sharing of similar practices. Limited access to effective public health facilities is also a significant contributing factor. PMID:29103267

Using streamflow and hydrochemical tracers to conceptualise hydrological function of underground channel system in a karst catchment of southwest China

NASA Astrophysics Data System (ADS)

Zhang, Zhicai; Chen, Xi; Wang, Jinli

2016-04-01

Karst hydrodynamic behaviour is complex because of special karst geology and geomorphology. The permeable multi-media consisting of soil, epikarst fractures and conduits has a key influence on karst hydrological processes. Spatial heterogeneity is high due to special landforms of vertical shafts, caves and sinkholes, which leads to a high dynamic variability of hydrological processes in space and time, and frequent exchange of surface water and groundwater. Underground water in different reach were sampled over the 1996-2001 in a karst catchment of Houzhai, with 81km2, located in Guizhou province of southwest China. Samples were analysed for water temperature, pH, conductivity and four solute concentrations. The monitoring sought to assess the combined utility of flow discharge and natural geochemical tracers in upscaling flow structure understanding in karst area. Based on previous researches and field investigation, the catchment characteristics were explored with the use of a GIS. Both flow discharge and solute concentrations exhibited clear seasonal patterns at every groundwater sampling sites. The variations of flow and chemistry are more dramatic in upstream site with less soil cover and more sinkholes development, which affect the hydrological pathways significantly. There was clear evidence that the differences in geology and soil were the main controls on hydrology and flow chemistry, which was spatially variable in different sites of underground channel. Conceptual flow structures in main hydrological response units for different area in the catchment were developed according to the variation of discharge and flow chemistry.

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

Spatial and temporal trends in PCBs in sediment along the lower Rhone River, France

USGS Publications Warehouse

Desmet, Marc; Mourier, Brice; Mahler, Barbara J.; Van Metre, Peter C.; Roux, Gwenaelle; Persat, Henri; Lefevre, Irene; Peretti, Annie; Chapron, Emmanuel; Anaelle, Simonneau; Miege, Cecile; Babut, Marc

2012-01-01

Despite increasingly strict control of polychlorinated biphenyl (PCB) releases in France since the mid-1970s, PCB contamination of fish recently has emerged as a major concern in the lower Rhone River basin. We measured PCB concentrations in Rhone sediment to evaluate the effects of PCB releases from major urban and industrial areas, sediment redistribution by large floods, and regulatory controls on PCB trends from 1970 to present. Profiles of PCBs (the sum of seven indicator PCB congeners) were reconstructed from sediment cores collected from an off-river rural reference site and from three depositional areas along the Rhone upstream and downstream from the city of Lyon, France. Core chronology was determined from radionuclide profiles and flood deposits. PCB concentrations increased progressively in the downstream direction, and reached a maximum concentration in 1991 of 281 μg/kg at the most downstream site. At the rural reference site and at the upstream Rhone site, PCB concentrations peaked in the 1970s (maximum concentration of 13 and 78 μg/kg, respectively) and have decreased exponentially since then. PCB concentrations in the middle and downstream cores were elevated into the early 1990s, decreased very rapidly until 2000, and since then have remained relatively stable. Congener profiles for three time windows (1965–80, 1986–93, and 2000–08) were similar in the three sediment cores from the Rhone and different from those at the rural reference site. The results indicate that permitted discharges from a hazardous-waste treatment facility upstream from Lyon might have contributed to high concentrations into the 1980-90s, but that industrial discharges from the greater Lyon area and tributaries to the Rhone near Lyon have had a greater contribution since the 1990s. There is little indication that PCB concentration in sediments downstream from Lyon will decrease over at least the short term.

Intra‐annual variability of Silver Carp populations in the Des Moines River, USA

USGS Publications Warehouse

Sullivan, Christopher J.; Camacho, Carlos A.; Weber, Michael J.; Pierce, Clay

2017-01-01

Since their introduction in the 1970s, Silver Carp Hypophthalmichthys molitrix have spread throughout the Mississippi River basin. Management of any species relies on an accurate understanding of population characteristics and dynamics. However, Silver Carp seasonal sampling variation is unknown. Sampling during periods of peak catch rates would facilitate Silver Carp assessment and management, improving monitoring and removal techniques. The objective of this study was to evaluate adult Silver Carp seasonal sampling variation with boat electroshocking and trammel nets. Silver Carp were collected monthly (April–October) during 2014 and 2015 from four locations in the Des Moines River, Iowa. Trammel nets rarely captured Silver Carp (mean ± SE = 4.9 ± 1.6 fish/net; 60% of fish were captured in 6.3% of net sets) and therefore were not included in analyses. Electroshocking catch rates (CPUEs) exhibited a bimodal distribution, with peak CPUEs generally occurring in May, June, and September and lower catch rates observed during July and August. Catch rates were positively related to river discharge at upstream sites but not at downstream sites. Silver Carp size structure was similar among months and sites except at Cliffland, where fish were smaller during August and October compared to earlier in the year. Finally, Silver Carp condition peaked during April and May and decreased throughout the year except at Keokuk, where peaks were observed during both May and August. Although spatiotemporal variability was substantial, these results suggest that sampling of Silver Carp via electroshocking in May–June and September–October generally produces higher catch rates compared to July–August sampling and generates a more representative size structure. Using site‐specific knowledge, monitoring and surveillance programs could more effectively sample during these periods of high vulnerability and densities in order to manage the spread and impacts of Silver Carp at statewide and regionwide scales.

Reconnaissance of chemical and physical characteristics of selected bottom sediments of the Caloosahatchee River and estuary, tributaries, and contiguous bays, Lee County, Florida, July 20-30, 1998

USGS Publications Warehouse

Fernandez, Mario; Marot, M.E.; Holmes, C.W.

1999-01-01

This report summarizes a reconnaissance study, conducted July 20-30, 1998, of chemical and physical characteristics of recently deposited bottom sediments in the Caloosahatchee River and Estuary. Recently deposited sediments were identified using an isotopic chronometer, Beryllium-7 (7Be), a short-lived radioisotope. Fifty-nine sites were sampled in an area that encompasses the Caloosahatchee River (River) about three miles upstream from the Franklin Lock (S-79), the entire tidally affected length of the river (estuary), and the contiguous water bodies of Matlacha Pass, San Carlos Bay, Estero Bay, Tarpon Bay, and Pine Island Sound in Lee County, Florida. Bottom sediments were sampled for 7Be at 59 sites. From the results of the 7Be analysis, 30 sites were selected for physical and chemical analysis. Sediments were analyzed for particle size, total organic carbon (TOC), trace elements, and toxic organic compounds, using semiquantitative methods for trace elements and organic compounds. The semiquantitative scans of trace elements indicated that cadmium, copper, lead, and zinc concentrations, when normalized to aluminum, were above the natural background range at 24 of 30 sites. Particle size and TOC were used to characterize sediment deposition patterns and organic content. Pesticides, polychlorinated biphenyls (PCBs), and carcinogenic polycyclic aromatic hydrocarbons (CaPAHs) were determined at 30 sites using immunoassay analysis. The semiquantitative immunoassay analyses of toxic organic compounds indicated that all of the samples contained DDT, cyclodienes as chlordane (pesticides), and CaPAHs. PCBs were not detected. Based on analyses of the 30 sites, sediments at 10 of these sites were analyzed for selected trace elements and toxic organic compounds, including pesticides, PCBs, and PAHs, using quantitative laboratory procedures. No arsenic or cadmium was detected. Zinc was detected at two sites with concentrations greater than the lower limit of the range of sediment contaminant concentrations that are usually or always associated with adverse effects (Florida Department of Environmental Protection's Sediment Quality Assessment Guidelines). Organochlorine pesticides were detected at four sites at concentrations below the reporting limits; there were no organophosphorus pesticides or PCBs detected. PAHs were detected at eight sites; however, only four sites had concentrations above the reporting limit.

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Concentrations, and estimated loads and yields of nutrients and suspended sediment in the Little River basin, Kentucky, 2003-04

USGS Publications Warehouse

Crain, Angela S.

2006-01-01

Nutrients, primarily nitrogen and phosphorus compounds, naturally occur but also are applied to land in the form of commercial fertilizers and livestock waste to enhance plant growth. Concentrations, estimated loads and yields, and sources of nitrite plus nitrate, total phosphorus, and orthophosphate were evaluated in streams of the Little River Basin to assist the Commonwealth of Kentucky in developing 'total maximum daily loads' (TMDLs) for streams in the basin. The Little River Basin encompasses about 600 square miles in Christian and Trigg Counties, and a portion of Caldwell County in western Kentucky. Water samples were collected in streams in the Little River Basin during 2003-04 as part of a study conducted in cooperation with the Kentucky Department of Agriculture. A total of 92 water samples were collected at four fixed-network sites from March through November 2003 and from February through November 2004. An additional 20 samples were collected at five synoptic-network sites during the same period. Median concentrations of nitrogen, phosphorus, and suspended sediment varied spatially and seasonally. Concentrations of nitrogen were higher in the spring (March-May) after fertilizer application and runoff. The highest concentration of nitrite plus nitrate-5.7 milligrams per liter (mg/L)-was detected at the South Fork Little River site. The Sinking Fork near Cadiz site had the highest median concentration of nitrite plus nitrate (4.6 mg/L). The North Fork Little River site and the Little River near Cadiz site had higher concentrations of orthophosphate in the fall and lower concentrations in the spring. Concentrations of orthophosphate remained high during the summer (June-August) at the North Fork Little River site possibly because of the contribution of wastewater effluent to streamflow. Fifty-eight percent of the concentrations of total phosphorus at the nine sites exceeded the U.S. Environmental Protection Agency recommended maximum concentration limit of 0.1 mg/L. Concentrations of suspended sediment were highest in the spring during runoff and lowest in the fall. The highest concentration of suspended sediment (1,020 mg/L) was observed at the Sinking Fork near Cadiz site. The median concentration of suspended sediment for all sites sampled was 12 mg/L. A nonparameteric statistical test (Wilcoxson rank-sum) showed that the median concentrations of suspended sediment were not different among any of the fixed-network sites. The Little River near Cadiz site contributed larger estimated mean annual loads of nitrite plus nitrate (2,500,000 pounds per year (lb/yr)) and total phosphorus (160,000 lb/yr) than the other three fixed-network sites. Of the two main upstream tributaries from the Little River near Cadiz site, the North Fork Little River was the greatest contributor of total phosphorus to the study area with an estimated mean annual load of 107,000 lb/yr or about 64 percent of the total estimated mean annual load at the Little River near Cadiz site. The other main upstream tributary, South Fork Little River, had an estimated mean annual load of total phosphorus that was about 20 percent of the mean annual load at the Little River near Cadiz site. Estimated loads of suspended sediment were largest at the Little River near Cadiz site, where the estimated mean annual load for 2003-04 was about 84,000,000 lb/yr. The North Fork Little River contributed an estimated 36 percent of the mean annual load of suspended sediment at the Little River near Cadiz site, while the South Fork Little River contributed an estimated 18 percent of the mean annual load at the Little River near Cadiz site. The North Fork Little River site had the largest estimated mean annual yield of total phosphorus (1,600 pounds per year per square mile (lb/yr/mi2)) and orthophosphate (1,100 lb/yr/mi2). A principal source of phosphorus for the North Fork Little River is discharge from wastewater-treatment facilities. The largest estimated mean annual yield of nitrite plus nitrate was observed at the South Fork Little River site. The North Fork Little River site had the largest estimated mean annual yield of suspended sediment (450,000 lb/yr/mi2). Inputs of nitrogen and phosphorus to streams from point and nonpoint sources were estimated for the Little River Basin. Commercial fertilizer and livestock-waste applications on row crops are a principal source of nutrients for most of the Little River Basin. Sources of nutrients in the urban areas of the basin mainly are from effluent discharge from wastewater-treatment facilities and fertilizer applications to lawns and golf courses.

Influence of Wastewater Discharge on the Metabolic Potential of the Microbial Community in River Sediments.

PubMed

Li, Dong; Sharp, Jonathan O; Drewes, Jörg E

2016-01-01

To reveal the variation of microbial community functions during water filtration process in river sediments, which has been utilized widely in natural water treatment systems, this study investigates the influence of municipal wastewater discharge to streams on the phylotype and metabolic potential of the microbiome in upstream and particularly various depths of downstream river sediments. Cluster analyses based on both microbial phylogenetic and functional data collectively revealed that shallow upstream sediments grouped with those from deeper subsurface downstream regions. These sediment samples were distinct from those found in shallow downstream sediments. Functional genes associated with carbohydrate, xenobiotic, and certain amino acid metabolisms were overrepresented in upstream and deep downstream samples. In contrast, the more immediate contact with wastewater discharge in shallow downstream samples resulted in an increase in the relative abundance of genes associated with nitrogen, sulfur, purine and pyrimidine metabolisms, as well as restriction-modification systems. More diverse bacterial phyla were associated with upstream and deep downstream sediments, mainly including Actinobacteria, Planctomycetes, and Firmicutes. In contrast, in shallow downstream sediments, genera affiliated with Betaproteobacteria and Gammaproteobacteria were enriched with putative functions that included ammonia and sulfur oxidation, polyphosphate accumulation, and methylotrophic bacteria. Collectively, these results highlight the enhanced capabilities of microbial communities residing in deeper stream sediments for the transformation of water contaminants and thus provide a foundation for better design of natural water treatment systems to further improve the removal of contaminants.

Trace element, semivolatile organic, and chlorinated organic compound concentrations in bed sediments of selected streams at Fort Gordon, Georgia, February-April 2010

USGS Publications Warehouse

Thomas, Lashun K.; Journey, Celeste A.; Stringfield, Whitney J.; Clark, Jimmy M.; Bradley, Paul M.; Wellborn, John B.; Ratliff, Hagan; Abrahamsen, Thomas A.

2011-01-01

A spatial survey of streams was conducted from February to April 2010 to assess the concentrations of major ions, selected trace elements, semivolatile organic compounds, organochlorine pesticides, and polychlorinated biphenyls associated with the bed sediments of surface waters at Fort Gordon military installation near Augusta, Georgia. This investigation expanded a previous study conducted in May 1998 by the U.S. Geological Survey, in cooperation with the U.S. Department of the Army Environmental and Natural Resources Management Office of the U.S. Army Signal Center and Fort Gordon, that evaluated the streambed sediment quality of selected surface waters at Fort Gordon. The data presented in this report are intended to help evaluate bed sediment quality in relation to guidelines for the protection of aquatic life, and identify temporal trends in trace elements and semivolatile organic compound concentrations at streambed sites previously sampled. Concentrations of 34 major ions and trace elements and 102 semivolatile organic, organochlorine pesticide, and polychlorinated biphenyl compounds were determined in the fine-grained fraction of bed sediment samples collected from 13 of the original 29 sites in the previous study, and 22 additional sites at Fort Gordon. Three of the sites were considered reference sites as they were presumed to be located away from potential sources of contaminants and were selected to represent surface waters flowing onto the fort, and the remaining 32 nonreference sites were presumed to be located within the contamination area at the fort. Temporal trends in trace elements and semivolatile organic compound concentrations also were evaluated at 13 of the 32 nonreference sites to provide an assessment of the variability in the number of detections and concentrations of constituents in bed sediment associated with potential sources, accumulation, and attenuation processes. Major ion and trace element concentrations in fine-grained bed sediment samples from most nonreference sites exceeded concentrations in samples from reference sites at Fort Gordon. Bed sediments from one of the nonreference sites sampled contained the highest concentrations of copper and lead with elevated levels of zinc and chromium relative to reference sites. The percentage change of major ions, trace elements, and total organic carbon that had been detected at sites previously sampled in May 1998 and current bed sediment sites ranged from -4 to 8 percent with an average percentage change of less than 1 percent. Concentrations of major ions and trace elements in bed sediments exceeded probable effect levels for aquatic life (based on the amphipod Hyalella azteca) established by the U.S. Environmental Protection Agency at 46 and 69 percent of the current and previously sampled locations, respectively. The greatest frequency of exceedances for major ions and trace elements in bed sediments was observed for lead. Concentrations of semivolatile organic compounds, organochlorine pesticides, and polychlorinated biphenyls were detected in bed sediment samples at 94 percent of the sites currently sampled. Detections of these organic compounds were reported with greater frequency in bed sediments at upstream sampling locations, when compared to downstream locations. The greatest number of detections of these compounds was reported for bed sediment samples collected from two creeks above a lake. The percentage change of semivolatile organic compounds detected at previously sampled and current bed sediment sites ranged from -68 to 100 percent with the greatest percentage increase reported for one of the creeks above the lake. Concentrations of semivolatile organic compounds and polychlorinated biphenyls in bed sediments exceeded aquatic life criteria established by the U.S. Environmental Protection Agency at three sites. Contaminant compounds exceeding aquatic life criteria included fluoranthene, phenanthrene, anthracene, benzo(a)anthracene

Development of a local-scale urban stream assessment method using benthic macroinvertebrates: An example from the Santa Clara Basin, California

USGS Publications Warehouse

Carter, J.L.; Purcell, A.H.; Fend, S.V.; Resh, V.H.

2009-01-01

Research that explores the biological response to urbanization on a site-specific scale is necessary for management of urban basins. Recent studies have proposed a method to characterize the biological response of benthic macroinvertebrates along an urban gradient for several climatic regions in the USA. Our study demonstrates how this general framework can be refined and applied on a smaller scale to an urbanized basin, the Santa Clara Basin (surrounding San Jose, California, USA). Eighty-four sampling sites on 14 streams in the Santa Clara Basin were used for assessing local stream conditions. First, an urban index composed of human population density, road density, and urban land cover was used to determine the extent of urbanization upstream from each sampling site. Second, a multimetric biological index was developed to characterize the response of macroinvertebrate assemblages along the urban gradient. The resulting biological index included metrics from 3 ecological categories: taxonomic composition ( Ephemeroptera, Plecoptera, and Trichoptera), functional feeding group (shredder richness), and habit ( clingers). The 90th-quantile regression line was used to define the best available biological conditions along the urban gradient, which we define as the predicted biological potential. This descriptor was then used to determine the relative condition of sites throughout the basin. Hierarchical partitioning of variance revealed that several site-specific variables (dissolved O2 and temperature) were significantly related to a site's deviation from its predicted biological potential. Spatial analysis of each site's deviation from its biological potential indicated geographic heterogeneity in the distribution of impaired sites. The presence and operation of local dams optimize water use, but modify natural flow regimes, which in turn influence stream habitat, dissolved O2, and temperature. Current dissolved O2 and temperature regimes deviate from natural conditions and appear to affect benthic macroinvertebrate assemblages. The assessment methods presented in our study provide finer-scale assessment tools for managers in urban basins. ?? North American Benthological Society.

Bioactive contaminants of emerging concern in National Park waters of the northern Colorado Plateau, USA.

PubMed

Weissinger, Rebecca H; Blackwell, Brett R; Keteles, Kristen; Battaglin, William A; Bradley, Paul M

2018-05-02

Pharmaceuticals and personal care products (PPCPs), wastewater indicators (WWIs), and pesticides (herein, Contaminants of Emerging Concern [CECs]) have been documented in surface waters throughout the world and have associated risks to aquatic life. While much research has focused on temperate and urbanized watersheds, less is known about CEC presence in semi-arid landscapes, where water availability is limited and populations are low. CEC presence in water and sediment is reported for 21 sites in eight U.S. national parks in the northern Colorado Plateau region. From 2012 to 2016, at least one PPCP and/or WWI was detected at most sites on over half of sampling visits, indicating that CECs are not uncommon even in isolated areas. CEC detections were generally fewer and at lower concentrations than in urbanized or agricultural watersheds. Consistent with studies from other U.S. regions, the most frequently detected CECs in this study include DEET, caffeine, organophosphorus flame retardants, and bisphenol A in water and fecal indicators and polycyclic aromatic hydrocarbons in sediment. Maximum concentrations in this study were generally below available water quality benchmarks, sediment quality guidelines, and risk assessment thresholds associated with vertebrates. Additional work is needed to assess the potential activity of hormones, which had high reporting limits in our study, and potential bioactivity of environmental concentrations for invertebrates, microbial communities, and algae. Potential sources of CEC contamination include upstream wastewater effluent discharges and National Park Service invasive-plant-control herbicide applications. CEC occurrence patterns and similarities between continuous and isolated flow locations suggest that direct contamination from individual visitors may also occur. While our data indicate there is little aquatic health risk associated with CECs at our sites, our results demonstrate the ubiquity of CECs on the landscape and a continued need for public outreach concerning resource-use ethics and the potential effects of upstream development. Copyright © 2018. Published by Elsevier B.V.

Using semi-permeable membrane devices and stable nitrogen isotopes to detect anthropogenic influences on the Truckee River, USA

USGS Publications Warehouse

Saito, L.; Rosen, Michael R.; Chandra, S.; Fritsen, C.H.; Arufe, J.A.; Redd, C.

2008-01-01

Stable nitrogen isotopes (??15N) and semipermeable membrane devices (SPMDs) were used together to provide evidence of potential anthropogenic connections to aquatic organisms in the Truckee River, which flows through the Reno/Sparks metropolitan area in Nevada. Crayfish, snail, and periphyton ??15N values, and SPMD toxicity data collected during high and low flow periods at seven primary sites on the river were used with water quality and flow data for the assessment. All biota showed an increase of ??15N on both dates at sites downstream of inflows of a water-quality impaired tributary and urban drain relative to upstream. In addition, most of the lowest ??15N values on each date occurred at the most downstream site on the river. SPMDs sample lipophilic organic contaminants and can be used to assess organic contaminant toxicity to aquatic organisms because they use a membrane that mimics organic contaminant uptake by fish. In this study, results from a fluoroscan test [pyrene index (PI)] of SPMD extracts that responds to higher molecular weight polycyclic aromatic hydrocarbons (PAHs) showed patterns similar to stable isotope data, although observed peaks in PI values occurred in the urban area upstream of where peak ??15N values occurred. The CYP1A biomarker test, which responds to PAHs, certain polychlorinated biphenyls (PCBs), and organochlorines, showed peak toxic equivalents (TEQ) values farther downstream of the urban area. Thus, it is likely that PAHs were contributing to toxicity in the urban area, whereas other nonurban sources of organic carbon may have been present farther downstream. The combined use of stable isotope measurements and SPMDs provided a means of simultaneously examining whether aquatic biota are incorporating constituents from potential food sources (via stable isotopes) or exposure through water (via SPMDs). ?? Mary Ann Liebert, Inc. 2008.

Bioactive contaminants of emerging concern in National Park waters of the northern Colorado Plateau, USA

USGS Publications Warehouse

Weissinger, Rebecca H; Blackwell, Brett R.; Keteles, Kristen; Battaglin, William A.; Bradley, Paul M.

2018-01-01

Pharmaceuticals and personal care products (PPCPs), wastewater indicators (WWIs), and pesticides (herein, Contaminants of Emerging Concern [CECs]) have been documented in surface waters throughout the world and have associated risks to aquatic life. While much research has focused on temperate and urbanized watersheds, less is known about CEC presence in semi-arid landscapes, where water availability is limited and populations are low. CEC presence in water and sediment is reported for 21 sites in eight U.S. national parks in the northern Colorado Plateau region. From 2012 to 2016, at least one PPCP and/or WWI was detected at most sites on over half of sampling visits, indicating that CECs are not uncommon even in isolated areas. CEC detections were generally fewer and at lower concentrations than in urbanized or agricultural watersheds. Consistent with studies from other U.S. regions, the most frequently detected CECs in this study include DEET, caffeine, organophosphorus flame retardants, and bisphenol A in water and fecal indicators and polycyclic aromatic hydrocarbons in sediment. Maximum concentrations in this study were generally below available water quality benchmarks, sediment quality guidelines, and risk assessment thresholds associated with vertebrates. Additional work is needed to assess the potential activity of hormones, which had high reporting limits in our study, and potential bioactivity of environmental concentrations for invertebrates, microbial communities, and algae. Potential sources of CEC contamination include upstream wastewater effluent discharges and National Park Service invasive-plant-control herbicide applications. CEC occurrence patterns and similarities between continuous and isolated flow locations suggest that direct contamination from individual visitors may also occur. While our data indicate there is little aquatic health risk associated with CECs at our sites, our results demonstrate the ubiquity of CECs on the landscape and a continued need for public outreach concerning resource-use ethics and the potential effects of upstream development.

Numerical simulation of vertical ground-water flux of the Rio Grande from ground-water temperature profiles, central New Mexico

USGS Publications Warehouse

Bartolino, James R.; Niswonger, Richard G.

1999-01-01

An important gap in the understanding of the hydrology of the Middle Rio Grande Basin, central New Mexico, is the rate at which water from the Rio Grande recharges the Santa Fe Group aquifer system. Several methodologies-including use of the Glover-Balmer equation, flood pulses, and channel permeameters- have been applied to this problem in the Middle Rio Grande Basin. In the work presented here, ground-water temperature profiles and ground-water levels beneath the Rio Grande were measured and numerically simulated at four sites. The direction and rate of vertical ground-water flux between the river and underlying aquifer was simulated and the effective vertical hydraulic conductivity of the sediments underlying the river was estimated through model calibration. Seven sets of nested piezometers were installed during July and August 1996 at four sites along the Rio Grande in the Albuquerque area, though only four of the piezometer nests were simulated. In downstream order, these four sites are (1) the Bernalillo site, upstream from the New Mexico State Highway 44 bridge in Bernalillo (piezometer nest BRN02); (2) the Corrales site, upstream from the Rio Rancho sewage treatment plant in Rio Rancho (COR01); (3) the Paseo del Norte site, upstream from the Paseo del Norte bridge in Albuquerque (PDN01); and (4) the Rio Bravo site, upstream from the Rio Bravo bridge in Albuquerque (RBR01). All piezometers were completed in the inner-valley alluvium of the Santa Fe Group aquifer system. Ground-water levels and temperatures were measured in the four piezometer nests a total of seven times in the 24-month period from September 1996 through August 1998. The flux between the surface- and ground-water systems at each of the field sites was quantified by one-dimensional numerical simulation of the water and heat exchange in the subsurface using the heat and water transport model VS2DH. Model calibration was aided by the use of PEST, a model-independent computer program that uses nonlinear parameter estimation. Mean vertical hydraulic conductivities were estimated by model calibration and range from 1.5x10-5 to 5.8x10-6 meters per second (m/s). Mean simulated vertical ground-water flux for the BRN02 piezometer nest is 3.30x10-7 m/s; for the COR01 piezometer nest is 3.58x10-7 m/s; for the PDN01 piezometer nest is 4.22x10- 7 m/s; and for the RBR01 piezometer nest is 2.05x10-7 m/s. Comparison of the simulated vertical fluxes and vertical hydraulic conductivities derived from this study with values from other studies in the Middle Rio Grande Basin indicate agreement between 1 and 3.5 orders of magnitude for hydraulic conductivity and within 1 order of magnitude for vertical flux.

Effects of historical lead–zinc mining on riffle-dwelling benthic fish and crayfish in the Big River of southeastern Missouri, USA

USGS Publications Warehouse

Allert, A.L.; DiStefano, R.J.; Fairchild, J.F.; Schmitt, C.J.; McKee, M.J.; Girondo, J.A.; Brumbaugh, W.G.; May, T.W.

2013-01-01

The Big River (BGR) drains much of the Old Lead Belt mining district (OLB) in southeastern Missouri, USA, which was historically among the largest producers of lead–zinc (Pb–Zn) ore in the world. We sampled benthic fish and crayfish in riffle habitats at eight sites in the BGR and conducted 56-day in situ exposures to the woodland crayfish (Orconectes hylas) and golden crayfish (Orconectes luteus) in cages at four sites affected to differing degrees by mining. Densities of fish and crayfish, physical habitat and water quality, and the survival and growth of caged crayfish were examined at sites with no known upstream mining activities (i.e., reference sites) and at sites downstream of mining areas (i.e., mining and downstream sites). Lead, zinc, and cadmium were analyzed in surface and pore water, sediment, detritus, fish, crayfish, and other benthic macro-invertebrates. Metals concentrations in all materials analyzed were greater at mining and downstream sites than at reference sites. Ten species of fish and four species of crayfish were collected. Fish and crayfish densities were significantly greater at reference than mining or downstream sites, and densities were greater at downstream than mining sites. Survival of caged crayfish was significantly lower at mining sites than reference sites; downstream sites were not tested. Chronic toxic-unit scores and sediment probable effects quotients indicated significant risk of toxicity to fish and crayfish, and metals concentrations in crayfish were sufficiently high to represent a risk to wildlife at mining and downstream sites. Collectively, the results provided direct evidence that metals associated with historical mining activities in the OLB continue to affect aquatic life in the BGR.

Quantitative Infrared Image Analysis Of Thermally-Thin Cellulose Surface Temperatures During Upstream and Downstream Microgravity Flame Spread from A Central Ignition Line

NASA Technical Reports Server (NTRS)

Olson, Sandra L.; Lee, J. R.; Fujita, O.; Kikuchi, M.; Kashiwagi, T.

2012-01-01

Surface view calibrated infrared images of ignition and flame spread over a thin cellulose fuel were obtained at 30 Hz during microgravity flame spread tests in the 10 second Japan Microgravity Center (JAMIC). The tests also used a color video of the surface view and color images of the edge view using 35 millimeter 1600 Kodak Ektapress film at 2 Hz. The cellulose fuel samples (50% long fibers from lumi pine and 50% short fibers from birch) were made with an area density of 60 grams per square meters. The samples were mounted in the center of a 12 centimeter wide by 16 centimeter tall flow duct that uses a downstream fan to draw the air through the flow duct. Samples were ignited after the experiment package was released using a straight hot wire across the center of the 7.5 centimeter wide by 14 centimeter long samples. One case, at 1 atmosphere 35%O2 in N2, at a forced flow of 10 centimeters per second, is presented here. In this case, as the test progresses, the single flame begins to separate into simultaneous upstream and downstream flames. Surface temperature profiles are evaluated as a function of time, and temperature gradients for upstream and downstream flame spread are measured. Flame spread rates from IR image data are compared to visible image spread rate data. IR blackbody temperatures are compared to surface thermocouple readings to evaluate the effective emissivity of the pyrolyzing surface. Preheat lengths are evaluated both upstream and downstream of the central ignition point. A surface energy balance estimates the net heat flux from the flame to the fuel surface along the length of the fuel.

Mechanism of Promoter Melting by the Xeroderma Pigmentosum Complementation Group B Helicase of Transcription Factor IIH Revealed by Protein-DNA Photo-Cross-Linking

PubMed Central

Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit

2000-01-01

The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286

Geochemical tracing of As pollution in the Orbiel Valley (southern France): 87Sr/86Sr as a tracer of the anthropogenic arsenic in surface and groundwater.

NASA Astrophysics Data System (ADS)

Khaska, Mahmoud; Le Gal La Salle, Corinnne; Lancelot, Joël; Verdoux, Patrick; Boutin, René

2014-05-01

The environmental impacts of arsenic mining activities and their effects on ecosystem and human health are observed in many stream waters and groundwater. The aim of this study is to identify the origin of As content in a mining environment using Sr isotopes. At the Salsigne gold mine, before the closure in 2004, high arsenic content has been observed in surface water and groundwater in the Orbiel valley. At the site, immobilization of As, in As rich leachate, is carried out by adding CaO. High contrast in 87Sr/86Sr between Arsenic rich minerals associated with Variscan metamorphic rocks (0.714888-0.718835), together with rich As waste water (0.713463-715477), and the CaO (0.707593) allows as to trace the origin of anthropogenic As. In 2012, Orbiel stream waters were sampled monthly upstream and downstream from the ancient ore processing site and once after an important rainy event (117mm). The upstream valley samples showed low and relatively constant As content with natural regional background of 3.6 and 5.6 μg/L. The rainy event induced only a slight increase in the As content up to 6.3 μg/L. High 87Sr/86Sr ratios suggested an influence of radiogenic Sr issued from the Variscan metamorphic basement. Downstream from the area, the As content was at least10 time as high. In the wet season, stream water As content clearly increased to 13.9-24 μg/L, reaching 120.5 μg/L during the rainy event. Associated 87Sr/86Sr ratio showed to be less radiogenic (0.712276-0.714002). The anti correlation observed between As and 87Sr/86Sr suggest that As issued from a natural origin is characterised by a high 87Sr/86Sr compared to As derived from the CaO treatement used on site and characterized by a low 87Sr/86Sr ratio. During the dry season, increase in As content was observed reaching 110 μg/L. These highlights the contribution of alluvial groundwater to base flow, probably associated with As reach leachate from the site. Contribution from the alluvial aquifer is confirmed by results from redox potential (Eh) measurements in both surface and groundwater. Hence, 87Sr/86Sr appears as an excellent tracer of the origin of pollution associated with CaO treatment widely used in many water treatment processes.

Isotope tracing of Hg pollution from artisanal small scale gold mining in an aquatic ecosystem of Amapá, Brazil

NASA Astrophysics Data System (ADS)

Adler Miserendino, R.; Silbergeld, E. K.; Guimarães, J. D.; Ghosh, S.; Bergquist, B. A.

2010-12-01

Artisinal small scale gold mining (ASGM) is a central economic activity throughout the developing world. It is both a poverty driven and poverty alleviating process; however, ASGM leads to extensive pollution of waterways through the use of Hg to extract gold from deposits. There have been many studies conducted in the Amazon showing elevated levels of Hg in fish and sediment downstream of ASGM sites; however, the debate continues about the contribution of Hg from ASGM versus other potential sources of Hg. In this study, we investigate whether Hg stable isotope analysis can be used to trace mercury pollution from an ASGM site through an aquatic ecosystem in Amapá, Brazil. We measured the Hg isotopic composition of sediment cores from two lakes, only one of which was heavily impacted by the use of elemental Hg in ASGM, as well as from grab samples at the AGSM site and upstream and downstream from the AGSM site along the river which connects the polluted lake to the ASGM site. Hg from all samples were trapped via combustion using the Leeman Labs Hydra-C mercury analyzer and analyzed for both mass-independent and mass-dependent signatures using cold vapor multi-collector inductively coupled plasma mass spectrometry (CV-MC-ICP-MS). Detectable variations in the Hg isotopic signatures were apparent across our field sites, suggesting stable isotopic analysis has great potential to trace contamination pathways in waterways. Preliminary data demonstrate Hg from the ASGM site has unique isotopic signatures that are seen downstream. However, the impacted lake sediments do not have the mining signature despite having three times more Hg than the non-impacted lake. Based on this data, it may be possible to trace Hg from ASGM and assess whether it is impacting local ecosystems and food webs. Hair and soil samples will also be discussed. This demonstration is essential for the broader application of these tools for understanding and applying Hg isotopic analysis in other contexts. This information may also be useful to help reduce Hg exposure of highly vulnerable populations exposed to Hg from ASGM through these aquatic networks in Amapá, Brazil.

USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

PubMed

Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

1991-09-11

The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

Seasonal and diel movements of white sturgeon in the lower columbia river

USGS Publications Warehouse

Parsley, M.J.; Popoff, N.D.; Van Der Leeuw, B. K.; Wright, C.D.

2008-01-01

Continuous monitoring of the movements and depths used by white sturgeon Acipenser transmontanus with acoustic telemetry technologies in the lower Columbia River provided information on diel and seasonal migrations, local movements, and site fidelity. White sturgeon moved to shallower water at night and showed greater activity, inferred from rates of movement, than during daytime. The extent of local movement within a season was variable among fish; some fish readily moved among habitats while the movements of others were more constrained. White sturgeon were absent from the study area (river kilometers 45-52) during winter and returned from upstream during the spring, confirming an upstream seasonal migration in the fall and downstream migration in spring. The return of individual fish and reoccupation of areas previously inhabited showed that some white sturgeon exhibit site fidelity. This work shows that studies seeking to characterize habitat for white sturgeon need to be cognizant of diel migrations and site fidelity. We urge caution in the use of limited fish location data to describe habitats if diel activities and fine-scale movements are not known.

Investigation of pharmaceuticals, personal care products and endocrine disrupting chemicals in a tropical urban catchment and the influence of environmental factors.

PubMed

You, Luhua; Nguyen, Viet Tung; Pal, Amrita; Chen, Huiting; He, Yiliang; Reinhard, Martin; Gin, Karina Yew-Hoong

2015-12-01

Previous studies showed the presence of multiple emerging organic contaminants (EOCs) in urban surface waters of Singapore even though there are no obvious direct wastewater discharges. In this study, we investigated the occurrence and distribution of 17 pharmaceuticals and personal care products (PPCPs) and endocrine disruptive compounds (EDCs) in a tropical urban catchment of Singapore. Monthly samples were collected from a reservoir and its 5 upstream tributaries during a 16-month period. Analysis of samples showed all sites had measurable PPCP and EDC concentrations, with caffeine (33.9-2980 ng/L), salicylic acid (5-838 ng/L), acetaminophen (<4-485.5 ng/L), BPA (<2-919.5 ng/L) and DEET (13-270 ng/L) being the most abundant. Marked differences in concentrations of target analytes between the reservoir and upstream tributaries were observed, and were tentatively attributed to the spatial differences in source inputs, water dilution capacity as well as natural attenuation of EOCs. Significant correlations between EOCs and conductivity, dissolved oxygen, chlorophyll a, turbidity, nutrients and cumulative precipitation were observed. These factors appeared to affect the distribution and attenuation of EOCs, depending on their physicochemical properties. Rainfall also influenced the temporal distribution of caffeine, BPA, triclosan, fipronil and DEET in the reservoir. Ecological risk assessment showed that caffeine, acetaminophen, estrone, BPA, triclosan and fipronil may warrant further survey. In particular, BPA levels exceeded the literature-based Predicted No-Effect Concentration (PNEC) value, highlighting the need for source control and/or water remediation in this urban catchment. Copyright © 2015 Elsevier B.V. All rights reserved.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

A comparison of results from a hydrologic transport model (HSPF) with distributions of sulfate and mercury in a mine-impacted watershed in northeastern Minnesota.

PubMed

Berndt, Michael E; Rutelonis, Wes; Regan, Charles P

2016-10-01

The St. Louis River watershed in northeast Minnesota hosts a major iron mining district that has operated continuously since the 1890s. Concern exists that chemical reduction of sulfate that is released from mines enhances the methylation of mercury in the watershed, leading to increased mercury concentrations in St. Louis River fish. This study tests this idea by simulating the behavior of chemical tracers using a hydrologic flow model (Hydrologic Simulation Program FORTRAN; HSPF) and comparing the results with measured chemistry from several key sites located both upstream and downstream from the mining region. It was found that peaks in measured methylmercury (MeHg), total mercury (THg), dissolved organic carbon (DOC), and dissolved iron (Fe) concentrations correspond to periods in time when modeled recharge was dominated by active groundwater throughout the watershed. This helps explain why the timing and size of the MeHg peaks was nearly the same at sites located just upstream and downstream from the mining region. Both the modeled percentages of mine water and the measured sulfate concentrations were low and computed transit times were short for sites downstream from the mining region at times when measured MeHg reached its peak. Taken together, the data and flow model imply that MeHg is released into groundwater that recharges the river through riparian sediments following periods of elevated summer rainfall. The measured sulfate concentrations at the upstream site reached minimum concentrations of approximately 1 mg/L just as MeHg reached its peak, suggesting that reduction of sulfate from non-point sources exerts an important influence on MeHg concentrations at this site. While mines are the dominant source of sulfate to sites downstream from them, it appears that the background sulfate which is present at only 1-6 mg/L, has the largest influence on MeHg concentrations. This is because point sourced sulfate is transported generally under oxidized conditions and is not flushed through riparian sediments in a gaining stream watershed system. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Streamflow gain/loss in the Republican River basin, Nebraska, March 1989

USGS Publications Warehouse

Johnson, Michaela R.; Stanton, Jennifer S.; Cornwall, James F.; Landon, Matthew K.

2002-01-01

This arc and point data set contains streamflow measurement sites and reaches indicating streamflow gain or loss under base-flow conditions along the Republican River and tributaries in Nebraska during March 21 to 22, 1989 (Boohar and others, 1990). These measurements were made to obtain data on ground-water/surface-water interaction. Flow was visually observed to be zero, was measured, or was estimated at 136 sites. The measurements were made on the main stem of the Republican River and all flowing tributaries that enter the Republican River above Swanson Reservoir and parts of the Frenchman, Red Willow, and Medicine Creek drainages in the Nebraska part of the Republican River Basin. Tributaries were followed upstream until the first road crossing where zero flow was encountered. For selected streams, points of zero flow upstream of the first zero flow site were also checked. Streamflow gain or loss for each stream reach was calculated by subtracting the streamflow values measured at the upstream end of the reach and values for contributing tributaries from the downstream value. The data obtained reflected base-flow conditions suitable for estimating streamflow gains and losses for stream reaches between sites. This digital data set was created by manually plotting locations of streamflow measurements. These points were used to designate stream-reach segments to calculate gain/loss per river mile. Reach segments were created by manually splitting the lines from a 1:250,000 hydrography data set (Soenksen and others, 1999) at every location where the streams were measured. Each stream-reach segment between streamflow-measurement sites was assigned a unique reach number. All other lines in the hydrography data set without reach numbers were omitted. This data set was created to archive the calculated streamflow gains and losses of selected streams in part of the Republican River Basin, Nebraska in March 1989, and make the data available for use with geographic information systems (GIS). If measurement sites are used separately from reaches, the maximum scale of 1:100,000 should not be exceeded. When used in conjunction with the reach segments, the maximum scale should not exceed 1:250,000.

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

PubMed

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

PubMed

Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

2017-11-01

We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

Evidence of autumn spawning in Suwannee River Gulf sturgeon, Acipenser oxyrinchus desotoi (Vladykov, 1955)

USGS Publications Warehouse

Randall, M.T.; Sulak, K.J.

2012-01-01

Evidence of autumn spawning of Gulf sturgeon Acipenser oxyrinchus desotoi in the Suwannee River, Florida, was compiled from multiple investigations between 1986 and 2008. Gulf sturgeon are known from egg collections to spawn in the springtime months following immigration into rivers. Evidence of autumn spawning includes multiple captures of sturgeon in September through early November that were ripe (late-development ova; motile sperm) or exhibited just-spawned characteristics, telemetry of fish that made >175 river kilometer upstream excursions to the spawning grounds in September–October, and the capture of a 9.3 cm TL age-0 Gulf sturgeon on 29 November 2000 (which would have been spawned in late September 2000). Analysis of age-at-length data indicates that ca. 20% of the Suwannee River Gulf sturgeon population may be attributable to autumn spawning. However, with the very low sampling effort expended, eggs or early life stages have not yet been captured in the autumn, which would be the conclusive proof of autumn spawning. More sampling, and sampling at previously unknown sites frequented by acoustic telemetry fish, would be required to find eggs.

Isolation of epidemic poliovirus from sewage during the 1992-3 type 3 outbreak in The Netherlands.

PubMed Central

van der Avoort, H. G.; Reimerink, J. H.; Ras, A.; Mulders, M. N.; van Loon, A. M.

1995-01-01

To examine the extent of wild poliovirus circulation during the 1992-3 epidemic in the Netherlands caused by poliovirus type 3, 269 samples from sewage pipelines at 120 locations were examined for the presence of poliovirus. The epidemic virus strain was found in 23 samples, all from locations inside the risk area which contained communities that refuse vaccination for religious reasons. By sewage investigation, the wildtype virus was shown to be present in the early phase of the epidemic at two locations, one week before patients were reported from that area. The wild type 3 poliovirus was also detected retrospectively in a river water sample collected for other reasons three weeks before notification of the first poliomyelitis case, at a site a few kilometres upstream the home village of this patient. Oral poliovirus vaccine (OPV) virus was found at 28 locations inside or at the border of the risk area. Trivalent OPV was offered to unvaccinated or incompletely-vaccinated persons living in this region as part of the measures to control the epidemic. PMID:7781736

Alkylphenols, Other Endocrine-Active Chemicals, and Fish Responses in Three Streams in Minnesota - Study Design and Data, February-September 2007

USGS Publications Warehouse

Lee, Kathy E.; Schoenfuss, Heiko L.; Jahns, Nathan D.; Brown, Greg K.; Barber, Larry B.

2008-01-01

This report presents the study design and environmental data for an integrated chemical and biological study of three streams (South Fork Crow River, Redwood River, and Grindstone River) that receive wastewater in Minnesota. The objective of the study was to identify distribution patterns of endocrine-active chemicals and other organic chemicals indicative of wastewater, and to identify fish responses in the same streams. Endocrine-active chemicals are a class of chemicals that interfere with the natural regulation of endocrine systems, and an understanding of their distribution in aquatic systems is important so that aquatic organism exposure can be evaluated. This study was a cooperative effort of the U.S. Geological Survey (USGS), the Minnesota Pollution Control Agency, and St. Cloud State University (St. Cloud, Minn.). The USGS collected and analyzed water and quality-assurance samples and measured streamflow during six sampling events in each of three streams. Water samples were collected upstream from and at two successive points downstream from wastewater-treatment plant (WWTP) effluent discharge and from treated effluent from February through September 2007. Bed-sediment samples were collected during one sampling period at each of the stream locations. Water and bed-sediment samples were analyzed for endocrine-active chemicals including alkylphenols, alkylphenol polyethoxylates, and nonylphenol ethoxycarboxlylates (NPECs). Water samples also were analyzed for major ions, nutrients, and organic carbon. In addition, as part of an intensive time-series investigation, the USGS staff collected daily water samples for 8 weeks from the Redwood River near Marshall, Minn., for analyses of total alkylphenols and atrazine. St. Cloud State University staff collected and analyzed fish to determine male fish responses at all water sampling sites and at an additional site near the discharge of wastewater-treatment plant effluent to these streams. Male fish responses included the presence and concentration of vitellogenin in plasma, gonadosomatic indices, and histological characterizations of liver and testes tissue. Hydrologic, chemical and biological characteristics were different among sites. The percentage of streamflow contributed by WWTP effluent (ranging from less than 1 to 79 percent) was greatest at the South Fork Crow River and least at the Grindstone River. WWTP effluent generally contributed the greatest percentage of streamflow during winter and late summer when streamflows were low. A wide variety of chemicals were detected. More chemicals were detected in WWTP effluent samples than in stream samples during most time periods. The most commonly detected chemicals in samples collected monthly and analyzed at the USGS National Research Program Laboratory were 2,6-di-tert-butyl-1,4-benzoquinone, 2,6-di-tert-butyl-4-methylphenol, 3-beta-coprostanol, 4-methylphenol, 4-nonylphenol (NP), 4-tert-octylphenol, bisphenol A, cholesterol, ethylenediaminetetraacetic acid, and triclosan. The chemicals 4-nonylphenolmonoethoxycarboxylate (NP1EC), 4-nonylphenoldiethoxycarboxylate (NP2EC), and 4-nonylphenoltriethoxycarboxylate (NP3EC) also were detected. Excluding nondetections, the sum of NP1EC through NP3EC concentrations ranged from 5.1 to 260 ug/L among all samples. NP was detected in upstream, effluent, and downstream samples in each stream during at least one time period. NP was detected in 49 percent of environmental samples. Excluding nondetections, concentrations of NP ranged from 100 to 880 nanograms per liter among all samples. NP was also detected in more than one-half of the bed-sediment samples. The most commonly detected wastewater indicator chemicals in samples analyzed by schedule 4433 at the USGS National Water Quality Laboratory were 3,4-dichlorophenyl isocyanate, acetyl-hexamethyl-tetrahydronaphthalene, benzophenone, cholesterol, hexahydrohexamethyl-cyclopenta-benzopyran, N,N-diethyl-meta-toluamide, and

Characterization of ROP18 alleles in human toxoplasmosis.

PubMed

Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

2014-04-01

The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

Level II scour analysis for Bridge 41 (ANDOVT00110041) on State Route 11, crossing the Middle Branch Williams River, Andover, Vermont

USGS Publications Warehouse

Wild, Emily C.; Hammond, Robert E.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure ANDOVT00110041 on State Route 11 crossing the Middle Branch Williams River, Andover, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the Green Mountain section of the New England physiographic province in southeastern Vermont. The 12.1-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is grass on the upstream right overbank while the immediate banks have dense woody vegetation. The upstream left overbank and downstream right overbank are brushland. The downstream left overbank is forested. In the study area, the Middle Branch Williams River has an incised, sinuous channel with a slope of approximately 0.018 ft/ft, an average channel top width of 71 ft and an average bank height of 4 ft. The channel bed material ranges from gravel to boulders with a median grain size (D50) of 85.0 mm (0.279 ft). The geomorphic assessment at the time of the Level I and Level II site visit on September 10, 1996, indicated that the reach was laterally unstable due to a cut-bank present on the upstream right bank and a wide channel bar with vegetation in the upstream reach. The State Route 11 crossing of the Middle Branch Williams River is a 46-ft-long, two-lane bridge consisting of a concrete 44-foot tee-beam span (Vermont Agency of Transportation, written communication, March 29, 1995). The opening length of the structure parallel to the bridge face is 42 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 35 degrees to the opening while the opening-skew-toroadway is zero degrees. A scour hole 0.8 ft deeper than the mean thalweg depth was observed along the downstream end of the left abutment and downstream left wingwall during the Level I assessment. Type- 2 stone fill (less than 36 inches diameter) protects the upstream end of the upstream left wingwall, the downstream ends of the downstream left and right wingwalls and the downstream right road embankment. Type-3 stone fill protects the upstream end of the upstream right wingwall and the upstream right bank. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). In addition, the incipient roadway-overtopping discharge was determined and analyzed as another potential worst-case scour scenario. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 2.1 ft. The worst-case contraction scour occurred at the 500-year discharge. Abutment scour ranged from 11.1 to 18.7 ft. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

PubMed

Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

2011-09-26

HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

PubMed Central

2011-01-01

Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

Mobilization and degradation of particulate organic carbon from retrogressive thaw slumps in the western Canadian Arctic

NASA Astrophysics Data System (ADS)

Shakil, S.; Tank, S. E.; Kokelj, S.

2016-12-01

Rapid arctic climate warming has contributed to a significant intensification in the rate and occurrence of thermokarst features which can cause large quantities of frozen organic carbon to suddenly become an active part of the contemporary carbon cycle. Mobilized organic carbon becomes susceptible to bacterial decomposition to CO2, which can then act as a significant positive feedback to climate change. Increasingly, studies are showing dissolved organic carbon (DOC) released from thawing permafrost is highly biodegradable, however, we know little about the biodegradability of permafrost-derived particulate organic carbon (POC). On the Peel Plateau, NWT, Canada, where a warming and wetting climate has intensified the activity of massive retrogressive thaw slumps (RTS), and where some of the Arctic's largest RTS features occur, POC can be more than an order of magnitude greater in streams impacted by an RTS feature when compared to upstream, un-impacted locations, and this mobilization causes POC concentrations to be more than 200 times greater than DOC downstream of slumps. Furthermore, POC released from RTS features can be 6,000 to 13,000 years older than POC in un-impacted streams, indicating a significant mobilization of permafrost carbon in the particulate form. To determine the biodegradability of RTS-released POC in this region, incubations using water samples collected upstream, at, and downstream of RTS sites were conducted during the summer of 2015. Dissolved oxygen measurements were taken 1-2 times per day, and samples for POC and DOC concentration, SUVA254, and bacterial abundance were collected at 0 days, 7 days, and 11 days. Treatments containing a spike of RTS-runoff in filtered water declined in oxygen at a rate as much as 10 times greater than treatments containing filtered DOC controls and unfiltered upstream water indicating that the released of RTS-derived POC substantially increases carbon mineralization in impacted streams. This pool of organic carbon could therefore substantially contribute to the transfer of organic carbon from permafrost soils to the atmospheric carbon pool. Ongoing work is examining the balance between POC decomposition during downstream transport and re-sequestration into streambed sediments.

A novel protein factor is required for use of distal alternative 5' splice sites in vitro.

PubMed Central

Harper, J E; Manley, J L

1991-01-01

Adenovirus E1A pre-mRNA was used as a model to examine alternative 5' splice site selection during in vitro splicing reactions. Strong preference for the downstream 13S 5' splice site over the upstream 12S or 9S 5' splice sites was observed. However, the 12S 5' splice site was used efficiently when a mutant pre-mRNA lacking the 13S 5' splice site was processed, and 12S splicing from this substrate was not reduced by 13S splicing from a separate pre-mRNA, demonstrating that 13S splicing reduced 12S 5' splice site selection through a bona fide cis-competition. DEAE-cellulose chromatography of nuclear extract yielded two fractions with different splicing activities. The bound fraction contained all components required for efficient splicing of simple substrates but was unable to utilize alternative 5' splice sites. In contrast, the flow-through fraction, which by itself was inactive, contained an activity required for alternative splicing and was shown to stimulate 12S and 9S splicing, while reducing 13S splicing, when added to reactions carried out by the bound fraction. Furthermore, the activity, which we have called distal splicing factor (DSF), enhanced utilization of an upstream 5' splice site on a simian virus 40 early pre-mRNA, suggesting that the factor acts in a position-dependent, substrate-independent fashion. Several lines of evidence are presented suggesting that DSF is a non-small nuclear ribonucleoprotein protein. Finally, we describe a functional interaction between DSF and ASF, a protein that enhances use of downstream 5' splice sites. Images PMID:1658620

Regulation of Dpp activity by tissue-specific cleavage of an upstream site within the prodomain

PubMed Central

Sopory, Shailaja; Kwon, Sunjong; Wehrli, Marcel; Christian, Jan L.

2010-01-01

BMP4 is synthesized as an inactive precursor that is cleaved at two sites during maturation: initially at a site (S1) adjacent to the ligand domain, and then at an upstream site (S2) within the prodomain. Cleavage at the second site regulates the stability of mature BMP4 and this in turn influences its signaling intensity and range of action. The Drosophila ortholog of BMP4, Dpp, functions as a long- or short-range signaling molecule in the wing disc or embryonic midgut, respectively but mechanisms that differentially regulate its bioactivity in these tissues have not been explored. In the current studies we demonstrate, by dpp mutant rescue, that cleavage at the S2 site of proDpp is required for development of the wing and leg imaginal discs, whereas cleavage at the S1 site is sufficient to rescue Dpp function in the midgut. Both the S1 and S2 site of proDpp are cleaved in the wing disc, and S2-cleavage is essential to generate sufficient ligand to exceed the threshold for pMAD activation at both short- and long-range in most cells. By contrast, proDpp is cleaved at the S1 site alone in the embryonic mesoderm and this generates sufficient ligand to activate physiological target genes in neighboring cells. These studies provide the first biochemical and genetic evidence that that selective cleavage of the S2 site of proDPP provides a tissue-specific mechanism for regulating Dpp activity, and that differential cleavage can contribute to, but is not an absolute determinant of signaling range. PMID:20659445

Using Soluble Reactive Phosphorus and Ammonia to Identify Point Source Discharge from Large Livestock Facilities

NASA Astrophysics Data System (ADS)

Borrello, M. C.; Scribner, M.; Chessin, K.

2013-12-01

A growing body of research draws attention to the negative environmental impacts on surface water from large livestock facilities. These impacts are mostly in the form of excessive nutrient loading resulting in significantly decreased oxygen levels. Over-application of animal waste on fields as well as direct discharge into surface water from facilities themselves has been identified as the main contributor to the development of hypoxic zones in Lake Erie, Chesapeake Bay and the Gulf of Mexico. Some regulators claim enforcement of water quality laws is problematic because of the nature and pervasiveness of non-point source impacts. Any direct discharge by a facility is a violation of permits governed by the Clean Water Act, unless the facility has special dispensation for discharge. Previous research by the principal author and others has shown runoff and underdrain transport are the main mechanisms by which nutrients enter surface water. This study utilized previous work to determine if the effects of non-point source discharge can be distinguished from direct (point-source) discharge using simple nutrient analysis and dissolved oxygen (DO) parameters. Nutrient and DO parameters were measured from three sites: 1. A stream adjacent to a field receiving manure, upstream of a large livestock facility with a history of direct discharge, 2. The same stream downstream of the facility and 3. A stream in an area relatively unimpacted by large-scale agriculture (control site). Results show that calculating a simple Pearson correlation coefficient (r) of soluble reactive phosphorus (SRP) and ammonia over time as well as temperature and DO, distinguishes non-point source from point source discharge into surface water. The r value for SRP and ammonia for the upstream site was 0.01 while the r value for the downstream site was 0.92. The control site had an r value of 0.20. Likewise, r values were calculated on temperature and DO for each site. High negative correlations between temperature and DO are indicative of a relatively unimpacted stream. Results from this study are commensurate with nutrient correlations and are: r = -0.97 for the upstream site, r = -0.21 for the downstream site and r = -0.89 for the control site. Results from every site tested were statistically significant (p ≤ 0.05). These results support previous studies and demonstrate that the simple analytical techniques mentioned provide an effective means for regulatory agencies and community groups to monitor and identify point source discharge from large livestock facilities.

Determination of Organic and Inorganic Percentages and Mass of Suspended Material at Four Sites in the Illinois River in Northwestern Arkansas and Northeastern Oklahoma, 2005-07

USGS Publications Warehouse

Galloway, Joel M.

2008-01-01

The Illinois River located in northwestern Arkansas and northeastern Oklahoma is influenced by point and nonpoint sources of nutrient enrichment. This has led to increased algal growth within the stream, reducing water clarity. Also, sediment runoff from fields, pastures, construction sites, and other disturbed areas, in addition to frequent streambank failure, has increased sedimentation within the stream and decreased water clarity. A study was conducted by the U.S. Geological Survey in cooperation with the Arkansas Department of Environmental Quality and the U.S. Environmental Protection Agency to characterize the increased turbidity by determining the organic and inorganic composition and mass of suspended material in the Illinois River from August 2005 through July 2007. Water-quality samples were collected at four sites on the Illinois River (listed in downstream order): near Viney Grove, Arkansas; at Savoy, Arkansas; south of Siloam Springs, Arkansas; and near Tahlequah, Oklahoma. In general, turbidity, total suspended solids, suspended-sediment concentration, organic material concentration (measured as volatile suspended solids and ash-free dry mass), and chlorophyll a concentration were the greatest in samples collected from the Illinois River at Savoy and the least in samples from the most upstream Illinois River site (near Viney Grove) and the most downstream site (near Tahlequah) from August 2005 through July 2007. For example, the suspended-sediment concentration at the Illinois River at Savoy had a median of 15 milligrams per liter, and the total suspended solids had a median of 12 milligrams per liter. The Illinois River near Tahlequah had the least suspended-sediment concentration with a median of 10 milligrams per liter and the least total suspended solids with a median of 6 milligrams per liter. The turbidity, total suspended solids, suspended-sediment concentration, organic material concentration, and chlorophyll a concentration in samples collected during high-flow events were greater than in samples collected during base-flow conditions at the Illinois River at Savoy, south of Siloam Springs, and near Tahlequah. For example, the median turbidity for the Illinois River at Savoy was 3 nephelometric turbidity ratio units during base-flow conditions and 52 nephelometric turbidity ratio units during high-flow conditions. Organic material in the Illinois River generally composed between 13 and 47 percent of the total suspended material in samples collected from August 2005 through July 2007. Therefore, most of the suspended material in samples collected from the sites was inorganic material. Overall, the highest percentage of organic material was found at the Illinois River near Viney Grove and at the Illinois River near Tahlequah. The Illinois River south of Siloam Springs had the lowest percentage of organic material among the four sites. In general, the percentage of organic material was greater in samples collected during base-flow conditions compared to samples collected during high-flow conditions. The mean seasonal concentrations and percentages of organic material were the least in the fall (September through November) in samples collected from August 2005 to July 2007 from the four Illinois River sites, while the greatest concentrations and percentages of organic material occurred at various times of the year depending on the site. The greatest concentrations of organic material occurred in the summer (June through August) in samples from sites on the Illinois River near Viney Grove, at Savoy and south of Siloam Springs, but in the spring (March through May) in samples from the Illinois River near Tahlequah. The greatest percentages of organic material (least percentages of inorganic material) occurred in the summer in samples from the site near Viney Grove, the winter and summer at the site at Savoy, in the spring, fall, and winter (December through February) at the site south of Siloam Springs, an

Contact sheet recording with a self-acting negative air bearing

NASA Technical Reports Server (NTRS)

Muftu , Sinan (Inventor); Hinteregger, Hans F (Inventor)

2000-01-01

A flat head and a tape transport arrangement impart a wrap angle to the tape at the upstream corner of the head. The wrap angle, corner sharpness and tape stiffness are sufficient to cause a moving tape to form a hollow bump at the upstream corner, thereby creating a hollow into which entrained air can expand, causing a subambient pressure within and downstream of the bump. This pressure keeps the tape in contact with the head. It is created without the need for a groove or complex pressure relief slot(s). No contact pressure arises at the signal exchange site due to media wrap. The highest contact pressures are developed at a wrapped upstream corner. For a tape drive, traveling in both forward and reverse, the wrap can be at both the upstream and downstream (which is the reverse upstream) corners. Heads that are not flat can also be used, if the wrap angle relative to a main surface is sufficient and not too large. The wrapped head can also be used with rotating media, such as disks (floppy and hard) and rotating heads, such as helical wound heads for video recording. Multiple flat tape bearing surfaces can be separated by grooves and/or angles. Each flat can carry heads along one or more gap lines. Multiple adjacent narrow tracks can thus be written for extreme high track density recording.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Urbanization and the Level of Microplastic Ingestion by Fish: A Comparison of Freshwater Sunfish (Centrarchidae) from the Brazos River watershed, and Pinfish (Sparidae), from the Brazos Estuary and Inshore Marine Sites, Texas, USA

NASA Astrophysics Data System (ADS)

Rieper, K. B.; Peters, C. A.; Bratton, S. P.

2016-02-01

While previous research has documented ingestion of macro- and microplastics by aquatic fauna in both freshwater and marine ecosystems, relatively little is known of the environmental and ecological factors influencing the entry and diffusion of plastics and artificial polymers into aquatic foodwebs. Microplastics are defined as 50 μm to 5 mm in length. This study utilized stomach content analysis to compare the level of microplastic artificial polymer ingestion for fish collected from the Brazos River watershed, Brazos estuary, and inshore coastal waters of Texas, USA, in areas with varying levels of urbanization. We collected 318 bluegill (Lepomis macrochirus) and 118 longear sunfish (Lepomis megalotis) at 14 freshwater locales, and 11 samples of 298 pinfish (Lagodon rhomboides) at 6 saltwater locales. Sunfish averaged 12.6 cm in length, and pinfish averaged 14.9 cm. Sunfish averaged .807 microplastics per fish, and pinfish averaged 1.09. The maximum percentage for pinfish with microplastics present per sample (frequency) was 77%, compared to 75% for sunfish. Mean frequencies per sample were also similar: 45% for sunfish and 47% for pinfish. The Brazos River collections, however, had a greater percentage with frequencies of <.30 (42%) for sunfish, versus 9% for pinfish. Sample sites in the center of urbanized zones, including downtown Waco and Galveston, TX, had the greatest frequencies of ingestion, while sites upstream of Waco, TX, had the least. For pinfish, the mean stomach weight per sample was significantly positively correlated (p=.01) to both the percent of individuals ingesting microplastics (cc=.742) and the mean number of plastic particles ingested per fish (cc=.697). The majority of the microplastics were thread shaped, with blue and grey the dominant colors. Comparison with presence of natural food items suggests microplastic ingestion is predominantly incidental for these sentinel fish species.

Risk Assessment of Heavy Metals in Surface Sediments from the Yanghe River, China

PubMed Central

Li, Jing

2014-01-01

The magnitude and ecological relevance of metal pollution from the upstream of water sources after emergency pollution events was investigated by applying a set of complementary sediment quality assessment methods: (1) geochemical assessment based on background value (the geoaccumulation index); (2) comparisons with sediment quality guidelines (SQGs); (3) an evaluation of the combined pollution according to the risk index (RI); and (4) investigation of the chemical patterns of target heavy metals (Cd, Zn, Cr, Pb, Ni). The geoaccumulation indices (Igeo) suggested that the magnitude of heavy metal pollution of the sediment of Yanghe River decreased in the order of Cd > Zn > Pb > Cr > Ni. Risk analysis also suggested that Cd and Zn concentrations were sufficiently elevated as to cause adverse biological effects in this study area. According to the RI values, 27% of total sampling sites showed considerable ecological risk for the water body, and 53% of total sampling sites showed very high ecological risk for the waterbody. Sediment-bound Cd was found to be predominantly associated with the exchangeable phase of the sediment (25%–68%), while Cr, Ni, Zn and Pb showed the strongest association with the residual fractions (60%–92%, 53%–67%, 24%–85% and 35%–67%, respectively). PMID:25464136

Clustering and estimating fish fingerling abundance in a tidal river in close ploximity to a thermal power plant in Southern Thailand

NASA Astrophysics Data System (ADS)

Chesoh, S.; Lim, A.; Luangthuvapranit, C.

2018-04-01

This study aimed to cluster and to quantify the wild-caught fingerlings nearby thermal power plant. Samples were monthly collected by bongo nets from four upstream sites of the Na Thap tidal river in Thailand from 2008 to 2013. Each caught species was identified, counted and calculated density in term of individuals per 1,000 cubic meters. A total of 45 aquatic animal fingerlings was commonly trapped in the average density of 2,652 individuals per 1,000 cubic meters of water volume (1,235–4,570). The results of factor analysis revealed that factor 1 was represented by the largest group of freshwater fish species, factors 2 represented a medium-sized group of mesohaline species, factor 3 represented several brackish species and factor 4 was a few euryhaline species. All four factor reached maximum levels during May to October. Total average numbers of fish fingerling caught at the outflow showed greater than those of other sampling sites. The impact of heated pollution from power plant effluents did not clearly detected. Overall water quality according the Thailand Surface Water Quality Standards Coastal tidal periodic and seasonal runoff phenomena exhibit influentially factors. Continuous ecological monitoring is strongly recommended.

Polybrominated diphenyl ether metabolism in field collected fish from the Gila River, Arizona, USA-Levels, possible sources, and patterns

USGS Publications Warehouse

Echols, Kathy R.; Peterman, Paul H.; Hinck, Jo Ellen; Orazio, Carl E.

2013-01-01

Polybrominated diphenyl ethers (PBDEs) were determined in fish collected from the Gila River, Arizona, a tributary of the Colorado River in the lower part of the Colorado River Basin. Fish samples were collected at sites on the Gila River downstream from Hayden, Phoenix, and Arlington, Arizona in late summer 2003. The Gila River is ephemeral upstream of the Phoenix urban area due to dams and irrigation projects and has limited perennial flow downstream of Phoenix due to wastewater and irrigation return flows. Fifty PBDE congeners were analyzed by high resolution gas chromatography/high resolution mass spectrometry using labeled surrogate standards in composite samples of male and female common carp (Cyrpinus carpio), largemouth bass (Micropterus salmoides) and channel catfish (Ictalurus punctatus). The predominant PBDE congeners detected and quantified were 47, 100, 153, 49, 28, and 17. Concentrations of total PBDEs in these fish ranged from 1.4 to 12700 ng g-1 wet weight, which are some of the highest concentrations reported in fish from the United States. Differences in metabolism of several PBDE congeners by carp is clear at the Phoenix site; congeners with at least one ring of 2,4,5-substitution are preferentially metabolized as are congeners with 2,3,4-substitution.

Sediment characteristics in the San Antonio River Basin downstream from San Antonio, Texas, and at a site on the Guadalupe River downstream from the San Antonio River Basin, 1966-2013

USGS Publications Warehouse

Crow, Cassi L.; Banta, J. Ryan; Opsahl, Stephen P.

2014-01-01

San Antonio and surrounding municipalities in Bexar County, Texas, are in a rapidly urbanizing region in the San Antonio River Basin. The U.S. Geological Survey, in cooperation with the San Antonio River Authority and the Texas Water Development Board, compiled historical sediment data collected between 1996 and 2004 and collected suspended-sediment and bedload samples over a range of hydrologic conditions in the San Antonio River Basin downstream from San Antonio, Tex., and at a site on the Guadalupe River downstream from the San Antonio River Basin during 2011–13. In the suspended-sediment samples collected during 2011–13, an average of about 94 percent of the particles was less than 0.0625 millimeter (silt and clay sized particles); the 50 samples for which a complete sediment-size analysis was performed indicated that an average of about 69 percent of the particles was less than 0.002 millimeter. In the bedload samples collected during 2011–13, an average of 51 percent of sediment particles was sand-sized particles in the 0.25–0.5 millimeter-size range. In general, the loads calculated from the samples indicated that bedload typically composed less than 1 percent of the total sediment load. A least-squares log-linear regression was developed between suspended-sediment concentration and instantaneous streamflow and was used to estimate daily mean suspended-sediment loads based on daily mean streamflow. The daily mean suspended-sediment loads computed for each of the sites indicated that during 2011–12, the majority of the suspended-sediment loads originated upstream from the streamflow-gaging station on the San Antonio River near Elmendorf, Tex. A linear regression relation was developed between turbidity and suspended-sediment concentration data collected at the San Antonio River near Elmendorf site because the high-resolution data can facilitate understanding of the complex suspended-sediment dynamics over time and throughout the river basin.

Heavy metal contamination and risk assessment in water, paddy soil, and rice around an electroplating plant.

PubMed

Liu, Jie; Zhang, Xue-Hong; Tran, Henry; Wang, Dun-Qiu; Zhu, Yi-Nian

2011-11-01

The objective of this paper is to assess the impact of long-term electroplating industrial activities on heavy metal contamination in agricultural soils and potential health risks for local residents. Water, soil, and rice samples were collected from sites upstream (control) and downstream of the electroplating wastewater outlet. The concentrations of heavy metals were determined by an atomic absorption spectrophotometer. Fractionation and risk assessment code (RAC) were used to evaluate the environmental risks of heavy metals in soils. The health risk index (HRI) and hazard index (HI) were calculated to assess potential health risks to local populations through rice consumption. Hazardous levels of Cu, Cr, and Ni were observed in water and paddy soils at sites near the plant. According to the RAC analysis, the soils showed a high risk for Ni and a medium risk for Cu and Cr at certain sites. The rice samples were primarily contaminated with Ni, followed by Cr and Cu. HRI values >1 were not found for any heavy metal. However, HI values for adults and children were 2.075 and 1.808, respectively. Water, paddy soil, and rice from the studied area have been contaminated by Cu, Cr, and Ni. The contamination of these elements is related to the electroplating wastewater. Although no single metal poses health risks for local residents through rice consumption, the combination of several metals may threaten the health of local residents. Cu and Ni are the key components contributing to the potential health risks.

Spatial characterization, risk assessment, and statistical source identification of the dissolved trace elements in the Ganjiang River-feeding tributary of the Poyang Lake, China.

PubMed

Zhang, Hua; Jiang, Yinghui; Wang, Min; Wang, Peng; Shi, Guangxun; Ding, Mingjun

2017-01-01

Surface water samples were collected from 20 sampling sites throughout the Ganjiang River during pre-monsoon, monsoon, and post-monsoon seasons, and the concentrations of dissolved trace elements were determined by inductively coupled plasma-mass spectrometry (ICP-MS) for the spatial and seasonal variations, risk assessment, source identification, and categorization for risk area. The result demonstrated that concentrations of the elements exhibited significant seasonality. The high total element concentrations were detected at sites close to the intensive mining and urban activities. The concentrations of the elements were under the permissible limits as prescribed by related standards with a few exceptions. The most of heavy metal pollution index (HPI) values were lower than the critical index limit, indicating the basically clean water used as habitat for aquatic life. As was identified as the priority pollutant of non-carcinogenic and carcinogenic concerns, and the inhabitants ingesting the surface water at particular site might be subjected to the integrated health risks for exposure to the mixed trace elements. Multivariate statistical analyses confirmed that Zn, As, Cd, and Tl were derived from mining and urban activities; V, Cd, and Pb exhibited mixed origin; and Co, Ni, and Cu mainly resulted from natural processes. Three categorized risk areas corresponded to high, moderate, and low risks, respectively. As a whole, the upstream of the Ganjiang River was identified as the high-risk area relatively.

Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

PubMed Central

Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

2017-01-01

In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

1988 Hanford riverbank springs characterization report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dirkes, R.L.

1990-12-01

This reports presents the results of a special study undertaken to characterize the riverbank springs (i.e., ground-water seepage) entering the Columbia River along the Hanford Site. Radiological and nonradiological analyses were performed. River water samples were also analyzed from upstream and downstream of the Site as well as from the immediate vicinity of the springs. In addition, irrigation return water and spring water entering the river along the shoreline opposite Hanford were analyzed. Hanford-origin contaminants were detected in spring water entering the Columbia River along the Hanford Site. The type and concentrations of contaminants in the spring water were similarmore » to those known to exist in the ground water near the river. The location and extent of the contaminated discharges compared favorably with recent ground-water reports and predictions. Spring discharge volumes remain very small relative to the flow of the Columbia. Downstream river sampling demonstrates the impact of ground-water discharges to be minimal, and negligible in most cases. Radionuclide concentrations were below US Department of Energy Derived Concentration Guides (DCGs) with the exception {sup 90}Sr near the 100-N Area. Tritium, while below the DCG, was detected at concentrations above the US Environmental Protection Agency drinking water standards in several springs. All other radionuclide concentrations were below drinking water standards. Nonradiological contaminants were generally undetectable in the spring water. River water contaminant concentrations, outside of the immediate discharge zones, were below drinking water standards in all cases. 19 refs., 5 figs., 12 tabs.« less

Correction of Anisokinetic Sampling Errors.

ERIC Educational Resources Information Center

Nelson, William G.

Gas flow patterns at a sampling nozzle are described in this presentation for the 12th Conference on Methods in Air Pollution and Industrial Hygiene Studies, University of Southern California, April, 1971. Three situations for sampling velocity are illustrated and analyzed, where the flow upstream of a sampling probe is: (1) equal to free stream…

Field Evaluation of Detection-Control System

DOT National Transportation Integrated Search

2015-04-01

In this research, a field evaluation of the Detection-Control System (D-CS) was conducted at eight sites located in four States. D-CS is similar to a traditional advance detector system in that it uses information from detectors located upstream of t...

Stream channel responses and soil loss at off-highway vehicle stream crossings in the Ouachita National Forest

Treesearch

Daniel A. Marion; Jonathan D. Phillips; Chad Yocum; Stephanie H. Mehlhope

2014-01-01

This study investigates the geomorphic effects of ford-type stream crossings in an off-highway vehicle (OHV) trail complex in the Ouachita National Forest, Arkansas. At a total of 15 crossing sites, we used a disturbed vs. undisturbed study design to assess soil truncation and an upstream vs. downstream design to assess in-channel effects. The 15 sites ranged from OHV...

Migration Patterns, Densities, and Growth of Neritina punctulata Snails in Rio Espiritu Santo and Rio Mameyes, Northeastern Puerto Rico.

Treesearch

MARK PYRON; ALAN P. COVICH

2003-01-01

Snail size-frequency distributions in Rios Espiritu Santo and Mameyes, which drain the Luquillo Experimental Forest, Puerto Rico, showed that Neritina punctulata with shell lengths greater than 30 mm were the most abundant size class at upstream sites. The highest densities for all size classes were at the downstream sites. Growth rates were 0.015 mm/day for a large...

Prioritizing conservation activities using reserve site selection methods and population viability analysis.

PubMed

Newbold, Stephen C; Siikamäki, Juha

2009-10-01

In recent years a large literature on reserve site selection (RSS) has developed at the interface between ecology, operations research, and environmental economics. Reserve site selection models use numerical optimization techniques to select sites for a network of nature reserves for protecting biodiversity. In this paper, we develop a population viability analysis (PVA) model for salmon and incorporate it into an RSS framework for prioritizing conservation activities in upstream watersheds. We use spawner return data for three closely related salmon stocks in the upper Columbia River basin and estimates of the economic costs of watershed protection from NOAA to illustrate the framework. We compare the relative cost-effectiveness of five alternative watershed prioritization methods, based on various combinations of biological and economic information. Prioritization based on biological benefit-economic cost comparisons and accounting for spatial interdependencies among watersheds substantially outperforms other more heuristic methods. When using this best-performing prioritization method, spending 10% of the cost of protecting all upstream watersheds yields 79% of the biological benefits (increase in stock persistence) from protecting all watersheds, compared to between 20% and 64% for the alternative methods. We also find that prioritization based on either costs or benefits alone can lead to severe reductions in cost-effectiveness.

Lateral movement and stability of channel banks near four highway crossings in southwestern Mississippi

USGS Publications Warehouse

Turnipseed, D. Phil

1994-01-01

Channel meandering in alluvial streams has caused localized channel instability that has resulted in bridge failure and loss of human life in Mississippi. The U.S. Geological Survey, in coopera- tion with the Mississippi Department of Transpor- tation, conducted a study to develop a better methodology for defining and estimating channel meandering. For this report, river reaches near four bridge sites with current lateral movement of channel banks were selected for study. The lateral movement of channel banks was studied by mapping meanders from aerial photographs taken at various times, evaluating available discharge measurements, and measuring existing channel geometry and soil strength properties at these sites. Rapid, unre- stricted meander cuts and sandy banks are charac- teristic of the sites. Lateral movement was signi- ficant upstream from all four sites, and only one bridge site did not have significant lateral channel-bank movement during the study period. The development of cutbanks and localized channel-bank erosion have caused unstable conditions at three of the sites. Maps of tops of channel indicate significant lateral movement of channel banks upstream and downstream of all four sites and near the bridges at three of four sites. No significant movement occurred at the U.S. Highway 98 crossing of the Bogue Chitto near Tylertown from 1941 to 1991 despite large floods in 1983 and 1990. Slope stability analyses indicated this site to be marginally stable. The maximum lateral movement indicated from maps of tops of channel banks was 680 feet of northward movement of the right (north) bank of the Homochitto River near the State Highway 33 crossing at Rosetta from 1941 to 1983.

Patterns of Larval Sucker Emigration from the Sprague and Lower Williamson Rivers of the Upper Klamath Basin, Oregon, Prior to the Removal of Chiloquin Dam - 2006 Annual Report

USGS Publications Warehouse

Ellsworth, Craig M.; Tyler, Torrey J.; VanderKooi, Scott P.; Markle, Douglas F.

2009-01-01

In 2006, we collected larval Lost River sucker Deltistes luxatus (LRS), shortnose sucker Chasmistes brevirostris (SNS), and Klamath largescale sucker Catostomus snyderi (KLS) emigrating from spawning areas in the Williamson and Sprague Rivers. This work is part of a multi-year effort to characterize the relative abundance, drift timing, and length frequencies of larval suckers in this watershed prior to the removal of Chiloquin Dam on the lower Sprague River. Additional larval drift samples were collected from the Fremont Bridge on Lakeshore Drive on the south end of Upper Klamath Lake near its outlet to the Link River. Because of difficulties in distinguishing KLS larvae from SNS larvae, individuals identified as either of these two species were grouped together and reported as KLS-SNS in this report. We found that larval densities varied by site with the highest densities being collected at the most upstream site on the Sprague River at river kilometer (rkm) 108.0 near Beatty, Oregon (Beatty), and the most downstream sites near Chiloquin, Oregon; one site on the Sprague River at rkm 0.7 (Chiloquin) and the other site on the Williamson River at rkm 7.4 (Williamson). Larval catches were relatively small and sporadic at two other sites on the Sprague River located between Chiloquin and Beatty (Power Station at rkm 9.5 and Lone Pine at rkm 52.7) and one site on the Sycan River at rkm 4.7. Most larvae (79 percent) collected in 2006 were identified as LRS. More larvae and eggs were collected at Chiloquin than at any other site. The seasonal timing of larval drift varied by location; larvae generally were captured earlier at upstream sites than at downstream sites. Cumulative catch percentages of drifting larvae suggest that larval LRS emigrated earlier than KLS-SNS larvae at every site. Drift of LRS larvae at Beatty began 3 to 4 weeks earlier than at Chiloquin or Williamson. At Chiloquin, peak larval catches occurred 3 and 5 weeks after peak egg catches. The daily peak in larval drift at Chiloquin occurred approximately 1.5 to 2.0 hours after sunset. Nightly peak larval drift varied by location; larvae were captured earlier in the evening at sites closer to known spawning locations than sites farther away from these areas. The highest numerical catches of sucker-sized eggs were at Chiloquin indicating that this site is in close proximity to a spawning area. Numerical catches of older, more developed larval and juvenile suckers also were highest at Chiloquin. This may be due to the turbulent nature of this site, which could have swept larger fish into the drift. Proportional catches of older, more developed larval and juvenile suckers were highest at Sycan, Lone Pine, Power Station, and Fremont Bridge. This indicates these sites are located nearer to sucker nursery areas rather than spawning areas. Very few larval LRS were collected at Fremont Bridge at the south end of Upper Klamath Lake. Larval KLS-SNS densities at Fremont Bridge were the third highest of the seven sampling sites. Peak drift of larval KLS-SNS at Fremont Bridge occurred the week after peak drift of larval KLS-SNS at Williamson. Although inter-annual variation continues to appear in the larval drift data, our results continue to show consistent patterns of larval emigration in the drainage basin. In combination with data collected from the spawning movements and destinations of radio-tagged and PIT-tagged adult suckers, this larval drift data will provide a baseline standard by which to determine the effects of dam removal on the spawning distribution of endangered Klamath Basin suckers in the Sprague River.

Water quality, sources of nitrate, and chemical loadings in the Geronimo Creek and Plum Creek watersheds, south-central Texas, April 2015–March 2016

USGS Publications Warehouse

Lambert, Rebecca B.; Opsahl, Stephen P.; Musgrove, MaryLynn

2017-12-22

Located in south-central Texas, the Geronimo Creek and Plum Creek watersheds have long been characterized by elevated nitrate concentrations. From April 2015 through March 2016, an assessment was done by the U.S. Geological Survey, in cooperation with the Guadalupe-Blanco River Authority and the Texas State Soil and Water Conservation Board, to characterize nitrate concentrations and to document possible sources of elevated nitrate in these two watersheds. Water-quality samples were collected from stream, spring, and groundwater sites distributed across the two watersheds, along with precipitation samples and wastewater treatment plant (WWTP) effluent samples from the Plum Creek watershed, to characterize endmember concentrations and isotopic compositions from April 2015 through March 2016. Stream, spring, and groundwater samples from both watersheds were collected during four synoptic sampling events to characterize spatial and temporal variations in water quality and chemical loadings. Water-quality and -quantity data from the WWTPs and stream discharge data also were considered. Samples were analyzed for major ions, selected trace elements, nutrients, and stable isotopes of water and nitrate.The dominant land use in both watersheds is agriculture (cultivated crops, rangeland, and grassland and pasture). The upper part of the Plum Creek watershed is more highly urbanized and has five major WWTPs; numerous smaller permitted wastewater outfalls are concentrated in the upper and central parts of the Plum Creek watershed. The Geronimo Creek watershed, in contrast, has no WWTPs upstream from or near the sampling sites.Results indicate that water quality in the Geronimo Creek watershed, which was evaluated only during base-flow conditions, is dominated by groundwater, which discharges to the stream by numerous springs at various locations. Nitrate isotope values for most Geronimo Creek samples were similar, which indicates that they likely have a common source (or sources) of nitrate. Nitrate sources in the Geronimo Creek watershed include a predominance of nitrate from fertilizer applications, as well as a contribution from septic systems. Additional nitrate loading from these sources is ongoing. Chemical loadings of dissolved solids, chloride, and sulfate varied little among sampling events and were low at most sites because of low streamflow.In contrast to the Geronimo Creek watershed, nitrate sources in the Plum Creek watershed are dominated by effluent discharge from the major WWTPs in the upper and central parts of the watershed. Results indicate that discharge from these WWTPs accounts for the majority of base flow in the watershed. Nitrate concentrations in Plum Creek were dependent on flow conditions, with the highest concentrations measured at lower flows, when flow is dominated by WWTP effluent discharge. In addition to WWTP effluent discharge, the Plum Creek watershed, similar to the Geronimo Creek watershed, also is affected by historical and current loading of nitrate from fertilizer applications and from septic systems in the watershed. Chemical loadings of dissolved solids, chloride, sulfate, and nitrate in Plum Creek at lower flow conditions are highest at the upstream sites and decrease downstream as distance from the WWTPs increases, which is consistent with WWTP effluent as an important control on water quality. Under higher flow conditions, however, nitrate loads to Plum Creek increased by about a factor of three. These higher nitrate loads cannot be accounted for by WWTP effluent discharge from the five major WWTPs in the watershed. This additional loading indicates that nitrate is exported from the northeastern part of the watershed. In the lower part of the Plum Creek watershed, higher concentrations of dissolved solids, chloride, and sulfate occur, which might be affected by produced water associated with oil and gas exploration, or mixing with saline groundwater.

Asymmetric connectivity of spawning aggregations of a commercially important marine fish using a multidisciplinary approach

PubMed Central

Jackson, Alexis; Marinone, Silvio Guido; Erisman, Brad; Moreno-Baez, Marcia; Girón-Nava, Alfredo; Pfister, Tad; Aburto-Oropeza, Octavio; Torre, Jorge

2014-01-01

Understanding patterns of larval dispersal is key in determining whether no-take marine reserves are self-sustaining, what will be protected inside reserves and where the benefits of reserves will be observed. We followed a multidisciplinary approach that merged detailed descriptions of fishing zones and spawning time at 17 sites distributed in the Midriff Island region of the Gulf of California with a biophysical oceanographic model that simulated larval transport at Pelagic Larval Duration (PLD) 14, 21 and 28 days for the most common and targeted predatory reef fish, (leopard grouper Mycteroperca rosacea). We tested the hypothesis that source–sink larval metapopulation dynamics describing the direction and frequency of larval dispersal according to an oceanographic model can help to explain empirical genetic data. We described modeled metapopulation dynamics using graph theory and employed empirical sequence data from a subset of 11 sites at two mitochondrial genes to verify the model predictions based on patterns of genetic diversity within sites and genetic structure between sites. We employed a population graph describing a network of genetic relationships among sites and contrasted it against modeled networks. While our results failed to explain genetic diversity within sites, they confirmed that ocean models summarized via graph and adjacency distances over modeled networks can explain seemingly chaotic patterns of genetic structure between sites. Empirical and modeled networks showed significant similarities in the clustering coefficients of each site and adjacency matrices between sites. Most of the connectivity patterns observed towards downstream sites (Sonora coast) were strictly asymmetric, while those between upstream sites (Baja and the Midriffs) were symmetric. The best-supported gene flow model and analyses of modularity of the modeled networks confirmed a pulse of larvae from the Baja Peninsula, across the Midriff Island region and towards the Sonoran coastline that acts like a larval sink, in agreement with the cyclonic gyre (anti-clockwise) present at the peak of spawning (May–June). Our approach provided a mechanistic explanation of the location of fishing zones: most of the largest areas where fishing takes place seem to be sustained simultaneously by high levels of local retention, contribution of larvae from upstream sites and oceanographic patterns that concentrate larval density from all over the region. The general asymmetry in marine connectivity observed highlights that benefits from reserves are biased towards particular directions, that no-take areas need to be located upstream of targeted fishing zones, and that some fishing localities might not directly benefit from avoiding fishing within reserves located adjacent to their communities. We discuss the implications of marine connectivity for the current network of marine protected areas and no-take zones, and identify ways of improving it. PMID:25165626

Are mangroves as tough as a seawall? Flow-vegetation interaction in a living shoreline restoration

NASA Astrophysics Data System (ADS)

Kibler, K. M.; Kitsikoudis, V.; Spiering, D. W.

2017-12-01

This study aims to assess the impact of an established living shoreline restoration on near-shore hydraulics, shoreline slope, and sediment texture and organic matter content. We collected data from three 100 m shoreline sites within an estuarine lagoon in Canaveral National Seashore: one restored; one that had been stabilized by a seawall; and one in a reference condition stabilized by mature mangrove vegetation. The living shoreline site was restored five years prior with a breakwater of oyster shell bags, emergent marsh grasses (Spartina alterniflora), and mangroves (Rhizophora mangle and Avicennia germinans). We sampled water depth and incoming velocity profiles of the full water column at 2 Hz using a 2 MHz Acoustic Doppler Current Profiler (ADCP, Nortek), stationed down-looking, approximately 10 m offshore. A 2 - 3 cm velocity profile above the bed was sampled on the shoreline at 100 Hz, using a Nortek Vectrino profiler. In restored and reference sites, the onshore probe was placed within vegetation. We surveyed vegetation upstream of the probe for species and diameter at water level. Windspeed and direction were collected 2 m above the water surface. Shorelines were surveyed in transects using GPS survey equipment. Five sediment cores were collected to 20 cm depth from both onshore and offshore of each site. Individual cores were processed for loss on ignition before being pooled by site for analysis of grain size distribution. While incoming velocity profiles were similar between sites, hydraulic conditions onshore within the vegetated sites deviated from the seawall site, which was devoid of vegetation. Offshore to onshore gradients in shear stress, mean velocity, and turbulent kinetic energy differed widely between sites, despite similar wind and tidal conditions. Sediment grain sizes were finer and contained more organic matter in the restored and reference sites than in the seawall site. Profiles of the restored and seawall sites were similar, though the reference site had a more complex bathymetry. Variable hydraulic patterns observed at restored and reference sites may attribute to differences in dominant vegetation-water interactions. Interactions at the reference site were characterized by flow between mangrove prop roots while the restored site consisted mainly of Spartina leaves.

Analysis of selected water-quality data for surface water in St. Tammany Parish, Louisiana, April-August 1995

USGS Publications Warehouse

Demcheck, Dennis K.

1996-01-01

Physical and chemical-related properties, concentrations of chemical constituents, which included major ions and nutrients, and concentrations of fecal-coliform bacteria were determined for 17 sites on 11 streams in St. Tammany Parish, Louisiana, during the period April-August 1995. The streams were sampled to assess the effects of different streamflow conditions on the concentrations of water-quality constituents. The streams included in the study were Tchefuncte River, Bogue Falaya, Abita River, Bayou Chinchouba, Bayou Castine, Cane Bayou, Bayou Lacombe, Bayou Liberty, Bayou Bonfouca, Bogue Chitto, and West Pearl River. Water-quality samples were collected under several hydrologic conditions. These conditions included a period of wet weather and sustained high river stages; a period of local storms several days apart and river stages typical of that situation; and a period of dry weather and low river stages. The concentrations of inorganic chemical constituents in water from the upstream sites generally were low. Concentrations from the downstream sites varied and were higher. Nutrient and fecal-coliform bacteria concentrations varied and indicated that degraded water-quality conditions that typically occur during storms persisted less than 1-3 days. In general, the larger the drainage basin, the longer it takes for the stream to recover. Fecal-coliform concen- trations reflected the effects of small, isolated storms in the area. Bayou Castine, sampled immediately after a storm, had a fecal-coliform concentration of 26,000 colonies per 100 milliliters. The stream was resampled 24 hours later, and the fecal-coliform concentration had decreased to 1,700 colonies per 100 milliliters. This is an indication of the rapid water-quality changes that typically occur in small streams.

Monitoring design for assessing compliance with numeric nutrient standards for rivers and streams using geospatial variables.

PubMed

Williams, Rachel E; Arabi, Mazdak; Loftis, Jim; Elmund, G Keith

2014-09-01

Implementation of numeric nutrient standards in Colorado has prompted a need for greater understanding of human impacts on ambient nutrient levels. This study explored the variability of annual nutrient concentrations due to upstream anthropogenic influences and developed a mathematical expression for the number of samples required to estimate median concentrations for standard compliance. A procedure grounded in statistical hypothesis testing was developed to estimate the number of annual samples required at monitoring locations while taking into account the difference between the median concentrations and the water quality standard for a lognormal population. For the Cache La Poudre River in northern Colorado, the relationship between the median and standard deviation of total N (TN) and total P (TP) concentrations and the upstream point and nonpoint concentrations and general hydrologic descriptors was explored using multiple linear regression models. Very strong relationships were evident between the upstream anthropogenic influences and annual medians for TN and TP ( > 0.85, < 0.001) and corresponding standard deviations ( > 0.7, < 0.001). Sample sizes required to demonstrate (non)compliance with the standard depend on the measured water quality conditions. When the median concentration differs from the standard by >20%, few samples are needed to reach a 95% confidence level. When the median is within 20% of the corresponding water quality standard, however, the required sample size increases rapidly, and hundreds of samples may be required. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

Level II scour analysis for Bridge 4 (DANVTH00010004) on Town Highway 1, crossing Joes Brook, Danville, Vermont

USGS Publications Warehouse

Flynn, Robert H.; Boehmler, Erick M.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure DANVTH00010004 on Town Highway 1 crossing Joes Brook, Danville, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the New England Upland section of the New England physiographic province in northeastern Vermont. The 42.5-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is pasture along the upstream and downstream left banks with trees and brush along the immediate banks. The upstream and downstream right banks are forested. In the study area, Joes Brook has an incised, sinuous channel with a slope of approximately 0.02 ft/ft, an average channel top width of 68 ft and an average bank height of 5 ft. The channel bed material ranges from gravel to bedrock with a median grain size (D50) of 80.1 mm (0.263 ft). The geomorphic assessment at the time of the Level I and Level II site visit on August 22, 1995, indicated that the reach was stable. The Town Highway 1 crossing of Joes Brook is a 49-ft-long, two-lane bridge consisting of one 45-foot steel-beam span (Vermont Agency of Transportation, written communication, March 17, 1995). The opening length of the structure parallel to the bridge face is 45 ft.The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 15 degrees to the opening and the computed opening-skew-to-roadway is 15 degrees. A scour hole 1.0 ft deeper than the mean thalweg depth was observed along the right abutment during the Level I assessment. The scour hole also extends upstream and downstream of the bridge, along the right side of the channel. The scour protection measures at the site include type-2 stone fill (less than 36 inches diameter) at the upstream end of the upstream left wingwall and along the entire base length of the downstream right wingwall. Type-3 stone fill (less than 48 inches diameter) is along the entire base length of the upstream right wingwall and type-5 protection (stone block wall) is along the upstream right bank. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995) for the 100- and 500-year discharges. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows was computed to be zero ft. Abutment scour ranged from 11.7 to 13.0 ft along the right abutment and from 6.6 to 9.4 ft along the left abutment. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich and Hire equations (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Streambed scour evaluations and conditions at selected bridge sites in Alaska, 2012

USGS Publications Warehouse

Beebee, Robin A.; Schauer, Paul V.

2015-11-19

Vertical contraction and pressure flow occurred during 1 percent or smaller annual exceedance probability floods at five sites, including three aggradation sites. Contraction scour exceeded 5 feet at two sites, and total scour at piers (pier scour plus contraction scour) exceeded 5 feet at two sites. Debris accumulation increased calculated pier scour at six sites by an average of 1.2 feet. Total scour at abutments including contraction scour exceeded 5 feet at seven sites. Scour estimates seemed excessive at aggradation sites where upstream sediment supply controls scour and deposition processes, at cohesive soil sites where conservative assumptions were made for soil strength and flood duration, and for abutment scour at sites where failure of the embankment and attendant channel widening would reduce scour.

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.)

PubMed Central

2012-01-01

Background Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication. PMID:23241244

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

PubMed

Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

2012-12-15

Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication.

Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

PubMed

Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

2015-09-01

The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

Assessment of hydrologic and water quality data collected in Abbotts Lagoon watershed, Point Reyes National Seashore, California, during water years 1999 and 2000

USGS Publications Warehouse

Kratzer, Charles R.; Saleh, Dina K.; Zamora, Celia

2006-01-01

Abbotts Lagoon is part of Point Reyes National Seashore, located about 40 miles northwest of San Francisco and about 20 miles south of Bodega Bay. Water-quality samples were collected quarterly during water year 1999 at a site in each of three connected lagoons that make up Abbotts Lagoon and at a site in its most significant tributary. The quarterly samples were analyzed for major ions, nutrients, and chlorophyll-a. A bed-sediment sample was collected in each lagoon during August 1999 and was analyzed for organic carbon, iron, and total phosphorus. Seven tributaries were sampled during a February 1999 storm and four during an April 1999 storm. These samples were analyzed only for nutrients. One storm sample collected in April 1999 from a tributary downstream of the I Ranch dairy was analyzed for a suite of 47 compounds indicative of wastewater. Continuous water-level recorders were installed in the most significant tributary and the two largest lagoons for portions of the study. A water budget analysis for an April 2000 storm indicated that the main tributary accounted for 85 percent of surface inflows to Abbotts Lagoon. The portion of the surface inflow from the main tributary was lower in the February 1999 storms and is a function of upstream storage and vegetative growth in the tributary basins. Another water budget analysis for a period of no surface inflow (June and July 2000) indicated that the net ground-water contribution was an outflow (seepage) from Abbotts Lagoon of about 0.3 ft3/s. Salinity increased and nutrient concentrations decreased from upstream to downstream in the chain of lagoons. The lower lagoon, nearest the ocean, had less organic carbon and total phosphorus in the bed sediment than the upper lagoons. The two tributaries originating in the I Ranch dairy had the highest concentrations of nutrients in storm runoff, and the highest loading rates and yields of ammonia and phosphorus. These tributaries account for only 10.3 percent of the area drained by the sampled tributaries, but contributed 83 percent of the ammonia load and 79 percent of the orthophosphate load. The basins with the highest nutrient loading rates and yields had the highest percentage of dairy and (or) ranching impacted land use and, to a lesser extent, grazing land use. The ratios of inorganic nitrogen to phosphorus in the lagoons ranged from 0.1 to 9.5 in the upper lagoon, 0.10 to 0.15 in the middle lagoon, and 0.05 to 0.10 in the lower lagoon. Thus, there is an abundance of phosphorus in the lagoons, and nitrogen appears to be limiting the growth of phytoplankton. Two sterols indicative of fecal material were among 11 compounds detected in the sample collected for analysis of wastewater indicators from a tributary downstream of the I Ranch dairy.

Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

PubMed

Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

2004-09-01

Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.