Sample records for scattering probability method

  1. Simulation of inverse Compton scattering and its implications on the scattered linewidth

    NASA Astrophysics Data System (ADS)

    Ranjan, N.; Terzić, B.; Krafft, G. A.; Petrillo, V.; Drebot, I.; Serafini, L.

    2018-03-01

    Rising interest in inverse Compton sources has increased the need for efficient models that properly quantify the behavior of scattered radiation given a set of interaction parameters. The current state-of-the-art simulations rely on Monte Carlo-based methods, which, while properly expressing scattering behavior in high-probability regions of the produced spectra, may not correctly simulate such behavior in low-probability regions (e.g. tails of spectra). Moreover, sampling may take an inordinate amount of time for the desired accuracy to be achieved. In this paper, we present an analytic derivation of the expression describing the scattered radiation linewidth and propose a model to describe the effects of horizontal and vertical emittance on the properties of the scattered radiation. We also present an improved version of the code initially reported in Krafft et al. [Phys. Rev. Accel. Beams 19, 121302 (2016), 10.1103/PhysRevAccelBeams.19.121302], that can perform the same simulations as those present in cain and give accurate results in low-probability regions by integrating over the emissions of the electrons. Finally, we use these codes to carry out simulations that closely verify the behavior predicted by the analytically derived scaling law.

  2. Simulation of inverse Compton scattering and its implications on the scattered linewidth

    DOE PAGES

    Ranjan, N.; Terzić, B.; Krafft, G. A.; ...

    2018-03-06

    Rising interest in inverse Compton sources has increased the need for efficient models that properly quantify the behavior of scattered radiation given a set of interaction parameters. The current state-of-the-art simulations rely on Monte Carlo-based methods, which, while properly expressing scattering behavior in high-probability regions of the produced spectra, may not correctly simulate such behavior in low-probability regions (e.g. tails of spectra). Moreover, sampling may take an inordinate amount of time for the desired accuracy to be achieved. Here in this article, we present an analytic derivation of the expression describing the scattered radiation linewidth and propose a model tomore » describe the effects of horizontal and vertical emittance on the properties of the scattered radiation. We also present an improved version of the code initially reported in Krafft et al. [Phys. Rev. Accel. Beams 19, 121302 (2016)], that can perform the same simulations as those present in cain and give accurate results in low-probability regions by integrating over the emissions of the electrons. Finally, we use these codes to carry out simulations that closely verify the behavior predicted by the analytically derived scaling law.« less

  3. Probability density of tunneled carrier states near heterojunctions calculated numerically by the scattering method.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wampler, William R.; Myers, Samuel M.; Modine, Normand A.

    2017-09-01

    The energy-dependent probability density of tunneled carrier states for arbitrarily specified longitudinal potential-energy profiles in planar bipolar devices is numerically computed using the scattering method. Results agree accurately with a previous treatment based on solution of the localized eigenvalue problem, where computation times are much greater. These developments enable quantitative treatment of tunneling-assisted recombination in irradiated heterojunction bipolar transistors, where band offsets may enhance the tunneling effect by orders of magnitude. The calculations also reveal the density of non-tunneled carrier states in spatially varying potentials, and thereby test the common approximation of uniform- bulk values for such densities.

  4. Robust statistical reconstruction for charged particle tomography

    DOEpatents

    Schultz, Larry Joe; Klimenko, Alexei Vasilievich; Fraser, Andrew Mcleod; Morris, Christopher; Orum, John Christopher; Borozdin, Konstantin N; Sossong, Michael James; Hengartner, Nicolas W

    2013-10-08

    Systems and methods for charged particle detection including statistical reconstruction of object volume scattering density profiles from charged particle tomographic data to determine the probability distribution of charged particle scattering using a statistical multiple scattering model and determine a substantially maximum likelihood estimate of object volume scattering density using expectation maximization (ML/EM) algorithm to reconstruct the object volume scattering density. The presence of and/or type of object occupying the volume of interest can be identified from the reconstructed volume scattering density profile. The charged particle tomographic data can be cosmic ray muon tomographic data from a muon tracker for scanning packages, containers, vehicles or cargo. The method can be implemented using a computer program which is executable on a computer.

  5. Improved Convergence Rate of Multi-Group Scattering Moment Tallies for Monte Carlo Neutron Transport Codes

    NASA Astrophysics Data System (ADS)

    Nelson, Adam

    Multi-group scattering moment matrices are critical to the solution of the multi-group form of the neutron transport equation, as they are responsible for describing the change in direction and energy of neutrons. These matrices, however, are difficult to correctly calculate from the measured nuclear data with both deterministic and stochastic methods. Calculating these parameters when using deterministic methods requires a set of assumptions which do not hold true in all conditions. These quantities can be calculated accurately with stochastic methods, however doing so is computationally expensive due to the poor efficiency of tallying scattering moment matrices. This work presents an improved method of obtaining multi-group scattering moment matrices from a Monte Carlo neutron transport code. This improved method of tallying the scattering moment matrices is based on recognizing that all of the outgoing particle information is known a priori and can be taken advantage of to increase the tallying efficiency (therefore reducing the uncertainty) of the stochastically integrated tallies. In this scheme, the complete outgoing probability distribution is tallied, supplying every one of the scattering moment matrices elements with its share of data. In addition to reducing the uncertainty, this method allows for the use of a track-length estimation process potentially offering even further improvement to the tallying efficiency. Unfortunately, to produce the needed distributions, the probability functions themselves must undergo an integration over the outgoing energy and scattering angle dimensions. This integration is too costly to perform during the Monte Carlo simulation itself and therefore must be performed in advance by way of a pre-processing code. The new method increases the information obtained from tally events and therefore has a significantly higher efficiency than the currently used techniques. The improved method has been implemented in a code system containing a new pre-processor code, NDPP, and a Monte Carlo neutron transport code, OpenMC. This method is then tested in a pin cell problem and a larger problem designed to accentuate the importance of scattering moment matrices. These tests show that accuracy was retained while the figure-of-merit for generating scattering moment matrices and fission energy spectra was significantly improved.

  6. A full-angle Monte-Carlo scattering technique including cumulative and single-event Rutherford scattering in plasmas

    NASA Astrophysics Data System (ADS)

    Higginson, Drew P.

    2017-11-01

    We describe and justify a full-angle scattering (FAS) method to faithfully reproduce the accumulated differential angular Rutherford scattering probability distribution function (pdf) of particles in a plasma. The FAS method splits the scattering events into two regions. At small angles it is described by cumulative scattering events resulting, via the central limit theorem, in a Gaussian-like pdf; at larger angles it is described by single-event scatters and retains a pdf that follows the form of the Rutherford differential cross-section. The FAS method is verified using discrete Monte-Carlo scattering simulations run at small timesteps to include each individual scattering event. We identify the FAS regime of interest as where the ratio of temporal/spatial scale-of-interest to slowing-down time/length is from 10-3 to 0.3-0.7; the upper limit corresponds to Coulomb logarithm of 20-2, respectively. Two test problems, high-velocity interpenetrating plasma flows and keV-temperature ion equilibration, are used to highlight systems where including FAS is important to capture relevant physics.

  7. Surface roughness scattering of electrons in bulk mosfets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zuverink, Amanda Renee

    2015-11-01

    Surface-roughness scattering of electrons at the Si-SiO 2 interface is a very important consideration when analyzing Si metal-oxide-semiconductor field-effect transistors (MOSFETs). Scattering reduces the mobility of the electrons and degrades the device performance. 250-nm and 50-nm bulk MOSFETs were simulated with varying device parameters and mesh sizes in order to compare the effects of surface-roughness scattering in multiple devices. The simulation framework includes the ensemble Monte Carlo method used to solve the Boltzmann transport equation coupled with a successive over-relaxation method used to solve the two-dimensional Poisson's equation. Four methods for simulating the surface-roughness scattering of electrons were implemented onmore » both devices and compared: the constant specularity parameter, the momentum-dependent specularity parameter, and the real-space-roughness method with both uniform and varying electric fields. The specularity parameter is the probability of an electron scattering speculariy from a rough surface. It can be chosen as a constant, characterizing partially diffuse scattering of all electrons from the surface the same way, or it can be momentum dependent, where the size of rms roughness and the normal component of the electron wave number determine the probability of electron-momentum randomization. The real-space rough surface method uses the rms roughness height and correlation length of an actual MOSFET to simulate a rough interface. Due to their charge, electrons scatter from the electric field and not directly from the surface. If the electric field is kept uniform, the electrons do not perceive the roughness and scatter as if from a at surface. However, if the field is allowed to vary, the electrons scatter from the varying electric field as they would in a MOSFET. These methods were implemented for both the 50-nm and 250-nm MOSFETs, and using the rms roughness heights and correlation lengths for real devices. The current-voltage and mobility-electric field curves were plotted for each method on the two devices and compared. The conclusion is that the specularity-parameter methods are valuable as simple models for relatively smooth interfaces. However, they have limitations, as they cannot accurately describe the drastic reduction in the current and the electron mobility that occur in MOSFETs with very rough Si-SiO 2 interfaces.« less

  8. Determination of Acoustic Cavitation Probabilities and Thresholds Using a Single Focusing Transducer to Induce and Detect Acoustic Cavitation Events: I. Method and Terminology.

    PubMed

    Haller, Julian; Wilkens, Volker; Shaw, Adam

    2018-02-01

    A method to determine acoustic cavitation probabilities in tissue-mimicking materials (TMMs) is described that uses a high-intensity focused ultrasound (HIFU) transducer for both inducing and detecting the acoustic cavitation events. The method was evaluated by studying acoustic cavitation probabilities in agar-based TMMs with and without scatterers and for different sonication modes like continuous wave, single pulses (microseconds to milliseconds) and repeated burst signals. Acoustic cavitation thresholds (defined here as the peak rarefactional in situ pressure at which the acoustic cavitation probability reaches 50%) at a frequency of 1.06 MHz were observed between 1.1 MPa (for 1 s of continuous wave sonication) and 4.6 MPa (for 1 s of a repeated burst signal with 25-cycle burst length and 10-ms burst period) in a 3% (by weight) agar phantom without scatterers. The method and its evaluation are described, and general terminology useful for standardizing the description of insonation conditions and comparing results is provided. In the accompanying second part, the presented method is used to systematically study the acoustic cavitation thresholds in the same material for a range of sonication modes. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Improving the Ar I and II branching ratio calibration method: Monte Carlo simulations of effects from photon scattering/reflecting in hollow cathodes

    NASA Astrophysics Data System (ADS)

    Lawler, J. E.; Den Hartog, E. A.

    2018-03-01

    The Ar I and II branching ratio calibration method is discussed with the goal of improving the technique. This method of establishing a relative radiometric calibration is important in ongoing research to improve atomic transition probabilities for quantitative spectroscopy in astrophysics and other fields. Specific suggestions are presented along with Monte Carlo simulations of wavelength dependent effects from scattering/reflecting of photons in a hollow cathode.

  10. The coupled three-dimensional wave packet approach to reactive scattering

    NASA Astrophysics Data System (ADS)

    Marković, Nikola; Billing, Gert D.

    1994-01-01

    A recently developed scheme for time-dependent reactive scattering calculations using three-dimensional wave packets is applied to the D+H2 system. The present method is an extension of a previously published semiclassical formulation of the scattering problem and is based on the use of hyperspherical coordinates. The convergence requirements are investigated by detailed calculations for total angular momentum J equal to zero and the general applicability of the method is demonstrated by solving the J=1 problem. The inclusion of the geometric phase is also discussed and its effect on the reaction probability is demonstrated.

  11. Direct-method SAD phasing with partial-structure iteration: towards automation.

    PubMed

    Wang, J W; Chen, J R; Gu, Y X; Zheng, C D; Fan, H F

    2004-11-01

    The probability formula of direct-method SAD (single-wavelength anomalous diffraction) phasing proposed by Fan & Gu (1985, Acta Cryst. A41, 280-284) contains partial-structure information in the form of a Sim-weighting term. Previously, only the substructure of anomalous scatterers has been included in this term. In the case that the subsequent density modification and model building yields only structure fragments, which do not straightforwardly lead to the complete solution, the partial structure can be fed back into the Sim-weighting term of the probability formula in order to strengthen its phasing power and to benefit the subsequent automatic model building. The procedure has been tested with experimental SAD data from two known proteins with copper and sulfur as the anomalous scatterers.

  12. Measurement of Plutonium-240 Angular Momentum Dependent Fission Probabilities Using the Alpha-Alpha' Reaction

    NASA Astrophysics Data System (ADS)

    Koglin, Johnathon

    Accurate nuclear reaction data from a few keV to tens of MeV and across the table of nuclides is essential to a number of applications of nuclear physics, including national security, nuclear forensics, nuclear astrophysics, and nuclear energy. Precise determination of (n, f) and neutron capture cross sections for reactions in high- ux environments are particularly important for a proper understanding of nuclear reactor performance and stellar nucleosynthesis. In these extreme environments reactions on short-lived and otherwise difficult-to-produce isotopes play a significant role in system evolution and provide insights into the types of nuclear processes taking place; a detailed understanding of these processes is necessary to properly determine cross sections far from stability. Indirect methods are often attempted to measure cross sections on isotopes that are difficult to separate in a laboratory setting. Using the surrogate approach, the same compound nucleus from the reaction of interest is created through a "surrogate" reaction on a different isotope and the resulting decay is measured. This result is combined with appropriate reaction theory for compound nucleus population, from which the desired cross sections can be inferred. This method has shown promise, but the theoretical framework often lacks necessary experimental data to constrain models. In this work, dual arrays of silicon telescope particle identification detectors and photovoltaic (solar) cell fission fragment detectors have been used to measure the fission probability of the 240Pu(alpha, alpha'f) reaction - a surrogate for the 239Pu(n, f) - and fission of 35.9(2)MeV at eleven scattering angles from 40° to 140° in 10° intervals and at nuclear excitation energies up to 16MeV. Within experimental uncertainty, the maximum fission probability was observed at the neutron separation energy for each alpha scattering angle. Fission probabilities were separated into five 500 keV bins from 5:5MeV to 8:0MeV and one bin from 4:5MeV to 5:5MeV. Across energy bins the fission probability increases approximately linearly with increasing alpha' scattering angle. At 90° the fission probability increases from 0:069(6) in the lowest energy bin to 0:59(2) in the highest. Likewise, within a single energy bin the fission probability increases with alpha' scattering angle. Within the 6:5MeV and 7:0MeV energy bin, the fission probability increased from 0:41(1) at 60° to 0:81(10) at 140°. Fission fragment angular distributions were also measured integrated over each energy bin. These distributions were fit to theoretical distributions based on combinations of transitional nuclear vibrational and rotational excitations at the saddle point. Contributions from specific K vibrational states were extracted and combined with fission probability measurements to determine the relative fission probability of each state as a function of nuclear excitation energy. Within a given excitation energy bin, it is found that contributions from K states greater than the minimum K = 0 state tend to increase with the increasing alpha' scattering angle. This is attributed to an increase in the transferred angular momentum associated with larger scattering angles. The 90° alpha' scattering angle produced the highest quality results. The relative contributions of K states do not show a discernible trend across the energy spectrum. The energy-binned results confirm existing measurements that place a K = 2 state in the first energy bin with the opening of K = 1 and K = 4 states at energies above 5:5MeV. This experiment represents the first of its kind in which fission probabilities and angular distributions are simultaneously measured at a large number of scattering angles. The acquired fission probability, angular distribution, and K state contribution provide a diverse dataset against which microscopic fission models can be constrained and further the understanding of the properties of the 240Pu fission.

  13. A full-angle Monte-Carlo scattering technique including cumulative and single-event Rutherford scattering in plasmas [Theory of cumulative large-angle collisions in plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Higginson, Drew P.

    Here, we describe and justify a full-angle scattering (FAS) method to faithfully reproduce the accumulated differential angular Rutherford scattering probability distribution function (pdf) of particles in a plasma. The FAS method splits the scattering events into two regions. At small angles it is described by cumulative scattering events resulting, via the central limit theorem, in a Gaussian-like pdf; at larger angles it is described by single-event scatters and retains a pdf that follows the form of the Rutherford differential cross-section. The FAS method is verified using discrete Monte-Carlo scattering simulations run at small timesteps to include each individual scattering event.more » We identify the FAS regime of interest as where the ratio of temporal/spatial scale-of-interest to slowing-down time/length is from 10 -3 to 0.3–0.7; the upper limit corresponds to Coulomb logarithm of 20–2, respectively. Two test problems, high-velocity interpenetrating plasma flows and keV-temperature ion equilibration, are used to highlight systems where including FAS is important to capture relevant physics.« less

  14. A full-angle Monte-Carlo scattering technique including cumulative and single-event Rutherford scattering in plasmas [Theory of cumulative large-angle collisions in plasmas

    DOE PAGES

    Higginson, Drew P.

    2017-08-12

    Here, we describe and justify a full-angle scattering (FAS) method to faithfully reproduce the accumulated differential angular Rutherford scattering probability distribution function (pdf) of particles in a plasma. The FAS method splits the scattering events into two regions. At small angles it is described by cumulative scattering events resulting, via the central limit theorem, in a Gaussian-like pdf; at larger angles it is described by single-event scatters and retains a pdf that follows the form of the Rutherford differential cross-section. The FAS method is verified using discrete Monte-Carlo scattering simulations run at small timesteps to include each individual scattering event.more » We identify the FAS regime of interest as where the ratio of temporal/spatial scale-of-interest to slowing-down time/length is from 10 -3 to 0.3–0.7; the upper limit corresponds to Coulomb logarithm of 20–2, respectively. Two test problems, high-velocity interpenetrating plasma flows and keV-temperature ion equilibration, are used to highlight systems where including FAS is important to capture relevant physics.« less

  15. Seismic imaging of Q structures by a trans-dimensional coda-wave analysis

    NASA Astrophysics Data System (ADS)

    Takahashi, Tsutomu

    2017-04-01

    Wave scattering and intrinsic attenuation are important processes to describe incoherent and complex wave trains of high frequency seismic wave (>1Hz). The multiple lapse time window analysis (MLTWA) has been used to estimate scattering and intrinsic Q values by assuming constant Q in a study area (e.g., Hoshiba 1993). This study generalizes this MLTWA to estimate lateral variations of Q values under the Bayesian framework in dimension variable space. Study area is partitioned into small areas by means of the Voronoi tessellation. Scattering and intrinsic Q in each small area are constant. We define a misfit function for spatiotemporal variations of wave energy as with the original MLTWA, and maximize the posterior probability with changing not only Q values but the number and spatial layout of the Voronoi cells. This maximization is conducted by means of the reversible jump Markov chain Monte Carlo (rjMCMC) (Green 1995) since the number of unknown parameters (i.e., dimension of posterior probability) is variable. After a convergence to the maximum posterior, we estimate Q structures from the ensemble averages of MCMC samples around the maximum posterior probability. Synthetic tests showed stable reconstructions of input structures with reasonable error distributions. We applied this method for seismic waveform data recorded by ocean bottom seismograms at the outer-rise area off Tohoku, and estimated Q values at 4-8Hz, 8-16Hz and 16-32Hz. Intrinsic Q are nearly constant at all frequency bands, and scattering Q shows two distinct strong scattering regions at petit spot area and high seismicity area. These strong scattering are probably related to magma inclusions and fractured structure, respectively. Difference between these two areas becomes clear at high frequencies. It means that scale dependences of inhomogeneities or smaller scale inhomogeneity is important to discuss medium property and origins of structural variations. While the generalized MLTWA is based on a classical waveform modeling in constant Q medium, this method can be a fundamental basis for Q structure imaging in the crust.

  16. Hiding the interior region of core-shell nanoparticles with quantum invisible cloaks

    NASA Astrophysics Data System (ADS)

    Lee, Jeng Yi; Lee, Ray-Kuang

    2014-04-01

    Based on the scattering cancellation, we provide a method not only making a nanoparticle nearly invisible, but also hiding its interior region from the outside probing matter wave. By applying the interplay among the nodal points of partial waves along with the concept of streamline in fluid dynamics for probability flux, a quantum invisible cloak to the electron transport in a host semiconductor is demonstrated by simultaneously guiding the probability flux outside a hidden region and keeping the total scattering cross section negligible. As the probability flux vanishes in the interior region, one can embed any materials inside a multiple core-shell nanoparticle without affecting physical observables from the outside. Our results reveal the possibility to design a protection shield layer for fragile interior parts from the impact of transport electrons.

  17. Scattering properties of alumina particle clusters with different radius of monomers in aerocraft plume

    NASA Astrophysics Data System (ADS)

    Li, Jingying; Bai, Lu; Wu, Zhensen; Guo, Lixin; Gong, Yanjun

    2017-11-01

    In this paper, diffusion limited aggregation (DLA) algorithm is improved to generate the alumina particle cluster with different radius of monomers in the plume. Scattering properties of these alumina clusters are solved by the multiple sphere T matrix method (MSTM). The effect of the number and radius of monomers on the scattering properties of clusters of alumina particles is discussed. The scattering properties of two types of alumina particle clusters are compared, one has different radius of monomers that follows lognormal probability distribution, another has the same radius of monomers that equals the mean of lognormal probability distribution. The result show that the scattering phase functions and linear polarization degrees of these two types of alumina particle clusters are of great differences. For the alumina clusters with different radius of monomers, the forward scatterings are bigger and the linear polarization degree has multiple peaks. Moreover, the vary of their scattering properties do not have strong correlative with the change of number of monomers. For larger booster motors, 25-38% of the plume being condensed alumina. The alumina can scatter radiation from other sources present in the plume and effect on radiation transfer characteristics of plume. In addition, the shape, size distribution and refractive index of the particles in the plume are estimated by linear polarization degree. Therefore, accurate scattering properties calculation is very important to decrease the deviation in the related research.

  18. Multiple Scattering in Planetary Regoliths Using Incoherent Interactions

    NASA Astrophysics Data System (ADS)

    Muinonen, K.; Markkanen, J.; Vaisanen, T.; Penttilä, A.

    2017-12-01

    We consider scattering of light by a planetary regolith using novel numerical methods for discrete random media of particles. Understanding the scattering process is of key importance for spectroscopic, photometric, and polarimetric modeling of airless planetary objects, including radar studies. In our modeling, the size of the spherical random medium can range from microscopic to macroscopic sizes, whereas the particles are assumed to be of the order of the wavelength in size. We extend the radiative transfer and coherent backscattering method (RT-CB) to the case of dense packing of particles by adopting the ensemble-averaged first-order incoherent extinction, scattering, and absorption characteristics of a volume element of particles as input. In the radiative transfer part, at each absorption and scattering process, we account for absorption with the help of the single-scattering albedo and peel off the Stokes parameters of radiation emerging from the medium in predefined scattering angles. We then generate a new scattering direction using the joint probability density for the local polar and azimuthal scattering angles. In the coherent backscattering part, we utilize amplitude scattering matrices along the radiative-transfer path and the reciprocal path. Furthermore, we replace the far-field interactions of the RT-CB method with rigorous interactions facilitated by the Superposition T-matrix method (STMM). This gives rise to a new RT-RT method, radiative transfer with reciprocal interactions. For microscopic random media, we then compare the new results to asymptotically exact results computed using the STMM, succeeding in the numerical validation of the new methods.Acknowledgments. Research supported by European Research Council with Advanced Grant No. 320773 SAEMPL, Scattering and Absorption of ElectroMagnetic waves in ParticuLate media. Computational resources provided by CSC - IT Centre for Science Ltd, Finland.

  19. Nonlinear resonance scattering of femtosecond X-ray pulses on atoms in plasmas

    NASA Astrophysics Data System (ADS)

    Rosmej, F. B.; Astapenko, V. A.; Lisitsa, V. S.; Moroz, N. N.

    2017-11-01

    It is shown that for sufficiently short pulses the resonance scattering probability becomes a nonlinear function of the pulse duration. For fs X-ray pulses scattered on atoms in plasmas maxima and minima develop in the nonlinear regime whereas in the limit of long pulses the probability becomes linear and turns over into the standard description of the electromagnetic pulse scattering. Numerical calculations are carried out in terms of a generalized scattering probability for the total time of pulse duration including fine structure splitting and ion Doppler broadening in hot plasmas. For projected X-ray monocycles, the generalized nonlinear approach differs by 1-2 orders of magnitude from the standard theory.

  20. A Numerical Method for Obtaining Monoenergetic Neutron Flux Distributions and Transmissions in Multiple-Region Slabs

    NASA Technical Reports Server (NTRS)

    Schneider, Harold

    1959-01-01

    This method is investigated for semi-infinite multiple-slab configurations of arbitrary width, composition, and source distribution. Isotropic scattering in the laboratory system is assumed. Isotropic scattering implies that the fraction of neutrons scattered in the i(sup th) volume element or subregion that will make their next collision in the j(sup th) volume element or subregion is the same for all collisions. These so-called "transfer probabilities" between subregions are calculated and used to obtain successive-collision densities from which the flux and transmission probabilities directly follow. For a thick slab with little or no absorption, a successive-collisions technique proves impractical because an unreasonably large number of collisions must be followed in order to obtain the flux. Here the appropriate integral equation is converted into a set of linear simultaneous algebraic equations that are solved for the average total flux in each subregion. When ordinary diffusion theory applies with satisfactory precision in a portion of the multiple-slab configuration, the problem is solved by ordinary diffusion theory, but the flux is plotted only in the region of validity. The angular distribution of neutrons entering the remaining portion is determined from the known diffusion flux and the remaining region is solved by higher order theory. Several procedures for applying the numerical method are presented and discussed. To illustrate the calculational procedure, a symmetrical slab ia vacuum is worked by the numerical, Monte Carlo, and P(sub 3) spherical harmonics methods. In addition, an unsymmetrical double-slab problem is solved by the numerical and Monte Carlo methods. The numerical approach proved faster and more accurate in these examples. Adaptation of the method to anisotropic scattering in slabs is indicated, although no example is included in this paper.

  1. Scattering of ultrashort electromagnetic pulses on metal clusters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Astapenko, V. A., E-mail: astval@mail.ru; Sakhno, S. V.

    We have calculated and analyzed the probability of ultrashort electromagnetic pulse (USP) scattering on small metal clusters in the frequency range of plasmon resonances during the field action. The main attention is devoted to dependence of the probability of scattering on the pulse duration for various detunings of the USP carrier frequency from the plasmon resonance frequency. Peculiarities of the USP scattering from plasmon resonances with various figures of merit are revealed.

  2. Scattering of ultrashort electromagnetic pulses on metal clusters

    NASA Astrophysics Data System (ADS)

    Astapenko, V. A.; Sakhno, S. V.

    2016-12-01

    We have calculated and analyzed the probability of ultrashort electromagnetic pulse (USP) scattering on small metal clusters in the frequency range of plasmon resonances during the field action. The main attention is devoted to dependence of the probability of scattering on the pulse duration for various detunings of the USP carrier frequency from the plasmon resonance frequency. Peculiarities of the USP scattering from plasmon resonances with various figures of merit are revealed.

  3. New KF-PP-SVM classification method for EEG in brain-computer interfaces.

    PubMed

    Yang, Banghua; Han, Zhijun; Zan, Peng; Wang, Qian

    2014-01-01

    Classification methods are a crucial direction in the current study of brain-computer interfaces (BCIs). To improve the classification accuracy for electroencephalogram (EEG) signals, a novel KF-PP-SVM (kernel fisher, posterior probability, and support vector machine) classification method is developed. Its detailed process entails the use of common spatial patterns to obtain features, based on which the within-class scatter is calculated. Then the scatter is added into the kernel function of a radial basis function to construct a new kernel function. This new kernel is integrated into the SVM to obtain a new classification model. Finally, the output of SVM is calculated based on posterior probability and the final recognition result is obtained. To evaluate the effectiveness of the proposed KF-PP-SVM method, EEG data collected from laboratory are processed with four different classification schemes (KF-PP-SVM, KF-SVM, PP-SVM, and SVM). The results showed that the overall average improvements arising from the use of the KF-PP-SVM scheme as opposed to KF-SVM, PP-SVM and SVM schemes are 2.49%, 5.83 % and 6.49 % respectively.

  4. Implementation and testing of the on-the-fly thermal scattering Monte Carlo sampling method for graphite and light water in MCNP6

    DOE PAGES

    Pavlou, Andrew T.; Ji, Wei; Brown, Forrest B.

    2016-01-23

    Here, a proper treatment of thermal neutron scattering requires accounting for chemical binding through a scattering law S(α,β,T). Monte Carlo codes sample the secondary neutron energy and angle after a thermal scattering event from probability tables generated from S(α,β,T) tables at discrete temperatures, requiring a large amount of data for multiscale and multiphysics problems with detailed temperature gradients. We have previously developed a method to handle this temperature dependence on-the-fly during the Monte Carlo random walk using polynomial expansions in 1/T to directly sample the secondary energy and angle. In this paper, the on-the-fly method is implemented into MCNP6 andmore » tested in both graphite-moderated and light water-moderated systems. The on-the-fly method is compared with the thermal ACE libraries that come standard with MCNP6, yielding good agreement with integral reactor quantities like k-eigenvalue and differential quantities like single-scatter secondary energy and angle distributions. The simulation runtimes are comparable between the two methods (on the order of 5–15% difference for the problems tested) and the on-the-fly fit coefficients only require 5–15 MB of total data storage.« less

  5. Research on the development of space target detecting system and three-dimensional reconstruction technology

    NASA Astrophysics Data System (ADS)

    Li, Dong; Wei, Zhen; Song, Dawei; Sun, Wenfeng; Fan, Xiaoyan

    2016-11-01

    With the development of space technology, the number of spacecrafts and debris are increasing year by year. The demand for detecting and identification of spacecraft is growing strongly, which provides support to the cataloguing, crash warning and protection of aerospace vehicles. The majority of existing approaches for three-dimensional reconstruction is scattering centres correlation, which is based on the radar high resolution range profile (HRRP). This paper proposes a novel method to reconstruct the threedimensional scattering centre structure of target from a sequence of radar ISAR images, which mainly consists of three steps. First is the azimuth scaling of consecutive ISAR images based on fractional Fourier transform (FrFT). The later is the extraction of scattering centres and matching between adjacent ISAR images using grid method. Finally, according to the coordinate matrix of scattering centres, the three-dimensional scattering centre structure is reconstructed using improved factorization method. The three-dimensional structure is featured with stable and intuitive characteristic, which provides a new way to improve the identification probability and reduce the complexity of the model matching library. A satellite model is reconstructed using the proposed method from four consecutive ISAR images. The simulation results prove that the method has gotten a satisfied consistency and accuracy.

  6. Use of the Wigner representation in scattering problems

    NASA Technical Reports Server (NTRS)

    Bemler, E. A.

    1975-01-01

    The basic equations of quantum scattering were translated into the Wigner representation, putting quantum mechanics in the form of a stochastic process in phase space, with real valued probability distributions and source functions. The interpretative picture associated with this representation is developed and stressed and results used in applications published elsewhere are derived. The form of the integral equation for scattering as well as its multiple scattering expansion in this representation are derived. Quantum corrections to classical propagators are briefly discussed. The basic approximation used in the Monte-Carlo method is derived in a fashion which allows for future refinement and which includes bound state production. Finally, as a simple illustration of some of the formalism, scattering is treated by a bound two body problem. Simple expressions for single and double scattering contributions to total and differential cross-sections as well as for all necessary shadow corrections are obtained.

  7. Empirical entropic contributions in computational docking: evaluation in APS reductase complexes.

    PubMed

    Chang, Max W; Belew, Richard K; Carroll, Kate S; Olson, Arthur J; Goodsell, David S

    2008-08-01

    The results from reiterated docking experiments may be used to evaluate an empirical vibrational entropy of binding in ligand-protein complexes. We have tested several methods for evaluating the vibrational contribution to binding of 22 nucleotide analogues to the enzyme APS reductase. These include two cluster size methods that measure the probability of finding a particular conformation, a method that estimates the extent of the local energetic well by looking at the scatter of conformations within clustered results, and an RMSD-based method that uses the overall scatter and clustering of all conformations. We have also directly characterized the local energy landscape by randomly sampling around docked conformations. The simple cluster size method shows the best performance, improving the identification of correct conformations in multiple docking experiments. 2008 Wiley Periodicals, Inc.

  8. XUV and x-ray elastic scattering of attosecond electromagnetic pulses on atoms

    NASA Astrophysics Data System (ADS)

    Rosmej, F. B.; Astapenko, V. A.; Lisitsa, V. S.

    2017-12-01

    Elastic scattering of electromagnetic pulses on atoms in XUV and soft x-ray ranges is considered for ultra-short pulses. The inclusion of the retardation term, non-dipole interaction and an efficient scattering tensor approximation allowed studying the scattering probability in dependence of the pulse duration for different carrier frequencies. Numerical calculations carried out for Mg, Al and Fe atoms demonstrate that the scattering probability is a highly nonlinear function of the pulse duration and has extrema for pulse carrier frequencies in the vicinity of the resonance-like features of the polarization charge spectrum. Closed expressions for the non-dipole correction and the angular dependence of the scattered radiation are obtained.

  9. Probabilistic simulation of uncertainties in composite uniaxial strengths

    NASA Technical Reports Server (NTRS)

    Chamis, C. C.; Stock, T. A.

    1990-01-01

    Probabilistic composite micromechanics methods are developed that simulate uncertainties in unidirectional fiber composite strengths. These methods are in the form of computational procedures using composite mechanics with Monte Carlo simulation. The variables for which uncertainties are accounted include constituent strengths and their respective scatter. A graphite/epoxy unidirectional composite (ply) is studied to illustrate the procedure and its effectiveness to formally estimate the probable scatter in the composite uniaxial strengths. The results show that ply longitudinal tensile and compressive, transverse compressive and intralaminar shear strengths are not sensitive to single fiber anomalies (breaks, intergacial disbonds, matrix microcracks); however, the ply transverse tensile strength is.

  10. Schwinger-variational-principle theory of collisions in the presence of multiple potentials

    NASA Astrophysics Data System (ADS)

    Robicheaux, F.; Giannakeas, P.; Greene, Chris H.

    2015-08-01

    A theoretical method for treating collisions in the presence of multiple potentials is developed by employing the Schwinger variational principle. The current treatment agrees with the local (regularized) frame transformation theory and extends its capabilities. Specifically, the Schwinger variational approach gives results without the divergences that need to be regularized in other methods. Furthermore, it provides a framework to identify the origin of these singularities and possibly improve the local frame transformation. We have used the method to obtain the scattering parameters for different confining potentials symmetric in x ,y . The method is also used to treat photodetachment processes in the presence of various confining potentials, thereby highlighting effects of the infinitely many closed channels. Two general features predicted are the vanishing of the total photoabsorption probability at every channel threshold and the occurrence of resonances below the channel thresholds for negative scattering lengths. In addition, the case of negative-ion photodetachment in the presence of uniform magnetic fields is also considered where unique features emerge at large scattering lengths.

  11. A MATLAB-based finite-element visualization of quantum reactive scattering. I. Collinear atom-diatom reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warehime, Mick; Alexander, Millard H., E-mail: mha@umd.edu

    We restate the application of the finite element method to collinear triatomic reactive scattering dynamics with a novel treatment of the scattering boundary conditions. The method provides directly the reactive scattering wave function and, subsequently, the probability current density field. Visualizing these quantities provides additional insight into the quantum dynamics of simple chemical reactions beyond simplistic one-dimensional models. Application is made here to a symmetric reaction (H+H{sub 2}), a heavy-light-light reaction (F+H{sub 2}), and a heavy-light-heavy reaction (F+HCl). To accompany this article, we have written a MATLAB code which is fast, simple enough to be accessible to a wide audience,more » as well as generally applicable to any problem that can be mapped onto a collinear atom-diatom reaction. The code and user's manual are available for download from http://www2.chem.umd.edu/groups/alexander/FEM.« less

  12. Joint Processing of Envelope Alignment and Phase Compensation for Isar Imaging

    NASA Astrophysics Data System (ADS)

    Chen, Tao; Jin, Guanghu; Dong, Zhen

    2018-04-01

    Range envelope alignment and phase compensation are spilt into two isolated parts in the classical methods of translational motion compensation in Inverse Synthetic Aperture Radar (ISAR) imaging. In classic method of the rotating object imaging, the two reference points of the envelope alignment and the Phase Difference (PD) estimation are probably not the same point, making it difficult to uncouple the coupling term by conducting the correction of Migration Through Resolution Cell (MTRC). In this paper, an improved approach of joint processing which chooses certain scattering point as the sole reference point is proposed to perform with utilizing the Prominent Point Processing (PPP) method. With this end in view, we firstly get the initial image using classical methods from which a certain scattering point can be chose. The envelope alignment and phase compensation using the selected scattering point as the same reference point are subsequently conducted. The keystone transform is thus smoothly applied to further improve imaging quality. Both simulation experiments and real data processing are provided to demonstrate the performance of the proposed method compared with classical method.

  13. Energy Distributions of Neutrons Scattered from Graphite, Light and Heavy Water, Ice, Zirconium Hydride, Lithium Hydride, Sodium Hydride and Ammonium Chloride by the Beryllium Detector Method

    DOE R&D Accomplishments Database

    Woods, A. D. B.; Brockhouse, Bertram N.; Sakamoto, M.; Sinclair, R. N.

    1960-09-12

    Energy distributions of neutrons scattered from various moderators and from several hydrogenous substances were measured at energy transfers of 0.02 to 0.24 ev. Results from experiments on graphite, light and heavy water, ice, ZrH, LiH, NaH, and NH4Cl are included. It is noted that the results are of a preliminary character; however, they are probably the most accurate measurements of high-energy transfers yet made. (J.R.D.)

  14. Multiple scattering in planetary regoliths using first-order incoherent interactions

    NASA Astrophysics Data System (ADS)

    Muinonen, Karri; Markkanen, Johannes; Väisänen, Timo; Penttilä, Antti

    2017-10-01

    We consider scattering of light by a planetary regolith modeled using discrete random media of spherical particles. The size of the random medium can range from microscopic sizes of a few wavelengths to macroscopic sizes approaching infinity. The size of the particles is assumed to be of the order of the wavelength. We extend the numerical Monte Carlo method of radiative transfer and coherent backscattering (RT-CB) to the case of dense packing of particles. We adopt the ensemble-averaged first-order incoherent extinction, scattering, and absorption characteristics of a volume element of particles as input for the RT-CB. The volume element must be larger than the wavelength but smaller than the mean free path length of incoherent extinction. In the radiative transfer part, at each absorption and scattering process, we account for absorption with the help of the single-scattering albedo and peel off the Stokes parameters of radiation emerging from the medium in predefined scattering angles. We then generate a new scattering direction using the joint probability density for the local polar and azimuthal scattering angles. In the coherent backscattering part, we utilize amplitude scattering matrices along the radiative-transfer path and the reciprocal path, and utilize the reciprocity of electromagnetic waves to verify the computation. We illustrate the incoherent volume-element scattering characteristics and compare the dense-medium RT-CB to asymptotically exact results computed using the Superposition T-matrix method (STMM). We show that the dense-medium RT-CB compares favorably to the STMM results for the current cases of sparse and dense discrete random media studied. The novel method can be applied in modeling light scattering by the surfaces of asteroids and other airless solar system objects, including UV-Vis-NIR spectroscopy, photometry, polarimetry, and radar scattering problems.Acknowledgments. Research supported by European Research Council with Advanced Grant No. 320773 SAEMPL, Scattering and Absorption of ElectroMagnetic waves in ParticuLate media. Computational resources provided by CSC - IT Centre for Science Ltd, Finland.

  15. Application of the QSDC procedure to the formulation of space shuttle design criteria. Volume 2: Applications guide

    NASA Technical Reports Server (NTRS)

    Bouton, I.; Martin, G. L.

    1972-01-01

    Criteria to determine the probability of aircraft structural failure were established according to the Quantitative Structural Design Criteria by Statistical Methods, the QSDC Procedure. This criteria method was applied to the design of the space shuttle during this contract. An Applications Guide was developed to demonstrate the utilization of the QSDC Procedure, with examples of the application to a hypothetical space shuttle illustrating the application to specific design problems. Discussions of the basic parameters of the QSDC Procedure: the Limit and Omega Conditions, and the strength scatter, have been included. Available data pertinent to the estimation of the strength scatter have also been included.

  16. E-O Sensor Signal Recognition Simulation: Computer Code SPOT I.

    DTIC Science & Technology

    1978-10-01

    scattering phase function PDCO , defined at the specified wavelength, given for each of the scattering angles defined. Currently, a maximum of sixty-four...PHASE MATRIX DATA IS DEFINED PDCO AVERAGE PROBABILITY FOR PHASE MATRIX DEFINITION NPROB PROBLEM NUMBER 54 Fig. 12. FLOWCHART for the SPOT Computer Code...El0.1 WLAM(N) Wavelength at which the aerosol single-scattering phase function set is defined (microns) 3 8El0.1 PDCO (N,I) Average probability for

  17. Depth resolved grazing incidence neutron scattering experiments from semi-infinite interfaces: a statistical analysis of the scattering contributions

    NASA Astrophysics Data System (ADS)

    Adlmann, Franz A.; Herbel, Jörg; Korolkovas, Airidas; Bliersbach, Andreas; Toperverg, Boris; Van Herck, Walter; Pálsson, Gunnar K.; Kitchen, Brian; Wolff, Max

    2018-04-01

    Grazing incidence neutron scattering experiments offer surface sensitivity by reflecting from an interface at momentum transfers close to total external reflection. Under these conditions the penetration depth is strongly non-linear and may change by many orders of magnitude. This fact imposes severe challenges for depth resolved experiments, since the brilliance of neutron beams is relatively low in comparison to e.g. synchrotron radiation. In this article we use probability density functions to calculate the contribution of scattering at different distances from an interface to the intensities registered on the detector. Our method has the particular advantage that the depth sensitivity is directly extracted from the scattering pattern itself. Hence for perfectly known samples exact resolution functions can be calculated and visa versa. We show that any tails in the resolution function, e.g. Gaussian shaped, hinders depth resolved experiments. More importantly we provide means for a descriptive statistical analysis of detector images with respect to the scattering contributions and show that even for perfect resolution near surface scattering is hardly accessible.

  18. Optical correlation techniques in fluid dynamics

    NASA Astrophysics Data System (ADS)

    Schätzel, K.; Schulz-Dubois, E. O.; Vehrenkamp, R.

    1981-04-01

    Three flow measurement techniques make use of fast digital correlators. The most widely spread is photon correlation velocimetry using crossed laser beams, and detecting Doppler shifted light scattered by small particles in the flow. Depending on the processing of the photon correlation output, this technique yields mean velocity, turbulence level, and even the detailed probability distribution of one velocity component. An improved data processing scheme is demonstrated on laminar vortex flow in a curved channel. In the second method, rate correlation based upon threshold crossings of a high pass filtered laser Doppler signal can be used to obtain velocity correlation functions. The most powerful set-up developed in our laboratory uses a phase locked loop type tracker and a multibit correlator to analyze time-dependent Taylor vortex flow. With two optical systems and trackers, cross-correlation functions reveal phase relations between different vortices. The last method makes use of refractive index fluctuations (eg in two phase flows) instead of scattering particles. Interferometry with bidirectional counting, and digital correlation and probability analysis, constitutes a new quantitative technique related to classical Schlieren methods. Measurements on a mixing flow of heated and cold air contribute new ideas to the theory of turbulent random phase screens.

  19. Comparison of spatially and temporally resolved diffuse transillumination measurement systems for extraction of optical properties of scattering media.

    PubMed

    Ortiz-Rascón, E; Bruce, N C; Garduño-Mejía, J; Carrillo-Torres, R; Hernández-Paredes, J; Álvarez-Ramos, M E

    2017-11-20

    This paper discusses the main differences between two different methods for determining the optical properties of tissue optical phantoms by fitting the spatial and temporal intensity distribution functions to the diffusion approximation theory. The consistency in the values of the optical properties is verified by changing the width of the recipient containing the turbid medium; as the optical properties are an intrinsic value of the scattering medium, independently of the recipient width, the stability in these values for different widths implies a better measurement system for the acquisition of the optical properties. It is shown that the temporal fitting method presents higher stability than the spatial fitting method; this is probably due to the addition of the time of flight parameter into the diffusion theory.

  20. A Modified Monte Carlo Method for Carrier Transport in Germanium, Free of Isotropic Rates

    NASA Astrophysics Data System (ADS)

    Sundqvist, Kyle

    2010-03-01

    We present a new method for carrier transport simulation, relevant for high-purity germanium < 100 > at a temperature of 40 mK. In this system, the scattering of electrons and holes is dominated by spontaneous phonon emission. Free carriers are always out of equilibrium with the lattice. We must also properly account for directional effects due to band structure, but there are many cautions in the literature about treating germanium in particular. These objections arise because the germanium electron system is anisotropic to an extreme degree, while standard Monte Carlo algorithms maintain a reliance on isotropic, integrated rates. We re-examine Fermi's Golden Rule to produce a Monte Carlo method free of isotropic rates. Traditional Monte Carlo codes implement particle scattering based on an isotropically averaged rate, followed by a separate selection of the particle's final state via a momentum-dependent probability. In our method, the kernel of Fermi's Golden Rule produces analytical, bivariate rates which allow for the simultaneous choice of scatter and final state selection. Energy and momentum are automatically conserved. We compare our results to experimental data.

  1. Exact Time-Dependent Exchange-Correlation Potential in Electron Scattering Processes

    NASA Astrophysics Data System (ADS)

    Suzuki, Yasumitsu; Lacombe, Lionel; Watanabe, Kazuyuki; Maitra, Neepa T.

    2017-12-01

    We identify peak and valley structures in the exact exchange-correlation potential of time-dependent density functional theory that are crucial for time-resolved electron scattering in a model one-dimensional system. These structures are completely missed by adiabatic approximations that, consequently, significantly underestimate the scattering probability. A recently proposed nonadiabatic approximation is shown to correctly capture the approach of the electron to the target when the initial Kohn-Sham state is chosen judiciously, and it is more accurate than standard adiabatic functionals but ultimately fails to accurately capture reflection. These results may explain the underestimation of scattering probabilities in some recent studies on molecules and surfaces.

  2. Atom counting in HAADF STEM using a statistical model-based approach: methodology, possibilities, and inherent limitations.

    PubMed

    De Backer, A; Martinez, G T; Rosenauer, A; Van Aert, S

    2013-11-01

    In the present paper, a statistical model-based method to count the number of atoms of monotype crystalline nanostructures from high resolution high-angle annular dark-field (HAADF) scanning transmission electron microscopy (STEM) images is discussed in detail together with a thorough study on the possibilities and inherent limitations. In order to count the number of atoms, it is assumed that the total scattered intensity scales with the number of atoms per atom column. These intensities are quantitatively determined using model-based statistical parameter estimation theory. The distribution describing the probability that intensity values are generated by atomic columns containing a specific number of atoms is inferred on the basis of the experimental scattered intensities. Finally, the number of atoms per atom column is quantified using this estimated probability distribution. The number of atom columns available in the observed STEM image, the number of components in the estimated probability distribution, the width of the components of the probability distribution, and the typical shape of a criterion to assess the number of components in the probability distribution directly affect the accuracy and precision with which the number of atoms in a particular atom column can be estimated. It is shown that single atom sensitivity is feasible taking the latter aspects into consideration. © 2013 Elsevier B.V. All rights reserved.

  3. Stochastic description of geometric phase for polarized waves in random media

    NASA Astrophysics Data System (ADS)

    Boulanger, Jérémie; Le Bihan, Nicolas; Rossetto, Vincent

    2013-01-01

    We present a stochastic description of multiple scattering of polarized waves in the regime of forward scattering. In this regime, if the source is polarized, polarization survives along a few transport mean free paths, making it possible to measure an outgoing polarization distribution. We consider thin scattering media illuminated by a polarized source and compute the probability distribution function of the polarization on the exit surface. We solve the direct problem using compound Poisson processes on the rotation group SO(3) and non-commutative harmonic analysis. We obtain an exact expression for the polarization distribution which generalizes previous works and design an algorithm solving the inverse problem of estimating the scattering properties of the medium from the measured polarization distribution. This technique applies to thin disordered layers, spatially fluctuating media and multiple scattering systems and is based on the polarization but not on the signal amplitude. We suggest that it can be used as a non-invasive testing method.

  4. Extended bidirectional reflectance distribution function for polarized light scattering from subsurface defects under a smooth surface.

    PubMed

    Shen, Jian; Deng, Degang; Kong, Weijin; Liu, Shijie; Shen, Zicai; Wei, Chaoyang; He, Hongbo; Shao, Jianda; Fan, Zhengxiu

    2006-11-01

    By introducing the scattering probability of a subsurface defect (SSD) and statistical distribution functions of SSD radius, refractive index, and position, we derive an extended bidirectional reflectance distribution function (BRDF) from the Jones scattering matrix. This function is applicable to the calculation for comparison with measurement of polarized light-scattering resulting from a SSD. A numerical calculation of the extended BRDF for the case of p-polarized incident light was performed by means of the Monte Carlo method. Our numerical results indicate that the extended BRDF strongly depends on the light incidence angle, the light scattering angle, and the out-of-plane azimuth angle. We observe a 180 degrees symmetry with respect to the azimuth angle. We further investigate the influence of the SSD density, the substrate refractive index, and the statistical distributions of the SSD radius and refractive index on the extended BRDF. For transparent substrates, we also find the dependence of the extended BRDF on the SSD positions.

  5. The Aharonov–Bohm effect in scattering theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sitenko, Yu.A., E-mail: yusitenko@bitp.kiev.ua; Vlasii, N.D.

    2013-12-15

    The Aharonov–Bohm effect is considered as a scattering event with nonrelativistic charged particles of the wavelength which is less than the transverse size of an impenetrable magnetic vortex. The quasiclassical WKB method is shown to be efficient in solving this scattering problem. We find that the scattering cross section consists of two terms, one describing the classical phenomenon of elastic reflection and another one describing the quantum phenomenon of diffraction; the Aharonov–Bohm effect is manifested as a fringe shift in the diffraction pattern. Both the classical and the quantum phenomena are independent of the choice of a boundary condition atmore » the vortex edge, providing that probability is conserved. We show that a propagation of charged particles can be controlled by altering the flux of a magnetic vortex placed on their way. -- Highlights: •Aharonov–Bohm effect as a scattering event. •Impenetrable magnetic vortex of nonzero transverse size. •Scattering cross section is independent of a self-adjoint extension employed. •Classical phenomenon of elastic reflection and quantum phenomenon of diffraction. •Aharonov–Bohm effect as a fringe shift in the diffraction pattern.« less

  6. Rare event simulation in radiation transport

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kollman, Craig

    1993-10-01

    This dissertation studies methods for estimating extremely small probabilities by Monte Carlo simulation. Problems in radiation transport typically involve estimating very rare events or the expected value of a random variable which is with overwhelming probability equal to zero. These problems often have high dimensional state spaces and irregular geometries so that analytic solutions are not possible. Monte Carlo simulation must be used to estimate the radiation dosage being transported to a particular location. If the area is well shielded the probability of any one particular particle getting through is very small. Because of the large number of particles involved,more » even a tiny fraction penetrating the shield may represent an unacceptable level of radiation. It therefore becomes critical to be able to accurately estimate this extremely small probability. Importance sampling is a well known technique for improving the efficiency of rare event calculations. Here, a new set of probabilities is used in the simulation runs. The results are multiple by the likelihood ratio between the true and simulated probabilities so as to keep the estimator unbiased. The variance of the resulting estimator is very sensitive to which new set of transition probabilities are chosen. It is shown that a zero variance estimator does exist, but that its computation requires exact knowledge of the solution. A simple random walk with an associated killing model for the scatter of neutrons is introduced. Large deviation results for optimal importance sampling in random walks are extended to the case where killing is present. An adaptive ``learning`` algorithm for implementing importance sampling is given for more general Markov chain models of neutron scatter. For finite state spaces this algorithm is shown to give with probability one, a sequence of estimates converging exponentially fast to the true solution.« less

  7. Comments on PDF methods

    NASA Technical Reports Server (NTRS)

    Chen, J.-Y.

    1992-01-01

    Viewgraphs are presented on the following topics: the grand challenge of combustion engineering; research of probability density function (PDF) methods at Sandia; experiments of turbulent jet flames (Masri and Dibble, 1988); departures from chemical equilibrium; modeling turbulent reacting flows; superequilibrium OH radical; pdf modeling of turbulent jet flames; scatter plot for CH4 (methane) and O2 (oxygen); methanol turbulent jet flames; comparisons between predictions and experimental data; and turbulent C2H4 jet flames.

  8. Cluster membership probability: polarimetric approach

    NASA Astrophysics Data System (ADS)

    Medhi, Biman J.; Tamura, Motohide

    2013-04-01

    Interstellar polarimetric data of the six open clusters Hogg 15, NGC 6611, NGC 5606, NGC 6231, NGC 5749 and NGC 6250 have been used to estimate the membership probability for the stars within them. For proper-motion member stars, the membership probability estimated using the polarimetric data is in good agreement with the proper-motion cluster membership probability. However, for proper-motion non-member stars, the membership probability estimated by the polarimetric method is in total disagreement with the proper-motion cluster membership probability. The inconsistencies in the determined memberships may be because of the fundamental differences between the two methods of determination: one is based on stellar proper motion in space and the other is based on selective extinction of the stellar output by the asymmetric aligned dust grains present in the interstellar medium. The results and analysis suggest that the scatter of the Stokes vectors q (per cent) and u (per cent) for the proper-motion member stars depends on the interstellar and intracluster differential reddening in the open cluster. It is found that this method could be used to estimate the cluster membership probability if we have additional polarimetric and photometric information for a star to identify it as a probable member/non-member of a particular cluster, such as the maximum wavelength value (λmax), the unit weight error of the fit (σ1), the dispersion in the polarimetric position angles (overline{ɛ }), reddening (E(B - V)) or the differential intracluster reddening (ΔE(B - V)). This method could also be used to estimate the membership probability of known member stars having no membership probability as well as to resolve disagreements about membership among different proper-motion surveys.

  9. Prediction of deviations from the Rutherford formula for low-energy Coulomb scattering of wavepackets

    NASA Astrophysics Data System (ADS)

    Hoffmann, Scott E.

    2017-11-01

    We calculate the nonrelativistic scattering of a wavepacket from a Coulomb potential and find deviations from the Rutherford formula in all cases. These generally occur only at low scattering angles, where they would be obscured by the part of the incident beam that emerges essentially unscattered. For a model experiment, the scattering of helium nuclei from a thin gold foil, we find the deviation region is magnified for low incident energies (in the keV range), so that a large shadow zone of low probability around the forward direction is expected to be measurable. From a theoretical perspective, the use of wavepackets makes partial wave analysis applicable to this infinite-range potential. It allows us to calculate the everywhere finite probability for a wavepacket to wavepacket transition and to relate this to the differential cross section. Time delays and advancements in the detection probabilities can be calculated. We investigate the optical theorem as applied to this special case.

  10. Rare Event Simulation in Radiation Transport

    NASA Astrophysics Data System (ADS)

    Kollman, Craig

    This dissertation studies methods for estimating extremely small probabilities by Monte Carlo simulation. Problems in radiation transport typically involve estimating very rare events or the expected value of a random variable which is with overwhelming probability equal to zero. These problems often have high dimensional state spaces and irregular geometries so that analytic solutions are not possible. Monte Carlo simulation must be used to estimate the radiation dosage being transported to a particular location. If the area is well shielded the probability of any one particular particle getting through is very small. Because of the large number of particles involved, even a tiny fraction penetrating the shield may represent an unacceptable level of radiation. It therefore becomes critical to be able to accurately estimate this extremely small probability. Importance sampling is a well known technique for improving the efficiency of rare event calculations. Here, a new set of probabilities is used in the simulation runs. The results are multiplied by the likelihood ratio between the true and simulated probabilities so as to keep our estimator unbiased. The variance of the resulting estimator is very sensitive to which new set of transition probabilities are chosen. It is shown that a zero variance estimator does exist, but that its computation requires exact knowledge of the solution. A simple random walk with an associated killing model for the scatter of neutrons is introduced. Large deviation results for optimal importance sampling in random walks are extended to the case where killing is present. An adaptive "learning" algorithm for implementing importance sampling is given for more general Markov chain models of neutron scatter. For finite state spaces this algorithm is shown to give, with probability one, a sequence of estimates converging exponentially fast to the true solution. In the final chapter, an attempt to generalize this algorithm to a continuous state space is made. This involves partitioning the space into a finite number of cells. There is a tradeoff between additional computation per iteration and variance reduction per iteration that arises in determining the optimal grid size. All versions of this algorithm can be thought of as a compromise between deterministic and Monte Carlo methods, capturing advantages of both techniques.

  11. Adjoint Fokker-Planck equation and runaway electron dynamics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Chang; Brennan, Dylan P.; Bhattacharjee, Amitava

    2016-01-15

    The adjoint Fokker-Planck equation method is applied to study the runaway probability function and the expected slowing-down time for highly relativistic runaway electrons, including the loss of energy due to synchrotron radiation. In direct correspondence to Monte Carlo simulation methods, the runaway probability function has a smooth transition across the runaway separatrix, which can be attributed to effect of the pitch angle scattering term in the kinetic equation. However, for the same numerical accuracy, the adjoint method is more efficient than the Monte Carlo method. The expected slowing-down time gives a novel method to estimate the runaway current decay timemore » in experiments. A new result from this work is that the decay rate of high energy electrons is very slow when E is close to the critical electric field. This effect contributes further to a hysteresis previously found in the runaway electron population.« less

  12. Impact of signal scattering and parametric uncertainties on receiver operating characteristics

    NASA Astrophysics Data System (ADS)

    Wilson, D. Keith; Breton, Daniel J.; Hart, Carl R.; Pettit, Chris L.

    2017-05-01

    The receiver operating characteristic (ROC curve), which is a plot of the probability of detection as a function of the probability of false alarm, plays a key role in the classical analysis of detector performance. However, meaningful characterization of the ROC curve is challenging when practically important complications such as variations in source emissions, environmental impacts on the signal propagation, uncertainties in the sensor response, and multiple sources of interference are considered. In this paper, a relatively simple but realistic model for scattered signals is employed to explore how parametric uncertainties impact the ROC curve. In particular, we show that parametric uncertainties in the mean signal and noise power substantially raise the tails of the distributions; since receiver operation with a very low probability of false alarm and a high probability of detection is normally desired, these tails lead to severely degraded performance. Because full a priori knowledge of such parametric uncertainties is rarely available in practice, analyses must typically be based on a finite sample of environmental states, which only partially characterize the range of parameter variations. We show how this effect can lead to misleading assessments of system performance. For the cases considered, approximately 64 or more statistically independent samples of the uncertain parameters are needed to accurately predict the probabilities of detection and false alarm. A connection is also described between selection of suitable distributions for the uncertain parameters, and Bayesian adaptive methods for inferring the parameters.

  13. Time dependent three-dimensional body frame quantal wave packet treatment of the H + H2 exchange reaction on the Liu-Siegbahn-Truhlar-Horowitz (LSTH) surface

    NASA Technical Reports Server (NTRS)

    Neuhauser, Daniel; Baer, Michael; Judson, Richard S.; Kouri, Donald J.

    1989-01-01

    The first successful application of the three-dimensional quantum body frame wave packet approach to reactive scattering is reported for the H + H2 exchange reaction on the LSTH potential surface. The method used is based on a procedure for calculating total reaction probabilities from wave packets. It is found that converged, vibrationally resolved reactive probabilities can be calculated with a grid that is not much larger than required for the pure inelastic calculation. Tabular results are presented for several energies.

  14. Light enpolarization by disordered media under partial polarized illumination: the role of cross-scattering coefficients.

    PubMed

    Zerrad, M; Soriano, G; Ghabbach, A; Amra, C

    2013-02-11

    We show how disordered media allow to increase the local degree of polarization (DOP) of an arbitrary (partial) polarized incident beam. The role of cross-scattering coefficients is emphasized, together with the probability density functions (PDF) of the scattering DOP. The average DOP of scattering is calculated versus the incident illumination DOP.

  15. Multivariate Density Estimation and Remote Sensing

    NASA Technical Reports Server (NTRS)

    Scott, D. W.

    1983-01-01

    Current efforts to develop methods and computer algorithms to effectively represent multivariate data commonly encountered in remote sensing applications are described. While this may involve scatter diagrams, multivariate representations of nonparametric probability density estimates are emphasized. The density function provides a useful graphical tool for looking at data and a useful theoretical tool for classification. This approach is called a thunderstorm data analysis.

  16. Maximum-likelihood fitting of data dominated by Poisson statistical uncertainties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoneking, M.R.; Den Hartog, D.J.

    1996-06-01

    The fitting of data by {chi}{sup 2}-minimization is valid only when the uncertainties in the data are normally distributed. When analyzing spectroscopic or particle counting data at very low signal level (e.g., a Thomson scattering diagnostic), the uncertainties are distributed with a Poisson distribution. The authors have developed a maximum-likelihood method for fitting data that correctly treats the Poisson statistical character of the uncertainties. This method maximizes the total probability that the observed data are drawn from the assumed fit function using the Poisson probability function to determine the probability for each data point. The algorithm also returns uncertainty estimatesmore » for the fit parameters. They compare this method with a {chi}{sup 2}-minimization routine applied to both simulated and real data. Differences in the returned fits are greater at low signal level (less than {approximately}20 counts per measurement). the maximum-likelihood method is found to be more accurate and robust, returning a narrower distribution of values for the fit parameters with fewer outliers.« less

  17. Particle Identification in Nuclear Emulsion by Measuring Multiple Coulomb Scattering

    NASA Astrophysics Data System (ADS)

    Than Tint, Khin; Nakazawa, Kazuma; Yoshida, Junya; Kyaw Soe, Myint; Mishina, Akihiro; Kinbara, Shinji; Itoh, Hiroki; Endo, Yoko; Kobayashi, Hidetaka; E07 Collaboration

    2014-09-01

    We are developing particle identification techniques for single charged particles such as Xi, proton, K and π by measuring multiple Coulomb scattering in nuclear emulsion. Nuclear emulsion is the best three dimensional detector for double strangeness (S = -2) nuclear system. We expect to accumulate about 10000 Xi-minus stop events which produce double lambda hypernucleus in J-PARC E07 emulsion counter hybrid experiment. The purpose of this particle identification (PID) in nuclear emulsion is to purify Xi-minus stop events which gives information about production probability of double hypernucleus and branching ratio of decay mode. Amount of scattering parameterized as angular distribution and second difference is inversely proportional to the momentum of particle. We produced several thousands of various charged particle tracks in nuclear emulsion stack via Geant4 simulation. In this talk, PID with some measuring methods for multiple scattering will be discussed by comparing with simulation data and real Xi-minus stop events in KEK-E373 experiment.

  18. Probability density function formalism for optical coherence tomography signal analysis: a controlled phantom study.

    PubMed

    Weatherbee, Andrew; Sugita, Mitsuro; Bizheva, Kostadinka; Popov, Ivan; Vitkin, Alex

    2016-06-15

    The distribution of backscattered intensities as described by the probability density function (PDF) of tissue-scattered light contains information that may be useful for tissue assessment and diagnosis, including characterization of its pathology. In this Letter, we examine the PDF description of the light scattering statistics in a well characterized tissue-like particulate medium using optical coherence tomography (OCT). It is shown that for low scatterer density, the governing statistics depart considerably from a Gaussian description and follow the K distribution for both OCT amplitude and intensity. The PDF formalism is shown to be independent of the scatterer flow conditions; this is expected from theory, and suggests robustness and motion independence of the OCT amplitude (and OCT intensity) PDF metrics in the context of potential biomedical applications.

  19. Coherent model of L-band radar scattering by soybean plants: model development, validation and retrieval

    USDA-ARS?s Scientific Manuscript database

    An improved coherent branching model for L-band radar remote sensing of soybean is proposed by taking into account the correlated scattering among scatterers. The novel feature of the analytic coherent model consists of conditional probability functions to eliminate the overlapping effects of branc...

  20. Scattering of Femtosecond Laser Pulses on the Negative Hydrogen Ion

    NASA Astrophysics Data System (ADS)

    Astapenko, V. A.; Moroz, N. N.

    2018-05-01

    Elastic scattering of ultrashort laser pulses (USLPs) on the negative hydrogen ion is considered. Results of calculations of the USLP scattering probability are presented and analyzed for pulses of two types: the corrected Gaussian pulse and wavelet pulse without carrier frequency depending on the problem parameters.

  1. Constraints on scattering amplitudes in multistate Landau-Zener theory

    NASA Astrophysics Data System (ADS)

    Sinitsyn, Nikolai A.; Lin, Jeffmin; Chernyak, Vladimir Y.

    2017-01-01

    We derive a set of constraints, which we will call hierarchy constraints, on scattering amplitudes of an arbitrary multistate Landau-Zener model (MLZM). The presence of additional symmetries can transform such constraints into nontrivial relations between elements of the transition probability matrix. This observation can be used to derive complete solutions of some MLZMs or, for models that cannot be solved completely, to reduce the number of independent elements of the transition probability matrix.

  2. Effect of nanodiamond fluorination on the efficiency of quasispecular reflection of cold neutrons

    NASA Astrophysics Data System (ADS)

    Nesvizhevsky, V. V.; Dubois, M.; Gutfreund, Ph.; Lychagin, E. V.; Nezvanov, A. Yu.; Zhernenkov, K. N.

    2018-02-01

    Nanomaterials, which show large reflectivity for external radiation, are of general interest in science and technology. We report a result from our ongoing research on the reflection of low-energy neutrons from powders of detonation diamond nanoparticles. Our previous work showed a large probability for quasispecular reflection of neutrons from this medium. The model of neutron scattering from nanoparticles, which we have developed, suggests two ways to increase the quasispecular reflection probability: (1) the reduction of incoherent scattering by substitution of hydrogen with fluorine inside the nanoparticles, and (2) the sharpening of the neutron optical potential step by removal of amorphous s p2 carbon from the nanoparticle shells. We present experimental results on scattering of slow neutrons from both raw and fluorinated diamond nanoparticles with amorphous s p2 carbon removed by gas-solid fluorination. These results show a clear increase in quasispecular reflection probability.

  3. Generalized Bloch theorem for complex periodic potentials: A powerful application to quantum transport calculations

    NASA Astrophysics Data System (ADS)

    Zhang, X.-G.; Varga, Kalman; Pantelides, Sokrates T.

    2007-07-01

    Band-theoretic methods with periodically repeated supercells have been a powerful approach for ground-state electronic structure calculations but have not so far been adapted for quantum transport problems with open boundary conditions. Here, we introduce a generalized Bloch theorem for complex periodic potentials and use a transfer-matrix formulation to cast the transmission probability in a scattering problem with open boundary conditions in terms of the complex wave vectors of a periodic system with absorbing layers, allowing a band technique for quantum transport calculations. The accuracy and utility of the method are demonstrated by the model problems of the transmission of an electron over a square barrier and the scattering of a phonon in an inhomogeneous nanowire. Application to the resistance of a twin boundary in nanocrystalline copper yields excellent agreement with recent experimental data.

  4. Precise calculations in simulations of the interaction of low energy neutrons with nano-dispersed media

    NASA Astrophysics Data System (ADS)

    Artem'ev, V. A.; Nezvanov, A. Yu.; Nesvizhevsky, V. V.

    2016-01-01

    We discuss properties of the interaction of slow neutrons with nano-dispersed media and their application for neutron reflectors. In order to increase the accuracy of model simulation of the interaction of neutrons with nanopowders, we perform precise quantum mechanical calculation of potential scattering of neutrons on single nanoparticles using the method of phase functions. We compare results of precise calculations with those performed within first Born approximation for nanodiamonds with the radius of 2-5 nm and for neutron energies 3 × 10-7-10-3 eV. Born approximation overestimates the probability of scattering to large angles, while the accuracy of evaluation of integral characteristics (cross sections, albedo) is acceptable. Using Monte-Carlo method, we calculate albedo of neutrons from different layers of piled up diamond nanopowder.

  5. Time-independent quantum dynamics for diatom-surface scattering

    NASA Astrophysics Data System (ADS)

    Saalfrank, Peter; Miller, William H.

    1993-06-01

    Two time-independent quantum reactive scattering methods, namely, the S-matrix Kohn technique to compute the full S-matrix, and the absorbing boundary Green's function method to compute cumulative reaction probabilities, are applied here to the case of diatom-surface scattering. In both cases a discrete variable representation for the operators is used. We test the methods for two- and three-dimensional uncorrugated potential energy surfaces, which have been used earlier by Halstead et al. [J. Chem. Phys. 93, 2359 (1990)] and by Sheng et al. [J. Chem. Phys. 97, 684 (1992)] in studies of H2 dissociating on metal substrates with theoretical techniques different from those applied here. We find overall but not always perfect agreement with these earlier studies. Based on ab initio data and experiment, a new, six-dimensional potential energy surface for the dissociative chemisorption of H2 on Ni(100) is proposed. Two- and three-dimensional cuts through the new potential are performed to illustrate special dynamical aspects of this particular molecule-surface reaction: (i) the role of corrugation effects, (ii) the importance of the ``cartwheel'' rotation of H2, and (iii) the role of the ``helicopter'' degree of freedom for the adsorbing molecule.

  6. Quantum scattering in one-dimensional systems satisfying the minimal length uncertainty relation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernardo, Reginald Christian S., E-mail: rcbernardo@nip.upd.edu.ph; Esguerra, Jose Perico H., E-mail: jesguerra@nip.upd.edu.ph

    In quantum gravity theories, when the scattering energy is comparable to the Planck energy the Heisenberg uncertainty principle breaks down and is replaced by the minimal length uncertainty relation. In this paper, the consequences of the minimal length uncertainty relation on one-dimensional quantum scattering are studied using an approach involving a recently proposed second-order differential equation. An exact analytical expression for the tunneling probability through a locally-periodic rectangular potential barrier system is obtained. Results show that the existence of a non-zero minimal length uncertainty tends to shift the resonant tunneling energies to the positive direction. Scattering through a locally-periodic potentialmore » composed of double-rectangular potential barriers shows that the first band of resonant tunneling energies widens for minimal length cases when the double-rectangular potential barrier is symmetric but narrows down when the double-rectangular potential barrier is asymmetric. A numerical solution which exploits the use of Wronskians is used to calculate the transmission probabilities through the Pöschl–Teller well, Gaussian barrier, and double-Gaussian barrier. Results show that the probability of passage through the Pöschl–Teller well and Gaussian barrier is smaller in the minimal length cases compared to the non-minimal length case. For the double-Gaussian barrier, the probability of passage for energies that are more positive than the resonant tunneling energy is larger in the minimal length cases compared to the non-minimal length case. The approach is exact and applicable to many types of scattering potential.« less

  7. Constraints on scattering amplitudes in multistate Landau-Zener theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinitsyn, Nikolai A.; Lin, Jeffmin; Chernyak, Vladimir Y.

    2017-01-30

    Here, we derive a set of constraints, which we will call hierarchy constraints, on scattering amplitudes of an arbitrary multistate Landau-Zener model (MLZM). The presence of additional symmetries can transform such constraints into nontrivial relations between elements of the transition probability matrix. This observation can be used to derive complete solutions of some MLZMs or, for models that cannot be solved completely, to reduce the number of independent elements of the transition probability matrix.

  8. Theoretical Transport Studies of Non-equilibrium Carriers Driven by High Electric Fields

    DTIC Science & Technology

    2012-04-25

    for two different types of confinement. Motivated by our desire to understand scattering processes in quantum wires in a simple way, in the final...Π’s are probability propagators. The probability propagators can be found, for example, by solving a Master equation if the motion is fully inco - herent...shown that when the transport is coherent (i.e. there are no phase- breaking scattering processes ), the current in the conductor is related to the

  9. Quantum hydrodynamics: capturing a reactive scattering resonance.

    PubMed

    Derrickson, Sean W; Bittner, Eric R; Kendrick, Brian K

    2005-08-01

    The hydrodynamic equations of motion associated with the de Broglie-Bohm formulation of quantum mechanics are solved using a meshless method based upon a moving least-squares approach. An arbitrary Lagrangian-Eulerian frame of reference and a regridding algorithm which adds and deletes computational points are used to maintain a uniform and nearly constant interparticle spacing. The methodology also uses averaged fields to maintain unitary time evolution. The numerical instabilities associated with the formation of nodes in the reflected portion of the wave packet are avoided by adding artificial viscosity to the equations of motion. A new and more robust artificial viscosity algorithm is presented which gives accurate scattering results and is capable of capturing quantum resonances. The methodology is applied to a one-dimensional model chemical reaction that is known to exhibit a quantum resonance. The correlation function approach is used to compute the reactive scattering matrix, reaction probability, and time delay as a function of energy. Excellent agreement is obtained between the scattering results based upon the quantum hydrodynamic approach and those based upon standard quantum mechanics. This is the first clear demonstration of the ability of moving grid approaches to accurately and robustly reproduce resonance structures in a scattering system.

  10. Probability density cloud as a geometrical tool to describe statistics of scattered light.

    PubMed

    Yaitskova, Natalia

    2017-04-01

    First-order statistics of scattered light is described using the representation of the probability density cloud, which visualizes a two-dimensional distribution for complex amplitude. The geometric parameters of the cloud are studied in detail and are connected to the statistical properties of phase. The moment-generating function for intensity is obtained in a closed form through these parameters. An example of exponentially modified normal distribution is provided to illustrate the functioning of this geometrical approach.

  11. Effects of periodic forcing in chaotic scattering

    NASA Astrophysics Data System (ADS)

    Blesa, Fernando; Seoane, Jesús M.; Barrio, Roberto; Sanjuán, Miguel A. F.

    2014-04-01

    The effects of a periodic forcing on chaotic scattering are relevant in certain situations of physical interest. We investigate the effects of the forcing amplitude and the external frequency in both the survival probability of the particles in the scattering region and the exit basins associated to phase space. We have found an exponential decay law for the survival probability of the particles in the scattering region. A resonant-like behavior is uncovered where the critical values of the frequencies ω ≃1 and ω ≃2 permit the particles to escape faster than for other different values. On the other hand, the computation of the exit basins in phase space reveals the existence of Wada basins depending of the frequency values. We provide some heuristic arguments that are in good agreement with the numerical results. Our results are expected to be relevant for physical phenomena such as the effect of companion galaxies, among others.

  12. X-ray Emission Line Anisotropy Effects on the Isoelectronic Temperature Measurement Method

    NASA Astrophysics Data System (ADS)

    Liedahl, Duane; Barrios, Maria; Brown, Greg; Foord, Mark; Gray, William; Hansen, Stephanie; Heeter, Robert; Jarrott, Leonard; Mauche, Christopher; Moody, John; Schneider, Marilyn; Widmann, Klaus

    2016-10-01

    Measurements of the ratio of analogous emission lines from isoelectronic ions of two elements form the basis of the isoelectronic method of inferring electron temperatures in laser-produced plasmas, with the expectation that atomic modeling errors cancel to first order. Helium-like ions are a common choice in many experiments. Obtaining sufficiently bright signals often requires sample sizes with non-trivial line optical depths. For lines with small destruction probabilities per scatter, such as the 1s2p-1s2 He-like resonance line, repeated scattering can cause a marked angular dependence in the escaping radiation. Isoelectronic lines from near-Z equimolar dopants have similar optical depths and similar angular variations, which leads to a near angular-invariance for their line ratios. Using Monte Carlo simulations, we show that possible ambiguities associated with anisotropy in deriving electron temperatures from X-ray line ratios are minimized by exploiting this isoelectronic invariance.

  13. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. Communication: Energy transfer and reaction dynamics for DCl scattering on Au(111): An ab initio molecular dynamics study.

    PubMed

    Kolb, Brian; Guo, Hua

    2016-07-07

    Scattering and dissociative chemisorption of DCl on Au(111) are investigated using ab initio molecular dynamics with a slab model, in which the top two layers of Au are mobile. Substantial kinetic energy loss in the scattered DCl is found, but the amount of energy transfer is notably smaller than that observed in the experiment. On the other hand, the dissociative chemisorption probability reproduces the experimental trend with respect to the initial kinetic energy, but is about one order of magnitude larger than the reported initial sticking probability. While the theory-experiment agreement is significantly improved from the previous rigid surface model, the remaining discrepancies are still substantial, calling for further scrutiny in both theory and experiment.

  15. On-the-Fly Generation of Differential Resonance Scattering Probability Distribution Functions for Monte Carlo Codes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davidson, Eva E.; Martin, William R.

    Current Monte Carlo codes use one of three models: (1) the asymptotic scattering model, (2) the free gas scattering model, or (3) the S(α,β) model, depending on the neutron energy and the specific Monte Carlo code. This thesis addresses the consequences of using the free gas scattering model, which assumes that the neutron interacts with atoms in thermal motion in a monatomic gas in thermal equilibrium at material temperature, T. Most importantly, the free gas model assumes the scattering cross section is constant over the neutron energy range, which is usually a good approximation for light nuclei, but not formore » heavy nuclei where the scattering cross section may have several resonances in the epithermal region. Several researchers in the field have shown that the exact resonance scattering model is temperaturedependent, and neglecting the resonances in the lower epithermal range can under-predict resonance absorption due to the upscattering phenomenon mentioned above, leading to an over-prediction of keff by several hundred pcm. Existing methods to address this issue involve changing the neutron weights or implementing an extra rejection scheme in the free gas sampling scheme, and these all involve performing the collision analysis in the center-of-mass frame, followed by a conversion back to the laboratory frame to continue the random walk of the neutron. The goal of this paper was to develop a sampling methodology that (1) accounted for the energydependent scattering cross sections in the collision analysis and (2) was performed in the laboratory frame,avoiding the conversion to the center-of-mass frame. The energy dependence of the scattering cross section was modeled with even-ordered polynomials (2nd and 4th order) to approximate the scattering cross section in Blackshaw’s equations for the moments of the differential scattering PDFs. These moments were used to sample the outgoing neutron speed and angle in the laboratory frame on-the-fly during the random walk of the neutron. Results for criticality studies on fuel pin and fuel assembly calculations using methods developed in this dissertation showed very close comparison to results using the reference Dopplerbroadened rejection correction (DBRC) scheme.« less

  16. On-the-Fly Generation of Differential Resonance Scattering Probability Distribution Functions for Monte Carlo Codes

    DOE PAGES

    Davidson, Eva E.; Martin, William R.

    2017-05-26

    Current Monte Carlo codes use one of three models: (1) the asymptotic scattering model, (2) the free gas scattering model, or (3) the S(α,β) model, depending on the neutron energy and the specific Monte Carlo code. This thesis addresses the consequences of using the free gas scattering model, which assumes that the neutron interacts with atoms in thermal motion in a monatomic gas in thermal equilibrium at material temperature, T. Most importantly, the free gas model assumes the scattering cross section is constant over the neutron energy range, which is usually a good approximation for light nuclei, but not formore » heavy nuclei where the scattering cross section may have several resonances in the epithermal region. Several researchers in the field have shown that the exact resonance scattering model is temperaturedependent, and neglecting the resonances in the lower epithermal range can under-predict resonance absorption due to the upscattering phenomenon mentioned above, leading to an over-prediction of keff by several hundred pcm. Existing methods to address this issue involve changing the neutron weights or implementing an extra rejection scheme in the free gas sampling scheme, and these all involve performing the collision analysis in the center-of-mass frame, followed by a conversion back to the laboratory frame to continue the random walk of the neutron. The goal of this paper was to develop a sampling methodology that (1) accounted for the energydependent scattering cross sections in the collision analysis and (2) was performed in the laboratory frame,avoiding the conversion to the center-of-mass frame. The energy dependence of the scattering cross section was modeled with even-ordered polynomials (2nd and 4th order) to approximate the scattering cross section in Blackshaw’s equations for the moments of the differential scattering PDFs. These moments were used to sample the outgoing neutron speed and angle in the laboratory frame on-the-fly during the random walk of the neutron. Results for criticality studies on fuel pin and fuel assembly calculations using methods developed in this dissertation showed very close comparison to results using the reference Dopplerbroadened rejection correction (DBRC) scheme.« less

  17. SAXS Combined with UV-vis Spectroscopy and QELS: Accurate Characterization of Silver Sols Synthesized in Polymer Matrices.

    PubMed

    Bulavin, Leonid; Kutsevol, Nataliya; Chumachenko, Vasyl; Soloviov, Dmytro; Kuklin, Alexander; Marynin, Andrii

    2016-12-01

    The present work demonstrates a validation of small-angle X-ray scattering (SAXS) combining with ultra violet and visible (UV-vis) spectroscopy and quasi-elastic light scattering (QELS) analysis for characterization of silver sols synthesized in polymer matrices. Polymer matrix internal structure and polymer chemical nature actually controlled the sol size characteristics. It was shown that for precise analysis of nanoparticle size distribution these techniques should be used simultaneously. All applied methods were in good agreement for the characterization of size distribution of small particles (less than 60 nm) in the sols. Some deviations of the theoretical curves from the experimental ones were observed. The most probable cause is that nanoparticles were not entirely spherical in form.

  18. Poly-Gaussian model of randomly rough surface in rarefied gas flow

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aksenova, Olga A.; Khalidov, Iskander A.

    2014-12-09

    Surface roughness is simulated by the model of non-Gaussian random process. Our results for the scattering of rarefied gas atoms from a rough surface using modified approach to the DSMC calculation of rarefied gas flow near a rough surface are developed and generalized applying the poly-Gaussian model representing probability density as the mixture of Gaussian densities. The transformation of the scattering function due to the roughness is characterized by the roughness operator. Simulating rough surface of the walls by the poly-Gaussian random field expressed as integrated Wiener process, we derive a representation of the roughness operator that can be appliedmore » in numerical DSMC methods as well as in analytical investigations.« less

  19. Probing the structure of the stable Xe isotopes with inelastic neutron scattering

    NASA Astrophysics Data System (ADS)

    Peters, Erin E.; Ross, Timothy J.; Crider, Benjamin P.; Yates, Steven W.

    2018-05-01

    The stable isotopes of xenon, which have attracted interest for a number of reasons, span a transitional region that evolves from γ-soft structures for the lighter mass isotopes to nearly spherical 136Xe with a closed neutron shell. The nature of this transition, which is gradual, is not well understood. To provide detailed spectroscopic information on the Xe isotopes, we have studied 130,132,134,136Xe at the University of Kentucky Accelerator Laboratory using inelastic neutron scattering and γ-ray detection. These measurements yielded γ-ray angular distributions, branching ratios, multipole mixing ratios, and level lifetimes (from the Doppler-shift attenuation method), which allowed the determination of reduced transition probabilities and provided insight into the structure of these nuclei.

  20. Estimation of seismic attenuation in carbonate rocks using three different methods: Application on VSP data from Abu Dhabi oilfield

    NASA Astrophysics Data System (ADS)

    Bouchaala, F.; Ali, M. Y.; Matsushima, J.

    2016-06-01

    In this study a relationship between the seismic wavelength and the scale of heterogeneity in the propagating medium has been examined. The relationship estimates the size of heterogeneity that significantly affects the wave propagation at a specific frequency, and enables a decrease in the calculation time of wave scattering estimation. The relationship was applied in analyzing synthetic and Vertical Seismic Profiling (VSP) data obtained from an onshore oilfield in the Emirate of Abu Dhabi, United Arab Emirates. Prior to estimation of the attenuation, a robust processing workflow was applied to both synthetic and recorded data to increase the Signal-to-Noise Ratio (SNR). Two conventional methods of spectral ratio and centroid frequency shift methods were applied to estimate the attenuation from the extracted seismic waveforms in addition to a new method based on seismic interferometry. The attenuation profiles derived from the three approaches demonstrated similar variation, however the interferometry method resulted in greater depth resolution, differences in attenuation magnitude. Furthermore, the attenuation profiles revealed significant contribution of scattering on seismic wave attenuation. The results obtained from the seismic interferometry method revealed estimated scattering attenuation ranges from 0 to 0.1 and estimated intrinsic attenuation can reach 0.2. The subsurface of the studied zones is known to be highly porous and permeable, which suggest that the mechanism of the intrinsic attenuation is probably the interactions between pore fluids and solids.

  1. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  2. The zig-zag walk with scattering and absorption on the real half line and in a lattice model

    NASA Astrophysics Data System (ADS)

    Wuttke, Joachim

    2014-05-01

    The Darwin-Hamilton equations, describing one-dimensional transport with scattering and absorption, are expanded into a recursion. The solution involves ballot numbers. The recurrence probability as function of scattering order is given by Catalan numbers. To reproduce this analytical result in a lattice model, a novel relation between Narayana and Catalan numbers is derived.

  3. Non-negative Matrix Factorization for Self-calibration of Photometric Redshift Scatter in Weak-lensing Surveys

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Le; Yu, Yu; Zhang, Pengjie, E-mail: lezhang@sjtu.edu.cn

    Photo- z error is one of the major sources of systematics degrading the accuracy of weak-lensing cosmological inferences. Zhang et al. proposed a self-calibration method combining galaxy–galaxy correlations and galaxy–shear correlations between different photo- z bins. Fisher matrix analysis shows that it can determine the rate of photo- z outliers at a level of 0.01%–1% merely using photometric data and do not rely on any prior knowledge. In this paper, we develop a new algorithm to implement this method by solving a constrained nonlinear optimization problem arising in the self-calibration process. Based on the techniques of fixed-point iteration and non-negativemore » matrix factorization, the proposed algorithm can efficiently and robustly reconstruct the scattering probabilities between the true- z and photo- z bins. The algorithm has been tested extensively by applying it to mock data from simulated stage IV weak-lensing projects. We find that the algorithm provides a successful recovery of the scatter rates at the level of 0.01%–1%, and the true mean redshifts of photo- z bins at the level of 0.001, which may satisfy the requirements in future lensing surveys.« less

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, H; Medin, P; Jiang, S

    Purpose: In-treatment tumor localization is critical for the management of tumor motion in lung cancer radiotherapy. Conventional tumor-tracking methods using a kV or MV x-ray projection has limited contrast. To facilitate real-time, marker-less and low-dose in-treatment image tumor tracking, we propose a novel scheme using Compton scatter imaging. This study reports Monte Carlo (MC) simulations on this scheme for the purpose of proof-of-principle. Methods: A slit x-ray beam along the patient superior-inferior (SI) direction is directed to the patient, intersecting the patient lung at a 2D plane containing majority part of the tumor motion trajectory. X-ray photons are scattered duemore » to Compton effect from this plane, which are spatially collimated by, e.g., a pinhole, on one side of the plane and then captured by a detector behind it. The captured image, after correcting for x-ray attenuation and scatter angle variation, reflects the electron density, which allows visualization of the instantaneous anatomy on this plane. We performed MC studies on a phantom and a patient case for the initial test of this proposed method. Results: In the phantom case, the contrast-resolution calculated using tumor/lung as foreground/background for kV fluoroscopy, cone-beam CT, and scattering image were 0.0625, 0.6993, and 0.5290, respectively. In the patient case, tumor motion can be clearly observed in the scatter images. Compared to fluoroscopy, scattering imaging also significantly reduced imaging dose because of its narrower beam design. Conclusion: MC simulation studies demonstrated the potential of the proposed scheme in terms of capturing the instantaneous anatomy of a patient on a 2D plane. Clear visualization of the tumor will probably facilitate ‘marker-less’ and ‘real-time’ tumor tracking with low imaging dose. NIH (1R01CA154747-01, 1R21CA178787-01A1 and 1R21EB017978-01A1)« less

  5. A mathematical characterization of vegetation effect on microwave remote sensing from the Earth

    NASA Technical Reports Server (NTRS)

    Choe, Y.; Tsang, L.

    1983-01-01

    In passive microwave remote sensing of the earth, a theoretical model that utilizes the radiative transfer equations was developed to account for the volume scattering effects of the vegetation canopy. Vegetation canopies such as alfalfa, sorghum, and corn are simulated by a layer of ellipsoidal scatterers and cylindrical structures. The ellipsoidal scatterers represent the leaves of vegetation and are randomly positioned and oriented. The orientation of ellipsoids is characterized by a probability density function of Eulerian angles of rotation. The cylindrical structures represent the stalks of vegetation and their radii are assumed to be much smaller than their lengths. The underlying soil is represented by a half-space medium with a homogeneous permittivity and uniform temperature profile. The radiative transfer quations are solved by a numerical method using a Gaussian quadrature formula to compute both the vertical and horizontal polarized brightness temperature as a function of observation angle. The theory was applied to the interpretation of experimental data obtained from sorghum covered fields near College Station, Texas.

  6. Incoherent Scatterer in a Luttinger Liquid: A New Paradigmatic Limit

    NASA Astrophysics Data System (ADS)

    Altland, Alexander; Gefen, Yuval; Rosenow, Bernd

    2012-03-01

    We address the problem of a Luttinger liquid with a scatterer that allows for both coherent and incoherent scattering channels. The asymptotic behavior at zero temperature is governed by a new stable fixed point: A Goldstone mode dominates the low energy dynamics, leading to universal behavior. This limit is marked by equal probabilities for forward and backward scattering. Notwithstanding this nontrivial scattering pattern, we find that the shot noise as well as cross-current correlations vanish. We thus present a paradigmatic picture of an impurity in the Luttinger model, alternative to the Kane-Fisher picture.

  7. Selectivity in the inelastic rotational scattering of D2 and HD molecules from graphite: Similarities and differences respect to the H2 case

    NASA Astrophysics Data System (ADS)

    Rutigliano, Maria; Pirani, Fernando

    2018-03-01

    The inelastic scattering of D2 and HD molecules impinging on a graphite surface in well-defined initial roto-vibrational states has been studied by using the computational setup recently developed to characterize important selectivities in the molecular dynamics occurring at the gas-surface interface. In order to make an immediate comparison of determined elastic and inelastic scattering probabilities, we considered for D2 and HD molecules the same initial states, as well as the same collision energy range, previously selected for the investigation of H2 behaviour. The analysis of the back-scattered molecules shows that, while low-lying initial vibrational states are preserved, the medium-high initial ones give rise to final states covering the complete ladder of vibrational levels, although with different probability for the various cases investigated. Moreover, propensities in the formation of the final rotational states are found to depend strongly on the initial ones, on the collision energy, and on the isotopologue species.

  8. Fruit Size Determines the Role of Three Scatter-Hoarding Rodents as Dispersers or Seed Predators of a Fleshy-Fruited Atacama Desert Shrub

    PubMed Central

    Loayza, Andrea P.; Squeo, Francisco A.

    2016-01-01

    Scatter-hoarding rodents can act as both predators and dispersers for many large-seeded plants because they cache seeds for future use, but occasionally forget them in sites with high survival and establishment probabilities. The most important fruit or seed trait influencing rodent foraging behavior is seed size; rodents prefer large seeds because they have higher nutritional content, but this preference can be counterbalanced by the higher costs of handling larger seeds. We designed a cafeteria experiment to assess whether fruit and seed size of Myrcianthes coquimbensis, an endangered desert shrub, influence the decision-making process during foraging by three species of scatter-hoarding rodents differing in body size: Abrothrix olivaceus, Phyllotis darwini and Octodon degus. We found that the size of fruits and seeds influenced foraging behavior in the three rodent species; the probability of a fruit being harvested and hoarded was higher for larger fruits than for smaller ones. Patterns of fruit size preference were not affected by rodent size; all species were able to hoard fruits within the entire range of sizes offered. Finally, fruit and seed size had no effect on the probability of seed predation, rodents typically ate only the fleshy pulp of the fruits offered and discarded whole, intact seeds. In conclusion, our results reveal that larger M. coquimbensis fruits have higher probabilities of being harvested, and ultimately of its seeds being hoarded and dispersed by scatter-hoarding rodents. As this plant has no other dispersers, rodents play an important role in its recruitment dynamics. PMID:27861550

  9. Probabilistic Simulation of Progressive Fracture in Bolted-Joint Composite Laminates

    NASA Technical Reports Server (NTRS)

    Minnetyan, L.; Singhal, S. N.; Chamis, C. C.

    1996-01-01

    This report describes computational methods to probabilistically simulate fracture in bolted composite structures. An innovative approach that is independent of stress intensity factors and fracture toughness was used to simulate progressive fracture. The effect of design variable uncertainties on structural damage was also quantified. A fast probability integrator assessed the scatter in the composite structure response before and after damage. Then the sensitivity of the response to design variables was computed. General-purpose methods, which are applicable to bolted joints in all types of structures and in all fracture processes-from damage initiation to unstable propagation and global structure collapse-were used. These methods were demonstrated for a bolted joint of a polymer matrix composite panel under edge loads. The effects of the fabrication process were included in the simulation of damage in the bolted panel. Results showed that the most effective way to reduce end displacement at fracture is to control both the load and the ply thickness. The cumulative probability for longitudinal stress in all plies was most sensitive to the load; in the 0 deg. plies it was very sensitive to ply thickness. The cumulative probability for transverse stress was most sensitive to the matrix coefficient of thermal expansion. In addition, fiber volume ratio and fiber transverse modulus both contributed significantly to the cumulative probability for the transverse stresses in all the plies.

  10. Self-calibration of photometric redshift scatter in weak-lensing surveys

    DOE PAGES

    Zhang, Pengjie; Pen, Ue -Li; Bernstein, Gary

    2010-06-11

    Photo-z errors, especially catastrophic errors, are a major uncertainty for precision weak lensing cosmology. We find that the shear-(galaxy number) density and density-density cross correlation measurements between photo-z bins, available from the same lensing surveys, contain valuable information for self-calibration of the scattering probabilities between the true-z and photo-z bins. The self-calibration technique we propose does not rely on cosmological priors nor parameterization of the photo-z probability distribution function, and preserves all of the cosmological information available from shear-shear measurement. We estimate the calibration accuracy through the Fisher matrix formalism. We find that, for advanced lensing surveys such as themore » planned stage IV surveys, the rate of photo-z outliers can be determined with statistical uncertainties of 0.01-1% for z < 2 galaxies. Among the several sources of calibration error that we identify and investigate, the galaxy distribution bias is likely the most dominant systematic error, whereby photo-z outliers have different redshift distributions and/or bias than non-outliers from the same bin. This bias affects all photo-z calibration techniques based on correlation measurements. As a result, galaxy bias variations of O(0.1) produce biases in photo-z outlier rates similar to the statistical errors of our method, so this galaxy distribution bias may bias the reconstructed scatters at several-σ level, but is unlikely to completely invalidate the self-calibration technique.« less

  11. Quantum tunneling and scattering of a composite object

    NASA Astrophysics Data System (ADS)

    Ahsan, Naureen

    Reaction physics involving composite objects with internal degrees of freedom is an important subject since it is encountered in the context of nuclear processes like fusion, fission, particle decay, as well as many other branches of science. Quantum tunneling and scattering of a composite object are explored in this work. A few model Hamiltonians are chosen as examples where a two-particle system interacts, in one dimension, with a target that poses a delta-potential or an infinite wall potential. It is assumed that only one of the two components interacts with the target. The study includes the harmonic oscillator and the infinite square well as examples of intrinsic Hamiltonians that do not allow the projectile to break up, and a finite square well and a delta-well as examples of Hamiltonians that do. The Projection Method and the Variable Phase Method are applied with the aim of an exact solution to the relevant scattering problems. These methods are discussed in the context of the pertinent convergence issues related thereto, and of their applicability. Virtual excitations of the projectile into the classically forbidden energy-domain are found to play a dominant and non-perturbative role in shaping reaction observables, giving rise to enhanced or reduced tunneling in various situations. Cusps and discontinuities are found to appear in observables as manifestations of unitarity and redistribution of flux at the thresholds. The intrinsic structure gives rise to resonancelike behavior in tunneling probabilities. It is also shown that there is charge asymmetry in the scattering of a composite object, unlike in the case of a structureless particle.

  12. a Hybrid Method in Vegetation Height Estimation Using Polinsar Images of Campaign Biosar

    NASA Astrophysics Data System (ADS)

    Dehnavi, S.; Maghsoudi, Y.

    2015-12-01

    Recently, there have been plenty of researches on the retrieval of forest height by PolInSAR data. This paper aims at the evaluation of a hybrid method in vegetation height estimation based on L-band multi-polarized air-borne SAR images. The SAR data used in this paper were collected by the airborne E-SAR system. The objective of this research is firstly to describe each interferometry cross correlation as a sum of contributions corresponding to single bounce, double bounce and volume scattering processes. Then, an ESPIRIT (Estimation of Signal Parameters via Rotational Invariance Techniques) algorithm is implemented, to determine the interferometric phase of each local scatterer (ground and canopy). Secondly, the canopy height is estimated by phase differencing method, according to the RVOG (Random Volume Over Ground) concept. The applied model-based decomposition method is unrivaled, as it is not limited to specific type of vegetation, unlike the previous decomposition techniques. In fact, the usage of generalized probability density function based on the nth power of a cosine-squared function, which is characterized by two parameters, makes this method useful for different vegetation types. Experimental results show the efficiency of the approach for vegetation height estimation in the test site.

  13. Photon escape probabilities in a semi-infinite plane-parallel medium. [from electron plasma surrounding galactic X-ray sources

    NASA Technical Reports Server (NTRS)

    Williams, A. C.; Elsner, R. F.; Weisskopf, M. C.; Darbro, W.

    1984-01-01

    It is shown in this work how to obtain the probabilities of photons escaping from a cold electron plasma environment after having undergone an arbitrary number of scatterings. This is done by retaining the exact differential cross section for Thomson scattering as opposed to using its polarization and angle averaged form. The results are given in the form of recursion relations. The geometry used is the semi-infinite plane-parallel geometry witlh a photon source located on a plane at an arbitrary optical depth below the surface. Analytical expressions are given for the probabilities which are accurate over a wide range of initial optical depth. These results can be used to model compact X-ray galactic sources which are surrounded by an electron-rich plasma.

  14. Fractional conductance oscillations in quantum rings: wave packet picture of transport in a few-electron system.

    PubMed

    Chwiej, T; Szafran, B

    2013-04-17

    We study electron transfer across a two-terminal quantum ring using a time-dependent description of the scattering process. For the considered scattering event the quantum ring is initially charged with one or two electrons, with another electron incident to the ring from the input channel. We study the electron transfer probability (T) as a function of the external magnetic field. We determine the periodicity of T for a varied number of electrons confined within the ring. For that purpose we develop a method to describe the wave packet dynamics for a few electrons participating in the scattering process, taking into full account the electron-electron correlations. We find that electron transfer across the quantum ring initially charged by a single electron acquires a distinct periodicity of half of the magnetic flux quantum (Φ0/2), corresponding to the formation of a transient two-electron state inside the ring. In the case of a three-electron scattering problem with two electrons initially occupying the ring, a period of Φ0/3 for T is formed in the limit of thin channels. The effect of disorder present in the confinement potential of the ring is also discussed.

  15. Optical Correlation Techniques In Fluid Dynamics

    NASA Astrophysics Data System (ADS)

    Schatzel, K.; Schulz-DuBois, E. O.; Vehrenkamp, R.

    1981-05-01

    Three flow measurement techniques make use of fast digital correlators. (1) Most widely spread is photon correlation velocimetry using crossed laser beams and detecting Doppler shifted light scattered by small particles in the flow. Depending on the processing of the photon correlogram, this technique yields mean velocity, turbulence level, or even the detailed probability distribution of one velocity component. An improved data processing scheme is demonstrated on laminar vortex flow in a curved channel. (2) Rate correlation based upon threshold crossings of a high pass filtered laser Doppler signal can he used to obtain velocity correlation functions. The most powerful setup developed in our laboratory uses a phase locked loop type tracker and a multibit correlator to analyse time-dependent Taylor vortex flow. With two optical systems and trackers, crosscorrelation functions reveal phase relations between different vortices. (3) Making use of refractive index fluctuations (e. g. in two phase flows) instead of scattering particles, interferometry with bidirectional fringe counting and digital correlation and probability analysis constitute a new quantitative technique related to classical Schlieren methods. Measurements on a mixing flow of heated and cold air contribute new ideas to the theory of turbulent random phase screens.

  16. Siphonophores and the Deep Scattering Layer.

    PubMed

    Barham, E G

    1963-05-17

    Bathyscaphe dives in the San Diego Trough have revealed a close spatial relation between siphonophores and the deep scattering layer as recorded by precision depth recording echo-sounders. Measurements of gas bubbles within the flotation structures of Nanomia bijuga captured in a closing net in an ascended scattering layer indicate that these are very close to the resonant size for 12-kcy/sec sound. Because such organisms are capable of making prolonged vertical migrations, and are widespread geographically, they are very probably the major cause of stratified zones of scattering throughout the oceans of the world.

  17. Generalized skew-symmetric interfacial probability distribution in reflectivity and small-angle scattering analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Zhang; Chen, Wei

    Generalized skew-symmetric probability density functions are proposed to model asymmetric interfacial density distributions for the parameterization of any arbitrary density profiles in the `effective-density model'. The penetration of the densities into adjacent layers can be selectively controlled and parameterized. A continuous density profile is generated and discretized into many independent slices of very thin thickness with constant density values and sharp interfaces. The discretized profile can be used to calculate reflectivities via Parratt's recursive formula, or small-angle scattering via the concentric onion model that is also developed in this work.

  18. Generalized skew-symmetric interfacial probability distribution in reflectivity and small-angle scattering analysis

    DOE PAGES

    Jiang, Zhang; Chen, Wei

    2017-11-03

    Generalized skew-symmetric probability density functions are proposed to model asymmetric interfacial density distributions for the parameterization of any arbitrary density profiles in the `effective-density model'. The penetration of the densities into adjacent layers can be selectively controlled and parameterized. A continuous density profile is generated and discretized into many independent slices of very thin thickness with constant density values and sharp interfaces. The discretized profile can be used to calculate reflectivities via Parratt's recursive formula, or small-angle scattering via the concentric onion model that is also developed in this work.

  19. Coherent spectroscopic methods for monitoring pathogens, genetically modified products and nanostructured materials in colloidal solution

    NASA Astrophysics Data System (ADS)

    Moguilnaya, T.; Suminov, Y.; Botikov, A.; Ignatov, S.; Kononenko, A.; Agibalov, A.

    2017-01-01

    We developed the new automatic method that combines the method of forced luminescence and stimulated Brillouin scattering. This method is used for monitoring pathogens, genetically modified products and nanostructured materials in colloidal solution. We carried out the statistical spectral analysis of pathogens, genetically modified soy and nano-particles of silver in water from different regions in order to determine the statistical errors of the method. We studied spectral characteristics of these objects in water to perform the initial identification with 95% probability. These results were used for creation of the model of the device for monitor of pathogenic organisms and working model of the device to determine the genetically modified soy in meat.

  20. Stopping cross sections for 0.25-3.0-MeV He-4 ions in cadmium sulfide

    NASA Technical Reports Server (NTRS)

    Miller, W. E.; Hutchby, J. A.

    1975-01-01

    Stopping cross sections of He-4 ions with energies between 0.25 and 3.0 MeV have been measured for cadmium sulfide with a probable error of plus or minus 7% to 8%. The experimental method utilized the Rutherford backscattering technique and measured the energy loss of elastically scattered He-4 ions from films of cadmium sulfide sputtered on carbon substrates. The experimental data are compared with recent experimental and theoretical results.

  1. The global short-period wavefield modelled with a Monte Carlo seismic phonon method

    USGS Publications Warehouse

    Shearer, Peter M.; Earle, Paul

    2004-01-01

    At high frequencies (∼1 Hz), much of the seismic energy arriving at teleseismic distances is not found in the main phases (e.g. P, PP, S, etc.) but is contained in the extended coda that follows these arrivals. This coda results from scattering off small-scale velocity and density perturbations within the crust and mantle and contains valuable information regarding the depth dependence and strength of this heterogeneity as well as the relative importance of intrinsic versus scattering attenuation. Most analyses of seismic coda to date have concentrated on S-wave coda generated from lithospheric scattering for events recorded at local and regional distances. Here, we examine the globally averaged vertical-component, 1-Hz wavefield (>10° range) for earthquakes recorded in the IRIS FARM archive from 1990 to 1999. We apply an envelope-function stacking technique to image the average time–distance behavior of the wavefield for both shallow (≤50 km) and deep (≥500 km) earthquakes. Unlike regional records, our images are dominated by P and P coda owing to the large effect of attenuation on PPand S at high frequencies. Modelling our results is complicated by the need to include a variety of ray paths, the likely contributions of multiple scattering and the possible importance of P-to-S and S-to-P scattering. We adopt a stochastic, particle-based approach in which millions of seismic phonons are randomly sprayed from the source and tracked through the Earth. Each phonon represents an energy packet that travels along the appropriate ray path until it is affected by a discontinuity or a scatterer. Discontinuities are modelled by treating the energy normalized reflection and transmission coefficients as probabilities. Scattering probabilities and scattering angles are computed in a similar fashion, assuming random velocity and density perturbations characterized by an exponential autocorrelation function. Intrinsic attenuation is included by reducing the energy contained in each particle as an appropriate function of traveltime. We find that most scattering occurs in the lithosphere and upper mantle, as previous results have indicated, but that some lower-mantle scattering is likely also required. A model with 3 to 4 per cent rms velocity heterogeneity at 4-km scale length in the upper mantle and 0.5 per cent rms velocity heterogeneity at 8-km scale length in the lower mantle (with intrinsic attenuation of Qα= 450 above 200 km depth andQα= 2500 below 200 km) provides a reasonable fit to both the shallow- and deep-earthquake observations, although many trade-offs exist between the scale length, depth extent and strength of the heterogeneity.

  2. Quantitative characterization of fatty liver disease using x-ray scattering

    NASA Astrophysics Data System (ADS)

    Elsharkawy, Wafaa B.; Elshemey, Wael M.

    2013-11-01

    Nonalcoholic fatty liver disease (NAFLD) is a dynamic condition in which fat abnormally accumulates within the hepatocytes. It is believed to be a marker of risk of later chronic liver diseases, such as liver cirrhosis and carcinoma. The fat content in liver biopsies determines its validity for liver transplantation. Transplantation of livers with severe NAFLD is associated with a high risk of primary non-function. Moreover, NAFLD is recognized as a clinically important feature that influences patient morbidity and mortality after hepatic resection. Unfortunately, there is a lack in a precise, reliable and reproducible method for quantification of NAFLD. This work suggests a method for the quantification of NAFLD. The method is based on the fact that fatty liver tissue would have a characteristic x-ray scattering profile with a relatively intense fat peak at a momentum transfer value of 1.1 nm-1 compared to a soft tissue peak at 1.6 nm-1. The fat content in normal and fatty liver is plotted against three profile characterization parameters (ratio of peak intensities, ratio of area under peaks and ratio of area under fat peak to total profile area) for measured and Monte Carlo simulated x-ray scattering profiles. Results show a high linear dependence (R2>0.9) of the characterization parameters on the liver fat content with a reported high correlation coefficient (>0.9) between measured and simulated data. These results indicate that the current method probably offers reliable quantification of fatty liver disease.

  3. Aerosol Light Absorption and Scattering in Mexico City: Comparison With Las Vegas, NV, and Los Angeles, CA.

    NASA Astrophysics Data System (ADS)

    Paredes-Miranda, G.; Arnott, W. P.; Gaffney, J. S.; Marley, N. A.; Campbell, D.; Fujita, E.

    2007-12-01

    Aerosol light scattering and absorption measurements were deployed in and near Mexico City in March 2006 as part of the Megacity Impacts on Regional and Global Environments (MIRAGE). The primary site in Mexico City was an urban site at Instituto Mexicano del Petroleo (Mexican Oil Institute, denoted by IMP). Similar campaigns were held in Las Vegas, NV in January-February, 2003; and Los Angeles, CA at numerous sites during all seasons from 2003 through 2007. The IMP site gave in-situ characterization of the Mexico City plume under favorable wind conditions. The photoacoustic instrument (PAS) used at IMP operates at 532 nm, and conveniently allowed for characterization of gaseous absorption at this wavelength as well. Light scattering measurements are accomplished within the PAS by the reciprocal nephelometery method. In Mexico City the aerosol absorption coefficient typically varies between 20 and 180 Mm-1 during the course of the day and significant diurnal variation of the aerosol single scattering albedo was observed probably as a consequence of secondary aerosol formation. We will present the diurnal variation of the scattering and absorption as well as the single scattering albedo and fraction of absorption due to gases at the IMP site and compare with Las Vegas diurnal variation. Mexico City 'breaths' more during the course of the day than Las Vegas, Nevada in part because the latitude of Mexico City resulted in more direct solar radiation. Further insight on the meteorological connections and population dynamics will be discussed.

  4. Absorption-enhanced imaging through scattering media using carbon black nano-particles: from visible to near infrared wavelengths

    NASA Astrophysics Data System (ADS)

    Tanzid, Mehbuba; Hogan, Nathaniel J.; Robatjazi, Hossein; Veeraraghavan, Ashok; Halas, Naomi J.

    2018-05-01

    Imaging through scattering media can be improved with the addition of absorbers, since multiply-scattered photons, with their longer path length, are absorbed with a higher probability than ballistic photons. The image resolution enhancement is substantially greater when imaging through isotropic scatterers than when imaging through an ensemble of strongly forward-scattering particles. However, since the angular scattering distribution is determined by the size of the scatterers with respect to the wavelength of incident light, particles that are forward scatterers at visible wavelengths can be isotropic scatterers at infrared (IR) wavelengths. Here, we show that substantial image resolution enhancement can be achieved in the near-infrared wavelength regime for particles that are forward scattering at visible wavelengths using carbon black nanoparticles as a broadband absorber. This observation provides a new strategy for image enhancement through scattering media: by selecting the appropriate wavelength range for imaging, in this case the near-IR, the addition of absorbers more effectively enhances the image resolution.

  5. Monte Carlo Perturbation Theory Estimates of Sensitivities to System Dimensions

    DOE PAGES

    Burke, Timothy P.; Kiedrowski, Brian C.

    2017-12-11

    Here, Monte Carlo methods are developed using adjoint-based perturbation theory and the differential operator method to compute the sensitivities of the k-eigenvalue, linear functions of the flux (reaction rates), and bilinear functions of the forward and adjoint flux (kinetics parameters) to system dimensions for uniform expansions or contractions. The calculation of sensitivities to system dimensions requires computing scattering and fission sources at material interfaces using collisions occurring at the interface—which is a set of events with infinitesimal probability. Kernel density estimators are used to estimate the source at interfaces using collisions occurring near the interface. The methods for computing sensitivitiesmore » of linear and bilinear ratios are derived using the differential operator method and adjoint-based perturbation theory and are shown to be equivalent to methods previously developed using a collision history–based approach. The methods for determining sensitivities to system dimensions are tested on a series of fast, intermediate, and thermal critical benchmarks as well as a pressurized water reactor benchmark problem with iterated fission probability used for adjoint-weighting. The estimators are shown to agree within 5% and 3σ of reference solutions obtained using direct perturbations with central differences for the majority of test problems.« less

  6. Approximating Reflectance and Transmittance of Vegetation Using Multiple Spectral Invariants

    NASA Astrophysics Data System (ADS)

    Mottus, M.

    2011-12-01

    Canopy spectral invariants, eigenvalues of the radiative transfer equation and photon recollision probability are some of the new theoretical tools that have been applied in remote sensing of vegetation and atmosphere. The theoretical approach based on spectral invariants, informally also referred to as the p-theory, owns its attractivity to several factors. Firstly, it provides a rapid and physically-based way of describing canopy scattering. Secondly, the p-theory aims at parameterizing canopy structure in reflectance models using a simple and intuitive concept which can be applied at various structural levels, from shoot to tree crown. The theory has already been applied at scales from the molecular level to forest stands. The most important shortcoming of the p-theory lies in its inability to predict the directionality of scattering. The theory is currently based on only one physical parameter, the photon recollision probability p. It is evident that one parameter cannot contain enough information to reasonably predict the observed complex reflectance patterns produced by natural vegetation canopies. Without estimating scattering directionality, however, the theory cannot be compared with even the most simple (and well-tested) two-stream vegetation reflectance models. In this study, we evaluate the possibility to use additional parameters to fit the measured reflectance and transmittance of a vegetation stand. As a first step, the parameters are applied to separate canopy scattering into reflectance and transmittance. New parameters are introduced following the general approach of eigenvector expansion. Thus, the new parameters are coined higher-order spectral invariants. Calculation of higher-order invariants is based on separating first-order scattering from total scattering. Thus, the method explicitly accounts for different view geometries with different fractions of visible sunlit canopy (e.g., hot-spot). It additionally allows to produce different irradiation levels on leaf surfaces for direct and diffuse incidence, thus (in theory) allowing more accurate calculation of potential photosynthesis rates. Similarly to the p-theory, the use of multiple spectral invariants facilitates easy parametrization of canopy structure and scaling between different structural levels (leaf-shoot-stand). Spectral invariant-based remote sensing approaches are well suited for relatively large pixels even when no detailed ground truth information is available. In a case study, the theory of multiple spectral invariants was applied to measured canopy scattering. Spectral reflectance and transmittance measurements were carried out in gray alder (Alnus incana) plantation at Tartu Observatory, Estonia, in August 2006. The equations produced by the theory of spectral invariants were fitted to measured radiation fluxes. Preliminary results indicate that quantities with invariant-like behavior may indeed be used to approximate canopy scattering directionality.

  7. Reduced-Dimensionality Semiclassical Transition State Theory: Application to Hydrogen Atom Abstraction and Exchange Reactions of Hydrocarbons.

    PubMed

    Greene, Samuel M; Shan, Xiao; Clary, David C

    2015-12-17

    Quantum mechanical methods for calculating rate constants are often intractable for reactions involving many atoms. Semiclassical transition state theory (SCTST) offers computational advantages over these methods but nonetheless scales exponentially with the number of degrees of freedom (DOFs) of the system. Here we present a method with more favorable scaling, reduced-dimensionality SCTST (RD SCTST), that treats only a subset of DOFs of the system explicitly. We apply it to three H abstraction and exchange reactions for which two-dimensional potential energy surfaces (PESs) have previously been constructed and evaluated using RD quantum scattering calculations. We differentiated these PESs to calculate harmonic frequencies and anharmonic constants, which were then used to calculate cumulative reaction probabilities and rate constants by RD SCTST. This method yielded rate constants in good agreement with quantum scattering results. Notably, it performed well for a heavy-light-heavy reaction, even though it does not explicitly account for corner-cutting effects. Recent extensions to SCTST that improve its treatment of deep tunneling were also evaluated within the reduced-dimensionality framework. The success of RD SCTST in this study suggests its potential applicability to larger systems.

  8. Impenetrability in Floquet Scattering in One Dimension

    NASA Astrophysics Data System (ADS)

    Volosniev, A. G.; Smith, D. H.

    2018-07-01

    We study the scattering off a time-periodic zero-range potential in one spatial dimension. We focus on the parameter regions that lead to zero-transmission probability (ZTP). For static potentials, ZTP leads to fermionization of distinguishable equal-mass particles. For time-periodic potentials, fermionization is prevented by the formation of evanescent waves.

  9. Impact of planet-planet scattering on the formation and survival of debris discs

    NASA Astrophysics Data System (ADS)

    Marzari, F.

    2014-10-01

    Planet-planet scattering is a major dynamical mechanism able to significantly alter the architecture of a planetary system. In addition to that, it may also affect the formation and retention of a debris disc by the system. A violent chaotic evolution of the planets can easily clear leftover planetesimal belts preventing the ignition of a substantial collisional cascade that can give origin to a debris disc. On the other end, a mild evolution with limited steps in eccentricity and semimajor axis can trigger the formation of a debris disc by stirring an initially quiet planetesimal belt. The variety of possible effects that planet-planet scattering can have on the formation of debris discs is analysed and the statistical probability of the different outcomes is evaluated. This leads to the prediction that systems which underwent an episode of chaotic evolution might have a lower probability of harbouring a debris disc.

  10. Structural and mechanical properties of cardiolipin lipid bilayers determined using neutron spin echo, small angle neutron and X-ray scattering, and molecular dynamics simulations

    DOE PAGES

    Pan, Jianjun; Cheng, Xiaolin; Sharp, Melissa; ...

    2014-10-29

    We report that the detailed structural and mechanical properties of a tetraoleoyl cardiolipin (TOCL) bilayer were determined using neutron spin echo (NSE) spectroscopy, small angle neutron and X-ray scattering (SANS and SAXS, respectively), and molecular dynamics (MD) simulations. We used MD simulations to develop a scattering density profile (SDP) model, which was then utilized to jointly refine SANS and SAXS data. In addition to commonly reported lipid bilayer structural parameters, component distributions were obtained, including the volume probability, electron density and neutron scattering length density.

  11. Scattering of water from the glycerol liquid-vacuum interface

    NASA Technical Reports Server (NTRS)

    Benjamin, I.; Wilson, M. A.; Pohorille, A.; Nathanson, G. M.

    1995-01-01

    Molecular dynamics calculations of the scattering of D2O from the glycerol surface at different collision energies are reported. The results for the trapping probabilities and energy transfer are in good agreement with experiments. The calculations demonstrate that the strong attractive forces between these two strongly hydrogen bonding molecules have only a minor effect on the initial collision dynamics. The trapping probability is influenced to a significant extent by the repulsive hard sphere-like initial encounter with the corrugated surface and, only at a later stage, by the efficiency of energy flow in the multiple interactions between the water and the surface molecules.

  12. Multigroup computation of the temperature-dependent Resonance Scattering Model (RSM) and its implementation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghrayeb, S. Z.; Ouisloumen, M.; Ougouag, A. M.

    2012-07-01

    A multi-group formulation for the exact neutron elastic scattering kernel is developed. This formulation is intended for implementation into a lattice physics code. The correct accounting for the crystal lattice effects influences the estimated values for the probability of neutron absorption and scattering, which in turn affect the estimation of core reactivity and burnup characteristics. A computer program has been written to test the formulation for various nuclides. Results of the multi-group code have been verified against the correct analytic scattering kernel. In both cases neutrons were started at various energies and temperatures and the corresponding scattering kernels were tallied.more » (authors)« less

  13. Atomic and Molecular Beam Scattering: Characterizing Structure and Dynamics of Hybrid Organic-Semiconductor Interfaces and Introducing Novel Isotope Separation Techniques

    NASA Astrophysics Data System (ADS)

    Nihill, Kevin John

    This thesis details a range of experiments and techniques that use the scattering of atomic beams from surfaces to both characterize a variety of interfaces and harness mass-specific scattering conditions to separate and enrich isotopic components in a mixture of gases. Helium atom scattering has been used to characterize the surface structure and vibrational dynamics of methyl-terminated Ge(111), thereby elucidating the effects of organic termination on a rigid semiconductor interface. Helium atom scattering was employed as a surface-sensitive, non-destructive probe of the surface. By means of elastic gas-surface diffraction, this technique is capable of providing measurements of atomic spacing, step height, average atomic displacement as a function of surface temperature, gas-surface potential well depth, and surface Debye temperature. Inelastic time-of-flight studies provide highly resolved energy exchange measurements between helium atoms and collective lattice vibrations, or phonons; a collection of these measurements across a range of incident kinematic parameters allowed for a thorough mapping of low-energy phonons (e.g., the Rayleigh wave) across the surface Brillouin zone and subsequent comparison with complementary theoretical calculations. The scattering of molecular beams - here, hydrogen and deuterium from methyl-terminated Si(111) - enables the measurement of the anisotropy of the gas-surface interaction potential through rotationally inelastic diffraction (RID), whereby incident atoms can exchange internal energy between translational and rotational modes and diffract into unique angular channels as a result. The probability of rotational excitations as a function of incident energy and angle were measured and compared with electronic structure and scattering calculations to provide insight into the gas-surface interaction potential and hence the surface charge density distribution, revealing important details regarding the interaction of H2 with an organic-functionalized semiconductor interface. Aside from their use as probes for surface structure and dynamics, atomic beam sources are also demonstrated to enable the efficient separation of gaseous mixtures of isotopes by means of diffraction and differential condensation. In the former method, the kinematic conditions for elastic diffraction result in an incident beam of natural abundance neon diffracting into isotopically distinct angles, resulting in the enrichment of a desired isotope; this purification can be improved by exploiting the difference in arrival times of the two isotopes at a given final angle. In the latter method, the identical incident velocities of coexpanded isotopes lead to minor but important differences in their incident kinetic energies, and thus their probability of adsorbing on a sufficiently cold surface, resulting in preferential condensation of a given isotope that depends on the energy of the incident beam. Both of these isotope separation techniques are made possible by the narrow velocity distribution and velocity seeding effect offered only by high-Mach number supersonic beam sources. These experiments underscore the utility of supersonically expanded atomic and molecular beam sources as both extraordinarily precise probes of surface structure and dynamics and as a means for high-throughput, non-dissociative isotopic enrichment methods.

  14. Analysis of scattering statistics and governing distribution functions in optical coherence tomography.

    PubMed

    Sugita, Mitsuro; Weatherbee, Andrew; Bizheva, Kostadinka; Popov, Ivan; Vitkin, Alex

    2016-07-01

    The probability density function (PDF) of light scattering intensity can be used to characterize the scattering medium. We have recently shown that in optical coherence tomography (OCT), a PDF formalism can be sensitive to the number of scatterers in the probed scattering volume and can be represented by the K-distribution, a functional descriptor for non-Gaussian scattering statistics. Expanding on this initial finding, here we examine polystyrene microsphere phantoms with different sphere sizes and concentrations, and also human skin and fingernail in vivo. It is demonstrated that the K-distribution offers an accurate representation for the measured OCT PDFs. The behavior of the shape parameter of K-distribution that best fits the OCT scattering results is investigated in detail, and the applicability of this methodology for biological tissue characterization is demonstrated and discussed.

  15. A theoretical study on the impact of particle scattering on the channel characteristics of underwater optical communication system

    NASA Astrophysics Data System (ADS)

    Sahu, Sanjay Kumar; Shanmugam, Palanisamy

    2018-02-01

    Scattering by water molecules and particulate matters determines the path and distance of photon propagation in underwater medium. Consequently, photon angle of scattering (given by scattering phase function) requires to be considered in addition to the extinction coefficient of the aquatic medium governed by the absorption and scattering coefficients in channel characterization for an underwater wireless optical communication (UWOC) system. This study focuses on analyzing the received signal power and impulse response of UWOC channel based on Monte-Carlo simulations for different water types, link distances, link geometries and transceiver parameters. A newly developed scattering phase function (referred to as SS phase function), which represents the real water types more accurately like the Petzold phase function, is considered for quantification of the channel characteristics along with the effects of absorption and scattering coefficients. A comparison between the results simulated using various phase function models and the experimental measurements of Petzold revealed that the SS phase function model predicts values closely matching with the actual values of the Petzold's phase function, which further establishes the importance of using a correct scattering phase function model while estimating the channel capacity of UWOC system in terms of the received power and channel impulse response. Results further demonstrate a great advantage of considering the nonzero probability of receiving scattered photons in estimating channel capacity rather than considering the reception of only ballistic photons as in Beer's Law, which severely underestimates the received power and affects the range of communication especially in the scattering water column. The received power computed based on the Monte-Carlo method by considering the receiver aperture sizes and field of views in different water types are further analyzed and discussed. These results are essential for evaluating the underwater link budget and constructing different system and design parameters for an UWOC system.

  16. Comparison of Geant4 multiple Coulomb scattering models with theory for radiotherapy protons

    NASA Astrophysics Data System (ADS)

    Makarova, Anastasia; Gottschalk, Bernard; Sauerwein, Wolfgang

    2017-08-01

    Usually, Monte Carlo models are validated against experimental data. However, models of multiple Coulomb scattering (MCS) in the Gaussian approximation are exceptional in that we have theories which are probably more accurate than the experiments which have, so far, been done to test them. In problems directly sensitive to the distribution of angles leaving the target, the relevant theory is the Molière/Fano/Hanson variant of Molière theory (Gottschalk et al 1993 Nucl. Instrum. Methods Phys. Res. B 74 467-90). For transverse spreading of the beam in the target itself, the theory of Preston and Koehler (Gottschalk (2012 arXiv:1204.4470)) holds. Therefore, in this paper we compare Geant4 simulations, using the Urban and Wentzel models of MCS, with theory rather than experiment, revealing trends which would otherwise be obscured by experimental scatter. For medium-energy (radiotherapy) protons, and low-Z (water-like) target materials, Wentzel appears to be better than Urban in simulating the distribution of outgoing angles. For beam spreading in the target itself, the two models are essentially equal.

  17. Comparison of Geant4 multiple Coulomb scattering models with theory for radiotherapy protons.

    PubMed

    Makarova, Anastasia; Gottschalk, Bernard; Sauerwein, Wolfgang

    2017-07-06

    Usually, Monte Carlo models are validated against experimental data. However, models of multiple Coulomb scattering (MCS) in the Gaussian approximation are exceptional in that we have theories which are probably more accurate than the experiments which have, so far, been done to test them. In problems directly sensitive to the distribution of angles leaving the target, the relevant theory is the Molière/Fano/Hanson variant of Molière theory (Gottschalk et al 1993 Nucl. Instrum. Methods Phys. Res. B 74 467-90). For transverse spreading of the beam in the target itself, the theory of Preston and Koehler (Gottschalk (2012 arXiv:1204.4470)) holds. Therefore, in this paper we compare Geant4 simulations, using the Urban and Wentzel models of MCS, with theory rather than experiment, revealing trends which would otherwise be obscured by experimental scatter. For medium-energy (radiotherapy) protons, and low-Z (water-like) target materials, Wentzel appears to be better than Urban in simulating the distribution of outgoing angles. For beam spreading in the target itself, the two models are essentially equal.

  18. A Probabilistic Design Method Applied to Smart Composite Structures

    NASA Technical Reports Server (NTRS)

    Shiao, Michael C.; Chamis, Christos C.

    1995-01-01

    A probabilistic design method is described and demonstrated using a smart composite wing. Probabilistic structural design incorporates naturally occurring uncertainties including those in constituent (fiber/matrix) material properties, fabrication variables, structure geometry and control-related parameters. Probabilistic sensitivity factors are computed to identify those parameters that have a great influence on a specific structural reliability. Two performance criteria are used to demonstrate this design methodology. The first criterion requires that the actuated angle at the wing tip be bounded by upper and lower limits at a specified reliability. The second criterion requires that the probability of ply damage due to random impact load be smaller than an assigned value. When the relationship between reliability improvement and the sensitivity factors is assessed, the results show that a reduction in the scatter of the random variable with the largest sensitivity factor (absolute value) provides the lowest failure probability. An increase in the mean of the random variable with a negative sensitivity factor will reduce the failure probability. Therefore, the design can be improved by controlling or selecting distribution parameters associated with random variables. This can be implemented during the manufacturing process to obtain maximum benefit with minimum alterations.

  19. MAGNETIC RELAXATION IN RARE EARTH DOPED GARNET.

    DTIC Science & Technology

    in resonance measurements by the constant low temperature linewidth due to two magnon scattering. In contrast, the PPI relaxation rate is independent...of two magnon scattering. The 4.5K doublet may well be related to a near crossing of energy levels which probably causes the anomalous low temperature peaks in delta H and resonance field observed by Dillon. (Author)

  20. Electron Impact Exciation of Fe IX

    NASA Astrophysics Data System (ADS)

    Tayal, Swaraj; Zatsarinny, Oleg

    2015-05-01

    Transition probabilities and electron impact excitation collision strengths and rates for astrophysically important extreme ultraviolet lines of Fe IX are calculated. The 322 fine-structure levels of the 3s2 3p6 , 3s2 3p5 3 d , 3 s 3p6 3 d , 3s2 3p5 4 s , and 3s2 3p4 3d2 configurations are included in our calculations. The collision strengths have been calculated using the B-spline Breit-Pauli R-matrix method for all fine-structure transitions among the 322 levels. The mass, Darwin, and spin-orbit relativistic effects are included in the Breit-Pauli Hamiltonian in the scattering calculation. The one-body and two-body relativistic operators are included in the multi-configuration Hartree-Fock calculations of transition probabilities. Several sets of non-orthogonal spectroscopic and correlation radial orbitals are used to obtain accurate description of Fe IX levels and to represent the scattering functions. The calculated excitation energies are in very good agreement with experiment and represents an improvement over the previous calculations. The present collision strengths show reasonable agreement with the previously available R-matrix and distorted-wave calculations. This research is supported by NASA grant from the Solar and Heliophysics Program.

  1. Evaluation of ultrasonic array imaging algorithms for inspection of a coarse grained material

    NASA Astrophysics Data System (ADS)

    Van Pamel, A.; Lowe, M. J. S.; Brett, C. R.

    2014-02-01

    Improving the ultrasound inspection capability for coarse grain metals remains of longstanding interest to industry and the NDE research community and is expected to become increasingly important for next generation power plants. A test sample of coarse grained Inconel 625 which is representative of future power plant components has been manufactured to test the detectability of different inspection techniques. Conventional ultrasonic A, B, and C-scans showed the sample to be extraordinarily difficult to inspect due to its scattering behaviour. However, in recent years, array probes and Full Matrix Capture (FMC) imaging algorithms, which extract the maximum amount of information possible, have unlocked exciting possibilities for improvements. This article proposes a robust methodology to evaluate the detection performance of imaging algorithms, applying this to three FMC imaging algorithms; Total Focusing Method (TFM), Phase Coherent Imaging (PCI), and Decomposition of the Time Reversal Operator with Multiple Scattering (DORT MSF). The methodology considers the statistics of detection, presenting the detection performance as Probability of Detection (POD) and probability of False Alarm (PFA). The data is captured in pulse-echo mode using 64 element array probes at centre frequencies of 1MHz and 5MHz. All three algorithms are shown to perform very similarly when comparing their flaw detection capabilities on this particular case.

  2. Hot Oxygen Transport Model for Martian Coronal Retrievals with MAVEN's IUVS Instrument

    NASA Astrophysics Data System (ADS)

    Deighan, Justin; Stewart, I.; Schneider, N.

    2013-10-01

    One of the primary goals of the upcoming Mars Atmosphere and Volatile EvolutioN (MAVEN) mission is the study of non-thermal escape of atomic oxygen to space. In support of this goal, the Imaging Ultraviolet Spectrograph (IUVS) instrument will make regular observations of the gravitationally bound O corona surrounding the planet. Interpreting these measurements requires a computationally efficient forward model to calculate collisional transport of hot O through the exosphere. To accurately treat the strong forward scattering of O at energies of a few eV, we are developing a model which applies the δ-M approximation from radiative transport theory. This method consolidates the strong forward peak of the scattering phase function into a δ-function, leaving the residual as a sum of smoothly varying Legendre polynomials. Preliminary Monte Carlo results with this approach show great promise, producing coronal O densities and escape rates with accuracies of ~5% or better. Our objective is to integrate this δ-M technique into a Markov-Chain transport model. The Markov-Chain method produces hot O particle densities and velocity distributions as a function of altitude by quantizing all possible particle states and calculating the probabilities of state transition, then solving for equilibrium using standard matrix routines. This allows for forward model run-times on the order of seconds, enabling real-time pipeline retrievals from IUVS measurements. The general method is applicable to rapidly calculating the transport of any strongly forward scattering species through a background medium.

  3. The Effect of Scattering and Absorption on Noise from a Cavitating Noise Source in the Subsurface Ocean Layer.

    DTIC Science & Technology

    1981-06-01

    for a de- tection probability of PD and associated false alarm probability PFA (in dB). 21 - - - II V. REFERENCE MODEL A. INTRODUCTION In order to...space for which to choose HI . PFA = P (wI 0o)dw = Q(---) (26) j 0 Similarity, the miss probability=l-detection probability is obtained by integrating...31) = 2 (1+ (22 [()BT z] ~Z The input signal-to-noise ratio: S/N(input) - a2 (32) The probability of false alarm: PFA = Q[ tB(j-I) 1 (33) The

  4. On the Relation Between Spherical Harmonics and Simplified Spherical Harmonics Methods

    NASA Astrophysics Data System (ADS)

    Coppa, G. G. M.; Giusti, V.; Montagnini, B.; Ravetto, P.

    2010-03-01

    The purpose of the paper is, first, to recall the proof that the AN method and, therefore, the SP2N-1 method (of which AN was shown to be a variant) are equivalent to the odd order P2N-1, at least for a particular class of multi-region problems; namely the problems for which the total cross section has the same value for all the regions and the scattering is supposed to be isotropic. By virtue of the introduction of quadrature formulas representing first collision probabilities, this class is then enlarged in order to encompass the systems in which the regions may have different total cross sections. Some examples are reported to numerically validate the procedure.

  5. High-pT Physics in the Heavy Ion Era

    NASA Astrophysics Data System (ADS)

    Rak, Jan; Tannenbaum, Michael J.

    2013-04-01

    1. Introduction and overview; 2. Basic observables; 3. Some experimental techniques; 4. The search for structure; 5. Origins of high pT physics - the search for the W boson; 6. Discovery of hard scattering in p-p collisions; 7. Direct single lepton production and the discovery of charm; 8. J/ ψ, u and Drell-Yan pair production; 9. Two particle correlations; 10. Direct photon production; 11. The search for jets; 12. QCD in hard scattering; 13. Heavy ion physics in the high pT era; 14. RHIC and LHC; Appendix A. Probability and statistics; Appendix B. Methods of Monte Carlo calculations; Appendix C. TAB and the Glauber Monte Carlo calculation; Appendix D. Fits including systematic errors; Appendix E. The shape of the xE distribution triggered by a jet fragment, for example, π0; Appendix F. kT phenomenology and Gaussian smearing; References; Index.

  6. Role of nuclear charge change and nuclear recoil on shaking processes and their possible implication on physical processes

    NASA Astrophysics Data System (ADS)

    Sharma, Prashant

    2017-12-01

    The probable role of the sudden nuclear charge change and nuclear recoil in the shaking processes during the neutron- or heavy-ion-induced nuclear reactions and weakly interacting massive particle-nucleus scattering has been investigated in the present work. Using hydrogenic wavefunctions, general analytical expressions of survival, shakeup/shakedown, and shakeoff probability have been derived for various subshells of hydrogen-like atomic systems. These expressions are employed to calculate the shaking, shakeup/shakedown, and shakeoff probabilities in some important cases of interest in the nuclear astrophysics and the dark matter search experiments. The results underline that the shaking processes are one of the probable channels of electronic transitions during the weakly interacting massive particle-nucleus scattering, which can be used to probe the dark matter in the sub-GeV regime. Further, it is found that the shaking processes initiating due to nuclear charge change and nuclear recoil during the nuclear reactions may influence the electronic configuration of the participating atomic systems and thus may affect the nuclear reaction measurements at astrophysically relevant energies.

  7. Positronium collisions with molecular nitrogen

    NASA Astrophysics Data System (ADS)

    Wilde, R. S.; Fabrikant, I. I.

    2018-05-01

    For many atomic and molecular targets positronium (Ps) scattering looks very similar to electron scattering if total scattering cross sections are plotted as functions of the projectile velocity. Recently this similarity was observed for the resonant scattering by the N2 molecule. For correct treatment of Ps-molecule scattering incorporation of the exchange interaction and short-range correlations is of paramount importance. In the present work we have used a free-electron-gas model to describe these interactions in collisions of Ps with the N2 molecule. The results agree reasonably well with the experiment, but the position of the resonance is somewhat shifted towards lower energies, probably due to the fixed-nuclei approximation employed in the calculations. The partial-wave analysis of the resonant peak shows that its composition is more complex than in the case of e -N2 scattering.

  8. Implementation of the direct S ( α , β ) method in the KENO Monte Carlo code

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hart, Shane W. D.; Maldonado, G. Ivan

    The Monte Carlo code KENO contains thermal scattering data for a wide variety of thermal moderators. These data are processed from Evaluated Nuclear Data Files (ENDF) by AMPX and stored as double differential probability distribution functions. The method examined in this study uses S(α,β) probability distribution functions derived from the ENDF data files directly instead of being converted to double differential cross sections. This allows the size of the cross section data on the disk to be reduced substantially amount. KENO has also been updated to allow interpolation in temperature on these data so that problems can be run atmore » any temperature. Results are shown for several simplified problems for a variety of moderators. In addition, benchmark models based on the KRITZ reactor in Sweden were run, and the results are compared with the previous versions of KENO without the direct S(α,β) method. Results from the direct S(α,β) method compare favorably with the original results obtained using the double differential cross sections. Finally, sampling the data increases the run-time of the Monte Carlo calculation, but memory usage is decreased substantially.« less

  9. Implementation of the direct S ( α , β ) method in the KENO Monte Carlo code

    DOE PAGES

    Hart, Shane W. D.; Maldonado, G. Ivan

    2016-11-25

    The Monte Carlo code KENO contains thermal scattering data for a wide variety of thermal moderators. These data are processed from Evaluated Nuclear Data Files (ENDF) by AMPX and stored as double differential probability distribution functions. The method examined in this study uses S(α,β) probability distribution functions derived from the ENDF data files directly instead of being converted to double differential cross sections. This allows the size of the cross section data on the disk to be reduced substantially amount. KENO has also been updated to allow interpolation in temperature on these data so that problems can be run atmore » any temperature. Results are shown for several simplified problems for a variety of moderators. In addition, benchmark models based on the KRITZ reactor in Sweden were run, and the results are compared with the previous versions of KENO without the direct S(α,β) method. Results from the direct S(α,β) method compare favorably with the original results obtained using the double differential cross sections. Finally, sampling the data increases the run-time of the Monte Carlo calculation, but memory usage is decreased substantially.« less

  10. Electronic transport property in Weyl semimetal with local Weyl cone tilt

    NASA Astrophysics Data System (ADS)

    Jiang, Liwei; Feng, Lanting; Yao, Haibo; Zheng, Yisong

    2018-03-01

    In realistic materials of Weyl semimetal (WSM), the Weyl cone tilt (WCT) is allowed due to the absence of Lorentz invariance in condensed matter physics. In this context, we theoretically study the electronic transport property in WSM with the local WCT as the scattering mechanism. In so doing, we establish an electronic transport structure of WSM with the WCT occurring only in the central region sandwiched between two pieces of semi-infinite WSM without the WCT. By means of two complementary theoretical approaches, i.e. the continuum-model method and the lattice-model method, the electronic transmission probability, the conductivity and the Fano factor as functions of the incident electron energy are calculated respectively. We find that the WCT can give rise to nontrivial intervalley scattering, as a result, the Klein tunneling is notably suppressed. More importantly, the minimal conductivity of a WSM shifts in energy from the Weyl nodal point. The Fano factor of the shot noise deviates obviously from the sub-Poissonian value in a two dimensional WSM with the WCT.

  11. Quantum ratchet in two-dimensional semiconductors with Rashba spin-orbit interaction

    PubMed Central

    Ang, Yee Sin; Ma, Zhongshui; Zhang, Chao

    2015-01-01

    Ratchet is a device that produces direct current of particles when driven by an unbiased force. We demonstrate a simple scattering quantum ratchet based on an asymmetrical quantum tunneling effect in two-dimensional electron gas with Rashba spin-orbit interaction (R2DEG). We consider the tunneling of electrons across a square potential barrier sandwiched by interface scattering potentials of unequal strengths on its either sides. It is found that while the intra-spin tunneling probabilities remain unchanged, the inter-spin-subband tunneling probabilities of electrons crossing the barrier in one direction is unequal to that of the opposite direction. Hence, when the system is driven by an unbiased periodic force, a directional flow of electron current is generated. The scattering quantum ratchet in R2DEG is conceptually simple and is capable of converting a.c. driving force into a rectified current without the need of additional symmetry breaking mechanism or external magnetic field. PMID:25598490

  12. Markov chain formalism for generalized radiative transfer in a plane-parallel medium, accounting for polarization

    NASA Astrophysics Data System (ADS)

    Xu, Feng; Davis, Anthony B.; Diner, David J.

    2016-11-01

    A Markov chain formalism is developed for computing the transport of polarized radiation according to Generalized Radiative Transfer (GRT) theory, which was developed recently to account for unresolved random fluctuations of scattering particle density and can also be applied to unresolved spectral variability of gaseous absorption as an improvement over the standard correlated-k method. Using Gamma distribution to describe the probability density function of the extinction or absorption coefficient, a shape parameter a that quantifies the variability is introduced, defined as the mean extinction or absorption coefficient squared divided by its variance. It controls the decay rate of a power-law transmission that replaces the usual exponential Beer-Lambert-Bouguer law. Exponential transmission, hence classic RT, is recovered when a→∞. The new approach is verified to high accuracy against numerical benchmark results obtained with a custom Monte Carlo method. For a<∞, angular reciprocity is violated to a degree that increases with the spatial variability, as observed for finite portions of real-world cloudy scenes. While the degree of linear polarization in liquid water cloudbows, supernumerary bows, and glories is affected by spatial heterogeneity, the positions in scattering angle of these features are relatively unchanged. As a result, a single-scattering model based on the assumption of subpixel homogeneity can still be used to derive droplet size distributions from polarimetric measurements of extended stratocumulus clouds.

  13. A method for the compensation of the effects of surface cloth impressions on polar backscatter applied to porous epoxy and biaxial graphite/epoxy composites

    NASA Technical Reports Server (NTRS)

    Madaras, Eric I.; Bridal, S. L.; Holland, Mark R.; Handley, Scott M.; Miller, James G.

    1993-01-01

    The anisotropy of polar backscatter from graphite/epoxy composites is a potentially useful parameter for the characterization of porosity levels. However, the effects of release-cloth impressions on measured integrated polar backscatter levels are sufficient to inhibit the detection of porosity with this method. Recently, we developed a theoretical model to predict the frequency distribution of the backscattered power along the high-symmetry directions of release-cloth impressions. This study investigates experimentally the usefulness of limiting the bandwidth to regions not dominated by the scattering from the surface impressions, hence increasing the probability of detecting flaws such as porosity.

  14. Measurement of 240Pu Angular Momentum Dependent Fission Probabilities Using the (α ,α') Reaction

    NASA Astrophysics Data System (ADS)

    Koglin, Johnathon; Burke, Jason; Fisher, Scott; Jovanovic, Igor

    2017-09-01

    The surrogate reaction method often lacks the theoretical framework and necessary experimental data to constrain models especially when rectifying differences between angular momentum state differences between the desired and surrogate reaction. In this work, dual arrays of silicon telescope particle identification detectors and photovoltaic (solar) cell fission fragment detectors have been used to measure the fission probability of the 240Pu(α ,α' f) reaction - a surrogate for the 239Pu(n , f) - and fission fragment angular distributions. Fission probability measurements were performed at a beam energy of 35.9(2) MeV at eleven scattering angles from 40° to 140°e in 10° intervals and at nuclear excitation energies up to 16 MeV. Fission fragment angular distributions were measured in six bins from 4.5 MeV to 8.0 MeV and fit to expected distributions dependent on the vibrational and rotational excitations at the saddle point. In this way, the contributions to the total fission probability from specific states of K angular momentum projection on the symmetry axis are extracted. A sizable data collection is presented to be considered when constraining microscopic cross section calculations.

  15. The beam stop array method to measure object scatter in digital breast tomosynthesis

    NASA Astrophysics Data System (ADS)

    Lee, Haeng-hwa; Kim, Ye-seul; Park, Hye-Suk; Kim, Hee-Joung; Choi, Jae-Gu; Choi, Young-Wook

    2014-03-01

    Scattered radiation is inevitably generated in the object. The distribution of the scattered radiation is influenced by object thickness, filed size, object-to-detector distance, and primary energy. One of the investigations to measure scatter intensities involves measuring the signal detected under the shadow of the lead discs of a beam-stop array (BSA). The measured scatter by BSA includes not only the scattered radiation within the object (object scatter), but also the external scatter source. The components of external scatter source include the X-ray tube, detector, collimator, x-ray filter, and BSA. Excluding background scattered radiation can be applied to different scanner geometry by simple parameter adjustments without prior knowledge of the scanned object. In this study, a method using BSA to differentiate scatter in phantom (object scatter) from external background was used. Furthermore, this method was applied to BSA algorithm to correct the object scatter. In order to confirm background scattered radiation, we obtained the scatter profiles and scatter fraction (SF) profiles in the directions perpendicular to the chest wall edge (CWE) with and without scattering material. The scatter profiles with and without the scattering material were similar in the region between 127 mm and 228 mm from chest wall. This result indicated that the measured scatter by BSA included background scatter. Moreover, the BSA algorithm with the proposed method could correct the object scatter because the total radiation profiles of object scatter correction corresponded to original image in the region between 127 mm and 228 mm from chest wall. As a result, the BSA method to measure object scatter could be used to remove background scatter. This method could apply for different scanner geometry after background scatter correction. In conclusion, the BSA algorithm with the proposed method is effective to correct object scatter.

  16. Quantum scattering studies of spin-orbit effects in the Cl({sup 2}P) + HCl {yields} ClH + Cl({sup 2}P) reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schatz, G.C.; McCabe, P.; Connor, J.N.L.

    1998-07-01

    The authors present quantum scattering calculations for the Cl + HCl {yields} ClH + Cl reaction in which they include the three electronic states that correlate asymptotically to the ground state of Cl({sup 2}P) + HCl(X{sup 1}{Sigma}{sup +}). The potential surfaces and couplings are taken from the recent work of C.S. Maierle, G.C. Schatz, M.S. Gordon, P. McCabe and J.N.L. Connor, J. Chem. Soc. Farad. Trans. (1997). They are based on extensive ab initio calculations for geometries in the vicinity of the lowest energy saddle point, and on an electrostatic expansion (plus empirical dispersion and repulsion) for long range geometriesmore » including the van der Waals wells. Spin-orbit coupling has been included using a spin-orbit coupling parameter {lambda} that is assumed to be independent of nuclear geometry, and Coriolis interactions are incorporated accurately. The scattering calculations use a hyperspherical coordinate coupled channel method in full dimensionality. AJ-shifting approximation is employed to convert cumulative reaction probabilities for total angular momentum quantum number J = 1/2 into state selected and thermal rate coefficients. Two issues have been studied: (a) the influence of the magnitude of {lambda} on the fine-structure resolved cumulative probabilities and rate coefficients (the authors consider {lambda}`s that vary from 0 to {+-}100% of the true Cl value), and (b) the transition state resonance spectrum, and its variation with {lambda} and with other parameters in the calculations. Cl + HCl is a simple hydrogen transfer reaction which serves as a canonical model both for heavy-light-heavy atom reactions, and for the reactions of halogen atoms with closed shell molecules.« less

  17. Feasibility study of direct spectra measurements for Thomson scattered signals for KSTAR fusion-grade plasmas

    NASA Astrophysics Data System (ADS)

    Park, K.-R.; Kim, K.-h.; Kwak, S.; Svensson, J.; Lee, J.; Ghim, Y.-c.

    2017-11-01

    Feasibility study of direct spectra measurements of Thomson scattered photons for fusion-grade plasmas is performed based on a forward model of the KSTAR Thomson scattering system. Expected spectra in the forward model are calculated based on Selden function including the relativistic polarization correction. Noise in the signal is modeled with photon noise and Gaussian electrical noise. Electron temperature and density are inferred using Bayesian probability theory. Based on bias error, full width at half maximum and entropy of posterior distributions, spectral measurements are found to be feasible. Comparisons between spectrometer-based and polychromator-based Thomson scattering systems are performed with varying quantum efficiency and electrical noise levels.

  18. Doppler Temperature Coefficient Calculations Using Adjoint-Weighted Tallies and Continuous Energy Cross Sections in MCNP6

    NASA Astrophysics Data System (ADS)

    Gonzales, Matthew Alejandro

    The calculation of the thermal neutron Doppler temperature reactivity feedback co-efficient, a key parameter in the design and safe operation of advanced reactors, using first order perturbation theory in continuous energy Monte Carlo codes is challenging as the continuous energy adjoint flux is not readily available. Traditional approaches of obtaining the adjoint flux attempt to invert the random walk process as well as require data corresponding to all temperatures and their respective temperature derivatives within the system in order to accurately calculate the Doppler temperature feedback. A new method has been developed using adjoint-weighted tallies and On-The-Fly (OTF) generated continuous energy cross sections within the Monte Carlo N-Particle (MCNP6) transport code. The adjoint-weighted tallies are generated during the continuous energy k-eigenvalue Monte Carlo calculation. The weighting is based upon the iterated fission probability interpretation of the adjoint flux, which is the steady state population in a critical nuclear reactor caused by a neutron introduced at that point in phase space. The adjoint-weighted tallies are produced in a forward calculation and do not require an inversion of the random walk. The OTF cross section database uses a high order functional expansion between points on a user-defined energy-temperature mesh in which the coefficients with respect to a polynomial fitting in temperature are stored. The coefficients of the fits are generated before run- time and called upon during the simulation to produce cross sections at any given energy and temperature. The polynomial form of the OTF cross sections allows the possibility of obtaining temperature derivatives of the cross sections on-the-fly. The use of Monte Carlo sampling of adjoint-weighted tallies and the capability of computing derivatives of continuous energy cross sections with respect to temperature are used to calculate the Doppler temperature coefficient in a research version of MCNP6. Temperature feedback results from the cross sections themselves, changes in the probability density functions, as well as changes in the density of the materials. The focus of this work is specific to the Doppler temperature feedback which result from Doppler broadening of cross sections as well as changes in the probability density function within the scattering kernel. This method is compared against published results using Mosteller's numerical benchmark to show accurate evaluations of the Doppler temperature coefficient, fuel assembly calculations, and a benchmark solution based on the heavy gas model for free-gas elastic scattering. An infinite medium benchmark for neutron free gas elastic scattering for large scattering ratios and constant absorption cross section has been developed using the heavy gas model. An exact closed form solution for the neutron energy spectrum is obtained in terms of the confluent hypergeometric function and compared against spectra for the free gas scattering model in MCNP6. Results show a quick increase in convergence of the analytic energy spectrum to the MCNP6 code with increasing target size, showing absolute relative differences of less than 5% for neutrons scattering with carbon. The analytic solution has been generalized to accommodate piecewise constant in energy absorption cross section to produce temperature feedback. Results reinforce the constraints in which heavy gas theory may be applied resulting in a significant target size to accommodate increasing cross section structure. The energy dependent piecewise constant cross section heavy gas model was used to produce a benchmark calculation of the Doppler temperature coefficient to show accurate calculations when using the adjoint-weighted method. Results show the Doppler temperature coefficient using adjoint weighting and cross section derivatives accurately obtains the correct solution within statistics as well as reduce computer runtimes by a factor of 50.

  19. Quantum mechanical prediction of four-phonon scattering rates and reduced thermal conductivity of solids

    NASA Astrophysics Data System (ADS)

    Feng, Tianli; Ruan, Xiulin

    2016-01-01

    Recently, first principle-based predictions of lattice thermal conductivity κ from perturbation theory have achieved significant success. However, it only includes three-phonon scattering due to the assumption that four-phonon and higher-order processes are generally unimportant. Also, directly evaluating the scattering rates of four-phonon and higher-order processes has been a long-standing challenge. In this work, however, we have developed a formalism to explicitly determine quantum mechanical scattering probability matrices for four-phonon scattering in the full Brillouin zone, and by mitigating the computational challenge we have directly calculated four-phonon scattering rates. We find that four-phonon scattering rates are comparable to three-phonon scattering rates at medium and high temperatures, and they increase quadratically with temperature. As a consequence, κ of Lennard-Jones argon is reduced by more than 60% at 80 K when four-phonon scattering is included. Also, in less anharmonic materials—diamond, silicon, and germanium—κ is still reduced considerably at high temperature by four-phonon scattering by using the classical Tersoff potentials. Also, the thermal conductivity of optical phonons is dominated by the fourth- and higher-orders phonon scattering even at low temperature.

  20. Analytically based photon scatter modeling for a multipinhole cardiac SPECT camera.

    PubMed

    Pourmoghaddas, Amir; Wells, R Glenn

    2016-11-01

    Dedicated cardiac SPECT scanners have improved performance over standard gamma cameras allowing reductions in acquisition times and/or injected activity. One approach to improving performance has been to use pinhole collimators, but this can cause position-dependent variations in attenuation, sensitivity, and spatial resolution. CT attenuation correction (AC) and an accurate system model can compensate for many of these effects; however, scatter correction (SC) remains an outstanding issue. In addition, in cameras using cadmium-zinc-telluride-based detectors, a large portion of unscattered photons is detected with reduced energy (low-energy tail). Consequently, application of energy-based SC approaches in these cameras leads to a higher increase in noise than with standard cameras due to the subtraction of true counts detected in the low-energy tail. Model-based approaches with parallel-hole collimator systems accurately calculate scatter based on the physics of photon interactions in the patient and camera and generate lower-noise estimates of scatter than energy-based SC. In this study, the accuracy of a model-based SC method was assessed using physical phantom studies on the GE-Discovery NM530c and its performance was compared to a dual energy window (DEW)-SC method. The analytical photon distribution (APD) method was used to calculate the distribution of probabilities that emitted photons will scatter in the surrounding scattering medium and be subsequently detected. APD scatter calculations for 99m Tc-SPECT (140 ± 14 keV) were validated with point-source measurements and 15 anthropomorphic cardiac-torso phantom experiments and varying levels of extra-cardiac activity causing scatter inside the heart. The activity inserted into the myocardial compartment of the phantom was first measured using a dose calibrator. CT images were acquired on an Infinia Hawkeye (GE Healthcare) SPECT/CT and coregistered with emission data for AC. For comparison, DEW scatter projections (120 ± 6 keV ) were also extracted from the acquired list-mode SPECT data. Either APD or DEW scatter projections were subtracted from corresponding 140 keV measured projections and then reconstructed with AC (APD-SC and DEW-SC). Quantitative accuracy of the activity measured in the heart for the APD-SC and DEW-SC images was assessed against dose calibrator measurements. The difference between modeled and acquired projections was measured as the root-mean-squared-error (RMSE). APD-modeled projections for a clinical cardiac study were also evaluated. APD-modeled projections showed good agreement with SPECT measurements and had reduced noise compared to DEW scatter estimates. APD-SC reduced mean error in activity measurement compared to DEW-SC in images and the reduction was statistically significant where the scatter fraction (SF) was large (mean SF = 28.5%, T-test p = 0.007). APD-SC reduced measurement uncertainties as well; however, the difference was not found to be statistically significant (F-test p > 0.5). RMSE comparisons showed that elevated levels of scatter did not significantly contribute to a change in RMSE (p > 0.2). Model-based APD scatter estimation is feasible for dedicated cardiac SPECT scanners with pinhole collimators. APD-SC images performed better than DEW-SC images and improved the accuracy of activity measurement in high-scatter scenarios.

  1. Scattering of electromagnetic wave by the layer with one-dimensional random inhomogeneities

    NASA Astrophysics Data System (ADS)

    Kogan, Lev; Zaboronkova, Tatiana; Grigoriev, Gennadii., IV.

    A great deal of attention has been paid to the study of probability characteristics of electro-magnetic waves scattered by one-dimensional fluctuations of medium dielectric permittivity. However, the problem of a determination of a density of a probability and average intensity of the field inside the stochastically inhomogeneous medium with arbitrary extension of fluc-tuations has not been considered yet. It is the purpose of the present report to find and to analyze the indicated functions for the plane electromagnetic wave scattered by the layer with one-dimensional fluctuations of permittivity. We assumed that the length and the amplitude of individual fluctuations as well the interval between them are random quantities. All of indi-cated fluctuation parameters are supposed as independent random values possessing Gaussian distribution. We considered the stationary time cases both small-scale and large-scale rarefied inhomogeneities. Mathematically such problem can be reduced to the solution of integral Fred-holm equation of second kind for Hertz potential (U). Using the decomposition of the field into the series of multiply scattered waves we obtained the expression for a probability density of the field of the plane wave and determined the moments of the scattered field. We have shown that all odd moments of the centered field (U-¡U¿) are equal to zero and the even moments depend on the intensity. It was obtained that the probability density of the field possesses the Gaussian distribution. The average field is small compared with the standard fluctuation of scattered field for all considered cases of inhomogeneities. The value of average intensity of the field is an order of a standard of fluctuations of field intensity and drops with increases the inhomogeneities length in the case of small-scale inhomogeneities. The behavior of average intensity is more complicated in the case of large-scale medium inhomogeneities. The value of average intensity is the oscillating function versus the average fluctuations length if the standard of fluctuations of inhomogeneities length is greater then the wave length. When the standard of fluctuations of medium inhomogeneities extension is smaller then the wave length, the av-erage intensity value weakly depends from the average fluctuations extension. The obtained results may be used for analysis of the electromagnetic wave propagation into the media with the fluctuating parameters caused by such factors as leafs of trees, cumulus, internal gravity waves with a chaotic phase and etc. Acknowledgment: This work was supported by the Russian Foundation for Basic Research (projects 08-02-97026 and 09-05-00450).

  2. Normal mode and experimental analysis of TNT Raman spectrum

    NASA Astrophysics Data System (ADS)

    Liu, Yuemin; Perkins, Richard; Liu, Yucheng; Tzeng, Nianfeng

    2017-04-01

    In this study, a Raman spectrum of TNT was characterized through experiments and simulated using 22 hybrid density functional theory (DFT) methods. Among the different hybrid DFT methods, it was found that the most accurate simulation results of the Raman shift frequency were calculated by the O3LYP method. However, the deviations of the calculated Raman frequencies from the experimental value showed no dependency on the abilities of the DFT methods in recovering the correlation energy. The accuracies of the DFT methods in predicting the Raman bands are probably determined by the numerical grid and convergence criteria for optimizations of each DFT method. It was also decided that the prominent Raman shift 1362 cm-1 is mainly caused by symmetric stretching of the 4-nitro groups. Findings of this study can facilitate futuristic development of more effective surface enhanced Raman spectroscopy/scattering (SERS) substrates for explosive characterization and detection.

  3. Muon energy estimate through multiple scattering with the MACRO detector

    NASA Astrophysics Data System (ADS)

    Ambrosio, M.; Antolini, R.; Auriemma, G.; Bakari, D.; Baldini, A.; Barbarino, G. C.; Barish, B. C.; Battistoni, G.; Becherini, Y.; Bellotti, R.; Bemporad, C.; Bernardini, P.; Bilokon, H.; Bloise, C.; Bower, C.; Brigida, M.; Bussino, S.; Cafagna, F.; Calicchio, M.; Campana, D.; Candela, A.; Carboni, M.; Caruso, R.; Cassese, F.; Cecchini, S.; Cei, F.; Chiarella, V.; Choudhary, B. C.; Coutu, S.; Cozzi, M.; de Cataldo, G.; de Deo, M.; Dekhissi, H.; de Marzo, C.; de Mitri, I.; Derkaoui, J.; de Vincenzi, M.; di Credico, A.; Dincecco, M.; Erriquez, O.; Favuzzi, C.; Forti, C.; Fusco, P.; Giacomelli, G.; Giannini, G.; Giglietto, N.; Giorgini, M.; Grassi, M.; Gray, L.; Grillo, A.; Guarino, F.; Gustavino, C.; Habig, A.; Hanson, K.; Heinz, R.; Iarocci, E.; Katsavounidis, E.; Katsavounidis, I.; Kearns, E.; Kim, H.; Kyriazopoulou, S.; Lamanna, E.; Lane, C.; Levin, D. S.; Lindozzi, M.; Lipari, P.; Longley, N. P.; Longo, M. J.; Loparco, F.; Maaroufi, F.; Mancarella, G.; Mandrioli, G.; Margiotta, A.; Marini, A.; Martello, D.; Marzari-Chiesa, A.; Mazziotta, M. N.; Michael, D. G.; Monacelli, P.; Montaruli, T.; Monteno, M.; Mufson, S.; Musser, J.; Nicolo, D.; Nolty, R.; Orth, C.; Osteria, G.; Palamara, O.; Patera, V.; Patrizii, L.; Pazzi, R.; Peck, C. W.; Perrone, L.; Petrera, S.; Pistilli, P.; Popa, V.; Raino, A.; Reynoldson, J.; Ronga, F.; Rrhioua, A.; Satriano, C.; Scapparone, E.; Scholberg, K.; Sciubba, A.; Serra, P.; Sioli, M.; Sirri, G.; Sitta, M.; Spinelli, P.; Spinetti, M.; Spurio, M.; Steinberg, R.; Stone, J. L.; Sulak, L. R.; Surdo, A.; Tarle, G.; Tatananni, E.; Togo, V.; Vakili, M.; Walter, C. W.; Webb, R.; MACRO Collaboration

    2002-10-01

    Muon energy measurement represents an important issue for any experiment addressing neutrino-induced up-going muon studies. Since the neutrino oscillation probability depends on the neutrino energy, a measurement of the muon energy adds an important piece of information concerning the neutrino system. We show in this paper how the MACRO limited streamer tube system can be operated in drift mode by using the TDCs included in the QTPs, an electronics designed for magnetic monopole search. An improvement of the space resolution is obtained, through an analysis of the multiple scattering of muon tracks as they pass through our detector. This information can be used further to obtain an estimate of the energy of muons crossing the detector. Here we present the results of two dedicated tests, performed at CERN PS-T9 and SPS-X7 beam lines, to provide a full check of the electronics and to exploit the feasibility of such a multiple scattering analysis. We show that by using a neural network approach, we are able to reconstruct the muon energy for E μ<40 GeV. The test beam data provide an absolute energy calibration, which allows us to apply this method to MACRO data.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Xi; Mou, Xuanqin; Nishikawa, Robert M.

    Purpose: Small calcifications are often the earliest and the main indicator of breast cancer. Dual-energy digital mammography (DEDM) has been considered as a promising technique to improve the detectability of calcifications since it can be used to suppress the contrast between adipose and glandular tissues of the breast. X-ray scatter leads to erroneous calculations of the DEDM image. Although the pinhole-array interpolation method can estimate scattered radiations, it requires extra exposures to measure the scatter and apply the correction. The purpose of this work is to design an algorithmic method for scatter correction in DEDM without extra exposures.Methods: In thismore » paper, a scatter correction method for DEDM was developed based on the knowledge that scattered radiation has small spatial variation and that the majority of pixels in a mammogram are noncalcification pixels. The scatter fraction was estimated in the DEDM calculation and the measured scatter fraction was used to remove scatter from the image. The scatter correction method was implemented on a commercial full-field digital mammography system with breast tissue equivalent phantom and calcification phantom. The authors also implemented the pinhole-array interpolation scatter correction method on the system. Phantom results for both methods are presented and discussed. The authors compared the background DE calcification signals and the contrast-to-noise ratio (CNR) of calcifications in the three DE calcification images: image without scatter correction, image with scatter correction using pinhole-array interpolation method, and image with scatter correction using the authors' algorithmic method.Results: The authors' results show that the resultant background DE calcification signal can be reduced. The root-mean-square of background DE calcification signal of 1962 μm with scatter-uncorrected data was reduced to 194 μm after scatter correction using the authors' algorithmic method. The range of background DE calcification signals using scatter-uncorrected data was reduced by 58% with scatter-corrected data by algorithmic method. With the scatter-correction algorithm and denoising, the minimum visible calcification size can be reduced from 380 to 280 μm.Conclusions: When applying the proposed algorithmic scatter correction to images, the resultant background DE calcification signals can be reduced and the CNR of calcifications can be improved. This method has similar or even better performance than pinhole-array interpolation method in scatter correction for DEDM; moreover, this method is convenient and requires no extra exposure to the patient. Although the proposed scatter correction method is effective, it is validated by a 5-cm-thick phantom with calcifications and homogeneous background. The method should be tested on structured backgrounds to more accurately gauge effectiveness.« less

  5. Quantum State-Resolved Collision Dynamics of Nitric Oxide at Ionic Liquid and Molten Metal Surfaces

    NASA Astrophysics Data System (ADS)

    Zutz, Amelia Marie

    Detailed molecular scale interactions at the gas-liquid interface are explored with quantum state-to-state resolved scattering of a jet-cooled beam of NO(2pi1/2; N = 0) from ionic liquid and molten metal surfaces. The scattered distributions are probed via laser-induced fluorescence methods, which yield rotational and spin-orbit state populations that elucidate the dynamics of energy transfer at the gas-liquid interface. These collision dynamics are explored as a function of incident collision energy, surface temperature, scattering angle, and liquid identity, all of which are found to substantially affect the degree of rotational, electronic and vibrational excitation of NO via collisions at the liquid surface. Rotational distributions observed reveal two distinct scattering pathways, (i) molecules that trap, thermalize and eventually desorb from the surface (trapping-desorption, TD), and (ii) those that undergo prompt recoil (impulsive scattering, IS) prior to complete equilibration with the liquid surface. Thermally desorbing NO molecules are found to have rotational temperatures close to, but slightly cooler than the surface temperature, indicative of rotational dependent sticking probabilities on liquid surfaces. Nitric oxide is a radical with multiple low-lying electronic states that serves as an ideal candidate for exploring nonadiabatic state-changing collision dynamics at the gas-liquid interface, which induce significant excitation from ground (2pi1/2) to excited (2pi 3/2) spin-orbit states. Molecular beam scattering of supersonically cooled NO from hot molten metals (Ga and Au, Ts = 300 - 1400 K) is also explored, which provide preliminary evidence for vibrational excitation of NO mediated by thermally populated electron-hole pairs in the hot, conducting liquid metals. The results highlight the presence of electronically nonadiabatic effects and build toward a more complete characterization of energy transfer dynamics at gas-liquid interfaces.

  6. Multiple scattering in the high-frequency limit with second-order shadowing function from 2D anisotropic rough dielectric surfaces: I. Theoretical study

    NASA Astrophysics Data System (ADS)

    Bourlier, C.; Berginc, G.

    2004-07-01

    In this paper the first- and second-order Kirchhoff approximation is applied to study the backscattering enhancement phenomenon, which appears when the surface rms slope is greater than 0.5. The formulation is reduced to the geometric optics approximation in which the second-order illumination function is taken into account. This study is developed for a two-dimensional (2D) anisotropic stationary rough dielectric surface and for any surface slope and height distributions assumed to be statistically even. Using the Weyl representation of the Green function (which introduces an absolute value over the surface elevation in the phase term), the incoherent scattering coefficient under the stationary phase assumption is expressed as the sum of three terms. The incoherent scattering coefficient then requires the numerical computation of a ten- dimensional integral. To reduce the number of numerical integrations, the geometric optics approximation is applied, which assumes that the correlation between two adjacent points is very strong. The model is then proportional to two surface slope probabilities, for which the slopes would specularly reflect the beams in the double scattering process. In addition, the slope distributions are related with each other by a propagating function, which accounts for the second-order illumination function. The companion paper is devoted to the simulation of this model and comparisons with an 'exact' numerical method.

  7. Laser spot dynamics.

    PubMed

    Postan, A

    1987-03-01

    The dynamics of a pulsed laser spot covering an optical aperture of a receiver is analyzed. This analysis includes the influence of diffraction, jitter, atmospheric absorption and scattering, and atmospheric turbulence. A simple expression for the probability of response of the receiver illuminated by the laser spot is derived. It is found that this probability would not always increase as the laser beam divergence decreases. Moreover, this probability has an optimum (maximum) with respect to the laser beam divergence or rather with respect to the diameter of the transmitting optics.

  8. Impact Hazard Monitoring: Theory and Implementation

    NASA Astrophysics Data System (ADS)

    Farnocchia, Davide

    2015-08-01

    Impact monitoring is a crucial component of the mitigation or elimination of the hazard posed by asteroid impacts. Once an asteroid is discovered, it is important to achieve an early detection and an accurate assessment of the risk posed by future Earth encounters. Here we review the most standard impact monitoring techniques. Linear methods are the fastest approach but their applicability regime is limited because of the chaotic dynamics of near-Earth asteroids, whose orbits are often scattered by planetary encounters. Among nonlinear methods, Monte Carlo algorithms are the most reliable ones. However, the large number of near-Earth asteroids and the computational load required to detect low probability impact events make Monte Carlo approaches impractical in the framework of monitoring all near-Earth asteroids. In the last 15 years, the Line of Variations (LOV) method has been the most successful technique as it strikes a remarkable compromise between computational efficiency and the capability of detecting low probability events deep in the nonlinear regime. As a matter of fact, the LOV method is the engine of JPL’s Sentry and University of Pisa’s NEODyS, which the two fully automated impact monitoring systems that routinely search for potential impactors among known near-Earth asteroids. We also present some more recent techniques developed to deal with the new challenges arising in the impact hazard assessment problem. In particular, we describe how to use keyhole maps to go beyond strongly scattering encounters and push forward in time the impact prediction horizon. In these cases asteroids usually have a very well constrained orbit and we often need to account for the action of nongravitational perturbations, especially the Yarkovsky effect. Finally, we discuss the short-term hazard assessment problem for newly discovered asteroids, when only a short observed arc is available. The limited amount of observational data generally leads to severe degeneracies in the orbit estimation process. We overcome these degeneracies by employing ranging techniques, which scan the poorly constrained space of topocentric range and range rate.

  9. Analysis of Ion Composition Estimation Accuracy for Incoherent Scatter Radars

    NASA Astrophysics Data System (ADS)

    Martínez Ledesma, M.; Diaz, M. A.

    2017-12-01

    The Incoherent Scatter Radar (ISR) is one of the most powerful sounding methods developed to estimate the Ionosphere. This radar system determines the plasma parameters by sending powerful electromagnetic pulses to the Ionosphere and analyzing the received backscatter. This analysis provides information about parameters such as electron and ion temperatures, electron densities, ion composition, and ion drift velocities. Nevertheless in some cases the ISR analysis has ambiguities in the determination of the plasma characteristics. It is of particular relevance the ion composition and temperature ambiguity obtained between the F1 and the lower F2 layers. In this case very similar signals are obtained with different mixtures of molecular ions (NO2+ and O2+) and atomic oxygen ions (O+), and consequently it is not possible to completely discriminate between them. The most common solution to solve this problem is the use of empirical or theoretical models of the ionosphere in the fitting of ambiguous data. More recent works take use of parameters estimated from the Plasma Line band of the radar to reduce the number of parameters to determine. In this work we propose to determine the error estimation of the ion composition ambiguity when using Plasma Line electron density measurements. The sensibility of the ion composition estimation has been also calculated depending on the accuracy of the ionospheric model, showing that the correct estimation is highly dependent on the capacity of the model to approximate the real values. Monte Carlo simulations of data fitting at different signal to noise (SNR) ratios have been done to obtain valid and invalid estimation probability curves. This analysis provides a method to determine the probability of erroneous estimation for different signal fluctuations. Also it can be used as an empirical method to compare the efficiency of the different algorithms and methods on when solving the ion composition ambiguity.

  10. Stationary phase method and delay times for relativistic and non-relativistic tunneling particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernardini, A.E.

    2009-06-15

    The stationary phase method is frequently adopted for calculating tunneling phase times of analytically-continuous Gaussian or infinite-bandwidth step pulses which collide with a potential barrier. This report deals with the basic concepts on deducing transit times for quantum scattering: the stationary phase method and its relation with delay times for relativistic and non-relativistic tunneling particles. After reexamining the above-barrier diffusion problem, we notice that the applicability of this method is constrained by several subtleties in deriving the phase time that describes the localization of scattered wave packets. Using a recently developed procedure - multiple wave packet decomposition - for somemore » specifical colliding configurations, we demonstrate that the analytical difficulties arising when the stationary phase method is applied for obtaining phase (traversal) times are all overcome. In this case, we also investigate the general relation between phase times and dwell times for quantum tunneling/scattering. Considering a symmetrical collision of two identical wave packets with an one-dimensional barrier, we demonstrate that these two distinct transit time definitions are explicitly connected. The traversal times are obtained for a symmetrized (two identical bosons) and an antisymmetrized (two identical fermions) quantum colliding configuration. Multiple wave packet decomposition shows us that the phase time (group delay) describes the exact position of the scattered particles and, in addition to the exact relation with the dwell time, leads to correct conceptual understanding of both transit time definitions. At last, we extend the non-relativistic formalism to the solutions for the tunneling zone of a one-dimensional electrostatic potential in the relativistic (Dirac to Klein-Gordon) wave equation where the incoming wave packet exhibits the possibility of being almost totally transmitted through the potential barrier. The conditions for the occurrence of accelerated and, eventually, superluminal tunneling transmission probabilities are all quantified and the problematic superluminal interpretation based on the non-relativistic tunneling dynamics is revisited. Lessons concerning the dynamics of relativistic tunneling and the mathematical structure of its solutions suggest revealing insights into mathematically analogous condensed-matter experiments using electrostatic barriers in single- and bi-layer graphene, for which the accelerated tunneling effect deserves a more careful investigation.« less

  11. Scatter correction for cone-beam computed tomography using self-adaptive scatter kernel superposition

    NASA Astrophysics Data System (ADS)

    Xie, Shi-Peng; Luo, Li-Min

    2012-06-01

    The authors propose a combined scatter reduction and correction method to improve image quality in cone beam computed tomography (CBCT). The scatter kernel superposition (SKS) method has been used occasionally in previous studies. However, this method differs in that a scatter detecting blocker (SDB) was used between the X-ray source and the tested object to model the self-adaptive scatter kernel. This study first evaluates the scatter kernel parameters using the SDB, and then isolates the scatter distribution based on the SKS. The quality of image can be improved by removing the scatter distribution. The results show that the method can effectively reduce the scatter artifacts, and increase the image quality. Our approach increases the image contrast and reduces the magnitude of cupping. The accuracy of the SKS technique can be significantly improved in our method by using a self-adaptive scatter kernel. This method is computationally efficient, easy to implement, and provides scatter correction using a single scan acquisition.

  12. S-matrix decomposition, natural reaction channels, and the quantum transition state approach to reactive scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Manthe, Uwe, E-mail: uwe.manthe@uni-bielefeld.de; Ellerbrock, Roman, E-mail: roman.ellerbrock@uni-bielefeld.de

    2016-05-28

    A new approach for the quantum-state resolved analysis of polyatomic reactions is introduced. Based on the singular value decomposition of the S-matrix, energy-dependent natural reaction channels and natural reaction probabilities are defined. It is shown that the natural reaction probabilities are equal to the eigenvalues of the reaction probability operator [U. Manthe and W. H. Miller, J. Chem. Phys. 99, 3411 (1993)]. Consequently, the natural reaction channels can be interpreted as uniquely defined pathways through the transition state of the reaction. The analysis can efficiently be combined with reactive scattering calculations based on the propagation of thermal flux eigenstates. Inmore » contrast to a decomposition based straightforwardly on thermal flux eigenstates, it does not depend on the choice of the dividing surface separating reactants from products. The new approach is illustrated studying a prototypical example, the H + CH{sub 4} → H{sub 2} + CH{sub 3} reaction. The natural reaction probabilities and the contributions of the different vibrational states of the methyl product to the natural reaction channels are calculated and discussed. The relation between the thermal flux eigenstates and the natural reaction channels is studied in detail.« less

  13. Detective quantum efficiency of photon-counting x-ray detectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanguay, Jesse, E-mail: jessetan@mail.ubc.ca; Yun, Seungman; Kim, Ho Kyung

    Purpose: Single-photon-counting (SPC) x-ray imaging has the potential to improve image quality and enable novel energy-dependent imaging methods. Similar to conventional detectors, optimizing image SPC quality will require systems that produce the highest possible detective quantum efficiency (DQE). This paper builds on the cascaded-systems analysis (CSA) framework to develop a comprehensive description of the DQE of SPC detectors that implement adaptive binning. Methods: The DQE of SPC systems can be described using the CSA approach by propagating the probability density function (PDF) of the number of image-forming quanta through simple quantum processes. New relationships are developed to describe PDF transfermore » through serial and parallel cascades to accommodate scatter reabsorption. Results are applied to hypothetical silicon and selenium-based flat-panel SPC detectors including the effects of reabsorption of characteristic/scatter photons from photoelectric and Compton interactions, stochastic conversion of x-ray energy to secondary quanta, depth-dependent charge collection, and electronic noise. Results are compared with a Monte Carlo study. Results: Depth-dependent collection efficiency can result in substantial broadening of photopeaks that in turn may result in reduced DQE at lower x-ray energies (20–45 keV). Double-counting interaction events caused by reabsorption of characteristic/scatter photons may result in falsely inflated image signal-to-noise ratio and potential overestimation of the DQE. Conclusions: The CSA approach is extended to describe signal and noise propagation through photoelectric and Compton interactions in SPC detectors, including the effects of escape and reabsorption of emission/scatter photons. High-performance SPC systems can be achieved but only for certain combinations of secondary conversion gain, depth-dependent collection efficiency, electronic noise, and reabsorption characteristics.« less

  14. Microwave backscattering theory and active remote sensing of the ocean surface

    NASA Technical Reports Server (NTRS)

    Brown, G. S.; Miller, L. S.

    1977-01-01

    The status is reviewed of electromagnetic scattering theory relative to the interpretation of microwave remote sensing data acquired from spaceborne platforms over the ocean surface. Particular emphasis is given to the assumptions which are either implicit or explicit in the theory. The multiple scale scattering theory developed during this investigation is extended to non-Gaussian surface statistics. It is shown that the important statistic for the case is the probability density function of the small scale heights conditioned on the large scale slopes; this dependence may explain the anisotropic scattering measurements recently obtained with the AAFE Radscat. It is noted that present surface measurements are inadequate to verify or reject the existing scattering theories. Surface measurements are recommended for qualifying sensor data from radar altimeters and scatterometers. Additional scattering investigations are suggested for imaging type radars employing synthetically generated apertures.

  15. CS and IOS approximations for fine structure transitions in Na(/sup 2/P)--He(/sup 1/S) collisions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fitz, D.E.; Kouri, D.J.

    1980-11-15

    The l-average CS and IOS approximations are extended to treat fine structure transitions in /sup 2/P atom--/sup 1/S atom scattering. Calculations of degeneracy averaged probabilities and differential cross sections for Na(/sup 2/P)+He(/sup 1/S) collisions in the CS and IOS methods agree well with the CC results. The present nonunitarized form of the CS approximation fails to properly predict all of the jm..-->..j'm' sections and in particular leads to a selection rule forbidding jm..-->..j--m transitions for j=half-odd integer values.

  16. The self-organization and functional activity of binary system based on erucyl amidopropyl betaine - alkylated polyethyleneimine

    NASA Astrophysics Data System (ADS)

    Gaynanova, Gulnara A.; Valiakhmetova, Alsu R.; Kuryashov, Dmitry A.; Kudryashova, Yuliana R.; Lukashenko, Svetlana S.; Syakaev, Victor V.; Latypov, Shamil K.; Bukharov, Sergey V.; Bashkirtseva, Natalia Yu.; Zakharova, Lucia Ya.

    2013-11-01

    The self-organization in individual and binary aqueous solutions of a zwitterionic surfactant erucyl amidopropyl betaine and alkylated polyethyleneimine is carried out with a wide range of physical and chemical methods, including tensiometry, conductometry, dynamic light scattering, pH-metry, spectrophotometry, and fluorescence spectroscopy. The data obtained strongly support the formation of nanosized aggregates in the systems and provide information on their structure and probable morphological transitions. High solubilization capacity and data on the contact angle showed a possibility of the application of these systems as nanocontainers or oil wetting agents in the oil recovery.

  17. A study on scattering correction for γ-photon 3D imaging test method

    NASA Astrophysics Data System (ADS)

    Xiao, Hui; Zhao, Min; Liu, Jiantang; Chen, Hao

    2018-03-01

    A pair of 511KeV γ-photons is generated during a positron annihilation. Their directions differ by 180°. The moving path and energy information can be utilized to form the 3D imaging test method in industrial domain. However, the scattered γ-photons are the major factors influencing the imaging precision of the test method. This study proposes a γ-photon single scattering correction method from the perspective of spatial geometry. The method first determines possible scattering points when the scattered γ-photon pair hits the detector pair. The range of scattering angle can then be calculated according to the energy window. Finally, the number of scattered γ-photons denotes the attenuation of the total scattered γ-photons along its moving path. The corrected γ-photons are obtained by deducting the scattered γ-photons from the original ones. Two experiments are conducted to verify the effectiveness of the proposed scattering correction method. The results concluded that the proposed scattering correction method can efficiently correct scattered γ-photons and improve the test accuracy.

  18. The manifestation of vibrational excitation effect in reactions C + SH(v = 0-20, j = 0) \\rightarrow H + CS, S + CH

    NASA Astrophysics Data System (ADS)

    Zhang, Lulu; Gao, Shoubao; Song, Yuzhi; Meng, Qingtian

    2018-03-01

    The dependence of the cross section for the C + SH \\to H + CS, S + CH reactions on the vibrational excitation of SH(v = 0-20, j = 0) is analyzed in detail at the collision energies of 0.3 and 0.8 eV by using the quasi-classical trajectory method and the new potential energy surface (Song et al 2016 Sci. Rep. 6 37734) of the {{HCS}}({{X}}{}2{{A}}\\prime ). The efficiency of vibrational excitation to promote the reaction is investigated through the analysis of the cross section and its v dependence in terms of the reaction probability, maximum impact parameter, and the features of the potential energy surface. The differential cross sections obtained show that at higher vibrational levels, the products (CS, CH) are mainly forward scattered, and the sideward and backward scatterings are quite weak. In addition to the scalar properties, the stereodynamical attributes, such as angle distribution functions P(θ r ), P(ϕ r ) and P(θ r , ϕ r ) at different vibrational levels are explored in detail. Furthermore, through the investigation of the state-to-state dynamics for the titled reaction, it is clear that the vibrational excitation of the product for C + SH \\to H + CS reaction is quite strong, with the most probable population appearing at high vibration numbers.

  19. Chirality Characterization of Dispersed Single Wall Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Namkung, Min; Williams, Phillip A.; Mayweather, Candis D.; Wincheski, Buzz; Park, Cheol; Namkung, Juock S.

    2005-01-01

    Raman scattering and optical absorption spectroscopy are used for the chirality characterization of HiPco single wall carbon nanotubes (SWNTs) dispersed in aqueous solution with the surfactant sodium dodecylbenzene sulfonate. Radial breathing mode (RBM) Raman peaks for semiconducting and metallic SWNTs are identified by directly comparing the Raman spectra with the Kataura plot. The SWNT diameters are calculated from these resonant peak positions. Next, a list of (n, m) pairs, yielding the SWNT diameters within a few percent of that obtained from each resonant peak position, is established. The interband transition energies for the list of SWNT (n, m) pairs are calculated based on the tight binding energy expression for each list of the (n, m) pairs, and the pairs yielding the closest values to the corresponding experimental optical absorption peaks are selected. The results reveal that (1, 11), (4, 11), and (0, 11) as the most probable chiralities of the semiconducting nanotubes. The results also reveal that (4, 16), (6, 12) and (8, 8) are the most probable chiralities for the metallic nanotubes. Directly relating the Raman scattering data to the optical absorption spectra, the present method is considered the simplest technique currently available. Another advantage of this technique is the use of the E(sup 8)(sub 11) peaks in the optical absorption spectrum in the analysis to enhance the accuracy in the results.

  20. Microscopic modeling of gas-surface scattering. I. A combined molecular dynamics-rate equation approach

    NASA Astrophysics Data System (ADS)

    Filinov, A.; Bonitz, M.; Loffhagen, D.

    2018-06-01

    A combination of first principle molecular dynamics (MD) simulations with a rate equation model (MD-RE approach) is presented to study the trapping and the scattering of rare gas atoms from metal surfaces. The temporal evolution of the atom fractions that are either adsorbed or scattered into the continuum is investigated in detail. We demonstrate that for this description one has to consider trapped, quasi-trapped and scattering states, and present an energetic definition of these states. The rate equations contain the transition probabilities between the states. We demonstrate how these rate equations can be derived from kinetic theory. Moreover, we present a rigorous way to determine the transition probabilities from a microscopic analysis of the particle trajectories generated by MD simulations. Once the system reaches quasi-equilibrium, the rates converge to stationary values, and the subsequent thermal adsorption/desorption dynamics is completely described by the rate equations without the need to perform further time-consuming MD simulations. As a proof of concept of our approach, MD simulations for argon atoms interacting with a platinum (111) surface are presented. A detailed deterministic trajectory analysis is performed, and the transition rates are constructed. The dependence of the rates on the incidence conditions and the lattice temperature is analyzed. Based on this example, we analyze the time scale of the gas-surface system to approach the quasi-stationary state. The MD-RE model has great relevance for the plasma-surface modeling as it makes an extension of accurate simulations to long, experimentally relevant time scales possible. Its application to the computation of atomic sticking probabilities is given in the second part (paper II).

  1. A complete measurement of spin-observables for intermediate-energy inclusive quasielastic polarized proton scattering from 12C

    NASA Astrophysics Data System (ADS)

    Chan, C.; Drake, T. E.; Abegg, R.; Frekers, D.; Häusser, O.; Hicks, K.; Hutcheon, D. A.; Lee, L.; Miller, C. A.; Schubank, R.; Yen, S.

    1990-04-01

    The complete set of Wolfenstein parameters, the polarization, the asymmetry of scattering and the unpolarized double-differential cross section are presented for inclusive quasielastic proton scattering from 12C at a central momentum transfer of q = 1.9 fm -1 and incident energies of 290 and 420 MeV. The spin observables D0, Dx, Dy and Dz as well as the longitudinal-to-transverse ratio of spin-flip probabilities are extracted from the data. Across the quasielastic continuum, the experimental data is compared to the variations expected from a single-scattering Fermi-gas approximation using the free NN amplitudes. Medium effects are evident in the pronounced quenching of the polarization parameter relative to the free value.

  2. Enhancement effects in polarimetric radar returns: Phase difference statistics

    NASA Technical Reports Server (NTRS)

    Lang, R. H.; Khadr, N.

    1993-01-01

    The probability density functions (pdfs) of the co- and cross-polarized phase differences are derived for backscatter from vegetation using the coherent and incoherent scattering theories. Unlike previous derivations, no assumptions or observations other than the applicability of the Central Limit Theorem (CLT), the low fractional volume of the medium, the reciprocity of the scatterers, and the azimuthal symmetry of the scatterer's orientation statistics are employed. Everything else follows logically via the mathematics. The difference between the coherent theory and the incoherent theory is referred to as the backscatter enhancement effect. The influence of this enhancement effect on the phase difference pdfs is examined and found to be important under combined conditions of scatterer anisotropy and appropriate reflection coefficient values.

  3. Nuclear rainbow in elastic scattering of {sup 9}Be nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Glukhov, Yu. A., E-mail: gloukhov@inbox.ru; Ogloblin, A. A.; Artemov, K. P.

    2010-01-15

    A systematic investigation of the elastic scattering of the {sup 9}Be nucleus, which is among themost loosely bound stable nuclei was performed.Differential cross sections for elastic {sup 9}Be + {sup 16}O scattering were measured at a c.m. energy of 47.5 MeV (beam of 132-MeV {sup 16}O nuclei). Available data at different energy values and data for neighboring nuclei were included in our analysis. As a result, the very fact of rainbow scattering was reliably established for the first time in systems involving {sup 9}Be. In addition, the analysis in question made it possible to identify Airy minima and to determinemore » unambiguously the nucleus-nucleus potential with a high probability.« less

  4. Development of a practical image-based scatter correction method for brain perfusion SPECT: comparison with the TEW method.

    PubMed

    Shidahara, Miho; Watabe, Hiroshi; Kim, Kyeong Min; Kato, Takashi; Kawatsu, Shoji; Kato, Rikio; Yoshimura, Kumiko; Iida, Hidehiro; Ito, Kengo

    2005-10-01

    An image-based scatter correction (IBSC) method was developed to convert scatter-uncorrected into scatter-corrected SPECT images. The purpose of this study was to validate this method by means of phantom simulations and human studies with 99mTc-labeled tracers, based on comparison with the conventional triple energy window (TEW) method. The IBSC method corrects scatter on the reconstructed image I(mub)AC with Chang's attenuation correction factor. The scatter component image is estimated by convolving I(mub)AC with a scatter function followed by multiplication with an image-based scatter fraction function. The IBSC method was evaluated with Monte Carlo simulations and 99mTc-ethyl cysteinate dimer SPECT human brain perfusion studies obtained from five volunteers. The image counts and contrast of the scatter-corrected images obtained by the IBSC and TEW methods were compared. Using data obtained from the simulations, the image counts and contrast of the scatter-corrected images obtained by the IBSC and TEW methods were found to be nearly identical for both gray and white matter. In human brain images, no significant differences in image contrast were observed between the IBSC and TEW methods. The IBSC method is a simple scatter correction technique feasible for use in clinical routine.

  5. Inverse kinematic problem for a random gradient medium in geometric optics approximation

    NASA Astrophysics Data System (ADS)

    Petersen, N. V.

    1990-03-01

    Scattering at random inhomogeneities in a gradient medium results in systematic deviations of the rays and travel times of refracted body waves from those corresponding to the deterministic velocity component. The character of the difference depends on the parameters of the deterministic and random velocity component. However, at great distances to the source, independently of the velocity parameters (weakly or strongly inhomogeneous medium), the most probable depth of the ray turning point is smaller than that corresponding to the deterministic velocity component, the most probable travel times also being lower. The relative uncertainty in the deterministic velocity component, derived from the mean travel times using methods developed for laterally homogeneous media (for instance, the Herglotz-Wiechert method), is systematic in character, but does not exceed the contrast of velocity inhomogeneities by magnitude. The gradient of the deterministic velocity component has a significant effect on the travel-time fluctuations. The variance at great distances to the source is mainly controlled by shallow inhomogeneities. The travel-time flucutations are studied only for weakly inhomogeneous media.

  6. Methods for modeling non-equilibrium degenerate statistics and quantum-confined scattering in 3D ensemble Monte Carlo transport simulations

    NASA Astrophysics Data System (ADS)

    Crum, Dax M.; Valsaraj, Amithraj; David, John K.; Register, Leonard F.; Banerjee, Sanjay K.

    2016-12-01

    Particle-based ensemble semi-classical Monte Carlo (MC) methods employ quantum corrections (QCs) to address quantum confinement and degenerate carrier populations to model tomorrow's ultra-scaled metal-oxide-semiconductor-field-effect-transistors. Here, we present the most complete treatment of quantum confinement and carrier degeneracy effects in a three-dimensional (3D) MC device simulator to date, and illustrate their significance through simulation of n-channel Si and III-V FinFETs. Original contributions include our treatment of far-from-equilibrium degenerate statistics and QC-based modeling of surface-roughness scattering, as well as considering quantum-confined phonon and ionized-impurity scattering in 3D. Typical MC simulations approximate degenerate carrier populations as Fermi distributions to model the Pauli-blocking (PB) of scattering to occupied final states. To allow for increasingly far-from-equilibrium non-Fermi carrier distributions in ultra-scaled and III-V devices, we instead generate the final-state occupation probabilities used for PB by sampling the local carrier populations as function of energy and energy valley. This process is aided by the use of fractional carriers or sub-carriers, which minimizes classical carrier-carrier scattering intrinsically incompatible with degenerate statistics. Quantum-confinement effects are addressed through quantum-correction potentials (QCPs) generated from coupled Schrödinger-Poisson solvers, as commonly done. However, we use these valley- and orientation-dependent QCPs not just to redistribute carriers in real space, or even among energy valleys, but also to calculate confinement-dependent phonon, ionized-impurity, and surface-roughness scattering rates. FinFET simulations are used to illustrate the contributions of each of these QCs. Collectively, these quantum effects can substantially reduce and even eliminate otherwise expected benefits of considered In0.53Ga0.47 As FinFETs over otherwise identical Si FinFETs despite higher thermal velocities in In0.53Ga0.47 As. It also may be possible to extend these basic uses of QCPs, however calculated, to still more computationally efficient drift-diffusion and hydrodynamic simulations, and the basic concepts even to compact device modeling.

  7. New method of control of tooth whitening

    NASA Astrophysics Data System (ADS)

    Angelov, I.; Mantareva, V.; Gisbrecht, A.; Valkanov, S.; Uzunov, Tz.

    2010-10-01

    New methods of control of tooth bleaching stages through simultaneous measurements of a reflected light and a fluorescence signal are proposed. It is shown that the bleaching process leads to significant changes in the intensity of a scattered signal and also in the shape and intensity of the fluorescence spectra. Experimental data illustrate that the bleaching process causes essential changes in the teeth discoloration in short time as 8-10 min from the beginning of the application procedure. The continuation of the treatment is not necessary moreover the probability of the enamel destroy increases considerably. The proposed optical back control of tooth surface is a base for development of a practical set up to control the duration of the bleaching procedure.

  8. Quantum vs Classical Mechanics for a 'Simple' Dissociation Reaction. Should They Give the Same Results?

    NASA Astrophysics Data System (ADS)

    Holloway, Stephen

    1997-03-01

    When performing molecular dynamical simulations on light systems at low energies, there is always the risk of producing data that bear no similarity to experiment. Indeed, John Barker himself was particularly anxious about treating Ar scattering from surfaces using classical mechanics where it had been shown experimentally in his own lab that diffraction occurs. In such cases, the correct procedure is probably to play the trump card "... well of course, quantum effects will modify this so that....." and retire gracefully. For our particular interests, the tables are turned in that we are interested in gas-surface dynamical studies for highly quantized systems, but would be interested to know when it is possible to use classical mechanics in order that a greater dimensionality might be treated. For molecular dissociation and scattering, it has been oft quoted that the greater the number of degrees of freedom, the more appropriate is classical mechanics, primarily because of the mass averaging over the quantized dimensions. Is this true? We have been investigating the dissociation of hydrogen molecules at surfaces and in this talk I will present quantum results for dissociation and scattering, along with a novel method for their interpretation based upon adiabatic potential energy surfaces. Comparison with classical calculations will be made and conclusions drawn. a novel method for their interpretation based upon adiabatic potential energy surfaces

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Greene, Samuel M., E-mail: samuel.greene@chem.ox.ac.uk; Shan, Xiao, E-mail: xiao.shan@chem.ox.ac.uk; Clary, David C., E-mail: david.clary@chem.ox.ac.u

    Semiclassical Transition State Theory (SCTST), a method for calculating rate constants of chemical reactions, offers gains in computational efficiency relative to more accurate quantum scattering methods. In full-dimensional (FD) SCTST, reaction probabilities are calculated from third and fourth potential derivatives along all vibrational degrees of freedom. However, the computational cost of FD SCTST scales unfavorably with system size, which prohibits its application to larger systems. In this study, the accuracy and efficiency of 1-D SCTST, in which only third and fourth derivatives along the reaction mode are used, are investigated in comparison to those of FD SCTST. Potential derivatives aremore » obtained from numerical ab initio Hessian matrix calculations at the MP2/cc-pVTZ level of theory, and Richardson extrapolation is applied to improve the accuracy of these derivatives. Reaction barriers are calculated at the CCSD(T)/cc-pVTZ level. Results from FD SCTST agree with results from previous theoretical and experimental studies when Richardson extrapolation is applied. Results from our implementation of 1-D SCTST, which uses only 4 single-point MP2/cc-pVTZ energy calculations in addition to those for conventional TST, agree with FD results to within a factor of 5 at 250 K. This degree of agreement and the efficiency of the 1-D method suggest its potential as a means of approximating rate constants for systems too large for existing quantum scattering methods.« less

  10. Correlation of 0.67um scatter with local stress in Ge impacted with the modified Cambridge liquid jet device

    NASA Astrophysics Data System (ADS)

    Wilson, Michael; Price, D.; Strohecker, Steve

    1994-09-01

    Germanium witness samples were impacted with the NAWCADWAR modified Cambridge liquid jet device introducing varying levels of damage about the center of each sample. Surface damage statistics were collected, scatter measurements were made at 0.67 micrometers and the samples were failed in tension using a bi-axial flexure test setup. The level and character of the damage was correlated with the reflected scatter measurements as a function of local stress and flaw size distribution. Bi-axial flexure data was analyzed to predict fracture stress and the probability of failure of the germanium samples. The mechanical data were then correlated with the scatter data in order to correlate the BRDF with the material failure. The BRDF measurements were taken in several different orientations in order to study the differences in scatter character for the in-plane and out-of-plane conditions.

  11. Time-resolved scattering of a single photon by a single atom

    PubMed Central

    Leong, Victor; Seidler, Mathias Alexander; Steiner, Matthias; Cerè, Alessandro; Kurtsiefer, Christian

    2016-01-01

    Scattering of light by matter has been studied extensively in the past. Yet, the most fundamental process, the scattering of a single photon by a single atom, is largely unexplored. One prominent prediction of quantum optics is the deterministic absorption of a travelling photon by a single atom, provided the photon waveform matches spatially and temporally the time-reversed version of a spontaneously emitted photon. Here we experimentally address this prediction and investigate the influence of the photon's temporal profile on the scattering dynamics using a single trapped atom and heralded single photons. In a time-resolved measurement of atomic excitation we find a 56(11)% increase of the peak excitation by photons with an exponentially rising profile compared with a decaying one. However, the overall scattering probability remains unchanged within the experimental uncertainties. Our results demonstrate that envelope tailoring of single photons enables precise control of the photon–atom interaction. PMID:27897173

  12. A methodology for evaluating detection performance of ultrasonic array imaging algorithms for coarse-grained materials.

    PubMed

    Van Pamel, Anton; Brett, Colin R; Lowe, Michael J S

    2014-12-01

    Improving the ultrasound inspection capability for coarse-grained metals remains of longstanding interest and is expected to become increasingly important for next-generation electricity power plants. Conventional ultrasonic A-, B-, and C-scans have been found to suffer from strong background noise caused by grain scattering, which can severely limit the detection of defects. However, in recent years, array probes and full matrix capture (FMC) imaging algorithms have unlocked exciting possibilities for improvements. To improve and compare these algorithms, we must rely on robust methodologies to quantify their performance. This article proposes such a methodology to evaluate the detection performance of imaging algorithms. For illustration, the methodology is applied to some example data using three FMC imaging algorithms; total focusing method (TFM), phase-coherent imaging (PCI), and decomposition of the time-reversal operator with multiple scattering filter (DORT MSF). However, it is important to note that this is solely to illustrate the methodology; this article does not attempt the broader investigation of different cases that would be needed to compare the performance of these algorithms in general. The methodology considers the statistics of detection, presenting the detection performance as probability of detection (POD) and probability of false alarm (PFA). A test sample of coarse-grained nickel super alloy, manufactured to represent materials used for future power plant components and containing some simple artificial defects, is used to illustrate the method on the candidate algorithms. The data are captured in pulse-echo mode using 64-element array probes at center frequencies of 1 and 5 MHz. In this particular case, it turns out that all three algorithms are shown to perform very similarly when comparing their flaw detection capabilities.

  13. Remote sensing of ocean currents. [Loop Current in Gulf of Mexico

    NASA Technical Reports Server (NTRS)

    Maul, G. A. (Principal Investigator)

    1974-01-01

    The author has identified the following significant results. A time series of the Loop Current in the Gulf of Mexico, covering an annual cycle of growth, spreading, and decay, has been obtained in synchronization with ERTS-1. Computer enhanced images, which are necessary to extract useful oceanic information, show that the current can be observed either by color or sea state effects associated with the cyclonic boundary. The color effect relates to the spectral variations in the optical properties of the water and its suspended particles, and is studied by radiative transfer theory. Significant oceanic parameters identified are: the probability of forward scattering, and the ratio of scattering to total attenuation. Several spectra of upwelling diffuse light are computed as a function of the concentration of particles and yellow substance. These calculations compare favorably with experimental measurements and show that the ratio of channels method gives ambiguous interpretative results. These results are used to discuss features in images where surface measurements were obtained and are extended to tentative explanation in others.

  14. Nanoporous PbSe-SiO2 Thermoelectric Composites.

    PubMed

    Wu, Chao-Feng; Wei, Tian-Ran; Sun, Fu-Hua; Li, Jing-Feng

    2017-11-01

    Nanoporous architecture has long been predicted theoretically for its proficiency in suppressing thermal conduction, but less concerned as a practical approach for better thermoelectric materials hitherto probably due to its technical challenges. This article demonstrates a study on nanoporous PbSe-SiO 2 composites fabricated by a facile method of mechanical alloying assisted by subsequent wet-milling and then spark plasma sintering. Owing to the formation of random nanopores and additional interface scattering, the lattice thermal conductivity is limited to a value as low as 0.56 W m -1 K -1 at above 600 K, almost the same low level achieved by introducing nanoscale precipitates. Besides, the room-temperature electrical transport is found to be dominated by the grain-boundary potential barrier scattering, whose effect fades away with increasing temperatures. Consequently, a maximum ZT of 1.15 at 823 K is achieved in the PbSe + 0.7 vol% SiO 2 composition with >20% increase in average ZT , indicating the great potential of nanoporous structuring toward high thermoelectric conversion efficiency.

  15. CADDIS Volume 4. Data Analysis: Exploratory Data Analysis

    EPA Pesticide Factsheets

    Intro to exploratory data analysis. Overview of variable distributions, scatter plots, correlation analysis, GIS datasets. Use of conditional probability to examine stressor levels and impairment. Exploring correlations among multiple stressors.

  16. Probabilistic Evaluation of Blade Impact Damage

    NASA Technical Reports Server (NTRS)

    Chamis, C. C.; Abumeri, G. H.

    2003-01-01

    The response to high velocity impact of a composite blade is probabilistically evaluated. The evaluation is focused on quantifying probabilistically the effects of uncertainties (scatter) in the variables that describe the impact, the blade make-up (geometry and material), the blade response (displacements, strains, stresses, frequencies), the blade residual strength after impact, and the blade damage tolerance. The results of probabilistic evaluations results are in terms of probability cumulative distribution functions and probabilistic sensitivities. Results show that the blade has relatively low damage tolerance at 0.999 probability of structural failure and substantial at 0.01 probability.

  17. Coherent backscattering of light by complex random media of spherical scatterers: numerical solution

    NASA Astrophysics Data System (ADS)

    Muinonen, Karri

    2004-07-01

    Novel Monte Carlo techniques are described for the computation of reflection coefficient matrices for multiple scattering of light in plane-parallel random media of spherical scatterers. The present multiple scattering theory is composed of coherent backscattering and radiative transfer. In the radiative transfer part, the Stokes parameters of light escaping from the medium are updated at each scattering process in predefined angles of emergence. The scattering directions at each process are randomized using probability densities for the polar and azimuthal scattering angles: the former angle is generated using the single-scattering phase function, whereafter the latter follows from Kepler's equation. For spherical scatterers in the Rayleigh regime, randomization proceeds semi-analytically whereas, beyond that regime, cubic spline presentation of the scattering matrix is used for numerical computations. In the coherent backscattering part, the reciprocity of electromagnetic waves in the backscattering direction allows the renormalization of the reversely propagating waves, whereafter the scattering characteristics are computed in other directions. High orders of scattering (~10 000) can be treated because of the peculiar polarization characteristics of the reverse wave: after a number of scatterings, the polarization state of the reverse wave becomes independent of that of the incident wave, that is, it becomes fully dictated by the scatterings at the end of the reverse path. The coherent backscattering part depends on the single-scattering albedo in a non-monotonous way, the most pronounced signatures showing up for absorbing scatterers. The numerical results compare favourably to the literature results for nonabsorbing spherical scatterers both in and beyond the Rayleigh regime.

  18. Multi-Group Formulation of the Temperature-Dependent Resonance Scattering Model and its Impact on Reactor Core Parameters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghrayeb, Shadi Z.; Ougouag, Abderrafi M.; Ouisloumen, Mohamed

    2014-01-01

    A multi-group formulation for the exact neutron elastic scattering kernel is developed. It incorporates the neutron up-scattering effects, stemming from lattice atoms thermal motion and accounts for it within the resulting effective nuclear cross-section data. The effects pertain essentially to resonant scattering off of heavy nuclei. The formulation, implemented into a standalone code, produces effective nuclear scattering data that are then supplied directly into the DRAGON lattice physics code where the effects on Doppler Reactivity and neutron flux are demonstrated. The correct accounting for the crystal lattice effects influences the estimated values for the probability of neutron absorption and scattering,more » which in turn affect the estimation of core reactivity and burnup characteristics. The results show an increase in values of Doppler temperature feedback coefficients up to -10% for UOX and MOX LWR fuels compared to the corresponding values derived using the traditional asymptotic elastic scattering kernel. This paper also summarizes the results done on this topic to date.« less

  19. Photoelectron diffraction from single oriented molecules: Towards ultrafast structure determination of molecules using x-ray free-electron lasers

    NASA Astrophysics Data System (ADS)

    Kazama, Misato; Fujikawa, Takashi; Kishimoto, Naoki; Mizuno, Tomoya; Adachi, Jun-ichi; Yagishita, Akira

    2013-06-01

    We provide a molecular structure determination method, based on multiple-scattering x-ray photoelectron diffraction (XPD) calculations. This method is applied to our XPD data on several molecules having different equilibrium geometries. Then it is confirmed that, by our method, bond lengths and bond angles can be determined with a resolution of less than 0.1 Å and 10∘, respectively. Differently from any other scenario of ultrafast structure determination, we measure the two- or three-dimensional XPD of aligned or oriented molecules in the energy range from 100 to 200 eV with a 4π detection velocity map imaging spectrometer. Thanks to the intense and ultrashort pulse properties of x-ray free-electron lasers, our approach exhibits the most probable method for obtaining ultrafast real-time structural information on small to medium-sized molecules consisting of light elements, i.e., a “molecular movie.”

  20. [Analysis of scatterer microstructure feature based on Chirp-Z transform cepstrum].

    PubMed

    Guo, Jianzhong; Lin, Shuyu

    2007-12-01

    The fundamental research field of medical ultrasound has been the characterization of tissue scatterers. The signal processing method is widely used in this research field. A new method of Chirp-Z Transform Cepstrum for mean spacing estimation of tissue scatterers using ultrasonic scattered signals has been developed. By using this method together with conventional AR cepstrum method, we processed the backscattered signals of mimic tissue and pig liver in vitro. The results illustrated that the Chirp-Z Transform Cepstrum method is effective for signal analysis of ultrasonic scattering and characterization of tissue scatterers, and it can improve the resolution for mean spacing estimation of tissue scatterers.

  1. Equivalence of internal and external mixture schemes of single scattering properties in vector radiative transfer

    PubMed Central

    Mukherjee, Lipi; Zhai, Peng-Wang; Hu, Yongxiang; Winker, David M.

    2018-01-01

    Polarized radiation fields in a turbid medium are influenced by single-scattering properties of scatterers. It is common that media contain two or more types of scatterers, which makes it essential to properly mix single-scattering properties of different types of scatterers in the vector radiative transfer theory. The vector radiative transfer solvers can be divided into two basic categories: the stochastic and deterministic methods. The stochastic method is basically the Monte Carlo method, which can handle scatterers with different scattering properties explicitly. This mixture scheme is called the external mixture scheme in this paper. The deterministic methods, however, can only deal with a single set of scattering properties in the smallest discretized spatial volume. The single-scattering properties of different types of scatterers have to be averaged before they are input to deterministic solvers. This second scheme is called the internal mixture scheme. The equivalence of these two different mixture schemes of scattering properties has not been demonstrated so far. In this paper, polarized radiation fields for several scattering media are solved using the Monte Carlo and successive order of scattering (SOS) methods and scattering media contain two types of scatterers: Rayleigh scatterers (molecules) and Mie scatterers (aerosols). The Monte Carlo and SOS methods employ external and internal mixture schemes of scatterers, respectively. It is found that the percentage differences between radiances solved by these two methods with different mixture schemes are of the order of 0.1%. The differences of Q/I, U/I, and V/I are of the order of 10−5 ~ 10−4, where I, Q, U, and V are the Stokes parameters. Therefore, the equivalence between these two mixture schemes is confirmed to the accuracy level of the radiative transfer numerical benchmarks. This result provides important guidelines for many radiative transfer applications that involve the mixture of different scattering and absorptive particles. PMID:29047543

  2. Monte Carlo Calculation of Thermal Neutron Inelastic Scattering Cross Section Uncertainties by Sampling Perturbed Phonon Spectra

    NASA Astrophysics Data System (ADS)

    Holmes, Jesse Curtis

    Nuclear data libraries provide fundamental reaction information required by nuclear system simulation codes. The inclusion of data covariances in these libraries allows the user to assess uncertainties in system response parameters as a function of uncertainties in the nuclear data. Formats and procedures are currently established for representing covariances for various types of reaction data in ENDF libraries. This covariance data is typically generated utilizing experimental measurements and empirical models, consistent with the method of parent data production. However, ENDF File 7 thermal neutron scattering library data is, by convention, produced theoretically through fundamental scattering physics model calculations. Currently, there is no published covariance data for ENDF File 7 thermal libraries. Furthermore, no accepted methodology exists for quantifying or representing uncertainty information associated with this thermal library data. The quality of thermal neutron inelastic scattering cross section data can be of high importance in reactor analysis and criticality safety applications. These cross sections depend on the material's structure and dynamics. The double-differential scattering law, S(alpha, beta), tabulated in ENDF File 7 libraries contains this information. For crystalline solids, S(alpha, beta) is primarily a function of the material's phonon density of states (DOS). Published ENDF File 7 libraries are commonly produced by calculation and processing codes, such as the LEAPR module of NJOY, which utilize the phonon DOS as the fundamental input for inelastic scattering calculations to directly output an S(alpha, beta) matrix. To determine covariances for the S(alpha, beta) data generated by this process, information about uncertainties in the DOS is required. The phonon DOS may be viewed as a probability density function of atomic vibrational energy states that exist in a material. Probable variation in the shape of this spectrum may be established that depends on uncertainties in the physics models and methodology employed to produce the DOS. Through Monte Carlo sampling of perturbations from the reference phonon spectrum, an S(alpha, beta) covariance matrix may be generated. In this work, density functional theory and lattice dynamics in the harmonic approximation are used to calculate the phonon DOS for hexagonal crystalline graphite. This form of graphite is used as an example material for the purpose of demonstrating procedures for analyzing, calculating and processing thermal neutron inelastic scattering uncertainty information. Several sources of uncertainty in thermal neutron inelastic scattering calculations are examined, including sources which cannot be directly characterized through a description of the phonon DOS uncertainty, and their impacts are evaluated. Covariances for hexagonal crystalline graphite S(alpha, beta) data are quantified by coupling the standard methodology of LEAPR with a Monte Carlo sampling process. The mechanics of efficiently representing and processing this covariance information is also examined. Finally, with appropriate sensitivity information, it is shown that an S(alpha, beta) covariance matrix can be propagated to generate covariance data for integrated cross sections, secondary energy distributions, and coupled energy-angle distributions. This approach enables a complete description of thermal neutron inelastic scattering cross section uncertainties which may be employed to improve the simulation of nuclear systems.

  3. Scatter and crosstalk corrections for {sup 99m}Tc/{sup 123}I dual-radionuclide imaging using a CZT SPECT system with pinhole collimators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fan, Peng; Hutton, Brian F.; Holstensson, Maria

    2015-12-15

    Purpose: The energy spectrum for a cadmium zinc telluride (CZT) detector has a low energy tail due to incomplete charge collection and intercrystal scattering. Due to these solid-state detector effects, scatter would be overestimated if the conventional triple-energy window (TEW) method is used for scatter and crosstalk corrections in CZT-based imaging systems. The objective of this work is to develop a scatter and crosstalk correction method for {sup 99m}Tc/{sup 123}I dual-radionuclide imaging for a CZT-based dedicated cardiac SPECT system with pinhole collimators (GE Discovery NM 530c/570c). Methods: A tailing model was developed to account for the low energy tail effectsmore » of the CZT detector. The parameters of the model were obtained using {sup 99m}Tc and {sup 123}I point source measurements. A scatter model was defined to characterize the relationship between down-scatter and self-scatter projections. The parameters for this model were obtained from Monte Carlo simulation using SIMIND. The tailing and scatter models were further incorporated into a projection count model, and the primary and self-scatter projections of each radionuclide were determined with a maximum likelihood expectation maximization (MLEM) iterative estimation approach. The extracted scatter and crosstalk projections were then incorporated into MLEM image reconstruction as an additive term in forward projection to obtain scatter- and crosstalk-corrected images. The proposed method was validated using Monte Carlo simulation, line source experiment, anthropomorphic torso phantom studies, and patient studies. The performance of the proposed method was also compared to that obtained with the conventional TEW method. Results: Monte Carlo simulations and line source experiment demonstrated that the TEW method overestimated scatter while their proposed method provided more accurate scatter estimation by considering the low energy tail effect. In the phantom study, improved defect contrasts were observed with both correction methods compared to no correction, especially for the images of {sup 99m}Tc in dual-radionuclide imaging where there is heavy contamination from {sup 123}I. In this case, the nontransmural defect contrast was improved from 0.39 to 0.47 with the TEW method and to 0.51 with their proposed method and the transmural defect contrast was improved from 0.62 to 0.74 with the TEW method and to 0.73 with their proposed method. In the patient study, the proposed method provided higher myocardium-to-blood pool contrast than that of the TEW method. Similar to the phantom experiment, the improvement was the most substantial for the images of {sup 99m}Tc in dual-radionuclide imaging. In this case, the myocardium-to-blood pool ratio was improved from 7.0 to 38.3 with the TEW method and to 63.6 with their proposed method. Compared to the TEW method, the proposed method also provided higher count levels in the reconstructed images in both phantom and patient studies, indicating reduced overestimation of scatter. Using the proposed method, consistent reconstruction results were obtained for both single-radionuclide data with scatter correction and dual-radionuclide data with scatter and crosstalk corrections, in both phantom and human studies. Conclusions: The authors demonstrate that the TEW method leads to overestimation in scatter and crosstalk for the CZT-based imaging system while the proposed scatter and crosstalk correction method can provide more accurate self-scatter and down-scatter estimations for quantitative single-radionuclide and dual-radionuclide imaging.« less

  4. Matter scattering in quadratic gravity and unitarity

    NASA Astrophysics Data System (ADS)

    Abe, Yugo; Inami, Takeo; Izumi, Keisuke; Kitamura, Tomotaka

    2018-03-01

    We investigate the ultraviolet (UV) behavior of two-scalar elastic scattering with graviton exchanges in higher-curvature gravity theory. In Einstein gravity, matter scattering is shown not to satisfy the unitarity bound at tree level at high energy. Among some of the possible directions for the UV completion of Einstein gravity, such as string theory, modified gravity, and inclusion of high-mass/high-spin states, we take R_{μν}^2 gravity coupled to matter. We show that matter scattering with graviton interactions satisfies the unitarity bound at high energy, even with negative norm states due to the higher-order derivatives of metric components. The difference in the unitarity property of these two gravity theories is probably connected to that in another UV property, namely, the renormalizability property of the two.

  5. Multiple Scattering Effects on Pulse Propagation in Optically Turbid Media.

    NASA Astrophysics Data System (ADS)

    Joelson, Bradley David

    The effects of multiple scattering in a optically turbid media is examined for an impulse solution to the radiative transfer equation for a variety of geometries and phase functions. In regions where the complexities of the phase function proved too cumbersome for analytic methods Monte Carlo techniques were developed to describe the entire scalar radiance distribution. The determination of a general spread function is strongly dependent on geometry and particular regions where limits can be placed on the variables of the problem. Hence, the general spread function is first simplified by considering optical regions which reduce the complexity of the variable dependence. First, in the small-angle limit we calculate some contracted spread functions along with their moments and then use Monte Carlo techniques to establish the limitations imposed by the small-angle approximation in planar geometry. The point spread function (PSF) for a spherical geometry is calculated for the full angular spread in the forward direction of ocean waters using Monte Carlo methods in the optically thin and moderate depths and analytic methods in the diffusion domain. The angular dependence of the PSF for various ocean waters is examined for a range of optical parameters. The analytic method used in the diffusion calculation is justified by examining the angular dependence of the radiance of a impulse solution in a planar geometry for a prolongated Henyey-Greenstein phase function of asymmetry factor approximately equal to that of the ocean phase functions. The Legendre moments of the radiance are examined in order to examine the viability of the diffusion approximation which assumes a linearly anisotropic angular distribution for the radiance. A realistic lidar calculation is performed for a variety of ocean waters to determine the effects of multiple scattering on the determination of the speed of sound by using the range gated frequency spectrum of the lidar signal. It is shown that the optical properties of the ocean help to ensure single scatter form for the frequency spectra of the lidar signal. This spectra can then be used to compute the speed of sound and backscatter probability.

  6. Rayleigh, Compton and K-shell radiative resonant Raman scattering in 83Bi for 88.034 keV γ-rays

    NASA Astrophysics Data System (ADS)

    Kumar, Sanjeev; Sharma, Veena; Mehta, D.; Singh, Nirmal

    2007-11-01

    The Rayleigh, Compton and K-shell radiative resonant Raman scattering cross-sections for the 88.034 keV γ-rays have been measured in the 83Bi (K-shell binding energy = 90.526 keV) element. The measurements have been performed at 130° scattering angle using reflection-mode geometrical arrangement involving the 109Cd radioisotope as photon source and an LEGe detector. Computer simulations were exercised to determine distributions of the incident and emission angles, which were further used in evaluation of the absorption corrections for the incident and emitted photons in the target. The measured cross-sections for the Rayleigh scattering are compared with the modified form-factors (MFs) corrected for the anomalous-scattering factors (ASFs) and the S-matrix calculations; and those for the Compton scattering are compared with the Klein-Nishina cross-sections corrected for the non-relativistic Hartree-Fock incoherent scattering function S(x, Z). The ratios of the measured KL2, KL3, KM and KN2,3 radiative resonant Raman scattering cross-sections are found to be in general agreement with those of the corresponding measured fluorescence transition probabilities.

  7. Analysis of human tissue optical scattering spectra for the purpose of breast cancer diagnostics using multi-layer perceptron

    NASA Astrophysics Data System (ADS)

    Nuzhny, Anton S.; Shumsky, Sergey A.; Korzhov, Alexey G.; Lyubynskaya, Tatiana E.

    2008-02-01

    Optical scattering spectra obtained in the clinical trials of breast cancer diagnostic system were analyzed for the purpose to detect in the dataflow the segments corresponding to malignant tissues. Minimal invasive probe with optical fibers inside delivers white light from the source and collects the scattering light while being moved through the tissue. The sampling rate is 100 Hz and each record contains the results of measurements of scattered light intensity at 184 fixed wavelength points. Large amount of information acquired in each procedure, fuzziness in criteria of 'cancer' family membership and data noisiness make neural networks to be an attractive tool for analysis of these data. To define the dividing rule between 'cancer' and 'non-cancer' spectral families a three-layer perceptron was applied. In the process of perceptron learning back propagation method was used to minimize the learning error. Regularization was done using the Bayesian approach. The learning sample was formed by the experts. End-to-end probability calculation throughout the procedure dataset showed reliable detection of the 'cancer' segments. Much attention was paid on the spectra of the tissues with high blood content. Often the reason is vessel injury caused by the penetrating optical probe. But also it can be a dense vessel net surrounding the malignant tumor. To make the division into 'cancer' and 'non-cancer' families for the tissues with high blood content a special perceptron was learnt exceptionally on such spectra.

  8. Retrieval of Aerosol Optical Properties from Ground-Based Remote Sensing Measurements: Aerosol Asymmetry Factor and Single Scattering Albedo

    NASA Astrophysics Data System (ADS)

    Qie, L.; Li, Z.; Li, L.; Li, K.; Li, D.; Xu, H.

    2018-04-01

    The Devaux-Vermeulen-Li method (DVL method) is a simple approach to retrieve aerosol optical parameters from the Sun-sky radiance measurements. This study inherited the previous works of retrieving aerosol single scattering albedo (SSA) and scattering phase function, the DVL method was modified to derive aerosol asymmetric factor (g). To assess the algorithm performance at various atmospheric aerosol conditions, retrievals from AERONET observations were implemented, and the results are compared with AERONET official products. The comparison shows that both the DVL SSA and g were well correlated with those of AERONET. The RMSD and the absolute value of MBD deviations between the SSAs are 0.025 and 0.015 respectively, well below the AERONET declared SSA uncertainty of 0.03 for all wavelengths. For asymmetry factor g, the RMSD deviations are smaller than 0.02 and the absolute values of MBDs smaller than 0.01 at 675, 870 and 1020 nm bands. Then, considering several factors probably affecting retrieval quality (i.e. the aerosol optical depth (AOD), the solar zenith angle, and the sky residual error, sphericity proportion and Ångström exponent), the deviations for SSA and g of these two algorithms were calculated at varying value intervals. Both the SSA and g deviations were found decrease with the AOD and the solar zenith angle, and increase with sky residual error. However, the deviations do not show clear sensitivity to the sphericity proportion and Ångström exponent. This indicated that the DVL algorithm is available for both large, non-spherical particles and spherical particles. The DVL results are suitable for the evaluation of aerosol direct radiative effects of different aerosol types.

  9. Change Detection Based on Persistent Scatterer Interferometry - a New Method of Monitoring Building Changes

    NASA Astrophysics Data System (ADS)

    Yang, C. H.; Kenduiywo, B. K.; Soergel, U.

    2016-06-01

    Persistent Scatterer Interferometry (PSI) is a technique to detect a network of extracted persistent scatterer (PS) points which feature temporal phase stability and strong radar signal throughout time-series of SAR images. The small surface deformations on such PS points are estimated. PSI particularly works well in monitoring human settlements because regular substructures of man-made objects give rise to large number of PS points. If such structures and/or substructures substantially alter or even vanish due to big change like construction, their PS points are discarded without additional explorations during standard PSI procedure. Such rejected points are called big change (BC) points. On the other hand, incoherent change detection (ICD) relies on local comparison of multi-temporal images (e.g. image difference, image ratio) to highlight scene modifications of larger size rather than detail level. However, image noise inevitably degrades ICD accuracy. We propose a change detection approach based on PSI to synergize benefits of PSI and ICD. PS points are extracted by PSI procedure. A local change index is introduced to quantify probability of a big change for each point. We propose an automatic thresholding method adopting change index to extract BC points along with a clue of the period they emerge. In the end, PS ad BC points are integrated into a change detection image. Our method is tested at a site located around north of Berlin main station where steady, demolished, and erected building substructures are successfully detected. The results are consistent with ground truth derived from time-series of aerial images provided by Google Earth. In addition, we apply our technique for traffic infrastructure, business district, and sports playground monitoring.

  10. Stochastic transfer of polarized radiation in finite cloudy atmospheric media with reflective boundaries

    NASA Astrophysics Data System (ADS)

    Sallah, M.

    2014-03-01

    The problem of monoenergetic radiative transfer in a finite planar stochastic atmospheric medium with polarized (vector) Rayleigh scattering is proposed. The solution is presented for an arbitrary absorption and scattering cross sections. The extinction function of the medium is assumed to be a continuous random function of position, with fluctuations about the mean taken as Gaussian distributed. The joint probability distribution function of these Gaussian random variables is used to calculate the ensemble-averaged quantities, such as reflectivity and transmissivity, for an arbitrary correlation function. A modified Gaussian probability distribution function is also used to average the solution in order to exclude the probable negative values of the optical variable. Pomraning-Eddington approximation is used, at first, to obtain the deterministic analytical solution for both the total intensity and the difference function used to describe the polarized radiation. The problem is treated with specular reflecting boundaries and angular-dependent externally incident flux upon the medium from one side and with no flux from the other side. For the sake of comparison, two different forms of the weight function, which introduced to force the boundary conditions to be fulfilled, are used. Numerical results of the average reflectivity and average transmissivity are obtained for both Gaussian and modified Gaussian probability density functions at the different degrees of polarization.

  11. Internal Energy Dependence of Molecular Condensation Coefficients Determined from Molecular Beam Surface Scattering Experiments

    DOE R&D Accomplishments Database

    Sibener, S. J.; Lee, Y. T.

    1978-05-01

    An experiment was performed which confirms the existence of an internal mode dependence of molecular sticking probabilities for collisions of molecules with a cold surface. The scattering of a velocity selected effusive beam of CCl{sub 4} from a 90 K CC1{sub 4} ice surface has been studied at five translational velocities and for two different internal temperatures. At a surface temperature of 90 K (approx. 99% sticking probability) a four fold increase in reflected intensity was observed for the internally excited (560 K) CC1{sub 4} relative to the room temperature (298 K) CC1{sub 4} at a translational velocity of 2.5 X 10{sup 4} cm/sec. For a surface temperature of 90 K all angular distributions were found to peak 15{sup 0} superspecularly independent of incident velocity.

  12. From Waves to Particle Tracks and Quantum Probabilities

    NASA Astrophysics Data System (ADS)

    Falkenburg, Brigitte

    Here, the measurement methods for identifying massive charged particles are investigated. They have been used from early cosmic ray studies up to the present day. Laws such as the classical Lorentz force and Einstein's relativistic kinematics were established before the rise of quantum mechanics. Later, it became crucial to measure the energy loss of charged particles in matter. In 1930, Bethe developed a semi-classical model based on the quantum mechanics of scattering. In the early 1930s, he and others calculated the passage of charged particles through matter including pair creation and bremsstrahlung. Due to missing trust in quantum electrodynamics, however, only semi-empirical methods were employed in order to estimate the mass and charge from the features of particle tracks. In 1932, Anderson inserted a lead plate into the cloud chamber in order to determine the flight direction and charge of the `positive electron'. In the 1940s, nuclear emulsions helped to resolve puzzles about particle identification and quantum electrodynamics. Later, the measurement theory was extended in a cumulative process by adding conservation laws for dynamic properties, probabilistic quantum formulas for resonances, scattering cross sections, etc. The measurement method was taken over from cosmic ray studies to the era of particle accelerators, and finally taken back from there to astroparticle physics. The measurement methods remained the same, but in the transition from particle to astroparticle physics the focus of interest shifted. Indeed, the experimental methods of both fields explore the grounds of `new physics' in complementary ways.

  13. PSC and volcanic aerosol routine observations in Antarctica by UV-visible ground-based spectrometry

    NASA Technical Reports Server (NTRS)

    Sarkissian, A.; Pommereau, J. P.; Goutail, F.

    1994-01-01

    Polar statospheric clouds (PSC) and stratospheric aerosol can be observed by ground-based UV-visible spectrometry by looking at the variation of the color of the sky during twilight. A radiative transfer model shows that reddenings are caused by high altitude (22-28 km) thin layers of scatterers, while low altitude (12-20 km) thick ones result in blueings. The color index method applied on 4 years of observations at Dumont d'Urville (67 deg S), from 1988 to 1991, shows that probably because the station is located at the edge of the vortex, dense PSC are uncommon. More unexpected is the existence of a systematic seasonal variation of the color of the twilight sky - bluer at spring - which reveals the formation of a dense scattering layer at or just above the tropopause at the end of the winter. Large scattering layers are reported above the station in 1991, first in August around 12-14 km, later in September at 22-24 km. They are attributed to volcanic aerosol from Mt Hudson and Mt Pinatubo respectively, which erupted in 1991. Inspection of the data shows that the lowest entered rapidly into the polar vortex but not the highest which remained outside, demonstrating that the vortex was isolated at 22-26 km.

  14. A low-cost landslide displacement activity assessment from time-lapse photogrammetry and rainfall data: Application to the Tessina landslide site

    NASA Astrophysics Data System (ADS)

    Gabrieli, F.; Corain, L.; Vettore, L.

    2016-09-01

    Acquiring useful and reliable displacement data from a complex landslide site is often a problem because of large, localized and scattered erosive processes and deformations; the inaccessibility of the site; the high cost of instrumentation and maintenance. However, these data are of fundamental importance not only to hazard assessments but also to understanding the processes at the basis of slope evolution. In this framework, time-lapse photogrammetry can represent a good compromise; the low accuracy is compensated for by the wide-ranging and dense spatial displacement information that can be obtained with inexpensive equipment. Nevertheless, when large displacement monitoring data sets become available, the problem becomes the choice of the most suitable statistical model to describe the probability of movement and adequately simplify the complexity of a scattered, intermittent, and spatially inhomogeneous displacement field. In this paper, an automated displacement detection method, which is based on the absolute image differences and digital correlations from a sequence of photos, was developed and applied to a photographic survey activity at the head of the Tessina landslide (northeastern Italy). The method allowed us to simplify and binarize the displacement field and to recognize the intermittent activity and the peculiar behaviours of different parts of the landslide, which were identified and classified by combining geomorphological and geological information. Moreover, for the first time, sliding correlations between these areas were quantitatively estimated using time-series-based binary logistic regression and the definition of a probability-based directed graph of displacement occurrence that connected the source zones to the lower depletion basin and the main collector channel. Using rainfall data, event-based logistic and Poisson regression models were applied to the upper zones of the landslide to estimate the probability of movement of each scarp and the persistence of the displacement as a result of certain rainfall events. The results of these statistical analyses highlighted the capability of this approach to quantitatively evaluate the pattern of displacement occurrences and to assess the evolution of a landslide site to gain insight into geomorphological processes.

  15. Orbital evolution of some Centaurs

    NASA Astrophysics Data System (ADS)

    Kovalenko, Nataliya; Babenko, Yuri; Churyumov, Klim

    2002-11-01

    In this work we investigated the dynamical evolution of Centaurs objects 2060 (Chiron), 5145 (Pholus), 7066 (Nessus), 8405 (Asbolus), 10199 (Chariklo), 10370 (Hylonome), and Scattered-Disk object 15874. We have carried out orbital integration of test particles with initial orbits similar to those of these objects. Calculations were produced for +/-600kyr-10Myr starting at epoch and using the implicit single sequence Everhart methods. 12 variational orbits for each of selected Centaurs also have been numerically integrated for +/-200 kyr toward the past and the future. The most probable paths were traced up to +/-1 Myr. The character of orbital elements changes and peculiarities of close approaches to giant planets are discussed.

  16. Listening to light scattering in turbid media: quantitative optical scattering imaging using photoacoustic measurements with one-wavelength illumination

    NASA Astrophysics Data System (ADS)

    Yuan, Zhen; Li, Xiaoqi; Xi, Lei

    2014-06-01

    Biomedical photoacoustic tomography (PAT), as a potential imaging modality, can visualize tissue structure and function with high spatial resolution and excellent optical contrast. It is widely recognized that the ability of quantitatively imaging optical absorption and scattering coefficients from photoacoustic measurements is essential before PAT can become a powerful imaging modality. Existing quantitative PAT (qPAT), while successful, has been focused on recovering absorption coefficient only by assuming scattering coefficient a constant. An effective method for photoacoustically recovering optical scattering coefficient is presently not available. Here we propose and experimentally validate such a method for quantitative scattering coefficient imaging using photoacoustic data from one-wavelength illumination. The reconstruction method developed combines conventional PAT with the photon diffusion equation in a novel way to realize the recovery of scattering coefficient. We demonstrate the method using various objects having scattering contrast only or both absorption and scattering contrasts embedded in turbid media. The listening-to-light-scattering method described will be able to provide high resolution scattering imaging for various biomedical applications ranging from breast to brain imaging.

  17. [Heart rate variability study based on a novel RdR RR Intervals Scatter Plot].

    PubMed

    Lu, Hongwei; Lu, Xiuyun; Wang, Chunfang; Hua, Youyuan; Tian, Jiajia; Liu, Shihai

    2014-08-01

    On the basis of Poincare scatter plot and first order difference scatter plot, a novel heart rate variability (HRV) analysis method based on scatter plots of RR intervals and first order difference of RR intervals (namely, RdR) was proposed. The abscissa of the RdR scatter plot, the x-axis, is RR intervals and the ordinate, y-axis, is the difference between successive RR intervals. The RdR scatter plot includes the information of RR intervals and the difference between successive RR intervals, which captures more HRV information. By RdR scatter plot analysis of some records of MIT-BIH arrhythmias database, we found that the scatter plot of uncoupled premature ventricular contraction (PVC), coupled ventricular bigeminy and ventricular trigeminy PVC had specific graphic characteristics. The RdR scatter plot method has higher detecting performance than the Poincare scatter plot method, and simpler and more intuitive than the first order difference method.

  18. Fixed forced detection for fast SPECT Monte-Carlo simulation

    NASA Astrophysics Data System (ADS)

    Cajgfinger, T.; Rit, S.; Létang, J. M.; Halty, A.; Sarrut, D.

    2018-03-01

    Monte-Carlo simulations of SPECT images are notoriously slow to converge due to the large ratio between the number of photons emitted and detected in the collimator. This work proposes a method to accelerate the simulations based on fixed forced detection (FFD) combined with an analytical response of the detector. FFD is based on a Monte-Carlo simulation but forces the detection of a photon in each detector pixel weighted by the probability of emission (or scattering) and transmission to this pixel. The method was evaluated with numerical phantoms and on patient images. We obtained differences with analog Monte Carlo lower than the statistical uncertainty. The overall computing time gain can reach up to five orders of magnitude. Source code and examples are available in the Gate V8.0 release.

  19. Fixed forced detection for fast SPECT Monte-Carlo simulation.

    PubMed

    Cajgfinger, T; Rit, S; Létang, J M; Halty, A; Sarrut, D

    2018-03-02

    Monte-Carlo simulations of SPECT images are notoriously slow to converge due to the large ratio between the number of photons emitted and detected in the collimator. This work proposes a method to accelerate the simulations based on fixed forced detection (FFD) combined with an analytical response of the detector. FFD is based on a Monte-Carlo simulation but forces the detection of a photon in each detector pixel weighted by the probability of emission (or scattering) and transmission to this pixel. The method was evaluated with numerical phantoms and on patient images. We obtained differences with analog Monte Carlo lower than the statistical uncertainty. The overall computing time gain can reach up to five orders of magnitude. Source code and examples are available in the Gate V8.0 release.

  20. SU-E-I-08: Investigation of Deconvolution Methods for Blocker-Based CBCT Scatter Estimation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, C; Jin, M; Ouyang, L

    2015-06-15

    Purpose: To investigate whether deconvolution methods can improve the scatter estimation under different blurring and noise conditions for blocker-based scatter correction methods for cone-beam X-ray computed tomography (CBCT). Methods: An “ideal” projection image with scatter was first simulated for blocker-based CBCT data acquisition by assuming no blurring effect and no noise. The ideal image was then convolved with long-tail point spread functions (PSF) with different widths to mimic the blurring effect from the finite focal spot and detector response. Different levels of noise were also added. Three deconvolution Methods: 1) inverse filtering; 2) Wiener; and 3) Richardson-Lucy, were used tomore » recover the scatter signal in the blocked region. The root mean square error (RMSE) of estimated scatter serves as a quantitative measure for the performance of different methods under different blurring and noise conditions. Results: Due to the blurring effect, the scatter signal in the blocked region is contaminated by the primary signal in the unblocked region. The direct use of the signal in the blocked region to estimate scatter (“direct method”) leads to large RMSE values, which increase with the increased width of PSF and increased noise. The inverse filtering is very sensitive to noise and practically useless. The Wiener and Richardson-Lucy deconvolution methods significantly improve scatter estimation compared to the direct method. For a typical medium PSF and medium noise condition, both methods (∼20 RMSE) can achieve 4-fold improvement over the direct method (∼80 RMSE). The Wiener method deals better with large noise and Richardson-Lucy works better on wide PSF. Conclusion: We investigated several deconvolution methods to recover the scatter signal in the blocked region for blocker-based scatter correction for CBCT. Our simulation results demonstrate that Wiener and Richardson-Lucy deconvolution can significantly improve the scatter estimation compared to the direct method.« less

  1. Double Bounce Component in Cross-Polarimetric SAR from a New Scattering Target Decomposition

    NASA Astrophysics Data System (ADS)

    Hong, Sang-Hoon; Wdowinski, Shimon

    2013-08-01

    Common vegetation scattering theories assume that the Synthetic Aperture Radar (SAR) cross-polarization (cross-pol) signal represents solely volume scattering. We found this assumption incorrect based on SAR phase measurements acquired over the south Florida Everglades wetlands indicating that the cross-pol radar signal often samples the water surface beneath the vegetation. Based on these new observations, we propose that the cross-pol measurement consists of both volume scattering and double bounce components. The simplest multi-bounce scattering mechanism that generates cross-pol signal occurs by rotated dihedrals. Thus, we use the rotated dihedral mechanism with probability density function to revise some of the vegetation scattering theories and develop a three- component decomposition algorithm with single bounce, double bounce from both co-pol and cross-pol, and volume scattering components. We applied the new decomposition analysis to both urban and rural environments using Radarsat-2 quad-pol datasets. The decomposition of the San Francisco's urban area shows higher double bounce scattering and reduced volume scattering compared to other common three-component decomposition. The decomposition of the rural Everglades area shows that the relations between volume and cross-pol double bounce depend on the vegetation density. The new decomposition can be useful to better understand vegetation scattering behavior over the various surfaces and the estimation of above ground biomass using SAR observations.

  2. Unparticle may be a remedy to the information loss in the scattering of fermion off dilaton black-hole

    NASA Astrophysics Data System (ADS)

    Rahaman, Anisur

    2018-07-01

    We study s-wave scattering of fermion off dilaton black-hole. With one loop correction it was found to suffer from nonpreservation of information and that of course, went against Hawking's revised suggestion on this issue. A nonstandard approach, e.g. the probable existence of unparticle in (1 + 1) dimension has been adopted here that shows a remedy to get rid of the danger of information loss to bring it in agrees with the Hawking's revised suggestion.

  3. Physics Model-Based Scatter Correction in Multi-Source Interior Computed Tomography.

    PubMed

    Gong, Hao; Li, Bin; Jia, Xun; Cao, Guohua

    2018-02-01

    Multi-source interior computed tomography (CT) has a great potential to provide ultra-fast and organ-oriented imaging at low radiation dose. However, X-ray cross scattering from multiple simultaneously activated X-ray imaging chains compromises imaging quality. Previously, we published two hardware-based scatter correction methods for multi-source interior CT. Here, we propose a software-based scatter correction method, with the benefit of no need for hardware modifications. The new method is based on a physics model and an iterative framework. The physics model was derived analytically, and was used to calculate X-ray scattering signals in both forward direction and cross directions in multi-source interior CT. The physics model was integrated to an iterative scatter correction framework to reduce scatter artifacts. The method was applied to phantom data from both Monte Carlo simulations and physical experimentation that were designed to emulate the image acquisition in a multi-source interior CT architecture recently proposed by our team. The proposed scatter correction method reduced scatter artifacts significantly, even with only one iteration. Within a few iterations, the reconstructed images fast converged toward the "scatter-free" reference images. After applying the scatter correction method, the maximum CT number error at the region-of-interests (ROIs) was reduced to 46 HU in numerical phantom dataset and 48 HU in physical phantom dataset respectively, and the contrast-noise-ratio at those ROIs increased by up to 44.3% and up to 19.7%, respectively. The proposed physics model-based iterative scatter correction method could be useful for scatter correction in dual-source or multi-source CT.

  4. Multiple Scattering in Random Mechanical Systems and Diffusion Approximation

    NASA Astrophysics Data System (ADS)

    Feres, Renato; Ng, Jasmine; Zhang, Hong-Kun

    2013-10-01

    This paper is concerned with stochastic processes that model multiple (or iterated) scattering in classical mechanical systems of billiard type, defined below. From a given (deterministic) system of billiard type, a random process with transition probabilities operator P is introduced by assuming that some of the dynamical variables are random with prescribed probability distributions. Of particular interest are systems with weak scattering, which are associated to parametric families of operators P h , depending on a geometric or mechanical parameter h, that approaches the identity as h goes to 0. It is shown that ( P h - I)/ h converges for small h to a second order elliptic differential operator on compactly supported functions and that the Markov chain process associated to P h converges to a diffusion with infinitesimal generator . Both P h and are self-adjoint (densely) defined on the space of square-integrable functions over the (lower) half-space in , where η is a stationary measure. This measure's density is either (post-collision) Maxwell-Boltzmann distribution or Knudsen cosine law, and the random processes with infinitesimal generator respectively correspond to what we call MB diffusion and (generalized) Legendre diffusion. Concrete examples of simple mechanical systems are given and illustrated by numerically simulating the random processes.

  5. A measurement of the angular distribution of 5 eV atomic oxygen scattered off a solid surface in earth orbit

    NASA Technical Reports Server (NTRS)

    Gregory, John C.; Peters, Palmer N.

    1986-01-01

    The angular distribution of 5 eV atomic oxygen scattered off a polished vitreous carbon surface was measured on a recent Space Shuttle flight. The experimental apparatus was of novel design, completely passive, and used thin silver films as the recording device for oxygen atoms. Most of the incident oxygen was contained in the reflected beam and remained in an active form and probably still atoms. Allowance was made for 12 percent loss of incident atoms which are converted to CO at the carbon surface. The scattered distribution which is wide lobular, peaking 15 deg in the forward direction, shows almost but not quite full accommodation.

  6. Structure effects in polarization and cross sections for A(p, p’)X inelastic reactions on {sup 40}Ca and {sup 12}C nuclei at 1 GeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miklukho, O. V., E-mail: miklukho-ov@pnpi.rncki.ru; Kisselev, A. Yu., E-mail: kisselev@mail.desy.de; Amalsky, G. M.

    2017-03-15

    The polarization of secondary protons in the (p, p’) inelastic reactions on {sup 40}Ca and {sup 12}C nuclei at the initial proton energy of 1 GeV was measured over a wide range of scattered-proton momenta at a laboratory angle of Θ = 21°. The reaction cross sections were also measured. Scattered protons were detected by means of magnetic spectrometer equipped with a polarimeter based on multiwire-proportional chambers. A structure in the polarization and cross-section data, which is probably related to scattering off nucleon correlations in the nuclei involved, was observed.

  7. Proposal for a transmon-based quantum router.

    PubMed

    Sala, Arnau; Blaauboer, M

    2016-07-13

    We propose an implementation of a quantum router for microwave photons in a superconducting qubit architecture consisting of a transmon qubit, SQUIDs and a nonlinear capacitor. We model and analyze the dynamics of operation of the quantum switch using quantum Langevin equations in a scattering approach and compute the photon reflection and transmission probabilities. For parameters corresponding to up-to-date experimental devices we predict successful operation of the router with probabilities above 94%.

  8. Wave vector modification of the infinite order sudden approximation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sachs, J.G.; Bowman, J.M.

    1980-10-15

    A simple method is proposed to modify the infinite order sudden approximation (IOS) in order to extend its region of quantitative validity. The method involves modifying the phase of the IOS scattering matrix to include a part calculated at the outgoing relative kinetic energy as well as a part calculated at the incoming kinetic energy. An immediate advantage of this modification is that the resulting S matrix is symmetric. We also present a closely related method in which the relative kinetic energies used in the calculation of the phase are determined from quasiclassical trajectory calculations. A set of trajectories ismore » run with the initial state being the incoming state, and another set is run with the initial state being the outgoing state, and the average final relative kinetic energy of each set is obtained. One part of the S-operator phase is then calculated at each of these kinetic energies. We apply these methods to vibrationally inelastic collinear collisions of an atom and a harmonic oscillator, and calculate transition probabilities P/sub n/1..-->..nf for three model systems. For systems which are sudden, or nearly so, the agreement with exact quantum close-coupling calculations is substantially improved over standard IOS ones when ..delta..n=such thatub f/-n/sub i/ is large, and the corresponding transition probability is small, i.e., less than 0.1. However, the modifications we propose will not improve the accuracy of the IOS transition probabilities for any collisional system unless the standard form of IOS already gives at least qualitative agreement with exact quantal calculations. We also suggest comparisons between some classical quantities and sudden predictions which should help in determining the validity of the sudden approximation. This is useful when exact quantal data is not available for comparison.« less

  9. Wave vector modification of the infinite order sudden approximation

    NASA Astrophysics Data System (ADS)

    Sachs, Judith Grobe; Bowman, Joel M.

    1980-10-01

    A simple method is proposed to modify the infinite order sudden approximation (IOS) in order to extend its region of quantitative validity. The method involves modifying the phase of the IOS scattering matrix to include a part calculated at the outgoing relative kinetic energy as well as a part calculated at the incoming kinetic energy. An immediate advantage of this modification is that the resulting S matrix is symmetric. We also present a closely related method in which the relative kinetic energies used in the calculation of the phase are determined from quasiclassical trajectory calculations. A set of trajectories is run with the initial state being the incoming state, and another set is run with the initial state being the outgoing state, and the average final relative kinetic energy of each set is obtained. One part of the S-operator phase is then calculated at each of these kinetic energies. We apply these methods to vibrationally inelastic collinear collisions of an atom and a harmonic oscillator, and calculate transition probabilities Pn1→nf for three model systems. For systems which are sudden, or nearly so, the agreement with exact quantum close-coupling calculations is substantially improved over standard IOS ones when Δn=‖nf-ni‖ is large, and the corresponding transition probability is small, i.e., less than 0.1. However, the modifications we propose will not improve the accuracy of the IOS transition probabilities for any collisional system unless the standard form of IOS already gives at least qualitative agreement with exact quantal calculations. We also suggest comparisons between some classical quantities and sudden predictions which should help in determining the validity of the sudden approximation. This is useful when exact quantal data is not available for comparison.

  10. An eigenfunction method for reconstruction of large-scale and high-contrast objects.

    PubMed

    Waag, Robert C; Lin, Feng; Varslot, Trond K; Astheimer, Jeffrey P

    2007-07-01

    A multiple-frequency inverse scattering method that uses eigenfunctions of a scattering operator is extended to image large-scale and high-contrast objects. The extension uses an estimate of the scattering object to form the difference between the scattering by the object and the scattering by the estimate of the object. The scattering potential defined by this difference is expanded in a basis of products of acoustic fields. These fields are defined by eigenfunctions of the scattering operator associated with the estimate. In the case of scattering objects for which the estimate is radial, symmetries in the expressions used to reconstruct the scattering potential greatly reduce the amount of computation. The range of parameters over which the reconstruction method works well is illustrated using calculated scattering by different objects. The method is applied to experimental data from a 48-mm diameter scattering object with tissue-like properties. The image reconstructed from measurements has, relative to a conventional B-scan formed using a low f-number at the same center frequency, significantly higher resolution and less speckle, implying that small, high-contrast structures can be demonstrated clearly using the extended method.

  11. Angular-domain scattering interferometry.

    PubMed

    Shipp, Dustin W; Qian, Ruobing; Berger, Andrew J

    2013-11-15

    We present an angular-scattering optical method that is capable of measuring the mean size of scatterers in static ensembles within a field of view less than 20 μm in diameter. Using interferometry, the method overcomes the inability of intensity-based models to tolerate the large speckle grains associated with such small illumination areas. By first estimating each scatterer's location, the method can model between-scatterer interference as well as traditional single-particle Mie scattering. Direct angular-domain measurements provide finer angular resolution than digitally transformed image-plane recordings. This increases sensitivity to size-dependent scattering features, enabling more robust size estimates. The sensitivity of these angular-scattering measurements to various sizes of polystyrene beads is demonstrated. Interferometry also allows recovery of the full complex scattered field, including a size-dependent phase profile in the angular-scattering pattern.

  12. Modal Ring Method for the Scattering of Electromagnetic Waves

    NASA Technical Reports Server (NTRS)

    Baumeister, Kenneth J.; Kreider, Kevin L.

    1993-01-01

    The modal ring method for electromagnetic scattering from perfectly electric conducting (PEC) symmetrical bodies is presented. The scattering body is represented by a line of finite elements (triangular) on its outer surface. The infinite computational region surrounding the body is represented analytically by an eigenfunction expansion. The modal ring method effectively reduces the two dimensional scattering problem to a one-dimensional problem similar to the method of moments. The modal element method is capable of handling very high frequency scattering because it has a highly banded solution matrix.

  13. A new method for solving the quantum hydrodynamic equations of motion: application to two-dimensional reactive scattering.

    PubMed

    Pauler, Denise K; Kendrick, Brian K

    2004-01-08

    The de Broglie-Bohm hydrodynamic equations of motion are solved using a meshless method based on a moving least squares approach and an arbitrary Lagrangian-Eulerian frame of reference. A regridding algorithm adds and deletes computational points as needed in order to maintain a uniform interparticle spacing, and unitary time evolution is obtained by propagating the wave packet using averaged fields. The numerical instabilities associated with the formation of nodes in the reflected portion of the wave packet are avoided by adding artificial viscosity to the equations of motion. The methodology is applied to a two-dimensional model collinear reaction with an activation barrier. Reaction probabilities are computed as a function of both time and energy, and are in excellent agreement with those based on the quantum trajectory method. (c) 2004 American Institute of Physics

  14. Velocity structure in long period variable star atmospheres

    NASA Technical Reports Server (NTRS)

    Pilachowski, C.; Wallerstein, G.; Willson, L. A.

    1980-01-01

    A regression analysis of the dependence of absorption line velocities on wavelength, line strength, excitation potential, and ionization potential is presented. The method determines the region of formation of the absorption lines for a given data and wavelength region. It is concluded that the scatter which is frequently found in velocity measurements of absorption lines in long period variables is probably the result of a shock of moderate amplitude located in or near the reversing layer and that the frequently observed correlation of velocity with excitation and ionization are a result of the velocity gradients produced by this shock in the atmosphere. A simple interpretation of the signs of the coefficients of the regression analysis is presented in terms of preshock, post shock, or across the shock, together with criteria for evaluating the validity of the fit. The amplitude of the reversing layer shock is estimated from an analysis of a series of plates for four long period variable stars along with the most probable stellar velocity for these stars.

  15. Quantifying Uncertainties in the Thermo-Mechanical Properties of Particulate Reinforced Composites

    NASA Technical Reports Server (NTRS)

    Mital, Subodh K.; Murthy, Pappu L. N.

    1999-01-01

    The present paper reports results from a computational simulation of probabilistic particulate reinforced composite behavior. The approach consists use of simplified micromechanics of particulate reinforced composites together with a Fast Probability Integration (FPI) technique. Sample results are presented for a Al/SiC(sub p)(silicon carbide particles in aluminum matrix) composite. The probability density functions for composite moduli, thermal expansion coefficient and thermal conductivities along with their sensitivity factors are computed. The effect of different assumed distributions and the effect of reducing scatter in constituent properties on the thermal expansion coefficient are also evaluated. The variations in the constituent properties that directly effect these composite properties are accounted for by assumed probabilistic distributions. The results show that the present technique provides valuable information about the scatter in composite properties and sensitivity factors, which are useful to test or design engineers.

  16. Coupling between absorption and scattering in disordered colloids

    NASA Astrophysics Data System (ADS)

    Stephenson, Anna; Hwang, Victoria; Park, Jin-Gyu; Manoharan, Vinothan N.

    We aim to understand how scattering and absorption are coupled in disordered colloidal suspensions containing absorbing molecules (dyes). When the absorption length is shorter than the transport length, absorption dominates, and absorption and scattering can be seen as two additive effects. However, when the transport length is shorter than the absorption length, the scattering and absorption become coupled, as multiple scattering increases the path length of the light in the sample, leading to a higher probability of absorption. To quantify this synergistic effect, we measure the diffuse reflectance spectra of colloidal samples of varying dye concentrations, thicknesses, and particle concentrations, and we calculate the transport length and absorption length from our measurements, using a radiative transfer model. At particle concentrations so high that the particles form disordered packings, we find a minimum in the transport length. We show that selecting a dye where the absorption peak matches the location of the minimum in the transport length allows for enhanced absorption. Kraft-Heinz Corporation, NSF GRFP 2015200426.

  17. Currents and Associated Electron Scattering and Bouncing Near the Diffusion Region at Earth's Magnetopause

    NASA Technical Reports Server (NTRS)

    Lavraud, B.; Zhang, Y. C.; Vernisse, Y.; Gershman, D. J.; Dorelli, J.; Cassak, P. A.; Dargent, J.; Pollock, C.; Giles, B.; Aunai, N.; hide

    2016-01-01

    Based on high-resolution measurements from NASA's Magnetospheric Multlscale mission, we present the dynamics of electrons associated with current systems observed near the diffusion region of magnetic reconnection at Earth's magnetopause. Using pitch angle distributions (PAD) and magnetic curvature analysis, we demonstrate the occurrence of electron scattering in the curved magnetic field of the diffusion region down to energies of 20eV. We show that scattering occurs closer to the current sheet as the electron energy decreases. The scattering of Inflowing electrons, associated with field-aligned electrostatic potentials and Hall currents, produces a new population of scattered electrons with broader PAD which bounce back and forth in the exhaust. Except at the center of the diffusion region the two populations are collocated and appear to behave adiabatically: the inflowing electron PAD focuses inward (toward lower magnetic field), while the bouncing population PAD gradually peaks at 90 degrees away from the center (where it mirrors owing to higher magnetic field and probable field-aligned potentials).

  18. Investigation on Beam-Blocker-Based Scatter Correction Method for Improving CT Number Accuracy

    NASA Astrophysics Data System (ADS)

    Lee, Hoyeon; Min, Jonghwan; Lee, Taewon; Pua, Rizza; Sabir, Sohail; Yoon, Kown-Ha; Kim, Hokyung; Cho, Seungryong

    2017-03-01

    Cone-beam computed tomography (CBCT) is gaining widespread use in various medical and industrial applications but suffers from substantially larger amount of scatter than that in the conventional diagnostic CT resulting in relatively poor image quality. Various methods that can reduce and/or correct for the scatter in the CBCT have therefore been developed. Scatter correction method that uses a beam-blocker has been considered a direct measurement-based approach providing accurate scatter estimation from the data in the shadows of the beam-blocker. To the best of our knowledge, there has been no record reporting the significance of the scatter from the beam-blocker itself in such correction methods. In this paper, we identified the scatter from the beam-blocker that is detected in the object-free projection data investigated its influence on the image accuracy of CBCT reconstructed images, and developed a scatter correction scheme that takes care of this scatter as well as the scatter from the scanned object.

  19. Rate constants of chemical reactions from semiclassical transition state theory in full and one dimension.

    PubMed

    Greene, Samuel M; Shan, Xiao; Clary, David C

    2016-06-28

    Semiclassical Transition State Theory (SCTST), a method for calculating rate constants of chemical reactions, offers gains in computational efficiency relative to more accurate quantum scattering methods. In full-dimensional (FD) SCTST, reaction probabilities are calculated from third and fourth potential derivatives along all vibrational degrees of freedom. However, the computational cost of FD SCTST scales unfavorably with system size, which prohibits its application to larger systems. In this study, the accuracy and efficiency of 1-D SCTST, in which only third and fourth derivatives along the reaction mode are used, are investigated in comparison to those of FD SCTST. Potential derivatives are obtained from numerical ab initio Hessian matrix calculations at the MP2/cc-pVTZ level of theory, and Richardson extrapolation is applied to improve the accuracy of these derivatives. Reaction barriers are calculated at the CCSD(T)/cc-pVTZ level. Results from FD SCTST agree with results from previous theoretical and experimental studies when Richardson extrapolation is applied. Results from our implementation of 1-D SCTST, which uses only 4 single-point MP2/cc-pVTZ energy calculations in addition to those for conventional TST, agree with FD results to within a factor of 5 at 250 K. This degree of agreement and the efficiency of the 1-D method suggest its potential as a means of approximating rate constants for systems too large for existing quantum scattering methods.

  20. Principles of Quantum Mechanics

    NASA Astrophysics Data System (ADS)

    Landé, Alfred

    2013-10-01

    Preface; Introduction: 1. Observation and interpretation; 2. Difficulties of the classical theories; 3. The purpose of quantum theory; Part I. Elementary Theory of Observation (Principle of Complementarity): 4. Refraction in inhomogeneous media (force fields); 5. Scattering of charged rays; 6. Refraction and reflection at a plane; 7. Absolute values of momentum and wave length; 8. Double ray of matter diffracting light waves; 9. Double ray of matter diffracting photons; 10. Microscopic observation of ρ (x) and σ (p); 11. Complementarity; 12. Mathematical relation between ρ (x) and σ (p) for free particles; 13. General relation between ρ (q) and σ (p); 14. Crystals; 15. Transition density and transition probability; 16. Resultant values of physical functions; matrix elements; 17. Pulsating density; 18. General relation between ρ (t) and σ (є); 19. Transition density; matrix elements; Part II. The Principle of Uncertainty: 20. Optical observation of density in matter packets; 21. Distribution of momenta in matter packets; 22. Mathematical relation between ρ and σ; 23. Causality; 24. Uncertainty; 25. Uncertainty due to optical observation; 26. Dissipation of matter packets; rays in Wilson Chamber; 27. Density maximum in time; 28. Uncertainty of energy and time; 29. Compton effect; 30. Bothe-Geiger and Compton-Simon experiments; 31. Doppler effect; Raman effect; 32. Elementary bundles of rays; 33. Jeans' number of degrees of freedom; 34. Uncertainty of electromagnetic field components; Part III. The Principle of Interference and Schrödinger's equation: 35. Physical functions; 36. Interference of probabilities for p and q; 37. General interference of probabilities; 38. Differential equations for Ψp (q) and Xq (p); 39. Differential equation for фβ (q); 40. The general probability amplitude Φβ' (Q); 41. Point transformations; 42. General theorem of interference; 43. Conjugate variables; 44. Schrödinger's equation for conservative systems; 45. Schrödinger's equation for non-conservative systems; 46. Pertubation theory; 47. Orthogonality, normalization and Hermitian conjugacy; 48. General matrix elements; Part IV. The Principle of Correspondence: 49. Contact transformations in classical mechanics; 50. Point transformations; 51. Contact transformations in quantum mechanics; 52. Constants of motion and angular co-ordinates; 53. Periodic orbits; 54. De Broglie and Schrödinger function; correspondence to classical mechanics; 55. Packets of probability; 56. Correspondence to hydrodynamics; 57. Motion and scattering of wave packets; 58. Formal correspondence between classical and quantum mechanics; Part V. Mathematical Appendix: Principle of Invariance: 59. The general theorem of transformation; 60. Operator calculus; 61. Exchange relations; three criteria for conjugacy; 62. First method of canonical transformation; 63. Second method of canonical transformation; 64. Proof of the transformation theorem; 65. Invariance of the matrix elements against unitary transformations; 66. Matrix mechanics; Index of literature; Index of names and subjects.

  1. Modal ring method for the scattering of sound

    NASA Technical Reports Server (NTRS)

    Baumeister, Kenneth J.; Kreider, Kevin L.

    1993-01-01

    The modal element method for acoustic scattering can be simplified when the scattering body is rigid. In this simplified method, called the modal ring method, the scattering body is represented by a ring of triangular finite elements forming the outer surface. The acoustic pressure is calculated at the element nodes. The pressure in the infinite computational region surrounding the body is represented analytically by an eigenfunction expansion. The two solution forms are coupled by the continuity of pressure and velocity on the body surface. The modal ring method effectively reduces the two-dimensional scattering problem to a one-dimensional problem capable of handling very high frequency scattering. In contrast to the boundary element method or the method of moments, which perform a similar reduction in problem dimension, the model line method has the added advantage of having a highly banded solution matrix requiring considerably less computer storage. The method shows excellent agreement with analytic results for scattering from rigid circular cylinders over a wide frequency range (1 is equal to or less than ka is less than or equal to 100) in the near and far fields.

  2. A singular-value method for reconstruction of nonradial and lossy objects.

    PubMed

    Jiang, Wei; Astheimer, Jeffrey; Waag, Robert

    2012-03-01

    Efficient inverse scattering algorithms for nonradial lossy objects are presented using singular-value decomposition to form reduced-rank representations of the scattering operator. These algorithms extend eigenfunction methods that are not applicable to nonradial lossy scattering objects because the scattering operators for these objects do not have orthonormal eigenfunction decompositions. A method of local reconstruction by segregation of scattering contributions from different local regions is also presented. Scattering from each region is isolated by forming a reduced-rank representation of the scattering operator that has domain and range spaces comprised of far-field patterns with retransmitted fields that focus on the local region. Methods for the estimation of the boundary, average sound speed, and average attenuation slope of the scattering object are also given. These methods yielded approximations of scattering objects that were sufficiently accurate to allow residual variations to be reconstructed in a single iteration. Calculated scattering from a lossy elliptical object with a random background, internal features, and white noise is used to evaluate the proposed methods. Local reconstruction yielded images with spatial resolution that is finer than a half wavelength of the center frequency and reproduces sound speed and attenuation slope with relative root-mean-square errors of 1.09% and 11.45%, respectively.

  3. Treating electron transport in MCNP{sup trademark}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hughes, H.G.

    1996-12-31

    The transport of electrons and other charged particles is fundamentally different from that of neutrons and photons. A neutron, in aluminum slowing down from 0.5 MeV to 0.0625 MeV will have about 30 collisions; a photon will have fewer than ten. An electron with the same energy loss will undergo 10{sup 5} individual interactions. This great increase in computational complexity makes a single- collision Monte Carlo approach to electron transport unfeasible for many situations of practical interest. Considerable theoretical work has been done to develop a variety of analytic and semi-analytic multiple-scattering theories for the transport of charged particles. Themore » theories used in the algorithms in MCNP are the Goudsmit-Saunderson theory for angular deflections, the Landau an theory of energy-loss fluctuations, and the Blunck-Leisegang enhancements of the Landau theory. In order to follow an electron through a significant energy loss, it is necessary to break the electron`s path into many steps. These steps are chosen to be long enough to encompass many collisions (so that multiple-scattering theories are valid) but short enough that the mean energy loss in any one step is small (for the approximations in the multiple-scattering theories). The energy loss and angular deflection of the electron during each step can then be sampled from probability distributions based on the appropriate multiple- scattering theories. This subsumption of the effects of many individual collisions into single steps that are sampled probabilistically constitutes the ``condensed history`` Monte Carlo method. This method is exemplified in the ETRAN series of electron/photon transport codes. The ETRAN codes are also the basis for the Integrated TIGER Series, a system of general-purpose, application-oriented electron/photon transport codes. The electron physics in MCNP is similar to that of the Integrated TIGER Series.« less

  4. Shrunk loop theorem for the topology probabilities of closed Brownian (or Feynman) paths on the twice punctured plane

    NASA Astrophysics Data System (ADS)

    Giraud, O.; Thain, A.; Hannay, J. H.

    2004-02-01

    The shrunk loop theorem proved here is an integral identity which facilitates the calculation of the relative probability (or probability amplitude) of any given topology that a free, closed Brownian (or Feynman) path of a given 'duration' might have on the twice punctured plane (plane with two marked points). The result is expressed as a 'scattering' series of integrals of increasing dimensionality based on the maximally shrunk version of the path. Physically, this applies in different contexts: (i) the topology probability of a closed ideal polymer chain on a plane with two impassable points, (ii) the trace of the Schrödinger Green function, and thence spectral information, in the presence of two Aharonov-Bohm fluxes and (iii) the same with two branch points of a Riemann surface instead of fluxes. Our theorem starts from the Stovicek scattering expansion for the Green function in the presence of two Aharonov-Bohm flux lines, which itself is based on the famous Sommerfeld one puncture point solution of 1896 (the one puncture case has much easier topology, just one winding number). Stovicek's expansion itself can supply the results at the expense of choosing a base point on the loop and then integrating it away. The shrunk loop theorem eliminates this extra two-dimensional integration, distilling the topology from the geometry.

  5. Robust scatter correction method for cone-beam CT using an interlacing-slit plate

    NASA Astrophysics Data System (ADS)

    Huang, Kui-Dong; Xu, Zhe; Zhang, Ding-Hua; Zhang, Hua; Shi, Wen-Long

    2016-06-01

    Cone-beam computed tomography (CBCT) has been widely used in medical imaging and industrial nondestructive testing, but the presence of scattered radiation will cause significant reduction of image quality. In this article, a robust scatter correction method for CBCT using an interlacing-slit plate (ISP) is carried out for convenient practice. Firstly, a Gaussian filtering method is proposed to compensate the missing data of the inner scatter image, and simultaneously avoid too-large values of calculated inner scatter and smooth the inner scatter field. Secondly, an interlacing-slit scan without detector gain correction is carried out to enhance the practicality and convenience of the scatter correction method. Finally, a denoising step for scatter-corrected projection images is added in the process flow to control the noise amplification The experimental results show that the improved method can not only make the scatter correction more robust and convenient, but also achieve a good quality of scatter-corrected slice images. Supported by National Science and Technology Major Project of the Ministry of Industry and Information Technology of China (2012ZX04007021), Aeronautical Science Fund of China (2014ZE53059), and Fundamental Research Funds for Central Universities of China (3102014KYJD022)

  6. Inverse scattering theory: Inverse scattering series method for one dimensional non-compact support potential

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jie, E-mail: yjie2@uh.edu; Lesage, Anne-Cécile; Hussain, Fazle

    2014-12-15

    The reversion of the Born-Neumann series of the Lippmann-Schwinger equation is one of the standard ways to solve the inverse acoustic scattering problem. One limitation of the current inversion methods based on the reversion of the Born-Neumann series is that the velocity potential should have compact support. However, this assumption cannot be satisfied in certain cases, especially in seismic inversion. Based on the idea of distorted wave scattering, we explore an inverse scattering method for velocity potentials without compact support. The strategy is to decompose the actual medium as a known single interface reference medium, which has the same asymptoticmore » form as the actual medium and a perturbative scattering potential with compact support. After introducing the method to calculate the Green’s function for the known reference potential, the inverse scattering series and Volterra inverse scattering series are derived for the perturbative potential. Analytical and numerical examples demonstrate the feasibility and effectiveness of this method. Besides, to ensure stability of the numerical computation, the Lanczos averaging method is employed as a filter to reduce the Gibbs oscillations for the truncated discrete inverse Fourier transform of each order. Our method provides a rigorous mathematical framework for inverse acoustic scattering with a non-compact support velocity potential.« less

  7. Two-Dimensional Heterostructure as a Platform for Surface-Enhanced Raman Scattering.

    PubMed

    Tan, Yang; Ma, Linan; Gao, Zhibin; Chen, Ming; Chen, Feng

    2017-04-12

    Raman enhancement on a flat nonmetallic surface has attracted increasing attention, ever since the discovery of graphene enhanced Raman scattering. Recently, diverse two-dimensional layered materials have been applied as a flat surface for the Raman enhancement, attributed to different mechanisms. Looking beyond these isolated materials, atomic layers can be reassembled to design a heterostructure stacked layer by layer with an arbitrary chosen sequence, which allows the flow of charge carriers between neighboring layers and offers novel functionalities. Here, we demonstrate the heterostructure as a novel Raman enhancement platform. The WSe 2 (W) monolayer and graphene (G) were stacked together to form a heterostructure with an area of 10 mm × 10 mm. Heterostructures with different stacked structuress are used as platforms for the enhanced Raman scattering, including G/W, W/G, G/W/G/W, and W/G/G/W. On the surface of the heterostructure, the intensity of the Raman scattering is much stronger compared with isolated layers, using the copper phthalocyanine (CuPc) molecule as a probe. It is found that the Raman enhancement effect on heterostructures depends on stacked methods. Phonon modes of CuPc have the strongest enhancement on G/W. W/G and W/G/G/W have a stronger enhancement than that on the isolated WSe 2 monolayer, while lower than the graphene monolayer. The G/W/G/W/substrate demonstrated a comparable Raman enhancement effect than the G/W/substrate. These differences are due to the different interlayer couplings in heterostructures related to electron transition probability rates, which are further proved by first-principle calculations and probe-pump measurements.

  8. TU-H-CAMPUS-IeP1-05: A Framework for the Analytic Calculation of Patient-Specific Dose Distribution Due to CBCT Scan for IGRT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Youn, H; Jeon, H; Nam, J

    Purpose: To investigate the feasibility of an analytic framework to estimate patients’ absorbed dose distribution owing to daily cone-beam CT scan for image-guided radiation treatment. Methods: To compute total absorbed dose distribution, we separated the framework into primary and scattered dose calculations. Using the source parameters such as voltage, current, and bowtie filtration, for the primary dose calculation, we simulated the forward projection from the source to each voxel of an imaging object including some inhomogeneous inserts. Then we calculated the primary absorbed dose at each voxel based on the absorption probability deduced from the HU values and Beer’s law.more » In sequence, all voxels constructing the phantom were regarded as secondary sources to radiate scattered photons for scattered dose calculation. Details of forward projection were identical to that of the previous step. The secondary source intensities were given by using scatter-to- primary ratios provided by NIST. In addition, we compared the analytically calculated dose distribution with their Monte Carlo simulation results. Results: The suggested framework for absorbed dose estimation successfully provided the primary and secondary dose distributions of the phantom. Moreover, our analytic dose calculations and Monte Carlo calculations were well agreed each other even near the inhomogeneous inserts. Conclusion: This work indicated that our framework can be an effective monitor to estimate a patient’s exposure owing to cone-beam CT scan for image-guided radiation treatment. Therefore, we expected that the patient’s over-exposure during IGRT might be prevented by our framework.« less

  9. Identifying the theory of dark matter with direct detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.

    2015-12-01

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able tomore » select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either 'heavy' or 'light' mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.« less

  10. Identifying the theory of dark matter with direct detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.

    2015-12-29

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able tomore » select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either “heavy” or “light” mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.« less

  11. Time-Series INSAR: An Integer Least-Squares Approach For Distributed Scatterers

    NASA Astrophysics Data System (ADS)

    Samiei-Esfahany, Sami; Hanssen, Ramon F.

    2012-01-01

    The objective of this research is to extend the geode- tic mathematical model which was developed for persistent scatterers to a model which can exploit distributed scatterers (DS). The main focus is on the integer least- squares framework, and the main challenge is to include the decorrelation effect in the mathematical model. In order to adapt the integer least-squares mathematical model for DS we altered the model from a single master to a multi-master configuration and introduced the decorrelation effect stochastically. This effect is described in our model by a full covariance matrix. We propose to de- rive this covariance matrix by numerical integration of the (joint) probability distribution function (PDF) of interferometric phases. This PDF is a function of coherence values and can be directly computed from radar data. We show that the use of this model can improve the performance of temporal phase unwrapping of distributed scatterers.

  12. Effect of chiral symmetry on chaotic scattering from Majorana zero modes.

    PubMed

    Schomerus, H; Marciani, M; Beenakker, C W J

    2015-04-24

    In many of the experimental systems that may host Majorana zero modes, a so-called chiral symmetry exists that protects overlapping zero modes from splitting up. This symmetry is operative in a superconducting nanowire that is narrower than the spin-orbit scattering length, and at the Dirac point of a superconductor-topological insulator heterostructure. Here we show that chiral symmetry strongly modifies the dynamical and spectral properties of a chaotic scatterer, even if it binds only a single zero mode. These properties are quantified by the Wigner-Smith time-delay matrix Q=-iℏS^{†}dS/dE, the Hermitian energy derivative of the scattering matrix, related to the density of states by ρ=(2πℏ)^{-1}TrQ. We compute the probability distribution of Q and ρ, dependent on the number ν of Majorana zero modes, in the chiral ensembles of random-matrix theory. Chiral symmetry is essential for a significant ν dependence.

  13. Scatter measurement and correction method for cone-beam CT based on single grating scan

    NASA Astrophysics Data System (ADS)

    Huang, Kuidong; Shi, Wenlong; Wang, Xinyu; Dong, Yin; Chang, Taoqi; Zhang, Hua; Zhang, Dinghua

    2017-06-01

    In cone-beam computed tomography (CBCT) systems based on flat-panel detector imaging, the presence of scatter significantly reduces the quality of slices. Based on the concept of collimation, this paper presents a scatter measurement and correction method based on single grating scan. First, according to the characteristics of CBCT imaging, the scan method using single grating and the design requirements of the grating are analyzed and figured out. Second, by analyzing the composition of object projection images and object-and-grating projection images, the processing method for the scatter image at single projection angle is proposed. In addition, to avoid additional scan, this paper proposes an angle interpolation method of scatter images to reduce scan cost. Finally, the experimental results show that the scatter images obtained by this method are accurate and reliable, and the effect of scatter correction is obvious. When the additional object-and-grating projection images are collected and interpolated at intervals of 30 deg, the scatter correction error of slices can still be controlled within 3%.

  14. Aerosol Light Absorption and Scattering at Four Sites in and Near Mexico City: Comparison with Las Vegas, Nevada, USA

    NASA Astrophysics Data System (ADS)

    Arnott, W. P.; Miranda, G. P.; Gaffney, J. S.; Marley, N. A.

    2007-05-01

    Four photoacoustic spectrometers (PAS) for aerosol light scattering and absorption measurements were deployed in and near Mexico City in March 2006 as part of the Megacity Impacts on Regional and Global Environments (MIRAGE). The four sites included: an urban site at Instituto Mexicano del Petroleo (Mexican Oil Institute, denoted by IMP); a suburban site at the Technological University of Tecamac; a rural site at "La Biznaga" ranch; and a site at the Paseo de Cortes (altitude 3,810 meters ASL) in the rural area above Amecameca in the State of Mexico, on the saddle between the volcanoes Popocatepetl and Iztaccihuatl. A similar campaign was held in Las Vegas, Nevada, USA in January-February, 2003. The IMP site gave in-situ characterization of the Mexico City plume under favorable wind conditions while the other sites provided characterization of the plume, mixed in with any local sources. The second and third sites are north of Mexico City, and the fourth site is south. The PAS used at IMP operates at 532 nm, and conveniently allowed for characterization of gaseous absorption at this wavelength as well. Instruments at the second and third sites operate at 870 nm, and the one at the fourth site at 780 nm. Light scattering measurements are accomplished within the PAS by the reciprocal nephelometery method. In the urban site the aerosol absorption coefficient typically varies between 20 and 180 Mm-1 during the course of the day and significant diurnal variation of the aerosol single scattering albedo was observed probably as a consequence of secondary aerosol formation. Comparisons with TSI nephelometer scattering at the T0 site will be presented. We will present the diurnal variation of the scattering and absorption as well as the single scattering albedo and fraction of absorption due to gases at the IMP site and compare with Las Vegas diurnal variation. Mexico City 'breaths' more during the course of the day than Las Vegas, Nevada in part because the latitude of Mexico City resulted in more direct solar radiation. Further insight on the meteorological connections will be discussed.

  15. Army ants algorithm for rare event sampling of delocalized nonadiabatic transitions by trajectory surface hopping and the estimation of sampling errors by the bootstrap method.

    PubMed

    Nangia, Shikha; Jasper, Ahren W; Miller, Thomas F; Truhlar, Donald G

    2004-02-22

    The most widely used algorithm for Monte Carlo sampling of electronic transitions in trajectory surface hopping (TSH) calculations is the so-called anteater algorithm, which is inefficient for sampling low-probability nonadiabatic events. We present a new sampling scheme (called the army ants algorithm) for carrying out TSH calculations that is applicable to systems with any strength of coupling. The army ants algorithm is a form of rare event sampling whose efficiency is controlled by an input parameter. By choosing a suitable value of the input parameter the army ants algorithm can be reduced to the anteater algorithm (which is efficient for strongly coupled cases), and by optimizing the parameter the army ants algorithm may be efficiently applied to systems with low-probability events. To demonstrate the efficiency of the army ants algorithm, we performed atom-diatom scattering calculations on a model system involving weakly coupled electronic states. Fully converged quantum mechanical calculations were performed, and the probabilities for nonadiabatic reaction and nonreactive deexcitation (quenching) were found to be on the order of 10(-8). For such low-probability events the anteater sampling scheme requires a large number of trajectories ( approximately 10(10)) to obtain good statistics and converged semiclassical results. In contrast by using the new army ants algorithm converged results were obtained by running 10(5) trajectories. Furthermore, the results were found to be in excellent agreement with the quantum mechanical results. Sampling errors were estimated using the bootstrap method, which is validated for use with the army ants algorithm. (c) 2004 American Institute of Physics.

  16. Remote sensing of ocean current boundary layer. [Loop Current in Gulf of Mexico

    NASA Technical Reports Server (NTRS)

    Maul, G. A. (Principal Investigator)

    1973-01-01

    The author has identified the following significant results. A time series of the Loop Current in the Gulf of Mexico, covering an annual cycle of growth, spreading, and decay, has been obtained in synchronization with ERTS-1. Computer enhanced images, which are necessary to extract useful oceanic information, show that the current can be observed either by color or sea state effects associated with the cyclonic boundary. The color effect relates to the spectral variations in the optical properties of the water and its suspended particles, and is studied by radiative transfer theory. Significant oceanic parameters identified are: the probability of forward scattering, and the ratio of scattering to total attenuation. Several spectra of upwelling diffuse light are computed as a function of the concentration of particles and yellow substance. These calculations compare favorably with experimental measurements and show that the ratio of channels method gives ambiguous interpretative results. These results are used to discuss features in images where surface measurements were obtained and are extended to tentative explanation in others.

  17. A satellite-asteroid mystery and a possible early flux of scattered C-class asteroids

    NASA Technical Reports Server (NTRS)

    Hartmann, William K.

    1987-01-01

    The C spectral class implied by the neutral spectra and low albedo of probably capture-originated satellites orbiting Saturn, Jupiter, and Mars is noted to contradict evidence that class-C objects are native only to the outer half of the asteroid belt. It is presently suggested that Jupiter resonances may have scattered a high flux of C-type objects out of the belt as well as throughout the primordial solar system, at the close of planet accretion, when extended atmospheres could figure in their capture. The largest scattered object fluxes come from the resonance regions primarily populated by C-class objects, lending support to the Pollack et al. (1979) capture scenario invoking extended protoatmospheres.

  18. Monte Carlo simulation of wave sensing with a short pulse radar

    NASA Technical Reports Server (NTRS)

    Levine, D. M.; Davisson, L. D.; Kutz, R. L.

    1977-01-01

    A Monte Carlo simulation is used to study the ocean wave sensing potential of a radar which scatters short pulses at small off-nadir angles. In the simulation, realizations of a random surface are created commensurate with an assigned probability density and power spectrum. Then the signal scattered back to the radar is computed for each realization using a physical optics analysis which takes wavefront curvature and finite radar-to-surface distance into account. In the case of a Pierson-Moskowitz spectrum and a normally distributed surface, reasonable assumptions for a fully developed sea, it has been found that the cumulative distribution of time intervals between peaks in the scattered power provides a measure of surface roughness. This observation is supported by experiments.

  19. Proposed software system for atomic-structure calculation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fischer, C.F.

    1981-07-01

    Atomic structure calculations are understood well enough that, at a routine level, an atomic structure software package can be developed. At the Atomic Physics Conference in Riga, 1978 L.V. Chernysheva and M.Y. Amusia of Leningrad University, presented a paper on Software for Atomic Calculations. Their system, called ATOM is based on the Hartree-Fock approximation and correlation is included within the framework of RPAE. Energy level calculations, transition probabilities, photo-ionization cross-sections, electron scattering cross-sections are some of the physical properties that can be evaluated by their system. The MCHF method, together with CI techniques and the Breit-Pauli approximation also provides amore » sound theoretical basis for atomic structure calculations.« less

  20. Lifetimes in Te 124 : Examining critical-point symmetry in the Te nuclei

    DOE PAGES

    Hicks, S. F.; Vanhoy, J. R.; Burkett, P. G.; ...

    2017-03-27

    The Doppler-shift attenuation method following inelastic neutron scattering was used to determine the lifetimes of nuclear levels to 3.3-MeV excitation in 124Te. Level energies and spins, γ -ray energies and branching ratios, and multipole-mixing ratios were deduced from measured γ-ray angular distributions at incident neutron energies of 2.40 and 3.30 MeV, γ-ray excitation functions, and γγ coincidence measurements. The newly obtained reduced transition probabilities and level energies for 124Te were compared to critical-point symmetry model predictions. The E(5) and β 4 potential critical-point symmetries were also investigated in 122Te and 126Te.

  1. Physics and Computational Methods for X-ray Scatter Estimation and Correction in Cone-Beam Computed Tomography

    NASA Astrophysics Data System (ADS)

    Bootsma, Gregory J.

    X-ray scatter in cone-beam computed tomography (CBCT) is known to reduce image quality by introducing image artifacts, reducing contrast, and limiting computed tomography (CT) number accuracy. The extent of the effect of x-ray scatter on CBCT image quality is determined by the shape and magnitude of the scatter distribution in the projections. A method to allay the effects of scatter is imperative to enable application of CBCT to solve a wider domain of clinical problems. The work contained herein proposes such a method. A characterization of the scatter distribution through the use of a validated Monte Carlo (MC) model is carried out. The effects of imaging parameters and compensators on the scatter distribution are investigated. The spectral frequency components of the scatter distribution in CBCT projection sets are analyzed using Fourier analysis and found to reside predominately in the low frequency domain. The exact frequency extents of the scatter distribution are explored for different imaging configurations and patient geometries. Based on the Fourier analysis it is hypothesized the scatter distribution can be represented by a finite sum of sine and cosine functions. The fitting of MC scatter distribution estimates enables the reduction of the MC computation time by diminishing the number of photon tracks required by over three orders of magnitude. The fitting method is incorporated into a novel scatter correction method using an algorithm that simultaneously combines multiple MC scatter simulations. Running concurrent MC simulations while simultaneously fitting the results allows for the physical accuracy and flexibility of MC methods to be maintained while enhancing the overall efficiency. CBCT projection set scatter estimates, using the algorithm, are computed on the order of 1--2 minutes instead of hours or days. Resulting scatter corrected reconstructions show a reduction in artifacts and improvement in tissue contrast and voxel value accuracy.

  2. A novel hybrid scattering order-dependent variance reduction method for Monte Carlo simulations of radiative transfer in cloudy atmosphere

    NASA Astrophysics Data System (ADS)

    Wang, Zhen; Cui, Shengcheng; Yang, Jun; Gao, Haiyang; Liu, Chao; Zhang, Zhibo

    2017-03-01

    We present a novel hybrid scattering order-dependent variance reduction method to accelerate the convergence rate in both forward and backward Monte Carlo radiative transfer simulations involving highly forward-peaked scattering phase function. This method is built upon a newly developed theoretical framework that not only unifies both forward and backward radiative transfer in scattering-order-dependent integral equation, but also generalizes the variance reduction formalism in a wide range of simulation scenarios. In previous studies, variance reduction is achieved either by using the scattering phase function forward truncation technique or the target directional importance sampling technique. Our method combines both of them. A novel feature of our method is that all the tuning parameters used for phase function truncation and importance sampling techniques at each order of scattering are automatically optimized by the scattering order-dependent numerical evaluation experiments. To make such experiments feasible, we present a new scattering order sampling algorithm by remodeling integral radiative transfer kernel for the phase function truncation method. The presented method has been implemented in our Multiple-Scaling-based Cloudy Atmospheric Radiative Transfer (MSCART) model for validation and evaluation. The main advantage of the method is that it greatly improves the trade-off between numerical efficiency and accuracy order by order.

  3. Single-scan patient-specific scatter correction in computed tomography using peripheral detection of scatter and compressed sensing scatter retrieval

    PubMed Central

    Meng, Bowen; Lee, Ho; Xing, Lei; Fahimian, Benjamin P.

    2013-01-01

    Purpose: X-ray scatter results in a significant degradation of image quality in computed tomography (CT), representing a major limitation in cone-beam CT (CBCT) and large field-of-view diagnostic scanners. In this work, a novel scatter estimation and correction technique is proposed that utilizes peripheral detection of scatter during the patient scan to simultaneously acquire image and patient-specific scatter information in a single scan, and in conjunction with a proposed compressed sensing scatter recovery technique to reconstruct and correct for the patient-specific scatter in the projection space. Methods: The method consists of the detection of patient scatter at the edges of the field of view (FOV) followed by measurement based compressed sensing recovery of the scatter through-out the projection space. In the prototype implementation, the kV x-ray source of the Varian TrueBeam OBI system was blocked at the edges of the projection FOV, and the image detector in the corresponding blocked region was used for scatter detection. The design enables image data acquisition of the projection data on the unblocked central region of and scatter data at the blocked boundary regions. For the initial scatter estimation on the central FOV, a prior consisting of a hybrid scatter model that combines the scatter interpolation method and scatter convolution model is estimated using the acquired scatter distribution on boundary region. With the hybrid scatter estimation model, compressed sensing optimization is performed to generate the scatter map by penalizing the L1 norm of the discrete cosine transform of scatter signal. The estimated scatter is subtracted from the projection data by soft-tuning, and the scatter-corrected CBCT volume is obtained by the conventional Feldkamp-Davis-Kress algorithm. Experimental studies using image quality and anthropomorphic phantoms on a Varian TrueBeam system were carried out to evaluate the performance of the proposed scheme. Results: The scatter shading artifacts were markedly suppressed in the reconstructed images using the proposed method. On the Catphan©504 phantom, the proposed method reduced the error of CT number to 13 Hounsfield units, 10% of that without scatter correction, and increased the image contrast by a factor of 2 in high-contrast regions. On the anthropomorphic phantom, the spatial nonuniformity decreased from 10.8% to 6.8% after correction. Conclusions: A novel scatter correction method, enabling unobstructed acquisition of the high frequency image data and concurrent detection of the patient-specific low frequency scatter data at the edges of the FOV, is proposed and validated in this work. Relative to blocker based techniques, rather than obstructing the central portion of the FOV which degrades and limits the image reconstruction, compressed sensing is used to solve for the scatter from detection of scatter at the periphery of the FOV, enabling for the highest quality reconstruction in the central region and robust patient-specific scatter correction. PMID:23298098

  4. Signals of strong electronic correlation in ion scattering processes

    NASA Astrophysics Data System (ADS)

    Bonetto, F.; Gonzalez, C.; Goldberg, E. C.

    2016-05-01

    Previous measurements of neutral atom fractions for S r+ scattered by gold polycrystalline surfaces show a singular dependence with the target temperature. There is still not a theoretical model that can properly describe the magnitude and the temperature dependence of the neutralization probabilities found. Here, we applied a first-principles quantum-mechanical theoretical formalism to describe the time-dependent scattering process. Three different electronic correlation approaches consistent with the system analyzed are used: (i) the spinless approach, where two charge channels are considered (S r0 and S r+ ) and the spin degeneration is neglected; (ii) the infinite-U approach, with the same charge channels (S r0 and S r+ ) but considering the spin degeneration; and (iii) the finite-U approach, where the first ionization and second ionization energy levels are considered very, but finitely, separated. Neutral fraction magnitudes and temperature dependence are better described by the finite-U approach, indicating that e -correlation plays a significant role in charge-transfer processes. However, none of them is able to explain the nonmonotonous temperature dependence experimentally obtained. Here, we suggest that small changes in the surface work function introduced by the target heating, and possibly not detected by experimental standard methods, could be responsible for that singular behavior. Additionally, we apply the same theoretical model using the infinite-U approximation for the Mg-Au system, obtaining an excellent description of the experimental neutral fractions measured.

  5. Transition probability functions for applications of inelastic electron scattering

    PubMed Central

    Löffler, Stefan; Schattschneider, Peter

    2012-01-01

    In this work, the transition matrix elements for inelastic electron scattering are investigated which are the central quantity for interpreting experiments. The angular part is given by spherical harmonics. For the weighted radial wave function overlap, analytic expressions are derived in the Slater-type and the hydrogen-like orbital models. These expressions are shown to be composed of a finite sum of polynomials and elementary trigonometric functions. Hence, they are easy to use, require little computation time, and are significantly more accurate than commonly used approximations. PMID:22560709

  6. Analysis of the Hessian for Inverse Scattering Problems. Part 3. Inverse Medium Scattering of Electromagnetic Waves in Three Dimensions

    DTIC Science & Technology

    2012-08-01

    small data noise and model error, the discrete Hessian can be approximated by a low-rank matrix. This in turn enables fast solution of an appropriately...implication of the compactness of the Hessian is that for small data noise and model error, the discrete Hessian can be approximated by a low-rank matrix. This...probability distribution is given by the inverse of the Hessian of the negative log likelihood function. For Gaussian data noise and model error, this

  7. Optical Sensors Using Stimulated Brillouin Scattering

    NASA Technical Reports Server (NTRS)

    Christensen, Caleb A (Inventor); Zavriyev, Anton (Inventor)

    2017-01-01

    A method for enhancing a sensitivity of an optical sensor having an optical cavity counter-propagates beams of pump light within the optical cavity to produce scattered light based on Stimulated Brillouin Scattering (SBS). The properties of the pump light are selected to generate fast-light conditions for the scattered light, such that the scattered light includes counter-propagating beams of fast light. The method prevents the pump light from resonating within the optical cavity, while allowing the scattered light to resonate within the optical cavity. At least portions of the scattered light are interfered outside of the optical cavity to produce a beat note for a measurement of the optical sensor. The disclosed method is particularly applicable to optical gyroscopes.

  8. Microscopic modeling of gas-surface scattering: II. Application to argon atom adsorption on a platinum (111) surface

    NASA Astrophysics Data System (ADS)

    Filinov, A.; Bonitz, M.; Loffhagen, D.

    2018-06-01

    A new combination of first principle molecular dynamics (MD) simulations with a rate equation model presented in the preceding paper (paper I) is applied to analyze in detail the scattering of argon atoms from a platinum (111) surface. The combined model is based on a classification of all atom trajectories according to their energies into trapped, quasi-trapped and scattering states. The number of particles in each of the three classes obeys coupled rate equations. The coefficients in the rate equations are the transition probabilities between these states which are obtained from MD simulations. While these rates are generally time-dependent, after a characteristic time scale t E of several tens of picoseconds they become stationary allowing for a rather simple analysis. Here, we investigate this time scale by analyzing in detail the temporal evolution of the energy distribution functions of the adsorbate atoms. We separately study the energy loss distribution function of the atoms and the distribution function of in-plane and perpendicular energy components. Further, we compute the sticking probability of argon atoms as a function of incident energy, angle and lattice temperature. Our model is important for plasma-surface modeling as it allows to extend accurate simulations to longer time scales.

  9. Classical theory of atom-surface scattering: The rainbow effect

    NASA Astrophysics Data System (ADS)

    Miret-Artés, Salvador; Pollak, Eli

    2012-07-01

    The scattering of heavy atoms and molecules from surfaces is oftentimes dominated by classical mechanics. A large body of experiments have gathered data on the angular distributions of the scattered species, their energy loss distribution, sticking probability, dependence on surface temperature and more. For many years these phenomena have been considered theoretically in the framework of the “washboard model” in which the interaction of the incident particle with the surface is described in terms of hard wall potentials. Although this class of models has helped in elucidating some of the features it left open many questions such as: true potentials are clearly not hard wall potentials, it does not provide a realistic framework for phonon scattering, and it cannot explain the incident angle and incident energy dependence of rainbow scattering, nor can it provide a consistent theory for sticking. In recent years we have been developing a classical perturbation theory approach which has provided new insight into the dynamics of atom-surface scattering. The theory includes both surface corrugation as well as interaction with surface phonons in terms of harmonic baths which are linearly coupled to the system coordinates. This model has been successful in elucidating many new features of rainbow scattering in terms of frictions and bath fluctuations or noise. It has also given new insight into the origins of asymmetry in atomic scattering from surfaces. New phenomena deduced from the theory include friction induced rainbows, energy loss rainbows, a theory of super-rainbows, and more. In this review we present the classical theory of atom-surface scattering as well as extensions and implications for semiclassical scattering and the further development of a quantum theory of surface scattering. Special emphasis is given to the inversion of scattering data into information on the particle-surface interactions.

  10. Classical theory of atom-surface scattering: The rainbow effect

    NASA Astrophysics Data System (ADS)

    Miret-Artés, Salvador; Pollak, Eli

    The scattering of heavy atoms and molecules from surfaces is oftentimes dominated by classical mechanics. A large body of experiments have gathered data on the angular distributions of the scattered species, their energy loss distribution, sticking probability, dependence on surface temperature and more. For many years these phenomena have been considered theoretically in the framework of the "washboard model" in which the interaction of the incident particle with the surface is described in terms of hard wall potentials. Although this class of models has helped in elucidating some of the features it left open many questions such as: true potentials are clearly not hard wall potentials, it does not provide a realistic framework for phonon scattering, and it cannot explain the incident angle and incident energy dependence of rainbow scattering, nor can it provide a consistent theory for sticking. In recent years we have been developing a classical perturbation theory approach which has provided new insight into the dynamics of atom-surface scattering. The theory includes both surface corrugation as well as interaction with surface phonons in terms of harmonic baths which are linearly coupled to the system coordinates. This model has been successful in elucidating many new features of rainbow scattering in terms of frictions and bath fluctuations or noise. It has also given new insight into the origins of asymmetry in atomic scattering from surfaces. New phenomena deduced from the theory include friction induced rainbows, energy loss rainbows, a theory of super-rainbows, and more. In this review we present the classical theory of atom-surface scattering as well as extensions and implications for semiclassical scattering and the further development of a quantum theory of surface scattering. Special emphasis is given to the inversion of scattering data into information on the particle-surface interactions.

  11. Scattering Cross Section of Sound Waves by the Modal Element Method

    NASA Technical Reports Server (NTRS)

    Baumeister, Kenneth J.; Kreider, Kevin L.

    1994-01-01

    #he modal element method has been employed to determine the scattered field from a plane acoustic wave impinging on a two dimensional body. In the modal element method, the scattering body is represented by finite elements, which are coupled to an eigenfunction expansion representing the acoustic pressure in the infinite computational domain surrounding the body. The present paper extends the previous work by developing the algorithm necessary to calculate the acoustics scattering cross section by the modal element method. The scattering cross section is the acoustical equivalent to the Radar Cross Section (RCS) in electromagnetic theory. Since the scattering cross section is evaluated at infinite distance from the body, an asymptotic approximation is used in conjunction with the standard modal element method. For validation, the scattering cross section of the rigid circular cylinder is computed for the frequency range 0.1 is less than or equal to ka is less than or equal to 100. Results show excellent agreement with the analytic solution.

  12. Spatial correlations and probability density function of the phase difference in a developed speckle-field: numerical and natural experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mysina, N Yu; Maksimova, L A; Ryabukho, V P

    Investigated are statistical properties of the phase difference of oscillations in speckle-fields at two points in the far-field diffraction region, with different shapes of the scatterer aperture. Statistical and spatial nonuniformity of the probability density function of the field phase difference is established. Numerical experiments show that, for the speckle-fields with an oscillating alternating-sign transverse correlation function, a significant nonuniformity of the probability density function of the phase difference in the correlation region of the field complex amplitude, with the most probable values 0 and p, is observed. A natural statistical interference experiment using Young diagrams has confirmed the resultsmore » of numerical experiments. (laser applications and other topics in quantum electronics)« less

  13. X-ray solution scattering combined with computation characterizing protein folds and multiple conformational states : computation and application.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, S.; Park, S.; Makowski, L.

    Small angle X-ray scattering (SAXS) is an increasingly powerful technique to characterize the structure of biomolecules in solution. We present a computational method for accurately and efficiently computing the solution scattering curve from a protein with dynamical fluctuations. The method is built upon a coarse-grained (CG) representation of the protein. This CG approach takes advantage of the low-resolution character of solution scattering. It allows rapid determination of the scattering pattern from conformations extracted from CG simulations to obtain scattering characterization of the protein conformational landscapes. Important elements incorporated in the method include an effective residue-based structure factor for each aminomore » acid, an explicit treatment of the hydration layer at the surface of the protein, and an ensemble average of scattering from all accessible conformations to account for macromolecular flexibility. The CG model is calibrated and illustrated to accurately reproduce the experimental scattering curve of Hen egg white lysozyme. We then illustrate the computational method by calculating the solution scattering pattern of several representative protein folds and multiple conformational states. The results suggest that solution scattering data, when combined with a reliable computational method, have great potential for a better structural description of multi-domain complexes in different functional states, and for recognizing structural folds when sequence similarity to a protein of known structure is low. Possible applications of the method are discussed.« less

  14. Wave multiple scattering by a finite number of unclosed circular cylinders

    NASA Technical Reports Server (NTRS)

    Veliyev, E. I.; Veremey, V. V.

    1984-01-01

    The boundary value problem of plane H-polarized electromagnetic wave multiple scattering by a finite number of unclosed circular cylinders is solved. The solution is obtained by two different methods: the method of successive scattering and the method of partial matrix inversion for simultaneous dual equations. The advantages of the successive scattering method are shown. Computer calculations of the suface currents and the total cross section are presented for the structure of two screens.

  15. Inverse scattering method and soliton double solution family for the general symplectic gravity model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao Yajun

    A previously established Hauser-Ernst-type extended double-complex linear system is slightly modified and used to develop an inverse scattering method for the stationary axisymmetric general symplectic gravity model. The reduction procedures in this inverse scattering method are found to be fairly simple, which makes the inverse scattering method applied fine and effective. As an application, a concrete family of soliton double solutions for the considered theory is obtained.

  16. A novel sampling method for multiple multiscale targets from scattering amplitudes at a fixed frequency

    NASA Astrophysics Data System (ADS)

    Liu, Xiaodong

    2017-08-01

    A sampling method by using scattering amplitude is proposed for shape and location reconstruction in inverse acoustic scattering problems. Only matrix multiplication is involved in the computation, thus the novel sampling method is very easy and simple to implement. With the help of the factorization of the far field operator, we establish an inf-criterion for characterization of underlying scatterers. This result is then used to give a lower bound of the proposed indicator functional for sampling points inside the scatterers. While for the sampling points outside the scatterers, we show that the indicator functional decays like the bessel functions as the sampling point goes away from the boundary of the scatterers. We also show that the proposed indicator functional continuously depends on the scattering amplitude, this further implies that the novel sampling method is extremely stable with respect to errors in the data. Different to the classical sampling method such as the linear sampling method or the factorization method, from the numerical point of view, the novel indicator takes its maximum near the boundary of the underlying target and decays like the bessel functions as the sampling points go away from the boundary. The numerical simulations also show that the proposed sampling method can deal with multiple multiscale case, even the different components are close to each other.

  17. SAR Polarimetry

    NASA Technical Reports Server (NTRS)

    vanZyl, Jakob J.

    2012-01-01

    Radar Scattering includes: Surface Characteristics, Geometric Properties, Dielectric Properties, Rough Surface Scattering, Geometrical Optics and Small Perturbation Method Solutions, Integral Equation Method, Magellan Image of Pancake Domes on Venus, Dickinson Impact Crater on Venus (Magellan), Lakes on Titan (Cassini Radar, Longitudinal Dunes on Titan (Cassini Radar), Rough Surface Scattering: Effect of Dielectric Constant, Vegetation Scattering, Effect of Soil Moisture. Polarimetric Radar includes: Principles of Polarimetry: Field Descriptions, Wave Polarizations: Geometrical Representations, Definition of Ellipse Orientation Angles, Scatter as Polarization Transformer, Scattering Matrix, Coordinate Systems, Scattering Matrix, Covariance Matrix, Pauli Basis and Coherency Matrix, Polarization Synthesis, Polarimeter Implementation.

  18. Scattering and transport statistics at the metal-insulator transition: A numerical study of the power-law banded random-matrix model

    NASA Astrophysics Data System (ADS)

    Méndez-Bermúdez, J. A.; Gopar, Victor A.; Varga, Imre

    2010-09-01

    We study numerically scattering and transport statistical properties of the one-dimensional Anderson model at the metal-insulator transition described by the power-law banded random matrix (PBRM) model at criticality. Within a scattering approach to electronic transport, we concentrate on the case of a small number of single-channel attached leads. We observe a smooth crossover from localized to delocalized behavior in the average-scattering matrix elements, the conductance probability distribution, the variance of the conductance, and the shot noise power by varying b (the effective bandwidth of the PBRM model) from small (b≪1) to large (b>1) values. We contrast our results with analytic random matrix theory predictions which are expected to be recovered in the limit b→∞ . We also compare our results for the PBRM model with those for the three-dimensional (3D) Anderson model at criticality, finding that the PBRM model with bɛ[0.2,0.4] reproduces well the scattering and transport properties of the 3D Anderson model.

  19. Elastic and inelastic neutron scattering cross sections for fission reactor applications

    NASA Astrophysics Data System (ADS)

    Hicks, S. F.; Chakraborty, A.; Combs, B.; Crider, B. P.; Downes, L.; Girgis, J.; Kersting, L. J.; Kumar, A.; Lueck, C. J.; McDonough, P. J.; McEllistrem, M. T.; Peters, E. E.; Prados-Estevz, F. M.; Schniederjan, J.; Sidwell, L.; Sigillito, A. J.; Vanhoy, J. R.; Watts, D.; Yates, S. W.

    2013-04-01

    Nuclear data important for the design and development of the next generation of light-water reactors and future fast reactors include neutron elastic and inelastic scattering cross sections on important structural materials, such as Fe, and on coolant materials, such as Na. These reaction probabilities are needed since neutron reactions impact fuel performance during irradiations and the overall efficiency of reactors. While neutron scattering cross sections from these materials are available for certain incident neutron energies, the fast neutron region, particularly above 2 MeV, has large gaps for which no measurements exist, or the existing uncertainties are large. Measurements have been made at the University of Kentucky Accelerator Laboratory to measure neutron scattering cross sections on both Fe and Na in the region where these gaps occur and to reduce the uncertainties on scattering from the ground state and first excited state of these nuclei. Results from measurements on Fe at incident neutron energies between 2 and 4 MeV will be presented and comparisons will be made to model calculations available from data evaluators.

  20. Three-Component Decomposition of Polarimetric SAR Data Integrating Eigen-Decomposition Results

    NASA Astrophysics Data System (ADS)

    Lu, Da; He, Zhihua; Zhang, Huan

    2018-01-01

    This paper presents a novel three-component scattering power decomposition of polarimetric SAR data. There are two problems in three-component decomposition method: volume scattering component overestimation in urban areas and artificially set parameter to be a fixed value. Though volume scattering component overestimation can be partly solved by deorientation process, volume scattering still dominants some oriented urban areas. The speckle-like decomposition results introduced by artificially setting value are not conducive to further image interpretation. This paper integrates the results of eigen-decomposition to solve the aforementioned problems. Two principal eigenvectors are used to substitute the surface scattering model and the double bounce scattering model. The decomposed scattering powers are obtained using a constrained linear least-squares method. The proposed method has been verified using an ESAR PolSAR image, and the results show that the proposed method has better performance in urban area.

  1. Ground state atoms confined in a real Rydberg and complex Rydberg-Scarf II potential

    NASA Astrophysics Data System (ADS)

    Mansoori Kermani, Maryam

    2017-12-01

    In this work, a system of two ground state atoms confined in a one-dimensional real Rydberg potential was modeled. The atom-atom interaction was considered as a nonlocal separable potential (NLSP) of rank one. This potential was assumed because it leads to an analytical solution of the Lippmann-Schwinger equation. The NLSPs are useful in the few body problems that the many-body potential at each point is replaced by a projective two-body nonlocal potential operator. Analytical expressions for the confined particle resolvent were calculated as a key function in this study. The contributions of the bound and virtual states in the complex energy plane were obtained via the derived transition matrix. Since the low energy quantum scattering problems scattering length is an important quantity, the behavior of this parameter was described versus the reduced energy considering various values of potential parameters. In a one-dimensional model, the total cross section in units of the area is not a meaningful property; however, the reflectance coefficient has a similar role. Therefore the reflectance probability and its behavior were investigated. Then a new confined potential via combining the complex absorbing Scarf II potential with the real Rydberg potential, called the Rydberg-Scarf II potential, was introduced to construct a non-Hermitian Hamiltonian. In order to investigate the effect of the complex potential, the scattering length and reflectance coefficient were calculated. It was concluded that in addition to the competition between the repulsive and attractive parts of both potentials, the imaginary part of the complex potential has an important effect on the properties of the system. The complex potential also reduces the reflectance probability via increasing the absorption probability. For all numerical computations, the parameters of a system including argon gas confined in graphite were considered.

  2. On the role of electronic friction for dissociative adsorption and scattering of hydrogen molecules at a Ru(0001) surface.

    PubMed

    Füchsel, Gernot; Schimka, Selina; Saalfrank, Peter

    2013-09-12

    The role of electronic friction and, more generally, of nonadiabatic effects during dynamical processes at the gas/metal surface interface is still a matter of discussion. In particular, it is not clear if electronic nonadiabaticity has an effect under "mild" conditions, when molecules in low rovibrational states interact with a metal surface. In this paper, we investigate the role of electronic friction on the dissociative sticking and (inelastic) scattering of vibrationally and rotationally cold H2 molecules at a Ru(0001) surface theoretically. For this purpose, classical molecular dynamics with electronic friction (MDEF) calculations are performed and compared to MD simulations without friction. The two H atoms move on a six-dimensional potential energy surface generated from gradient-corrected density functional theory (DFT), that is, all molecular degrees of freedom are accounted for. Electronic friction is included via atomic friction coefficients obtained from an embedded atom, free electron gas (FEG) model, with embedding densities taken from gradient-corrected DFT. We find that within this model, dissociative sticking probabilities as a function of impact kinetic energies and impact angles are hardly affected by nonadiabatic effects. If one accounts for a possibly enhanced electronic friction near the dissociation barrier, on the other hand, reduced sticking probabilities are observed, in particular, at high impact energies. Further, there is always an influence on inelastic scattering, in particular, as far as the translational and internal energy distribution of the reflected molecules is concerned. Additionally, our results shed light on the role played by the velocity distribution of the incident molecular beam for adsorption probabilities, where, in particular, at higher impact energies, large effects are found.

  3. WAXS fat subtraction model to estimate differential linear scattering coefficients of fatless breast tissue: Phantom materials evaluation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, Robert Y., E-mail: rx-tang@laurentian.ca; Laamanen, Curtis, E-mail: cx-laamanen@laurentian.ca; McDonald, Nancy, E-mail: mcdnancye@gmail.com

    Purpose: Develop a method to subtract fat tissue contributions to wide-angle x-ray scatter (WAXS) signals of breast biopsies in order to estimate the differential linear scattering coefficients μ{sub s} of fatless tissue. Cancerous and fibroglandular tissue can then be compared independent of fat content. In this work phantom materials with known compositions were used to test the efficacy of the WAXS subtraction model. Methods: Each sample 5 mm in diameter and 5 mm thick was interrogated by a 50 kV 2.7 mm diameter beam for 3 min. A 25 mm{sup 2} by 1 mm thick CdTe detector allowed measurements ofmore » a portion of the θ = 6° scattered field. A scatter technique provided means to estimate the incident spectrum N{sub 0}(E) needed in the calculations of μ{sub s}[x(E, θ)] where x is the momentum transfer argument. Values of μ{sup ¯}{sub s} for composite phantoms consisting of three plastic layers were estimated and compared to the values obtained via the sum μ{sup ¯}{sub s}{sup ∑}(x)=ν{sub 1}μ{sub s1}(x)+ν{sub 2}μ{sub s2}(x)+ν{sub 3}μ{sub s3}(x), where ν{sub i} is the fractional volume of the ith plastic component. Water, polystyrene, and a volume mixture of 0.6 water + 0.4 polystyrene labelled as fibphan were chosen to mimic cancer, fat, and fibroglandular tissue, respectively. A WAXS subtraction model was used to remove the polystyrene signal from tissue composite phantoms so that the μ{sub s} of water and fibphan could be estimated. Although the composite samples were layered, simulations were performed to test the models under nonlayered conditions. Results: The well known μ{sub s} signal of water was reproduced effectively between 0.5 < x < 1.6 nm{sup −1}. The μ{sup ¯}{sub s} obtained for the heterogeneous samples agreed with μ{sup ¯}{sub s}{sup ∑}. Polystyrene signals were subtracted successfully from composite phantoms. The simulations validated the usefulness of the WAXS models for nonlayered biopsies. Conclusions: The methodology to measure μ{sub s} of homogeneous samples was quantitatively accurate. Simple WAXS models predicted the probabilities for specific x-ray scattering to occur from heterogeneous biopsies. The fat subtraction model can allow μ{sub s} signals of breast cancer and fibroglandular tissue to be compared without the effects of fat provided there is an independent measurement of the fat volume fraction ν{sub f}. Future work will consist of devising a quantitative x-ray digital imaging method to estimate ν{sub f} in ex vivo breast samples.« less

  4. A new method for determining the mass ejected during the cometary outburst - Application to the Jupiter-family comets

    NASA Astrophysics Data System (ADS)

    Wesołowski, M.; Gronkowski, P.

    2018-07-01

    In the present article, we propose a new method of mass estimation which is ejected from a nucleus of a comet during its outburst of brightness. The phenomena of cometary outburst are often reported for both periodic and parabolic comets. The outburst of a comet brightness is a sudden increase in its brightness greater than one magnitude, average by 2-5 mag. This should not be confused with explosions such as outbreak of a bomb. The essence of the phenomenon is only a sudden brightening of the comet. Long-term observations and studies of this phenomenon lead to the conclusion that the very probable direct cause of the many outbursts is the ejection of the some part of surface layer of a comet's nucleus and an increase in the rate of a sublimation (Hughes (1990), Gronkowski (2007), Gronkowski and Wesołowski (2015)). The purpose of this article is presentation of a new simple method of the estimation of the mass which is ejected from the comet's nucleus during considered phenomenon. To estimate the mass released during an outburst, different probable coefficients of extinction for cometary matter was assumed. The scattering cross-sections of cometary grains were precisely calculated on the basis of Mie's theory. This method was applied to the outburst of a hypothetical comet X/PC belonging to the Jupiter-family comets and to the case of the comet 17P/Holmes outburst in 2007.

  5. A two-scale scattering model with application to the JONSWAP '75 aircraft microwave scatterometer experiment

    NASA Technical Reports Server (NTRS)

    Wentz, F. J.

    1977-01-01

    The general problem of bistatic scattering from a two scale surface was evaluated. The treatment was entirely two-dimensional and in a vector formulation independent of any particular coordinate system. The two scale scattering model was then applied to backscattering from the sea surface. In particular, the model was used in conjunction with the JONSWAP 1975 aircraft scatterometer measurements to determine the sea surface's two scale roughness distributions, namely the probability density of the large scale surface slope and the capillary wavenumber spectrum. Best fits yield, on the average, a 0.7 dB rms difference between the model computations and the vertical polarization measurements of the normalized radar cross section. Correlations between the distribution parameters and the wind speed were established from linear, least squares regressions.

  6. A compound scattering pdf for the ultrasonic echo envelope and its relationship to K and Nakagami distributions.

    PubMed

    Shankar, P Mohana

    2003-03-01

    A compound probability density function (pdf) is presented to describe the envelope of the backscattered echo from tissue. This pdf allows local and global variation in scattering cross sections in tissue. The ultrasonic backscattering cross sections are assumed to be gamma distributed. The gamma distribution also is used to model the randomness in the average cross sections. This gamma-gamma model results in the compound scattering pdf for the envelope. The relationship of this compound pdf to the Rayleigh, K, and Nakagami distributions is explored through an analysis of the signal-to-noise ratio of the envelopes and random number simulations. The three parameter compound pdf appears to be flexible enough to represent envelope statistics giving rise to Rayleigh, K, and Nakagami distributions.

  7. Light in condensed matter in the upper atmosphere as the origin of homochirality: circularly polarized light from Rydberg matter.

    PubMed

    Holmlid, Leif

    2009-01-01

    Clouds of the condensed excited Rydberg matter (RM) exist in the atmospheres of comets and planetary bodies (most easily observed at Mercury and the Moon), where they surround the entire bodies. Vast such clouds are recently proposed to exist in the upper atmosphere of Earth (giving rise to the enormous features called noctilucent clouds, polar mesospheric clouds, and polar mesospheric summer radar echoes). It has been shown in experiments with RM that linearly polarized visible light scattered from an RM layer is transformed to circularly polarized light with a probability of approximately 50%. The circular Rydberg electrons in the magnetic field in the RM may be chiral scatterers. The magnetic and anisotropic RM medium acts as a circular polarizer probably by delaying one of the perpendicular components of the light wave. The delay process involved is called Rabi-flopping and gives delays of the order of femtoseconds. This strong effect thus gives intense circularly polarized visible and UV light within RM clouds. Amino acids and other chiral molecules will experience a strong interaction with this light field in the upper atmospheres of planets. The interaction will vary with the stereogenic conformation of the molecules and in all probability promote the survival of one enantiomer. Here, this strong effect is proposed to be the origin of homochirality. The formation of amino acids in the RM clouds is probably facilitated by the catalytic effect of RM.

  8. Light in Condensed Matter in the Upper Atmosphere as the Origin of Homochirality: Circularly Polarized Light from Rydberg Matter

    NASA Astrophysics Data System (ADS)

    Holmlid, Leif

    2009-08-01

    Clouds of the condensed excited Rydberg matter (RM) exist in the atmospheres of comets and planetary bodies (most easily observed at Mercury and the Moon), where they surround the entire bodies. Vast such clouds are recently proposed to exist in the upper atmosphere of Earth (giving rise to the enormous features called noctilucent clouds, polar mesospheric clouds, and polar mesospheric summer radar echoes). It has been shown in experiments with RM that linearly polarized visible light scattered from an RM layer is transformed to circularly polarized light with a probability of approximately 50%. The circular Rydberg electrons in the magnetic field in the RM may be chiral scatterers. The magnetic and anisotropic RM medium acts as a circular polarizer probably by delaying one of the perpendicular components of the light wave. The delay process involved is called Rabi-flopping and gives delays of the order of femtoseconds. This strong effect thus gives intense circularly polarized visible and UV light within RM clouds. Amino acids and other chiral molecules will experience a strong interaction with this light field in the upper atmospheres of planets. The interaction will vary with the stereogenic conformation of the molecules and in all probability promote the survival of one enantiomer. Here, this strong effect is proposed to be the origin of homochirality. The formation of amino acids in the RM clouds is probably facilitated by the catalytic effect of RM.

  9. Analysis of hyperspectral scattering images using a moment method for apple firmness prediction

    USDA-ARS?s Scientific Manuscript database

    This article reports on using a moment method to extract features from the hyperspectral scattering profiles for apple fruit firmness prediction. Hyperspectral scattering images between 500 nm and 1000 nm were acquired online, using a hyperspectral scattering system, for ‘Golden Delicious’, ’Jonagol...

  10. Fast implementations of reconstruction-based scatter compensation in fully 3D SPECT image reconstruction

    NASA Astrophysics Data System (ADS)

    Kadrmas, Dan J.; Frey, Eric C.; Karimi, Seemeen S.; Tsui, Benjamin M. W.

    1998-04-01

    Accurate scatter compensation in SPECT can be performed by modelling the scatter response function during the reconstruction process. This method is called reconstruction-based scatter compensation (RBSC). It has been shown that RBSC has a number of advantages over other methods of compensating for scatter, but using RBSC for fully 3D compensation has resulted in prohibitively long reconstruction times. In this work we propose two new methods that can be used in conjunction with existing methods to achieve marked reductions in RBSC reconstruction times. The first method, coarse-grid scatter modelling, significantly accelerates the scatter model by exploiting the fact that scatter is dominated by low-frequency information. The second method, intermittent RBSC, further accelerates the reconstruction process by limiting the number of iterations during which scatter is modelled. The fast implementations were evaluated using a Monte Carlo simulated experiment of the 3D MCAT phantom with tracer, and also using experimentally acquired data with tracer. Results indicated that these fast methods can reconstruct, with fully 3D compensation, images very similar to those obtained using standard RBSC methods, and in reconstruction times that are an order of magnitude shorter. Using these methods, fully 3D iterative reconstruction with RBSC can be performed well within the realm of clinically realistic times (under 10 minutes for image reconstruction).

  11. SEC proton prediction model: verification and analysis.

    PubMed

    Balch, C C

    1999-06-01

    This paper describes a model that has been used at the NOAA Space Environment Center since the early 1970s as a guide for the prediction of solar energetic particle events. The algorithms for proton event probability, peak flux, and rise time are described. The predictions are compared with observations. The current model shows some ability to distinguish between proton event associated flares and flares that are not associated with proton events. The comparisons of predicted and observed peak flux show considerable scatter, with an rms error of almost an order of magnitude. Rise time comparisons also show scatter, with an rms error of approximately 28 h. The model algorithms are analyzed using historical data and improvements are suggested. Implementation of the algorithm modifications reduces the rms error in the log10 of the flux prediction by 21%, and the rise time rms error by 31%. Improvements are also realized in the probability prediction by deriving the conditional climatology for proton event occurrence given flare characteristics.

  12. Measurement of Two- and Three-Nucleon Short-Range Correlation Probabilities in Nuclei

    NASA Astrophysics Data System (ADS)

    Egiyan, K. S.; Dashyan, N. B.; Sargsian, M. M.; Strikman, M. I.; Weinstein, L. B.; Adams, G.; Ambrozewicz, P.; Anghinolfi, M.; Asavapibhop, B.; Asryan, G.; Avakian, H.; Baghdasaryan, H.; Baillie, N.; Ball, J. P.; Baltzell, N. A.; Batourine, V.; Battaglieri, M.; Bedlinskiy, I.; Bektasoglu, M.; Bellis, M.; Benmouna, N.; Biselli, A. S.; Bonner, B. E.; Bouchigny, S.; Boiarinov, S.; Bradford, R.; Branford, D.; Brooks, W. K.; Bültmann, S.; Burkert, V. D.; Bultuceanu, C.; Calarco, J. R.; Careccia, S. L.; Carman, D. S.; Carnahan, B.; Chen, S.; Cole, P. L.; Coltharp, P.; Corvisiero, P.; Crabb, D.; Crannell, H.; Cummings, J. P.; Sanctis, E. De; Devita, R.; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Dharmawardane, K. V.; Djalali, C.; Dodge, G. E.; Donnelly, J.; Doughty, D.; Dragovitsch, P.; Dugger, M.; Dytman, S.; Dzyubak, O. P.; Egiyan, H.; Elouadrhiri, L.; Empl, A.; Eugenio, P.; Fatemi, R.; Fedotov, G.; Feuerbach, R. J.; Forest, T. A.; Funsten, H.; Gavalian, G.; Gevorgyan, N. G.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guillo, M.; Guler, N.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hardie, J.; Hersman, F. W.; Hicks, K.; Hleiqawi, I.; Holtrop, M.; Hu, J.; Huertas, M.; Hyde-Wright, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Ito, M. M.; Jenkins, D.; Jo, H. S.; Joo, K.; Juengst, H. G.; Kellie, J. D.; Khandaker, M.; Kim, K. Y.; Kim, K.; Kim, W.; Klein, A.; Klein, F. J.; Klimenko, A.; Klusman, M.; Kramer, L. H.; Kubarovsky, V.; Kuhn, J.; Kuhn, S. E.; Kuleshov, S.; Lachniet, J.; Laget, J. M.; Langheinrich, J.; Lawrence, D.; Lee, T.; Livingston, K.; Maximon, L. C.; McAleer, S.; McKinnon, B.; McNabb, J. W.; Mecking, B. A.; Mestayer, M. D.; Meyer, C. A.; Mibe, T.; Mikhailov, K.; Minehart, R.; Mirazita, M.; Miskimen, R.; Mokeev, V.; Morrow, S. A.; Mueller, J.; Mutchler, G. S.; Nadel-Turonski, P.; Napolitano, J.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niyazov, R. A.; O'Rielly, G. V.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Peterson, C.; Pierce, J.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Polli, E.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Prok, Y.; Protopopescu, D.; Qin, L. M.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Ritchie, B. G.; Ronchetti, F.; Rosner, G.; Rossi, P.; Rowntree, D.; Rubin, P. D.; Sabatié, F.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Schumacher, R. A.; Serov, V. S.; Sharabian, Y. G.; Shaw, J.; Smith, E. S.; Smith, L. C.; Sober, D. I.; Stavinsky, A.; Stepanyan, S.; Stokes, B. E.; Stoler, P.; Strauch, S.; Suleiman, R.; Taiuti, M.; Taylor, S.; Tedeschi, D. J.; Thompson, R.; Tkabladze, A.; Tkachenko, S.; Todor, L.; Tur, C.; Ungaro, M.; Vineyard, M. F.; Vlassov, A. V.; Weygand, D. P.; Williams, M.; Wolin, E.; Wood, M. H.; Yegneswaran, A.; Yun, J.; Zana, L.; Zhang, J.

    2006-03-01

    The ratios of inclusive electron scattering cross sections of 4He, 12C, and 56Fe to 3He have been measured at 11.4 GeV2, the ratios exhibit two separate plateaus, at 1.52.25. This pattern is predicted by models that include 2- and 3-nucleon short-range correlations (SRC). Relative to A=3, the per-nucleon probabilities of 3-nucleon SRC are 2.3, 3.1, and 4.4 times larger for A=4, 12, and 56. This is the first measurement of 3-nucleon SRC probabilities in nuclei.

  13. Calculation of far-field scattering from nonspherical particles using a geometrical optics approach

    NASA Technical Reports Server (NTRS)

    Hovenac, Edward A.

    1991-01-01

    A numerical method was developed using geometrical optics to predict far-field optical scattering from particles that are symmetric about the optic axis. The diffractive component of scattering is calculated and combined with the reflective and refractive components to give the total scattering pattern. The phase terms of the scattered light are calculated as well. Verification of the method was achieved by assuming a spherical particle and comparing the results to Mie scattering theory. Agreement with the Mie theory was excellent in the forward-scattering direction. However, small-amplitude oscillations near the rainbow regions were not observed using the numerical method. Numerical data from spheroidal particles and hemispherical particles are also presented. The use of hemispherical particles as a calibration standard for intensity-type optical particle-sizing instruments is discussed.

  14. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto

    DOEpatents

    Bond, Tiziana C.; Miles, Robin; Davidson, James C.; Liu, Gang Logan

    2014-07-22

    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  15. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto

    DOEpatents

    Bond, Tiziana C.; Miles, Robin; Davidson, James C.; Liu, Gang Logan

    2015-07-14

    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  16. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto

    DOEpatents

    Bond, Tiziana C; Miles, Robin; Davidson, James; Liu, Gang Logan

    2015-11-03

    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  17. On Modeling Air/Space-Borne Radar Returns in the Melting Layer

    NASA Technical Reports Server (NTRS)

    Liao, Liang; Meneghini, Robert

    2005-01-01

    The bright band is the enhanced radar echo associated with the melting of hydrometeors in stratiform rain where the melting process usually occurs below 0 C isotherm over a distance of about 500m. To simulate this radar signature, a scattering model of melting snow is proposed in which the fractional water content is prescribed as a function of the radius of a spherical mixed- phase particle consisting of air, ice and water. The model is based on the observation that melting starts at the surface of the particle and then gradually develops towards the center. To compute the scattering parameters of a non-uniform melting particle, the particle is modeled as a sphere represented by a collection of 64(exp 3) cubic cells of identical size where the probability of water at any cell is prescribed as a function of the radius. The internal field of the particle, used for deriving the effective dielectric constant, is computed by the Conjugate Gradient and Fast Fourier Transform (CGFFT) numerical methods. To make computations of the scattering parameters more efficient, a multi-layer stratified-sphere scattering model is introduced after demonstrating that the scattering parameters of the non-uniformly melting particle can be accurately reproduced by the stratified sphere. In conjunction with a melting layer model that describes the melting fractions and fall velocities of hydrometeors as a function of the distance from the 0 C isotherm, the stratified-sphere model is used to simulate the radar bright band profiles. These simulated profiles are shown to compare well with measurements from the Precipitation Radar (PR) aboard the Tropical Rainfall Measuring Mission (TRMM) satellite and a dual-wavelength airborne radar. The results suggest that the proposed model of a melting snow particle may be useful in studying the characteristics of the bright-band in particular and mixed- phase hydrometeors in general.

  18. Enhanced dye-sensitized solar cells performance using anatase TiO2 mesocrystals with the Wulff construction of nearly 100% exposed {101} facets as effective light scattering layer.

    PubMed

    Zhou, Yu; Wang, Xinyu; Wang, Hai; Song, Yeping; Fang, Liang; Ye, Naiqing; Wang, Linjiang

    2014-03-28

    Anatase TiO2 mesocrystals with a Wulff construction of nearly 100% exposed {101} facets were successfully synthesized by a facile, green solvothermal method. Their morphology, and crystal structure are characterized by powder X-ray diffraction (XRD), Field emission scanning electron microscopy (FESEM) and high-resolution transmission electron microscopy (HRTEM). Accordingly, a possible growth mechanism of anatase TiO2 mesocrystals is elucidated in this work. The as-prepared single anatase TiO2 mesocrystal's mean center diameter is about 500 nm, and the length is about 1 μm. They exhibit high light adsorbance, high reflectance and low transmittance in the visible region due to the unique nearly 100% exposed {101} facets. When utilized as the scattering layer in dye-sensitized solar cells (DSSCs), such mesocrystals effectively enhanced light harvesting and led to an increase of the photocurrent of the DSSCs. As a result, by using an anatase TiO2 mesocrystal film as a scattering overlayer of a compact commercial P25 TiO2 nanoparticle film, the double layered DSSCs show a power conversion efficiency of 7.23%, indicating a great improvement compared to the DSSCs based on a P25 film (5.39%) and anatase TiO2 mesocrystal films, respectively. The synergetic effect of P25 and the mesocrystals as well as the latters unique feature of a Wulff construction of nearly 100% exposed (101) facets are probably responsible for the enhanced photoelectrical performance. In particular, we explore the possibility of the low surface area and exposed {101} facets as an efficient light scattering layer of DSSCs. Our work suggests that anatase TiO2 mesocrystals with the Wulff construction is a promising candidate as a superior scattering material for high-performance DSSCs.

  19. The effect of dissipative inhomogeneous medium on the statistics of the wave intensity

    NASA Technical Reports Server (NTRS)

    Saatchi, Sasan S.

    1993-01-01

    One of the main theoretical points in the theory of wave propagation in random medium is the derivation of closed form equations to describe the statistics of the propagating waves. In particular, in one dimensional problems, the closed form representation of the multiple scattering effects is important since it contributes in understanding such problems like wave localization, backscattering enhancement, and intensity fluctuations. In this the propagation of plane waves in a layer of one-dimensional dissipative random medium is considered. The medium is modeled by a complex permittivity whose real part is a constant representing the absorption. The one dimensional problem is mathematically equivalent to the analysis of a transmission line with randomly perturbed distributed parameters and a single mode lossy waveguide and the results can be used to study the propagation of radio waves through atmosphere and the remote sensing of geophysical media. It is assumed the scattering medium consists of an ensemble of one-dimensional point scatterers randomly positioned in a layer of thickness L with diffuse boundaries. A Poisson impulse process with density lambda is used to model the position of scatterers in the medium. By employing the Markov properties of this process an exact closed form equation of Kolmogorov-Feller type was obtained for the probability density of the reflection coefficient. This equation was solved by combining two limiting cases: (1) when the density of scatterers is small; and (2) when the medium is weakly dissipative. A two variable perturbation method for small lambda was used to obtain solutions valid for thick layers. These solutions are then asymptotically evaluated for small dissipation. To show the effect of dissipation, the mean and fluctuations of the reflected power are obtained. The results were compared with a lossy homogeneous medium and with a lossless inhomogeneous medium and the regions where the effect of absorption is not essential were discussed.

  20. a Study of the Concentration Dependence of Macromolecular Diffusion Using Photon Correlation Spectroscopy.

    NASA Astrophysics Data System (ADS)

    Marlowe, Robert Lloyd

    The dynamic light scattering technique of photon correlation spectroscopy has been used to investigate the dependence of the mutual diffusion coefficient of a macromolecular system upon concentration. The first part of the research was devoted to the design and construction of a single-clipping autocorrelator based on newly-developed integrated circuits. The resulting 128 channel instrument can perform real time autocorrelation for sample time intervals >(, )10 (mu)s, and batch processed autocorrelation for intervals down to 3 (mu)s. An improved design for a newer, all-digital autocorrelator is given. Homodyne light scattering experiments were then undertaken on monodisperse solutions of polystyrene spheres. The single-mode TEM(,oo) beam of an argon-ion laser ((lamda) = 5145 (ANGSTROM)) was used as the light source; all solutions were studied at room temperature. The scattering angle was varied from 30(DEGREES) to 110(DEGREES). Excellent agreement with the manufacturer's specification for the particle size was obtained from the photon correlation studies. Finally, aqueous solutions of the globular protein ovalbumin, ranging in concentration from 18.9 to 244.3 mg/ml, were illuminated under the same conditions of temperature and wavelength as before; the homodyne scattered light was detected at a fixed scattering angle of 30(DEGREES). The single-clipped photocount autocorrelation function was analyzed using the homodyne exponential integral method of Meneely et al. The resulting diffusion coefficients showed a general linear dependence upon concentration, as predicted by the generalized Stokes-Einstein equation. However, a clear peak in the data was evident at c (TURNEQ) 100 mg/ml, which could not be explained on the basis of a non -interacting particle theory. A semi-quantitative approach based on the Debye-Huckel theory of electrostatic interactions is suggested as the probable cause for the peak's rise, and an excluded volume effect for its decline.

  1. Optimization of surface morphology and scattering properties of TCO/AIT textured glass front electrode for thin film solar cells

    NASA Astrophysics Data System (ADS)

    Addonizio, M. L.; Fusco, L.; Antonaia, A.; Cominale, F.; Usatii, I.

    2015-12-01

    Aluminium induced texture (AIT) method has been used for obtaining highly textured glass substrate suitable for silicon based thin film solar cell technology. Wet etch step parameters of AIT process have been varied and effect of different etchants and different etching times on morphological and optical properties has been analyzed. The resulting morphology features (shape, size distribution, inclination angle) have been optimized in order to obtain the best scattering properties. ZnO:Ga (GZO) films have been deposited by sputtering technique on AIT-processed glass. Two different ZnO surface morphologies have been obtained, strongly depending on the underlying glass substrate morphology induced by different etching times. Very rough and porous texture (σrms ∼ 150 nm) was obtained on glass etched 2 min showing cauliflower-like structure, whereas a softer texture (σrms ∼ 78 nm) was obtained on glass etched 7 min giving wider and smoother U-shaped craters. The effect of different glass textures on optical confinement has been tested in amorphous silicon based p-i-n devices. Devices fabricated on GZO/high textured glass showed a quantum efficiency enhancement due to both an effective light trapping phenomenon and an effective anti-reflective optical behaviour. Short etching time produce smaller cavities (<1 μm) with deep U-shape characterized by high roughness, high inclination angle and low autocorrelation length. This surface morphology promoted a large light scattering phenomenon, as evidenced by haze value and by angular resolved scattering (ARS) behaviour, into a large range of diffraction angles, giving high probability of effective light trapping inside a PV device.

  2. Stochastic parameterization for light absorption by internally mixed BC/dust in snow grains for application to climate models

    NASA Astrophysics Data System (ADS)

    Liou, K. N.; Takano, Y.; He, C.; Yang, P.; Leung, L. R.; Gu, Y.; Lee, W. L.

    2014-06-01

    A stochastic approach has been developed to model the positions of BC (black carbon)/dust internally mixed with two snow grain types: hexagonal plate/column (convex) and Koch snowflake (concave). Subsequently, light absorption and scattering analysis can be followed by means of an improved geometric-optics approach coupled with Monte Carlo photon tracing to determine BC/dust single-scattering properties. For a given shape (plate, Koch snowflake, spheroid, or sphere), the action of internal mixing absorbs substantially more light than external mixing. The snow grain shape effect on absorption is relatively small, but its effect on asymmetry factor is substantial. Due to a greater probability of intercepting photons, multiple inclusions of BC/dust exhibit a larger absorption than an equal-volume single inclusion. The spectral absorption (0.2-5 µm) for snow grains internally mixed with BC/dust is confined to wavelengths shorter than about 1.4 µm, beyond which ice absorption predominates. Based on the single-scattering properties determined from stochastic and light absorption parameterizations and using the adding/doubling method for spectral radiative transfer, we find that internal mixing reduces snow albedo substantially more than external mixing and that the snow grain shape plays a critical role in snow albedo calculations through its forward scattering strength. Also, multiple inclusion of BC/dust significantly reduces snow albedo as compared to an equal-volume single sphere. For application to land/snow models, we propose a two-layer spectral snow parameterization involving contaminated fresh snow on top of old snow for investigating and understanding the climatic impact of multiple BC/dust internal mixing associated with snow grain metamorphism, particularly over mountain/snow topography.

  3. Detective quantum efficiency of photon-counting x-ray detectors.

    PubMed

    Tanguay, Jesse; Yun, Seungman; Kim, Ho Kyung; Cunningham, Ian A

    2015-01-01

    Single-photon-counting (SPC) x-ray imaging has the potential to improve image quality and enable novel energy-dependent imaging methods. Similar to conventional detectors, optimizing image SPC quality will require systems that produce the highest possible detective quantum efficiency (DQE). This paper builds on the cascaded-systems analysis (CSA) framework to develop a comprehensive description of the DQE of SPC detectors that implement adaptive binning. The DQE of SPC systems can be described using the CSA approach by propagating the probability density function (PDF) of the number of image-forming quanta through simple quantum processes. New relationships are developed to describe PDF transfer through serial and parallel cascades to accommodate scatter reabsorption. Results are applied to hypothetical silicon and selenium-based flat-panel SPC detectors including the effects of reabsorption of characteristic/scatter photons from photoelectric and Compton interactions, stochastic conversion of x-ray energy to secondary quanta, depth-dependent charge collection, and electronic noise. Results are compared with a Monte Carlo study. Depth-dependent collection efficiency can result in substantial broadening of photopeaks that in turn may result in reduced DQE at lower x-ray energies (20-45 keV). Double-counting interaction events caused by reabsorption of characteristic/scatter photons may result in falsely inflated image signal-to-noise ratio and potential overestimation of the DQE. The CSA approach is extended to describe signal and noise propagation through photoelectric and Compton interactions in SPC detectors, including the effects of escape and reabsorption of emission/scatter photons. High-performance SPC systems can be achieved but only for certain combinations of secondary conversion gain, depth-dependent collection efficiency, electronic noise, and reabsorption characteristics.

  4. Fluorine atom abstraction by Si(100). I. Experimental

    NASA Astrophysics Data System (ADS)

    Tate, M. R.; Gosalvez-Blanco, D.; Pullman, D. P.; Tsekouras, A. A.; Li, Y. L.; Yang, J. J.; Laughlin, K. B.; Eckman, S. C.; Bertino, M. F.; Ceyer, S. T.

    1999-08-01

    In the interaction of low energy F2 with Si(100) at 250 K, a dissociative chemisorption mechanism called atom abstraction is identified in which only one of the F atoms is adsorbed while the other F atom is scattered into the gas phase. The dynamics of atom abstraction are characterized via time-of-flight measurements of the scattered F atoms. The F atoms are translationally hyperthermal but only carry a small fraction (˜3%) of the tremendous exothermicity of the reaction. The angular distribution of F atoms is unusually broad for the product of an exothermic reaction. These results suggest an "attractive" interaction potential between F2 and the Si dangling bond with a transition state that is not constrained geometrically. These results are in disagreement with the results of theoretical investigations implying that the available potential energy surfaces are inadequate to describe the dynamics of this gas-surface interaction. In addition to single atom abstraction, two atom adsorption, a mechanism analogous to classic dissociative chemisorption in which both F atoms are adsorbed onto the surface, is also observed. The absolute probability of the three scattering channels (single atom abstraction, two atom adsorption, and unreactive scattering) for an incident F2 are determined as a function of F2 exposure. The fluorine coverage is determined by integrating the reaction probabilities over F2 exposure, and the reaction probabilities are recast as a function of fluorine coverage. Two atom adsorption is the dominant channel [P2=0.83±0.03(95%, N=9)] in the limit of zero coverage and decays monotonically to zero. Single atom abstraction is the minor channel (P1=0.13±0.03) at low coverage but increases to a maximum (P1=0.35±0.08) at about 0.5 monolayer (ML) coverage before decaying to zero. The reaction ceases at 0.94±0.11(95%, N=9) ML. Thermal desorption and helium diffraction confirm that the dangling bonds are the abstraction and adsorption sites. No Si lattice bonds are broken, in contrast to speculation by other investigators that the reaction exothermicity causes lattice disorder.

  5. Inverse scattering pre-stack depth imaging and it's comparison to some depth migration methods for imaging rich fault complex structure

    NASA Astrophysics Data System (ADS)

    Nurhandoko, Bagus Endar B.; Sukmana, Indriani; Mubarok, Syahrul; Deny, Agus; Widowati, Sri; Kurniadi, Rizal

    2012-06-01

    Migration is important issue for seismic imaging in complex structure. In this decade, depth imaging becomes important tools for producing accurate image in depth imaging instead of time domain imaging. The challenge of depth migration method, however, is in revealing the complex structure of subsurface. There are many methods of depth migration with their advantages and weaknesses. In this paper, we show our propose method of pre-stack depth migration based on time domain inverse scattering wave equation. Hopefully this method can be as solution for imaging complex structure in Indonesia, especially in rich thrusting fault zones. In this research, we develop a recent advance wave equation migration based on time domain inverse scattering wave which use more natural wave propagation using scattering wave. This wave equation pre-stack depth migration use time domain inverse scattering wave equation based on Helmholtz equation. To provide true amplitude recovery, an inverse of divergence procedure and recovering transmission loss are considered of pre-stack migration. Benchmarking the propose inverse scattering pre-stack depth migration with the other migration methods are also presented, i.e.: wave equation pre-stack depth migration, waveequation depth migration, and pre-stack time migration method. This inverse scattering pre-stack depth migration could image successfully the rich fault zone which consist extremely dip and resulting superior quality of seismic image. The image quality of inverse scattering migration is much better than the others migration methods.

  6. Vibrational energy transfer near a dissociative adsorption transition state: State-to-state study of HCl collisions at Au(111).

    PubMed

    Geweke, Jan; Shirhatti, Pranav R; Rahinov, Igor; Bartels, Christof; Wodtke, Alec M

    2016-08-07

    In this work we seek to examine the nature of collisional energy transfer between HCl and Au(111) for nonreactive scattering events that sample geometries near the transition state for dissociative adsorption by varying both the vibrational and translational energy of the incident HCl molecules in the range near the dissociation barrier. Specifically, we report absolute vibrational excitation probabilities for HCl(v = 0 → 1) and HCl(v = 1 → 2) scattering from clean Au(111) as a function of surface temperature and incidence translational energy. The HCl(v = 2 → 3) channel could not be observed-presumably due to the onset of dissociation. The excitation probabilities can be decomposed into adiabatic and nonadiabatic contributions. We find that both contributions strongly increase with incidence vibrational state by a factor of 24 and 9, respectively. This suggests that V-T as well as V-EHP coupling can be enhanced near the transition state for dissociative adsorption at a metal surface. We also show that previously reported HCl(v = 0 → 1) excitation probabilities [Q. Ran et al., Phys. Rev. Lett. 98, 237601 (2007)]-50 times smaller than those reported here-were influenced by erroneous assignment of spectroscopic lines used in the data analysis.

  7. Estimation of scattering object characteristics for image reconstruction using a nonzero background.

    PubMed

    Jin, Jing; Astheimer, Jeffrey; Waag, Robert

    2010-06-01

    Two methods are described to estimate the boundary of a 2-D penetrable object and the average sound speed in the object. One method is for circular objects centered in the coordinate system of the scattering observation. This method uses an orthogonal function expansion for the scattering. The other method is for noncircular, essentially convex objects. This method uses cross correlation to obtain time differences that determine a family of parabolas whose envelope is the boundary of the object. A curve-fitting method and a phase-based method are described to estimate and correct the offset of an uncentered radial or elliptical object. A method based on the extinction theorem is described to estimate absorption in the object. The methods are applied to calculated scattering from a circular object with an offset and to measured scattering from an offset noncircular object. The results show that the estimated boundaries, sound speeds, and absorption slopes agree very well with independently measured or true values when the assumptions of the methods are reasonably satisfied.

  8. A novel method to extract dark matter parameters from neutrino telescope data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Esmaili, Arman; Farzan, Yasaman, E-mail: arman@ipm.ir, E-mail: yasaman@theory.ipm.ac.ir

    2011-04-01

    Recently it has been shown that when the Dark Matter (DM) particles captured in the Sun directly annihilate into neutrino pairs, the oscillatory terms in the oscillation probability do not average to zero and can lead to a seasonal variation as the distance between the Sun and Earth changes in time. In this paper, we explore this feature as a novel method to extract information on the properties of dark matter. We show that by studying the variation of the flux over a few months, it would in principle be possible to derive the DM mass as well as newmore » information on the flavor structure of the DM annihilation modes. In addition to analytic analysis, we present the results of our numerical calculations that take into account scattering and regeneration of neutrinos traversing the Sun.« less

  9. Light-extraction efficiency and forward voltage in GaN-based light-emitting diodes with different patterns of V-shaped pits

    NASA Astrophysics Data System (ADS)

    Wang, Min-Shuai; Huang, Xiao-Jing

    2013-08-01

    We present a new method of making a textured V-pit surface for improving the light extraction efficiency in GaN-based light-emitting diodes and compare it with the usual low-temperature method for p-GaN V-pits. Three types of GaN-based light-emitting diodes (LEDs) with surface V-pits in different densities and regions were grown by metal—organic chemical vapor deposition. We achieved the highest output power and lowest forward voltage values with the p-InGaN V-pit LED. The V-pits enhanced the light output power values by 1.45 times the values of the conventional LED owing to an enhancement of the light scattering probability and an effective reduction of Mg-acceptor activation energy. Moreover, this new technique effectively solved the higher forward voltage problem of the usual V-pit LED.

  10. Solar Wind Halo Formation by the Scattering of the Strahl via Direct Cluster/PEACE Observations of the 3D Velocity Distribution Function

    NASA Technical Reports Server (NTRS)

    Figueroa-Vinas, Adolfo; Gurgiolo, Chris A.; Nieves-Chinchilla, Teresa; Goldstein, Melvyn L.

    2010-01-01

    It has been suggested by a number of authors that the solar wind electron halo can be formed by the scattering of the strahl. On frequent occasions we have observed in electron angular skymaps (Phi/Theta-plots) of the electron 3D velocity distribution functions) a bursty-filament of particles connecting the strahl to the solar wind core-halo. These are seen over a very limited energy range. When the magnetic field is well off the nominal solar wind flow direction such filaments are inconsistent with any local forces and are probably the result of strong scattering. Furthermore, observations indicates that the strahl component is frequently and significantly anisotropic (Tper/Tpal approx.2). This provides a possible free energy source for the excitation of whistler waves as a possible scattering mechanism. The empirical observational evidence between the halo and the strahl suggests that the strahl population may be, at least in part, the source of the halo component.

  11. Prediction of Spin-Polarization Effects in Quantum Wire Transport

    NASA Astrophysics Data System (ADS)

    Fasol, Gerhard; Sakaki, Hiroyuki

    1994-01-01

    We predict a new effect for transport in quantum wires: spontaneous spin polarization. Most work on transport in mesoscopic devices has assumed a model of non interacting, spin-free electrons. We introduce spin, electron pair scattering and microscopic crystal properties into the design of mesoscopic devices. The new spin polarization effect results from the fact that in a single mode quantum wire, electron and hole bands still have two spin subbands. In general, these two spin subbands are expected to be split even in zero magnetic field. At sufficiently low temperatures the electron pair scattering rates for one spin subband ( e.g., the spin-down) can be much larger than for the other spin subband. This effect can be used for an active spin polarizer device: hot electrons in one subband ( e.g., `spin up') pass with weak pair scattering, while electrons in the opposite subband ( e.g., `spin down'), have high probability of scattering into the `spin-up' subband, resulting in spin polarization of a hot electron beam.

  12. An initial analysis of short- and medium-range correlations potential non-Pt catalysts in CoNx

    NASA Astrophysics Data System (ADS)

    Peterson, Joe

    2009-10-01

    A potential show stopper for the development of fuel cells for the commercial automotive industry is the design of low-cost catalysts. The best catalysts are based on platinum, which is a rare and expensive noble metal. Our group has been involved in the characterization of potential materials for non-Pt catalysts. In this presentation, I will present some preliminary neutron scattering data from a nanocrystalline powder sample of CoNx. It is apparent that the diffraction data cannot be analyzed with standard Riedveld refinement, and we have to invoke pair distribution function (PDF) analysis. The PDF provides insight into short-range correlations, as it measures the probabilities of short- and mid-range interatomic distances in a material. The analysis reveals a strong incoherent scattering response, which is indicative of the presence of hydrogen in the sample. After correcting for the incoherent scattering, one obtains the normalized scattering function S(Q), whose Fourier transform yields the PDF.

  13. An initial analysis of short- and medium-range correlations potential non-Pt catalysts in CoNx

    NASA Astrophysics Data System (ADS)

    Peterson, Joe

    2010-03-01

    A potential show stopper for the development of fuel cells for the commercial automotive industry is the design of low-cost catalysts. The best catalysts are based on platinum, which is a rare and expensive noble metal. Our group has been involved in the characterization of potential materials for non-Pt catalysts. In this presentation, I will present some preliminary neutron scattering data from a nanocrystalline powder sample of CoNx. It is apparent that the diffraction data cannot be analyzed with standard Riedveld refinement, and we have to invoke pair distribution function (PDF) analysis. The PDF provides insight into short-range correlations, as it measures the probabilities of short- and mid-range interatomic distances in a material. The analysis reveals a strong incoherent scattering response, which is indicative of the presence of hydrogen in the sample. After correcting for the incoherent scattering, one obtains the normalized scattering function S(Q), whose Fourier transform yields the PDF.

  14. Irradiance attenuation coefficient in a stratified ocean - A local property of the medium

    NASA Technical Reports Server (NTRS)

    Gordon, H. R.

    1980-01-01

    The influence of optically important constituents of water on the absorption (a) and scattering (b) coefficients and the backscattering probability is considered, with emphasis placed on measuring the volume scattering function (B/theta/). Two stratification models are examined; one in which the phase function (B(theta)/b) is depth independent and only b/c is allowed to vary with optical depth, and the other in which both b/c and the phase function depend on depth. The results demonstrate that Gordon's (1977) technique of estimating a and b is applicable without change to a stratified ocean.

  15. A Practical Cone-beam CT Scatter Correction Method with Optimized Monte Carlo Simulations for Image-Guided Radiation Therapy

    PubMed Central

    Xu, Yuan; Bai, Ti; Yan, Hao; Ouyang, Luo; Pompos, Arnold; Wang, Jing; Zhou, Linghong; Jiang, Steve B.; Jia, Xun

    2015-01-01

    Cone-beam CT (CBCT) has become the standard image guidance tool for patient setup in image-guided radiation therapy. However, due to its large illumination field, scattered photons severely degrade its image quality. While kernel-based scatter correction methods have been used routinely in the clinic, it is still desirable to develop Monte Carlo (MC) simulation-based methods due to their accuracy. However, the high computational burden of the MC method has prevented routine clinical application. This paper reports our recent development of a practical method of MC-based scatter estimation and removal for CBCT. In contrast with conventional MC approaches that estimate scatter signals using a scatter-contaminated CBCT image, our method used a planning CT image for MC simulation, which has the advantages of accurate image intensity and absence of image truncation. In our method, the planning CT was first rigidly registered with the CBCT. Scatter signals were then estimated via MC simulation. After scatter signals were removed from the raw CBCT projections, a corrected CBCT image was reconstructed. The entire workflow was implemented on a GPU platform for high computational efficiency. Strategies such as projection denoising, CT image downsampling, and interpolation along the angular direction were employed to further enhance the calculation speed. We studied the impact of key parameters in the workflow on the resulting accuracy and efficiency, based on which the optimal parameter values were determined. Our method was evaluated in numerical simulation, phantom, and real patient cases. In the simulation cases, our method reduced mean HU errors from 44 HU to 3 HU and from 78 HU to 9 HU in the full-fan and the half-fan cases, respectively. In both the phantom and the patient cases, image artifacts caused by scatter, such as ring artifacts around the bowtie area, were reduced. With all the techniques employed, we achieved computation time of less than 30 sec including the time for both the scatter estimation and CBCT reconstruction steps. The efficacy of our method and its high computational efficiency make our method attractive for clinical use. PMID:25860299

  16. Near-infrared scattering as a dust diagnostic

    NASA Astrophysics Data System (ADS)

    Saajasto, Mika; Juvela, Mika; Malinen, Johanna

    2018-06-01

    Context. Regarding the evolution of dust grains from diffuse regions of space to dense molecular cloud cores, many questions remain open. Scattering at near-infrared wavelengths, or "cloudshine", can provide information on cloud structure, dust properties, and the radiation field that is complementary to mid-infrared "coreshine" and observations of dust emission at longer wavelengths. Aims: We examine the possibility of using near-infrared scattering to constrain the local radiation field and the dust properties, the scattering and absorption efficiency, the size distribution of the grains, and the maximum grain size. Methods: We use radiative transfer modelling to examine the constraints provided by the J, H, and K bands in combination with mid-infrared surface brightness at 3.6 μm. We use spherical one-dimensional and elliptical three-dimensional cloud models to study the observable effects of different grain size distributions with varying absorption and scattering properties. As an example, we analyse observations of a molecular cloud in Taurus, TMC-1N. Results: The observed surface brightness ratios of the bands change when the dust properties are changed. However, even a change of ±10% in the surface brightness of one band changes the estimated power-law exponent of the size distribution γ by up to 30% and the estimated strength of the radiation field KISRF by up to 60%. The maximum grain size Amax and γ are always strongly anti-correlated. For example, overestimating the surface brightness by 10% changes the estimated radiation field strength by 20% and the exponent of the size distribution by 15%. The analysis of our synthetic observations indicates that the relative uncertainty of the parameter distributions are on average Amax, γ 25%, and the deviation between the estimated and correct values ΔQ < 15%. For the TMC-1N observations, a maximum grain size Amax > 1.5μm and a size distribution with γ > 4.0 have high probability. The mass weighted average grain size is ⟨am⟩ = 0.113μm. Conclusions: We show that scattered infrared light can be used to derive meaningful limits for the dust parameters. However, errors in the surface brightness data can result in considerable uncertainties on the derived parameters.

  17. Fatigue Reliability of Gas Turbine Engine Structures

    NASA Technical Reports Server (NTRS)

    Cruse, Thomas A.; Mahadevan, Sankaran; Tryon, Robert G.

    1997-01-01

    The results of an investigation are described for fatigue reliability in engine structures. The description consists of two parts. Part 1 is for method development. Part 2 is a specific case study. In Part 1, the essential concepts and practical approaches to damage tolerance design in the gas turbine industry are summarized. These have evolved over the years in response to flight safety certification requirements. The effect of Non-Destructive Evaluation (NDE) methods on these methods is also reviewed. Assessment methods based on probabilistic fracture mechanics, with regard to both crack initiation and crack growth, are outlined. Limit state modeling techniques from structural reliability theory are shown to be appropriate for application to this problem, for both individual failure mode and system-level assessment. In Part 2, the results of a case study for the high pressure turbine of a turboprop engine are described. The response surface approach is used to construct a fatigue performance function. This performance function is used with the First Order Reliability Method (FORM) to determine the probability of failure and the sensitivity of the fatigue life to the engine parameters for the first stage disk rim of the two stage turbine. A hybrid combination of regression and Monte Carlo simulation is to use incorporate time dependent random variables. System reliability is used to determine the system probability of failure, and the sensitivity of the system fatigue life to the engine parameters of the high pressure turbine. 'ne variation in the primary hot gas and secondary cooling air, the uncertainty of the complex mission loading, and the scatter in the material data are considered.

  18. Measurement of Attenuation with Airborne and Ground-Based Radar in Convective Storms Over Land Its Microphysical Implications

    NASA Technical Reports Server (NTRS)

    Tian, Lin; Heymsfield, G. M.; Srivastava, R. C.; O'C.Starr, D. (Technical Monitor)

    2001-01-01

    Observations by the airborne X-band Doppler radar (EDOP) and the NCAR S-band polarimetric (S-Pol) radar from two field experiments are used to evaluate the surface reference technique (SRT) for measuring the path integrated attenuation (PIA) and to study attenuation in deep convective storms. The EDOP, flying at an altitude of 20 km, uses a nadir beam and a forward pointing beam. It is found that over land, the surface scattering cross-section is highly variable at nadir incidence but relatively stable at forward incidence. It is concluded that measurement by the forward beam provides a viable technique for measuring PIA using the SRT. Vertical profiles of peak attenuation coefficient are derived in two deep convective storms by the dual-wavelength method. Using the measured Doppler velocity, the reflectivities at the two wavelengths, the differential reflectivity and the estimated attenuation coefficients, it is shown that: supercooled drops and (dry) ice particles probably co-existed above the melting level in regions of updraft, that water-coated partially melted ice particles probably contributed to high attenuation below the melting level.

  19. Optimization-based scatter estimation using primary modulation for computed tomography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Yi; Ma, Jingchen; Zhao, Jun, E-mail: junzhao

    Purpose: Scatter reduces the image quality in computed tomography (CT), but scatter correction remains a challenge. A previously proposed primary modulation method simultaneously obtains the primary and scatter in a single scan. However, separating the scatter and primary in primary modulation is challenging because it is an underdetermined problem. In this study, an optimization-based scatter estimation (OSE) algorithm is proposed to estimate and correct scatter. Methods: In the concept of primary modulation, the primary is modulated, but the scatter remains smooth by inserting a modulator between the x-ray source and the object. In the proposed algorithm, an objective function ismore » designed for separating the scatter and primary. Prior knowledge is incorporated in the optimization-based framework to improve the accuracy of the estimation: (1) the primary is always positive; (2) the primary is locally smooth and the scatter is smooth; (3) the location of penumbra can be determined; and (4) the scatter-contaminated data provide knowledge about which part is smooth. Results: The simulation study shows that the edge-preserving weighting in OSE improves the estimation accuracy near the object boundary. Simulation study also demonstrates that OSE outperforms the two existing primary modulation algorithms for most regions of interest in terms of the CT number accuracy and noise. The proposed method was tested on a clinical cone beam CT, demonstrating that OSE corrects the scatter even when the modulator is not accurately registered. Conclusions: The proposed OSE algorithm improves the robustness and accuracy in scatter estimation and correction. This method is promising for scatter correction of various kinds of x-ray imaging modalities, such as x-ray radiography, cone beam CT, and the fourth-generation CT.« less

  20. Forward and inverse models of electromagnetic scattering from layered media with rough interfaces

    NASA Astrophysics Data System (ADS)

    Tabatabaeenejad, Seyed Alireza

    This work addresses the problem of electromagnetic scattering from layered dielectric structures with rough boundaries and the associated inverse problem of retrieving the subsurface parameters of the structure using the scattered field. To this end, a forward scattering model based on the Small Perturbation Method (SPM) is developed to calculate the first-order spectral-domain bistatic scattering coefficients of a two-layer rough surface structure. SPM requires the boundaries to be slightly rough compared to the wavelength, but to understand the range of applicability of this method in scattering from two-layer rough surfaces, its region of validity is investigated by comparing its output with that of a first principle solver that does not impose roughness restrictions. The Method of Moments (MoM) is used for this purpose. Finally, for retrieval of the model parameters of the layered structure using scattered field, an inversion scheme based on the Simulated Annealing method is investigated and a strategy is proposed to address convergence to local minimum.

  1. Experimental and theoretical study of rotationally inelastic diffraction of H2(D2) from methyl-terminated Si(111)

    NASA Astrophysics Data System (ADS)

    Nihill, Kevin J.; Hund, Zachary M.; Muzas, Alberto; Díaz, Cristina; del Cueto, Marcos; Frankcombe, Terry; Plymale, Noah T.; Lewis, Nathan S.; Martín, Fernando; Sibener, S. J.

    2016-08-01

    Fundamental details concerning the interaction between H2 and CH3-Si(111) have been elucidated by the combination of diffractive scattering experiments and electronic structure and scattering calculations. Rotationally inelastic diffraction (RID) of H2 and D2 from this model hydrocarbon-decorated semiconductor interface has been confirmed for the first time via both time-of-flight and diffraction measurements, with modest j = 0 → 2 RID intensities for H2 compared to the strong RID features observed for D2 over a large range of kinematic scattering conditions along two high-symmetry azimuthal directions. The Debye-Waller model was applied to the thermal attenuation of diffraction peaks, allowing for precise determination of the RID probabilities by accounting for incoherent motion of the CH3-Si(111) surface atoms. The probabilities of rotationally inelastic diffraction of H2 and D2 have been quantitatively evaluated as a function of beam energy and scattering angle, and have been compared with complementary electronic structure and scattering calculations to provide insight into the interaction potential between H2 (D2) and hence the surface charge density distribution. Specifically, a six-dimensional potential energy surface (PES), describing the electronic structure of the H2(D2)/CH3-Si(111) system, has been computed based on interpolation of density functional theory energies. Quantum and classical dynamics simulations have allowed for an assessment of the accuracy of the PES, and subsequently for identification of the features of the PES that serve as classical turning points. A close scrutiny of the PES reveals the highly anisotropic character of the interaction potential at these turning points. This combination of experiment and theory provides new and important details about the interaction of H2 with a hybrid organic-semiconductor interface, which can be used to further investigate energy flow in technologically relevant systems.

  2. Oil spill detection from TerraSAR-X dual-polarized images using artificial neural network

    NASA Astrophysics Data System (ADS)

    Kim, D.; Jung, H.-S.

    2017-10-01

    Marine pollution from oil spills destroys ecosystems. In order to minimize the damage, it is important to fast cleanup it after predicting how the oil will spread. In order to predict the spread of oil spill, remote sensing technique, especially radar satellite image is widely used. In previous studies, only the back-scattering value is generally used for the detection of oil spill. However, in this study, oil spill was detected by applying ANN (Artificial Neural Network) as input data from the back-scattering value of the radar image as well as the phase information extracted from the dual polarization. In order to maximize the efficiency of oil spill detection using a back-scattering value, the speckle noise acting as an error factor should be removed first. NL-means filter was applied to multi-look image to remove it without smoothing of spatial resolution. In the coherence image, the sea has a high value and the oil spill area has a low value due to the scattering characteristics of the pulse. In order to using the characteristics of radar image, training sample was set up from NL-means filtered images(HH, VV) and coherence image, and ANN was applied to produce probability map of oil spill. In general, the value was 0.4 or less in the case of the sea, and the value was mainly in the range of 0.7 to 0.9 in the oil spill area. Using coherence images generated from different polarizations showed better detection results for relatively thin oil spill areas such as oil slick or oil sheen than using back-scattering information alone. It is expected that if the information about the look-alike of oil spill such as algae, internal wave and rainfall area is provided, the probability map can be produced with higher accuracy.

  3. Large-scale atomistic calculations of clusters in intense x-ray pulses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, Phay J.; Knight, Chris

    Here, we present the methodology of our recently developed Monte-Carlo/ Molecular-Dynamics method for studying the fundamental ultrafast dynamics induced by high-fluence, high-intensity x-ray free electron laser (XFEL) pulses in clusters. The quantum nature of the initiating ionization process is accounted for by a Monte Carlo method to calculate probabilities of electronic transitions, including photo absorption, inner-shell relaxation, photon scattering, electron collision and recombination dynamics, and thus track the transient electronic configurations explicitly. The freed electrons and ions are followed by classical particle trajectories using a molecular dynamics algorithm. These calculations reveal the surprising role of electron-ion recombination processes that leadmore » to the development of nonuniform spatial charge density profiles in x-ray excited clusters over femtosecond timescales. In the high-intensity limit, it is important to include the recombination dynamics in the calculated scattering response even for a 2- fs pulse. We also demonstrate that our numerical codes and algorithms can make e!cient use of the computational power of massively parallel supercomputers to investigate the intense-field dynamics in systems with increasing complexity and size at the ultrafast timescale and in non-linear x-ray interaction regimes. In particular, picosecond trajectories of XFEL clusters with attosecond time resolution containing millions of particles can be e!ciently computed on upwards of 262,144 processes.« less

  4. Large-scale atomistic calculations of clusters in intense x-ray pulses

    DOE PAGES

    Ho, Phay J.; Knight, Chris

    2017-04-28

    Here, we present the methodology of our recently developed Monte-Carlo/ Molecular-Dynamics method for studying the fundamental ultrafast dynamics induced by high-fluence, high-intensity x-ray free electron laser (XFEL) pulses in clusters. The quantum nature of the initiating ionization process is accounted for by a Monte Carlo method to calculate probabilities of electronic transitions, including photo absorption, inner-shell relaxation, photon scattering, electron collision and recombination dynamics, and thus track the transient electronic configurations explicitly. The freed electrons and ions are followed by classical particle trajectories using a molecular dynamics algorithm. These calculations reveal the surprising role of electron-ion recombination processes that leadmore » to the development of nonuniform spatial charge density profiles in x-ray excited clusters over femtosecond timescales. In the high-intensity limit, it is important to include the recombination dynamics in the calculated scattering response even for a 2- fs pulse. We also demonstrate that our numerical codes and algorithms can make e!cient use of the computational power of massively parallel supercomputers to investigate the intense-field dynamics in systems with increasing complexity and size at the ultrafast timescale and in non-linear x-ray interaction regimes. In particular, picosecond trajectories of XFEL clusters with attosecond time resolution containing millions of particles can be e!ciently computed on upwards of 262,144 processes.« less

  5. Modeling Electromagnetic Scattering From Complex Inhomogeneous Objects

    NASA Technical Reports Server (NTRS)

    Deshpande, Manohar; Reddy, C. J.

    2011-01-01

    This software innovation is designed to develop a mathematical formulation to estimate the electromagnetic scattering characteristics of complex, inhomogeneous objects using the finite-element-method (FEM) and method-of-moments (MoM) concepts, as well as to develop a FORTRAN code called FEMOM3DS (Finite Element Method and Method of Moments for 3-Dimensional Scattering), which will implement the steps that are described in the mathematical formulation. Very complex objects can be easily modeled, and the operator of the code is not required to know the details of electromagnetic theory to study electromagnetic scattering.

  6. Simulations of wave propagation and disorder in 3D non-close-packed colloidal photonic crystals with low refractive index contrast.

    PubMed

    Glushko, O; Meisels, R; Kuchar, F

    2010-03-29

    The plane-wave expansion method (PWEM), the multiple-scattering method (MSM) and the 3D finite-difference time-domain method (FDTD) are applied for simulations of propagation of electromagnetic waves through 3D colloidal photonic crystals. The system investigated is not a "usual" artificial opal with close-packed fcc lattice but a dilute bcc structure which occurs due to long-range repulsive interaction between electrically charged colloidal particles during the growth process. The basic optical properties of non-close-packed colloidal PhCs are explored by examining the band structure and reflection spectra for a bcc lattice of silica spheres in an aqueous medium. Finite size effects and correspondence between the Bragg model, band structure and reflection spectra are discussed. The effects of size, positional and missing-spheres disorder are investigated. In addition, by analyzing the results of experimental work we show that the fabricated structures have reduced plane-to-plane distance probably due to the effect of gravity during growth.

  7. Probabilistic Assessment of Fracture Progression in Composite Structures

    NASA Technical Reports Server (NTRS)

    Chamis, Christos C.; Minnetyan, Levon; Mauget, Bertrand; Huang, Dade; Addi, Frank

    1999-01-01

    This report describes methods and corresponding computer codes that are used to evaluate progressive damage and fracture and to perform probabilistic assessment in built-up composite structures. Structural response is assessed probabilistically, during progressive fracture. The effects of design variable uncertainties on structural fracture progression are quantified. The fast probability integrator (FPI) is used to assess the response scatter in the composite structure at damage initiation. The sensitivity of the damage response to design variables is computed. The methods are general purpose and are applicable to stitched and unstitched composites in all types of structures and fracture processes starting from damage initiation to unstable propagation and to global structure collapse. The methods are demonstrated for a polymer matrix composite stiffened panel subjected to pressure. The results indicated that composite constituent properties, fabrication parameters, and respective uncertainties have a significant effect on structural durability and reliability. Design implications with regard to damage progression, damage tolerance, and reliability of composite structures are examined.

  8. The extraordinary radar echoes from Europa, Ganymede, and Callisto: A geological perspective

    USGS Publications Warehouse

    Ostro, S.J.; Shoemaker, E.M.

    1990-01-01

    This outline of plausible geologic explanations for the icy Galilean satellites' radar properties takes into consideration electromagnetic scattering models for the echoes, available empirical and theoretical information about regolith formation, and ice physics. The strange radar signatures arise because (1) ice is electrically different from silicates and/or (2) icy regoliths contain bulk-density (and hence refractive-index) structures absent within silicate regoliths. Ice's relatively high radar-frequency transparency compared with that of silicates permits longer photon path lengths, deeper radar sounding, and a greater number of scattering events. Consequently, scattering mechanisms that cannot contribute significantly to lunar echoes can dominate icy-satellite echoes. Possible phenomena unique to icy regoliths include (1) smoothing out of discontinuities between solid ejecta fragments and more porous surroundings under the action of thermal annealing to form refraction-scattering (RS) "lenses" and (2) formation of density enhancements in the shape of crater floors that result in RS and/or total internal reflection (TIR). In either case, high-order multiple scattering is more likely to be responsible for the echoes than low-order scattering. Radar/radio observations can constrain the order of the scattering and the scale of the structures responsible for the echoes but might not determine whether TIR or RS dominates the scattering. Multiwavelength investigations of the degree of correlation between radar properties and geologic terrain type should prove most useful, because inter- and intrasatellite variations in radar properties probably correspond to variations in ice purity, regolith thickness, and regolith thermal history and age. ?? 1990.

  9. The role of lower-hybrid-wave collapse in the auroral ionosphere.

    PubMed

    Schuck, P W; Ganguli, G I; Kintner, P M

    2002-08-05

    In regions where lower-hybrid solitary structures (LHSS) are observed, the character of auroral lower-hybrid turbulence (LHT) (0-20 kHz) is investigated using the amplitude probability distribution of the electric field. The observed probability distributions are accurately described by a Rayleigh distribution with two degrees of freedom. The statistics of the LHT exhibit no evidence of the global modulational instability or self-similar wave collapse. We conclude that nucleation and resonant scattering in preexisting density depletions are the processes responsible for LHSS in auroral LHT.

  10. Multi-Scale Scattering Transform in Music Similarity Measuring

    NASA Astrophysics Data System (ADS)

    Wang, Ruobai

    Scattering transform is a Mel-frequency spectrum based, time-deformation stable method, which can be used in evaluating music similarity. Compared with Dynamic time warping, it has better performance in detecting similar audio signals under local time-frequency deformation. Multi-scale scattering means to combine scattering transforms of different window lengths. This paper argues that, multi-scale scattering transform is a good alternative of dynamic time warping in music similarity measuring. We tested the performance of multi-scale scattering transform against other popular methods, with data designed to represent different conditions.

  11. Monte Carlo calculation of large and small-angle electron scattering in air

    NASA Astrophysics Data System (ADS)

    Cohen, B. I.; Higginson, D. P.; Eng, C. D.; Farmer, W. A.; Friedman, A.; Grote, D. P.; Larson, D. J.

    2017-11-01

    A Monte Carlo method for angle scattering of electrons in air that accommodates the small-angle multiple scattering and larger-angle single scattering limits is introduced. The algorithm is designed for use in a particle-in-cell simulation of electron transport and electromagnetic wave effects in air. The method is illustrated in example calculations.

  12. SU-E-I-07: An Improved Technique for Scatter Correction in PET

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, S; Wang, Y; Lue, K

    2014-06-01

    Purpose: In positron emission tomography (PET), the single scatter simulation (SSS) algorithm is widely used for scatter estimation in clinical scans. However, bias usually occurs at the essential steps of scaling the computed SSS distribution to real scatter amounts by employing the scatter-only projection tail. The bias can be amplified when the scatter-only projection tail is too small, resulting in incorrect scatter correction. To this end, we propose a novel scatter calibration technique to accurately estimate the amount of scatter using pre-determined scatter fraction (SF) function instead of the employment of scatter-only tail information. Methods: As the SF depends onmore » the radioactivity distribution and the attenuating material of the patient, an accurate theoretical relation cannot be devised. Instead, we constructed an empirical transformation function between SFs and average attenuation coefficients based on a serious of phantom studies with different sizes and materials. From the average attenuation coefficient, the predicted SFs were calculated using empirical transformation function. Hence, real scatter amount can be obtained by scaling the SSS distribution with the predicted SFs. The simulation was conducted using the SimSET. The Siemens Biograph™ 6 PET scanner was modeled in this study. The Software for Tomographic Image Reconstruction (STIR) was employed to estimate the scatter and reconstruct images. The EEC phantom was adopted to evaluate the performance of our proposed technique. Results: The scatter-corrected image of our method demonstrated improved image contrast over that of SSS. For our technique and SSS of the reconstructed images, the normalized standard deviation were 0.053 and 0.182, respectively; the root mean squared errors were 11.852 and 13.767, respectively. Conclusion: We have proposed an alternative method to calibrate SSS (C-SSS) to the absolute scatter amounts using SF. This method can avoid the bias caused by the insufficient tail information and therefore improve the accuracy of scatter estimation.« less

  13. A multiwave range test for obstacle reconstructions with unknown physical properties

    NASA Astrophysics Data System (ADS)

    Potthast, Roland; Schulz, Jochen

    2007-08-01

    We develop a new multiwave version of the range test for shape reconstruction in inverse scattering theory. The range test [R. Potthast, et al., A `range test' for determining scatterers with unknown physical properties, Inverse Problems 19(3) (2003) 533-547] has originally been proposed to obtain knowledge about an unknown scatterer when the far field pattern for only one plane wave is given. Here, we extend the method to the case of multiple waves and show that the full shape of the unknown scatterer can be reconstructed. We further will clarify the relation between the range test methods, the potential method [A. Kirsch, R. Kress, On an integral equation of the first kind in inverse acoustic scattering, in: Inverse Problems (Oberwolfach, 1986), Internationale Schriftenreihe zur Numerischen Mathematik, vol. 77, Birkhauser, Basel, 1986, pp. 93-102] and the singular sources method [R. Potthast, Point sources and multipoles in inverse scattering theory, Habilitation Thesis, Gottingen, 1999]. In particular, we propose a new version of the Kirsch-Kress method using the range test and a new approach to the singular sources method based on the range test and potential method. Numerical examples of reconstructions for all four methods are provided.

  14. Replacing backscattering with reduced scattering. A better formulation of reflectance function?

    NASA Astrophysics Data System (ADS)

    Piskozub, Jacek; McKee, David; Freda, Wlodzimierz

    2014-05-01

    Modern reflectance formulas all involve backscattering coefficient divided by absorption coefficient (bb/a). The backscattering (or backward scattering) coefficient describes how much of the incident radiation is scattered at angles between 90 and 180 deg. However, water leaving photons are not necessarily backscattered because it is possible for a variable fraction to exit after multiple forward scattering events. Therefore the whole angular function of scattering probability (phase function) influences the reflectance signal. This is the reason why phase functions of identical backscattering ratio may result in different reflectance values, contrary to the universally used formula. This creates the question whether there may exist a better formula using a parameter better describing phase function shape than backscattering ratio. The asymmetry parameter g (the average scattering cosine) is commonly used to parametrize phase functions. A replacement for backscattering should decrease with increasing g. Therefore, the simplest candidate to replace backscattering has the form of b(1-g), where b is the scattering coefficient. Such a parameter is well known in biomedical optics under the name of reduced scattering (sometimes transport scattering). It has even been used in parametrizing reflectance in (highly turbid) human tissues. However no attempt has been made to check its usefulness in marine optics. We perform Monte Carlo radiative transfer calculations of reflectance for multiple combinations of inherent optical properties, including different phase functions. The results are used to create a new reflectance formula as a function of reduced scattering and absorption and test its robustness to changes in phase function shape compared to the traditional bb/a formula. We discuss its usefulness as well as advantages and disadvantages compared to the traditional formulation.

  15. Photovoltaic structures having a light scattering interface layer and methods of making the same

    DOEpatents

    Liu, Xiangxin; Compaan, Alvin D.; Paudel, Naba Raj

    2015-10-13

    Photovoltaic (PV) cell structures having an integral light scattering interface layer configured to diffuse or scatter light prior to entering a semiconductor material and methods of making the same are described.

  16. Post-PRK corneal scatter measurements with a scanning confocal slit photon counter

    NASA Astrophysics Data System (ADS)

    Taboada, John; Gaines, David; Perez, Mary A.; Waller, Steve G.; Ivan, Douglas J.; Baldwin, J. Bruce; LoRusso, Frank; Tutt, Ronald C.; Perez, Jose; Tredici, Thomas; Johnson, Dan A.

    2000-06-01

    Increased corneal light scatter or 'haze' has been associated with excimer laser photorefractive surgery of the cornea. The increased scatter can affect visual performance; however, topical steroid treatment post surgery substantially reduces the post PRK scatter. For the treatment and monitoring of the scattering characteristics of the cornea, various methods have been developed to objectively measure the magnitude of the scatter. These methods generally can measure scatter associated with clinically observable levels of haze. For patients with moderate to low PRK corrections receiving steroid treatment, measurement becomes fairly difficult as the haze clinical rating is non observable. The goal of this development was to realize an objective, non-invasive physical measurement that could produce a significant reading for any level including the background present in a normal cornea. As back-scatter is the only readily accessible observable, the instrument is based on this measurement. To achieve this end required the use of a confocal method to bias out the background light that would normally confound conventional methods. A number of subjects with nominal refractive errors in an Air Force study have undergone PRK surgery. A measurable increase in corneal scatter has been observed in these subjects whereas clinical ratings of the haze were noted as level zero. Other favorable aspects of this back-scatter based instrument include an optical capability to perform what is equivalent to an optical A-scan of the anterior chamber. Lens scatter can also be measured.

  17. Electron scattering by molecules. II - Experimental methods and data

    NASA Technical Reports Server (NTRS)

    Trajmar, S.; Chutjian, A.; Register, D. F.

    1983-01-01

    Experimental techniques for measuring electron-molecule collision cross sections are briefly summarized. A survey of the available experimental cross section data is presented. The emphasis here is on elastic scattering, rotational, vibrational and electronic excitations, total electron scattering, and momentum transfer in the few eV to few hundred eV impact energy range. Reference is made to works concerned with high energy electron scattering, innershell and multi-electron excitations, conicidence methods and electron scattering in laser fields.

  18. Photon scattering cross sections of H2 and He measured with synchrotron radiation

    NASA Technical Reports Server (NTRS)

    Ice, G. E.

    1977-01-01

    Total (elastic + inelastic) differential photon scattering cross sections have been measured for H2 gas and He, using an X-ray beam. Absolute measured cross sections agree with theory within the probable errors. Relative cross sections (normalized to theory at large S) agree to better than one percent with theoretical values calculated from wave functions that include the effect of electron-electron Coulomb correlation, but the data deviate significantly from theoretical independent-particle (e.g., Hartree-Fock) results. The ratios of measured absolute He cross sections to those of H2, at any given S, also agree to better than one percent with theoretical He-to-H2 cross-section ratios computed from correlated wave functions. It appears that photon scattering constitutes a very promising tool for probing electron correlation in light atoms and molecules.

  19. Sizing aerosolized fractal nanoparticle aggregates through Bayesian analysis of wide-angle light scattering (WALS) data

    NASA Astrophysics Data System (ADS)

    Huber, Franz J. T.; Will, Stefan; Daun, Kyle J.

    2016-11-01

    Inferring the size distribution of aerosolized fractal aggregates from the angular distribution of elastically scattered light is a mathematically ill-posed problem. This paper presents a procedure for analyzing Wide-Angle Light Scattering (WALS) data using Bayesian inference. The outcome is probability densities for the recovered size distribution and aggregate morphology parameters. This technique is applied to both synthetic data and experimental data collected on soot-laden aerosols, using a measurement equation derived from Rayleigh-Debye-Gans fractal aggregate (RDG-FA) theory. In the case of experimental data, the recovered aggregate size distribution parameters are generally consistent with TEM-derived values, but the accuracy is impaired by the well-known limited accuracy of RDG-FA theory. Finally, we show how this bias could potentially be avoided using the approximation error technique.

  20. Finite difference time domain modeling of steady state scattering from jet engines with moving turbine blades

    NASA Technical Reports Server (NTRS)

    Ryan, Deirdre A.; Langdon, H. Scott; Beggs, John H.; Steich, David J.; Luebbers, Raymond J.; Kunz, Karl S.

    1992-01-01

    The approach chosen to model steady state scattering from jet engines with moving turbine blades is based upon the Finite Difference Time Domain (FDTD) method. The FDTD method is a numerical electromagnetic program based upon the direct solution in the time domain of Maxwell's time dependent curl equations throughout a volume. One of the strengths of this method is the ability to model objects with complicated shape and/or material composition. General time domain functions may be used as source excitations. For example, a plane wave excitation may be specified as a pulse containing many frequencies and at any incidence angle to the scatterer. A best fit to the scatterer is accomplished using cubical cells in the standard cartesian implementation of the FDTD method. The material composition of the scatterer is determined by specifying its electrical properties at each cell on the scatterer. Thus, the FDTD method is a suitable choice for problems with complex geometries evaluated at multiple frequencies. It is assumed that the reader is familiar with the FDTD method.

  1. New approach to CT pixel-based photon dose calculations in heterogeneous media

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, J.W.; Henkelman, R.M.

    The effects of small cavities on dose in water and the dose in a homogeneous nonunit density medium illustrate that inhomogeneities do not act independently in photon dose perturbation, and serve as two constraints which should be satisfied by approximate methods of computed tomography (CT) pixel-based dose calculations. Current methods at best satisfy only one of the two constraints and show inadequacies in some intermediate geometries. We have developed an approximate method that satisfies both these constraints and treats much of the synergistic effect of multiple inhomogeneities correctly. The method calculates primary and first-scatter doses by first-order ray tracing withmore » the first-scatter contribution augmented by a component of second scatter that behaves like first scatter. Multiple-scatter dose perturbation values extracted from small cavity experiments are used in a function which approximates the small residual multiple-scatter dose. For a wide range of geometries tested, our method agrees very well with measurements. The average deviation is less than 2% with a maximum of 3%. In comparison, calculations based on existing methods can have errors larger than 10%.« less

  2. Using seismic coda waves to resolve intrinsic and scattering attenuation

    NASA Astrophysics Data System (ADS)

    Wang, W.; Shearer, P. M.

    2016-12-01

    Seismic attenuation is caused by two factors, scattering and intrinsic absorption. Characterizing scattering and absorbing properties and the power spectrum of crustal heterogeneity is a fundamental problem for informing strong ground motion estimates at high frequencies, where scattering and attenuation effects are critical. Determining the relative amount of attenuation caused by scattering and intrinsic absorption has been a long-standing problem in seismology. The wavetrain following the direct body wave phases is called the coda, which is caused by scattered energy. Many studies have analyzed the coda of local events to constrain crustal and upper-mantle scattering strength and intrinsic attenuation. Here we examine two popular attenuation inversion methods, the Multiple Lapse Time Window Method (MLTWM) and the Coda Qc Method. First, based on our previous work on California attenuation structure, we apply an efficient and accurate method, the Monte Carlo Approach, to synthesize seismic envelope functions. We use this code to generate a series of synthetic data based on several complex and realistic forward models. Although the MLTWM assumes a uniform whole space, we use the MLTWM to invert for both scattering and intrinsic attenuation from the synthetic data to test how accurately it can recover the attenuation models. Results for the coda Qc method depend on choices for the length and starting time of the coda-wave time window. Here we explore the relation between the inversion results for Qc, the windowing parameters, and the intrinsic and scattering Q structure of our synthetic model. These results should help assess the practicality and accuracy of the Multiple Lapse Time Window Method and Coda Qc Method when applied to realistic crustal velocity and attenuation models.

  3. Searching for extra-terrestrial civilizations

    NASA Technical Reports Server (NTRS)

    Gindilis, L. M.

    1974-01-01

    The probability of radio interchange with extraterrestrial civilizations is discussed. Difficulties constitute absorption, scattering, and dispersion of signals by the rarified interstellar medium as well as the deciphering of received signals and convergence of semantic concept. A cybernetic approach considers searching for signals that develop from astroengineering activities of extraterrestrial civilizations.

  4. Fast estimation of first-order scattering in a medical x-ray computed tomography scanner using a ray-tracing technique.

    PubMed

    Liu, Xin

    2014-01-01

    This study describes a deterministic method for simulating the first-order scattering in a medical computed tomography scanner. The method was developed based on a physics model of x-ray photon interactions with matter and a ray tracing technique. The results from simulated scattering were compared to the ones from an actual scattering measurement. Two phantoms with homogeneous and heterogeneous material distributions were used in the scattering simulation and measurement. It was found that the simulated scatter profile was in agreement with the measurement result, with an average difference of 25% or less. Finally, tomographic images with artifacts caused by scatter were corrected based on the simulated scatter profiles. The image quality improved significantly.

  5. Wave Scattering in Heterogeneous Media using the Finite Element Method

    DTIC Science & Technology

    2016-10-21

    AFRL-AFOSR-JP-TR-2016-0086 Wave Scattering in Heterogeneous Media using the Finite Element Method Chiruvai Vendhan INDIAN INSTITUTE OF TECHNOLOGY...Scattering in Heterogeneous Media using the Finite Element Method 5a.  CONTRACT NUMBER 5b.  GRANT NUMBER FA2386-12-1-4026 5c.  PROGRAM ELEMENT NUMBER 61102F 6...14.  ABSTRACT The primary aim of this study is to develop a finite element model for elastic scattering by axisymmetric bodies submerged in a

  6. Application of linearized inverse scattering methods for the inspection in steel plates embedded in concrete structures

    NASA Astrophysics Data System (ADS)

    Tsunoda, Takaya; Suzuki, Keigo; Saitoh, Takahiro

    2018-04-01

    This study develops a method to visualize the state of steel-concrete interface with ultrasonic testing. Scattered waves are obtained by the UT pitch-catch mode from the surface of the concrete. Discrete wavelet transform is applied in order to extract echoes scattered from the steel-concrete interface. Then Linearized Inverse Scattering Methods are used for imaging the interface. The results show that LISM with Born and Kirchhoff approximation provide clear images for the target.

  7. Hybrid Monte Carlo-Diffusion Method For Light Propagation in Tissue With a Low-Scattering Region

    NASA Astrophysics Data System (ADS)

    Hayashi, Toshiyuki; Kashio, Yoshihiko; Okada, Eiji

    2003-06-01

    The heterogeneity of the tissues in a head, especially the low-scattering cerebrospinal fluid (CSF) layer surrounding the brain has previously been shown to strongly affect light propagation in the brain. The radiosity-diffusion method, in which the light propagation in the CSF layer is assumed to obey the radiosity theory, has been employed to predict the light propagation in head models. Although the CSF layer is assumed to be a nonscattering region in the radiosity-diffusion method, fine arachnoid trabeculae cause faint scattering in the CSF layer in real heads. A novel approach, the hybrid Monte Carlo-diffusion method, is proposed to calculate the head models, including the low-scattering region in which the light propagation does not obey neither the diffusion approximation nor the radiosity theory. The light propagation in the high-scattering region is calculated by means of the diffusion approximation solved by the finite-element method and that in the low-scattering region is predicted by the Monte Carlo method. The intensity and mean time of flight of the detected light for the head model with a low-scattering CSF layer calculated by the hybrid method agreed well with those by the Monte Carlo method, whereas the results calculated by means of the diffusion approximation included considerable error caused by the effect of the CSF layer. In the hybrid method, the time-consuming Monte Carlo calculation is employed only for the thin CSF layer, and hence, the computation time of the hybrid method is dramatically shorter than that of the Monte Carlo method.

  8. Hybrid Monte Carlo-diffusion method for light propagation in tissue with a low-scattering region.

    PubMed

    Hayashi, Toshiyuki; Kashio, Yoshihiko; Okada, Eiji

    2003-06-01

    The heterogeneity of the tissues in a head, especially the low-scattering cerebrospinal fluid (CSF) layer surrounding the brain has previously been shown to strongly affect light propagation in the brain. The radiosity-diffusion method, in which the light propagation in the CSF layer is assumed to obey the radiosity theory, has been employed to predict the light propagation in head models. Although the CSF layer is assumed to be a nonscattering region in the radiosity-diffusion method, fine arachnoid trabeculae cause faint scattering in the CSF layer in real heads. A novel approach, the hybrid Monte Carlo-diffusion method, is proposed to calculate the head models, including the low-scattering region in which the light propagation does not obey neither the diffusion approximation nor the radiosity theory. The light propagation in the high-scattering region is calculated by means of the diffusion approximation solved by the finite-element method and that in the low-scattering region is predicted by the Monte Carlo method. The intensity and mean time of flight of the detected light for the head model with a low-scattering CSF layer calculated by the hybrid method agreed well with those by the Monte Carlo method, whereas the results calculated by means of the diffusion approximation included considerable error caused by the effect of the CSF layer. In the hybrid method, the time-consuming Monte Carlo calculation is employed only for the thin CSF layer, and hence, the computation time of the hybrid method is dramatically shorter than that of the Monte Carlo method.

  9. Formation of Kuiper-belt binaries through multiple chaotic scattering encounters with low-mass intruders

    NASA Astrophysics Data System (ADS)

    Astakhov, Sergey A.; Lee, Ernestine A.; Farrelly, David

    2005-06-01

    The discovery that many trans-Neptunian objects exist in pairs, or binaries, is proving invaluable for shedding light on the formation, evolution and structure of the outer Solar system. Based on recent systematic searches it has been estimated that up to 10 per cent of Kuiper-belt objects might be binaries. However, all examples discovered to date are unusual, as compared with near-Earth and main-belt asteroid binaries, for their mass ratios of the order of unity and their large, eccentric orbits. In this article we propose a common dynamical origin for these compositional and orbital properties based on four-body simulations in the Hill approximation. Our calculations suggest that binaries are produced through the following chain of events. Initially, long-lived quasi-bound binaries form by two bodies getting entangled in thin layers of dynamical chaos produced by solar tides within the Hill sphere. Next, energy transfer through gravitational scattering with a low-mass intruder nudges the binary into a nearby non-chaotic, stable zone of phase space. Finally, the binary hardens (loses energy) through a series of relatively gentle gravitational scattering encounters with further intruders. This produces binary orbits that are well fitted by Kepler ellipses. Dynamically, the overall process is strongly favoured if the original quasi-bound binary contains comparable masses. We propose a simplified model of chaotic scattering to explain these results. Our findings suggest that the observed preference for roughly equal-mass ratio binaries is probably a real effect; that is, it is not primarily due to an observational bias for widely separated, comparably bright objects. Nevertheless, we predict that a sizeable population of very unequal-mass Kuiper-belt binaries is probably awaiting discovery.

  10. Evaluation of light scattering properties and chromophore concentrations in skin tissue based on diffuse reflectance signals at isosbestic wavelengths of hemoglobin

    NASA Astrophysics Data System (ADS)

    Yokokawa, Takumi; Nishidate, Izumi

    2016-04-01

    We investigate a method to evaluate light-scattering properties and chromophore concentrations in human skin tissue through diffuse reflectance spectroscopy using the reflectance signals acquired at isosbestic wavelengths of hemoglobin (420, 450, 500, and 585 nm). In the proposed method, Monte Carlo simulation-based empirical formulas are used to specify the scattering parameters of skin tissue, such as the scattering amplitude a and the scattering power b, as well as the concentration of melanin C m and the total blood concentration C tb. The use of isosbestic wavelengths of hemoglobin enables the values of C m, C tb, a, and b to be estimated independently of the oxygenation of hemoglobin. The spectrum of the reduced scattering coefficient is reconstructed from the scattering parameters. Experiments using in vivo human skin tissues were performed to confirm the feasibility of the proposed method for evaluating the changes in scattering properties and chromophore concentrations in skin tissue. The experimental results revealed that light scattering is significantly reduced by the application of a glycerol solution, which indicates an optical clearing effect due to osmotic dehydration and the matching of the refractive indices of scatterers in the epidermis.

  11. NOTE: Acceleration of Monte Carlo-based scatter compensation for cardiac SPECT

    NASA Astrophysics Data System (ADS)

    Sohlberg, A.; Watabe, H.; Iida, H.

    2008-07-01

    Single proton emission computed tomography (SPECT) images are degraded by photon scatter making scatter compensation essential for accurate reconstruction. Reconstruction-based scatter compensation with Monte Carlo (MC) modelling of scatter shows promise for accurate scatter correction, but it is normally hampered by long computation times. The aim of this work was to accelerate the MC-based scatter compensation using coarse grid and intermittent scatter modelling. The acceleration methods were compared to un-accelerated implementation using MC-simulated projection data of the mathematical cardiac torso (MCAT) phantom modelling 99mTc uptake and clinical myocardial perfusion studies. The results showed that when combined the acceleration methods reduced the reconstruction time for 10 ordered subset expectation maximization (OS-EM) iterations from 56 to 11 min without a significant reduction in image quality indicating that the coarse grid and intermittent scatter modelling are suitable for MC-based scatter compensation in cardiac SPECT.

  12. 149 Sources and 15 Years Later: The Navy-NRAO Green Bank Interferometer Monitoring Program

    NASA Astrophysics Data System (ADS)

    Lazio, T. J. W.; Waltman, E. B.; Ghigo, F.; Johnston, K. J.

    2000-12-01

    Flux densities for 149 sources were monitored with the Green Bank Interferometer for durations ranging from 3 to 15 yrs, covering the interval 1979--1996, with most sources observed for 6 yrs. Observations were at two radio frequencies (approximately 2.5 and 8.2 GHz) and have a typical sampling of one flux density measurement every 2 days. We have used these light curves to conduct various variability analysis of the sources. We find suggestive, though not unambiguous evidence, that these sources have a common, broadband mechanism for intrinsic variations. We also find that the extrinsic variation is more consistent with radio-wave scattering in an extended medium rather than in a thin screen. The primary motivation for this monitoring program was the identification of extreme scattering events. In an effort to identify ESEs in a systematic manner, we have taken the wavelet transform of the light curves. We find 15 events in the light curves of 12 sources that we classify as probable ESEs. However, we also find that five ESEs previously identified from these data do not survive our wavelet selection criteria. Future identification of ESEs will probably continue to rely on both visual and systematic methods. We present examples of the light curves and variability analyses. Instructions for obtaining the data are also given. The GBI is a facility of the National Science Foundation and was operated by the National Radio Astronomy Observatory under contract to the USNO and NRL during these observations. A portion of this work was performed while TJWL held a National Research Council-NRL Research Associateship. Basic research in radio astronomy at the NRL is supported by the Office of Naval Research.

  13. A search game model of the scatter hoarder's problem

    PubMed Central

    Alpern, Steve; Fokkink, Robbert; Lidbetter, Thomas; Clayton, Nicola S.

    2012-01-01

    Scatter hoarders are animals (e.g. squirrels) who cache food (nuts) over a number of sites for later collection. A certain minimum amount of food must be recovered, possibly after pilfering by another animal, in order to survive the winter. An optimal caching strategy is one that maximizes the survival probability, given worst case behaviour of the pilferer. We modify certain ‘accumulation games’ studied by Kikuta & Ruckle (2000 J. Optim. Theory Appl.) and Kikuta & Ruckle (2001 Naval Res. Logist.), which modelled the problem of optimal diversification of resources against catastrophic loss, to include the depth at which the food is hidden at each caching site. Optimal caching strategies can then be determined as equilibria in a new ‘caching game’. We show how the distribution of food over sites and the site-depths of the optimal caching varies with the animal's survival requirements and the amount of pilfering. We show that in some cases, ‘decoy nuts’ are required to be placed above other nuts that are buried further down at the same site. Methods from the field of search games are used. Some empirically observed behaviour can be shown to be optimal in our model. PMID:22012971

  14. Enhancement factor statistics of surface enhanced Raman scattering in multiscale heterostructures of nanoparticles.

    PubMed

    Zito, Gianluigi; Rusciano, Giulia; Sasso, Antonio

    2016-08-07

    Suitable metal nanostructures may induce surface-enhanced Raman scattering (SERS) enhancement factors (EFs) large-enough to reach single-molecule sensitivity. However, the gap hot-spot EF probability density function (PDF) has the character of a long-tail distribution, which dramatically mines the reproducibility of SERS experiments. Herein, we carry out electrodynamic calculations based on a 3D finite element method of two plasmonic nanostructures, combined with Monte Carlo simulations of the EF statistics under different external conditions. We compare the PDF produced by a homodimer of nanoparticles with that provided by a self-similar trimer. We show that the PDF is sensitive to the spatial distribution of near-field enhancement specifically supported by the nanostructure geometry. Breaking the symmetry of the plasmonic system is responsible for inducing particular modulations of the PDF tail resembling a multiple Poisson distribution. We also study the influence that molecular diffusion towards the hottest hot-spot, or selective hot-spot targeting, might have on the EF PDF. Our results quantitatively assess the possibility of designing the response of a SERS substrate so as to contain the intrinsic EF PDF variance and significantly improving, in principle, the reproducibility of SERS experiments.

  15. Measurement of the main and critical parameters for optimal laser treatment of heart disease

    NASA Astrophysics Data System (ADS)

    Kabeya, FB; Abrahamse, H.; Karsten, AE

    2017-10-01

    Laser light is frequently used in the diagnosis and treatment of patients. As in traditional treatments such as medication, bypass surgery, and minimally invasive ways, laser treatment can also fail and present serious side effects. The true reason for laser treatment failure or the side effects thereof, remains unknown. From the literature review conducted, and experimental results generated we conclude that an optimal laser treatment for coronary artery disease (named heart disease) can be obtained if certain critical parameters are correctly measured and understood. These parameters include the laser power, the laser beam profile, the fluence rate, the treatment time, as well as the absorption and scattering coefficients of the target treatment tissue. Therefore, this paper proposes different, accurate methods for the measurement of these critical parameters to determine the optimal laser treatment of heart disease with a minimal risk of side effects. The results from the measurement of absorption and scattering properties can be used in a computer simulation package to predict the fluence rate. The computing technique is a program based on the random number (Monte Carlo) process and probability statistics to track the propagation of photons through a biological tissue.

  16. Multiple Acquisition InSAR Analysis: Persistent Scatterer and Small Baseline Approaches

    NASA Astrophysics Data System (ADS)

    Hooper, A.

    2006-12-01

    InSAR techniques that process data from multiple acquisitions enable us to form time series of deformation and also allow us to reduce error terms present in single interferograms. There are currently two broad categories of methods that deal with multiple images: persistent scatterer methods and small baseline methods. The persistent scatterer approach relies on identifying pixels whose scattering properties vary little with time and look angle. Pixels that are dominated by a singular scatterer best meet these criteria; therefore, images are processed at full resolution to both increase the chance of there being only one dominant scatterer present, and to reduce the contribution from other scatterers within each pixel. In images where most pixels contain multiple scatterers of similar strength, even at the highest possible resolution, the persistent scatterer approach is less optimal, as the scattering characteristics of these pixels vary substantially with look angle. In this case, an approach that interferes only pairs of images for which the difference in look angle is small makes better sense, and resolution can be sacrificed to reduce the effects of the look angle difference by band-pass filtering. This is the small baseline approach. Existing small baseline methods depend on forming a series of multilooked interferograms and unwrapping each one individually. This approach fails to take advantage of two of the benefits of processing multiple acquisitions, however, which are usually embodied in persistent scatterer methods: the ability to find and extract the phase for single-look pixels with good signal-to-noise ratio that are surrounded by noisy pixels, and the ability to unwrap more robustly in three dimensions, the third dimension being that of time. We have developed, therefore, a new small baseline method to select individual single-look pixels that behave coherently in time, so that isolated stable pixels may be found. After correction for various error terms, the phase values of the selected pixels are unwrapped using a new three-dimensional algorithm. We apply our small baseline method to an area in southern Iceland that includes Katla and Eyjafjallajökull volcanoes, and retrieve a time series of deformation that shows transient deformation due to intrusion of magma beneath Eyjafjallajökull. We also process the data using the Stanford method for persistent scatterers (StaMPS) for comparison.

  17. The generalized scattering coefficient method for plane wave scattering in layered structures

    NASA Astrophysics Data System (ADS)

    Liu, Yu; Li, Chao; Wang, Huai-Yu; Zhou, Yun-Song

    2017-02-01

    The generalized scattering coefficient (GSC) method is pedagogically derived and employed to study the scattering of plane waves in homogeneous and inhomogeneous layered structures. The numerical stabilities and accuracies of this method and other commonly used numerical methods are discussed and compared. For homogeneous layered structures, concise scattering formulas with clear physical interpretations and strong numerical stability are obtained by introducing the GSCs. For inhomogeneous layered structures, three numerical methods are employed: the staircase approximation method, the power series expansion method, and the differential equation based on the GSCs. We investigate the accuracies and convergence behaviors of these methods by comparing their predictions to the exact results. The conclusions are as follows. The staircase approximation method has a slow convergence in spite of its simple and intuitive implementation, and a fine stratification within the inhomogeneous layer is required for obtaining accurate results. The expansion method results are sensitive to the expansion order, and the treatment becomes very complicated for relatively complex configurations, which restricts its applicability. By contrast, the GSC-based differential equation possesses a simple implementation while providing fast and accurate results.

  18. Monte Carlo calculation of large and small-angle electron scattering in air

    DOE PAGES

    Cohen, B. I.; Higginson, D. P.; Eng, C. D.; ...

    2017-08-12

    A Monte Carlo method for angle scattering of electrons in air that accommodates the small-angle multiple scattering and larger-angle single scattering limits is introduced. In this work, the algorithm is designed for use in a particle-in-cell simulation of electron transport and electromagnetic wave effects in air. The method is illustrated in example calculations.

  19. Nondestructive Method For Measuring The Scattering Coefficient Of Bulk Material

    NASA Astrophysics Data System (ADS)

    Groenhuis, R. A. J.; ten Bosch, J. J.

    1981-05-01

    During demineralization and remineralization of dental enamel its structure changes resulting in a change of the absorption and scattering coefficients of the enamel. By measuring these coefficients during demineralization and remineralization these processes can be monitored in a non-destructive way. For this purpose an experimental arrangement was made: a fibre illuminates a spot on the sample with monochromatic light with a wave-length between 400 nm and 700 nm; a photomultiplier measures the luminance of the light back-scattered by the sample as a function of the distance from the measuring snot to the spot of illumination. In a Monte Carlo-model this luminance is simulated using the same geometry given the scattering and absorption coefficients in a sample. Then the scattering and absorption coefficients in the sample are determined by selecting the theoretical curve fitting the experimental one. Scattering coefficients below 10 mm-1 and absorption coefficients obtained with this method on calibration samples correspond well with those obtained with another method. Scattering coefficients above 10 mm-1 (paper samples) were measured ton low. This perhaps is caused by the anisotropic structure of paper sheets. The method is very suitable to measure the scattering and absorption coefficients of bulk materials.

  20. Blood cell counting and classification by nonflowing laser light scattering method

    NASA Astrophysics Data System (ADS)

    Yang, Ye; Zhang, Zhenxi; Yang, Xinhui; Jiang, Dazong; Yeo, Joon Hock

    1999-11-01

    A new non-flowing laser light scattering method for counting and classifying blood cells is presented. A linear charge- coupled device with 1024 elements is used to detect the scattered light intensity distribution of the blood cells. A pinhole plate is combined with the CCD to compete the focusing of the measurement system. An isotropic sphere is used to simulate the blood cell. Mie theory is used to describe the scattering of blood cells. In order to inverse the size distribution of blood cells from their scattered light intensity distribution, Powell method combined with precision punishment method is used as a dependent model method for measurement red blood cells and blood plates. Non-negative constraint least square method combined with Powell method and precision punishment method is used as an independent model for measuring white blood cells. The size distributions of white blood cells and red blood cells, and the mean diameter of red blood cells are measured by this method. White blood cells can be divided into three classes: lymphocytes, middle-sized cells and neutrocytes according to their sizes. And the number of blood cells in unit volume can also be measured by the linear dependence of blood cells concentration on scattered light intensity.

  1. Possible violation of the optical theorem in LHC experiments

    NASA Astrophysics Data System (ADS)

    Kupczynski, M.

    2014-12-01

    The optical theorem (OT), allowing the determination of the total cross section for a hadron-hadron scattering from the imaginary part of the forward elastic scattering amplitude, is believed to be an unavoidable consequence of the conservation of probability and of the unitary S matrix. This is a fundamental theorem which contains an imaginary part of the forward elastic scattering amplitude that is not directly measurable. The impossibility of scattering phenomena without the elastic channel is considered to be a part of the quantum magic. However, if one takes seriously the idea that the hadrons are extended particles, one may define a unitary S matrix such that one cannot prove the OT. Moreover, data violating the OT do exist, but they are not conclusive due to the uncertainties related to the extrapolation of the differential elastic cross-section to the forward direction. These results were published several years ago, but they were forgotten. In this paper we will recall these results in an understandable way, and we will give the additional arguments why the OT can be violated in high energy strong interaction scattering and why it should be tested and not simply used as a tool in LHC experiments.

  2. Radiative heat transfer in strongly forward scattering media using the discrete ordinates method

    NASA Astrophysics Data System (ADS)

    Granate, Pedro; Coelho, Pedro J.; Roger, Maxime

    2016-03-01

    The discrete ordinates method (DOM) is widely used to solve the radiative transfer equation, often yielding satisfactory results. However, in the presence of strongly forward scattering media, this method does not generally conserve the scattering energy and the phase function asymmetry factor. Because of this, the normalization of the phase function has been proposed to guarantee that the scattering energy and the asymmetry factor are conserved. Various authors have used different normalization techniques. Three of these are compared in the present work, along with two other methods, one based on the finite volume method (FVM) and another one based on the spherical harmonics discrete ordinates method (SHDOM). In addition, the approximation of the Henyey-Greenstein phase function by a different one is investigated as an alternative to the phase function normalization. The approximate phase function is given by the sum of a Dirac delta function, which accounts for the forward scattering peak, and a smoother scaled phase function. In this study, these techniques are applied to three scalar radiative transfer test cases, namely a three-dimensional cubic domain with a purely scattering medium, an axisymmetric cylindrical enclosure containing an emitting-absorbing-scattering medium, and a three-dimensional transient problem with collimated irradiation. The present results show that accurate predictions are achieved for strongly forward scattering media when the phase function is normalized in such a way that both the scattered energy and the phase function asymmetry factor are conserved. The normalization of the phase function may be avoided using the FVM or the SHDOM to evaluate the in-scattering term of the radiative transfer equation. Both methods yield results whose accuracy is similar to that obtained using the DOM along with normalization of the phase function. Very satisfactory predictions were also achieved using the delta-M phase function, while the delta-Eddington phase function and the transport approximation may perform poorly.

  3. Multi-hybrid method for investigation of EM scattering from inhomogeneous object above a dielectric rough surface

    NASA Astrophysics Data System (ADS)

    Li, Jie; Guo, LiXin; He, Qiong; Wei, Bing

    2012-10-01

    An iterative strategy combining Kirchhoff approximation^(KA) with the hybrid finite element-boundary integral (FE-BI) method is presented in this paper to study the interactions between the inhomogeneous object and the underlying rough surface. KA is applied to study scattering from underlying rough surfaces, whereas FE-BI deals with scattering from the above target. Both two methods use updated excitation sources. Huygens equivalence principle and an iterative strategy are employed to consider the multi-scattering effects. This hybrid FE-BI-KA scheme is an improved and generalized version of previous hybrid Kirchhoff approximation-method of moments (KA-MoM). This newly presented hybrid method has the following advantages: (1) the feasibility of modeling multi-scale scattering problems (large scale underlying surface and small scale target); (2) low memory requirement as in hybrid KA-MoM; (3) the ability to deal with scattering from inhomogeneous (including coated or layered) scatterers above rough surfaces. The numerical results are given to evaluate the accuracy of the multi-hybrid technique; the computing time and memory requirements consumed in specific numerical simulation of FE-BI-KA are compared with those of MoM. The convergence performance is analyzed by studying the iteration number variation caused by related parameters. Then bistatic scattering from inhomogeneous object of different configurations above dielectric Gaussian rough surface is calculated and the influences of dielectric compositions and surface roughness on the scattering pattern are discussed.

  4. Formation of S-type planets in close binaries: scattering induced tidal capture of circumbinary planets

    NASA Astrophysics Data System (ADS)

    Gong, Yan-Xiang; Ji, Jianghui

    2018-05-01

    Although several S-type and P-type planets in binary systems were discovered in past years, S-type planets have not yet been found in close binaries with an orbital separation not more than 5 au. Recent studies suggest that S-type planets in close binaries may be detected through high-accuracy observations. However, nowadays planet formation theories imply that it is difficult for S-type planets in close binaries systems to form in situ. In this work, we extensively perform numerical simulations to explore scenarios of planet-planet scattering among circumbinary planets and subsequent tidal capture in various binary configurations, to examine whether the mechanism can play a part in producing such kind of planets. Our results show that this mechanism is robust. The maximum capture probability is ˜10%, which can be comparable to the tidal capture probability of hot Jupiters in single star systems. The capture probability is related to binary configurations, where a smaller eccentricity or a low mass ratio of the binary will lead to a larger probability of capture, and vice versa. Furthermore, we find that S-type planets with retrograde orbits can be naturally produced via capture process. These planets on retrograde orbits can help us distinguish in situ formation and post-capture origin for S-type planet in close binaries systems. The forthcoming missions (PLATO) will provide the opportunity and feasibility to detect such planets. Our work provides several suggestions for selecting target binaries in search for S-type planets in the near future.

  5. Three-Dimensional Electromagnetic Scattering from Layered Media with Rough Interfaces for Subsurface Radar Remote Sensing

    NASA Astrophysics Data System (ADS)

    Duan, Xueyang

    The objective of this dissertation is to develop forward scattering models for active microwave remote sensing of natural features represented by layered media with rough interfaces. In particular, soil profiles are considered, for which a model of electromagnetic scattering from multilayer rough surfaces with or without buried random media is constructed. Starting from a single rough surface, radar scattering is modeled using the stabilized extended boundary condition method (SEBCM). This method solves the long-standing instability issue of the classical EBCM, and gives three-dimensional full wave solutions over large ranges of surface roughnesses with higher computational efficiency than pure numerical solutions, e.g., method of moments (MoM). Based on this single surface solution, multilayer rough surface scattering is modeled using the scattering matrix approach and the model is used for a comprehensive sensitivity analysis of the total ground scattering as a function of layer separation, subsurface statistics, and sublayer dielectric properties. The buried inhomogeneities such as rocks and vegetation roots are considered for the first time in the forward scattering model. Radar scattering from buried random media is modeled by the aggregate transition matrix using either the recursive transition matrix approach for spherical or short-length cylindrical scatterers, or the generalized iterative extended boundary condition method we developed for long cylinders or root-like cylindrical clusters. These approaches take the field interactions among scatterers into account with high computational efficiency. The aggregate transition matrix is transformed to a scattering matrix for the full solution to the layered-medium problem. This step is based on the near-to-far field transformation of the numerical plane wave expansion of the spherical harmonics and the multipole expansion of plane waves. This transformation consolidates volume scattering from the buried random medium with the scattering from layered structure in general. Combined with scattering from multilayer rough surfaces, scattering contributions from subsurfaces and vegetation roots can be then simulated. Solutions of both the rough surface scattering and random media scattering are validated numerically, experimentally, or both. The experimental validations have been carried out using a laboratory-based transmit-receive system for scattering from random media and a new bistatic tower-mounted radar system for field-based surface scattering measurements.

  6. Apparatus and method for spectroscopic analysis of scattering media

    DOEpatents

    Strobl, Karlheinz; Bigio, Irving J.; Loree, Thomas R.

    1994-01-01

    Apparatus and method for spectroscopic analysis of scattering media. Subtle differences in materials have been found to be detectable from plots of intensity as a function of wavelength of collected emitted and scattered light versus wavelength of excitation light.

  7. Rydberg Molecules for Ion-Atom Scattering in the Ultracold Regime

    NASA Astrophysics Data System (ADS)

    Schmid, T.; Veit, C.; Zuber, N.; Löw, R.; Pfau, T.; Tarana, M.; Tomza, M.

    2018-04-01

    We propose a novel experimental method to extend the investigation of ion-atom collisions from the so far studied cold, essentially classical regime to the ultracold, quantum regime. The key aspect of this method is the use of Rydberg molecules to initialize the ultracold ion-atom scattering event. We exemplify the proposed method with the lithium ion-atom system, for which we present simulations of how the initial Rydberg molecule wave function, freed by photoionization, evolves in the presence of the ion-atom scattering potential. We predict bounds for the ion-atom scattering length from ab initio calculations of the interaction potential. We demonstrate that, in the predicted bounds, the scattering length can be experimentally determined from the velocity of the scattered wave packet in the case of 6Li+ = 6Li and from the molecular ion fraction in the case of 7Li+ - 7Li. The proposed method to utilize Rydberg molecules for ultracold ion-atom scattering, here particularized for the lithium ion-atom system, is readily applicable to other ion-atom systems as well.

  8. Rydberg Molecules for Ion-Atom Scattering in the Ultracold Regime.

    PubMed

    Schmid, T; Veit, C; Zuber, N; Löw, R; Pfau, T; Tarana, M; Tomza, M

    2018-04-13

    We propose a novel experimental method to extend the investigation of ion-atom collisions from the so far studied cold, essentially classical regime to the ultracold, quantum regime. The key aspect of this method is the use of Rydberg molecules to initialize the ultracold ion-atom scattering event. We exemplify the proposed method with the lithium ion-atom system, for which we present simulations of how the initial Rydberg molecule wave function, freed by photoionization, evolves in the presence of the ion-atom scattering potential. We predict bounds for the ion-atom scattering length from ab initio calculations of the interaction potential. We demonstrate that, in the predicted bounds, the scattering length can be experimentally determined from the velocity of the scattered wave packet in the case of ^{6}Li^{+}-^{6}Li and from the molecular ion fraction in the case of ^{7}Li^{+}-^{7}Li. The proposed method to utilize Rydberg molecules for ultracold ion-atom scattering, here particularized for the lithium ion-atom system, is readily applicable to other ion-atom systems as well.

  9. Advances in the microrheology of complex fluids

    NASA Astrophysics Data System (ADS)

    Waigh, Thomas Andrew

    2016-07-01

    New developments in the microrheology of complex fluids are considered. Firstly the requirements for a simple modern particle tracking microrheology experiment are introduced, the error analysis methods associated with it and the mathematical techniques required to calculate the linear viscoelasticity. Progress in microrheology instrumentation is then described with respect to detectors, light sources, colloidal probes, magnetic tweezers, optical tweezers, diffusing wave spectroscopy, optical coherence tomography, fluorescence correlation spectroscopy, elastic- and quasi-elastic scattering techniques, 3D tracking, single molecule methods, modern microscopy methods and microfluidics. New theoretical techniques are also reviewed such as Bayesian analysis, oversampling, inversion techniques, alternative statistical tools for tracks (angular correlations, first passage probabilities, the kurtosis, motor protein step segmentation etc), issues in micro/macro rheological agreement and two particle methodologies. Applications where microrheology has begun to make some impact are also considered including semi-flexible polymers, gels, microorganism biofilms, intracellular methods, high frequency viscoelasticity, comb polymers, active motile fluids, blood clots, colloids, granular materials, polymers, liquid crystals and foods. Two large emergent areas of microrheology, non-linear microrheology and surface microrheology are also discussed.

  10. Data consistency-driven scatter kernel optimization for x-ray cone-beam CT

    NASA Astrophysics Data System (ADS)

    Kim, Changhwan; Park, Miran; Sung, Younghun; Lee, Jaehak; Choi, Jiyoung; Cho, Seungryong

    2015-08-01

    Accurate and efficient scatter correction is essential for acquisition of high-quality x-ray cone-beam CT (CBCT) images for various applications. This study was conducted to demonstrate the feasibility of using the data consistency condition (DCC) as a criterion for scatter kernel optimization in scatter deconvolution methods in CBCT. As in CBCT, data consistency in the mid-plane is primarily challenged by scatter, we utilized data consistency to confirm the degree of scatter correction and to steer the update in iterative kernel optimization. By means of the parallel-beam DCC via fan-parallel rebinning, we iteratively optimized the scatter kernel parameters, using a particle swarm optimization algorithm for its computational efficiency and excellent convergence. The proposed method was validated by a simulation study using the XCAT numerical phantom and also by experimental studies using the ACS head phantom and the pelvic part of the Rando phantom. The results showed that the proposed method can effectively improve the accuracy of deconvolution-based scatter correction. Quantitative assessments of image quality parameters such as contrast and structure similarity (SSIM) revealed that the optimally selected scatter kernel improves the contrast of scatter-free images by up to 99.5%, 94.4%, and 84.4%, and of the SSIM in an XCAT study, an ACS head phantom study, and a pelvis phantom study by up to 96.7%, 90.5%, and 87.8%, respectively. The proposed method can achieve accurate and efficient scatter correction from a single cone-beam scan without need of any auxiliary hardware or additional experimentation.

  11. New Treatment of Strongly Anisotropic Scattering Phase Functions: The Delta-M+ Method

    NASA Astrophysics Data System (ADS)

    Stamnes, K. H.; Lin, Z.; Chen, N.; Fan, Y.; Li, W.; Stamnes, S.

    2017-12-01

    The treatment of strongly anisotropic scattering phase functions is still a challenge for accurate radiance computations. The new Delta-M+ method resolves this problem by introducing a reliable, fast, accurate, and easy-to-use Legendre expansion of the scattering phase function with modified moments. Delta-M+ is an upgrade of the widely-used Delta-M method that truncates the forward scattering cone into a Dirac-delta-function (a direct beam), where the + symbol indicates that it essentially matches moments above the first 2M terms. Compared with the original Delta-M method, Delta-M+ has the same computational efficiency, but the accuracy has been increased dramatically. Tests show that the errors for strongly forward-peaked scattering phase functions are greatly reduced. Furthermore, the accuracy and stability of radiance computations are also significantly improved by applying the new Delta-M+ method.

  12. Bidirectional light-scattering image processing method for high-concentration jet sprays

    NASA Astrophysics Data System (ADS)

    Shimizu, I.; Emori, Y.; Yang, W.-J.; Shimoda, M.; Suzuki, T.

    1985-01-01

    In order to study the distributions of droplet size and volume density in high-concentration jet sprays, a new technique is developed, which combines the forward and backward light scattering method and an image processing method. A pulsed ruby laser is used as the light source. The Mie scattering theory is applied to the results obtained from image processing on the scattering photographs. The time history is obtained for the droplet size and volume density distributions, and the method is demonstrated by diesel fuel sprays under various injecting conditions. The validity of the technique is verified by a good agreement in the injected fuel volume distributions obtained by the present method and by injection rate measurements.

  13. Retrieval of the scattering and microphysical properties of aerosols from ground-based optical measurements including polarization. I. Method.

    PubMed

    Vermeulen, A; Devaux, C; Herman, M

    2000-11-20

    A method has been developed for retrieving the scattering and microphysical properties of atmospheric aerosol from measurements of solar transmission, aureole, and angular distribution of the scattered and polarized sky light in the solar principal plane. Numerical simulations of measurements have been used to investigate the feasibility of the method and to test the algorithm's performance. It is shown that the absorption and scattering properties of an aerosol, i.e., the single-scattering albedo, the phase function, and the polarization for single scattering of incident unpolarized light, can be obtained by use of radiative transfer calculations to correct the values of scattered radiance and polarized radiance for multiple scattering, Rayleigh scattering, and the influence of ground. The method requires only measurement of the aerosol's optical thickness and an estimate of the ground's reflectance and does not need any specific assumption about properties of the aerosol. The accuracy of the retrieved phase function and polarization of the aerosols is examined at near-infrared wavelengths (e.g., 0.870 mum). The aerosol's microphysical properties (size distribution and complex refractive index) are derived in a second step. The real part of the refractive index is a strong function of the polarization, whereas the imaginary part is strongly dependent on the sky's radiance and the retrieved single-scattering albedo. It is demonstrated that inclusion of polarization data yields the real part of the refractive index.

  14. Electron scattering intensities and Patterson functions of Skyrmions

    NASA Astrophysics Data System (ADS)

    Karliner, M.; King, C.; Manton, N. S.

    2016-06-01

    The scattering of electrons off nuclei is one of the best methods of probing nuclear structure. In this paper we focus on electron scattering off nuclei with spin and isospin zero within the Skyrme model. We consider two distinct methods and simplify our calculations by use of the Born approximation. The first method is to calculate the form factor of the spherically averaged Skyrmion charge density; the second uses the Patterson function to calculate the scattering intensity off randomly oriented Skyrmions, and spherically averages at the end. We compare our findings with experimental scattering data. We also find approximate analytical formulae for the first zero and first stationary point of a form factor.

  15. An efficient algorithm for the generalized Foldy-Lax formulation

    NASA Astrophysics Data System (ADS)

    Huang, Kai; Li, Peijun; Zhao, Hongkai

    2013-02-01

    Consider the scattering of a time-harmonic plane wave incident on a two-scale heterogeneous medium, which consists of scatterers that are much smaller than the wavelength and extended scatterers that are comparable to the wavelength. In this work we treat those small scatterers as isotropic point scatterers and use a generalized Foldy-Lax formulation to model wave propagation and capture multiple scattering among point scatterers and extended scatterers. Our formulation is given as a coupled system, which combines the original Foldy-Lax formulation for the point scatterers and the regular boundary integral equation for the extended obstacle scatterers. The existence and uniqueness of the solution for the formulation is established in terms of physical parameters such as the scattering coefficient and the separation distances. Computationally, an efficient physically motivated Gauss-Seidel iterative method is proposed to solve the coupled system, where only a linear system of algebraic equations for point scatterers or a boundary integral equation for a single extended obstacle scatterer is required to solve at each step of iteration. The convergence of the iterative method is also characterized in terms of physical parameters. Numerical tests for the far-field patterns of scattered fields arising from uniformly or randomly distributed point scatterers and single or multiple extended obstacle scatterers are presented.

  16. Statistical analysis of dislocations and dislocation boundaries from EBSD data.

    PubMed

    Moussa, C; Bernacki, M; Besnard, R; Bozzolo, N

    2017-08-01

    Electron BackScatter Diffraction (EBSD) is often used for semi-quantitative analysis of dislocations in metals. In general, disorientation is used to assess Geometrically Necessary Dislocations (GNDs) densities. In the present paper, we demonstrate that the use of disorientation can lead to inaccurate results. For example, using the disorientation leads to different GND density in recrystallized grains which cannot be physically justified. The use of disorientation gradients allows accounting for measurement noise and leads to more accurate results. Misorientation gradient is then used to analyze dislocations boundaries following the same principle applied on TEM data before. In previous papers, dislocations boundaries were defined as Geometrically Necessary Boundaries (GNBs) and Incidental Dislocation Boundaries (IDBs). It has been demonstrated in the past, through transmission electron microscopy data, that the probability density distribution of the disorientation of IDBs and GNBs can be described with a linear combination of two Rayleigh functions. Such function can also describe the probability density of disorientation gradient obtained through EBSD data as reported in this paper. This opens the route for determining IDBs and GNBs probability density distribution functions separately from EBSD data, with an increased statistical relevance as compared to TEM data. The method is applied on deformed Tantalum where grains exhibit dislocation boundaries, as observed using electron channeling contrast imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. A preview of a microgravity laser light scattering instrument

    NASA Astrophysics Data System (ADS)

    Meyer, W. V.; Ansari, R. R.

    1991-01-01

    The development of a versatile, miniature, modular light scattering instrument to be used in microgravity is described. The instrument will measure microscopic particles in the size range of thirty angstroms to above three microns. This modular instrument permits several configurations, each optimized for a particular experiment. In particular, a multiangle instrument will probably be mounted in a rack in the Space Shuttle and on the Space Station. It is possible that a Space Shuttle glove-box and a lap-top computer containing a correlator card can be used to perform a number of experiments and to demonstrate the technology needed for more elaborate investigations.

  18. Imaging Fukushima Daiichi reactors with muons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyadera, Haruo; Borozdin, Konstantin N.; Greene, Steve J.

    2013-05-15

    A study of imaging the Fukushima Daiichi reactors with cosmic-ray muons to assess the damage to the reactors is presented. Muon scattering imaging has high sensitivity for detecting uranium fuel and debris even through thick concrete walls and a reactor pressure vessel. Technical demonstrations using a reactor mockup, detector radiation test at Fukushima Daiichi, and simulation studies have been carried out. These studies establish feasibility for the reactor imaging. A few months of measurement will reveal the spatial distribution of the reactor fuel. The muon scattering technique would be the best and probably the only way for Fukushima Daiichi tomore » make this determination in the near future.« less

  19. Imaging Fukushima Daiichi reactors with muons

    NASA Astrophysics Data System (ADS)

    Miyadera, Haruo; Borozdin, Konstantin N.; Greene, Steve J.; Lukić, Zarija; Masuda, Koji; Milner, Edward C.; Morris, Christopher L.; Perry, John O.

    2013-05-01

    A study of imaging the Fukushima Daiichi reactors with cosmic-ray muons to assess the damage to the reactors is presented. Muon scattering imaging has high sensitivity for detecting uranium fuel and debris even through thick concrete walls and a reactor pressure vessel. Technical demonstrations using a reactor mockup, detector radiation test at Fukushima Daiichi, and simulation studies have been carried out. These studies establish feasibility for the reactor imaging. A few months of measurement will reveal the spatial distribution of the reactor fuel. The muon scattering technique would be the best and probably the only way for Fukushima Daiichi to make this determination in the near future.

  20. Magnetic excitations in the orbital disordered phase of MnV2O4

    NASA Astrophysics Data System (ADS)

    Matsuura, Keisuke; Sagayama, Hajime; Uehara, Amane; Nii, Yoichi; Kajimoto, Ryoichi; Kamazawa, Kazuya; Ikeuchi, Kazuhiko; Ji, Sungdae; Abe, Nobuyuki; Arima, Taka-hisa

    2018-05-01

    We have investigated the temperature dependence of magnetic dynamics in a spinel-type vanadium oxide MnV2O4 by inelastic neutron scattering. The scattering intensity of excitation around 20 meV disappears in the collinear intermediate-temperature cubic-ferrimagnetic phase, which reveals that this excitation should be peculiar to the orbital ordered phase. We have found a weakly dispersive mode emergent from a non-integer wavevector (1.4,1.4,0) at 56 K, which lies in the cubic-ferrimagnetic phase between non-coplanar ferrimagnetic and paramagnetic phases. This indicates that the probable presence of an incommensurate instability in the simple collinear structure.

  1. Quark charge retention in final state hadrons from deep inelastic muon scattering

    NASA Astrophysics Data System (ADS)

    Albanese, J. P.; Arneodo, M.; Arvidson, A.; Aubert, J. J.; Becks, K. H.; Bee, C.; Benchouk, C.; Bird, I.; Blum, D.; Böhm, E.; de Bouard, X.; Brasse, F. W.; Braun, H.; Broll, C.; Brown, S.; Brück, H.; Calen, H.; Callebaut, D.; Carr, J.; Chima, J. S.; Clifft, R.; Cobb, J. H.; Coignet, G.; Combley, F.; Coughlan, J.; Court, G. R.; D'Agostini, G.; Dahlgren, S.; Davies, J. K.; Dau, W. D.; Dengler, F.; Derado, I.; Dobinson, R. W.; Dosselli, U.; Dreyer, T.; Drees, J.; Dumont, J. J.; Düren, M.; Eckardt, V.; Edwards, A.; Edwards, M.; Ernst, T.; Eszes, G.; Favier, J.; Ferrero, M. I.; Figiel, J.; Flauger, W.; Foster, J.; Gabathuler, E.; Gamet, R.; Gayler, J.; Geddes, N.; Giubellino, P.; Gössling, C.; Grafström, P.; Grard, F.; Gustafsson, L.; Haas, J.; Hagberg, E.; Hasert, F. J.; Hayman, P.; Heusse, P.; Hoppe, C.; Jaffré, M.; Jachołkowska, A.; Janata, F.; Jancso, G.; Johnson, A. S.; Kabuss, E. M.; Kellner, G.; Korbel, V.; Krüger, J.; Kullander, S.; Landgraf, U.; Lanske, D.; Loken, J.; Long, K.; Maire, M.; Manz, A.; Mohr, W.; Montanet, F.; Montgomery, H. E.; Mount, R. P.; Nagy, E.; Nassalski, J.; Norton, P. R.; Oakham, F. G.; Osborne, A. M.; Pascaud, C.; Paul, L.; Payre, P.; Peroni, C.; Pessard, H.; Pettingale, J.; Pönsgen, B.; Pötsch, M.; Preissner, H.; Renton, P.; Ribarics, P.; Rith, K.; Rondio, E.; Schlagböhmer, A.; Schmitz, N.; Schneegans, M.; Schröder, T.; Schultze, K.; Shiers, J.; Sloan, T.; Stier, H. E.; Stockhausen, W.; Studt, M.; Taylor, G.; Thénard, J. M.; Thompson, J. C.; de la Torre, A.; Toth, J.; Urban, L.; Wahlen, H.; Wallucks, W.; Whalley, M.; Williams, W. S. C.; Wheeler, S.; Wimpenny, S.; Windmolders, R.; Wolf, G.; Zank, P.; European Muon Collaboration

    1984-08-01

    The net charge of final state hadrons in both the current and target fragmentation regions has been measured in 280 GeV/ c muon-proton scattering experiment. A clean kinematic separation of the two regions in the centre-of-mass rapidity is demonstrated. The dependence on xBj of the mean net charges is found to be consistent with a large contribution of sea quarks at small xBj and with the dominance of valence quarks at large xBj thus giving clear confirmation of the quarck- parton model. It is also shown that the lending forward hadron has a high probability of containing the struck quark.

  2. Method for measuring multiple scattering corrections between liquid scintillators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Verbeke, J. M.; Glenn, A. M.; Keefer, G. J.

    2016-04-11

    In this study, a time-of-flight method is proposed to experimentally quantify the fractions of neutrons scattering between scintillators. An array of scintillators is characterized in terms of crosstalk with this method by measuring a californium source, for different neutron energy thresholds. The spectral information recorded by the scintillators can be used to estimate the fractions of neutrons multiple scattering. With the help of a correction to Feynman's point model theory to account for multiple scattering, these fractions can in turn improve the mass reconstruction of fissile materials under investigation.

  3. Photoacoustic tomography based on the Green's function retrieval with ultrasound interferometry for sample partially behind an acoustically scattering layer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yin, Jie; Department of Automation, Nanjing Polytechnic Institute, 210048 Nanjing; Tao, Chao, E-mail: taochao@nju.edu.cn

    2015-06-08

    Acoustically inhomogeneous mediums with multiple scattering are often the nightmare of photoacoustic tomography. In order to break this limitation, a photoacoustic tomography scheme combining ultrasound interferometry and time reversal is proposed to achieve images in acoustically scattering medium. An ultrasound interferometry is developed to determine the unknown Green's function of strong scattering tissue. Using the determined Greens' function, a time-reversal process is carried out to restore images behind an acoustically inhomogeneous layer from the scattering photoacoustic signals. This method effectively decreases the false contrast, noise, and position deviation of images induced by the multiple scattering. Phantom experiment is carried outmore » to validate the method. Therefore, the proposed method could have potential value in extending the biomedical applications of photoacoustic tomography in acoustically inhomogeneous tissue.« less

  4. First measurement of electron temperature from signal ratios in a double-pass Thomson scattering system.

    PubMed

    Tojo, H; Ejiri, A; Hiratsuka, J; Yamaguchi, T; Takase, Y; Itami, K; Hatae, T

    2012-02-01

    This paper presents an experimental demonstration to determine electron temperature (T(e)) with unknown spectral sensitivity (transmissivity) in a Thomson scattering system. In this method, a double-pass scattering configuration is used and the scattered lights from each pass (with different scattering angles) are measured separately. T(e) can be determined from the ratio of the signal intensities without knowing a real chromatic dependence in the sensitivity. Note that the wavelength range for each spectral channel must be known. This method was applied to the TST-2 Thomson scattering system. As a result, T(e) measured from the ratio (T(e,r)) and T(e) measured from a standard method (T(e,s)) showed a good agreement with <∣T(e,r) - T(e,s)∣∕T(e,s)> = 7.3%.

  5. Data-centric method for object observation through scattering media

    NASA Astrophysics Data System (ADS)

    Tanida, Jun; Horisaki, Ryoichi

    2018-03-01

    A data-centric method is introduced for object observation through scattering media. A large number of training pairs are used to characterize the relation between the object and the observation signals based on machine learning. Using the method object information can be retrieved even from strongly-disturbed signals. As potential applications, object recognition, imaging, and focusing through scattering media were demonstrated.

  6. SS-HORSE method for studying resonances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blokhintsev, L. D.; Mazur, A. I.; Mazur, I. A., E-mail: 008043@pnu.edu.ru

    A new method for analyzing resonance states based on the Harmonic-Oscillator Representation of Scattering Equations (HORSE) formalism and analytic properties of partial-wave scattering amplitudes is proposed. The method is tested by applying it to the model problem of neutral-particle scattering and can be used to study resonance states on the basis of microscopic calculations performed within various versions of the shell model.

  7. Relation between scattering and production amplitude--Case of intermediate {sigma}-particle in {pi}{pi}-system--

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ishida, Muneyuki; Ishida, Shin; Ishida, Taku

    1998-05-29

    The relation between scattering and production amplitudes are investigated, using a simple field theoretical model, from the general viewpoint of unitarity and the applicability of final state interaction (FSI-) theorem. The IA-method and VMW-method, which are applied to our phenomenological analyses [2,3] suggesting the {sigma}-existence, are obtained as the physical state representations of scattering and production amplitudes, respectively. Moreover, the VMW-method is shown to be an effective method to obtain the resonance properties from general production processes, while the conventional analyses based on the 'universality' of {pi}{pi}-scattering amplitude are powerless for this purpose.

  8. Relation between scattering and production amplitude—Case of intermediate σ-particle in ππ-system—

    NASA Astrophysics Data System (ADS)

    Ishida, Muneyuki; Ishida, Shin; Ishida, Taku

    1998-05-01

    The relation between scattering and production amplitudes are investigated, using a simple field theoretical model, from the general viewpoint of unitarity and the applicability of final state interaction (FSI-) theorem. The IA-method and VMW-method, which are applied to our phenomenological analyses [2,3] suggesting the σ-existence, are obtained as the physical state representations of scattering and production amplitudes, respectively. Moreover, the VMW-method is shown to be an effective method to obtain the resonance properties from general production processes, while the conventional analyses based on the "universality" of ππ-scattering amplitude are powerless for this purpose.

  9. Analysis method for Thomson scattering diagnostics in GAMMA 10/PDX.

    PubMed

    Ohta, K; Yoshikawa, M; Yasuhara, R; Chikatsu, M; Shima, Y; Kohagura, J; Sakamoto, M; Nakasima, Y; Imai, T; Ichimura, M; Yamada, I; Funaba, H; Minami, T

    2016-11-01

    We have developed an analysis method to improve the accuracies of electron temperature measurement by employing a fitting technique for the raw Thomson scattering (TS) signals. Least square fitting of the raw TS signals enabled reduction of the error in the electron temperature measurement. We applied the analysis method to a multi-pass (MP) TS system. Because the interval between the MPTS signals is very short, it is difficult to separately analyze each Thomson scattering signal intensity by using the raw signals. We used the fitting method to obtain the original TS scattering signals from the measured raw MPTS signals to obtain the electron temperatures in each pass.

  10. A diffusion approximation for ocean wave scatterings by randomly distributed ice floes

    NASA Astrophysics Data System (ADS)

    Zhao, Xin; Shen, Hayley

    2016-11-01

    This study presents a continuum approach using a diffusion approximation method to solve the scattering of ocean waves by randomly distributed ice floes. In order to model both strong and weak scattering, the proposed method decomposes the wave action density function into two parts: the transmitted part and the scattered part. For a given wave direction, the transmitted part of the wave action density is defined as the part of wave action density in the same direction before the scattering; and the scattered part is a first order Fourier series approximation for the directional spreading caused by scattering. An additional approximation is also adopted for simplification, in which the net directional redistribution of wave action by a single scatterer is assumed to be the reflected wave action of a normally incident wave into a semi-infinite ice cover. Other required input includes the mean shear modulus, diameter and thickness of ice floes, and the ice concentration. The directional spreading of wave energy from the diffusion approximation is found to be in reasonable agreement with the previous solution using the Boltzmann equation. The diffusion model provides an alternative method to implement wave scattering into an operational wave model.

  11. Numerical Model of Multiple Scattering and Emission from Layering Snowpack for Microwave Remote Sensing

    NASA Astrophysics Data System (ADS)

    Jin, Y.; Liang, Z.

    2002-12-01

    The vector radiative transfer (VRT) equation is an integral-deferential equation to describe multiple scattering, absorption and transmission of four Stokes parameters in random scatter media. From the integral formal solution of VRT equation, the lower order solutions, such as the first-order scattering for a layer medium or the second order scattering for a half space, can be obtained. The lower order solutions are usually good at low frequency when high-order scattering is negligible. It won't be feasible to continue iteration for obtaining high order scattering solution because too many folds integration would be involved. In the space-borne microwave remote sensing, for example, the DMSP (Defense Meterological Satellite Program) SSM/I (Special Sensor Microwave/Imager) employed seven channels of 19, 22, 37 and 85GHz. Multiple scattering from the terrain surfaces such as snowpack cannot be neglected at these channels. The discrete ordinate and eigen-analysis method has been studied to take into account for multiple scattering and applied to remote sensing of atmospheric precipitation, snowpack etc. Snowpack was modeled as a layer of dense spherical particles, and the VRT for a layer of uniformly dense spherical particles has been numerically studied by the discrete ordinate method. However, due to surface melting and refrozen crusts, the snowpack undergoes stratifying to form inhomegeneous profiles of the ice grain size, fractional volume and physical temperature etc. It becomes necessary to study multiple scattering and emission from stratified snowpack of dense ice grains. But, the discrete ordinate and eigen-analysis method cannot be simply applied to multi-layers model, because numerically solving a set of multi-equations of VRT is difficult. Stratifying the inhomogeneous media into multi-slabs and employing the first order Mueller matrix of each thin slab, this paper developed an iterative method to derive high orders scattering solutions of whole scatter media. High order scattering and emission from inhomogeneous stratifying media of dense spherical particles are numerically obtained. The brightness temperature at low frequency such as 5.3 GHz without high order scattering and at SSM/I channels with high order scattering are obtained. This approach is also compared with the conventional discrete ordinate method for an uniform layer model. Numerical simulation for inhomogeneous snowpack is also compared with the measurements of microwave remote sensing.

  12. Wide-field imaging through scattering media by scattered light fluorescence microscopy

    NASA Astrophysics Data System (ADS)

    Zhou, Yulan; Li, Xun

    2017-08-01

    To obtain images through scattering media, scattered light fluorescence (SLF) microscopy that utilizes the optical memory effect has been developed. However, the small field of view (FOV) of SLF microscopy limits its application. In this paper, we have introduced a re-modulation method to achieve wide-field imaging through scattering media by SLF microscopy. In the re-modulation method, to raster scan the focus across the object plane, the incident wavefront is re-modulated via a spatial light modulator (SLM) in the updated phase compensation calculated using the optimized iterative algorithm. Compared with the conventional optical memory effect method, the re-modulation method can greatly increase the FOV of a SLF microscope. With the phase compensation theoretically calculated, the process of updating the phase compensation of a high speed SLM is fast. The re-modulation method does not increase the imaging time. The re-modulation method is, therefore, expected to make SLF microscopy have much wider applications in biology, medicine and physiology.

  13. Mixing Single Scattering Properties in Vector Radiative Transfer for Deterministic and Stochastic Solutions

    NASA Astrophysics Data System (ADS)

    Mukherjee, L.; Zhai, P.; Hu, Y.; Winker, D. M.

    2016-12-01

    Among the primary factors, which determine the polarized radiation, field of a turbid medium are the single scattering properties of the medium. When multiple types of scatterers are present, the single scattering properties of the scatterers need to be properly mixed in order to find the solutions to the vector radiative transfer theory (VRT). The VRT solvers can be divided into two types: deterministic and stochastic. The deterministic solver can only accept one set of single scattering property in its smallest discretized spatial volume. When the medium contains more than one kind of scatterer, their single scattering properties are averaged, and then used as input for the deterministic solver. The stochastic solver, can work with different kinds of scatterers explicitly. In this work, two different mixing schemes are studied using the Successive Order of Scattering (SOS) method and Monte Carlo (MC) methods. One scheme is used for deterministic and the other is used for the stochastic Monte Carlo method. It is found that the solutions from the two VRT solvers using two different mixing schemes agree with each other extremely well. This confirms the equivalence to the two mixing schemes and also provides a benchmark for the VRT solution for the medium studied.

  14. Agreement between Results of Home Sleep Testing for Obstructive Sleep Apnea with and without a Sleep Specialist

    PubMed Central

    Aurora, R. Nisha; Putcha, Nirupama; Swartz, Rachel; Punjabi, Naresh M.

    2016-01-01

    Background Obstructive sleep apnea is a prevalent yet underdiagnosed condition associated with cardiovascular morbidity and mortality. Home sleep testing offers an efficient means for diagnosing obstructive sleep apnea but has primarily been deployed in clinical samples with a high pretest probability. The current study sought to assess if obstructive sleep apnea can be diagnosed with home sleep testing in a non-referred sample without involvement of a sleep medicine specialist. Methods A study of community-based adults with untreated obstructive sleep apnea was undertaken. Misclassification of disease severity based on home sleep testing with and without involvement of a sleep medicine specialist was assessed, and agreement was characterized using scatter plots, Pearson's correlation coefficient, Bland-Altman analysis, and the kappa statistic. Analyses were also conducted to assess whether any observed differences varied as a function of pretest probability of obstructive sleep apnea or subjective sleepiness. Results The sample consisted of 191 subjects with over half (56.5%) having obstructive sleep apnea. Without involvement of a sleep medicine specialist, obstructive sleep apnea was not identified in only 5.8% of the sample. Analyses comparing the categorical assessment of disease severity with and without a sleep medicine specialist showed that in total, 32 subjects (16.8%) were misclassified. Agreement in the disease severity with and without a sleep medicine specialist was not influenced by the pretest probability or daytime sleep tendency. Conclusion Obstructive sleep apnea can be reliably identified with home sleep testing in a non-referred sample irrespective of the pretest probability of the disease. PMID:26968467

  15. Rare earth element concentrations in dissolved and acid available particulate forms for eastern UK rivers

    NASA Astrophysics Data System (ADS)

    Neal, C.

    2007-01-01

    Variations in concentration of yttrium (Y), lanthanum (La), cerium (Ce), neodymium (Nd), samarium (Sm) and gadolinium (Gd) among rivers of eastern England and the border with Scotland are described in relation to the dissolved (<0.45 µM) fraction and acid-available particulate (AAP) fractions. The rivers cover a range of rural, agricultural and urban/industrial environments. Yttrium and the lanthanides show significant levels of both dissolved and acid-available particulate forms (typically about 40% in the dissolved form). For the dissolved phase, Y and the lanthanides are linearly correlated with each other and with iron: most of this dissolved component may be in a micro-particulate/colloidal form. The Y and lanthanide relationships show marked scatter and there are anomalously high La concentrations at times for the rivers Great Ouse, Thames and Wear that are probably linked to pollutant sources. For the Ouse, and especially for one of its tributaries, the Swale, relatively high Sm concentrations are probably associated with mineralisation within the catchment and contamination of the associated flood plain. For the AAP components, there are strong linear relationships with Y and the lanthanides across all the rivers. There is also a strong link between these AAP associated REE and AAP iron, although the scatter is greater and the industrial rivers have a lower lanthanide to iron ratio, probably due to iron-rich contaminants.

  16. X-ray coherent scattering tomography of textured material (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Zhu, Zheyuan; Pang, Shuo

    2017-05-01

    Small-angle X-ray scattering (SAXS) measures the signature of angular-dependent coherently scattered X-rays, which contains richer information in material composition and structure compared to conventional absorption-based computed tomography. SAXS image reconstruction method of a 2 or 3 dimensional object based on computed tomography, termed as coherent scattering computed tomography (CSCT), enables the detection of spatially-resolved, material-specific isotropic scattering signature inside an extended object, and provides improved contrast for medical diagnosis, security screening, and material characterization applications. However, traditional CSCT methods assumes materials are fine powders or amorphous, and possess isotropic scattering profiles, which is not generally true for all materials. Anisotropic scatters cannot be captured using conventional CSCT method and result in reconstruction errors. To obtain correct information from the sample, we designed new imaging strategy which incorporates extra degree of detector motion into X-ray scattering tomography for the detection of anisotropic scattered photons from a series of two-dimensional intensity measurements. Using a table-top, narrow-band X-ray source and a panel detector, we demonstrate the anisotropic scattering profile captured from an extended object and the reconstruction of a three-dimensional object. For materials possessing a well-organized crystalline structure with certain symmetry, the scatter texture is more predictable. We will also discuss the compressive schemes and implementation of data acquisition to improve the collection efficiency and accelerate the imaging process.

  17. Characterization of Diesel Soot Aggregates by Scattering and Extinction Methods

    NASA Astrophysics Data System (ADS)

    Kamimoto, Takeyuki

    2006-07-01

    Characteristics of diesel soot particles sampled from diesel exhaust of a common-rail turbo-charged diesel engine are quantified by scattering and extinction diagnostics using newly build two laser-based instruments. The radius of gyration representing the aggregates size is measured by the angular distribution of scattering intensity, while the soot mass concentration is measured by a two-wavelength extinction method. An approach to estimate the refractive index of diesel soot by an analysis of the extinction and scattering data using an aggregates scattering theory is proposed.

  18. Numerical solution of inverse scattering for near-field optics.

    PubMed

    Bao, Gang; Li, Peijun

    2007-06-01

    A novel regularized recursive linearization method is developed for a two-dimensional inverse medium scattering problem that arises in near-field optics, which reconstructs the scatterer of an inhomogeneous medium located on a substrate from data accessible through photon scanning tunneling microscopy experiments. Based on multiple frequency scattering data, the method starts from the Born approximation corresponding to weak scattering at a low frequency, and each update is obtained by continuation on the wavenumber from solutions of one forward problem and one adjoint problem of the Helmholtz equation.

  19. Hybrid method (JM-ECS) combining the J-matrix and exterior complex scaling methods for scattering calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vanroose, W.; Broeckhove, J.; Arickx, F.

    The paper proposes a hybrid method for calculating scattering processes. It combines the J-matrix method with exterior complex scaling and an absorbing boundary condition. The wave function is represented as a finite sum of oscillator eigenstates in the inner region, and it is discretized on a grid in the outer region. The method is validated for a one- and a two-dimensional model with partial wave equations and a calculation of p-shell nuclear scattering with semirealistic interactions.

  20. Electromagnetic Scattering from Two Dielectric Spheres: Comparison between Theory and Experiment,

    DTIC Science & Technology

    1982-08-30

    struct, a very complex computer program to perform the calculations. It should be noted that several errors (probably typographical) were disco - vered in...their equations and virtually all of them had to be rederived. In a future publication we will present a corrected set of equations along with several

  1. Thin-Film Phase Plates for Transmission Electron Microscopy Fabricated from Metallic Glasses.

    PubMed

    Dries, Manuel; Hettler, Simon; Schulze, Tina; Send, Winfried; Müller, Erich; Schneider, Reinhard; Gerthsen, Dagmar; Luo, Yuansu; Samwer, Konrad

    2016-10-01

    Thin-film phase plates (PPs) have become an interesting tool to enhance the contrast of weak-phase objects in transmission electron microscopy (TEM). The thin film usually consists of amorphous carbon, which suffers from quick degeneration under the intense electron-beam illumination. Recent investigations have focused on the search for alternative materials with an improved material stability. This work presents thin-film PPs fabricated from metallic glass alloys, which are characterized by a high electrical conductivity and an amorphous structure. Thin films of the zirconium-based alloy Zr65.0Al7.5Cu27.5 (ZAC) were fabricated and their phase-shifting properties were evaluated. The ZAC film was investigated by different TEM techniques, which reveal beneficial properties compared with amorphous carbon PPs. Particularly favorable is the small probability for inelastic plasmon scattering, which results from the combined effect of a moderate inelastic mean free path and a reduced film thickness due to a high mean inner potential. Small probability plasmon scattering improves contrast transfer at high spatial frequencies, which makes the ZAC alloy a promising material for PP fabrication.

  2. Mechanisms of decoherence in electron microscopy.

    PubMed

    Howie, A

    2011-06-01

    The understanding and where possible the minimisation of decoherence mechanisms in electron microscopy were first studied in plasmon loss, diffraction contrast images but are of even more acute relevance in high resolution TEM phase contrast imaging and electron holography. With the development of phase retrieval techniques they merit further attention particularly when their effect cannot be eliminated by currently available energy filters. The roles of electronic excitation, thermal diffuse scattering, transition radiation and bremsstrahlung are examined here not only in the specimen but also in the electron optical column. Terahertz-range aloof beam electronic excitation appears to account satisfactorily for recent observations of decoherence in electron holography. An apparent low frequency divergence can emerge for the calculated classical bremsstrahlung event probability but can be ignored for photon wavelengths exceeding the required coherence distance or path lengths in the equipment. Most bremsstrahlung event probabilities are negligibly important except possibly in large-angle bending magnets or mandolin systems. A more reliable procedure for subtracting thermal diffuse scattering from diffraction pattern intensities is proposed. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Adaptive handling of Rayleigh and Raman scatter of fluorescence data based on evaluation of the degree of spectral overlap

    NASA Astrophysics Data System (ADS)

    Hu, Yingtian; Liu, Chao; Wang, Xiaoping; Zhao, Dongdong

    2018-06-01

    At present the general scatter handling methods are unsatisfactory when scatter and fluorescence seriously overlap in excitation emission matrix. In this study, an adaptive method for scatter handling of fluorescence data is proposed. Firstly, the Raman scatter was corrected by subtracting the baseline of deionized water which was collected in each experiment to adapt to the intensity fluctuations. Then, the degrees of spectral overlap between Rayleigh scatter and fluorescence were classified into three categories based on the distance between the spectral peaks. The corresponding algorithms, including setting to zero, fitting on single or both sides, were implemented after the evaluation of the degree of overlap for individual emission spectra. The proposed method minimized the number of fitting and interpolation processes, which reduced complexity, saved time, avoided overfitting, and most importantly assured the authenticity of data. Furthermore, the effectiveness of this procedure on the subsequent PARAFAC analysis was assessed and compared to Delaunay interpolation by conducting experiments with four typical organic chemicals and real water samples. Using this method, we conducted long-term monitoring of tap water and river water near a dyeing and printing plant. This method can be used for improving adaptability and accuracy in the scatter handling of fluorescence data.

  4. Periodic disorder along ramie cellulose microfibrils.

    PubMed

    Nishiyama, Yoshiharu; Kim, Ung-Jin; Kim, Dae-Young; Katsumata, Kyoko S; May, Roland P; Langan, Paul

    2003-01-01

    Small angle neutron scattering studies have been carried out on cellulose fibers from ramie and Populus maximowicii (cotton wood). Labile hydrogen atoms were replaced by deuterium atoms, in water-accessible disordered regions of the fibers, to increase the neutron scattering contrast between the disordered and crystalline regions. A meridional Bragg reflection, corresponding to a longitudinal periodicity of 150 nm, was observed when scattering collected from hydrogenated and deuterated dry ramie fibers was subtracted. No Bragg reflection was observed with the cotton wood fibers, probably because of lower orientation of the microfibrils in the cell wall. The ramie fibers were then subjected to electron microscopy, acid hydrolysis, gel permeation chromatography, and viscosity studies. The leveling off degree of polymerization (LODP) of the hydrolyzed samples matched exactly the periodicity observed in the diffraction studies. The weight loss related to the LODP was only about 1.5%, and thus, the microfibrils can be considered to have 4-5 disordered residues every 300 residues.

  5. A plastic scintillator-based muon tomography system with an integrated muon spectrometer

    NASA Astrophysics Data System (ADS)

    Anghel, V.; Armitage, J.; Baig, F.; Boniface, K.; Boudjemline, K.; Bueno, J.; Charles, E.; Drouin, P.-L.; Erlandson, A.; Gallant, G.; Gazit, R.; Godin, D.; Golovko, V. V.; Howard, C.; Hydomako, R.; Jewett, C.; Jonkmans, G.; Liu, Z.; Robichaud, A.; Stocki, T. J.; Thompson, M.; Waller, D.

    2015-10-01

    A muon scattering tomography system which uses extruded plastic scintillator bars for muon tracking and a dedicated muon spectrometer that measures scattering through steel slabs has been constructed and successfully tested. The atmospheric muon detection efficiency is measured to be 97% per plane on average and the average intrinsic hit resolution is 2.5 mm. In addition to creating a variety of three-dimensional images of objects of interest, a quantitative study has been carried out to investigate the impact of including muon momentum measurements when attempting to detect high-density, high-Z material. As expected, the addition of momentum information improves the performance of the system. For a fixed data-taking time of 60 s and a fixed false positive fraction, the probability to detect a target increases when momentum information is used. This is the first demonstration of the use of muon momentum information from dedicated spectrometer measurements in muon scattering tomography.

  6. Azimuthal Dependence of Intrinsic Top in Photon-Quark Scattering and Higgs Production in Boson-Gluon Fusion DIS

    NASA Astrophysics Data System (ADS)

    Boroun, G. R.; Khanehzar, A.; Boustanchi Kashan, M.

    2017-11-01

    In this paper, we study the top content of nucleon by analyzing azimuthal asymmetries in lepton-nucleon deep inelastic scattering (DIS), also we search for the Higgs boson associated production channel, t\\bar{t}H, at the large hadron-electron collider (LHeC) caused by boson-gluon fusion (BGF) contribution. We use azimuthal asymmetries in {γ }* Q cross sections in terms of helicity contributions to semi-inclusive deep inelastic scattering to investigate numerical properties of the \\cos 2φ distribution. We conclude that measuring azimuthal distributions caused by intrinsic heavy quark production can directly probe heavy quarks inside nucleon. Moreover, in order to estimate the probability of producing the Higgs boson, we suggest another approach in the framework of calculating t\\bar{t} cross section in boson-gluon fusion mechanism. Finally, we can confirm that this observed massive particle is referred to Higgs boson produced by fermion loop.

  7. Large-Angle Scattering of Multi-GeV Muons on Thin Lead Targets

    NASA Astrophysics Data System (ADS)

    Longhin, A.; Paoloni, A.; Pupilli, F.

    2015-10-01

    The probability of large-angle scattering for multi-GeV muons in lead targets with a thickness of O(10 - 1) radiation lengths is studied. The new estimates presented here are based both on simulation programs (GEANT4 libraries) and theoretical calculations. In order to validate the results provided by simulation, a comparison is drawn with experimental data from the literature. This study is particularly relevant when applied to muons originating from νμ CC interactions of CNGS beam neutrinos. In that circumstance the process under study represents the dominant background for the νμ → ντ search in the τ→ μ channel for the OPERA experiment at LNGS. Finally we also investigate, in the CNGS context, possible contributions from the muon photo-nuclear process which might in principle also produce a large-angle muon scattering signature in the detector.

  8. Non-Gaussian statistics of extreme events in stimulated Raman scattering: The role of coherent memory and source noise

    NASA Astrophysics Data System (ADS)

    Monfared, Yashar E.; Ponomarenko, Sergey A.

    2017-10-01

    We explore theoretically and numerically extreme event excitation in stimulated Raman scattering in gases. We consider gas-filled hollow-core photonic crystal fibers as a particular system realization. We show that moderate amplitude pump fluctuations obeying Gaussian statistics lead to the emergence of heavy-tailed non-Gaussian statistics as coherent seed Stokes pulses are amplified on propagation along the fiber. We reveal the crucial role that coherent memory effects play in causing non-Gaussian statistics of the system. We discover that extreme events can occur even at the initial stage of stimulated Raman scattering when one can neglect energy depletion of an intense, strongly fluctuating Gaussian pump source. Our analytical results in the undepleted pump approximation explicitly illustrate power-law probability density generation as the input pump noise is transferred to the output Stokes pulses.

  9. Suppressing Klein tunneling in graphene using a one-dimensional array of localized scatterers.

    PubMed

    Walls, Jamie D; Hadad, Daniel

    2015-02-13

    Graphene's unique physical and chemical properties make it an attractive platform for use in micro- and nanoelectronic devices. However, electrostatically controlling the flow of electrons in graphene can be challenging as a result of Klein tunneling, where electrons normally incident to a one-dimensional potential barrier of height V are perfectly transmitted even as V → ∞. In this study, theoretical and numerical calculations predict that the transmission probability for an electron wave normally incident to a one-dimensional array of localized scatterers can be significantly less than unity when the electron wavelength is smaller than the spacing between scatterers. In effect, placing periodic openings throughout a potential barrier can, somewhat counterintuitively, decrease transmission in graphene. Our results suggest that electrostatic potentials with spatial variations on the order of the electron wavelength can suppress Klein tunneling and could find applications in developing graphene electronic devices.

  10. Low angle light scattering analysis: a novel quantitative method for functional characterization of human and murine platelet receptors.

    PubMed

    Mindukshev, Igor; Gambaryan, Stepan; Kehrer, Linda; Schuetz, Claudia; Kobsar, Anna; Rukoyatkina, Natalia; Nikolaev, Viacheslav O; Krivchenko, Alexander; Watson, Steve P; Walter, Ulrich; Geiger, Joerg

    2012-07-01

    Determinations of platelet receptor functions are indispensable diagnostic indicators of cardiovascular and hemostatic diseases including hereditary and acquired receptor defects and receptor responses to drugs. However, presently available techniques for assessing platelet function have some disadvantages, such as low sensitivity and the requirement of large sample sizes and unphysiologically high agonist concentrations. Our goal was to develop and initially characterize a new technique designed to quantitatively analyze platelet receptor activation and platelet function on the basis of measuring changes in low angle light scattering. We developed a novel technique based on low angle light scattering registering changes in light scattering at a range of different angles in platelet suspensions during activation. The method proved to be highly sensitive for simultaneous real time detection of changes in size and shape of platelets during activation. Unlike commonly-used methods, the light scattering method could detect platelet shape change and aggregation in response to nanomolar concentrations of extracellular nucleotides. Furthermore, our results demonstrate that the advantages of the light scattering method make it a choice method for platelet receptor monitoring and for investigation of both murine and human platelets in disease models. Our data demonstrate the suitability and superiority of this new low angle light scattering method for comprehensive analyses of platelet receptors and functions. This highly sensitive, quantitative, and online detection of essential physiological, pathophysiological and pharmacological-response properties of human and mouse platelets is a significant improvement over conventional techniques.

  11. Chapter 5 Multiple, Localized, and Delocalized/Conjugated Bonds in the Orbital Communication Theory of Molecular Systems

    NASA Astrophysics Data System (ADS)

    Nalewajski, Roman F.

    Information theory (IT) probe of the molecular electronic structure, within the communication theory of chemical bonds (CTCB), uses the standard entropy/information descriptors of the Shannon theory of communication to characterize a scattering of the electronic probabilities and their information content throughout the system chemical bonds generated by the occupied molecular orbitals (MO). These "communications" between the basis-set orbitals are determined by the two-orbital conditional probabilities: one- and two-electron in character. They define the molecular information system, in which the electron-allocation "signals" are transmitted between various orbital "inputs" and "outputs". It is argued, using the quantum mechanical superposition principle, that the one-electron conditional probabilities are proportional to the squares of corresponding elements of the charge and bond-order (CBO) matrix of the standard LCAO MO theory. Therefore, the probability of the interorbital connections in the molecular communication system is directly related to Wiberg's quadratic covalency indices of chemical bonds. The conditional-entropy (communication "noise") and mutual-information (information capacity) descriptors of these molecular channels generate the IT-covalent and IT-ionic bond components, respectively. The former reflects the electron delocalization (indeterminacy) due to the orbital mixing, throughout all chemical bonds in the system under consideration. The latter characterizes the localization (determinacy) in the probability scattering in the molecule. These two IT indices, respectively, indicate a fraction of the input information lost in the channel output, due to the communication noise, and its surviving part, due to deterministic elements in probability scattering in the molecular network. Together, these two components generate the system overall bond index. By a straightforward output reduction (condensation) of the molecular channel, the IT indices of molecular fragments, for example, localized bonds, functional groups, and forward and back donations accompanying the bond formation, and so on, can be extracted. The flow of information in such molecular communication networks is investigated in several prototype molecules. These illustrative (model) applications of the orbital communication theory of chemical bonds (CTCB) deal with several classical issues in the electronic structure theory: atom hybridization/promotion, single and multiple chemical bonds, bond conjugation, and so on. The localized bonds in hydrides and delocalized [pi]-bonds in simple hydrocarbons, as well as the multiple bonds in CO and CO2, are diagnosed using the entropy/information descriptors of CTCB. The atom promotion in hydrides and bond conjugation in [pi]-electron systems are investigated in more detail. A major drawback of the previous two-electron approach to molecular channels, namely, two weak bond differentiation in aromatic systems, has been shown to be remedied in the one-electron approach.

  12. The Fast Multipole Method and Fourier Convolution for the Solution of Acoustic Scattering on Regular Volumetric Grids

    PubMed Central

    Hesford, Andrew J.; Waag, Robert C.

    2010-01-01

    The fast multipole method (FMM) is applied to the solution of large-scale, three-dimensional acoustic scattering problems involving inhomogeneous objects defined on a regular grid. The grid arrangement is especially well suited to applications in which the scattering geometry is not known a priori and is reconstructed on a regular grid using iterative inverse scattering algorithms or other imaging techniques. The regular structure of unknown scattering elements facilitates a dramatic reduction in the amount of storage and computation required for the FMM, both of which scale linearly with the number of scattering elements. In particular, the use of fast Fourier transforms to compute Green's function convolutions required for neighboring interactions lowers the often-significant cost of finest-level FMM computations and helps mitigate the dependence of FMM cost on finest-level box size. Numerical results demonstrate the efficiency of the composite method as the number of scattering elements in each finest-level box is increased. PMID:20835366

  13. The fast multipole method and Fourier convolution for the solution of acoustic scattering on regular volumetric grids

    NASA Astrophysics Data System (ADS)

    Hesford, Andrew J.; Waag, Robert C.

    2010-10-01

    The fast multipole method (FMM) is applied to the solution of large-scale, three-dimensional acoustic scattering problems involving inhomogeneous objects defined on a regular grid. The grid arrangement is especially well suited to applications in which the scattering geometry is not known a priori and is reconstructed on a regular grid using iterative inverse scattering algorithms or other imaging techniques. The regular structure of unknown scattering elements facilitates a dramatic reduction in the amount of storage and computation required for the FMM, both of which scale linearly with the number of scattering elements. In particular, the use of fast Fourier transforms to compute Green's function convolutions required for neighboring interactions lowers the often-significant cost of finest-level FMM computations and helps mitigate the dependence of FMM cost on finest-level box size. Numerical results demonstrate the efficiency of the composite method as the number of scattering elements in each finest-level box is increased.

  14. The Fast Multipole Method and Fourier Convolution for the Solution of Acoustic Scattering on Regular Volumetric Grids.

    PubMed

    Hesford, Andrew J; Waag, Robert C

    2010-10-20

    The fast multipole method (FMM) is applied to the solution of large-scale, three-dimensional acoustic scattering problems involving inhomogeneous objects defined on a regular grid. The grid arrangement is especially well suited to applications in which the scattering geometry is not known a priori and is reconstructed on a regular grid using iterative inverse scattering algorithms or other imaging techniques. The regular structure of unknown scattering elements facilitates a dramatic reduction in the amount of storage and computation required for the FMM, both of which scale linearly with the number of scattering elements. In particular, the use of fast Fourier transforms to compute Green's function convolutions required for neighboring interactions lowers the often-significant cost of finest-level FMM computations and helps mitigate the dependence of FMM cost on finest-level box size. Numerical results demonstrate the efficiency of the composite method as the number of scattering elements in each finest-level box is increased.

  15. Memory sparing, fast scattering formalism for rigorous diffraction modeling

    NASA Astrophysics Data System (ADS)

    Iff, W.; Kämpfe, T.; Jourlin, Y.; Tishchenko, A. V.

    2017-07-01

    The basics and algorithmic steps of a novel scattering formalism suited for memory sparing and fast electromagnetic calculations are presented. The formalism, called ‘S-vector algorithm’ (by analogy with the known scattering-matrix algorithm), allows the calculation of the collective scattering spectra of individual layered micro-structured scattering objects. A rigorous method of linear complexity is applied to model the scattering at individual layers; here the generalized source method (GSM) resorting to Fourier harmonics as basis functions is used as one possible method of linear complexity. The concatenation of the individual scattering events can be achieved sequentially or in parallel, both having pros and cons. The present development will largely concentrate on a consecutive approach based on the multiple reflection series. The latter will be reformulated into an implicit formalism which will be associated with an iterative solver, resulting in improved convergence. The examples will first refer to 1D grating diffraction for the sake of simplicity and intelligibility, with a final 2D application example.

  16. Fully nonlocal inelastic scattering computations for spectroscopical transmission electron microscopy methods

    NASA Astrophysics Data System (ADS)

    Rusz, Ján; Lubk, Axel; Spiegelberg, Jakob; Tyutyunnikov, Dmitry

    2017-12-01

    The complex interplay of elastic and inelastic scattering amenable to different levels of approximation constitutes the major challenge for the computation and hence interpretation of TEM-based spectroscopical methods. The two major approaches to calculate inelastic scattering cross sections of fast electrons on crystals—Yoshioka-equations-based forward propagation and the reciprocal wave method—are founded in two conceptually differing schemes—a numerical forward integration of each inelastically scattered wave function, yielding the exit density matrix, and a computation of inelastic scattering matrix elements using elastically scattered initial and final states (double channeling). Here, we compare both approaches and show that the latter is computationally competitive to the former by exploiting analytical integration schemes over multiple excited states. Moreover, we show how to include full nonlocality of the inelastic scattering event, neglected in the forward propagation approaches, at no additional computing costs in the reciprocal wave method. Detailed simulations show in some cases significant errors due to the z -locality approximation and hence pitfalls in the interpretation of spectroscopical TEM results.

  17. Evaluation of Jacobian determinants by Monte Carlo methods: Application to the quasiclassical approximation in molecular scattering

    NASA Technical Reports Server (NTRS)

    Labudde, R. A.

    1971-01-01

    A technique is described which can be used to evaluate Jacobian determinants which occur in classical mechanical and quasiclassical approximation descriptions of molecular scattering. The method may be valuable in the study of reactive scattering using the quasiclassical approximation.

  18. Multi-scale Characterization and Modeling of Surface Slope Probability Distribution for ~20-km Diameter Lunar Craters

    NASA Astrophysics Data System (ADS)

    Mahanti, P.; Robinson, M. S.; Boyd, A. K.

    2013-12-01

    Craters ~20-km diameter and above significantly shaped the lunar landscape. The statistical nature of the slope distribution on their walls and floors dominate the overall slope distribution statistics for the lunar surface. Slope statistics are inherently useful for characterizing the current topography of the surface, determining accurate photometric and surface scattering properties, and in defining lunar surface trafficability [1-4]. Earlier experimental studies on the statistical nature of lunar surface slopes were restricted either by resolution limits (Apollo era photogrammetric studies) or by model error considerations (photoclinometric and radar scattering studies) where the true nature of slope probability distribution was not discernible at baselines smaller than a kilometer[2,3,5]. Accordingly, historical modeling of lunar surface slopes probability distributions for applications such as in scattering theory development or rover traversability assessment is more general in nature (use of simple statistical models such as the Gaussian distribution[1,2,5,6]). With the advent of high resolution, high precision topographic models of the Moon[7,8], slopes in lunar craters can now be obtained at baselines as low as 6-meters allowing unprecedented multi-scale (multiple baselines) modeling possibilities for slope probability distributions. Topographic analysis (Lunar Reconnaissance Orbiter Camera (LROC) Narrow Angle Camera (NAC) 2-m digital elevation models (DEM)) of ~20-km diameter Copernican lunar craters revealed generally steep slopes on interior walls (30° to 36°, locally exceeding 40°) over 15-meter baselines[9]. In this work, we extend the analysis from a probability distribution modeling point-of-view with NAC DEMs to characterize the slope statistics for the floors and walls for the same ~20-km Copernican lunar craters. The difference in slope standard deviations between the Gaussian approximation and the actual distribution (2-meter sampling) was computed over multiple scales. This slope analysis showed that local slope distributions are non-Gaussian for both crater walls and floors. Over larger baselines (~100 meters), crater wall slope probability distributions do approximate Gaussian distributions better, but have long distribution tails. Crater floor probability distributions however, were always asymmetric (for the baseline scales analyzed) and less affected by baseline scale variations. Accordingly, our results suggest that use of long tailed probability distributions (like Cauchy) and a baseline-dependant multi-scale model can be more effective in describing the slope statistics for lunar topography. Refrences: [1]Moore, H.(1971), JGR,75(11) [2]Marcus, A. H.(1969),JGR,74 (22).[3]R.J. Pike (1970),U.S. Geological Survey Working Paper [4]N. C. Costes, J. E. Farmer and E. B. George (1972),NASA Technical Report TR R-401 [5]M. N. Parker and G. L. Tyler(1973), Radio Science, 8(3),177-184 [6]Alekseev, V. A.et al (1968), Soviet Astronomy, Vol. 11, p.860 [7]Burns et al. (2012) Int. Arch. Photogramm. Remote Sens. Spatial Inf. Sci., XXXIX-B4, 483-488.[8]Smith et al. (2010) GRL 37, L18204, DOI: 10.1029/2010GL043751. [9]Wagner R., Robinson, M., Speyerer E., Mahanti, P., LPSC 2013, #2924.

  19. HEKATE-A novel grazing incidence neutron scattering concept for the European Spallation Source.

    PubMed

    Glavic, Artur; Stahn, Jochen

    2018-03-01

    Structure and magnetism at surfaces and buried interfaces on the nanoscale can only be accessed by few techniques, one of which is grazing incidence neutron scattering. While the technique has its strongest limitation in a low signal and large background, due to the low scattering probability and need for high resolution, it can be expected that the high intensity of the European Spallation Source in Lund, Sweden, will make many more such studies possible, warranting a dedicated beamline for this technique. We present an instrument concept, Highly Extended K range And Tunable Experiment (HEKATE), for surface scattering that combines the advantages of two Selene neutron guides with unique capabilities of spatially separated distinct wavelength frames. With this combination, it is not only possible to measure large specular reflectometry ranges, even on free liquid surfaces, but also to use two independent incident beams with tunable sizes and resolutions that can be optimized for the specifics of the investigated samples. Further the instrument guide geometry is tuned for reduction of high energy particle background and only uses low to moderate supermirror coatings for high reliability and affordable cost.

  20. HEKATE—A novel grazing incidence neutron scattering concept for the European Spallation Source

    NASA Astrophysics Data System (ADS)

    Glavic, Artur; Stahn, Jochen

    2018-03-01

    Structure and magnetism at surfaces and buried interfaces on the nanoscale can only be accessed by few techniques, one of which is grazing incidence neutron scattering. While the technique has its strongest limitation in a low signal and large background, due to the low scattering probability and need for high resolution, it can be expected that the high intensity of the European Spallation Source in Lund, Sweden, will make many more such studies possible, warranting a dedicated beamline for this technique. We present an instrument concept, Highly Extended K range And Tunable Experiment (HEKATE), for surface scattering that combines the advantages of two Selene neutron guides with unique capabilities of spatially separated distinct wavelength frames. With this combination, it is not only possible to measure large specular reflectometry ranges, even on free liquid surfaces, but also to use two independent incident beams with tunable sizes and resolutions that can be optimized for the specifics of the investigated samples. Further the instrument guide geometry is tuned for reduction of high energy particle background and only uses low to moderate supermirror coatings for high reliability and affordable cost.

  1. Infrared backscattering

    NASA Technical Reports Server (NTRS)

    Bohren, Craig F.; Nevitt, Timothy J.; Singham, Shermila Brito

    1989-01-01

    All particles in the atmosphere are not spherical. Moreover, the scattering properties of randomly oriented nonspherical particles are not equivalent to those of spherical particles no matter how the term equivalent is defined. This is especially true for scattering in the backward direction and at the infrared wavelengths at which some atmospheric particles have strong absorption bands. Thus calculations based on Mie theory of infrared backscattering by dry or insoluble atmospheric particles are suspect. To support this assertion, it was noted that peaks in laboratory-measured infrared backscattering spectra show appreciable shifts compared with those calculated using Mie theory. One example is ammonium sulfate. Some success was had in modeling backscattering spectra of ammonium sulfate particles using a simple statistical theory called the continuous distribution of ellipsoids (CDE) theory. In this theory, the scattering properties of an ensemble are calculated. Recently a modified version of this theory was applied to measured spectra of scattering by kaolin particles. The particles were platelike, so the probability distribution of ellipsoidal shapes was chosen to reflect this. As with ammonium sulfate, the wavelength of measured peak backscattering is shifted longward of that predicted by Mie theory.

  2. Low-energy d-d excitations in MnO studied by resonant x-ray fluorescence spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Butorin, S.M.; Guo, J.; Magnuson, M.

    1997-04-01

    Resonant soft X-ray emission spectroscopy has been demonstrated to possess interesting abilities for studies of electronic structure in various systems, such as symmetry probing, alignment and polarization dependence, sensitivity to channel interference, etc. In the present abstract the authors focus on the feasibility of resonant soft X-ray emission to probe low energy excitations by means of resonant electronic X-ray Raman scattering. Resonant X-ray emission can be regarded as an inelastic scattering process where a system in the ground state is transferred to a low excited state via a virtual core excitation. The energy closeness to a core excitation of themore » exciting radiation enhances the (generally) low probability for inelastic scattering at these wavelengths. Therefore soft X-ray emission spectroscopy (in resonant electronic Raman mode) can be used to study low energy d-d excitations in transition metal systems. The involvement of the intermediate core state allows one to use the selection rules of X-ray emission, and the appearance of the elastically scattered line in the spectra provides the reference to the ground state.« less

  3. Seabed roughness parameters from joint backscatter and reflection inversion at the Malta Plateau.

    PubMed

    Steininger, Gavin; Holland, Charles W; Dosso, Stan E; Dettmer, Jan

    2013-09-01

    This paper presents estimates of seabed roughness and geoacoustic parameters and uncertainties on the Malta Plateau, Mediterranean Sea, by joint Bayesian inversion of mono-static backscatter and spherical wave reflection-coefficient data. The data are modeled using homogeneous fluid sediment layers overlying an elastic basement. The scattering model assumes a randomly rough water-sediment interface with a von Karman roughness power spectrum. Scattering and reflection data are inverted simultaneously using a population of interacting Markov chains to sample roughness and geoacoustic parameters as well as residual error parameters. Trans-dimensional sampling is applied to treat the number of sediment layers and the order (zeroth or first) of an autoregressive error model (to represent potential residual correlation) as unknowns. Results are considered in terms of marginal posterior probability profiles and distributions, which quantify the effective data information content to resolve scattering/geoacoustic structure. Results indicate well-defined scattering (roughness) parameters in good agreement with existing measurements, and a multi-layer sediment profile over a high-speed (elastic) basement, consistent with independent knowledge of sand layers over limestone.

  4. Shell-model computed cross sections for charged-current scattering of astrophysical neutrinos off 40Ar

    NASA Astrophysics Data System (ADS)

    Kostensalo, Joel; Suhonen, Jouni; Zuber, K.

    2018-03-01

    Charged-current (anti)neutrino-40Ar cross sections for astrophysical neutrinos have been calculated. The initial and final nuclear states were calculated using the nuclear shell model. The folded solar-neutrino scattering cross section was found to be 1.78 (23 ) ×10-42cm2 , which is higher than what the previous papers have reported. The contributions from the 1- and 2- multipoles were found to be significant at supernova-neutrino energies, confirming the random-phase approximation (RPA) result of a previous study. The effects of neutrino flavor conversions in dense stellar matter (matter oscillations) were found to enhance the neutrino-scattering cross sections significantly for both the normal and inverted mass hierarchies. For the antineutrino scattering, only a small difference between the nonoscillating and inverted-hierarchy cross sections was found, while the normal-hierarchy cross section was 2-3 times larger than that of the nonoscillating cross section, depending on the adopted parametrization of the Fermi-Dirac distribution. This property of the supernova-antineutrino signal could probably be used to distinguish between the two hierarchies in megaton LAr detectors.

  5. Full wave two-dimensional modeling of scattering and inverse scattering for layered rough surfaces with buried objects

    NASA Astrophysics Data System (ADS)

    Kuo, Chih-Hao

    Efficient and accurate modeling of electromagnetic scattering from layered rough surfaces with buried objects finds applications ranging from detection of landmines to remote sensing of subsurface soil moisture. The formulation of a hybrid numerical/analytical solution to electromagnetic scattering from layered rough surfaces is first presented in this dissertation. The solution to scattering from each rough interface is sought independently based on the extended boundary condition method (EBCM), where the scattered fields of each rough interface are expressed as a summation of plane waves and then cast into reflection/transmission matrices. To account for interactions between multiple rough boundaries, the scattering matrix method (SMM) is applied to recursively cascade reflection and transmission matrices of each rough interface and obtain the composite reflection matrix from the overall scattering medium. The validation of this method against the Method of Moments (MoM) and Small Perturbation Method (SPM) is addressed and the numerical results which investigate the potential of low frequency radar systems in estimating deep soil moisture are presented. Computational efficiency of the proposed method is also discussed. In order to demonstrate the capability of this method in modeling coherent multiple scattering phenomena, the proposed method has been employed to analyze backscattering enhancement and satellite peaks due to surface plasmon waves from layered rough surfaces. Numerical results which show the appearance of enhanced backscattered peaks and satellite peaks are presented. Following the development of the EBCM/SMM technique, a technique which incorporates a buried object in layered rough surfaces by employing the T-matrix method and the cylindrical-to-spatial harmonics transformation is proposed. Validation and numerical results are provided. Finally, a multi-frequency polarimetric inversion algorithm for the retrieval of subsurface soil properties using VHF/UHF band radar measurements is devised. The top soil dielectric constant is first determined using an L-band inversion algorithm. For the retrieval of subsurface properties, a time-domain inversion technique is employed together with a parameter optimization for the pulse shape of time delay echoes from VHF/UHF band radar observations. Numerical studies to investigate the accuracy of the proposed inversion technique in presence of errors are addressed.

  6. Analysis of Scattering from Archival Pulsar Data using a CLEAN-based Method

    NASA Astrophysics Data System (ADS)

    Tsai, -Wei, Jr.; Simonetti, John H.; Kavic, Michael

    2017-02-01

    In this work, we adopted a CLEAN-based method to determine the scatter time, τ, from archived pulsar profiles under both the thin screen and uniform medium scattering models and to calculate the scatter time frequency scale index α, where τ \\propto {ν }α . The value of α is -4.4, if a Kolmogorov spectrum of the interstellar medium turbulence is assumed. We deconvolved 1342 profiles from 347 pulsars over a broad range of frequencies and dispersion measures. In our survey, in the majority of cases the scattering effect was not significant compared to pulse profile widths. For a subset of 21 pulsars scattering at the lowest frequencies was large enough to be measured. Because reliable scatter time measurements were determined only for the lowest frequency, we were limited to using upper limits on scatter times at higher frequencies for the purpose of our scatter time frequency slope estimation. We scaled the deconvolved scatter time to 1 GHz assuming α =-4.4 and considered our results in the context of other observations which yielded a broad relation between scatter time and dispersion measure.

  7. Practical way to avoid spurious geometrical contributions in Brillouin light scattering experiments at variable scattering angles.

    PubMed

    Battistoni, Andrea; Bencivenga, Filippo; Fioretto, Daniele; Masciovecchio, Claudio

    2014-10-15

    In this Letter, we present a simple method to avoid the well-known spurious contributions in the Brillouin light scattering (BLS) spectrum arising from the finite aperture of collection optics. The method relies on the use of special spatial filters able to select the scattered light with arbitrary precision around a given value of the momentum transfer (Q). We demonstrate the effectiveness of such filters by analyzing the BLS spectra of a reference sample as a function of scattering angle. This practical and inexpensive method could be an extremely useful tool to fully exploit the potentiality of Brillouin acoustic spectroscopy, as it will easily allow for effective Q-variable experiments with unparalleled luminosity and resolution.

  8. Characterization of target camouflage structures by means of different microwave imaging procedures

    NASA Astrophysics Data System (ADS)

    Inaebnit, Christian; John, Marc-Andre; Aulenbacher, Uwe; Akyol, Zeynrep; Hueppi, Rudolf; Wellig, Peter

    2009-05-01

    This paper presents two different test methods for camouflage layers (CL) like nets or foam based structures. The effectiveness of CL in preventing radar detection and recognition of targets depends on the interaction of CL properties as absorption and diffuse scattering with target specific scattering properties. This fact is taken into account by representing target backscattering as interference of different types of GTD contributions and evaluating the impact of CL onto these individual contributions separately. The first method investigates how a CL under test alters these individual scattering contributions and which "new" contributions are produced by "self-scattering" at the CL. This information is gained by applying ISAR imaging technique to a test structure with different types of scattering contributions. The second test method aims for separating the effects of absorption and "diffuse scattering" in case of a planar metallic plate covered by CL. For this, the equivalent source distribution in the plane of the CL is reconstructed from bistatic scattering data. Both test methods were verified by experimental results obtained from X-band measurements at different CL and proved to be well suited for an application specific evaluation of camouflage structures from different manufacturers.

  9. Fast inverse scattering solutions using the distorted Born iterative method and the multilevel fast multipole algorithm

    PubMed Central

    Hesford, Andrew J.; Chew, Weng C.

    2010-01-01

    The distorted Born iterative method (DBIM) computes iterative solutions to nonlinear inverse scattering problems through successive linear approximations. By decomposing the scattered field into a superposition of scattering by an inhomogeneous background and by a material perturbation, large or high-contrast variations in medium properties can be imaged through iterations that are each subject to the distorted Born approximation. However, the need to repeatedly compute forward solutions still imposes a very heavy computational burden. To ameliorate this problem, the multilevel fast multipole algorithm (MLFMA) has been applied as a forward solver within the DBIM. The MLFMA computes forward solutions in linear time for volumetric scatterers. The typically regular distribution and shape of scattering elements in the inverse scattering problem allow the method to take advantage of data redundancy and reduce the computational demands of the normally expensive MLFMA setup. Additional benefits are gained by employing Kaczmarz-like iterations, where partial measurements are used to accelerate convergence. Numerical results demonstrate both the efficiency of the forward solver and the successful application of the inverse method to imaging problems with dimensions in the neighborhood of ten wavelengths. PMID:20707438

  10. A Fast Hyperspectral Vector Radiative Transfer Model in UV to IR spectral bands

    NASA Astrophysics Data System (ADS)

    Ding, J.; Yang, P.; Sun, B.; Kattawar, G. W.; Platnick, S. E.; Meyer, K.; Wang, C.

    2016-12-01

    We develop a fast hyperspectral vector radiative transfer model with a spectral range from UV to IR with 5 nm resolutions. This model can simulate top of the atmosphere (TOA) diffuse radiance and polarized reflectance by considering gas absorption, Rayleigh scattering, and aerosol and cloud scattering. The absorption component considers several major atmospheric absorbers such as water vapor, CO2, O3, and O2 including both line and continuum absorptions. A regression-based method is used to parameterize the layer effective optical thickness for each gas, which substantially increases the computation efficiency for absorption while maintaining high accuracy. This method is over 500 times faster than the existing line-by-line method. The scattering component uses the successive order of scattering (SOS) method. For Rayleigh scattering, convergence is fast due to the small optical thickness of atmospheric gases. For cloud and aerosol layers, a small-angle approximation method is used in SOS calculations. The scattering process is divided into two parts, a forward part and a diffuse part. The scattering in the small-angle range in the forward direction is approximated as forward scattering. A cloud or aerosol layer is divided into thin layers. As the ray propagates through each thin layer, a portion diverges as diffuse radiation, while the remainder continues propagating in forward direction. The computed diffuse radiance is the sum of all of the diffuse parts. The small-angle approximation makes the SOS calculation converge rapidly even in a thick cloud layer.

  11. An assessment of the DORT method on simple scatterers using boundary element modelling.

    PubMed

    Gélat, P; Ter Haar, G; Saffari, N

    2015-05-07

    The ability to focus through ribs overcomes an important limitation of a high-intensity focused ultrasound (HIFU) system for the treatment of liver tumours. Whilst it is important to generate high enough acoustic pressures at the treatment location for tissue lesioning, it is also paramount to ensure that the resulting ultrasonic dose on the ribs remains below a specified threshold, since ribs both strongly absorb and reflect ultrasound. The DORT (décomposition de l'opérateur de retournement temporel) method has the ability to focus on and through scatterers immersed in an acoustic medium selectively without requiring prior knowledge of their location or geometry. The method requires a multi-element transducer and is implemented via a singular value decomposition of the measured matrix of inter-element transfer functions. The efficacy of a method of focusing through scatterers is often assessed by comparing the specific absorption rate (SAR) at the surface of the scatterer, and at the focal region. The SAR can be obtained from a knowledge of the acoustic pressure magnitude and the acoustic properties of the medium and scatterer. It is well known that measuring acoustic pressures with a calibrated hydrophone at or near a hard surface presents experimental challenges, potentially resulting in increased measurement uncertainties. Hence, the DORT method is usually assessed experimentally by measuring the SAR at locations on the surface of the scatterer after the latter has been removed from the acoustic medium. This is also likely to generate uncertainties in the acoustic pressure measurement. There is therefore a strong case for assessing the efficacy of the DORT method through a validated theoretical model. The boundary element method (BEM) applied to exterior acoustic scattering problems is well-suited for such an assessment. In this study, BEM was used to implement the DORT method theoretically on locally reacting spherical scatterers, and to assess its focusing capability relative to the spherical focusing case, binarised apodisation based on geometric ray tracing and the phase conjugation method.

  12. Fabrication of plasmonic cavity arrays for SERS analysis

    NASA Astrophysics Data System (ADS)

    Li, Ning; Feng, Lei; Teng, Fei; Lu, Nan

    2017-05-01

    The plasmonic cavity arrays are ideal substrates for surface enhanced Raman scattering analysis because they can provide hot spots with large volume for analyte molecules. The large area increases the probability to make more analyte molecules on hot spots and leads to a high reproducibility. Therefore, to develop a simple method for creating cavity arrays is important. Herein, we demonstrate how to fabricate a V and W shape cavity arrays by a simple method based on self-assembly. Briefly, the V and W shape cavity arrays are respectively fabricated by taking KOH etching on a nanohole and a nanoring array patterned silicon (Si) slides. The nanohole array is generated by taking a reactive ion etching on a Si slide assembled with monolayer of polystyrene (PS) spheres. The nanoring array is generated by taking a reactive ion etching on a Si slide covered with a monolayer of octadecyltrichlorosilane before self-assembling PS spheres. Both plasmonic V and W cavity arrays can provide large hot area, which increases the probability for analyte molecules to deposit on the hot spots. Taking 4-Mercaptopyridine as analyte probe, the enhancement factor can reach 2.99 × 105 and 9.97 × 105 for plasmonic V cavity and W cavity array, respectively. The relative standard deviations of the plasmonic V and W cavity arrays are 6.5% and 10.2% respectively according to the spectra collected on 20 random spots.

  13. Fabrication of plasmonic cavity arrays for SERS analysis.

    PubMed

    Li, Ning; Feng, Lei; Teng, Fei; Lu, Nan

    2017-05-05

    The plasmonic cavity arrays are ideal substrates for surface enhanced Raman scattering analysis because they can provide hot spots with large volume for analyte molecules. The large area increases the probability to make more analyte molecules on hot spots and leads to a high reproducibility. Therefore, to develop a simple method for creating cavity arrays is important. Herein, we demonstrate how to fabricate a V and W shape cavity arrays by a simple method based on self-assembly. Briefly, the V and W shape cavity arrays are respectively fabricated by taking KOH etching on a nanohole and a nanoring array patterned silicon (Si) slides. The nanohole array is generated by taking a reactive ion etching on a Si slide assembled with monolayer of polystyrene (PS) spheres. The nanoring array is generated by taking a reactive ion etching on a Si slide covered with a monolayer of octadecyltrichlorosilane before self-assembling PS spheres. Both plasmonic V and W cavity arrays can provide large hot area, which increases the probability for analyte molecules to deposit on the hot spots. Taking 4-Mercaptopyridine as analyte probe, the enhancement factor can reach 2.99 × 10 5 and 9.97 × 10 5 for plasmonic V cavity and W cavity array, respectively. The relative standard deviations of the plasmonic V and W cavity arrays are 6.5% and 10.2% respectively according to the spectra collected on 20 random spots.

  14. Vibrational relaxation in liquid chloroform following ultrafast excitation of the CH stretch fundamental

    NASA Astrophysics Data System (ADS)

    Sibert, Edwin L.; Rey, Rossend

    2002-01-01

    Vibrational energy flow in liquid chloroform that follows the ultrafast excitation of the CH stretch fundamental is modeled using semiclassical methods. Relaxation rates are calculated using Landau-Teller theory and a time-dependent method both of which consider a quantum mechanical CHCl3 solute molecule coupled to a classical bath of CHCl3 solvent molecules. Probability flow is examined for several potentials to determine the sensitivity of calculated relaxation rates to the parameters that describe the model potentials. Three stages of relaxation are obtained. Probability is calculated to decay initially to a single acceptor state, a combination state of the solute molecule with two quanta of excitation in the CH bend and one in the CCl stretch, in 13-23 ps depending on the potential model employed. This is followed by rapid and complex intramolecular energy flow into the remaining vibrational degrees of freedom. During this second stage the lowest frequency Cl-C-Cl bend is found to serve as a conduit for energy loss to the solvent. The bottleneck for relaxation back to the ground state is predicted to be the slow 100-200 ps relaxation of the CH bend and CCl stretch fundamentals. Several aspects of the incoherent anti-Stokes scattering that follows strong infrared excitation of the CH fundamental as observed by Graener, Zürl, and Hoffman [J. Phys. Chem. B 101, 1745 (1997)] are elucidated in the present study.

  15. Use of Probability Distribution Functions for Discriminating Between Cloud and Aerosol in Lidar Backscatter Data

    NASA Technical Reports Server (NTRS)

    Liu, Zhaoyan; Vaughan, Mark A.; Winker, Davd M.; Hostetler, Chris A.; Poole, Lamont R.; Hlavka, Dennis; Hart, William; McGill, Mathew

    2004-01-01

    In this paper we describe the algorithm hat will be used during the upcoming Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observations (CALIPSO) mission for discriminating between clouds and aerosols detected in two wavelength backscatter lidar profiles. We first analyze single-test and multiple-test classification approaches based on one-dimensional and multiple-dimensional probability density functions (PDFs) in the context of a two-class feature identification scheme. From these studies we derive an operational algorithm based on a set of 3-dimensional probability distribution functions characteristic of clouds and aerosols. A dataset acquired by the Cloud Physics Lidar (CPL) is used to test the algorithm. Comparisons are conducted between the CALIPSO algorithm results and the CPL data product. The results obtained show generally good agreement between the two methods. However, of a total of 228,264 layers analyzed, approximately 5.7% are classified as different types by the CALIPSO and CPL algorithm. This disparity is shown to be due largely to the misclassification of clouds as aerosols by the CPL algorithm. The use of 3-dimensional PDFs in the CALIPSO algorithm is found to significantly reduce this type of error. Dust presents a special case. Because the intrinsic scattering properties of dust layers can be very similar to those of clouds, additional algorithm testing was performed using an optically dense layer of Saharan dust measured during the Lidar In-space Technology Experiment (LITE). In general, the method is shown to distinguish reliably between dust layers and clouds. The relatively few erroneous classifications occurred most often in the LITE data, in those regions of the Saharan dust layer where the optical thickness was the highest.

  16. Method and apparatus for detecting and/or imaging clusters of small scattering centers in the body

    DOEpatents

    Perez-Mendez, V.; Sommer, F.G.

    1982-07-13

    An ultrasonic method and apparatus are provided for detecting and imaging clusters of small scattering centers in the breast wherein periodic pulses are applied to an ultrasound emitting transducer and projected into the body, thereafter being received by at least one receiving transducer positioned to receive scattering from the scattering center clusters. The signals are processed to provide an image showing cluster extent and location. 6 figs.

  17. Method and apparatus for detecting and/or imaging clusters of small scattering centers in the body

    DOEpatents

    Perez-Mendez, Victor; Sommer, Frank G.

    1982-01-01

    An ultrasonic method and apparatus are provided for detecting and imaging clusters of small scattering centers in the breast wherein periodic pulses are applied to an ultrasound emitting transducer and projected into the body, thereafter being received by at least one receiving transducer positioned to receive scattering from the scattering center clusters. The signals are processed to provide an image showing cluster extent and location.

  18. Correction of scatter in megavoltage cone-beam CT

    NASA Astrophysics Data System (ADS)

    Spies, L.; Ebert, M.; Groh, B. A.; Hesse, B. M.; Bortfeld, T.

    2001-03-01

    The role of scatter in a cone-beam computed tomography system using the therapeutic beam of a medical linear accelerator and a commercial electronic portal imaging device (EPID) is investigated. A scatter correction method is presented which is based on a superposition of Monte Carlo generated scatter kernels. The kernels are adapted to both the spectral response of the EPID and the dimensions of the phantom being scanned. The method is part of a calibration procedure which converts the measured transmission data acquired for each projection angle into water-equivalent thicknesses. Tomographic reconstruction of the projections then yields an estimate of the electron density distribution of the phantom. It is found that scatter produces cupping artefacts in the reconstructed tomograms. Furthermore, reconstructed electron densities deviate greatly (by about 30%) from their expected values. The scatter correction method removes the cupping artefacts and decreases the deviations from 30% down to about 8%.

  19. Characterizing tissue microstructure using an ultrasound system-independent spatial autocorrelation function

    NASA Astrophysics Data System (ADS)

    Dong, Fang

    1999-09-01

    The research described in this dissertation is related to characterization of tissue microstructure using a system- independent spatial autocorrelation function (SAF). The function was determined using a reference phantom method, which employed a well-defined ``point- scatterer'' reference phantom to account for instrumental factors. The SAF's were estimated for several tissue-mimicking (TM) phantoms and fresh dog livers. Both phantom tests and in vitro dog liver measurements showed that the reference phantom method is relatively simple and fairly accurate, providing the bandwidth of the measurement system is sufficient for the size of the scatterer being involved in the scattering process. Implementation of this method in clinical scanner requires that distortions from patient's body wall be properly accounted for. The SAF's were estimated for two phantoms with body-wall-like distortions. The experimental results demonstrated that body wall distortions have little effect if echo data are acquired from a large scattering volume. One interesting application of the SAF is to form a ``scatterer size image''. The scatterer size image may help providing diagnostic tools for those diseases in which the tissue microstructure is different from the normal. Another method, the BSC method, utilizes information contained in the frequency dependence of the backscatter coefficient to estimate the scatterer size. The SAF technique produced accurate scatterer size images of homogeneous TM phantoms and the BSC method was capable of generating accurate size images for heterogeneous phantoms. In the scatterer size image of dog kidneys, the contrast-to-noise-ratio (CNR) between renal cortex and medulla was improved dramatically compared to the gray- scale image. The effect of nonlinear propagation was investigated by using a custom-designed phantom with overlaying TM fat layer. The results showed that the correlation length decreased when the transmitting power increased. The measurement results support the assumption that nonlinear propagation generates harmonic energies and causes underestimation of scatterer diameters. Nonlinear propagation can be further enhanced by those materials with high B/A value-a parameter which characterizes the degree of nonlinearity. Nine versions of TM fat and non-fat materials were measured for their B/A values using a new measurement technique, the ``simplified finite amplitude insertion substitution'' (SFAIS) method.

  20. Method and apparatus for fiber optic multiple scattering suppression

    NASA Technical Reports Server (NTRS)

    Ackerson, Bruce J. (Inventor)

    2000-01-01

    The instant invention provides a method and apparatus for use in laser induced dynamic light scattering which attenuates the multiple scattering component in favor of the single scattering component. The preferred apparatus utilizes two light detectors that are spatially and/or angularly separated and which simultaneously record the speckle pattern from a single sample. The recorded patterns from the two detectors are then cross correlated in time to produce one point on a composite single/multiple scattering function curve. By collecting and analyzing cross correlation measurements that have been taken at a plurality of different spatial/angular positions, the signal representative of single scattering may be differentiated from the signal representative of multiple scattering, and a near optimum detector separation angle for use in taking future measurements may be determined.

  1. Absorption and scattering of light by nonspherical particles. [in atmosphere

    NASA Technical Reports Server (NTRS)

    Bohren, C. F.

    1986-01-01

    Using the example of the polarization of scattered light, it is shown that the scattering matrices for identical, randomly ordered particles and for spherical particles are unequal. The spherical assumptions of Mie theory are therefore inconsistent with the random shapes and sizes of atmospheric particulates. The implications for corrections made to extinction measurements of forward scattering light are discussed. Several analytical methods are examined as potential bases for developing more accurate models, including Rayleigh theory, Fraunhoffer Diffraction theory, anomalous diffraction theory, Rayleigh-Gans theory, the separation of variables technique, the Purcell-Pennypacker method, the T-matrix method, and finite difference calculations.

  2. Investigation of Dielectric Breakdown Characteristics for Double-break Vacuum Interrupter and Dielectric Breakdown Probability Distribution in Vacuum Interrupter

    NASA Astrophysics Data System (ADS)

    Shioiri, Tetsu; Asari, Naoki; Sato, Junichi; Sasage, Kosuke; Yokokura, Kunio; Homma, Mitsutaka; Suzuki, Katsumi

    To investigate the reliability of equipment of vacuum insulation, a study was carried out to clarify breakdown probability distributions in vacuum gap. Further, a double-break vacuum circuit breaker was investigated for breakdown probability distribution. The test results show that the breakdown probability distribution of the vacuum gap can be represented by a Weibull distribution using a location parameter, which shows the voltage that permits a zero breakdown probability. The location parameter obtained from Weibull plot depends on electrode area. The shape parameter obtained from Weibull plot of vacuum gap was 10∼14, and is constant irrespective non-uniform field factor. The breakdown probability distribution after no-load switching can be represented by Weibull distribution using a location parameter. The shape parameter after no-load switching was 6∼8.5, and is constant, irrespective of gap length. This indicates that the scatter of breakdown voltage was increased by no-load switching. If the vacuum circuit breaker uses a double break, breakdown probability at low voltage becomes lower than single-break probability. Although potential distribution is a concern in the double-break vacuum cuicuit breaker, its insulation reliability is better than that of the single-break vacuum interrupter even if the bias of the vacuum interrupter's sharing voltage is taken into account.

  3. Theory of Multiple Coulomb Scattering from Extended Nuclei

    DOE R&D Accomplishments Database

    Cooper, L. N.; Rainwater, J.

    1954-08-01

    Two independent methods are described for calculating the multiple scattering distribution for projected angle scattering resulting when very high energy charged particles traverse a thick scatterer. The results are compared with the theories of Moliere and Olbert.

  4. A study on independently using static and dynamic light scattering methods to determine the coagulation rate

    NASA Astrophysics Data System (ADS)

    Zhou, Hongwei; Xu, Shenghua; Mi, Li; Sun, Zhiwei; Qin, Yanming

    2014-09-01

    Absolute coagulation rate constants were determined by independently, instead of simultaneously, using static and dynamic light scattering with the requested optical factors calculated by T-matrix method. The aggregating suspensions of latex particles with diameters of 500, 700, and 900 nm, that are all beyond validity limit of the traditional Rayleigh-Debye-Gans approximation, were adopted. The results from independent static and dynamic light scattering measurements were compared with those by simultaneously using static and dynamic light scattering; and three of them show good consistency. We found, theoretically and experimentally, that for independent static light scattering measurements there are blind scattering angles at that the scattering measurements become impossible and the number of blind angles increases rapidly with particle size. For independent dynamic light scattering measurements, however, there is no such a blind angle at all. A possible explanation of the observed phenomena is also presented.

  5. Neutron Polarization Analysis for Biphasic Solvent Extraction Systems

    DOE PAGES

    Motokawa, Ryuhei; Endo, Hitoshi; Nagao, Michihiro; ...

    2016-06-16

    Here we performed neutron polarization analysis (NPA) of extracted organic phases containing complexes, comprised of Zr(NO 3) 4 and tri-n-butyl phosphate, which enabled decomposition of the intensity distribution of small-angle neutron scattering (SANS) into the coherent and incoherent scattering components. The coherent scattering intensity, containing structural information, and the incoherent scattering compete over a wide range of magnitude of scattering vector, q, specifically when q is larger than q* ≈ 1/R g, where R g is the radius of gyration of scatterer. Therefore, it is important to determine the incoherent scattering intensity exactly to perform an accurate structural analysis frommore » SANS data when R g is small, such as the aforementioned extracted coordination species. Although NPA is the best method for evaluating the incoherent scattering component for accurately determining the coherent scattering in SANS, this method is not used frequently in SANS data analysis because it is technically challenging. In this study, we successfully demonstrated that experimental determination of the incoherent scattering using NPA is suitable for sample systems containing a small scatterer with a weak coherent scattering intensity, such as extracted complexes in biphasic solvent extraction systems.« less

  6. Bayesian analysis of multiple direct detection experiments

    NASA Astrophysics Data System (ADS)

    Arina, Chiara

    2014-12-01

    Bayesian methods offer a coherent and efficient framework for implementing uncertainties into induction problems. In this article, we review how this approach applies to the analysis of dark matter direct detection experiments. In particular we discuss the exclusion limit of XENON100 and the debated hints of detection under the hypothesis of a WIMP signal. Within parameter inference, marginalizing consistently over uncertainties to extract robust posterior probability distributions, we find that the claimed tension between XENON100 and the other experiments can be partially alleviated in isospin violating scenario, while elastic scattering model appears to be compatible with the frequentist statistical approach. We then move to model comparison, for which Bayesian methods are particularly well suited. Firstly, we investigate the annual modulation seen in CoGeNT data, finding that there is weak evidence for a modulation. Modulation models due to other physics compare unfavorably with the WIMP models, paying the price for their excessive complexity. Secondly, we confront several coherent scattering models to determine the current best physical scenario compatible with the experimental hints. We find that exothermic and inelastic dark matter are moderatly disfavored against the elastic scenario, while the isospin violating model has a similar evidence. Lastly the Bayes' factor gives inconclusive evidence for an incompatibility between the data sets of XENON100 and the hints of detection. The same question assessed with goodness of fit would indicate a 2 σ discrepancy. This suggests that more data are therefore needed to settle this question.

  7. Snowfall Rate Retrieval using NPP ATMS Passive Microwave Measurements

    NASA Technical Reports Server (NTRS)

    Meng, Huan; Ferraro, Ralph; Kongoli, Cezar; Wang, Nai-Yu; Dong, Jun; Zavodsky, Bradley; Yan, Banghua; Zhao, Limin

    2014-01-01

    Passive microwave measurements at certain high frequencies are sensitive to the scattering effect of snow particles and can be utilized to retrieve snowfall properties. Some of the microwave sensors with snowfall sensitive channels are Advanced Microwave Sounding Unit (AMSU), Microwave Humidity Sounder (MHS) and Advance Technology Microwave Sounder (ATMS). ATMS is the follow-on sensor to AMSU and MHS. Currently, an AMSU and MHS based land snowfall rate (SFR) product is running operationally at NOAA/NESDIS. Based on the AMSU/MHS SFR, an ATMS SFR algorithm has been developed recently. The algorithm performs retrieval in three steps: snowfall detection, retrieval of cloud properties, and estimation of snow particle terminal velocity and snowfall rate. The snowfall detection component utilizes principal component analysis and a logistic regression model. The model employs a combination of temperature and water vapor sounding channels to detect the scattering signal from falling snow and derive the probability of snowfall (Kongoli et al., 2014). In addition, a set of NWP model based filters is also employed to improve the accuracy of snowfall detection. Cloud properties are retrieved using an inversion method with an iteration algorithm and a two-stream radiative transfer model (Yan et al., 2008). A method developed by Heymsfield and Westbrook (2010) is adopted to calculate snow particle terminal velocity. Finally, snowfall rate is computed by numerically solving a complex integral. The ATMS SFR product is validated against radar and gauge snowfall data and shows that the ATMS algorithm outperforms the AMSU/MHS SFR.

  8. Complex Correlation Kohn-T Method of Calculating Total and Elastic Cross Sections. Part 1; Electron-Hydrogen Elastic Scattering

    NASA Technical Reports Server (NTRS)

    Bhatia, A. K.; Temkin, A.; Fisher, Richard R. (Technical Monitor)

    2001-01-01

    We report on the first part of a study of electron-hydrogen scattering, using a method which allows for the ab initio calculation of total and elastic cross sections at higher energies. In its general form the method uses complex 'radial' correlation functions, in a (Kohn) T-matrix formalism. The titled method, abbreviated Complex Correlation Kohn T (CCKT) method, is reviewed, in the context of electron-hydrogen scattering, including the derivation of the equation for the (complex) scattering function, and the extraction of the scattering information from the latter. The calculation reported here is restricted to S-waves in the elastic region, where the correlation functions can be taken, without loss of generality, to be real. Phase shifts are calculated using Hylleraas-type correlation functions with up to 95 terms. Results are rigorous lower bounds; they are in general agreement with those of Schwartz, but they are more accurate and outside his error bounds at a couple of energies,

  9. Application of maximum likelihood methods to laser Thomson scattering measurements of low density plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Washeleski, Robert L.; Meyer, Edmond J. IV; King, Lyon B.

    2013-10-15

    Laser Thomson scattering (LTS) is an established plasma diagnostic technique that has seen recent application to low density plasmas. It is difficult to perform LTS measurements when the scattered signal is weak as a result of low electron number density, poor optical access to the plasma, or both. Photon counting methods are often implemented in order to perform measurements in these low signal conditions. However, photon counting measurements performed with photo-multiplier tubes are time consuming and multi-photon arrivals are incorrectly recorded. In order to overcome these shortcomings a new data analysis method based on maximum likelihood estimation was developed. Themore » key feature of this new data processing method is the inclusion of non-arrival events in determining the scattered Thomson signal. Maximum likelihood estimation and its application to Thomson scattering at low signal levels is presented and application of the new processing method to LTS measurements performed in the plume of a 2-kW Hall-effect thruster is discussed.« less

  10. Application of maximum likelihood methods to laser Thomson scattering measurements of low density plasmas.

    PubMed

    Washeleski, Robert L; Meyer, Edmond J; King, Lyon B

    2013-10-01

    Laser Thomson scattering (LTS) is an established plasma diagnostic technique that has seen recent application to low density plasmas. It is difficult to perform LTS measurements when the scattered signal is weak as a result of low electron number density, poor optical access to the plasma, or both. Photon counting methods are often implemented in order to perform measurements in these low signal conditions. However, photon counting measurements performed with photo-multiplier tubes are time consuming and multi-photon arrivals are incorrectly recorded. In order to overcome these shortcomings a new data analysis method based on maximum likelihood estimation was developed. The key feature of this new data processing method is the inclusion of non-arrival events in determining the scattered Thomson signal. Maximum likelihood estimation and its application to Thomson scattering at low signal levels is presented and application of the new processing method to LTS measurements performed in the plume of a 2-kW Hall-effect thruster is discussed.

  11. On measuring the scattering coefficient in a nondiffuse sound field

    NASA Astrophysics Data System (ADS)

    Kanev, N. G.

    2017-11-01

    The laws of sound decay in a cubic room, one wall of which is absorbing and the other scattering, are obtained. It is shown that under certain conditions, sound decay in a room occurs nonexponentially and the shape of the decay curve depends on the scattering coefficient of the walls. This makes it possible to suggest a method for measuring the scattering coefficient by the analysis the decay curve when the walls have sound-scattering materials and structures. Expressions are obtained for approximating the measured decay curve, and the boundaries of the method's applicability are determined.

  12. Signal evaluations using singular value decomposition for Thomson scattering diagnostics.

    PubMed

    Tojo, H; Yamada, I; Yasuhara, R; Yatsuka, E; Funaba, H; Hatae, T; Hayashi, H; Itami, K

    2014-11-01

    This paper provides a novel method for evaluating signal intensities in incoherent Thomson scattering diagnostics. A double-pass Thomson scattering system, where a laser passes through the plasma twice, generates two scattering pulses from the plasma. Evaluations of the signal intensities in the spectrometer are sometimes difficult due to noise and stray light. We apply the singular value decomposition method to Thomson scattering data with strong noise components. Results show that the average accuracy of the measured electron temperature (Te) is superior to that of temperature obtained using a low-pass filter (<20 MHz) or without any filters.

  13. Signal evaluations using singular value decomposition for Thomson scattering diagnostics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tojo, H., E-mail: tojo.hiroshi@jaea.go.jp; Yatsuka, E.; Hatae, T.

    2014-11-15

    This paper provides a novel method for evaluating signal intensities in incoherent Thomson scattering diagnostics. A double-pass Thomson scattering system, where a laser passes through the plasma twice, generates two scattering pulses from the plasma. Evaluations of the signal intensities in the spectrometer are sometimes difficult due to noise and stray light. We apply the singular value decomposition method to Thomson scattering data with strong noise components. Results show that the average accuracy of the measured electron temperature (T{sub e}) is superior to that of temperature obtained using a low-pass filter (<20 MHz) or without any filters.

  14. Practical and adequate approach to modeling light propagation in an adult head with low-scattering regions by use of diffusion theory.

    PubMed

    Koyama, Tatsuya; Iwasaki, Atsushi; Ogoshi, Yosuke; Okada, Eiji

    2005-04-10

    A practical and adequate approach to modeling light propagation in an adult head with a low-scattering cerebrospinal fluid (CSF) region by use of diffusion theory was investigated. The diffusion approximation does not hold in a nonscattering or low-scattering regions. The hybrid radiosity-diffusion method was adopted to model the light propagation in the head with a nonscattering region. In the hybrid method the geometry of the nonscattering region is acquired as a priori information. In reality, low-level scattering occurs in the CSF region and may reduce the error caused by the diffusion approximation. The partial optical path length and the spatial sensitivity profile calculated by the finite-element method agree well with those calculated by the Monte Carlo method in the case in which the transport scattering coefficient of the CSF layer is greater than 0.3 mm(-1). Because it is feasible to assume that the transport scattering coefficient of a CSF layer is 0.3 mm(-1), it is practical to adopt diffusion theory to the modeling of light propagation in an adult head as an alternative to the hybrid method.

  15. Practical and adequate approach to modeling light propagation in an adult head with low-scattering regions by use of diffusion theory

    NASA Astrophysics Data System (ADS)

    Koyama, Tatsuya; Iwasaki, Atsushi; Ogoshi, Yosuke; Okada, Eiji

    2005-04-01

    A practical and adequate approach to modeling light propagation in an adult head with a low-scattering cerebrospinal fluid (CSF) region by use of diffusion theory was investigated. The diffusion approximation does not hold in a nonscattering or low-scattering regions. The hybrid radiosity-diffusion method was adopted to model the light propagation in the head with a nonscattering region. In the hybrid method the geometry of the nonscattering region is acquired as a priori information. In reality, low-level scattering occurs in the CSF region and may reduce the error caused by the diffusion approximation. The partial optical path length and the spatial sensitivity profile calculated by the finite-element method agree well with those calculated by the Monte Carlo method in the case in which the transport scattering coefficient of the CSF layer is greater than 0.3 mm^-1. Because it is feasible to assume that the transport scattering coefficient of a CSF layer is 0.3 mm^-1, it is practical to adopt diffusion theory to the modeling of light propagation in an adult head as an alternative to the hybrid method.

  16. In vivo imaging of scattering and absorption properties of exposed brain using a digital red-green-blue camera

    NASA Astrophysics Data System (ADS)

    Nishidate, Izumi; Yoshida, Keiichiro; Kawauchi, Satoko; Sato, Shunichi; Sato, Manabu

    2014-03-01

    We investigate a method to estimate the spectral images of reduced scattering coefficients and the absorption coefficients of in vivo exposed brain tissues in the range from visible to near-infrared wavelength (500-760 nm) based on diffuse reflectance spectroscopy using a digital RGB camera. In the proposed method, the multi-spectral reflectance images of in vivo exposed brain are reconstructed from the digital red, green blue images using the Wiener estimation algorithm. The Monte Carlo simulation-based multiple regression analysis for the absorbance spectra is then used to specify the absorption and scattering parameters of brain tissue. In this analysis, the concentration of oxygenated hemoglobin and that of deoxygenated hemoglobin are estimated as the absorption parameters whereas the scattering amplitude a and the scattering power b in the expression of μs'=aλ-b as the scattering parameters, respectively. The spectra of absorption and reduced scattering coefficients are reconstructed from the absorption and scattering parameters, and finally, the spectral images of absorption and reduced scattering coefficients are estimated. The estimated images of absorption coefficients were dominated by the spectral characteristics of hemoglobin. The estimated spectral images of reduced scattering coefficients showed a broad scattering spectrum, exhibiting larger magnitude at shorter wavelengths, corresponding to the typical spectrum of brain tissue published in the literature. In vivo experiments with exposed brain of rats during CSD confirmed the possibility of the method to evaluate both hemodynamics and changes in tissue morphology due to electrical depolarization.

  17. Static and dynamic light scattering by red blood cells: A numerical study.

    PubMed

    Mauer, Johannes; Peltomäki, Matti; Poblete, Simón; Gompper, Gerhard; Fedosov, Dmitry A

    2017-01-01

    Light scattering is a well-established experimental technique, which gains more and more popularity in the biological field because it offers the means for non-invasive imaging and detection. However, the interpretation of light-scattering signals remains challenging due to the complexity of most biological systems. Here, we investigate static and dynamic scattering properties of red blood cells (RBCs) using two mesoscopic hydrodynamics simulation methods-multi-particle collision dynamics and dissipative particle dynamics. Light scattering is studied for various membrane shear elasticities, bending rigidities, and RBC shapes (e.g., biconcave and stomatocyte). Simulation results from the two simulation methods show good agreement, and demonstrate that the static light scattering of a diffusing RBC is not very sensitive to the changes in membrane properties and moderate alterations in cell shapes. We also compute dynamic light scattering of a diffusing RBC, from which dynamic properties of RBCs such as diffusion coefficients can be accessed. In contrast to static light scattering, the dynamic measurements can be employed to differentiate between the biconcave and stomatocytic RBC shapes and generally allow the differentiation based on the membrane properties. Our simulation results can be used for better understanding of light scattering by RBCs and the development of new non-invasive methods for blood-flow monitoring.

  18. Coherent amplification of X-ray scattering from meso-structures

    DOE PAGES

    Lhermitte, Julien R.; Stein, Aaron; Tian, Cheng; ...

    2017-07-10

    Small-angle X-ray scattering (SAXS) often includes an unwanted background, which increases the required measurement time to resolve the sample structure. This is undesirable in all experiments, and may make measurement of dynamic or radiation-sensitive samples impossible. Here, we demonstrate a new technique, applicable when the scattering signal is background-dominated, which reduces the requisite exposure time. Our method consists of exploiting coherent interference between a sample with a designed strongly scattering `amplifier'. A modified angular correlation function is used to extract the symmetry of the interference term; that is, the scattering arising from the interference between the amplifier and the sample.more » This enables reconstruction of the sample's symmetry, despite the sample scattering itself being well below the intensity of background scattering. Thus, coherent amplification is used to generate a strong scattering term (well above background), from which sample scattering is inferred. We validate this method using lithographically defined test samples.« less

  19. Accurate single-scattering simulation of ice cloud using the invariant-imbedding T-matrix method and the physical-geometric optics method

    NASA Astrophysics Data System (ADS)

    Sun, B.; Yang, P.; Kattawar, G. W.; Zhang, X.

    2017-12-01

    The ice cloud single-scattering properties can be accurately simulated using the invariant-imbedding T-matrix method (IITM) and the physical-geometric optics method (PGOM). The IITM has been parallelized using the Message Passing Interface (MPI) method to remove the memory limitation so that the IITM can be used to obtain the single-scattering properties of ice clouds for sizes in the geometric optics regime. Furthermore, the results associated with random orientations can be analytically achieved once the T-matrix is given. The PGOM is also parallelized in conjunction with random orientations. The single-scattering properties of a hexagonal prism with height 400 (in units of lambda/2*pi, where lambda is the incident wavelength) and an aspect ratio of 1 (defined as the height over two times of bottom side length) are given by using the parallelized IITM and compared to the counterparts using the parallelized PGOM. The two results are in close agreement. Furthermore, the integrated single-scattering properties, including the asymmetry factor, the extinction cross-section, and the scattering cross-section, are given in a completed size range. The present results show a smooth transition from the exact IITM solution to the approximate PGOM result. Because the calculation of the IITM method has reached the geometric regime, the IITM and the PGOM can be efficiently employed to accurately compute the single-scattering properties of ice cloud in a wide spectral range.

  20. Correction method for influence of tissue scattering for sidestream dark-field oximetry using multicolor LEDs

    NASA Astrophysics Data System (ADS)

    Kurata, Tomohiro; Oda, Shigeto; Kawahira, Hiroshi; Haneishi, Hideaki

    2016-12-01

    We have previously proposed an estimation method of intravascular oxygen saturation (SO_2) from the images obtained by sidestream dark-field (SDF) imaging (we call it SDF oximetry) and we investigated its fundamental characteristics by Monte Carlo simulation. In this paper, we propose a correction method for scattering by the tissue and performed experiments with turbid phantoms as well as Monte Carlo simulation experiments to investigate the influence of the tissue scattering in the SDF imaging. In the estimation method, we used modified extinction coefficients of hemoglobin called average extinction coefficients (AECs) to correct the influence from the bandwidth of the illumination sources, the imaging camera characteristics, and the tissue scattering. We estimate the scattering coefficient of the tissue from the maximum slope of pixel value profile along a line perpendicular to the blood vessel running direction in an SDF image and correct AECs using the scattering coefficient. To evaluate the proposed method, we developed a trial SDF probe to obtain three-band images by switching multicolor light-emitting diodes and obtained the image of turbid phantoms comprised of agar powder, fat emulsion, and bovine blood-filled glass tubes. As a result, we found that the increase of scattering by the phantom body brought about the decrease of the AECs. The experimental results showed that the use of suitable values for AECs led to more accurate SO_2 estimation. We also confirmed the validity of the proposed correction method to improve the accuracy of the SO_2 estimation.

  1. Dependent scattering and absorption by densely packed discrete spherical particles: Effects of complex refractive index

    NASA Astrophysics Data System (ADS)

    Ma, L. X.; Tan, J. Y.; Zhao, J. M.; Wang, F. Q.; Wang, C. A.; Wang, Y. Y.

    2017-07-01

    Due to the dependent scattering and absorption effects, the radiative transfer equation (RTE) may not be suitable for dealing with radiative transfer in dense discrete random media. This paper continues previous research on multiple and dependent scattering in densely packed discrete particle systems, and puts emphasis on the effects of particle complex refractive index. The Mueller matrix elements of the scattering system with different complex refractive indexes are obtained by both electromagnetic method and radiative transfer method. The Maxwell equations are directly solved based on the superposition T-matrix method, while the RTE is solved by the Monte Carlo method combined with the hard sphere model in the Percus-Yevick approximation (HSPYA) to consider the dependent scattering effects. The results show that for densely packed discrete random media composed of medium size parameter particles (equals 6.964 in this study), the demarcation line between independent and dependent scattering has remarkable connections with the particle complex refractive index. With the particle volume fraction increase to a certain value, densely packed discrete particles with higher refractive index contrasts between the particles and host medium and higher particle absorption indexes are more likely to show stronger dependent characteristics. Due to the failure of the extended Rayleigh-Debye scattering condition, the HSPYA has weak effect on the dependent scattering correction at large phase shift parameters.

  2. Controlled and in situ target strengths of the jumbo squid Dosidicus gigas and identification of potential acoustic scattering sources.

    PubMed

    Benoit-Bird, Kelly J; Gilly, William F; Au, Whitlow W L; Mate, Bruce

    2008-03-01

    This study presents the first target strength measurements of Dosidicus gigas, a large squid that is a key predator, a significant prey, and the target of an important fishery. Target strength of live, tethered squid was related to mantle length with values standardized to the length squared of -62.0, -67.4, -67.9, and -67.6 dB at 38, 70, 120, and 200 kHz, respectively. There were relatively small differences in target strength between dorsal and anterior aspects and none between live and freshly dead squid. Potential scattering mechanisms in squid have been long debated. Here, the reproductive organs had little effect on squid target strength. These data support the hypothesis that the pen may be an important source of squid acoustic scattering. The beak, eyes, and arms, probably via the sucker rings, also play a role in acoustic scattering though their effects were small and frequency specific. An unexpected source of scattering was the cranium of the squid which provided a target strength nearly as high as that of the entire squid though the mechanism remains unclear. Our in situ measurements of the target strength of free-swimming squid support the use of the values presented here in D. gigas assessment studies.

  3. Nonadiabatic dynamics of electron scattering from adsorbates in surface bands

    NASA Astrophysics Data System (ADS)

    Gumhalter, Branko; Šiber, Antonio; Buljan, Hrvoje; Fauster, Thomas

    2008-10-01

    We present a comparative study of nonadiabatic dynamics of electron scattering in quasi-two-dimensional surface band which is induced by the long-range component of the interactions with a random array of adsorbates. Using three complementary model descriptions of intraband spatiotemporal propagation of quasiparticles that go beyond the single-adsorbate scattering approach we are able to identify distinct subsequent regimes of evolution of an electron following its promotion into an unoccupied band state: (i) early quadratic or ballistic decay of the initial-state survival probability within the Heisenberg uncertainty window, (ii) preasymptotic exponential decay governed by the self-consistent Fermi golden rule scattering rate, and (iii) asymptotic decay described by a combined inverse power-law and logarithmic behavior. The developed models are applied to discuss the dynamics of intraband adsorbate-induced scattering of hot electrons excited into the n=1 image-potential band on Cu(100) surface during the first stage of a two-photon photoemission process. Estimates of crossovers between the distinct evolution regimes enable assessments of the lifespan of a standard quasiparticle behavior and thereby of the range of applicability of the widely used Fermi golden rule and optical Bloch equations approach for description of adsorbate-induced quasiparticle decay and dephasing in ultrafast experiments.

  4. Laser scattering method applied to determine the concentration of alfa 1-antitrypsin

    NASA Astrophysics Data System (ADS)

    Riquelme, Bibiana D.; Foresto, Patricia; Valverde, Juana R.; Rasia, Rodolfo J.

    2000-04-01

    An optical method has been developed to find (alpha) 1- antitrypsin unknown concentrations in human serum samples. This method applies light scattering properties exhibited by initially formed enzyme-inhibitor complexes and uses the curves of aggregation kinetics. It is independent of molecular hydrodynamics. Theoretical approaches showed that scattering properties of transient complexes obey the Rayleigh-Debie conditions. Experiments were performed on the Trypsin/(alpha) 1-antitrypsin system. Measurements were performed in newborn, adult and pregnant sera containing (alpha) 1-antitrypsin in the Trypsin excess region. The solution was excite by a He-Ne laser beam. SO, the particles formed during the reaction are scattering centers for the interacting light. The intensity of the scattered light at 90 degrees from incident beam depends on the nature of those scattering centers. Th rate of increase in scattered intensity depends on the variation in size and shape of the scatterers, being independent of its original size. Peak values of the first derivative linearly correlate with the concentration of (alpha) 1-antitrypsin originally present in the sample. Results are displayed 5 minutes after the initiation of the experimental process. Such speed is of great importance in the immuno-biochemistry determinations.

  5. Portal scatter to primary dose ratio of 4 to 18 MV photon spectra incident on heterogeneous phantoms

    NASA Astrophysics Data System (ADS)

    Ozard, Siobhan R.

    Electronic portal imagers designed and used to verify the positioning of a cancer patient undergoing radiation treatment can also be employed to measure the in vivo dose received by the patient. This thesis investigates the ratio of the dose from patient-scattered particles to the dose from primary (unscattered) photons at the imaging plane, called the scatter to primary dose ratio (SPR). The composition of the SPR according to the origin of scatter is analyzed more thoroughly than in previous studies. A new analytical method for calculating the SPR is developed and experimentally verified for heterogeneous phantoms. A novel technique that applies the analytical SPR method for in vivo dosimetry with a portal imager is evaluated. Monte Carlo simulation was used to determine the imager dose from patient-generated electrons and photons that scatter one or more times within the object. The database of SPRs reported from this investigation is new since the contribution from patient-generated electrons was neglected by previous Monte Carlo studies. The SPR from patient-generated electrons was found here to be as large as 0.03. The analytical SPR method relies on the established result that the scatter dose is uniform for an air gap between the patient and the imager that is greater than 50 cm. This method also applies the hypothesis that first-order Compton scatter only, is sufficient for scatter estimation. A comparison of analytical and measured SPRs for neck, thorax, and pelvis phantoms showed that the maximum difference was within +/-0.03, and the mean difference was less than +/-0.01 for most cases. This accuracy was comparable to similar analytical approaches that are limited to homogeneous phantoms. The analytical SPR method could replace lookup tables of measured scatter doses that can require significant time to measure. In vivo doses were calculated by combining our analytical SPR method and the convolution/superposition algorithm. Our calculated in vivo doses agreed within +/-3% with the doses measured in the phantom. The present in vivo method was faster compared to other techniques that use convolution/superposition. Our method is a feasible and satisfactory approach that contributes to on-line patient dose monitoring.

  6. Bayesian ionospheric multi-instrument 3D tomography

    NASA Astrophysics Data System (ADS)

    Norberg, Johannes; Vierinen, Juha; Roininen, Lassi

    2017-04-01

    The tomographic reconstruction of ionospheric electron densities is an inverse problem that cannot be solved without relatively strong regularising additional information. % Especially the vertical electron density profile is determined predominantly by the regularisation. % %Often utilised regularisations in ionospheric tomography include smoothness constraints and iterative methods with initial ionospheric models. % Despite its crucial role, the regularisation is often hidden in the algorithm as a numerical procedure without physical understanding. % % The Bayesian methodology provides an interpretative approach for the problem, as the regularisation can be given in a physically meaningful and quantifiable prior probability distribution. % The prior distribution can be based on ionospheric physics, other available ionospheric measurements and their statistics. % Updating the prior with measurements results as the posterior distribution that carries all the available information combined. % From the posterior distribution, the most probable state of the ionosphere can then be solved with the corresponding probability intervals. % Altogether, the Bayesian methodology provides understanding on how strong the given regularisation is, what is the information gained with the measurements and how reliable the final result is. % In addition, the combination of different measurements and temporal development can be taken into account in a very intuitive way. However, a direct implementation of the Bayesian approach requires inversion of large covariance matrices resulting in computational infeasibility. % In the presented method, Gaussian Markov random fields are used to form a sparse matrix approximations for the covariances. % The approach makes the problem computationally feasible while retaining the probabilistic and physical interpretation. Here, the Bayesian method with Gaussian Markov random fields is applied for ionospheric 3D tomography over Northern Europe. % Multi-instrument measurements are utilised from TomoScand receiver network for Low Earth orbit beacon satellite signals, GNSS receiver networks, as well as from EISCAT ionosondes and incoherent scatter radars. % %The performance is demonstrated in three-dimensional spatial domain with temporal development also taken into account.

  7. Enhanced coupling of light into a turbid medium through microscopic interface engineering

    PubMed Central

    Thompson, Jonathan V.; Hokr, Brett H.; Kim, Wihan; Ballmann, Charles W.; Applegate, Brian E.; Jo, Javier; Yamilov, Alexey; Cao, Hui; Scully, Marlan O.; Yakovlev, Vladislav V.

    2017-01-01

    There are many optical detection and sensing methods used today that provide powerful ways to diagnose, characterize, and study materials. For example, the measurement of spontaneous Raman scattering allows for remote detection and identification of chemicals. Many other optical techniques provide unique solutions to learn about biological, chemical, and even structural systems. However, when these systems exist in a highly scattering or turbid medium, the optical scattering effects reduce the effectiveness of these methods. In this article, we demonstrate a method to engineer the geometry of the optical interface of a turbid medium, thereby drastically enhancing the coupling efficiency of light into the material. This enhanced optical coupling means that light incident on the material will penetrate deeper into (and through) the medium. It also means that light thus injected into the material will have an enhanced interaction time with particles contained within the material. These results show that, by using the multiple scattering of light in a turbid medium, enhanced light–matter interaction can be achieved; this has a direct impact on spectroscopic methods such as Raman scattering and fluorescence detection in highly scattering regimes. Furthermore, the enhanced penetration depth achieved by this method will directly impact optical techniques that have previously been limited by the inability to deposit sufficient amounts of optical energy below or through highly scattering layers. PMID:28701381

  8. Rapid computation of the amplitude and phase of tightly focused optical fields distorted by scattering particles

    PubMed Central

    Ranasinghesagara, Janaka C.; Hayakawa, Carole K.; Davis, Mitchell A.; Dunn, Andrew K.; Potma, Eric O.; Venugopalan, Vasan

    2014-01-01

    We develop an efficient method for accurately calculating the electric field of tightly focused laser beams in the presence of specific configurations of microscopic scatterers. This Huygens–Fresnel wave-based electric field superposition (HF-WEFS) method computes the amplitude and phase of the scattered electric field in excellent agreement with finite difference time-domain (FDTD) solutions of Maxwell’s equations. Our HF-WEFS implementation is 2–4 orders of magnitude faster than the FDTD method and enables systematic investigations of the effects of scatterer size and configuration on the focal field. We demonstrate the power of the new HF-WEFS approach by mapping several metrics of focal field distortion as a function of scatterer position. This analysis shows that the maximum focal field distortion occurs for single scatterers placed below the focal plane with an offset from the optical axis. The HF-WEFS method represents an important first step toward the development of a computational model of laser-scanning microscopy of thick cellular/tissue specimens. PMID:25121440

  9. Two-step reconstruction method using global optimization and conjugate gradient for ultrasound-guided diffuse optical tomography.

    PubMed

    Tavakoli, Behnoosh; Zhu, Quing

    2013-01-01

    Ultrasound-guided diffuse optical tomography (DOT) is a promising method for characterizing malignant and benign lesions in the female breast. We introduce a new two-step algorithm for DOT inversion in which the optical parameters are estimated with the global optimization method, genetic algorithm. The estimation result is applied as an initial guess to the conjugate gradient (CG) optimization method to obtain the absorption and scattering distributions simultaneously. Simulations and phantom experiments have shown that the maximum absorption and reduced scattering coefficients are reconstructed with less than 10% and 25% errors, respectively. This is in contrast with the CG method alone, which generates about 20% error for the absorption coefficient and does not accurately recover the scattering distribution. A new measure of scattering contrast has been introduced to characterize benign and malignant breast lesions. The results of 16 clinical cases reconstructed with the two-step method demonstrates that, on average, the absorption coefficient and scattering contrast of malignant lesions are about 1.8 and 3.32 times higher than the benign cases, respectively.

  10. Experimental and theoretical study of rotationally inelastic diffraction of H{sub 2}(D{sub 2}) from methyl-terminated Si(111)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nihill, Kevin J.; Hund, Zachary M.; Sibener, S. J., E-mail: s-sibener@uchicago.edu

    2016-08-28

    Fundamental details concerning the interaction between H{sub 2} and CH{sub 3}–Si(111) have been elucidated by the combination of diffractive scattering experiments and electronic structure and scattering calculations. Rotationally inelastic diffraction (RID) of H{sub 2} and D{sub 2} from this model hydrocarbon-decorated semiconductor interface has been confirmed for the first time via both time-of-flight and diffraction measurements, with modest j = 0 → 2 RID intensities for H{sub 2} compared to the strong RID features observed for D{sub 2} over a large range of kinematic scattering conditions along two high-symmetry azimuthal directions. The Debye-Waller model was applied to the thermal attenuationmore » of diffraction peaks, allowing for precise determination of the RID probabilities by accounting for incoherent motion of the CH{sub 3}–Si(111) surface atoms. The probabilities of rotationally inelastic diffraction of H{sub 2} and D{sub 2} have been quantitatively evaluated as a function of beam energy and scattering angle, and have been compared with complementary electronic structure and scattering calculations to provide insight into the interaction potential between H{sub 2} (D{sub 2}) and hence the surface charge density distribution. Specifically, a six-dimensional potential energy surface (PES), describing the electronic structure of the H{sub 2}(D{sub 2})/CH{sub 3}−Si(111) system, has been computed based on interpolation of density functional theory energies. Quantum and classical dynamics simulations have allowed for an assessment of the accuracy of the PES, and subsequently for identification of the features of the PES that serve as classical turning points. A close scrutiny of the PES reveals the highly anisotropic character of the interaction potential at these turning points. This combination of experiment and theory provides new and important details about the interaction of H{sub 2} with a hybrid organic-semiconductor interface, which can be used to further investigate energy flow in technologically relevant systems.« less

  11. Constraints on the Mass–Richness Relation from the Abundance and Weak Lensing of SDSS Clusters

    NASA Astrophysics Data System (ADS)

    Murata, Ryoma; Nishimichi, Takahiro; Takada, Masahiro; Miyatake, Hironao; Shirasaki, Masato; More, Surhud; Takahashi, Ryuichi; Osato, Ken

    2018-02-01

    We constrain the scaling relation between optical richness (λ) and halo mass (M) for a sample of Sloan Digital Sky Survey (SDSS) red-sequence Matched-filter Probabilistic Percolation (redMaPPer) galaxy clusters within the context of the Planck cosmological model. We use a forward modeling approach where we model the probability distribution of optical richness for a given mass, P({ln}λ | M). To model the abundance and the stacked lensing profiles, we use an emulator specifically built to interpolate the halo mass function and the stacked lensing profile for an arbitrary set of halo mass and redshift, which is calibrated based on a suite of high-resolution N-body simulations. We apply our method to 8312 SDSS redMaPPer clusters with 20 ≤ λ ≤ 100 and 0.10 ≤ z λ ≤ 0.33 and show that the lognormal distribution model for P(λ | M), with four free parameters, well reproduces the measured abundances and lensing profiles simultaneously. The constraints are characterized by the mean relation, < {ln}λ > (M)=A+B{ln}(M/{M}pivot}), with A={3.207}-0.046+0.044 and B={0.993}-0.055+0.041 (68% CL), where the pivot mass scale M pivot = 3 × 1014 h ‑1 M ⊙, and the scatter {σ }lnλ | M}={σ }0+q{ln}(M/{M}pivot}) with {σ }0={0.456}-0.039+0.047 and q=-{0.169}-0.026+0.035. We find that a large scatter in halo masses is required at the lowest-richness bins (20 ≤ λ ≲ 30) in order to reproduce the measurements. Without such a large scatter, the model prediction for the lensing profiles tends to overestimate the measured amplitudes. This might imply a possible contamination of intrinsically low-richness clusters due to the projection effects. Such a low-mass halo contribution is significantly reduced when applying our method to the sample of 30 ≤ λ ≤ 100.

  12. Nucleon resonance structure in the finite volume of lattice QCD

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Jia -Jun; Kamano, H.; Lee, T. -S. H.

    An approach for relating the nucleon resonances extracted from πN reaction data to lattice QCD calculations has been developed by using the finite-volume Hamiltonian method. Within models of πN reactions, bare states are introduced to parametrize the intrinsic excitations of the nucleon. We show that the resonance can be related to the probability P N*(E) of finding the bare state, N*, in the πN scattering states in infinite volume. We further demonstrate that the probability P V N*(E) of finding the same bare states in the eigenfunctions of the underlying Hamiltonian in finite volume approaches P N*(E) as the volumemore » increases. Our findings suggest that the comparison of P N*(E) and P V N*(E) can be used to examine whether the nucleon resonances extracted from the πN reaction data within the dynamical models are consistent with lattice QCD calculation. We also discuss the measurement of P V N*(E) directly from lattice QCD. Furthermore, the practical differences between our approach and the approach using the Lüscher formalism to relate LQCD calculations to the nucleon resonance poles embedded in the data are also discussed.« less

  13. Nucleon resonance structure in the finite volume of lattice QCD

    DOE PAGES

    Wu, Jia -Jun; Kamano, H.; Lee, T. -S. H.; ...

    2017-06-19

    An approach for relating the nucleon resonances extracted from πN reaction data to lattice QCD calculations has been developed by using the finite-volume Hamiltonian method. Within models of πN reactions, bare states are introduced to parametrize the intrinsic excitations of the nucleon. We show that the resonance can be related to the probability P N*(E) of finding the bare state, N*, in the πN scattering states in infinite volume. We further demonstrate that the probability P V N*(E) of finding the same bare states in the eigenfunctions of the underlying Hamiltonian in finite volume approaches P N*(E) as the volumemore » increases. Our findings suggest that the comparison of P N*(E) and P V N*(E) can be used to examine whether the nucleon resonances extracted from the πN reaction data within the dynamical models are consistent with lattice QCD calculation. We also discuss the measurement of P V N*(E) directly from lattice QCD. Furthermore, the practical differences between our approach and the approach using the Lüscher formalism to relate LQCD calculations to the nucleon resonance poles embedded in the data are also discussed.« less

  14. Optoelectronics of inverted type-I CdS/CdSe core/crown quantum ring

    NASA Astrophysics Data System (ADS)

    Bose, Sumanta; Fan, Weijun; Zhang, Dao Hua

    2017-10-01

    Inverted type-I heterostructure core/crown quantum rings (QRs) are quantum-efficient luminophores, whose spectral characteristics are highly tunable. Here, we study the optoelectronic properties of type-I core/crown CdS/CdSe QRs in the zincblende phase—over contrasting lateral size and crown width. For this, we inspect their strain profiles, transition energies, transition matrix elements, spatial charge densities, electronic bandstructures, band-mixing probabilities, optical gain spectra, maximum optical gains, and differential optical gains. Our framework uses an effective-mass envelope function theory based on the 8-band k ṡ p method employing the valence force field model for calculating the atomic strain distributions. The gain calculations are based on the density-matrix equation and take into consideration the excitonic effects with intraband scattering. Variations in the QR lateral size and relative widths of core and crown (ergo the composition) affect their energy levels, band-mixing probabilities, optical transition matrix elements, emission wavelengths/intensities, etc. The optical gain of QRs is also strongly dimension and composition dependent with further dependency on the injection carrier density causing the band-filling effect. They also affect the maximum and differential gain at varying dimensions and compositions.

  15. Approximate non-linear multiparameter inversion for multicomponent single and double P-wave scattering in isotropic elastic media

    NASA Astrophysics Data System (ADS)

    Ouyang, Wei; Mao, Weijian

    2018-03-01

    An asymptotic quadratic true-amplitude inversion method for isotropic elastic P waves is proposed to invert medium parameters. The multicomponent P-wave scattered wavefield is computed based on a forward relationship using second-order Born approximation and corresponding high-frequency ray theoretical methods. Within the local double scattering mechanism, the P-wave transmission factors are elaborately calculated, which results in the radiation pattern for P-waves scattering being a quadratic combination of the density and Lamé's moduli perturbation parameters. We further express the elastic P-wave scattered wavefield in a form of generalized Radon transform (GRT). After introducing classical backprojection operators, we obtain an approximate solution of the inverse problem by solving a quadratic non-linear system. Numerical tests with synthetic data computed by finite-differences scheme demonstrate that our quadratic inversion can accurately invert perturbation parameters for strong perturbations, compared with the P-wave single-scattering linear inversion method. Although our inversion strategy here is only syncretized with P-wave scattering, it can be extended to invert multicomponent elastic data containing both P-wave and S-wave information.

  16. Microstructural effect on radiative scattering coefficient and asymmetry factor of anisotropic thermal barrier coatings

    NASA Astrophysics Data System (ADS)

    Chen, X. W.; Zhao, C. Y.; Wang, B. X.

    2018-05-01

    Thermal barrier coatings are common porous materials coated on the surface of devices operating under high temperatures and designed for heat insulation. This study presents a comprehensive investigation on the microstructural effect on radiative scattering coefficient and asymmetry factor of anisotropic thermal barrier coatings. Based on the quartet structure generation set algorithm, the finite-difference-time-domain method is applied to calculate angular scattering intensity distribution of complicated random microstructure, which takes wave nature into account. Combining Monte Carlo method with Particle Swarm Optimization, asymmetry factor, scattering coefficient and absorption coefficient are retrieved simultaneously. The retrieved radiative properties are identified with the angular scattering intensity distribution under different pore shapes, which takes dependent scattering and anisotropic pore shape into account implicitly. It has been found that microstructure significantly affects the radiative properties in thermal barrier coatings. Compared with spherical shape, irregular anisotropic pore shape reduces the forward scattering peak. The method used in this paper can also be applied to other porous media, which designs a frame work for further quantitative study on porous media.

  17. Approximate nonlinear multiparameter inversion for multicomponent single and double P-wave scattering in isotropic elastic media

    NASA Astrophysics Data System (ADS)

    Ouyang, Wei; Mao, Weijian

    2018-07-01

    An asymptotic quadratic true-amplitude inversion method for isotropic elastic P waves is proposed to invert medium parameters. The multicomponent P-wave scattered wavefield is computed based on a forward relationship using second-order Born approximation and corresponding high-frequency ray theoretical methods. Within the local double scattering mechanism, the P-wave transmission factors are elaborately calculated, which results in the radiation pattern for P-wave scattering being a quadratic combination of the density and Lamé's moduli perturbation parameters. We further express the elastic P-wave scattered wavefield in a form of generalized Radon transform. After introducing classical backprojection operators, we obtain an approximate solution of the inverse problem by solving a quadratic nonlinear system. Numerical tests with synthetic data computed by finite-differences scheme demonstrate that our quadratic inversion can accurately invert perturbation parameters for strong perturbations, compared with the P-wave single-scattering linear inversion method. Although our inversion strategy here is only syncretized with P-wave scattering, it can be extended to invert multicomponent elastic data containing both P- and S-wave information.

  18. Computation of scattering matrix elements of large and complex shaped absorbing particles with multilevel fast multipole algorithm

    NASA Astrophysics Data System (ADS)

    Wu, Yueqian; Yang, Minglin; Sheng, Xinqing; Ren, Kuan Fang

    2015-05-01

    Light scattering properties of absorbing particles, such as the mineral dusts, attract a wide attention due to its importance in geophysical and environment researches. Due to the absorbing effect, light scattering properties of particles with absorption differ from those without absorption. Simple shaped absorbing particles such as spheres and spheroids have been well studied with different methods but little work on large complex shaped particles has been reported. In this paper, the surface Integral Equation (SIE) with Multilevel Fast Multipole Algorithm (MLFMA) is applied to study scattering properties of large non-spherical absorbing particles. SIEs are carefully discretized with piecewise linear basis functions on triangle patches to model whole surface of the particle, hence computation resource needs increase much more slowly with the particle size parameter than the volume discretized methods. To improve further its capability, MLFMA is well parallelized with Message Passing Interface (MPI) on distributed memory computer platform. Without loss of generality, we choose the computation of scattering matrix elements of absorbing dust particles as an example. The comparison of the scattering matrix elements computed by our method and the discrete dipole approximation method (DDA) for an ellipsoid dust particle shows that the precision of our method is very good. The scattering matrix elements of large ellipsoid dusts with different aspect ratios and size parameters are computed. To show the capability of the presented algorithm for complex shaped particles, scattering by asymmetry Chebyshev particle with size parameter larger than 600 of complex refractive index m = 1.555 + 0.004 i and different orientations are studied.

  19. Isotopic response with small scintillator based gamma-ray spectrometers

    DOEpatents

    Madden, Norman W [Sparks, NV; Goulding, Frederick S [Lafayette, CA; Asztalos, Stephen J [Oakland, CA

    2012-01-24

    The intrinsic background of a gamma ray spectrometer is significantly reduced by surrounding the scintillator with a second scintillator. This second (external) scintillator surrounds the first scintillator and has an opening of approximately the same diameter as the smaller central scintillator in the forward direction. The second scintillator is selected to have a higher atomic number, and thus has a larger probability for a Compton scattering interaction than within the inner region. Scattering events that are essentially simultaneous in coincidence to the first and second scintillators, from an electronics perspective, are precluded electronically from the data stream. Thus, only gamma-rays that are wholly contained in the smaller central scintillator are used for analytic purposes.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinitsyn, N. A.

    We consider nonadiabatic transitions in explicitly time-dependent systems with Hamiltonians of the form Hˆ(t)=Aˆ+Bˆt+Cˆ/t, where t is time and Aˆ,Bˆ,Cˆ are Hermitian N × N matrices. We show that in any model of this type, scattering matrix elements satisfy nontrivial exact constraints that follow from the absence of the Stokes phenomenon for solutions with specific conditions at t→–∞. This allows one to continue such solutions analytically to t→+∞, and connect their asymptotic behavior at t→–∞ and t→+∞. This property becomes particularly useful when a model shows additional discrete symmetries. Specifically, we derive a number of simple exact constraints and explicitmore » expressions for scattering probabilities in such systems.« less

  1. Quasibound states in a triple Gaussian potential

    NASA Astrophysics Data System (ADS)

    Reichl, L. E.; Porter, Max D.

    2018-04-01

    We derive the transmission probabilities and delay times, and identify quasibound state structures in an open quantum system consisting of three Gaussian potential energy peaks, a system whose classical scattering dynamics we show to be chaotic. Such open quantum systems can serve as models for nanoscale quantum devices and their wave dynamics are similar to electromagnetic wave dynamics in optical microcavities. We use a quantum web to determine energy regimes for which the system exhibits the quantum manifestations of chaos, and we show that the classical scattering dynamics contains a significant amount of chaos. We also derive an exact expression for the non-Hermitian Hamiltonian whose eigenvalues give quasibound state energies and lifetimes of the system.

  2. Hybrid mode-scattering/sound-absorbing segmented liner system and method

    NASA Technical Reports Server (NTRS)

    Walker, Bruce E. (Inventor); Hersh, Alan S. (Inventor); Rice, Edward J. (Inventor)

    1999-01-01

    A hybrid mode-scattering/sound-absorbing segmented liner system and method in which an initial sound field within a duct is steered or scattered into higher-order modes in a first mode-scattering segment such that it is more readily and effectively absorbed in a second sound-absorbing segment. The mode-scattering segment is preferably a series of active control components positioned along the annulus of the duct, each of which includes a controller and a resonator into which a piezoelectric transducer generates the steering noise. The sound-absorbing segment is positioned acoustically downstream of the mode-scattering segment, and preferably comprises a honeycomb-backed passive acoustic liner. The invention is particularly adapted for use in turbofan engines, both in the inlet and exhaust.

  3. Calculation of the Full Scattering Amplitude without Partial Wave Decomposition. 2; Inclusion of Exchange

    NASA Technical Reports Server (NTRS)

    Shertzer, Janine; Temkin, Aaron

    2004-01-01

    The development of a practical method of accurately calculating the full scattering amplitude, without making a partial wave decomposition is continued. The method is developed in the context of electron-hydrogen scattering, and here exchange is dealt with by considering e-H scattering in the static exchange approximation. The Schroedinger equation in this approximation can be simplified to a set of coupled integro-differential equations. The equations are solved numerically for the full scattering wave function. The scattering amplitude can most accurately be calculated from an integral expression for the amplitude; that integral can be formally simplified, and then evaluated using the numerically determined wave function. The results are essentially identical to converged partial wave results.

  4. Empirical test of the spectral invariants theory using imaging spectroscopy data from a coniferous forest

    NASA Astrophysics Data System (ADS)

    Lukeš, Petr; Rautiainen, Miina; Stenberg, Pauline; Malenovský, Zbyněk

    2011-08-01

    The spectral invariants theory presents an alternative approach for modeling canopy scattering in remote sensing applications. The theory is particularly appealing in the case of coniferous forests, which typically display grouped structures and require computationally intensive calculation to account for the geometric arrangement of their canopies. However, the validity of the spectral invariants theory should be tested with empirical data sets from different vegetation types. In this paper, we evaluate a method to retrieve two canopy spectral invariants, the recollision probability and the escape factor, for a coniferous forest using imaging spectroscopy data from multiangular CHRIS PROBA and NADIR-view AISA Eagle sensors. Our results indicated that in coniferous canopies the spectral invariants theory performs well in the near infrared spectral range. In the visible range, on the other hand, the spectral invariants theory may not be useful. Secondly, our study suggested that retrieval of the escape factor could be used as a new method to describe the BRDF of a canopy.

  5. An atomic and molecular fluid model for efficient edge-plasma transport simulations at high densities

    NASA Astrophysics Data System (ADS)

    Rognlien, Thomas; Rensink, Marvin

    2016-10-01

    Transport simulations for the edge plasma of tokamaks and other magnetic fusion devices requires the coupling of plasma and recycling or injected neutral gas. There are various neutral models used for this purpose, e.g., atomic fluid model, a Monte Carlo particle models, transition/escape probability methods, and semi-analytic models. While the Monte Carlo method is generally viewed as the most accurate, it is time consuming, which becomes even more demanding for device simulations of high densities and size typical of fusion power plants because the neutral collisional mean-free path becomes very small. Here we examine the behavior of an extended fluid neutral model for hydrogen that includes both atoms and molecules, which easily includes nonlinear neutral-neutral collision effects. In addition to the strong charge-exchange between hydrogen atoms and ions, elastic scattering is included among all species. Comparisons are made with the DEGAS 2 Monte Carlo code. Work performed for U.S. DoE by LLNL under Contract DE-AC52-07NA27344.

  6. Time Domain Radar Laboratory Operating System Development and Transient EM Analysis.

    DTIC Science & Technology

    1981-09-01

    polarization of the return, arg used. Other similar methods use amplitude and phase differences or special properties of Rayleigh region scattering. All these...3ptias Inverse Scattering ... 19 2. "!xact" Inverse Scattering !Nethod .. 20 3. Other Methods ................... 21 C. REVIEW OF TDRL PROGRESS AT SPS...explicit independant variable in.most methods . In the past, frequency domain analysis has been the primary means of analyzing aan-monochromatic EM

  7. Hierarchical optimization for neutron scattering problems

    DOE PAGES

    Bao, Feng; Archibald, Rick; Bansal, Dipanshu; ...

    2016-03-14

    In this study, we present a scalable optimization method for neutron scattering problems that determines confidence regions of simulation parameters in lattice dynamics models used to fit neutron scattering data for crystalline solids. The method uses physics-based hierarchical dimension reduction in both the computational simulation domain and the parameter space. We demonstrate for silicon that after a few iterations the method converges to parameters values (interatomic force-constants) computed with density functional theory simulations.

  8. Hierarchical optimization for neutron scattering problems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bao, Feng; Archibald, Rick; Bansal, Dipanshu

    In this study, we present a scalable optimization method for neutron scattering problems that determines confidence regions of simulation parameters in lattice dynamics models used to fit neutron scattering data for crystalline solids. The method uses physics-based hierarchical dimension reduction in both the computational simulation domain and the parameter space. We demonstrate for silicon that after a few iterations the method converges to parameters values (interatomic force-constants) computed with density functional theory simulations.

  9. Lamb wave scattering by a surface-breaking crack in a plate

    NASA Technical Reports Server (NTRS)

    Datta, S. K.; Al-Nassar, Y.; Shah, A. H.

    1991-01-01

    An NDE method based on finite-element representation and modal expansion has been developed for solving the scattering of Lamb waves in an elastic plate waveguide. This method is very powerful for handling discontinuities of arbitrary shape, weldments of different orientations, canted cracks, etc. The advantage of the method is that it can be used to study the scattering of Lamb waves in anisotropic elastic plates and in multilayered plates as well.

  10. Detecting presence of live and dead pathogenic organisms in water and the water solutions by laser spectroscopy

    NASA Astrophysics Data System (ADS)

    Moguilnaya, T.; Suminov, I.; Ignatov, S.

    2017-05-01

    Presented is a new method for the recognition of live or dead pathogens in water. This method is based on the diagnostics of non-linear effects that comprise two phenomena: an induced luminescence of DNA under the influence of laser radiation, and a stimulated Brillouin scattering (SBS). The following model parameters were selected for the identification: the peak positions of spectral lines corresponding to pathogens and the difference between two wavelengths corresponding, respectively, to a laser mode maximum, and to a peak of the spectral line of a pathogen. A large volume of experimental data has been obtained and statistical analysis using Student’s test was carried out in order to determine the probability of the detection of spectra. The dynamics of the spectra of direct dispersion have been studied for a number of bacteria. Based on these results, the method and the device were developed. That device was tested in a water pipe line. In addition, we have studied the dynamics of changes in the spectra for solutions containing live bacteria and dead cells.

  11. The Inglorious Death of Jumbo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meade, Roger Allen

    In the summer of 1944, J. Robert Oppenheimer and Los Alamos faced a crisis. An isotopic impurity in Plutonium rendered the metal unusable in a gun-assembled atomic bomb (i.e., Little Boy). Making this situation worse was a shortage of Uranium. The combination of these two problems threatened the entire wartime project. The answer to this dilemma, in part, was to develop a novel assembly method for Plutonium using the supersonic shock waves created by several tons of high explosives to compress a ball of Plutonium into a supercritical state. Since this method, implosion, was not much more than a theoreticalmore » construct, the Trinity test was devised to proof test the process. Given the speculative nature of implosion, Trinity was a gamble of sorts. If the test failed (i.e., little or no nuclear yield), the blast of the high explosives would scatter the scarce and expensive Plutonium over the surrounding desert. Since the probability of failure remained high into the early summer of 1945, some method of containing a failed nuclear explosion was needed. Jumbo was the answer.« less

  12. State-to-state reactive scattering in six dimensions using reactant-product decoupling: OH + H2 → H2O + H (J = 0).

    PubMed

    Cvitaš, Marko T; Althorpe, Stuart C

    2011-01-14

    We extend to full dimensionality a recently developed wave packet method [M. T. Cvitaš and S. C. Althorpe, J. Phys. Chem. A 113, 4557 (2009)] for computing the state-to-state quantum dynamics of AB + CD → ABC + D reactions and also increase the computational efficiency of the method. This is done by introducing a new set of product coordinates, by applying the Crank-Nicholson approximation to the angular kinetic energy part of the split-operator propagator and by using a symmetry-adapted basis-to-grid transformation to evaluate integrals over the potential energy surface. The newly extended method is tested on the benchmark OH + H(2) → H(2)O + H reaction, where it allows us to obtain accurately converged state-to-state reaction probabilities (on the Wu-Schatz-Fang-Lendvay-Harding potential energy surface) with modest computational effort. These methodological advances will make possible efficient calculations of state-to-state differential cross sections on this system in the near future.

  13. Scattering from thin dielectric straps surrounding a perfectly conducting structure

    NASA Technical Reports Server (NTRS)

    Al-Hekail, Zeyad; Gupta, Inder J.

    1989-01-01

    A method to calculate the electromagnetic scattered fields from a dielectric strap wrapped around convex, conducting structure is presented. A moment method technique is used to find the current excited within the strap by the incident plane wave. Then, Uniform Geometrical Theory of Diffraction (UTD) is used to compute the fields scattered by the strap. Reasonable agreement was obtained between the computed and the measured results. The results found in this study are useful in evaluating straps as a target support structure for scattering measurements.

  14. Clusters of Point Defects Near Dislocations as a Tool to Control CdZnTe Electrical Parameters by Ultrasound

    NASA Astrophysics Data System (ADS)

    Olikh, Ya. M.; Tymochko, M. D.; Olikh, O. Ya.; Shenderovsky, V. A.

    2018-05-01

    We studied the temperature dependence (77-300 K) of the electron concentration and mobility using the Hall method under ultrasound (the acoustic Hall method) to determine the mechanisms by which ultrasound influences the electrical activity of near-dislocation clusters in n-type low-ohmic Cd1-x Zn x Te single crystals (N Cl ≈ 1024 m-3; x = 0; 0.04) with different dislocation density (0.4-5.1) × 1010 m-2. Changes in electrophysical parameters were found to occur as a function of temperature and ultrasound intensity. To evaluate the relative contribution of different charge carrier scattering mechanisms (lattice scattering, ionized impurity scattering, neutral impurity scattering, and dislocation scattering) and their change under ultrasound, a differential evolution method was used. This method made it possible to analyze experimental mobility μ H(T) by its nonlinear approximation with characteristic temperature dependence for each mechanism. An increase in neutral impurity scattering and a decrease in ionized impurity and dislocation scattering components were observed under ultrasound. The character and the amount of these acoustically induced changes correlate with particular sample dislocation characteristics. It was concluded that the observed effects are related to the acoustically induced transformation of the point-defect structure, mainly in the near dislocation crystal regions.

  15. Investigation of condensed matter by means of elastic thermal-neutron scattering

    NASA Astrophysics Data System (ADS)

    Abov, Yu. G.; Dzheparov, F. S.; Elyutin, N. O.; Lvov, D. V.; Tyulyusov, A. N.

    2016-07-01

    The application of elastic thermal-neutron scattering in investigations of condensed matter that were performed at the Institute for Theoretical and Experimental Physics is described. An account of diffraction studies with weakly absorbing crystals, including studies of the anomalous-absorption effect and coherent effects in diffuse scattering, is given. Particular attention is given to exposing the method of multiple small-angle neutron scattering (MSANS). It is shown how information about matter inhomogeneities can be obtained by this method on the basis of Molière's theory. Prospects of the development of this method are outlined, and MSANS theory is formulated for a high concentration of matter inhomogeneities.

  16. Novel laser Doppler flowmeter for pulpal blood flow measurements

    NASA Astrophysics Data System (ADS)

    Zang, De Yu; Millerd, James E.; Wilder-Smith, Petra B. B.; Arrastia-Jitosho, Anna-Marie A.

    1996-04-01

    We have proposed and experimentally demonstrated a new configuration of laser Doppler flowmetry for dental pulpal blood flow measurements. To date, the vitality of a tooth can be determined only by subjective thermal or electric tests, which are of questionable reliability and may induced pain in patient. Non-invasive techniques for determining pulpal vascular reactions to injury, treatment, and medication are in great demand. The laser Doppler flowmetry technique is non-invasive; however, clinical studies have shown that when used to measure pulpal blood flow the conventional back-scattering Doppler method suffers from low signal-to-noise ratio (SNR) and unreliable flux readings rendering it impossible to calibrate. A simplified theoretical model indicates that by using a forward scattered geometry the detected signal has a much higher SNR and can be calibrated. The forward scattered signal is readily detectable due to the fact that teeth are relatively thin organs with moderate optical loss. A preliminary experiment comparing forward scattered detection with conventional back- scattered detection was carried out using an extracted human molar. The results validated the findings of the simple theoretical model and clearly showed the utility of the forward scattering geometry. The back-scattering method had readings that fluctuated by as much as 187% in response to small changes in sensor position relative to the tooth. The forward scattered method had consistent readings (within 10%) that were independent of the sensor position, a signal-to-noise ratio that was at least 5.6 times higher than the back-scattering method, and a linear response to flow rate.

  17. Scattering of cylindrical electric field waves from an elliptical dielectric cylindrical shell

    NASA Astrophysics Data System (ADS)

    Urbanik, E. A.

    1982-12-01

    This thesis examines the scattering of cylindrical waves by large dielectric scatterers of elliptic cross section. The solution method was the method of moments using a Galerkin approach. Sinusoidal basis and testing functions were used resulting in a higher convergence rate. The higher rate of convergence made it possible for the program to run on the Aeronautical Systems Division's CYBER computers without any special storage methods. This report includes discussion on moment methods, solution of integral equations, and the relationship between the electric field and the source region or self cell singularity. Since the program produced unacceptable run times, no results are contained herein. The importance of this work is the evaluation of the practicality of moment methods using standard techniques. The long run times for a mid-sized scatterer demonstrate the impracticality of moment methods for dielectrics using standard techniques.

  18. Scatter correction in cone-beam CT via a half beam blocker technique allowing simultaneous acquisition of scatter and image information

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Ho; Xing Lei; Lee, Rena

    2012-05-15

    Purpose: X-ray scatter incurred to detectors degrades the quality of cone-beam computed tomography (CBCT) and represents a problem in volumetric image guided and adaptive radiation therapy. Several methods using a beam blocker for the estimation and subtraction of scatter have been proposed. However, due to missing information resulting from the obstruction of the blocker, such methods require dual scanning or dynamically moving blocker to obtain a complete volumetric image. Here, we propose a half beam blocker-based approach, in conjunction with a total variation (TV) regularized Feldkamp-Davis-Kress (FDK) algorithm, to correct scatter-induced artifacts by simultaneously acquiring image and scatter information frommore » a single-rotation CBCT scan. Methods: A half beam blocker, comprising lead strips, is used to simultaneously acquire image data on one side of the projection data and scatter data on the other half side. One-dimensional cubic B-Spline interpolation/extrapolation is applied to derive patient specific scatter information by using the scatter distributions on strips. The estimated scatter is subtracted from the projection image acquired at the opposite view. With scatter-corrected projections where this subtraction is completed, the FDK algorithm based on a cosine weighting function is performed to reconstruct CBCT volume. To suppress the noise in the reconstructed CBCT images produced by geometric errors between two opposed projections and interpolated scatter information, total variation regularization is applied by a minimization using a steepest gradient descent optimization method. The experimental studies using Catphan504 and anthropomorphic phantoms were carried out to evaluate the performance of the proposed scheme. Results: The scatter-induced shading artifacts were markedly suppressed in CBCT using the proposed scheme. Compared with CBCT without a blocker, the nonuniformity value was reduced from 39.3% to 3.1%. The root mean square error relative to values inside the regions of interest selected from a benchmark scatter free image was reduced from 50 to 11.3. The TV regularization also led to a better contrast-to-noise ratio. Conclusions: An asymmetric half beam blocker-based FDK acquisition and reconstruction technique has been established. The proposed scheme enables simultaneous detection of patient specific scatter and complete volumetric CBCT reconstruction without additional requirements such as prior images, dual scans, or moving strips.« less

  19. Small-angle x-ray scattering investigations of extrudates

    NASA Astrophysics Data System (ADS)

    Pikus, Stanislaw; Jamroz, Jerzy

    1997-02-01

    The small-angle X-ray scattering investigations of the extrudes are presented. The investigations of the different samples of starch by means of the SAXS indicate the new possibilities for using this method for extrudates examination. Results obtained by SAXS method of close dependance between intensity SAXS scattering and characteristic parameters of the extrudates were shown.

  20. Optimization of Al2O3/TiO2/Al 2O3 Multilayer Antireflection Coating With X-Ray Scattering Techniques

    NASA Astrophysics Data System (ADS)

    Li, Chao

    Broadband multilayer antireflection coatings (ARCs) are keys to improving solar cell efficiencies. The goal of this dissertation is to optimize the multilayer Al2O3/TiO2/Al2O 3 ARC designed for a III-V space multi-junction solar cell with understanding influences of post-annealing and varying deposition parameters on the optical properties. Accurately measuring optical properties is important in accessing optical performances of ARCs. The multilayer Al2O3/TiO 2/Al2O3 ARC and individual Al2O 3 and TiO2 layers were characterized by a novel X-ray reflectivity (XRR) method and a combined method of grazing-incidence small angle X-ray scattering (GISAXS), atomic force microscopy (AFM), and XRR developed in this study. The novel XRR method combining an enhanced Fourier analysis with specular XRR simulation effectively determines layer thicknesses and surface and interface roughnesses and/or grading with sub-nanometer precision, and densities less than three percent uncertainty. Also, the combined method of GISAXS, AFM, and XRR characterizes the distribution of pore size with one-nanometer uncertainty. Unique to this method, the diffuse scattering from surface and interface roughnesses is estimated with surface parameters (root mean square roughness sigma, lateral correlation length ξ, and Hurst parameter h) obtained from AFM, and layer densities, surface grading and interface roughness/grading obtained from specular XRR. It is then separated from pore scattering. These X-ray scattering techniques obtained consistent results and were validated by other techniques including optical reflectance, spectroscopic ellipsometry (SE), glancing incidence X-ray diffraction, transmission electron microscopy and energy dispersive X-ray spectroscopy. The ARCs were deposited by atomic layer deposition with standard parameters at 200 °C. The as-deposited individual Al2O3 layer on Si is porous and amorphous as indicated by the combined methods of GISAXS, AFM, and XRR. Both post-annealing at 400 °C for 40 min in air and varying ALD parameters can eliminate pores, and lead to consistent increases in density and refractive index determined by the XRR method, SE, and optical reflectance measurements. After annealing, the layer remains amorphous. On the other hand, the as-deposited TiO 2 layer is non-porous and amorphous. It is densified and crystallized after annealing at 400 °C for 10 min in air. The multilayer Al2O 3/TiO2/Al2O3 ARC deposited on Si has surface and interface roughnesses and/or grading on the order of one nanometer. Annealing at 400 °C for 10 min in air induces densification and crystallization of the amorphous TiO2 layer as well as possible chemical reactions between TiO2 and Si diffusing from the substrate. On the other hand, Al2O3 layers remain amorphous after annealing. The thickness of the top Al2O3 layer decreases - likely due to interdiffusion between the top two layers and loss of hydrogen from hydroxyl groups initially present in the ALD layers. The thickness of the bottom Al2O3 layer increases, probably due to the diffusion of Si atoms into the bottom layer. In addition, the multilayer Al 2O3/TiO2/Al2O3 ARC was deposited on AlInP (30nm) / GaInP (100nm) / GaAs that includes the topmost layers of III-V multi-junction solar cells. Reflectance below 5 % is achieved within nearly the whole wavelength range of the current-limiting sub-cell. Also, internal scattering occurs in the TiO2 layer possibly associated with the initiated crystallization in the TiO2 layer while absent in the amorphous Al2O3 layers.

  1. Pair distribution function analysis applied to decahedral gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Nakotte, H.; Silkwood, C.; Page, K.; Wang, H.-W.; Olds, D.; Kiefer, B.; Manna, S.; Karpov, D.; Fohtung, E.; Fullerton, E. E.

    2017-11-01

    The five-fold symmetry of face-centered cubic (fcc) derived nanoparticles is inconsistent with the translational symmetry of a Bravais lattice and generally explained by multiple twinning of a tetrahedral subunit about a (joint) symmetry axis, with or without structural modification to the fcc motif. Unlike in bulk materials, five-fold twinning in cubic nanoparticles is common and strongly affects their structural, chemical, and electronic properties. To test and verify theoretical approaches, it is therefore pertinent that the local structural features of such materials can be fully characterized. The small size of nanoparticles severely limits the application of traditional analysis techniques, such as Bragg diffraction. A complete description of the atomic arrangement in nanoparticles therefore requires a departure from the concept of translational symmetry, and prevents fully evaluating all the structural features experimentally. We describe how recent advances in instrumentation, together with the increasing power of computing, are shaping the development of alternative analysis methods of scattering data for nanostructures. We present the application of Debye scattering and pair distribution function (PDF) analysis towards modeling of the total scattering data for the example of decahedral gold nanoparticles. PDF measurements provide a statistical description of the pair correlations of atoms within a material, allowing one to evaluate the probability of finding two atoms within a given distance. We explored the sensitivity of existing synchrotron x-ray PDF instruments for distinguishing four different simple models for our gold nanoparticles: a multiply twinned fcc decahedron with either a single gap or multiple distributed gaps, a relaxed body-centered orthorhombic (bco) decahedron, and a hybrid decahedron. The data simulations of the models were then compared with experimental data from synchrotron x-ray total scattering. We present our experimentally derived atomistic models of the gold nanoparticles, with surprising results and a perspective on remaining challenges. Our findings provide evidence for the suitability of PDF analysis in the characterization of other nanosized particles that may have commercial applications.

  2. Novel QCD Phenomenology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brodsky, Stanley J.; /SLAC /Southern Denmark U., CP3-Origins

    2011-08-12

    I review a number of topics where conventional wisdom in hadron physics has been challenged. For example, hadrons can be produced at large transverse momentum directly within a hard higher-twist QCD subprocess, rather than from jet fragmentation. Such 'direct' processes can explain the deviations from perturbative QCD predictions in measurements of inclusive hadron cross sections at fixed x{sub T} = 2p{sub T}/{radical}s, as well as the 'baryon anomaly', the anomalously large proton-to-pion ratio seen in high centrality heavy ion collisions. Initial-state and final-state interactions of the struck quark, the soft-gluon rescattering associated with its Wilson line, lead to Bjorken-scaling single-spinmore » asymmetries, diffractive deep inelastic scattering, the breakdown of the Lam-Tung relation in Drell-Yan reactions, as well as nuclear shadowing and antishadowing. The Gribov-Glauber theory predicts that antishadowing of nuclear structure functions is not universal, but instead depends on the flavor quantum numbers of each quark and antiquark, thus explaining the anomalous nuclear dependence measured in deep-inelastic neutrino scattering. Since shadowing and antishadowing arise from the physics of leading-twist diffractive deep inelastic scattering, one cannot attribute such phenomena to the structure of the nucleus itself. It is thus important to distinguish 'static' structure functions, the probability distributions computed from the square of the target light-front wavefunctions, versus 'dynamical' structure functions which include the effects of the final-state rescattering of the struck quark. The importance of the J = 0 photon-quark QCD contact interaction in deeply virtual Compton scattering is also emphasized. The scheme-independent BLM method for setting the renormalization scale is discussed. Eliminating the renormalization scale ambiguity greatly improves the precision of QCD predictions and increases the sensitivity of searches for new physics at the LHC. Other novel features of QCD are discussed, including the consequences of confinement for quark and gluon condensates.« less

  3. Gaussian basis functions for highly oscillatory scattering wavefunctions

    NASA Astrophysics Data System (ADS)

    Mant, B. P.; Law, M. M.

    2018-04-01

    We have applied a basis set of distributed Gaussian functions within the S-matrix version of the Kohn variational method to scattering problems involving deep potential energy wells. The Gaussian positions and widths are tailored to the potential using the procedure of Bačić and Light (1986 J. Chem. Phys. 85 4594) which has previously been applied to bound-state problems. The placement procedure is shown to be very efficient and gives scattering wavefunctions and observables in agreement with direct numerical solutions. We demonstrate the basis function placement method with applications to hydrogen atom–hydrogen atom scattering and antihydrogen atom–hydrogen atom scattering.

  4. Library based x-ray scatter correction for dedicated cone beam breast CT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Linxi; Zhu, Lei, E-mail: leizhu@gatech.edu

    Purpose: The image quality of dedicated cone beam breast CT (CBBCT) is limited by substantial scatter contamination, resulting in cupping artifacts and contrast-loss in reconstructed images. Such effects obscure the visibility of soft-tissue lesions and calcifications, which hinders breast cancer detection and diagnosis. In this work, we propose a library-based software approach to suppress scatter on CBBCT images with high efficiency, accuracy, and reliability. Methods: The authors precompute a scatter library on simplified breast models with different sizes using the GEANT4-based Monte Carlo (MC) toolkit. The breast is approximated as a semiellipsoid with homogeneous glandular/adipose tissue mixture. For scatter correctionmore » on real clinical data, the authors estimate the breast size from a first-pass breast CT reconstruction and then select the corresponding scatter distribution from the library. The selected scatter distribution from simplified breast models is spatially translated to match the projection data from the clinical scan and is subtracted from the measured projection for effective scatter correction. The method performance was evaluated using 15 sets of patient data, with a wide range of breast sizes representing about 95% of general population. Spatial nonuniformity (SNU) and contrast to signal deviation ratio (CDR) were used as metrics for evaluation. Results: Since the time-consuming MC simulation for library generation is precomputed, the authors’ method efficiently corrects for scatter with minimal processing time. Furthermore, the authors find that a scatter library on a simple breast model with only one input parameter, i.e., the breast diameter, sufficiently guarantees improvements in SNU and CDR. For the 15 clinical datasets, the authors’ method reduces the average SNU from 7.14% to 2.47% in coronal views and from 10.14% to 3.02% in sagittal views. On average, the CDR is improved by a factor of 1.49 in coronal views and 2.12 in sagittal views. Conclusions: The library-based scatter correction does not require increase in radiation dose or hardware modifications, and it improves over the existing methods on implementation simplicity and computational efficiency. As demonstrated through patient studies, the authors’ approach is effective and stable, and is therefore clinically attractive for CBBCT imaging.« less

  5. WE-DE-207B-12: Scatter Correction for Dedicated Cone Beam Breast CT Based On a Forward Projection Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, L; Zhu, L; Vedantham, S

    2016-06-15

    Purpose: The image quality of dedicated cone-beam breast CT (CBBCT) is fundamentally limited by substantial x-ray scatter contamination, resulting in cupping artifacts and contrast-loss in reconstructed images. Such effects obscure the visibility of soft-tissue lesions and calcifications, which hinders breast cancer detection and diagnosis. In this work, we propose to suppress x-ray scatter in CBBCT images using a deterministic forward projection model. Method: We first use the 1st-pass FDK-reconstructed CBBCT images to segment fibroglandular and adipose tissue. Attenuation coefficients are assigned to the two tissues based on the x-ray spectrum used for imaging acquisition, and is forward projected to simulatemore » scatter-free primary projections. We estimate the scatter by subtracting the simulated primary projection from the measured projection, and then the resultant scatter map is further refined by a Fourier-domain fitting algorithm after discarding untrusted scatter information. The final scatter estimate is subtracted from the measured projection for effective scatter correction. In our implementation, the proposed scatter correction takes 0.5 seconds for each projection. The method was evaluated using the overall image spatial non-uniformity (SNU) metric and the contrast-to-noise ratio (CNR) with 5 clinical datasets of BI-RADS 4/5 subjects. Results: For the 5 clinical datasets, our method reduced the SNU from 7.79% to 1.68% in coronal view and from 6.71% to 3.20% in sagittal view. The average CNR is improved by a factor of 1.38 in coronal view and 1.26 in sagittal view. Conclusion: The proposed scatter correction approach requires no additional scans or prior images and uses a deterministic model for efficient calculation. Evaluation with clinical datasets demonstrates the feasibility and stability of the method. These features are attractive for clinical CBBCT and make our method distinct from other approaches. Supported partly by NIH R21EB019597, R21CA134128 and R01CA195512.The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.« less

  6. Library based x-ray scatter correction for dedicated cone beam breast CT

    PubMed Central

    Shi, Linxi; Karellas, Andrew; Zhu, Lei

    2016-01-01

    Purpose: The image quality of dedicated cone beam breast CT (CBBCT) is limited by substantial scatter contamination, resulting in cupping artifacts and contrast-loss in reconstructed images. Such effects obscure the visibility of soft-tissue lesions and calcifications, which hinders breast cancer detection and diagnosis. In this work, we propose a library-based software approach to suppress scatter on CBBCT images with high efficiency, accuracy, and reliability. Methods: The authors precompute a scatter library on simplified breast models with different sizes using the geant4-based Monte Carlo (MC) toolkit. The breast is approximated as a semiellipsoid with homogeneous glandular/adipose tissue mixture. For scatter correction on real clinical data, the authors estimate the breast size from a first-pass breast CT reconstruction and then select the corresponding scatter distribution from the library. The selected scatter distribution from simplified breast models is spatially translated to match the projection data from the clinical scan and is subtracted from the measured projection for effective scatter correction. The method performance was evaluated using 15 sets of patient data, with a wide range of breast sizes representing about 95% of general population. Spatial nonuniformity (SNU) and contrast to signal deviation ratio (CDR) were used as metrics for evaluation. Results: Since the time-consuming MC simulation for library generation is precomputed, the authors’ method efficiently corrects for scatter with minimal processing time. Furthermore, the authors find that a scatter library on a simple breast model with only one input parameter, i.e., the breast diameter, sufficiently guarantees improvements in SNU and CDR. For the 15 clinical datasets, the authors’ method reduces the average SNU from 7.14% to 2.47% in coronal views and from 10.14% to 3.02% in sagittal views. On average, the CDR is improved by a factor of 1.49 in coronal views and 2.12 in sagittal views. Conclusions: The library-based scatter correction does not require increase in radiation dose or hardware modifications, and it improves over the existing methods on implementation simplicity and computational efficiency. As demonstrated through patient studies, the authors’ approach is effective and stable, and is therefore clinically attractive for CBBCT imaging. PMID:27487870

  7. Scatter correction method for x-ray CT using primary modulation: Phantom studies

    PubMed Central

    Gao, Hewei; Fahrig, Rebecca; Bennett, N. Robert; Sun, Mingshan; Star-Lack, Josh; Zhu, Lei

    2010-01-01

    Purpose: Scatter correction is a major challenge in x-ray imaging using large area detectors. Recently, the authors proposed a promising scatter correction method for x-ray computed tomography (CT) using primary modulation. Proof of concept was previously illustrated by Monte Carlo simulations and physical experiments on a small phantom with a simple geometry. In this work, the authors provide a quantitative evaluation of the primary modulation technique and demonstrate its performance in applications where scatter correction is more challenging. Methods: The authors first analyze the potential errors of the estimated scatter in the primary modulation method. On two tabletop CT systems, the method is investigated using three phantoms: A Catphan©600 phantom, an anthropomorphic chest phantom, and the Catphan©600 phantom with two annuli. Two different primary modulators are also designed to show the impact of the modulator parameters on the scatter correction efficiency. The first is an aluminum modulator with a weak modulation and a low modulation frequency, and the second is a copper modulator with a strong modulation and a high modulation frequency. Results: On the Catphan©600 phantom in the first study, the method reduces the error of the CT number in the selected regions of interest (ROIs) from 371.4 to 21.9 Hounsfield units (HU); the contrast to noise ratio also increases from 10.9 to 19.2. On the anthropomorphic chest phantom in the second study, which represents a more difficult case due to the high scatter signals and object heterogeneity, the method reduces the error of the CT number from 327 to 19 HU in the selected ROIs and from 31.4% to 5.7% on the overall average. The third study is to investigate the impact of object size on the efficiency of our method. The scatter-to-primary ratio estimation error on the Catphan©600 phantom without any annulus (20 cm in diameter) is at the level of 0.04, it rises to 0.07 and 0.1 on the phantom with an elliptical annulus (30 cm in the minor axis and 38 cm in the major axis) and with a circular annulus (38 cm in diameter). Conclusions: On the three phantom studies, good scatter correction performance of the proposed method has been demonstrated using both image comparisons and quantitative analysis. The theory and experiments demonstrate that a strong primary modulation that possesses a low transmission factor and a high modulation frequency is preferred for high scatter correction accuracy. PMID:20229902

  8. Multispectral imaging of absorption and scattering properties of in vivo exposed rat brain using a digital red-green-blue camera.

    PubMed

    Yoshida, Keiichiro; Nishidate, Izumi; Ishizuka, Tomohiro; Kawauchi, Satoko; Sato, Shunichi; Sato, Manabu

    2015-05-01

    In order to estimate multispectral images of the absorption and scattering properties in the cerebral cortex of in vivo rat brain, we investigated spectral reflectance images estimated by the Wiener estimation method using a digital RGB camera. A Monte Carlo simulation-based multiple regression analysis for the corresponding spectral absorbance images at nine wavelengths (500, 520, 540, 560, 570, 580, 600, 730, and 760 nm) was then used to specify the absorption and scattering parameters of brain tissue. In this analysis, the concentrations of oxygenated hemoglobin and that of deoxygenated hemoglobin were estimated as the absorption parameters, whereas the coefficient a and the exponent b of the reduced scattering coefficient spectrum approximated by a power law function were estimated as the scattering parameters. The spectra of absorption and reduced scattering coefficients were reconstructed from the absorption and scattering parameters, and the spectral images of absorption and reduced scattering coefficients were then estimated. In order to confirm the feasibility of this method, we performed in vivo experiments on exposed rat brain. The estimated images of the absorption coefficients were dominated by the spectral characteristics of hemoglobin. The estimated spectral images of the reduced scattering coefficients had a broad scattering spectrum, exhibiting a larger magnitude at shorter wavelengths, corresponding to the typical spectrum of brain tissue published in the literature. The changes in the estimated absorption and scattering parameters during normoxia, hyperoxia, and anoxia indicate the potential applicability of the method by which to evaluate the pathophysiological conditions of in vivo brain due to the loss of tissue viability.

  9. Scatter correction using a primary modulator on a clinical angiography C-arm CT system.

    PubMed

    Bier, Bastian; Berger, Martin; Maier, Andreas; Kachelrieß, Marc; Ritschl, Ludwig; Müller, Kerstin; Choi, Jang-Hwan; Fahrig, Rebecca

    2017-09-01

    Cone beam computed tomography (CBCT) suffers from a large amount of scatter, resulting in severe scatter artifacts in the reconstructions. Recently, a new scatter correction approach, called improved primary modulator scatter estimation (iPMSE), was introduced. That approach utilizes a primary modulator that is inserted between the X-ray source and the object. This modulation enables estimation of the scatter in the projection domain by optimizing an objective function with respect to the scatter estimate. Up to now the approach has not been implemented on a clinical angiography C-arm CT system. In our work, the iPMSE method is transferred to a clinical C-arm CBCT. Additional processing steps are added in order to compensate for the C-arm scanner motion and the automatic X-ray tube current modulation. These challenges were overcome by establishing a reference modulator database and a block-matching algorithm. Experiments with phantom and experimental in vivo data were performed to evaluate the method. We show that scatter correction using primary modulation is possible on a clinical C-arm CBCT. Scatter artifacts in the reconstructions are reduced with the newly extended method. Compared to a scan with a narrow collimation, our approach showed superior results with an improvement of the contrast and the contrast-to-noise ratio for the phantom experiments. In vivo data are evaluated by comparing the results with a scan with a narrow collimation and with a constant scatter correction approach. Scatter correction using primary modulation is possible on a clinical CBCT by compensating for the scanner motion and the tube current modulation. Scatter artifacts could be reduced in the reconstructions of phantom scans and in experimental in vivo data. © 2017 American Association of Physicists in Medicine.

  10. Magnetic forces and localized resonances in electron transfer through quantum rings.

    PubMed

    Poniedziałek, M R; Szafran, B

    2010-11-24

    We study the current flow through semiconductor quantum rings. In high magnetic fields the current is usually injected into the arm of the ring preferred by classical magnetic forces. However, for narrow magnetic field intervals that appear periodically on the magnetic field scale the current is injected into the other arm of the ring. We indicate that the appearance of the anomalous-non-classical-current circulation results from Fano interference involving localized resonant states. The identification of the Fano interference is based on the comparison of the solution of the scattering problem with the results of the stabilization method. The latter employs the bound-state type calculations and allows us to extract both the energy of metastable states localized within the ring and the width of resonances by analysis of the energy spectrum of a finite size system as a function of its length. The Fano resonances involving states of anomalous current circulation become extremely narrow on both the magnetic field and energy scales. This is consistent with the orientation of the Lorentz force that tends to keep the electron within the ring and thus increases the lifetime of the electron localization within the ring. Absence of periodic Fano resonances in electron transfer probability through a quantum ring containing an elastic scatterer is also explained.

  11. Direct imaging of small scatterers using reduced time dependent data

    NASA Astrophysics Data System (ADS)

    Cakoni, Fioralba; Rezac, Jacob D.

    2017-06-01

    We introduce qualitative methods for locating small objects using time dependent acoustic near field waves. These methods have reduced data collection requirements compared to typical qualitative imaging techniques. In particular, we only collect scattered field data in a small region surrounding the location from which an incident field was transmitted. The new methods are partially theoretically justified and numerical simulations demonstrate their efficacy. We show that these reduced data techniques give comparable results to methods which require full multistatic data and that these time dependent methods require less scattered field data than their time harmonic analogs.

  12. Determination of thorium (IV) using isophthalaldehyde-tetrapyrrole as probe by resonance light scattering, second-order scattering and frequency-doubling scattering spectra

    NASA Astrophysics Data System (ADS)

    Wang, Jiao; Xue, Jinhua; Xiao, Xilin; Xu, Li; Jiang, Min; Peng, Pengcheng; Liao, Lifu

    2017-12-01

    The coordination reaction of thorium (IV) with a ditopic bidentate ligand to form supramolecular polymer was studied by resonance light scattering (RLS) spectra, second-order scattering (SOS) spectra and frequency-doubling scattering (FDS) spectra, respectively. The ditopic bidentate ligand is isophthalaldehyde-tetrapyrrole (IPTP). It was synthesized through a condensation reaction of isophthalaldehyde with pyrrole. The formation of supramolecular polymer results in remarkable intensity enhancements of the three light scattering signals. The maximum scattering wavelengths of RLS, FDS and SOS were 290, 568 and 340 nm, respectively. The reaction was used to establish new light scattering methods for the determination of thorium (IV) by using IPTP as probe. Under optimum conditions, the intensity enhancements of RLS, SOS and FDS were directly proportional to the concentration of thorium (IV) in the ranges of 0.01 to 1.2 μg mL- 1, 0.05 to 1.2 μg mL- 1 and 0.05 to 1.2 μg mL- 1, respectively. The detection limits were 0.003 μg mL- 1, 0.012 μg mL- 1 and 0.021 μg mL- 1, respectively. The methods were suitable for analyzing thorium (IV) in actual samples. The results show acceptable recoveries and precision compared with a reference method.

  13. Low dose scatter correction for digital chest tomosynthesis

    NASA Astrophysics Data System (ADS)

    Inscoe, Christina R.; Wu, Gongting; Shan, Jing; Lee, Yueh Z.; Zhou, Otto; Lu, Jianping

    2015-03-01

    Digital chest tomosynthesis (DCT) provides superior image quality and depth information for thoracic imaging at relatively low dose, though the presence of strong photon scatter degrades the image quality. In most chest radiography, anti-scatter grids are used. However, the grid also blocks a large fraction of the primary beam photons requiring a significantly higher imaging dose for patients. Previously, we have proposed an efficient low dose scatter correction technique using a primary beam sampling apparatus. We implemented the technique in stationary digital breast tomosynthesis, and found the method to be efficient in correcting patient-specific scatter with only 3% increase in dose. In this paper we reported the feasibility study of applying the same technique to chest tomosynthesis. This investigation was performed utilizing phantom and cadaver subjects. The method involves an initial tomosynthesis scan of the object. A lead plate with an array of holes, or primary sampling apparatus (PSA), was placed above the object. A second tomosynthesis scan was performed to measure the primary (scatter-free) transmission. This PSA data was used with the full-field projections to compute the scatter, which was then interpolated to full-field scatter maps unique to each projection angle. Full-field projection images were scatter corrected prior to reconstruction. Projections and reconstruction slices were evaluated and the correction method was found to be effective at improving image quality and practical for clinical implementation.

  14. Appearance of De Geer moraines in southern and western Finland - Implications for reconstructing glacier retreat dynamics

    NASA Astrophysics Data System (ADS)

    Ojala, Antti E. K.

    2016-02-01

    LiDAR digital elevation models (DEMs) from southern and western Finland were investigated to map and discriminate features of De Geer moraines, sparser and more scattered end moraines, and larger end moraine features (i.e., ice-marginal complexes). The results indicate that the occurrence and distribution of De Geer moraines and scattered end moraine ridges in Finland are more widespread than previously suggested. This is probably attributed to the ease of detecting and mapping these features with high-resolution DEMs, indicating the efficiency of LiDAR applications in geological and geomorphological studies. The variable appearance and distribution of moraine ridges in Finland support previous interpretations that no single model is likely to be appropriate for the genesis of De Geer moraines at all localities and for all types of end moraines. De Geer moraine appearances and interdistances probably result from a combination of the general rapidity of ice-margin recession during deglaciation, the proglacial water depth in which they were formed, and local glacier dynamics related to climate and terrain topography. The correlation between the varved clay-based rate of deglaciation and interdistances of distinct and regularly spaced De Geer moraine ridges indicates that the rate of deglaciation is probably involved in the De Geer ridge-forming process, but more thorough comparisons are needed to understand the extent to which De Geer interdistances represent an annual rate of ice-margin decay and the rapidity of regional deglaciation.

  15. Uncertainty propagation for statistical impact prediction of space debris

    NASA Astrophysics Data System (ADS)

    Hoogendoorn, R.; Mooij, E.; Geul, J.

    2018-01-01

    Predictions of the impact time and location of space debris in a decaying trajectory are highly influenced by uncertainties. The traditional Monte Carlo (MC) method can be used to perform accurate statistical impact predictions, but requires a large computational effort. A method is investigated that directly propagates a Probability Density Function (PDF) in time, which has the potential to obtain more accurate results with less computational effort. The decaying trajectory of Delta-K rocket stages was used to test the methods using a six degrees-of-freedom state model. The PDF of the state of the body was propagated in time to obtain impact-time distributions. This Direct PDF Propagation (DPP) method results in a multi-dimensional scattered dataset of the PDF of the state, which is highly challenging to process. No accurate results could be obtained, because of the structure of the DPP data and the high dimensionality. Therefore, the DPP method is less suitable for practical uncontrolled entry problems and the traditional MC method remains superior. Additionally, the MC method was used with two improved uncertainty models to obtain impact-time distributions, which were validated using observations of true impacts. For one of the two uncertainty models, statistically more valid impact-time distributions were obtained than in previous research.

  16. How Unusual were Hurricane Harvey's Rains?

    NASA Astrophysics Data System (ADS)

    Emanuel, K.

    2017-12-01

    We apply an advanced technique for hurricane risk assessment to evaluate the probability of hurricane rainfall of Harvey's magnitude. The technique embeds a detailed computational hurricane model in the large-scale conditions represented by climate reanalyses and by climate models. We simulate 3700 hurricane events affecting the state of Texas, from each of three climate reanalyses spanning the period 1980-2016, and 2000 events from each of six climate models for each of two periods: the period 1981-2000 from historical simulations, and the period 2081-2100 from future simulations under Representative Concentration Pathway (RCP) 8.5. On the basis of these simulations, we estimate that hurricane rain of Harvey's magnitude in the state of Texas would have had an annual probability of 0.01 in the late twentieth century, and will have an annual probability of 0.18 by the end of this century, with remarkably small scatter among the six climate models downscaled. If the event frequency is changing linearly over time, this would yield an annual probability of 0.06 in 2017.

  17. Blind source separation based on time-frequency morphological characteristics for rigid acoustic scattering by underwater objects

    NASA Astrophysics Data System (ADS)

    Yang, Yang; Li, Xiukun

    2016-06-01

    Separation of the components of rigid acoustic scattering by underwater objects is essential in obtaining the structural characteristics of such objects. To overcome the problem of rigid structures appearing to have the same spectral structure in the time domain, time-frequency Blind Source Separation (BSS) can be used in combination with image morphology to separate the rigid scattering components of different objects. Based on a highlight model, the separation of the rigid scattering structure of objects with time-frequency distribution is deduced. Using a morphological filter, different characteristics in a Wigner-Ville Distribution (WVD) observed for single auto term and cross terms can be simplified to remove any cross-term interference. By selecting time and frequency points of the auto terms signal, the accuracy of BSS can be improved. An experimental simulation has been used, with changes in the pulse width of the transmitted signal, the relative amplitude and the time delay parameter, in order to analyzing the feasibility of this new method. Simulation results show that the new method is not only able to separate rigid scattering components, but can also separate the components when elastic scattering and rigid scattering exist at the same time. Experimental results confirm that the new method can be used in separating the rigid scattering structure of underwater objects.

  18. Quantification of Material Fluorescence and Light Scattering Cross Sections Using Ratiometric Bandwidth-Varied Polarized Resonance Synchronous Spectroscopy.

    PubMed

    Xu, Joanna Xiuzhu; Hu, Juan; Zhang, Dongmao

    2018-05-25

    Presented herein is the ratiometric bandwidth-varied polarized resonance synchronous spectroscopy (BVPRS2) method for quantification of material optical activity spectra. These include the sample light absorption and scattering cross-section spectrum, the scattering depolarization spectrum, and the fluorescence emission cross-section and depolarization spectrum in the wavelength region where the sample both absorbs and emits. This ratiometric BVPRS2 spectroscopic method is a self-contained technique capable of quantitatively decoupling material fluorescence and light scattering signal contribution to its ratiometric BVPRS2 spectra through the linear curve-fitting of the ratiometric BVPRS2 signal as a function of the wavelength bandwidth used in the PRS2 measurements. Example applications of this new spectroscopic method are demonstrated with materials that can be approximated as pure scatterers, simultaneous photon absorbers/emitters, simultaneous photon absorbers/scatterers, and finally simultaneous photon absorbers/scatterers/emitters. Because the only instruments needed for this ratiometric BVPRS2 technique are the conventional UV-vis spectrophotometer and spectrofluorometer, this work should open doors for routine decomposition of material UV-vis extinction spectrum into its absorption and scattering component spectra. The methodology and insights provided in this work should be of broad significance to all chemical research that involves photon/matter interactions.

  19. Light Scattering by Fractal Dust Aggregates. I. Angular Dependence of Scattering

    NASA Astrophysics Data System (ADS)

    Tazaki, Ryo; Tanaka, Hidekazu; Okuzumi, Satoshi; Kataoka, Akimasa; Nomura, Hideko

    2016-06-01

    In protoplanetary disks, micron-sized dust grains coagulate to form highly porous dust aggregates. Because the optical properties of these aggregates are not completely understood, it is important to investigate how porous dust aggregates scatter light. In this study, the light scattering properties of porous dust aggregates were calculated using a rigorous method, the T-matrix method, and the results were then compared with those obtained using the Rayleigh-Gans-Debye (RGD) theory and Mie theory with the effective medium approximation (EMT). The RGD theory is applicable to moderately large aggregates made of nearly transparent monomers. This study considered two types of porous dust aggregates—ballistic cluster-cluster agglomerates (BCCAs) and ballistic particle-cluster agglomerates. First, the angular dependence of the scattered intensity was shown to reflect the hierarchical structure of dust aggregates; the large-scale structure of the aggregates is responsible for the intensity at small scattering angles, and their small-scale structure determines the intensity at large scattering angles. Second, it was determined that the EMT underestimates the backward scattering intensity by multiple orders of magnitude, especially in BCCAs, because the EMT averages the structure within the size of the aggregates. It was concluded that the RGD theory is a very useful method for calculating the optical properties of BCCAs.

  20. LIGHT SCATTERING BY FRACTAL DUST AGGREGATES. I. ANGULAR DEPENDENCE OF SCATTERING

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tazaki, Ryo; Tanaka, Hidekazu; Okuzumi, Satoshi

    2016-06-01

    In protoplanetary disks, micron-sized dust grains coagulate to form highly porous dust aggregates. Because the optical properties of these aggregates are not completely understood, it is important to investigate how porous dust aggregates scatter light. In this study, the light scattering properties of porous dust aggregates were calculated using a rigorous method, the T -matrix method, and the results were then compared with those obtained using the Rayleigh–Gans–Debye (RGD) theory and Mie theory with the effective medium approximation (EMT). The RGD theory is applicable to moderately large aggregates made of nearly transparent monomers. This study considered two types of porousmore » dust aggregates—ballistic cluster–cluster agglomerates (BCCAs) and ballistic particle–cluster agglomerates. First, the angular dependence of the scattered intensity was shown to reflect the hierarchical structure of dust aggregates; the large-scale structure of the aggregates is responsible for the intensity at small scattering angles, and their small-scale structure determines the intensity at large scattering angles. Second, it was determined that the EMT underestimates the backward scattering intensity by multiple orders of magnitude, especially in BCCAs, because the EMT averages the structure within the size of the aggregates. It was concluded that the RGD theory is a very useful method for calculating the optical properties of BCCAs.« less

Top