Molecular Characterization and Analysis of a Novel Protein Disulfide Isomerase-Like Protein of Eimeria tenella

PubMed Central

Han, Hongyu; Dong, Hui; Zhu, Shunhai; Zhao, Qiping; Jiang, Lianlian; Wang, Yange; Li, Liujia; Wu, Youlin; Huang, Bing

2014-01-01

Protein disulfide isomerase (PDI) and PDI-like proteins are members of the thioredoxin superfamily. They contain thioredoxin-like domains and catalyze the physiological oxidation, reduction and isomerization of protein disulfide bonds, which are involved in cell function and development in prokaryotes and eukaryotes. In this study, EtPDIL, a novel PDI-like gene of Eimeria tenella, was cloned using rapid amplification of cDNA ends (RACE) according to the expressed sequence tag (EST). The EtPDIL cDNA contained 1129 nucleotides encoding 216 amino acids. The deduced EtPDIL protein belonged to thioredoxin-like superfamily and had a single predicted thioredoxin domain with a non-classical thioredoxin-like motif (SXXC). BLAST analysis showed that the EtPDIL protein was 55–59% identical to PDI-like proteins of other apicomplexan parasites. The transcript and protein levels of EtPDIL at different development stages were investigated by real-time quantitative PCR and western blot. The messenger RNA and protein levels of EtPDIL were higher in sporulated oocysts than in unsporulated oocysts, sporozoites or merozoites. Protein expression was barely detectable in unsporulated oocysts. Western blots showed that rabbit antiserum against recombinant EtPDIL recognized only a native 24 kDa protein from parasites. Immunolocalization with EtPDIL antibody showed that EtPDIL had a disperse distribution in the cytoplasm of whole sporozoites and merozoites. After sporozoites were incubated in complete medium, EtPDIL protein concentrated at the anterior of the sporozoites and appeared on the surface of parasites. Specific staining was more intense and mainly located on the parasite surface after merozoites released from mature schizonts invaded DF-1 cells. After development of parasites in DF-1 cells, staining intensified in trophozoites, immature schizonts and mature schizonts. Antibody inhibition of EtPDIL function reduced the ability of E. tenella to invade DF-1 cells. These results suggested that EtPDIL might be involved in sporulation in external environments and in host cell adhesion, invasion and development of E. tenella. PMID:24932912

Inhibitors of ubiquitin E3 ligase as potential new antimalarial drug leads.

PubMed

Jain, Jagrati; Jain, Surendra K; Walker, Larry A; Tekwani, Babu L

2017-06-02

Protein ubiquitylation is an important post-translational regulation, which has been shown to be necessary for life cycle progression and survival of Plasmodium falciparum. Ubiquitin is a highly conserved 76 amino acid polypeptide, which attaches covalently to target proteins through combined action of three classes of enzymes namely, the ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin-protein ligase (E3). Ubiquitin E1 and E2 are highly conserved within eukaryotes. However, the P. falciparum E3 ligase is substantially variable and divergent compared to the homologs from other eukaryotes, which make the E3 ligase a parasite-specific target. A set of selected E3 ubiquitin ligase inhibitors was tested in vitro against a chloroquine-sensitive P. falciparum D6 strain (PfD6) and a chloroquine-resistant P. falciparum W2 strain (PfW2). The inhibitors were also tested against Vero and transformed THP1 cells for cytotoxicity. The lead antimalarial E3 ubiquitin ligase inhibitors were further evaluated for the stage-specific antimalarial action and effects on cellular development of P. falciparum in vitro. Statistics analysis was done by two-way ANOVA followed by Tukey and Sidak multiple comparison test using GraphPad Prism 6. E3 ligase inhibitors namely, JNJ 26854165, HLI 373 and Nutlin 3 showed prominent antimalarial activity against PfD6 and PfW2. These inhibitors were considerably less cytotoxic to mammalian Vero cells. JNJ 26854165, HLI 373 and Nutlin 3 blocked the development of P. falciparum parasite at the trophozoite and schizont stages, resulting in accumulation of distorted trophozoites and immature schizonts. Interruption of trophozoites and schizont maturation by the antimalarial E3 ligase inhibitors suggest the role of ubiquitin/proteasome functions in the intraerythrocytic development of malaria parasite. The ubiquitin/proteasome functions may be critical for schizont maturation. Further investigations on the lead E3 ligase inhibitors shall provide better understanding regarding the importance of E3 ligase functions in the malaria parasite as a potential new antimalarial drug target and a new class of antimalarial drug leads.

[Parahaemoproteus desseri n. sp.; gametogony and schizogony in the natural host: Psittacula roseata from Thailand, experimental sporogony in Culicoides nubeculosus (author's transl)].

PubMed

Miltgen, F; Landau, I; Ratanaworabhan, N; Yenbutra, S

1981-01-01

The gametogony and the tissue schizogony of Parahaemoproteus desseri are described in the natural host: Psittacula roseata; the schizonts develop in muscle fibres; they are large (up to 900 micrometer) and often sausage shaped with pseudo-septa. Experimental sporogony was studied in laboratory bred Culicoides nubeculosus (Ceratopogonidae). Oocysts are small and give rise to a small number of sporozoites. The morphological characteristics of the schizonts of our Parahaemoproteus are very similar to those of schizonts of Arthrocystis galli and therefore it is possible that the two genera are synonymous.

Evidence to support horses as natural intermediate hosts for Sarcocystis neurona.

PubMed

Mullaney, Thomas; Murphy, Alice J; Kiupel, Matti; Bell, Julia A; Rossano, Mary G; Mansfield, Linda S

2005-10-10

Opossums (Didelphis spp.) are the definitive host for the protozoan parasite Sarcocystis neurona, the causative agent of equine protozoal myeloencephalitis (EPM). Opossums shed sporocysts in feces that can be ingested by true intermediate hosts (cats, raccoons, skunks, armadillos and sea otters). Horses acquire the parasite by ingestion of feed or water contaminated by opossum feces. However, horses have been classified as aberrant intermediate hosts because the terminal asexual sarcocyst stage that is required for transmission to the definitive host has not been found in their tissues despite extensive efforts to search for them [Dubey, J.P., Lindsay, D.S., Saville, W.J., Reed, S.M., Granstrom, D.E., Speer, C.A., 2001b. A review of Sarcocystis neurona and equine protozoal myeloencephalitis (EPM). Vet. Parasitol. 95, 89-131]. In a 4-month-old filly with neurological disease consistent with EPM, we demonstrate schizonts in the brain and spinal cord and mature sarcocysts in the tongue and skeletal muscle, both with genetic and morphological characteristics of S. neurona. The histological and electron microscopic morphology of the schizonts and sarcocysts were identical to published features of S. neurona [Stanek, J.F., Dubey, J.P., Oglesbee, M.J., Reed, S.M., Lindsay, D.S., Capitini, L.A., Njoku, C.J., Vittitow, K.L., Saville, W.J., 2002. Life cycle of Sarcocystis neurona in its natural intermediate host, the raccoon, Procyon lotor. J. Parasitol. 88, 1151-1158]. DNA from schizonts and sarcocysts from this horse produced Sarcocystis specific 334bp PCR products [Tanhauser, S.M., Yowell, C.A., Cutler, T.J., Greiner, E.C., MacKay, R.J., Dame, J.B., 1999. Multiple DNA markers differentiate Sarcocystis neurona and Sarcocystis falcatula. J. Parasitol. 85, 221-228]. Restriction fragment length polymorphism (RFLP) analysis of these PCR products showed banding patterns characteristic of S. neurona. Sequencing, alignment and comparison of both schizont and sarcocyst DNA amplicons showed 100% identity. Although Koch's postulates have not been demonstrated in this case study, the finding of mature, intact S. neurona schizonts and sarcocysts in the tissues of this single horse strongly suggests that horses have the potential to act as intermediate hosts. Further studies are needed to demonstrate Koch's postulates with repeated transfer of S. neurona between opossums and horses.

Sarcocystis jamaicensis n. sp., from Red-Tailed Hawks (Buteo jamaicensis) Definitive Host and IFN-γ Gene Knockout Mice as Experimental Intermediate Host.

PubMed

Verma, S K; von Dohlen, A Rosypal; Mowery, J D; Scott, D; Rosenthal, B M; Dubey, J P; Lindsay, D S

2017-10-01

Here, we report a new species of Sarcocystis with red-tailed hawk (RTH, Buteo jamaicensis) as the natural definitive host and IFN-γ gene knockout (KO) mice as an experimental intermediate host in which sarcocysts form in muscle. Two RTHs submitted to the Carolina Raptor Center, Huntersville, North Carolina, were euthanized because they could not be rehabilitated and released. Fully sporulated 12.5 × 9.9-μm sized sporocysts were found in intestinal scrapings of both hawks. Sporocysts were orally fed to laboratory-reared outbred Swiss Webster mice (SW, Mus musculus) and also to KO mice. The sporocysts were infective for KO mice but not for SW mice. All SW mice remained asymptomatic, and neither schizonts nor sarcocysts were found in any SW mice euthanized on days 54, 77, 103 (n = 2) or 137 post-inoculation (PI). The KO mice developed neurological signs and were necropsied between 52 to 68 days PI. Schizonts/merozoites were found in all KO mice euthanized on days 52, 55 (n = 3), 59, 61 (n = 2), 66, and 68 PI and they were confined to the brain. The predominant lesion was meningoencephalitis characterized by perivascular cuffs, granulomas, and necrosis of the neural tissue. The schizonts/merozoites were located in neural tissue and were apparently extravascular. Brain homogenates from infected KO mice were infective to KO mice by subcutaneous inoculation and when seeded on to CV-1 cells. Microscopic sarcocysts were found in skeletal muscles of 5 of 8 KO mice euthanized between 55-61 days PI. Only a few sarcocysts were detected. Sarcocysts were microscopic, up to 3.5 mm long. When viewed with light microscopy, the sarcocyst wall appeared thin (<1 μm thick) and smooth. By transmission electron microscopy, the sarcocyst wall classified as "type 1j" (new designation). Molecular characterization using 18S rRNA, 28S rRNA, ITS-1, and cox1 genes revealed a close relationship with Sarcocystis microti and Sarcocystis glareoli; both species infect birds as definitive hosts. The parasite in the present study was biologically and molecularly different from species so far described in RTHs and we therefore propose a new species name, Sarcocystis jamaicensis n. sp.

Acute fatal sarcocystosis hepatitis in an Indo-Pacific bottlenose dolphin (Tursiops aduncus) in Hong Kong.

PubMed

Calero-Bernal, R; Mauroo, N F; Hui, S W; Kuiken, T; van de Bildt, M W G; de Jong, A W; Osterhaus, A D M E; Sims, L; Gendron-Fitzpatrick, A; Carmena, D; Cerqueira-Cézar, C K; Rosenthal, B M; Dubey, J P

2017-02-15

Unlike most species in the genus Sarcocystis, Sarcocystis canis has a broad intermediate host range. Its life cycle is incompletely known and most reports are from the USA. Here we report fatal hepatitis in a 4year old male Indo-Pacific bottlenose dolphin (Tursiops aduncus) from Hong Kong associated with a S. canis-like infection. Diagnosis was made based on clinical presentation, histopathology, transmission electron microscopy (TEM), and molecular characterization. Microscopically, S. canis-like like infection was confined to the liver. Immature and mature schizonts were found in hepatocytes and the parasite was associated with generalized hepatic necrosis. By TEM, schizonts divided by endopolygeny, and merozoites lacked rhoptries. Molecular characterization of parasites present in liver and brain tissues at the cox1 gene showed a high degree of identity (97-98%) and clustered together with Sarcocystis canis, S. lutrae, S. arctica, S. speeri, S. turdusi, and S. rileyi in a phylogenetic study. This is the first report of S. canis-like infection from Asia. Published by Elsevier B.V.

Plasmodium berghei MAPK1 Displays Differential and Dynamic Subcellular Localizations during Liver Stage Development

PubMed Central

Wierk, Jannika Katharina; Langbehn, Annette; Kamper, Maria; Richter, Stefanie; Burda, Paul-Christian; Heussler, Volker Theo; Deschermeier, Christina

2013-01-01

Mitogen-activated protein kinases (MAPKs) regulate key signaling events in eukaryotic cells. In the genomes of protozoan Plasmodium parasites, the causative agents of malaria, two genes encoding kinases with significant homology to other eukaryotic MAPKs have been identified (mapk1, mapk2). In this work, we show that both genes are transcribed during Plasmodium berghei liver stage development, and analyze expression and subcellular localization of the PbMAPK1 protein in liver stage parasites. Live cell imaging of transgenic parasites expressing GFP-tagged PbMAPK1 revealed a nuclear localization of PbMAPK1 in the early schizont stage mediated by nuclear localization signals in the C-terminal domain. In contrast, a distinct localization of PbMAPK1 in comma/ring-shaped structures in proximity to the parasite’s nuclei and the invaginating parasite membrane was observed during the cytomere stage of parasite development as well as in immature blood stage schizonts. The PbMAPK1 localization was found to be independent of integrity of a motif putatively involved in ATP binding, integrity of the putative activation motif and the presence of a predicted coiled-coil domain in the C-terminal domain. Although PbMAPK1 knock out parasites showed normal liver stage development, the kinase may still fulfill a dual function in both schizogony and merogony of liver stage parasites regulated by its dynamic and stage-dependent subcellular localization. PMID:23544094

The Microtubule-Stabilizing Protein CLASP1 Associates with the Theileria annulata Schizont Surface via Its Kinetochore-Binding Domain

PubMed Central

Huber, Sandra; Theiler, Romina; de Quervain, Daniel; Wiens, Olga; Karangenc, Tulin; Heussler, Volker; Dobbelaere, Dirk

2017-01-01

ABSTRACT Theileria is an apicomplexan parasite whose presence within the cytoplasm of a leukocyte induces cellular transformation and causes uncontrolled proliferation and clonal expansion of the infected cell. The intracellular schizont utilizes the host cell’s own mitotic machinery to ensure its distribution to both daughter cells by associating closely with microtubules (MTs) and incorporating itself within the central spindle. We show that CLASP1, an MT-stabilizing protein that plays important roles in regulating kinetochore-MT attachment and central spindle positioning, is sequestered at the Theileria annulata schizont surface. We used live-cell imaging and immunofluorescence in combination with MT depolymerization assays to demonstrate that CLASP1 binds to the schizont surface in an MT-independent manner throughout the cell cycle and that the recruitment of the related CLASP2 protein to the schizont is MT dependent. By transfecting Theileria-infected cells with a panel of truncation mutants, we found that the kinetochore-binding domain of CLASP1 is necessary and sufficient for parasite localization, revealing that CLASP1 interaction with the parasite occurs independently of EB1. We overexpressed the MT-binding domain of CLASP1 in parasitized cells. This exhibited a dominant negative effect on host MT stability and led to altered parasite size and morphology, emphasizing the importance of proper MT dynamics for Theileria partitioning during host cell division. Using coimmunoprecipitation, we demonstrate that CLASP1 interacts, directly or indirectly, with the schizont membrane protein p104, and we describe for the first time TA03615, a Theileria protein which localizes to the parasite surface, where it has the potential to participate in parasite-host interactions. IMPORTANCE T. annulata, the only eukaryote known to be capable of transforming another eukaryote, is a widespread parasite of veterinary importance that puts 250 million cattle at risk worldwide and limits livestock development for some of the poorest people in the world. Crucial to the pathology of Theileria is its ability to interact with host microtubules and the mitotic spindle of the infected cell. This study builds on our previous work in investigating the host and parasite molecules involved in mediating this interaction. Because it is not possible to genetically manipulate Theileria schizonts, identifying protein interaction partners is critical to understanding the function of parasite proteins. By identifying two Theileria surface proteins that are involved in the interaction between CLASP1 and the parasite, we provide important insights into the molecular basis of Theileria persistence within a dividing cell. PMID:28861517

Plasmodium falciparum polypeptides released during in vitro cultivation*

PubMed Central

Da Silva, L. Rodriguez; Loche, M.; Dayal, R.; Perrin, L. H.

1983-01-01

Synchronous cultures of Plasmodium falciparum were successively labelled with (35S)-methionine and both the supernatants and the pellets of infected red blood cells were collected. The release of TCA-precipitable material in the culture supernatants was low during the development of ring forms and trophozoites, increased during schizogony, and was maximum at the time of schizont rupture and merozoite reinvasion. Analysis of the supernatants by SDS — PAGE and autoradiography showed that both polypeptides common to the various developmental stages of the parasite and schizont/merozoite-specific polypeptides were released. Polypeptides of relative molecular mass 140 000, 82 000 and, to a lower degree, 41 000 were present in high amounts in the culture supernatants. These polypeptides have been shown to be the target of monoclonal antibodies that are able to inhibit the growth of P. falciparum cultures, and may be involved in protective immunity. The released polypeptides may also be used as target antigens in immunodiagnostic tests aiming at the detection of malaria infection. ImagesFig. 2AFig. 2BFig. 3 PMID:6340846

Sarcocystis calchasi has an expanded host range and induces neurological disease in cockatiels (Nymphicus hollandicus) and North American rock pigeons (Columbia livia f. dom.).

PubMed

Olias, Philipp; Maier, Kristina; Wuenschmann, Arno; Reed, Leslie; Armién, Aníbal G; Shaw, Daniel P; Gruber, Achim D; Lierz, Michael

2014-02-24

Pigeon protozoal encephalitis (PPE) is an emerging central nervous system disease of pigeons (Columba livia f. domestica) caused by the apicomplexan parasite Sarcocystis calchasi. The intermediate host specificity of S. calchasi had been considered high, as domestic chickens were resistant to experimental infection. Here, we have re-evaluated this concept and expanded the known host range of S. calchasi by experimental infection of cockatiels (Nymphicus hollandicus), a species distantly related to pigeons. In this work, a group of eight cockatiels were experimentally infected with S. calchasi, which resulted in a biphasic central nervous system disease that paralleled PPE in many aspects, albeit with a more diverse pathology. All cockatiels became lethargic and polyuric between days 7 and 13 pi and during that time schizonts of S. calchasi were found primarily in the liver and spleen accompanied by necrosis and inflammation. As with pigeons, neurological signs occurred during a chronic phase of the disease in three cockatiels between 57 and 63 dpi. However, all five cockatiels necropsied in that period, or at the end of the trial at 76 dpi, had a severe lymphohistiocytic and necrotizing encephalitis. No tissue cysts were found in the heart, and cockatiels infected with 10(5) sporocysts only had a negligible parasite load in skeletal muscles despite the presence of severe central nervous system lesions. Notably, intralesional schizonts were identified in the brain of one cockatiel. In contrast to previous results, intralesional schizonts were also identified in the brains of three of six naturally infected pigeons from Minnesota and Missouri examined as part of an epidemiological investigation. In both the cockatiel and the pigeons, tissue cysts were found concurrently with schizonts suggesting an uncommon phenomenon in the Sarcocystis life cycle. Based on the results of this study, transmission of S. calchasi to avian species other than the domestic pigeon is possible. These findings suggest a, so far, unmonitored prevalence of S. calchasi in avian populations and highlight a possible ongoing dissemination of this parasite in the Northern Hemisphere. Copyright © 2013 Elsevier B.V. All rights reserved.

Parasite Sequestration in Plasmodium falciparum Malaria: Spleen and Antibody Modulation of Cytoadherence of Infected Erythrocytes

NASA Astrophysics Data System (ADS)

David, Peter H.; Hommel, Marcel; Miller, Louis H.; Udeinya, Iroka J.; Oligino, Lynette D.

1983-08-01

Sequestration, the adherence of infected erythrocytes containing late developmental stages of the parasite (trophozoites and schizonts) to the endothelium of capillaries and venules, is characteristic of Plasmodium falciparum infections. We have studied two host factors, the spleen and antibody, that influence sequestration of P. falciparum in the squirrel monkey. Sequestration of trophozoite/schizont-infected erythrocytes that occurs in intact animals is reduced in splenectomized animals; in vitro, when infected blood is incubated with monolayers of human melanoma cells, trophozoite/schizont-infected erythrocytes from intact animals but not from splenectomized animals bind to the melanoma cells. The switch in cytoadherence characteristics of the infected erythrocytes from nonbinding to binding occurs with a cloned parasite. Immune serum can inhibit and reverse in vitro binding to melanoma cells of infected erythrocytes from intact animals. Similarly, antibody can reverse in vivo sequestration as shown by the appearance of trophozoite/schizont-infected erythrocytes in the peripheral blood of an intact animal after inoculation with immune serum. These results indicate that the spleen modulates the expression of parasite alterations of the infected erythrocyte membrane responsible for sequestration and suggest that the prevention and reversal of sequestration could be one of the effector mechanisms involved in antibody-mediated protection against P. falciparum malaria.

Rapid Generation of Marker-Free P. falciparum Fluorescent Reporter Lines Using Modified CRISPR/Cas9 Constructs and Selection Protocol.

PubMed

Mogollon, Catherin Marin; van Pul, Fiona J A; Imai, Takashi; Ramesar, Jai; Chevalley-Maurel, Séverine; de Roo, Guido M; Veld, Sabrina A J; Kroeze, Hans; Franke-Fayard, Blandine M D; Janse, Chris J; Khan, Shahid M

2016-01-01

The CRISPR/Cas9 system is a powerful genome editing technique employed in a wide variety of organisms including recently the human malaria parasite, P. falciparum. Here we report on further improvements to the CRISPR/Cas9 transfection constructs and selection protocol to more rapidly modify the P. falciparum genome and to introduce transgenes into the parasite genome without the inclusion of drug-selectable marker genes. This method was used to stably integrate the gene encoding GFP into the P. falciparum genome under the control of promoters of three different Plasmodium genes (calmodulin, gapdh and hsp70). These genes were selected as they are highly transcribed in blood stages. We show that the three reporter parasite lines generated in this study (GFP@cam, GFP@gapdh and GFP@hsp70) have in vitro blood stage growth kinetics and drug-sensitivity profiles comparable to the parental P. falciparum (NF54) wild-type line. Both asexual and sexual blood stages of the three reporter lines expressed GFP-fluorescence with GFP@hsp70 having the highest fluorescent intensity in schizont stages as shown by flow cytometry analysis of GFP-fluorescence intensity. The improved CRISPR/Cas9 constructs/protocol will aid in the rapid generation of transgenic and modified P. falciparum parasites, including those expressing different reporters proteins under different (stage specific) promoters.

Rapid Generation of Marker-Free P. falciparum Fluorescent Reporter Lines Using Modified CRISPR/Cas9 Constructs and Selection Protocol

PubMed Central

Mogollon, Catherin Marin; van Pul, Fiona J. A.; Imai, Takashi; Ramesar, Jai; Chevalley-Maurel, Séverine; de Roo, Guido M.; Veld, Sabrina A. J.; Kroeze, Hans; Franke-Fayard, Blandine M. D.; Janse, Chris J.

2016-01-01

The CRISPR/Cas9 system is a powerful genome editing technique employed in a wide variety of organisms including recently the human malaria parasite, P. falciparum. Here we report on further improvements to the CRISPR/Cas9 transfection constructs and selection protocol to more rapidly modify the P. falciparum genome and to introduce transgenes into the parasite genome without the inclusion of drug-selectable marker genes. This method was used to stably integrate the gene encoding GFP into the P. falciparum genome under the control of promoters of three different Plasmodium genes (calmodulin, gapdh and hsp70). These genes were selected as they are highly transcribed in blood stages. We show that the three reporter parasite lines generated in this study (GFP@cam, GFP@gapdh and GFP@hsp70) have in vitro blood stage growth kinetics and drug-sensitivity profiles comparable to the parental P. falciparum (NF54) wild-type line. Both asexual and sexual blood stages of the three reporter lines expressed GFP-fluorescence with GFP@hsp70 having the highest fluorescent intensity in schizont stages as shown by flow cytometry analysis of GFP-fluorescence intensity. The improved CRISPR/Cas9 constructs/protocol will aid in the rapid generation of transgenic and modified P. falciparum parasites, including those expressing different reporters proteins under different (stage specific) promoters. PMID:27997583

Glutathione-deficient Plasmodium berghei parasites exhibit growth delay and nuclear DNA damage.

PubMed

Padín-Irizarry, Vivian; Colón-Lorenzo, Emilee E; Vega-Rodríguez, Joel; Castro, María Del R; González-Méndez, Ricardo; Ayala-Peña, Sylvette; Serrano, Adelfa E

2016-06-01

Plasmodium parasites are exposed to endogenous and exogenous oxidative stress during their complex life cycle. To minimize oxidative damage, the parasites use glutathione (GSH) and thioredoxin (Trx) as primary antioxidants. We previously showed that disruption of the Plasmodium berghei gamma-glutamylcysteine synthetase (pbggcs-ko) or the glutathione reductase (pbgr-ko) genes resulted in a significant reduction of GSH in intraerythrocytic stages, and a defect in growth in the pbggcs-ko parasites. In this report, time course experiments of parasite intraerythrocytic development and morphological studies showed a growth delay during the ring to schizont progression. Morphological analysis shows a significant reduction in size (diameter) of trophozoites and schizonts with increased number of cytoplasmic vacuoles in the pbggcs-ko parasites in comparison to the wild type (WT). Furthermore, the pbggcs-ko mutants exhibited an impaired response to oxidative stress and increased levels of nuclear DNA (nDNA) damage. Reduced GSH levels did not result in mitochondrial DNA (mtDNA) damage or protein carbonylations in neither pbggcs-ko nor pbgr-ko parasites. In addition, the pbggcs-ko mutant parasites showed an increase in mRNA expression of genes involved in oxidative stress detoxification and DNA synthesis, suggesting a potential compensatory mechanism to allow for parasite proliferation. These results reveal that low GSH levels affect parasite development through the impairment of oxidative stress reduction systems and damage to the nDNA. Our studies provide new insights into the role of the GSH antioxidant system in the intraerythrocytic development of Plasmodium parasites, with potential translation into novel pharmacological interventions. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Discovery of three novel coccidian parasites infecting California sea lions (Zalophus californianus), with evidence of sexual replication and interspecies pathogenicity.

PubMed

Colegrove, Kathleen M; Grigg, Michael E; Carlson-Bremer, Daphne; Miller, Robin H; Gulland, Frances M D; Ferguson, David J P; Rejmanek, Daniel; Barr, Bradd C; Nordhausen, Robert; Melli, Ann C; Conrad, Patricia A

2011-10-01

Enteric protozoal infection was identified in 5 stranded California sea lions (Zalophus californianus). Microscopically, the apical cytoplasm of distal jejunal enterocytes contained multiple stages of coccidian parasites, including schizonts with merozoites and spherical gametocytes, which were morphologically similar to coccidians. By histopathology, organisms appeared to be confined to the intestine and accompanied by only mild enteritis. Using electron microscopy, both sexual (microgametocytes, macrogamonts) and asexual (schizonts, merozoites) coccidian stages were identified in enterocytes within parasitophorous vacuoles, consistent with apicomplexan development in a definitive host. Serology was negative for tissue cyst-forming coccidians, and immunohistochemistry for Toxoplasma gondii was inconclusive and negative for Neospora caninum and Sarcocystis neurona. Analysis of ITS-1 gene sequences amplified from frozen or formalin-fixed paraffin-embedded intestinal sections identified DNA sequences with closest homology to Neospora sp. (80%); these novel sequences were referred to as belonging to coccidian parasites "A," "B," and "C." Subsequent molecular analyses completed on a neonatal harbor seal (Phoca vitulina) with protozoal lymphadenitis, hepatitis, myocarditis, and encephalitis showed that it was infected with a coccidian parasite bearing the "C" sequence type. Our results indicate that sea lions likely serve as definitive hosts for 3 newly described coccidian parasites, at least 1 of which is pathogenic in a marine mammal intermediate host species.

Recruitment of EB1, a Master Regulator of Microtubule Dynamics, to the Surface of the Theileria annulata Schizont

PubMed Central

Woods, Kerry L.; Theiler, Romina; Mühlemann, Marcus; Segiser, Adrian; Huber, Sandra; Ansari, Hifzur R.; Pain, Arnab; Dobbelaere, Dirk A. E.

2013-01-01

The apicomplexan parasite Theileria annulata transforms infected host cells, inducing uncontrolled proliferation and clonal expansion of the parasitized cell population. Shortly after sporozoite entry into the target cell, the surrounding host cell membrane is dissolved and an array of host cell microtubules (MTs) surrounds the parasite, which develops into the transforming schizont. The latter does not egress to invade and transform other cells. Instead, it remains tethered to host cell MTs and, during mitosis and cytokinesis, engages the cell's astral and central spindle MTs to secure its distribution between the two daughter cells. The molecular mechanism by which the schizont recruits and stabilizes host cell MTs is not known. MT minus ends are mostly anchored in the MT organizing center, while the plus ends explore the cellular space, switching constantly between phases of growth and shrinkage (called dynamic instability). Assuming the plus ends of growing MTs provide the first point of contact with the parasite, we focused on the complex protein machinery associated with these structures. We now report how the schizont recruits end-binding protein 1 (EB1), a central component of the MT plus end protein interaction network and key regulator of host cell MT dynamics. Using a range of in vitro experiments, we demonstrate that T. annulata p104, a polymorphic antigen expressed on the schizont surface, functions as a genuine EB1-binding protein and can recruit EB1 in the absence of any other parasite proteins. Binding strictly depends on a consensus SxIP motif located in a highly disordered C-terminal region of p104. We further show that parasite interaction with host cell EB1 is cell cycle regulated. This is the first description of a pathogen-encoded protein to interact with EB1 via a bona-fide SxIP motif. Our findings provide important new insight into the mode of interaction between Theileria and the host cell cytoskeleton. PMID:23675298

Atypical fatal sarcocystosis associated with Sarcocystis neurona in a White-nosed coati (Nasua narica molaris).

PubMed

Dubey, Jitender P; Trupkiewicz, John G; Verma, Shiv K; Mowery, Joseph D; Adedoyin, Gloria; Georoff, Tim; Grigg, Michael E

2017-11-30

The protozoan parasite Sarcocystis neurona is an important cause of disease in horses (equine protozoal myeloencephalitis, EPM) and marine mammals. Isolated reports of clinical EPM-like disease have been documented in a zebra, raccoon, domestic cat, domestic dog, ferret, skunk, mink, lynx, red panda and fisher. The predominant disease is encephalomyelitis associated with schizonts in neural tissues. Here, we report highly disseminated sarcocystosis, in many tissues of a captive White-nosed coati (Nasua narica molaris). The 14year old, neutered male coati was euthanized due to progressive weakness, lethargy, and inappetence. Schizonts, including free and intracellular merozoites were detected in many cell types, and differed morphologically from S. neurona schizonts in horses. Only a few sarcocysts were seen in skeletal muscle and the myocardium. Immunohistochemically, the protozoa reacted positively to S. neurona but not to Toxoplasma gondii antibodies. Severe inflammtory disease detected in the stomach, intestine, adrenal and thyroid glands, ciliary body of eye, and urinary bladder associated with schizonts in the coati has not been reported earlier in any host with EPM. Although, a few schizonts were found in the brain, encephalitis was minimal and not the cause of clinical signs. Multilocus PCR-DNA sequencing using DNA derived from the coati lung tissue identified an S. neurona infection using the 18S, 28S and ITS-1 markers, and a novel genotype using primer pairs against antigenic surface proteins (SnSAG3, SnSAG4, SnSAG1-5-6) and microsatellite markers (MS, SN7, SN9). Although the genotype was similar to the widely distributed Type VI strain, it possessed a novel allele at SnSAG5, and a different MS combination of repeats at SN7 and SN9. Whether this severe parasitism was related to the host or the parasite needs further investigation. Published by Elsevier B.V.

Lymphocytes and Macrophages Are Infected by Theileria equi, but T Cells and B Cells Are Not Required to Establish Infection In Vivo

PubMed Central

Ramsay, Joshua D.; Ueti, Massaro W.; Johnson, Wendell C.; Scoles, Glen A.; Knowles, Donald P.; Mealey, Robert H.

2013-01-01

Theileria equi has a biphasic life cycle in horses, with a period of intraleukocyte development followed by patent erythrocytic parasitemia that causes acute and sometimes fatal hemolytic disease. Unlike Theileria spp. that infect cattle (Theileria parva and Theileria annulata), the intraleukocyte stage (schizont) of Theileria equi does not cause uncontrolled host cell proliferation or other significant pathology. Nevertheless, schizont-infected leukocytes are of interest because of their potential to alter host cell function and because immune responses directed against this stage could halt infection and prevent disease. Based on cellular morphology, Theileria equi has been reported to infect lymphocytes in vivo and in vitro, but the specific phenotype of schizont-infected cells has yet to be defined. To resolve this knowledge gap in Theileria equi pathogenesis, peripheral blood mononuclear cells were infected in vitro and the phenotype of infected cells determined using flow cytometry and immunofluorescence microscopy. These experiments demonstrated that the host cell range of Theileria equi was broader than initially reported and included B lymphocytes, T lymphocytes and monocyte/macrophages. To determine if B and T lymphocytes were required to establish infection in vivo, horses affected with severe combined immunodeficiency (SCID), which lack functional B and T lymphocytes, were inoculated with Theileria equi sporozoites. SCID horses developed patent erythrocytic parasitemia, indicating that B and T lymphocytes are not necessary to complete the Theileria equi life cycle in vivo. These findings suggest that the factors mediating Theileria equi leukocyte invasion and intracytoplasmic differentiation are common to several leukocyte subsets and are less restricted than for Theileria annulata and Theileria parva. These data will greatly facilitate future investigation into the relationships between Theileria equi leukocyte tropism and pathogenesis, breed susceptibility, and strain virulence. PMID:24116194

Lymphocytes and macrophages are infected by Theileria equi, but T cells and B cells are not required to establish infection in vivo.

PubMed

Ramsay, Joshua D; Ueti, Massaro W; Johnson, Wendell C; Scoles, Glen A; Knowles, Donald P; Mealey, Robert H

2013-01-01

Theileria equi has a biphasic life cycle in horses, with a period of intraleukocyte development followed by patent erythrocytic parasitemia that causes acute and sometimes fatal hemolytic disease. Unlike Theileria spp. that infect cattle (Theileria parva and Theileria annulata), the intraleukocyte stage (schizont) of Theileria equi does not cause uncontrolled host cell proliferation or other significant pathology. Nevertheless, schizont-infected leukocytes are of interest because of their potential to alter host cell function and because immune responses directed against this stage could halt infection and prevent disease. Based on cellular morphology, Theileria equi has been reported to infect lymphocytes in vivo and in vitro, but the specific phenotype of schizont-infected cells has yet to be defined. To resolve this knowledge gap in Theileria equi pathogenesis, peripheral blood mononuclear cells were infected in vitro and the phenotype of infected cells determined using flow cytometry and immunofluorescence microscopy. These experiments demonstrated that the host cell range of Theileria equi was broader than initially reported and included B lymphocytes, T lymphocytes and monocyte/macrophages. To determine if B and T lymphocytes were required to establish infection in vivo, horses affected with severe combined immunodeficiency (SCID), which lack functional B and T lymphocytes, were inoculated with Theileria equi sporozoites. SCID horses developed patent erythrocytic parasitemia, indicating that B and T lymphocytes are not necessary to complete the Theileria equi life cycle in vivo. These findings suggest that the factors mediating Theileria equi leukocyte invasion and intracytoplasmic differentiation are common to several leukocyte subsets and are less restricted than for Theileria annulata and Theileria parva. These data will greatly facilitate future investigation into the relationships between Theileria equi leukocyte tropism and pathogenesis, breed susceptibility, and strain virulence.

Re-evaluation of the life cycle of Eimeria maxima Tyzzer, 1929 in chickens (Gallus domesticus).

PubMed

Dubey, J P; Jenkins, M C

2017-12-14

A time-course study was conducted to resolve discrepancies in the literature and better define aspects of the Eimeria maxima life cycle such, as sites of development and both morphology and number of asexual stages. Broiler chickens were inoculated orally with five million E. maxima oocysts (APU1), and were necropsied at regular intervals from 12 to 120 h p.i. Small intestine tissue sections and smears were examined for developmental stages. The jejunum contained the highest numbers of developmental stages. At 12 h p.i., sporozoites were observed inside a parasitophorous vacuole (PV) in the epithelial villi and the lamina propria. By 24 h, sporozoites enclosed by a PV were observed in enterocytes of the glands of Lieberkühn. At 48 h p.i., sporozoites, elongated immature and mature schizonts, were all seen in the glands with merozoites budding off from a residual body. By 60 h, second-generation, sausage-shaped schizonts containing up to 12 merozoites were observed around a residual body in the villar tip of invaded enterocytes. At 72 and 96 h, profuse schizogony associated with third- and fourth-generation schizonts was observed throughout the villus. At 120 h, another generation (fifth) of schizonts were seen in villar tips as well as in subepithelium where gamonts and oocysts were also present; a few gamonts were in epithelium. Our finding of maximum parasitization of E. maxima in jejunum is important because this region is critical for nutrient absorption and weight gain.

A large scale Plasmodium vivax- Saimiri boliviensis trophozoite-schizont transition proteome

PubMed Central

Lapp, Stacey A.; Barnwell, John W.; Galinski, Mary R.

2017-01-01

Plasmodium vivax is a complex protozoan parasite with over 6,500 genes and stage-specific differential expression. Much of the unique biology of this pathogen remains unknown, including how it modifies and restructures the host reticulocyte. Using a recently published P. vivax reference genome, we report the proteome from two biological replicates of infected Saimiri boliviensis host reticulocytes undergoing transition from the late trophozoite to early schizont stages. Using five database search engines, we identified a total of 2000 P. vivax and 3487 S. boliviensis proteins, making this the most comprehensive P. vivax proteome to date. PlasmoDB GO-term enrichment analysis of proteins identified at least twice by a search engine highlighted core metabolic processes and molecular functions such as glycolysis, translation and protein folding, cell components such as ribosomes, proteasomes and the Golgi apparatus, and a number of vesicle and trafficking related clusters. Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8 enriched functional annotation clusters of S. boliviensis proteins highlighted vesicle and trafficking-related clusters, elements of the cytoskeleton, oxidative processes and response to oxidative stress, macromolecular complexes such as the proteasome and ribosome, metabolism, translation, and cell death. Host and parasite proteins potentially involved in cell adhesion were also identified. Over 25% of the P. vivax proteins have no functional annotation; this group includes 45 VIR members of the large PIR family. A number of host and pathogen proteins contained highly oxidized or nitrated residues, extending prior trophozoite-enriched stage observations from S. boliviensis infections, and supporting the possibility of oxidative stress in relation to the disease. This proteome significantly expands the size and complexity of the known P. vivax and Saimiri host iRBC proteomes, and provides in-depth data that will be valuable for ongoing research on this parasite’s biology and pathogenesis. PMID:28829774

Proteomic analysis of the Theileria annulata schizont

PubMed Central

Witschi, M.; Xia, D.; Sanderson, S.; Baumgartner, M.; Wastling, J.M.; Dobbelaere, D.A.E.

2013-01-01

The apicomplexan parasite, Theileria annulata, is the causative agent of tropical theileriosis, a devastating lymphoproliferative disease of cattle. The schizont stage transforms bovine leukocytes and provides an intriguing model to study host/pathogen interactions. The genome of T. annulata has been sequenced and transcriptomic data are rapidly accumulating. In contrast, little is known about the proteome of the schizont, the pathogenic, transforming life cycle stage of the parasite. Using one-dimensional (1-D) gel LC-MS/MS, a proteomic analysis of purified T. annulata schizonts was carried out. In whole parasite lysates, 645 proteins were identified. Proteins with transmembrane domains (TMDs) were under-represented and no proteins with more than four TMDs could be detected. To tackle this problem, Triton X-114 treatment was applied, which facilitates the extraction of membrane proteins, followed by 1-D gel LC-MS/MS. This resulted in the identification of an additional 153 proteins. Half of those had one or more TMD and 30 proteins with more than four TMDs were identified. This demonstrates that Triton X-114 treatment can provide a valuable additional tool for the identification of new membrane proteins in proteomic studies. With two exceptions, all proteins involved in glycolysis and the citric acid cycle were identified. For at least 29% of identified proteins, the corresponding transcripts were not present in the existing expressed sequence tag databases. The proteomics data were integrated into the publicly accessible database resource at EuPathDB (www.eupathdb.org) so that mass spectrometry-based protein expression evidence for T. annulata can be queried alongside transcriptional and other genomics data available for these parasites. PMID:23178997

Histone deacetylases play a major role in the transcriptional regulation of the Plasmodium falciparum life cycle.

PubMed

Chaal, Balbir K; Gupta, Archna P; Wastuwidyaningtyas, Brigitta D; Luah, Yen-Hoon; Bozdech, Zbynek

2010-01-22

The apparent paucity of molecular factors of transcriptional control in the genomes of Plasmodium parasites raises many questions about the mechanisms of life cycle regulation in these malaria parasites. Epigenetic regulation has been suggested to play a major role in the stage specific gene expression during the Plasmodium life cycle. To address some of these questions, we analyzed global transcriptional responses of Plasmodium falciparum to a potent inhibitor of histone deacetylase activities (HDAC). The inhibitor apicidin induced profound transcriptional changes in multiple stages of the P. falciparum intraerythrocytic developmental cycle (IDC) that were characterized by rapid activation and repression of a large percentage of the genome. A major component of this response was induction of genes that are otherwise suppressed during that particular stage of the IDC or specific for the exo-erythrocytic stages. In the schizont stage, apicidin induced hyperacetylation of histone lysine residues H3K9, H4K8 and the tetra-acetyl H4 (H4Ac4) and demethylation of H3K4me3. Interestingly, we observed overlapping patterns of chromosomal distributions between H4K8Ac and H3K4me3 and between H3K9Ac and H4Ac4. There was a significant but partial association between the apicidin-induced gene expression and histone modifications, which included a number of stage specific transcription factors. Taken together, inhibition of HDAC activities leads to dramatic de-regulation of the IDC transcriptional cascade, which is a result of both disruption of histone modifications and up-regulation of stage specific transcription factors. These findings suggest an important role of histone modification and chromatin remodeling in transcriptional regulation of the Plasmodium life cycle. This also emphasizes the potential of P. falciparum HDACs as drug targets for malaria chemotherapy.

Initial Characterization of the Pf-Int Recombinase from the Malaria Parasite Plasmodium falciparum

PubMed Central

Ghorbal, Mehdi; Scheidig-Benatar, Christine; Bouizem, Salma; Thomas, Christophe; Paisley, Genevieve; Faltermeier, Claire; Liu, Melanie; Scherf, Artur; Lopez-Rubio, Jose-Juan; Gopaul, Deshmukh N.

2012-01-01

Background Genetic variation is an essential means of evolution and adaptation in many organisms in response to environmental change. Certain DNA alterations can be carried out by site-specific recombinases (SSRs) that fall into two families: the serine and the tyrosine recombinases. SSRs are seldom found in eukaryotes. A gene homologous to a tyrosine site-specific recombinase has been identified in the genome of Plasmodium falciparum. The sequence is highly conserved among five other members of Plasmodia. Methodology/Principal Findings The predicted open reading frame encodes for a ∼57 kDa protein containing a C-terminal domain including the putative tyrosine recombinase conserved active site residues R-H-R-(H/W)-Y. The N-terminus has the typical alpha-helical bundle and potentially a mixed alpha-beta domain resembling that of λ-Int. Pf-Int mRNA is expressed differentially during the P. falciparum erythrocytic life stages, peaking in the schizont stage. Recombinant Pf-Int and affinity chromatography of DNA from genomic or synthetic origin were used to identify potential DNA targets after sequencing or micro-array hybridization. Interestingly, the sequences captured also included highly variable subtelomeric genes such as var, rif, and stevor sequences. Electrophoretic mobility shift assays with DNA were carried out to verify Pf-Int/DNA binding. Finally, Pf-Int knock-out parasites were created in order to investigate the biological role of Pf-Int. Conclusions/Significance Our data identify for the first time a malaria parasite gene with structural and functional features of recombinases. Pf-Int may bind to and alter DNA, either in a sequence specific or in a non-specific fashion, and may contribute to programmed or random DNA rearrangements. Pf-Int is the first molecular player identified with a potential role in genome plasticity in this pathogen. Finally, Pf-Int knock-out parasite is viable showing no detectable impact on blood stage development, which is compatible with such function. PMID:23056326

The role of cGMP signalling in regulating life cycle progression of Plasmodium.

PubMed

Hopp, Christine S; Bowyer, Paul W; Baker, David A

2012-08-01

The 3'-5'-cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG) is the main mediator of cGMP signalling in the malaria parasite. This article reviews the role of PKG in Plasmodium falciparum during gametogenesis and blood stage schizont rupture, as well as the role of the Plasmodium berghei orthologue in ookinete differentiation and motility, and liver stage schizont development. The current views on potential effector proteins downstream of PKG and the mechanisms that may regulate cyclic nucleotide levels are presented. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Evidence for an amoeba-like infectious stage of ichthyophonus sp. and description of a circulating blood stage: a probable mechanism for dispersal within the fish host

USGS Publications Warehouse

Kocan, Richard; LaPatra, Scott; Hershberger, Paul

2013-01-01

Small amoeboid cells, believed to be the infectious stage of Ichthyophonus sp., were observed in the bolus (stomach contents) and tunica propria (stomach wall) of Pacific staghorn sculpins and rainbow trout shortly after they ingested Ichthyophonus sp.–infected tissues. By 24–48 hr post-exposure (PE) the parasite morphed from the classically reported multinucleate thick walled schizonts to 2 distinct cell types, i.e., a larger multinucleate amoeboid cell surrounded by a narrow translucent zone and a smaller spherical cell surrounded by a “halo” and resembling a small schizont. Both cell types also appeared in the tunica propria, indicating that they had recently penetrated the columnar epithelium of the stomach. No Ichthyophonus sp. pseudo-hyphae (“germination tubes”) were observed in the bolus or penetrating the stomach wall. Simultaneously, Ichthyophonus sp. was isolated in vitro from aortic blood, which was consistently positive from 6 to 144 hr PE, then only intermittently for the next 4 wk. Small PAS-positive cells observed in blood cultures grew into colonies consisting of non-septate tubules (pseudo-hyphae) terminating in multinucleated knob-like apices similar to those seen in organ explant cultures. Organ explants were culture positive every day; however, typical Ichthyophonus sp. schizonts were not observed histologically until 20–25 days PE. From 20 to 60 days PE, schizont diameter increased from ≤25 μm to ≥82 μm. Based on the data presented herein, we are confident that we have resolved the life cycle of Ichthyophonus sp. within the piscivorous host.

DISCOVERY OF THREE NOVEL COCCIDIAN PARASITES INFECTING CALIFORNIA SEA LIONS (ZALOPHUS CALIFORNIANUS), WITH EVIDENCE OF SEXUAL REPLICATION AND INTERSPECIES PATHOGENICITY

PubMed Central

Colegrove, Kathleen M.; Grigg, Michael E.; Carlson-Bremer, Daphne; Miller, Robin H.; Gulland, Frances M. D.; Ferguson, David J. P.; Rejmanek, Daniel; Barr, Bradd C.; Nordhausen, Robert; Melli, Ann C.; Conrad, Patricia A.

2016-01-01

Enteric protozoal infection was identified in 5 stranded California sea lions (Zalophus californianus). Microscopically, the apical cytoplasm of distal jejunal enterocytes contained multiple stages of coccidian parasites, including schizonts with merozoites and spherical gametocytes, which were morphologically similar to coccidians. By histopathology, organisms appeared to be confined to the intestine and accompanied by only mild enteritis. Using electron microscopy, both sexual (microgametocytes, macrogamonts) and asexual (schizonts, merozoites) coccidian stages were identified in enterocytes within parasitophorous vacuoles, consistent with apicomplexan development in a definitive host. Serology was negative for tissue cyst-forming coccidians, and immunohistochemistry for Toxoplasma gondii was inconclusive and negative for Neospora caninum and Sarcocystis neurona. Analysis of ITS-1 gene sequences amplified from frozen or formalin-fixed paraffin-embedded intestinal sections identified DNA sequences with closest homology to Neospora sp. (80%); these novel sequences were referred to as belonging to coccidian parasites ‘‘A,’’ ‘‘B,’’ and ‘‘C.’’ Subsequent molecular analyses completed on a neonatal harbor seal (Phoca vitulina) with protozoal lymphadenitis, hepatitis, myocarditis, and encephalitis showed that it was infected with a coccidian parasite bearing the ‘‘C’’ sequence type. Our results indicate that sea lions likely serve as definitive hosts for 3 newly described coccidian parasites, at least 1 of which is pathogenic in a marine mammal intermediate host species. PMID:21495828

A novel strategy for the identification of antigens that are recognised by bovine MHC class I restricted cytotoxic T cells in a protozoan infection using reverse vaccinology.

PubMed

Graham, Simon P; Honda, Yoshikazu; Pellé, Roger; Mwangi, Duncan M; Glew, E Jane; de Villiers, Etienne P; Shah, Trushar; Bishop, Richard; van der Bruggen, Pierre; Nene, Vishvanath; Taracha, Evans L N

2007-02-09

Immunity against the bovine protozoan parasite Theileria parva has previously been shown to be mediated through lysis of parasite-infected cells by MHC class I restricted CD8+ cytotoxic T lymphocytes. It is hypothesized that identification of CTL target schizont antigens will aid the development of a sub-unit vaccine. We exploited the availability of the complete genome sequence data and bioinformatics tools to identify genes encoding secreted or membrane anchored proteins that may be processed and presented by the MHC class I molecules of infected cells to CTL. Of the 986 predicted open reading frames (ORFs) encoded by chromosome 1 of the T. parva genome, 55 were selected based on the presence of a signal peptide and/or a transmembrane helix domain. Thirty six selected ORFs were successfully cloned into a eukaryotic expression vector, transiently transfected into immortalized bovine skin fibroblasts and screened in vitro using T. parva-specific CTL. Recognition of gene products by CTL was assessed using an IFN-gamma ELISpot assay. A 525 base pair ORF encoding a 174 amino acid protein, designated Tp2, was identified by T. parva-specific CTL from 4 animals. These CTL recognized and lysed Tp2 transfected skin fibroblasts and recognized 4 distinct epitopes. Significantly, Tp2 specific CD8+ T cell responses were observed during the protective immune response against sporozoite challenge. The identification of an antigen containing multiple CTL epitopes and its apparent immunodominance during a protective anti-parasite response makes Tp2 an attractive candidate for evaluation of its vaccine potential.

The Plasmodium PHIST and RESA-Like Protein Families of Human and Rodent Malaria Parasites

PubMed Central

Moreira, Cristina K.; Naissant, Bernina; Coppi, Alida; Bennett, Brandy L.; Aime, Elena; Franke-Fayard, Blandine; Janse, Chris J.; Coppens, Isabelle; Sinnis, Photini; Templeton, Thomas J.

2016-01-01

The phist gene family has members identified across the Plasmodium genus, defined by the presence of a domain of roughly 150 amino acids having conserved aromatic residues and an all alpha-helical structure. The family is highly amplified in P. falciparum, with 65 predicted genes in the genome of the 3D7 isolate. In contrast, in the rodent malaria parasite P. berghei 3 genes are identified, one of which is an apparent pseudogene. Transcripts of the P. berghei phist genes are predominant in schizonts, whereas in P. falciparum transcript profiles span different asexual blood stages and gametocytes. We pursued targeted disruption of P. berghei phist genes in order to characterize a simplistic model for the expanded phist gene repertoire in P. falciparum. Unsuccessful attempts to disrupt P. berghei PBANKA_114540 suggest that this phist gene is essential, while knockout of phist PBANKA_122900 shows an apparent normal progression and non-essential function throughout the life cycle. Epitope-tagging of P. falciparum and P. berghei phist genes confirmed protein export to the erythrocyte cytoplasm and localization with a punctate pattern. Three P. berghei PEXEL/HT-positive exported proteins exhibit at least partial co-localization, in support of a common vesicular compartment in the cytoplasm of erythrocytes infected with rodent malaria parasites. PMID:27022937

Rhinitis and disseminated disease in a ferret (Mustela putorius furo) naturally infected with Sarcocystis neurona.

PubMed

Britton, Ann P; Dubey, J P; Rosenthal, Benjamin M

2010-04-19

Naturally occurring Sarcocystis neurona infection in a ferret (Mustela putorius furo) with rhinitis and disseminated disease are described for the first time. The ferret exhibited severe rhinitis with intra-lesional S. neurona merozoites and schizonts. Diagnosis was confirmed immunohistochemically by staining with S. neurona-specific antibodies, and by phylogenetic analyses of conserved and variable portions of nuclear ribosomal DNA. On the basis of intense schizogony in the nasal mucosa, we propose the possibility of an olfactory nerve pathway route of infection for S. neurona meningoencephalitis.

Characterization and storage of malaria antigens: Localization and chemical characterization of Plasmodium knowlesi schizont antigens

PubMed Central

Deans, J. A.; Cohen, S.

1979-01-01

The identification of malarial antigens that induce protective immunity could provide a rational basis for developing an effective antimalarial vaccine as well as specific serodiagnostic tests indicative of clinical immune status. Since protective immunity is probably induced by stage-dependent rather than stage-independent antigens, the antigenic composition of different stages of Plasmodium knowlesi has been compared, and a limited chemical characterization undertaken. This information should provide some insight into the types of preparative procedure appropriate for the purification of functionally important malarial antigens. PMID:120777

Integrative omics analysis. A study based on Plasmodium falciparum mRNA and protein data.

PubMed

Tomescu, Oana A; Mattanovich, Diethard; Thallinger, Gerhard G

2014-01-01

Technological improvements have shifted the focus from data generation to data analysis. The availability of large amounts of data from transcriptomics, protemics and metabolomics experiments raise new questions concerning suitable integrative analysis methods. We compare three integrative analysis techniques (co-inertia analysis, generalized singular value decomposition and integrative biclustering) by applying them to gene and protein abundance data from the six life cycle stages of Plasmodium falciparum. Co-inertia analysis is an analysis method used to visualize and explore gene and protein data. The generalized singular value decomposition has shown its potential in the analysis of two transcriptome data sets. Integrative Biclustering applies biclustering to gene and protein data. Using CIA, we visualize the six life cycle stages of Plasmodium falciparum, as well as GO terms in a 2D plane and interpret the spatial configuration. With GSVD, we decompose the transcriptomic and proteomic data sets into matrices with biologically meaningful interpretations and explore the processes captured by the data sets. IBC identifies groups of genes, proteins, GO Terms and life cycle stages of Plasmodium falciparum. We show method-specific results as well as a network view of the life cycle stages based on the results common to all three methods. Additionally, by combining the results of the three methods, we create a three-fold validated network of life cycle stage specific GO terms: Sporozoites are associated with transcription and transport; merozoites with entry into host cell as well as biosynthetic and metabolic processes; rings with oxidation-reduction processes; trophozoites with glycolysis and energy production; schizonts with antigenic variation and immune response; gametocyctes with DNA packaging and mitochondrial transport. Furthermore, the network connectivity underlines the separation of the intraerythrocytic cycle from the gametocyte and sporozoite stages. Using integrative analysis techniques, we can integrate knowledge from different levels and obtain a wider view of the system under study. The overlap between method-specific and common results is considerable, even if the basic mathematical assumptions are very different. The three-fold validated network of life cycle stage characteristics of Plasmodium falciparum could identify a large amount of the known associations from literature in only one study.

Integrative omics analysis. A study based on Plasmodium falciparum mRNA and protein data

PubMed Central

2014-01-01

Background Technological improvements have shifted the focus from data generation to data analysis. The availability of large amounts of data from transcriptomics, protemics and metabolomics experiments raise new questions concerning suitable integrative analysis methods. We compare three integrative analysis techniques (co-inertia analysis, generalized singular value decomposition and integrative biclustering) by applying them to gene and protein abundance data from the six life cycle stages of Plasmodium falciparum. Co-inertia analysis is an analysis method used to visualize and explore gene and protein data. The generalized singular value decomposition has shown its potential in the analysis of two transcriptome data sets. Integrative Biclustering applies biclustering to gene and protein data. Results Using CIA, we visualize the six life cycle stages of Plasmodium falciparum, as well as GO terms in a 2D plane and interpret the spatial configuration. With GSVD, we decompose the transcriptomic and proteomic data sets into matrices with biologically meaningful interpretations and explore the processes captured by the data sets. IBC identifies groups of genes, proteins, GO Terms and life cycle stages of Plasmodium falciparum. We show method-specific results as well as a network view of the life cycle stages based on the results common to all three methods. Additionally, by combining the results of the three methods, we create a three-fold validated network of life cycle stage specific GO terms: Sporozoites are associated with transcription and transport; merozoites with entry into host cell as well as biosynthetic and metabolic processes; rings with oxidation-reduction processes; trophozoites with glycolysis and energy production; schizonts with antigenic variation and immune response; gametocyctes with DNA packaging and mitochondrial transport. Furthermore, the network connectivity underlines the separation of the intraerythrocytic cycle from the gametocyte and sporozoite stages. Conclusion Using integrative analysis techniques, we can integrate knowledge from different levels and obtain a wider view of the system under study. The overlap between method-specific and common results is considerable, even if the basic mathematical assumptions are very different. The three-fold validated network of life cycle stage characteristics of Plasmodium falciparum could identify a large amount of the known associations from literature in only one study. PMID:25033389

Clinical Sarcocystis neurona, Sarcocystis canis, Toxoplasma gondii, and Neospora caninum infections in dogs.

PubMed

Dubey, J P; Chapman, Jennifer L; Rosenthal, Benjamin M; Mense, M; Schueler, Ronald L

2006-04-15

Sarcocystis neurona, Sarcocystis canis, Toxoplasma gondii, and Neospora caninum are related apicomplexans that can cause systemic illness in many species of animals, including dogs. We investigated one breeder's 25 Basset Hounds for these infections. In addition, tissues from dogs and other non-canine hosts previously reported as S. canis infections were studied retrospectively. Schizonts resembling those of S. neurona, and recognized by polyclonal rabbit anti-S. neurona antibodies, were found in six of eight retrospective cases, as well as in two additional dogs (one Basset Hound, one Springer Spaniel) not previously reported. S. neurona schizonts were found in several tissues including the central nervous system, lungs, and kidneys. Fatal toxoplasmosis was diagnosed in an adult dog, and neosporosis was diagnosed in an adult and a pup related to the one diagnosed with S. neurona. No serological reactivity to S. neurona antibodies occurred when S. canis-like liver schizonts were retrospectively assayed from two dogs, a dolphin, a sea lion, a horse, a chinchilla, a black or either of two polar bears. Sequencing conserved (18S) and variable (ITS-1) portions of nuclear ribosomal DNA isolated from the schizont-laden liver of a polar bear distinguished it from all previously characterized species of Sarcocystis. We take this genetic signature as provisionally representative of S. canis, an assumption that should be tested with future sequencing of similar liver infections in other mammalian hosts. These findings further extend the uncharacteristically broad intermediate host range for S. neurona, which also causes a neurologic disease in cats, mink, raccoons, skunks, Pacific harbor seals, ponies, zebras, lynxes, and sea otters. Further work is necessary to delineate the causative agent(s) of other cases of canine sarcocystosis, and in particular to specify the attributes of S. canis, which corresponds morphologically to infections reported from wide range of terrestrial and marine mammals.

Severe anaemia due to haematopoietic precursor cell destruction in field cases of East Coast Fever in Tanzania.

PubMed

Mbassa, G K; Balemba, O; Maselle, R M; Mwaga, N V

1994-04-01

Examinations were made on erythrocytes, thrombocytes, leukocytes, lymph nodes, thymus, haemal nodes and bone marrow in field cases of East Coast Fever (ECF) in Tanzania. Seventy-six clinically sick short-horn Zebu and Taurine-Zebu crosses, positive for Theileria parva piroplasms and schizonts and 55 apparently healthy cattle were studied. The syndrome observed was characterised by severe pancytopenia, with massive normocytic, normochromic anaemia, panleukopenia and thrombocytopenia, but no reticulocytes in peripheral blood. The erythrocyte and leukocyte counts, haematocrit and haemoglobin concentrations were greatly decreased compared with those of the healthy cattle. The means +/- SD (with values of healthy cattle in parentheses) were 2.85 +/- 1.10 (6.04 +/- 1.58) x 10(12) l-1, 2.78 +/- 1.70 (10.59 +/- 4.16) x 10(9) l-1, 0.19 +/- 0.06 (0.31 +/- 0.054)1 l-1 and 4.07 +/- 1.62 (7.29 +/- 1.39) mmol l-1 respectively. Lymphoproliferation was low, while lymphocyte destruction (lymphocytolysis) was high. There were very few small schizonts in parotid and prescapular glands. Lymphocytes were extensively destroyed in medullary cords, germinal centres of lymph nodules in cortex and paracortical regions of lymph nodes and haemal nodes. The bone marrow was hypocellular, with only a few haematopoietic precursor erythroid, granulocytic and thrombopoietic cell series. All stages of prorubriblasts and rubricytes had granulated nuclei, some with schizonts. Infection of erythrocytes by merozoites appeared to take place in precursor stages. The destruction of erythroblasts, rubricytes and other haematopoietic cells resulted in anaemia without reticulocytosis, haemoglobinuria and jaundice, accompanied by panleukopenia of extreme neutropenia, lymphopenia and eosinopenia. This indicated that this T. parva strain differs from previously described buffalo- or cattle-derived T. parva infections in causing both haemoproliferation and lymphoproliferation by extensive haematopoietic cell destruction and lymphocytolysis. In cattle- and buffalo-derived T. parva infections, anaemia is normally mild and there are numerous large schizonts in the former.

Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

DOE Office of Scientific and Technical Information (OSTI.GOV)

Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J.

1995-08-01

Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryoticmore » expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.« less

A novel monoclonal Perkinsus chesapeaki in vitro isolate from an Australian cockle, Anadara trapezia.

PubMed

Reece, Kimberly S; Scott, Gail P; Dang, Cécile; Dungan, Christopher F

2017-09-01

A monoclonal Perkinsus chesapeaki isolate was established from 1 of 10 infected Australian Anadara trapezia cockles. Morphological features were similar to those of described P. chesapeaki isolates, and also included a unique vermiform schizont cell-type. Perkinsus olseni-specific PCR primers amplified DNAs from all 10 cockles. Perkinsus chesapeaki-specific primers also amplified DNAs from 4/10 cockles, including DNA from the isolate source cockle. Three different sets of DNA sequences from the monoclonal isolate grouped with the homologous, previously deposited, P. chesapeaki sequences in phylogenetic analyses. In situ hybridization assays detected both P. chesapeaki and P. olseni cells in histological sections from the source cockle for monoclonal isolate ATCC PRA-425. Copyright © 2017 Elsevier Inc. All rights reserved.

Periodic and chaotic host-parasite interactions in human malaria.

PubMed Central

Kwiatkowski, D; Nowak, M

1991-01-01

It has been recognized since ancient times that malaria fever is highly periodic but the mechanism has been poorly understood. Malaria fever is related to the parasite growth cycle in erythrocytes. After a fixed period of replication, a mature parasite (schizont) causes the infected erythrocyte to rupture, releasing progeny that quickly invade other erythrocytes. Simultaneous rupture of a large number of schizonts stimulates a host fever response. Febrile temperatures are damaging to Plasmodium falciparum, particularly in the second half of its 48-hr replicative cycle. Using a mathematical model, we show that these interactions naturally tend to generate periodic fever. The model predicts chaotic parasite population dynamics at high multiplication rates, consistent with the classical observation that P. falciparum causes less regular fever than other species of parasite. PMID:2052590

Artemisinin resistance in Plasmodium falciparum is associated with an altered temporal pattern of transcription

PubMed Central

2011-01-01

Background Artemisinin resistance in Plasmodium falciparum malaria has emerged in Western Cambodia. This is a major threat to global plans to control and eliminate malaria as the artemisinins are a key component of antimalarial treatment throughout the world. To identify key features associated with the delayed parasite clearance phenotype, we employed DNA microarrays to profile the physiological gene expression pattern of the resistant isolates. Results In the ring and trophozoite stages, we observed reduced expression of many basic metabolic and cellular pathways which suggests a slower growth and maturation of these parasites during the first half of the asexual intraerythrocytic developmental cycle (IDC). In the schizont stage, there is an increased expression of essentially all functionalities associated with protein metabolism which indicates the prolonged and thus increased capacity of protein synthesis during the second half of the resistant parasite IDC. This modulation of the P. falciparum intraerythrocytic transcriptome may result from differential expression of regulatory proteins such as transcription factors or chromatin remodeling associated proteins. In addition, there is a unique and uniform copy number variation pattern in the Cambodian parasites which may represent an underlying genetic background that contributes to the resistance phenotype. Conclusions The decreased metabolic activities in the ring stages are consistent with previous suggestions of higher resilience of the early developmental stages to artemisinin. Moreover, the increased capacity of protein synthesis and protein turnover in the schizont stage may contribute to artemisinin resistance by counteracting the protein damage caused by the oxidative stress and/or protein alkylation effect of this drug. This study reports the first global transcriptional survey of artemisinin resistant parasites and provides insight to the complexities of the molecular basis of pathogens with drug resistance phenotypes in vivo. PMID:21810278

Analysis of antibodies to newly described Plasmodium falciparum merozoite antigens supports MSPDBL2 as a predicted target of naturally acquired immunity.

PubMed

Tetteh, Kevin K A; Osier, Faith H A; Salanti, Ali; Kamuyu, Gathoni; Drought, Laura; Failly, Marilyne; Martin, Christophe; Marsh, Kevin; Conway, David J

2013-10-01

Prospective studies continue to identify malaria parasite genes with particular patterns of polymorphism which indicate they may be under immune selection, and the encoded proteins require investigation. Sixteen new recombinant protein reagents were designed to characterize three such polymorphic proteins expressed in Plasmodium falciparum schizonts and merozoites: MSPDBL1 (also termed MSP3.4) and MSPDBL2 (MSP3.8), which possess Duffy binding-like (DBL) domains, and SURFIN4.2, encoded by a member of the surface-associated interspersed (surf) multigene family. After testing the antigenicities of these reagents by murine immunization and parasite immunofluorescence, we analyzed naturally acquired antibody responses to the antigens in two cohorts in coastal Kenya in which the parasite was endemic (Chonyi [n = 497] and Ngerenya [n = 461]). As expected, the prevalence and levels of serum antibodies increased with age. We then investigated correlations with subsequent risk of clinical malaria among children <11 years of age during 6 months follow-up surveillance. Antibodies to the polymorphic central region of MSPDBL2 were associated with reduced risk of malaria in both cohorts, with statistical significance remaining for the 3D7 allelic type after adjustment for individuals' ages in years and antibody reactivity to whole-schizont extract (Chonyi, risk ratio, 0.51, and 95% confidence interval [CI], 0.28 to 0.93; Ngerenya, risk ratio, 0.38, and 95% CI, 0.18 to 0.82). For the MSPDBL1 Palo Alto allelic-type antigen, there was a protective association in one cohort (Ngerenya, risk ratio, 0.53, and 95% CI, 0.32 to 0.89), whereas the other antigens showed no protective associations after adjustment. These findings support the prediction that antibodies to the polymorphic region of MSPDBL2 contribute to protective immunity.

A Global Survey of ATPase Activity in Plasmodium falciparum Asexual Blood Stages and Gametocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ortega, Corrie; Frando, Andrew; Webb-Robertson, Bobbie-Jo

Effective malaria control and elimination in hyperendemic areas of the world will require treatment of disease-causing Plasmodium falciparum (Pf) blood stage infection but also blocking parasite transmission from humans to mosquito to prevent disease spread. Numerous antimalarial drugs have become ineffective due to parasite drug resistance and many currently used therapies do not kill gametocytes, highly specialized sexual parasite stages with distinct physiology that are necessary for transmission from the human host to the mosquito vector. Further confounding next generation drug development against Pf is the lack of known biochemical activity for most parasite gene products as well as themore » unknown metabolic needs of non-replicating gametocyte. Here, we take a systematic activity-based proteomics approach to survey the large and druggable ATPase family that is associated with replicating blood stage asexual parasites and transmissible gametocytes. We experimentally confirm existing annotation and predict ATPase function for 38 uncharacterized proteins. ATPase activity broadly changes during the transition from asexual schizonts to gametocytes, indicating altered metabolism and regulatory roles of ATPases specific for each lifecycle stage. By mapping the activity of ATPases associated with gametocytogenesis, we assign biochemical activity to a large number of uncharacterized proteins and identify new candidate transmission blocking targets.« less

Exxon Valdez oil spill restoration project final report: Prince William Sound Herring disease program (HDP), restoration project 070819

USGS Publications Warehouse

Hershberger, Paul; Elliott, Diane G.; Emmenegger, Eveline J.; Hansen, John D.; Kurath, Gael; Winton, James R.; Kocan, Richard; LaPatra, Scott

2011-01-01

Surveys of pathogens in Pacific herring from 2007 – 2010 indicated that Ichthyophonus, viral hemorrhagic septicemia virus, and erythrocytic necrosis virus are endemic in Prince William Sound and throughout the NE Pacific. Laboratory studies with VHSV indicated that multiple herring stocks are equally susceptible to the resulting disease, Pacific herring shed copious levels of VHSV (as high at 5x108 plaque-forming units/day) shortly after exposure, chronic and persistent infections can occur in Pacific herring, susceptibility of Pacific herring to VHS extends to the larval life stages but not the embryonic stages, and the prior exposure history of Pacific herring to VHSV can be determined post hoc. Laboratory studies involving Ichthyophonus indicated that schizonts can be inactivated with chlorine and iodine solutions, the parasite can survive for extended periods in saltwater but not freshwater, a low potential exists for cross contamination between in vitro explant cultures, infectious schizonts are released from the skin surface of infected herring, schizonts are not uniformly distributed throughout the skeletal muscle of infected Pacific herring, multiple types of Ichthyophonus exist with different genotypes and phenotypic traits, and temperature is an important factor influencing the infectivity of Ichthyophonus. Additional field and laboratory studies indicated that Ichthyophonus negatively influences the swimming performance of infected hosts and the negative impacts effects are exacerbated by increasing temperatures, American shad are an important reservoir of Ichthyophonus in the NE Pacific, Pacific herring are not susceptible to infectious hematopoietic necrosis (IHN), and Pacific herring will accept surgically implanted acoustic tags with negligible impacts on survival.

Rediscovery and redescription of Plasmodium pifanoi and description of two additional Plasmodium parasites of Venezuelan lizards.

PubMed

Telford, Sam R; Telford, Sam R

2003-04-01

Plasmodium pifanoi Scorza and Dagert B., known only from the type host, Ameiva ameiva, is redescribed from Kentropyx calcarata collected in Territorio Amazonas, Venezuela. Schizonts, 6.2 x 4.5 (4-8 x 3-6), produce on average 11.9 (7-16) merozoites. Gametocytes average 12.4 x 6.0 (8-16 x 4-10), with length x width (LW) 72.9 (52-112) and L/W 2.18 (1.1-3.3), and always contain 1-5 prominent vacuoles. Macrogametocytes in active infection are longer than microgametocytes, with greater LW, but gametocytes in chronic infection are not sexually dimorphic in dimension and are slightly smaller. Two additional malarial parasites are described from K. calcarata. Plasmodium lepidoptiformis has small schizonts, 4.6 x 3.2 (3-6 x 2.5-3), that produce 5.1 (4-8) merozoites and commonly resemble a butterfly in appearance. Gametocytes are elongate, 9.0 x 4.3 (7-10 x 3-6), with LW 38.3 (24-51) and L/W 2.2 (1.3-3.3), and sexually dimorphic, with macrogametocytes longer than microgametocytes, with greater LW. Plasmodium minasense calcaratae is characterized by very small, usually fan-shaped, schizonts. 3.4 x 2.6 (2.5-4.5 x 2.0-3.0), that produce 3.9 (3-4) merozoites. Gametocytes are spherical or ovoid, 6.7 x 5.0 (4.5-9.0 x 3.0-7.0), with LW 33.7 (15-54) and L/W 1.4 (1.0-2.3), with no sexual dimorphism in dimensions.

Defining the Timing of Action of Antimalarial Drugs against Plasmodium falciparum

PubMed Central

Langer, Christine; Goodman, Christopher D.; McFadden, Geoffrey I.

2013-01-01

Most current antimalarials for treatment of clinical Plasmodium falciparum malaria fall into two broad drug families and target the food vacuole of the trophozoite stage. No antimalarials have been shown to target the brief extracellular merozoite form of blood-stage malaria. We studied a panel of 12 drugs, 10 of which have been used extensively clinically, for their invasion, schizont rupture, and growth-inhibitory activity using high-throughput flow cytometry and new approaches for the study of merozoite invasion and early intraerythrocytic development. Not surprisingly, given reported mechanisms of action, none of the drugs inhibited merozoite invasion in vitro. Pretreatment of erythrocytes with drugs suggested that halofantrine, lumefantrine, piperaquine, amodiaquine, and mefloquine diffuse into and remain within the erythrocyte and inhibit downstream growth of parasites. Studying the inhibitory activity of the drugs on intraerythrocytic development, schizont rupture, and reinvasion enabled several different inhibitory phenotypes to be defined. All drugs inhibited parasite replication when added at ring stages, but only artesunate, artemisinin, cycloheximide, and trichostatin A appeared to have substantial activity against ring stages, whereas the other drugs acted later during intraerythrocytic development. When drugs were added to late schizonts, only artemisinin, cycloheximide, and trichostatin A were able to inhibit rupture and subsequent replication. Flow cytometry proved valuable for in vitro assays of antimalarial activity, with the free merozoite population acting as a clear marker for parasite growth inhibition. These studies have important implications for further understanding the mechanisms of action of antimalarials, studying and evaluating drug resistance, and developing new antimalarials. PMID:23318799

The structurally related auxin and melatonin tryptophan-derivatives and their roles in Arabidopsis thaliana and in the human malaria parasite Plasmodium falciparum.

PubMed

Koyama, Fernanda C; Carvalho, Thais L G; Alves, Eduardo; da Silva, Henrique B; de Azevedo, Mauro F; Hemerly, Adriana S; Garcia, Célia R S

2013-01-01

Indole compounds are involved in a range of functions in many organisms. In the human malaria parasite Plasmodium falciparum, melatonin and other tryptophan derivatives are able to modulate its intraerythrocytic cycle, increasing the schizont population as well as parasitemia, likely through ubiquitin-proteasome system (UPS) gene regulation. In plants, melatonin regulates root development, in a similar way to that described for indoleacetic acid, suggesting that melatonin and indoleacetic acid could co-participate in some physiological processes due to structural similarities. In the present work, we evaluate whether the chemical structure similarity found in indoleacetic acid and melatonin can lead to similar effects in Arabidopsis thaliana lateral root formation and P. falciparum cell cycle modulation, as well as in the UPS of gene regulation, by qRT-PCR. Our data show that P. falciparum is not able to respond to indoleacetic acid either in the modulation of the intraerythrocytic cycle or in the gene regulation mediated by the UPS as observed for melatonin. The similarities of these indole compounds are not sufficient to confer synergistic functions in P. falciparum cell cycle modulation, but could interplay in A. thaliana lateral root formation. © 2013 The Author(s) Journal of Eukaryotic Microbiology © 2013 International Society of Protistologists.

A comprehensive model for assessment of liver stage therapies targeting Plasmodium vivax and Plasmodium falciparum.

PubMed

Roth, Alison; Maher, Steven P; Conway, Amy J; Ubalee, Ratawan; Chaumeau, Victor; Andolina, Chiara; Kaba, Stephen A; Vantaux, Amélie; Bakowski, Malina A; Luque, Richard Thomson; Adapa, Swamy Rakesh; Singh, Naresh; Barnes, Samantha J; Cooper, Caitlin A; Rouillier, Mélanie; McNamara, Case W; Mikolajczak, Sebastian A; Sather, Noah; Witkowski, Benoît; Campo, Brice; Kappe, Stefan H I; Lanar, David E; Nosten, François; Davidson, Silas; Jiang, Rays H Y; Kyle, Dennis E; Adams, John H

2018-05-09

Malaria liver stages represent an ideal therapeutic target with a bottleneck in parasite load and reduced clinical symptoms; however, current in vitro pre-erythrocytic (PE) models for Plasmodium vivax and P. falciparum lack the efficiency necessary for rapid identification and effective evaluation of new vaccines and drugs, especially targeting late liver-stage development and hypnozoites. Herein we report the development of a 384-well plate culture system using commercially available materials, including cryopreserved primary human hepatocytes. Hepatocyte physiology is maintained for at least 30 days and supports development of P. vivax hypnozoites and complete maturation of P. vivax and P. falciparum schizonts. Our multimodal analysis in antimalarial therapeutic research identifies important PE inhibition mechanisms: immune antibodies against sporozoite surface proteins functionally inhibit liver stage development and ion homeostasis is essential for schizont and hypnozoite viability. This model can be implemented in laboratories in disease-endemic areas to accelerate vaccine and drug discovery research.

Penetration of equine leukocytes by merozoites of Sarcocystis neurona.

PubMed

Lindsay, David S; Mitchell, Sheila M; Yang, Jibing; Dubey, J P; Gogal, Robert M; Witonsky, Sharon G

2006-06-15

Horses are considered accidental hosts for Sarcocystis neurona and they often develop severe neurological disease when infected with this parasite. Schizont stages develop in the central nervous system (CNS) and cause the neurological lesions associated with equine protozoal myeloencephalitis. The present study was done to examine the ability of S. neurona merozoites to penetrate and develop in equine peripheral blood leukocytes. These infected host cells might serve as a possible transport mechanism into the CNS. S. neurona merozoites penetrated equine leukocytes within 5 min of co-culture. Infected leukocytes were usually monocytes. Infected leukocytes were present up to the final day of examination at 3 days. Up to three merozoites were present in an infected monocyte. No development to schizont stages was observed. All stages observed were in the host cell cytoplasm. We postulate that S. neurona merozoites may cross the blood brain barrier hidden inside leukocytes. Once inside the CNS these merozoites can egress and invade additional cells and cause encephalitis.

In-vitro interaction of tafenoquine and chloroquine in Plasmodium falciparum from northwestern Thailand.

PubMed

Vollnberg, Anke; Prajakwong, Somsak; Sirichaisinthop, Jeeraphat; Wiedermann, Gerhard; Wernsdorfer, Gunther; Wernsdorfer, Walther H

2003-01-01

The blood schizontocidal, pharmacodynamic interaction between tafenoquine (WR 238605--a 5-phenoxyprimaquine derivative--and chloroquine was investigated, using an in-vitro test for the inhibition of schizont maturation, in 15 fresh isolates of Plasmodium falciparum that originated from northwestern Thailand and neighbouring Myanmar. In this area the parasite is highly resistant to chloroquine. The geometric mean cut-off concentrations of schizont maturation for tafenoquine and chloroquine were 5261 nM and 7638 nM, respectively. With a mixture of tafenoquine and chloroquine, the mean cut-off concentration was 5252 nM, corresponding to 389 nM tafenoquine + 4863 nM chloroquine. Further analysis showed that the interaction between tafenoquine and chloroquine was additive within the range of EC20 and EC77. At concentrations higher than the EC77, interaction was moderately synergistic. While tafenoquine did not reverse the resistance to chloroquine to the degree of clinically relevant sensitivity, there was evidence that the blood schizontocidal efficacy of tafenoquine would be enhanced in the presence of chloroquine.

Plasmodium falciparum FIKK Kinase Members Target Distinct Components of the Erythrocyte Membrane

PubMed Central

Scheidig-Benatar, Christine; Cooke, Brian M.; Scherf, Artur

2010-01-01

Background Modulation of infected host cells by intracellular pathogens is a prerequisite for successful establishment of infection. In the human malaria parasite Plasmodium falciparum, potential candidates for erythrocyte remodelling include the apicomplexan-specific FIKK kinase family (20 members), several of which have been demonstrated to be transported into the erythrocyte cytoplasm via Maurer's clefts. Methodology In the current work, we have knocked out two members of this gene family (Pf fikk7.1 and Pf fikk12), whose products are localized at the inner face of the erythrocyte membrane. Both mutant parasite lines were viable and erythrocytes infected with these parasites showed no detectable alteration in their ability to adhere in vitro to endothelial receptors such as chondroitin sulfate A and CD36. However, we observed sizeable decreases in the rigidity of infected erythrocytes in both knockout lines. Mutant parasites were further analyzed using a phospho-proteomic approach, which revealed distinct phosphorylation profiles in ghost preparations of infected erythrocytes. Knockout parasites showed a significant reduction in the level of phosphorylation of a protein of approximately 80 kDa for FIKK12-KO in trophozoite stage and a large protein of about 300 kDa for FIKK7.1-KO in schizont stage. Conclusions Our results suggest that FIKK members phosphorylate different membrane skeleton proteins of the infected erythrocyte in a stage-specific manner, inducing alterations in the mechanical properties of the parasite-infected red blood cell. This suggests that these host cell modifications may contribute to the parasites' survival in the circulation of the human host. PMID:20668526

Plasmodium falciparum FIKK kinase members target distinct components of the erythrocyte membrane.

PubMed

Nunes, Marta C; Okada, Mami; Scheidig-Benatar, Christine; Cooke, Brian M; Scherf, Artur

2010-07-23

Modulation of infected host cells by intracellular pathogens is a prerequisite for successful establishment of infection. In the human malaria parasite Plasmodium falciparum, potential candidates for erythrocyte remodelling include the apicomplexan-specific FIKK kinase family (20 members), several of which have been demonstrated to be transported into the erythrocyte cytoplasm via Maurer's clefts. In the current work, we have knocked out two members of this gene family (Pf fikk7.1 and Pf fikk12), whose products are localized at the inner face of the erythrocyte membrane. Both mutant parasite lines were viable and erythrocytes infected with these parasites showed no detectable alteration in their ability to adhere in vitro to endothelial receptors such as chondroitin sulfate A and CD36. However, we observed sizeable decreases in the rigidity of infected erythrocytes in both knockout lines. Mutant parasites were further analyzed using a phospho-proteomic approach, which revealed distinct phosphorylation profiles in ghost preparations of infected erythrocytes. Knockout parasites showed a significant reduction in the level of phosphorylation of a protein of approximately 80 kDa for FIKK12-KO in trophozoite stage and a large protein of about 300 kDa for FIKK7.1-KO in schizont stage. Our results suggest that FIKK members phosphorylate different membrane skeleton proteins of the infected erythrocyte in a stage-specific manner, inducing alterations in the mechanical properties of the parasite-infected red blood cell. This suggests that these host cell modifications may contribute to the parasites' survival in the circulation of the human host.

PfCDPK1 is critical for malaria parasite gametogenesis and mosquito infection

PubMed Central

Bansal, Abhisheka; Molina-Cruz, Alvaro; Brzostowski, Joseph; Liu, Poching; Luo, Yan; Gunalan, Karthigayan; Li, Yuesheng; Ribeiro, José M. C.; Miller, Louis H.

2018-01-01

Efforts to knock out Plasmodium falciparum calcium-dependent protein kinase 1 (PfCDPK1) from asexual erythrocytic stage have not been successful, indicating an indispensable role of the enzyme in asexual growth. We recently reported generation of a transgenic parasite with mutant CDPK1 [Bansal A, et al. (2016) MBio 7:e02011-16]. The mutant CDPK1 (T145M) had reduced activity of transphosphorylation. We reasoned that CDPK1 could be disrupted in the mutant parasites. Consistent with this assumption, CDPK1 was successfully disrupted in the mutant parasites using CRISPR/Cas9. We and others could not disrupt PfCDPK1 in the WT parasites. The CDPK1 KO parasites show a slow growth rate compared with the WT and the CDPK1 T145M parasites. Additionally, the CDPK1 KO parasites show a defect in both male and female gametogenesis and could not establish an infection in mosquitoes. Complementation of the KO parasite with full-length PfCDPK1 partially rescued the asexual growth defect and mosquito infection. Comparative global transcriptomics of WT and the CDPK1 KO schizonts using RNA-seq show significantly high transcript expression of gametocyte-specific genes in the CDPK1 KO parasites. This study conclusively demonstrates that CDPK1 is a good target for developing transmission-blocking drugs. PMID:29311293

PfCDPK1 is critical for malaria parasite gametogenesis and mosquito infection.

PubMed

Bansal, Abhisheka; Molina-Cruz, Alvaro; Brzostowski, Joseph; Liu, Poching; Luo, Yan; Gunalan, Karthigayan; Li, Yuesheng; Ribeiro, José M C; Miller, Louis H

2018-01-23

Efforts to knock out Plasmodium falciparum calcium-dependent protein kinase 1 ( Pf CDPK1) from asexual erythrocytic stage have not been successful, indicating an indispensable role of the enzyme in asexual growth. We recently reported generation of a transgenic parasite with mutant CDPK1 [Bansal A, et al. (2016) MBio 7:e02011-16]. The mutant CDPK1 (T145M) had reduced activity of transphosphorylation. We reasoned that CDPK1 could be disrupted in the mutant parasites. Consistent with this assumption, CDPK1 was successfully disrupted in the mutant parasites using CRISPR/Cas9. We and others could not disrupt Pf CDPK1 in the WT parasites. The CDPK1 KO parasites show a slow growth rate compared with the WT and the CDPK1 T145M parasites. Additionally, the CDPK1 KO parasites show a defect in both male and female gametogenesis and could not establish an infection in mosquitoes. Complementation of the KO parasite with full-length Pf CDPK1 partially rescued the asexual growth defect and mosquito infection. Comparative global transcriptomics of WT and the CDPK1 KO schizonts using RNA-seq show significantly high transcript expression of gametocyte-specific genes in the CDPK1 KO parasites. This study conclusively demonstrates that CDPK1 is a good target for developing transmission-blocking drugs. Copyright © 2018 the Author(s). Published by PNAS.

Bone Marrow Is a Major Parasite Reservoir in Plasmodium vivax Infection

PubMed Central

2018-01-01

ABSTRACT Plasmodium vivax causes heavy burdens of disease across malarious regions worldwide. Mature P. vivax asexual and transmissive gametocyte stages occur in the blood circulation, and it is often assumed that accumulation/sequestration in tissues is not an important phase in their development. Here, we present a systematic study of P. vivax stage distributions in infected tissues of nonhuman primate (NHP) malaria models as well as in blood from human infections. In a comparative analysis of the transcriptomes of P. vivax and Plasmodium falciparum blood-stage parasites, we found a conserved cascade of stage-specific gene expression despite the greatly different gametocyte maturity times of these two species. Using this knowledge, we validated a set of conserved asexual- and gametocyte-stage markers both by quantitative real-time PCR and by antibody assays of peripheral blood samples from infected patients and NHP (Aotus sp.). Histological analyses of P. vivax parasites in organs of 13 infected NHP (Aotus and Saimiri species) demonstrated a major fraction of immature gametocytes in the parenchyma of the bone marrow, while asexual schizont forms were enriched to a somewhat lesser extent in this region of the bone marrow as well as in sinusoids of the liver. These findings suggest that the bone marrow is an important reservoir for gametocyte development and proliferation of malaria parasites. PMID:29739900

Acute, fatal Sarcocystis calchasi-associated hepatitis in Roller pigeons (Columbia livia f. dom.) at Philadelphia Zoo

USDA-ARS?s Scientific Manuscript database

Four Roller pigeons (Columba livia f. dom.) at the Philadelphia Zoo died suddenly. Necropsy examination revealed macroscopic hepatitis. Microscopically, the predominant lesions were in liver, characterized with necrosis and mixed cell inflammatory response. Sarcocystis calchasi-like schizonts and fr...

The conserved apicomplexan Aurora kinase TgArk3 is involved in endodyogeny, duplication rate and parasite virulence

PubMed Central

Morlon-Guyot, Juliette; Bordat, Yann; Lebrun, Maryse; Gubbels, Marc-Jan; Doerig, Christian; Daher, Wassim

2016-01-01

Aurora kinases are eukaryotic serine/threonine protein kinases that regulate key events associated with chromatin condensation, centrosome and spindle function, and cytokinesis. Elucidating the roles of Aurora kinases in apicomplexan parasites is crucial to understand the cell cycle control during Plasmodium schizogony or Toxoplasma endodyogeny. Here, we report on the localization of two previously uncharacterized Toxoplasma Aurora-related kinases (Ark2 and Ark3) in tachyzoites and of the uncharacterized Ark3 orthologue in Plasmodium falciparum erythrocytic stages. In T. gondii, we show that TgArk2 and TgArk3 concentrate at specific sub-cellular structures linked to parasite division: the mitotic spindle and intranuclear mitotic structures (TgArk2), and the outer core of the centrosome and the budding daughter cells cytoskeleton (TgArk3). By tagging the endogenous PfArk3 gene with the green fluorescent protein (GFP) in live parasites, we show that PfArk3 protein expression peaks late in schizogony and localizes at the periphery of budding schizonts. Disruption of the TgArk2 gene reveals no essential function for tachyzoite propagation in vitro, which is surprising giving that the P. falciparum and P. berghei orthologues are essential for erythrocyte schizogony. In contrast, knock-down of TgArk3 protein results in pronounced defects in parasite division and a major growth deficiency. TgArk3-depleted parasites display several defects, such as reduced parasite growth rate, delayed egress and parasite duplication, defect in rosette formation, reduced parasite size and invasion efficiency and lack of virulence in mice. Our study provides new insights into cell cycle control in Toxoplasma and malaria parasites, and highlights Aurora kinase 3 as potential drug target. PMID:26833682

Biophysics of malarial parasite exit from infected erythrocytes.

PubMed

Chandramohanadas, Rajesh; Park, YongKeun; Lui, Lena; Li, Ang; Quinn, David; Liew, Kingsley; Diez-Silva, Monica; Sung, Yongjin; Dao, Ming; Lim, Chwee Teck; Preiser, Peter Rainer; Suresh, Subra

2011-01-01

Upon infection and development within human erythrocytes, P. falciparum induces alterations to the infected RBC morphology and bio-mechanical properties to eventually rupture the host cells through parasitic and host derived proteases of cysteine and serine families. We used previously reported broad-spectrum inhibitors (E64d, EGTA-AM and chymostatin) to inhibit these proteases and impede rupture to analyze mechanical signatures associated with parasite escape. Treatment of late-stage iRBCs with E64d and EGTA-AM prevented rupture, resulted in no major RBC cytoskeletal reconfiguration but altered schizont morphology followed by dramatic re-distribution of three-dimensional refractive index (3D-RI) within the iRBC. These phenotypes demonstrated several-fold increased iRBC membrane flickering. In contrast, chymostatin treatment showed no 3D-RI changes and caused elevated fluctuations solely within the parasitophorous vacuole. We show that E64d and EGTA-AM supported PV breakdown and the resulting elevated fluctuations followed non-Gaussian pattern that resulted from direct merozoite impingement against the iRBC membrane. Optical trapping experiments highlighted reduced deformability of the iRBC membranes upon rupture-arrest, more specifically in the treatments that facilitated PV breakdown. Taken together, our experiments provide novel mechanistic interpretations on the role of parasitophorous vacuole in maintaining the spherical schizont morphology, the impact of PV breakdown on iRBC membrane fluctuations leading to eventual parasite escape and the evolution of membrane stiffness properties of host cells in which merozoites were irreversibly trapped, recourse to protease inhibitors. These findings provide a comprehensive, previously unavailable, body of information on the combined effects of biochemical and biophysical factors on parasite egress from iRBCs.

Isolation and Characterization of Erythrocyte and Parasite Membranes from Rhesus Red Cells Infected with P. knowlesi.

DTIC Science & Technology

1981-06-01

initiated experiments to separate and isolate the vacuolar membrane and the parasite plasma menbrane . For this, the surfaces of intact schizonts...controlled nitrogen decompression (1) is surrounded by two membranes, its own plasma membrane and the membrane of the parasitophorous vacuole. We have

Pathology, immunohistochemistry, and ultrastructural findings associated with neurological sarcocystosis in cattle

USDA-ARS?s Scientific Manuscript database

The case of neurological sarcocystosis in a nine months old bull calf that died in 1982 was restudied. The bull was suspected to have rabies. Therefore, only brain was examined histologically. Thirty four years later, we restudied sections from paraffin-embedded blocks of brain. Numerous schizonts a...

The serological relationship between Theileria parva (Muguga) and Theileria lawrence from Rhodesia.

PubMed

Lawrence, J A

1977-05-28

Thirty-eight sera from cattle from a herd in Rhodesia naturally infected with Theileria lawrencei were titrated with the indirect immunofluorescent test against schizont antigens of T parva (Muguga) and T lawrencei from Rhodesia. T lawrencei was found to be indistinguishable from T parva with the test.

Sarcocystis canis associated hepatitis in a Steller sea lion (Eumetopias jubatus) from Alaska.

PubMed

Welsh, Trista; Burek-Huntington, Kathy; Savage, Kate; Rosenthal, Benjamin; Dubey, J P

2014-04-01

Sarcocystis canis infection was associated with hepatitis in a Steller sea lion (Eumetopias jubatus). Intrahepatocellular protozoal schizonts were among areas of necrosis and inflammation. The parasite was genetically identical to S. canis and is the first report in a Steller sea lion, indicating another intermediate host species for S. canis.

Plasmodium carmelinoi n. sp. (Haemosporida: Plasmodiidae) of the lizard Ameiva ameiva (Squamata: Teiidae) in Amazonian Brazil.

PubMed

Lainson, R; Franco, C M; Da Matta, R

2010-06-01

Plasmodium carmelinoi n. sp. is described in the teiid lizard Ameiva ameiva from north Brazil. Following entry of the merozoites into the erythrocyte, the young, uninucleated trophozoites are at first tear-shaped and already possess a large vacuole: with growth, they may assume an irregular shape, but eventually become spherical or broadly ovoid. The vacuole reduces the cytoplasm of the parasite to a narrow peripheral band in which nuclear division produces a schizont with 8-12 nuclei. At first the dark, brownish-black pigment granules are restricted to this rim of cytoplasm but latterly become conspicuously concentrated within the vacuole. The mature schizonts are spherical to ovoid and predominantly polar in their position in the erythrocyte. They average 5.4 x 4,9 microm (4.4 x 4.4 - 6.6 x 5,9 microm), shape index 1.1, n = 50: 8-12 merozoites are produced and measure approximately 2.0 x 1,0 microm. Mature gametocytes are also polar in position, and spherical to subspherical. The macrogametocytes measure 5.7 x 5,2 microm (4.4 x 4.0- 5.9 x 5,1 microm), shape index 1.1, n = 50 and, following staining by Giemsa's method, possess a compact, pink-staining nucleus and a clear blue, faintly stained cytoplasm. Microgametocytes are slightly larger, 6.0 x 5,0 microm (5.2 x 4.4 - 6.2 x 5,2 microm), shape index 1.2, n = 45. They stain an over-all pink colour due to the dispersed nuclear chromatin. The vacuoles in both the macro- and microgametocytes are considerably smaller than those of the schizonts and of ovoid or spindle shape: they contain most of the pigment granules. The sex ratio, as seen in an inicial intense infection, was 1 male to 2.2 females. Prevalence of infection was low (5%) but, due to the very low parasitaemia which may result in a failure to detect parasites, it is probably higher than this.

Besnoitia neotomofelis n. sp. (Protozoa: Apicomplexa) from the southern plains woodrat ( Neotoma micropus).

PubMed

Dubey, J P; Yabsley, M J

2010-10-01

Certain species of the protozoan genus Besnoitia cause clinical disease in livestock and wildlife. In the present paper a new species, Besnoitia neotomofelis is described from the southern planes woodrat (Neotoma micropus). The parasite was detected by bioassay of woodrat tissues in outbred Swiss Webster mice in an attempt to isolate Toxoplasma gondii. Initially, the organism was misdiagnosed as T. gondii because it was highly pathogenic for mice and its tachyzoites resembled T. gondii tachyzoites. Further studies revealed that it differed structurally and biologically from T. gondii. Tachyzoites were successfully cultivated and maintained in vitro in bovine monocytes and African green monkey kidney cells, and in vivo in mice. Non-dividing, uninucleate tachyzoites were approximately 1 x 5 μm in size. Longitudinally-cut bradyzoites in tissue sections measured 1.5-1.6 x 7.7-9.3 μm. Tissue cysts were microscopic, up to 210 μm long, and were infective orally to mice. Cats fed tissue cysts shed unsporulated 13 x 14 μm sized oocysts. All mice inoculated with B. neotomofelis died of acute besnoitiosis, irrespective of the dose, and Norwegian rats became infected but remained asymptomatic. Entero-epithelial stages (schizonts, gamonts) were found in cats fed tissue cysts. Large (up to 40 x 50 μm) first-generation schizonts developed in the lamina propria of the small intestine of cats. A second generation of small sized (8 μm) schizonts containing 4-8 merozoites was detected in enterocytes of the small intestine. Gamonts and oocysts were seen in goblet cells of the small intestinal epithelium. Tachyzoites were present in mesenteric lymph nodes of cats. Phylogenetic analysis indicated that B. neotomofelis was related to other Besnoitia species from rodents, rabbits, and opossums. Besnoitia neotomofelis is distinct from the 3 other species of Besnoitia, B. wallacei, B. darlingi and B. oryctofelisi that utilize cats as a definitive host.

IL-17A regulates Eimeria tenella schizont maturation and migration in avian coccidiosis

USDA-ARS?s Scientific Manuscript database

Although IL17A is associated with the immunological control of various infectious diseases, its role in host response to Eimeria infections is not well understood. In an effort to better dissect the role of IL17A in host-pathogen interactions in avian coccidiosis, a neutralizing antibody (Ab) to chi...

The Plasmodium protein P113 supports efficient sporozoite to liver stage conversion in vivo.

PubMed

Offeddu, Vittoria; Rauch, Manuel; Silvie, Olivier; Matuschewski, Kai

2014-02-01

Invasive stages of Plasmodium parasites possess distinct integral and peripheral membrane proteins that mediate host cell attachment and invasion. P113 is an abundant protein in detergent-resistant high molecular weight complexes in Plasmodium schizonts, but is unusual since expression extends to gametocytes and sporozoites. In this study, we tested whether P113 performs important functions for parasite propagation in Plasmodium berghei. We show that pre-erythrocytic expression of P113 displays key signatures of upregulated in infectious sporozoites (UIS) genes, including control by the liver stage master regulator SLARP. Targeted gene deletion resulted in viable blood stage parasites that displayed no signs of blood stage growth defects. p113(-) parasites propagated normally through the life cycle until mature sporozoites, but displayed defects during natural sporozoite transmission, leading to a delay to patency in infected animals. By comparative in vitro and in vivo analysis of pre-erythrocytic development and using a xeno-diagnostic test we show that ablation of P113 results in lower sporozoite to liver stage conversion and, as a consequence, reduced merozoite output in vivo, without delaying liver stage development. We conclude that p113 is dispensable for Plasmodium life cycle progression and plays auxiliary roles during pre-erythrocytic development. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of a dithiol-dependent nucleoside triphosphate hydrolase in Sarcocystis neurona.

PubMed

Zhang, Deqing; Gaji, Rajshekhar Y; Howe, Daniel K

2006-09-01

A putative nucleoside triphosphate hydrolase (NTPase) gene was identified in a database of expressed sequence tags (ESTs) from the apicomplexan parasite Sarcocystis neurona. Analysis of culture-derived S. neurona merozoites demonstrated a dithiol-dependent NTPase activity, consistent with the presence of a homologue to the TgNTPases of Toxoplasma gondii. A complete cDNA was obtained for the S. neurona gene and the predicted amino acid sequence shared 38% identity with the two TgNTPase isoforms from T. gondii. Based on the obvious homology, the S. neurona protein was designated SnNTP1. The SnNTP1 cDNA encodes a polypeptide of 714 amino acids with a predicted 22-residue signal peptide and an estimated mature molecular mass of 70kDa. Southern blot analysis of the SnNTP1 locus revealed that the gene exists as a single copy in the S. neurona genome, unlike the multiple gene copies that have been observed in T. gondii and Neospora caninum. Analyses of the SnNTP1 protein demonstrated that it is soluble and secreted into the culture medium by extracellular merozoites. Surprisingly, indirect immunofluorescence analysis of intracellular S. neurona revealed apical localisation of SnNTP1 and temporal expression characteristics that are comparable with the microneme protein SnMIC10. The absence of SnNTP1 during much of endopolygeny implies that this protein does not serve a function during intracellular growth and development of S. neurona schizonts. Instead, SnNTP1 may play a role in events that occur during or proximal to merozoite egress from and/or invasion into cells.

Sarcocystis neurona schizonts-associated encephalitis, chorioretinitis, and myositis in a two-month-old dog simulating toxoplasmosis, and presence of mature sarcocysts in muscles.

PubMed

Dubey, J P; Black, S S; Verma, S K; Calero-Bernal, R; Morris, E; Hanson, M A; Cooley, A J

2014-05-28

Sarcocystis neurona is an unusual species of the genus Sarcocystis. Opossums (Didelphis virginianus, D. albiventris) are the definitive hosts and several other species, including dogs, cats, marine mammals, and horses are intermediate or aberrant hosts. Sarcocysts are not known to form in aberrant hosts. Sarcocystis neurona causes fatal disease in horses (Equine Protozoal Myeloencephalitis, EPM). There are numerous reports of fatal EPM-like infections in other species, usually with central nervous system signs and associated with the schizont stage of S. neurona. Here, we report fatal disseminated S. neurona infection in a nine-week-old golden retriever dog from Mississippi, USA. Protozoal merozoites were identified in smears of the cerebrospinal fluid. Microscopically, lesions and protozoa were identified in eyes, tongue, heart, liver, intestines, nasal turbinates, skeletal muscle and brain, which reacted intensely with S. neurona polyclonal antibodies. Mature sarcocysts were seen in sections of muscles. These sarcocysts were ultrastructurally similar to those of S. neurona from experimentally infected animals. These data suggest that the dog is another intermediate host for S. neurona. Data suggest that the dog was transplacentally infected. Copyright © 2014 Elsevier B.V. All rights reserved.

A taxonomic revision of small neotropical saurian Malarias allied to Plasmodium minasense.

PubMed

Telford, S R

1979-01-01

Saurian malaria species which produce schizonts smaller than normal erythrocyte nuclei, with 4-8 merozoietes and gametocytes equal to or smaller than erythrocyte nuclei in size, parasitizing hosts of the lizard families Scincidae, Iguanidae and Teiidae in the Neotropics are considered to be Plasmodium minasense Carini and Rudolph, 1912. Subspecific designations are given to distinctive populations parasitizing different host species: P. minasense minasense is recognized from the type host, Mabuya mabouya of Brasil; P. minasense carinii Leger and Mouzels, 1917 from Iguana iguana of coastal South America; P. minasense anolisi subsp. nov. from Anolis limifrons of Panama; P. minasense capitoi subsp. nov. from Anolis capito of Panama; P. minasense plicae subsp. nov. from Plica umbra of Guyana; P. minasense tegui subsp. nov. from Tupinambis teguixin of Venezuela; and P. minasense diminutivum Telford, 1973, new combination, from Ameiva ameiva of Panama. Plasmodium rhadinurum Thompson and Huff, 1944 is recognized as a distinct species at present on the basis of possessing schizonts of different shape, asexual stages with filamentous projections in most portions of its range, and larger gametocytes, as well as apparent sympatry with P. minasense carinii in some areas.

Isolates of Sarcocystis falcatula-like organisms from South American opossums Didelphis marsupialis and Didelphis albiventris from São Paulo, Brazil.

PubMed

Dubey, J P; Lindsay, D S; Rosenthal, B M; Kerber, C E; Kasai, N; Pena, H F; Kwok, O C; Shen, S K; Gennari, S M

2001-12-01

Isolates of Sarcocystis falcatula-like organisms from South American opossums were characterized based on biological and morphological criteria. Sporocysts from intestinal scrapings of 1 Didelphis marsupialis and 8 Didelphis albiventris from São Paulo, Brazil, were fed to captive budgerigars (Melopsittacus undulatus). Budgerigars fed sporocysts from all 9 isolates became ill and S. falcatula-like schizonts were identified in sections of their lungs by immunohistochemical staining. Sarcocystis falcatula-like organisms were cultured from lungs of budgerigars fed sporocysts from D. marsupialis and from lungs of budgerigars fed sporocysts from 3 of 8 D. albiventris. The 33/54 locus amplified by polymerase chain reaction from culture-derived merozoites contained both a HinfI endonuclease recognition site previously suggested to diagnose S. falcatula and a DraI site thought to diagnosed S. neurona. Development of the isolate from D. marsupialis was studied in cell culture; its schizonts divided by endopolygeny, leaving a residual body. Morphological and genetic variation differentiated this Sarcocystis isolate originating in D. marsupialis from the Cornell I isolate of S. falcatula. This is the first report of a S. falcatula infection in the South American opossum, D. marsupialis.

Sarcocystis neurona encephalitis in a dog.

PubMed

Cooley, A J; Barr, B; Rejmanek, D

2007-11-01

A 1.5-year-old male Feist dog was presented to a veterinarian for reluctance to stand on the hind legs. Treatment included dexamethasone and resulted in a favorable initial response, but posterior paresis returned and progressed to recumbency, hyperesthesia, and attempts to bite the owner. The dog was euthanized. The brain was negative for rabies by fluorescent antibody analysis. Multiple foci of encephalitis were found in the cerebrum and particularly in the cerebellum. Protozoa morphologically consistent with Sarcocystis sp. were identified at sites of intense inflammation and malacia. Additionally, multiple schizonts were identified in areas without inflammation. Immunohistochemistry using both polyclonal and monoclonal antibodies specific for Sarcocystis neurona was strongly positive. No reaction to polyclonal antisera for Toxoplasma gondii or Neospora caninum was found. Polymerase chain reaction confirmed that the protozoa were S. neurona. Additional aberrant hosts for S. neurona other than horses have been identified, but S. neurona encephalitis has not been documented previously in the dog.

Plasmodium falciparum full life cycle and Plasmodium ovale liver stages in humanized mice.

PubMed

Soulard, Valérie; Bosson-Vanga, Henriette; Lorthiois, Audrey; Roucher, Clémentine; Franetich, Jean-François; Zanghi, Gigliola; Bordessoulles, Mallaury; Tefit, Maurel; Thellier, Marc; Morosan, Serban; Le Naour, Gilles; Capron, Frédérique; Suemizu, Hiroshi; Snounou, Georges; Moreno-Sabater, Alicia; Mazier, Dominique

2015-07-24

Experimental studies of Plasmodium parasites that infect humans are restricted by their host specificity. Humanized mice offer a means to overcome this and further provide the opportunity to observe the parasites in vivo. Here we improve on previous protocols to achieve efficient double engraftment of TK-NOG mice by human primary hepatocytes and red blood cells. Thus, we obtain the complete hepatic development of P. falciparum, the transition to the erythrocytic stages, their subsequent multiplication, and the appearance of mature gametocytes over an extended period of observation. Furthermore, using sporozoites derived from two P. ovale-infected patients, we show that human hepatocytes engrafted in TK-NOG mice sustain maturation of the liver stages, and the presence of late-developing schizonts indicate the eventual activation of quiescent parasites. Thus, TK-NOG mice are highly suited for in vivo observations on the Plasmodium species of humans.

The Plasma Concentration of the B Cell Activating Factor Is Increased in Children With Acute Malaria

PubMed Central

Nduati, Eunice; Gwela, Agnes; Karanja, Henry; Mugyenyi, Cleopatra; Langhorne, Jean; Marsh, Kevin

2011-01-01

Malaria-specific antibody responses in children often appear to be short-lived but the mechanisms underlying this phenomenon are not well understood. In this study, we investigated the relationship between the B-cell activating factor (BAFF) and its receptors expressed on B cells with antibody responses during and after acute malaria in children. Our results demonstrate that BAFF plasma levels increased during acute malarial disease and reflected disease severity. The expression profiles for BAFF receptors on B cells agreed with rapid activation and differentiation of a proportion of B cells to plasma cells. However, BAFF receptor (BAFF-R) expression was reduced on all peripheral blood B cells during acute infection, but those children with the highest level of BAFF-R expression on B cells maintained schizont-specific immunoglobin G (IgG) over a period of 4 months, indicating that dysregulation of BAFF-R expression on B cells may contribute to short-lived antibody responses to malarial antigens in children. In summary, this study suggests a potential role for BAFF during malaria disease, both as a marker for disease severity and in shaping the differentiation pattern of antigen-specific B cells. PMID:21849293

Investigation of SnSPR1, a novel and abundant surface protein of Sarcocystis neurona merozoites.

PubMed

Zhang, Deqing; Howe, Daniel K

2008-04-15

An expressed sequence tag (EST) sequencing project has produced over 15,000 partial cDNA sequences from the equine pathogen Sarcocystis neurona. While many of the sequences are clear homologues of previously characterized genes, a significant number of the S. neurona ESTs do not exhibit similarity to anything in the extensive sequence databases that have been generated. In an effort to characterize parasite proteins that are novel to S. neurona, a seemingly unique gene was selected for further investigation based on its abundant representation in the collection of ESTs and the predicted presence of a signal peptide and glycolipid anchor addition on the encoded protein. The gene was expressed in E. coli, and monospecific polyclonal antiserum against the recombinant protein was produced by immunization of a rabbit. Characterization of the native protein in S. neurona merozoites and schizonts revealed that it is a low molecular weight surface protein that is expressed throughout intracellular development of the parasite. The protein was designated Surface Protein 1 (SPR1) to reflect its display on the outer surface of merozoites and to distinguish it from the ubiquitous SAG/SRS surface antigens of the heteroxenous Coccidia. Interestingly, infection assays in the presence of the polyclonal antiserum suggested that SnSPR1 plays some role in attachment and/or invasion of host cells by S. neurona merozoites. The work described herein represents a general template for selecting and characterizing the various unidentified gene sequences that are plentiful in the EST databases for S. neurona and other apicomplexans. Furthermore, this study illustrates the value of investigating these novel sequences since it can offer new candidates for diagnostic or vaccine development while also providing greater insight into the biology of these parasites.

Effect of sodium citrate based anticoagulants on the growth activity of malaria parasites.

PubMed

Liu, Zhong-xiang; Wang, Xian-feng; Li, Shu-mei; Li, Xun; Xue, Cai-fang; Miao, Jun

2004-12-01

To study the effect of anticoagulants based on sodium citrate on the growth activity of malaria parasites. The parasites were treated with 3 anticoagulants (ACD, CD and SC), respectively, and the parasitemia was determined to measure the effect of the anticoagulants on the growth of the parasites. Unsynchronized Plasmodium falciparum was treated with the anticoagulants at different concentrations for 3 h at 37 degrees C. Treated erythrocytes were mixed with normal parasites or treated parasites with normal erythrocytes, which was followed by parasitemia determination of the two cultures to determine the cell target of the anticoagulants. Stage-synchronized parasites (ring, trophozoite and schizont) were treated as above to investigate the stage target. P. berghei was also treated with anticoagulants and inoculated in mice to detect the effect of anticoagulants on the animal malaria parasite by counting the parasitemia. All 3 anticoagulants inhibited falciparum parasite growth and ACD had the strongest potency. The treatments of the erythrocyte and the parasite with anticoagulants respectively showed that the anticoagulants targeted the parasites rather than normal erythrocytes. Stage-synchronized parasite treatment suggested anticoagulants primarily inhibited schizonts. The effect of anticoagulants on P. berghei was similar to that on P. falciparum. ACD showed the most significant inhibitive effect on the growth of malaria parasites and SC was the best anticoagulant based on sodium citrate for malarial experiments.

Fatal cytauxzoonosis in captive-reared lions in Brazil.

PubMed

Peixoto, P V; Soares, C O; Scofield, A; Santiago, C D; França, T N; Barros, S S

2007-04-30

Fatal cytauxzoonosis is described in a captive reared lioness (Panthera leo) and its 6-month-old cub. Clinical signs in the lioness included loss of weight, depression, anaemia, loss of hair, dark discolored urine, tachypnoea, nystagmus, deaphness and staggering gait. The cub died after a short period of depression. In the lioness, laboratory examination revealed normochromic normocytic anaemia, neutrophilia, lymphopenia, monocytosis, eosinopenia, thrombocytopenia, proteinuria, pyuria, haematuria and increased. At necropsy the lioness showed marked pulmonary edema and slight gelatinous translucent edema in the mediastinum, petechiae and echymosis disseminated in the serosae, and the intestinal content was red and semiliquid. The cub presented hemothorax, endocardial and pulmonary edema, petechiae in the cardiac serosae, hepatic and splenic congestion and segments of the small intestine with blood stained fluid contents and reddish mesenteric lymph nodes. Histopathological examination of liver, spleen, heart, lungs, intestines, pancreas, mesenteric lymph nodes, kidneys, skeletal muscle, brain and skin revealed large number of intravascular macrophages with their cytoplasm filled with various schizogonic stages of a Theileriidae. Electron microscopy confirmed the presence of schizonts in endothelial-associated macrophages. The diagnosis was established by the finding of the pathognomonic schizonts in macrophages within blood vessels in several organs and tissues from both lions. This is the first report of feline cytauxzoonosis in P. leo and of a confirmed infection by Cytauxzoon felis in felidae in South America.

Malaria Parasite-Infected Erythrocytes Secrete PfCK1, the Plasmodium Homologue of the Pleiotropic Protein Kinase Casein Kinase 1

PubMed Central

Dorin-Semblat, Dominique; Demarta-Gatsi, Claudia; Hamelin, Romain; Armand, Florence; Carvalho, Teresa Gil; Moniatte, Marc; Doerig, Christian

2015-01-01

Casein kinase 1 (CK1) is a pleiotropic protein kinase implicated in several fundamental processes of eukaryotic cell biology. Plasmodium falciparum encodes a single CK1 isoform, PfCK1, that is expressed at all stages of the parasite’s life cycle. We have previously shown that the pfck1 gene cannot be disrupted, but that the locus can be modified if no loss-of-function is incurred, suggesting an important role for this kinase in intra-erythrocytic asexual proliferation. Here, we report on the use of parasite lines expressing GFP- or His-tagged PfCK1 from the endogenous locus to investigate (i) the dynamics of PfCK1 localisation during the asexual cycle in red blood cells, and (ii) potential interactors of PfCK1, so as to gain insight into the involvement of the enzyme in specific cellular processes. Immunofluorescence analysis reveals a dynamic localisation of PfCK1, with evidence for a pool of the enzyme being directed to the membrane of the host erythrocyte in the early stages of infection, followed by a predominantly intra-parasite localisation in trophozoites and schizonts and association with micronemes in merozoites. Furthermore, we present strong evidence that a pool of enzymatically active PfCK1 is secreted into the culture supernatant, demonstrating that PfCK1 is an ectokinase. Our interactome experiments and ensuing kinase assays using recombinant PfCK1 to phosphorylate putative interactors in vitro suggest an involvement of PfCK1 in many cellular processes such as mRNA splicing, protein trafficking, ribosomal, and host cell invasion. PMID:26629826

Anti-Plasmodial Activity of Aroylhydrazone and Thiosemicarbazone Iron Chelators: Effect on Erythrocyte Membrane Integrity, Parasite Development and the Intracellular Labile Iron Pool

PubMed Central

Walcourt, Asikiya; Kurantsin-Mills, Joseph; Kwagyan, John; Adenuga, Babafemi B.; Kalinowski, Danuta S.; Lovejoy, David B.; Lane, Darius J. R.; Richardson, Des R.

2013-01-01

Iron chelators inhibit the growth of the malaria parasite, Plasmodium falciparum, in culture and in animal and human studies. We previously reported the anti-plasmodial activity of the chelators, 2-hydroxy-1-naphthylaldehyde isonicotinoyl hydrazone (311), 2-hydroxy-1-naphthylaldehyde 4-methyl-3-thiosemicarbazone (N4mT), and 2-hydroxy-1-naphthylaldehyde 4-phenyl-3-thiosemicarbazone (N4pT). In fact, these ligands showed greater growth inhibition of chloroquine-sensitive (3D7) and chloroquine-resistant (7G8) strains of P. falciparum in culture compared to desferrioxamine (DFO). The present study examined the effects of 311, N4mT and N4pT on erythrocyte membrane integrity and asexual parasite development. While the characteristic biconcave disk shape of the erythrocytes was unaffected, the chelators caused very slight hemolysis at IC50 values that inhibited parasite growth. The chelators 311, N4mT and N4pT affected all stages of the intra-erythrocytic development cycle (IDC) of P. falciparum in culture. However, while these ligands primarily affected the ring-stage, DFO inhibited primarily trophozoite and schizont-stages. Ring, trophozoite and schizont-stages of the IDC were inhibited by significantly lower concentrations of 311, N4mT, and N4pT (IC50 = 4.45 ± 1.70, 10.30 ± 4.40, and 3.64 ± 2.00 μM, respectively) than DFO (IC50 = 23.43 ± 3.40 μM). Complexation of 311, N4mT and N4pT with iron reduced their anti-plasmodial activity. Estimation of the intracellular labile iron pool (LIP) in erythrocytes showed that the chelation efficacy of 311, N4mT and N4pT corresponded to their anti-plasmodial activity, suggesting that the LIP may be a potential source of non-heme iron for parasite metabolism within the erythrocyte. This study has implications for malaria chemotherapy that specifically disrupts parasite iron utilization. PMID:24028863

Study of the in vitro antiplasmodial, antileishmanial and antitrypanosomal activities of medicinal plants from Saudi Arabia.

PubMed

Al-Musayeib, Nawal M; Mothana, Ramzi A; Al-Massarani, Shaza; Matheeussen, An; Cos, Paul; Maes, Louis

2012-09-25

The present study investigated the in vitro antiprotozoal activity of sixteen selected medicinal plants. Plant materials were extracted with methanol and screened in vitro against erythrocytic schizonts of Plasmodium falciparum, intracellular amastigotes of Leishmania infantum and Trypanosoma cruzi and free trypomastigotes of T. brucei. Cytotoxic activity was determined against MRC-5 cells to assess selectivity. The criterion for activity was an IC₅₀ < 10 μg/mL (<5 μg/mL for T. brucei) and a selectivity index of ≥4. Antiplasmodial activity was found in the extracts of Prosopis juliflora and Punica granatum. Antileishmanial activity against L. infantum was demonstrated in Caralluma sinaica and Periploca aphylla. Amastigotes of T. cruzi were affected by the methanol extract of Albizia lebbeck pericarp, Caralluma sinaica, Periploca aphylla and Prosopius juliflora. Activity against T. brucei was obtained in Prosopis juliflora. Cytotoxicity (MRC-5 IC₅₀ < 10 μg/mL) and hence non-specific activities were observed for Conocarpus lancifolius.

Immunization with apical membrane antigen 1 confers sterile infection-blocking immunity against Plasmodium sporozoite challenge in a rodent model.

PubMed

Schussek, Sophie; Trieu, Angela; Apte, Simon H; Sidney, John; Sette, Alessandro; Doolan, Denise L

2013-10-01

Apical membrane antigen 1 (AMA-1) is a leading blood-stage malaria vaccine candidate. Consistent with a key role in erythrocytic invasion, AMA-1-specific antibodies have been implicated in AMA-1-induced protective immunity. AMA-1 is also expressed in sporozoites and in mature liver schizonts where it may be a target of protective cell-mediated immunity. Here, we demonstrate for the first time that immunization with AMA-1 can induce sterile infection-blocking immunity against Plasmodium sporozoite challenge in 80% of immunized mice. Significantly higher levels of gamma interferon (IFN-γ)/interleukin-2 (IL-2)/tumor necrosis factor (TNF) multifunctional T cells were noted in immunized mice than in control mice. We also report the first identification of minimal CD8(+) and CD4(+) T cell epitopes on Plasmodium yoelii AMA-1. These data establish AMA-1 as a target of both preerythrocytic- and erythrocytic-stage protective immune responses and validate vaccine approaches designed to induce both cellular and humoral immunity.

Theileria orientalis: a review.

PubMed

Watts, J G; Playford, M C; Hickey, K L

2016-01-01

Theileria orientalis (also known historically as T. sergenti and T. buffeli) is responsible for benign or non-transforming theileriosis, and exerts its major effect through erythrocyte destruction. The life cycle of T. orientalis is essentially similar to that of other Theileria species, except that the schizonts do not induce transformation and fatal lymphoproliferation. The pathogenesis of anaemia as a result of infection is not clearly established and may be multifaceted. Clinical signs of weakness, reluctance to walk and abortion are early but non-specific indications of disease, particularly if accompanied by a history of cattle being moved. Physical examination may reveal pallor (pale eyes, vaginal mucosa), pyrexia, and elevated heart and respiratory rates. T. orientalis is an economically important parasite of cattle in New Zealand, Australia and Japan, especially where naïve animals are introduced into an endemic area or in animals under stress. Increased awareness of the risks posed by the parasite is required to enable management practices to be implemented to minimise its impact.

Identification of candidate vaccine antigens of bovine hemoparasites Theileria parva and Babesia bovis by use of helper T cell clones.

PubMed

Brown, W C; Zhao, S; Logan, K S; Grab, D J; Rice-Ficht, A C

1995-03-01

Current vaccines for bovine hemoparasites utilize live attenuated organisms or virulent organisms administered concurrently with antiparasitic drugs. Although such vaccines can be effective, for most hemoparasites the mechanisms of acquired resistance to challenge infection with heterologous parasite isolates have not been clearly defined. Selection of potentially protective antigens has traditionally made use of antibodies to identify immunodominant proteins. However, numerous studies have indicated that induction of high antibody titers neither predicts the ability of an antigen to confer protective immunity nor correlates with protection. Because successful parasites have evolved antibody evasion tactics, alternative strategies to identify protective immunogens should be used. Through the elaboration of cytokines, T helper 1-(Th1)-like T cells and macrophages mediate protective immunity against many intracellular parasites, and therefore most likely play an important role in protective immunity against bovine hemoparasites. CD4+ T cell clones specific for soluble or membrane antigens of either Theileria parva schizonts or Babesia bovis merozoites were therefore employed to identify parasite antigens that elicit strong Th cell responses in vitro. Soluble cytosolic parasite antigen was fractionated by gel filtration, anion exchange chromatography or hydroxylapatite chromatography, or a combination thereof, and fractions were tested for the ability to induce proliferation of Th cell clones. This procedure enabled the identification of stimulatory fractions containing T. parva proteins of approximately 10 and 24 kDa. Antisera raised against the purified 24 kDa band reacted with a native schizont protein of approximately 30 kDa. Babesia bovis-specific Th cell clones tested against fractionated soluble Babesia bovis merozoite antigen revealed the presence of at least five distinct antigenic epitopes. Proteins separated by gel filtration revealed four patterns of reactivity, and proteins separated by anion exchange revealed two patterns of reactivity when selected T cell clones were assayed for stimulation by antigenic fractions. Studies using a continuous-flow electrophoresis apparatus have indicated the feasibility of identifying T cell-stimulatory proteins from parasite membranes as well as from the cytosolic fraction of B. bovis merozoites. The Th cell clones reactive with these different hemoparasites expressed either unrestricted or Th1 cytokine profiles, and were generally characterized by the production of high levels of IFN-gamma. A comprehensive study of T cell and macrophage responses to defined parasite antigens will help elucidate the reasons for vaccine failure or success, and provide clues to the mechanisms of acquired immunity that are needed for vaccine development.

TpUB05, a Homologue of the Immunodominant Plasmodium falciparum Protein UB05, Is a Marker of Protective Immune Responses in Cattle Experimentally Vaccinated against East Coast Fever

PubMed Central

Dinga, Jerome Nyhalah; Wamalwa, Mark; Njimoh, Dieudonné Lemuh; Njahira, Moses N.; Djikeng, Appolinaire; Skilton, Rob; Titanji, Vincent Pryde Kehdingha; Pellé, Roger

2015-01-01

Introduction East Coast fever, a devastating disease of cattle, can be controlled partially by vaccination with live T. parva sporozoites. The antigens responsible for conferring immunity are not fully characterized. Recently it was shown that the P. falciparum immunodominant protein UB05 is highly conserved in T. parva, the causative agent of East Coast fever. The aim of the present investigation was to determine the role of the homologue TpUB05 in protective immunity to East Coast fever. Methods The cloning, sequencing and expression of TpUB05 were done according to standard protocols. Bioinformatics analysis of TpUB05 gene was carried out using algorithms found in the public domain. Polyclonal antiserum against recombinant TpUB05 were raised in rabbits and used for further analysis by Western blotting, ELISA, immunolocalization and in vitro infection neutralization assay. The ability of recombinant TpUB05 (r-TpUB05) to stimulate bovine PBMCs ex-vivo to produce IFN-γ or to proliferate was tested using ELISpot and [3H]-thymidine incorporation assays, respectively. Results All the 20 cattle immunised by the infection and treatment method (ITM) developed significantly higher levels of TpUB05 specific antibodies (p<0.0001) compared to the non-vaccinated ones. Similarly, r-TpUB05 highly stimulated bovine PMBCs from 8/12 (67%) of ITM-immunized cattle tested to produce IFN-γ and proliferate (p< 0.029) as compared to the 04 naїve cattle included as controls. Polyclonal TpUB05 antiserum raised against r-TpUB05 also marginally inhibited infection (p < 0.046) of bovine PBMCs by T. parva sporozoites. In further experiments RT-PCR showed that the TpUB05 gene is expressed by the parasite. This was confirmed by immunolocalization studies which revealed TpUB05 expression by schizonts and piroplasms. Bioinformatics analysis also revealed that this antigen possesses two transmembrane domains, a N-glycosylation site and several O-glycosylation sites. Conclusion It was concluded that TpUB05 is a potential marker of protective immunity in ECF worth investigating further. PMID:26053064

TpUB05, a Homologue of the Immunodominant Plasmodium falciparum Protein UB05, Is a Marker of Protective Immune Responses in Cattle Experimentally Vaccinated against East Coast Fever.

PubMed

Dinga, Jerome Nyhalah; Wamalwa, Mark; Njimoh, Dieudonné Lemuh; Njahira, Moses N; Djikeng, Appolinaire; Skilton, Rob; Titanji, Vincent Pryde Kehdingha; Pellé, Roger

2015-01-01

East Coast fever, a devastating disease of cattle, can be controlled partially by vaccination with live T. parva sporozoites. The antigens responsible for conferring immunity are not fully characterized. Recently it was shown that the P. falciparum immunodominant protein UB05 is highly conserved in T. parva, the causative agent of East Coast fever. The aim of the present investigation was to determine the role of the homologue TpUB05 in protective immunity to East Coast fever. The cloning, sequencing and expression of TpUB05 were done according to standard protocols. Bioinformatics analysis of TpUB05 gene was carried out using algorithms found in the public domain. Polyclonal antiserum against recombinant TpUB05 were raised in rabbits and used for further analysis by Western blotting, ELISA, immunolocalization and in vitro infection neutralization assay. The ability of recombinant TpUB05 (r-TpUB05) to stimulate bovine PBMCs ex-vivo to produce IFN-γ or to proliferate was tested using ELISpot and [3H]-thymidine incorporation assays, respectively. All the 20 cattle immunised by the infection and treatment method (ITM) developed significantly higher levels of TpUB05 specific antibodies (p<0.0001) compared to the non-vaccinated ones. Similarly, r-TpUB05 highly stimulated bovine PMBCs from 8/12 (67%) of ITM-immunized cattle tested to produce IFN-γ and proliferate (p< 0.029) as compared to the 04 naїve cattle included as controls. Polyclonal TpUB05 antiserum raised against r-TpUB05 also marginally inhibited infection (p < 0.046) of bovine PBMCs by T. parva sporozoites. In further experiments RT-PCR showed that the TpUB05 gene is expressed by the parasite. This was confirmed by immunolocalization studies which revealed TpUB05 expression by schizonts and piroplasms. Bioinformatics analysis also revealed that this antigen possesses two transmembrane domains, a N-glycosylation site and several O-glycosylation sites. It was concluded that TpUB05 is a potential marker of protective immunity in ECF worth investigating further.

Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens

PubMed Central

2011-01-01

Background Eimeria parasites can cause the disease coccidiosis in poultry and even subclinical infection can incur economic loss. Diagnosis of infection predominantly relies on traditional techniques including lesion scoring and faecal microscopy despite the availability of sensitive molecular assays, largely due to cost and the requirement for specialist equipment. Despite longstanding proven efficacy these traditional techniques demand time and expertise, can be highly subjective and may under-diagnose subclinical disease. Recognition of the tight economic margins prevailing in modern poultry production and the impact of avian coccidiosis on poverty in many parts of the world has highlighted a requirement for a panel of straightforward and sensitive, but cost-effective, Eimeria species-specific diagnostic assays. Results Loop-mediated isothermal amplification (LAMP) is an uncomplicated, quick and relatively inexpensive diagnostic tool. In this study we have developed a panel of species-specific LAMP assays targeting the seven Eimeria species that infect the chicken. Each assay has been shown to be genuinely species-specific with the capacity to detect between one and ten eimerian genomes, equivalent to less than a single mature schizont. Development of a simple protocol for template DNA preparation from tissue collected post mortem with no requirement for specialist laboratory equipment supports the use of these assays in routine diagnosis of eimerian infection. Preliminary field testing supports this hypothesis. Conclusions Development of a panel of sensitive species-specific LAMP assays introduces a valuable new cost-effective tool for use in poultry husbandry. PMID:22053893

Ultrastructural qualitative and quantitative data on the sporogenesis of the protozoan Abelspora portucalensis (Microspora, Abelsporidae): a different approach to the study of microsporidia.

PubMed

Rocha, E; Monteiro, R A

1992-09-01

The sporogenesis of the microsporidium Abelspora portucalensis was studied with electron microscopy. In qualitative terms, new aspects of the cytoplasmic ultrastructure of the schizont, sporont, and sporoblast are described: the presence of microtubules, of aggregates of small opaque vesicles, and of dispersed larger vesicles with clear matrix. The hypothesis that the opaque vesicles may represent the Golgi apparatus and the clear vesicles may correspond to the smooth endoplasmic reticulum is discussed. The use of standard stereological and statistical techniques gives us a new perspective on the development of this microsporidium. The most relevant quantitative data display that the amount of rough endoplasmic reticulum (either in relative or absolute terms) presents significant differences among the three stages, with the sporont showing the highest values; that the absolute (but not the relative) volume of the large vesicles significantly changes during sporogenesis with the highest values presented by the sporont; that the surface-to-volume ratio of the schizont and sporont cells is similar and significantly greater than that of the sporoblast cell; that the surface density of the nucleus in relation to soma remains constant in the three stages (on the contrary, the surface-to-volume ratio of the nucleus increases and its volumetric density diminishes); and finally, that the nucleolus decreases its relative and absolute volumes. The functional significance of these results is analyzed and the application of similar methodology in quantifying the effects of drugs upon microsporidia is suggested.

Molecular diagnosis of Eimeria stiedae in hepatic tissue of experimentally infected rabbits.

PubMed

Hassan, Khaled M; Arafa, Waleed M; Mousa, Waheed M; Shokier, Khaled A M; Shany, Salama A; Aboelhadid, Shawky M

2016-10-01

The early detection of Eimeria stiedae in the hepatic tissue of experimentally infected rabbits was investigated using molecular assay. Forty 6-week-old male New Zealand rabbits were divided into two groups. Group A (30 animals) was infected with 2.5 × 10(4) sporulated oocysts of E. stiedae per animal on Day 0 and Group B (10 animals) was used as the uninfected controls. Three animals from Group A and one from Group B were sacrificed at 0, 3, 6, 9, 12, 15, 18, 21, 24 and 27 days post infection (PI). Gross and microscopic post-mortem findings were recorded. Polymerase chain reaction (PCR) of the E. stiedae internal transcribed spacer 1 genomic region was conducted on blood, liver tissue, and feces from the Group A experimentally infected animals. Macroscopically, the liver showed irregular yellowish white nodules pathognomonic to E. stiedae infection beginning on Day 15 PI. Hepatomegaly and ascites were obvious from Day 21-24 PI. The presence of different E. stiedae schizonts and gametocytes in the histopathological sections of the biliary epithelium were evident on Day 15 PI. The E. stiedae PCR was first positive in liver tissues on Day 12 and in fecal samples on Day 18 PI, but the blood samples were negative. In conclusion, the PCR can be used for early diagnosis and control of E. stiedae schizonts before shedding of the oocysts in feces. Copyright © 2016 Elsevier Inc. All rights reserved.

Phosphorylated and Nonphosphorylated PfMAP2 Are Localized in the Nucleus, Dependent on the Stage of Plasmodium falciparum Asexual Maturation

PubMed Central

Dahalan, Farah Aida; Sidek, Hasidah Mohd; Murtey, Mogana Das; Embi, Mohammed Noor; Ibrahim, Jamaiah; Fei Tieng, Lim; Zakaria, Nurul Aiezzah

2016-01-01

Plasmodium falciparum mitogen-activated protein (MAP) kinases, a family of enzymes central to signal transduction processes including inflammatory responses, are a promising target for antimalarial drug development. Our study shows for the first time that the P. falciparum specific MAP kinase 2 (PfMAP2) is colocalized in the nucleus of all of the asexual erythrocytic stages of P. falciparum and is particularly elevated in its phosphorylated form. It was also discovered that PfMAP2 is expressed in its highest quantity during the early trophozoite (ring form) stage and significantly reduced in the mature trophozoite and schizont stages. Although the phosphorylated form of the kinase is always more prevalent, its ratio relative to the nonphosphorylated form remained constant irrespective of the parasites' developmental stage. We have also shown that the TSH motif specifically renders PfMAP2 genetically divergent from the other plasmodial MAP kinase activation sites using Neighbour Joining analysis. Furthermore, TSH motif-specific designed antibody is crucial in determining the location of the expression of the PfMAP2 protein. However, by using immunoelectron microscopy, PPfMAP2 were detected ubiquitously in the parasitized erythrocytes. In summary, PfMAP2 may play a far more important role than previously thought and is a worthy candidate for research as an antimalarial. PMID:27525262

Assessment of the in vitro antiprotozoal and cytotoxic potential of 20 selected medicinal plants from the island of Soqotra.

PubMed

Mothana, Ramzi A; Al-Musayeib, Nawal M; Matheeussen, An; Cos, Paul; Maes, Louis

2012-12-03

Malaria, leishmaniasis and human African trypanosomiasis continue to be major public health problems in need of new and more effective drugs. The aim of this study was to evaluate in vitro antiprotozoal activity of twenty endemic medicinal plants collected from the island of Soqotra in the Indian Ocean. The plant materials were extracted with methanol and tested for antiplasmodial activity against erythrocytic schizonts of Plasmodium falciparum, for antileishmanial activity against intracellular amastigotes of Leishmania infantum and for antitrypanosomal activity against intracellular amastigotes of Trypanosoma cruzi and free trypomastigotes of T. brucei. To assess selectivity, cytotoxicity was determined against MRC-5 fibroblasts. Selective activity was obtained for Punica protopunica against Plasmodium (IC₅₀ 2.2 µg/mL) while Eureiandra balfourii and Hypoestes pubescens displayed activity against the three kinetoplastid parasites (IC₅₀ < 10 µg/mL). Acridocarpus socotranus showed activity against T. brucei and T. cruzi (IC₅₀ 3.5 and 8.4 µg/mL). Ballochia atrovirgata, Dendrosicycos socotrana, Dracaena cinnabari and Euphorbia socotrana displayed non-specific inhibition of the parasites related to high cytotoxicity.

Inhibition of Plasmodium falciparum proliferation in vitro by double-stranded RNA directed against malaria histone deacetylase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sriwilaijaroen, N.; Boonma, S.; Attasart, P.

Acetylation and deacetylation of histones play important roles in transcription regulation, cell cycle progression and development events. The steady state status of histone acetylation is controlled by a dynamic equilibrium between competing histone acetylase and deacetylase (HDAC). We have used long PfHDAC-1 double-stranded (ds)RNA to interfere with its cognate mRNA expression and determined the effect on malaria parasite growth and development. Chloroquine- and pyrimethamine-resistant Plasmodium falciparum K1 strain was exposed to 1-25 {mu}g of dsRNA/ml of culture for 48 h and growth was determined by [{sup 3}H]-hypoxanthine incorporation and microscopic examination. Parasite culture treated with 10 {mu}g/ml pfHDAC-1 dsRNA exhibitedmore » 47% growth inhibition when compared with either untreated control or culture treated with an unrelated dsRNA. PfHDAC-1 dsRNA specifically blocked maturation of trophozoite to schizont stages and decreased PfHDAC-1 transcript 44% in treated trophozoites. These results indicate the potential of HDAC-1 as a target for development of novel antimalarials.« less

In vitro antioxidant and antimalarial activities of leaves, pods and bark extracts of Acacia nilotica (L.) Del.

PubMed

Sadiq, Muhammad Bilal; Tharaphan, Pattamon; Chotivanich, Kesinee; Tarning, Joel; Anal, Anil Kumar

2017-07-18

The emergence of drug resistant malaria is threatening our ability to treat and control malaria in the Southeast Asian region. There is an urgent need to develop novel and chemically diverse antimalarial drugs. This study aimed at evaluating the antimalarial and antioxidant potentials of Acacia nilotica plant extracts. The antioxidant activities of leaves, pods and bark extracts were determined by standard antioxidant assays; reducing power capacity, % lipid peroxidation inhibition and ferric reducing antioxidant power assay. The antimalarial activities of plant extracts against Plasmodium falciparum parasites were determined by the 48 h schizont maturation inhibition assay. Further confirmation of schizonticide activity of extracts was made by extending the incubation period up to 96 h after removing the plant extract residues from parasites culture. Inhibition assays were analyzed by dose-response modelling. In all antioxidant assays, leaves of A. nilotica showed higher antioxidant activity than pods and bark. Antimalarial IC 50 values of leaves, pods and bark extracts were 1.29, 4.16 and 4.28 μg/ml respectively, in the 48 h maturation assay. The IC 50 values determined for leaves, pods and bark extracts were 3.72, 5.41 and 5.32 μg/ml respectively, after 96 h of incubation. All extracts inhibited the development of mature schizont, indicating schizonticide activity against P. falciparum. A. nilotica extracts showed promising antimalarial and antioxidant effects. However, further investigation is needed to isolate and identify the active components responsible for the antimalarial and antioxidant effects.

Decreased level of 2,3-diphosphoglycerate and alteration of structural integrity in erythrocytes infected with Plasmodium falciparum in vitro.

PubMed

Dubey, M L; Hegde, Ramakrishna; Ganguly, N K; Mahajan, R C

2003-04-01

2,3-Diphosphoglycerate (2,3-DPG), an intracellular metabolite of glycolytic pathway is known to affect the oxygen binding capacity of haemoglobin and mechanical properties of the red blood cells. 2,3-DPG levels have been reported to be elevated during anaemic conditions including visceral leishmaniasis. 2,3-DPG activity in P. falciparum infected red blood cells, particularly in cells infected with different stages of the parasite and its relationship with structural integrity of the cells is not known. Chloroquine sensitive and resistant strains of P. falciparum were cultured in vitro and synchronized cultures of ring, trophozoite and schizont stage rich cells along with the uninfected control erythrocytes were assayed for 2,3-DPG activity and osmotic fragility. It was observed that in both the strains, in infected erythrocytes the 2,3-DPG activity gradually decreased and osmotic fragility gradually increased as the parasite matured from ring to schizont stage. The decrease in 2,3-DPG may probably be due to increased pyruvate kinase activity of parasite origin, which has been shown in erythrocytes infected with several species of Plasmodium. The absence of compensatory increase in 2,3-DPG in P. falciparum infected erythrocytes may aggravate hypoxia due to anaemia in malaria and probably may contribute to hypoxia in cerebral malaria. As 2,3-DPG was not found to be increased in erythrocytes parasitized with P. falciparum, the increased osmotic fragility observed in these cells is not due to increased 2,3-DPG as has been suggested in visceral leishmaniasis.

Na+ Influx Induced by New Antimalarials Causes Rapid Alterations in the Cholesterol Content and Morphology of Plasmodium falciparum

PubMed Central

Das, Sudipta; Bhatanagar, Suyash; Morrisey, Joanne M.; Daly, Thomas M.; Burns, James M.; Coppens, Isabelle; Vaidya, Akhil B.

2016-01-01

Among the several new antimalarials discovered over the past decade are at least three clinical candidate drugs, each with a distinct chemical structure, that disrupt Na+ homeostasis resulting in a rapid increase in intracellular Na+ concentration ([Na+]i) within the erythrocytic stages of Plasmodium falciparum. At present, events triggered by Na+ influx that result in parasite demise are not well-understood. Here we report effects of two such drugs, a pyrazoleamide and a spiroindolone, on intraerythrocytic P. falciparum. Within minutes following the exposure to these drugs, the trophozoite stage parasite, which normally contains little cholesterol, was made permeant by cholesterol-dependent detergents, suggesting it acquired a substantial amount of the lipid. Consistently, the merozoite surface protein 1 and 2 (MSP1 and MSP2), glycosylphosphotidylinositol (GPI)-anchored proteins normally uniformly distributed in the parasite plasma membrane, coalesced into clusters. These alterations were not observed following drug treatment of P. falciparum parasites adapted to grow in a low [Na+] growth medium. Both cholesterol acquisition and MSP1 coalescence were reversible upon the removal of the drugs, implicating an active process of cholesterol exclusion from trophozoites that we hypothesize is inhibited by high [Na+]i. Electron microscopy of drug-treated trophozoites revealed substantial morphological changes normally seen at the later schizont stage including the appearance of partial inner membrane complexes, dense organelles that resemble “rhoptries” and apparent nuclear division. Together these results suggest that [Na+]i disruptor drugs by altering levels of cholesterol in the parasite, dysregulate trophozoite to schizont development and cause parasite demise. PMID:27227970

Experimental Theileria lestoquardi infection in sheep: Biochemical and hematological changes.

PubMed

Yaghfoori, Saeed; Mohri, Mehrdad; Razmi, Gholamreza

2017-09-01

Malignant theileriosis (Theileria lestoquardi infection) is a hemoparasitic tick-borne disease that affects both wild and domestic small ruminants. The aim of this study was to evaluate biochemical and hematological characteristics of sheep after being experimentally infected by T. lestoquardi. T. lestoquardi infection was induced in seven Baluchi sheep of six-to-eight months old via experimentally-infected Hyalomma anatolicum adult ticks. Biochemical and hematological parameters were measured twice a week during the three weeks' post infection. Twenty-three biochemical analytes and seven hematological ones were measured. After three to four days infection, body temperature rose above 40 ° C. Maximum and minimum parasitaemia were 3.3% and 0.28%, respectively. Piroplasms and schizont were seen on average from days 7.2 and 4 post infection, respectively. The concentrations and activities of Alb, HDL, ALT, T3, T4, Ca, Fe, Mg, iP, WBC, RBC, PCV, Hb, Plt, neutrophil and lymphocytes significantly decreased (P≤0.05) during experimental infection. However, concentrations and activities of BT, GGT, Glu, BUN, Crea, FIB and Cu significantly increased (P≤0.05). There was no significant change in the serum amounts of Chol, LDL, TG, VLDL and Zn. The observed hypoalbuminemia and increase of FIB concentrations referred to pro-inflammatory cytokines production. Moreover, the raising of GGT activity indicates liver damage, cholestatic disorders or schizont infiltration. The disease stress and corticosteroids are suspected to cause the Glu concentration increase. The present study is aimed at improving the knowledge of malignant theileriosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Expression of Plasmodium vivax crt-o Is Related to Parasite Stage but Not Ex Vivo Chloroquine Susceptibility.

PubMed

Pava, Zuleima; Handayuni, Irene; Wirjanata, Grennady; To, Sheren; Trianty, Leily; Noviyanti, Rintis; Poespoprodjo, Jeanne Rini; Auburn, Sarah; Price, Ric N; Marfurt, Jutta

2016-01-01

Chloroquine (CQ)-resistant Plasmodium vivax is present in most countries where P. vivax infection is endemic, but the underlying molecular mechanisms responsible remain unknown. Increased expression of P. vivax crt-o (pvcrt-o) has been correlated with in vivo CQ resistance in an area with low-grade resistance. We assessed pvcrt-o expression in isolates from Papua (Indonesia), where P. vivax is highly CQ resistant. Ex vivo drug susceptibilities to CQ, amodiaquine, piperaquine, mefloquine, and artesunate were determined using a modified schizont maturation assay. Expression levels of pvcrt-o were measured using a novel real-time quantitative reverse transcription-PCR method. Large variations in pvcrt-o expression were observed across the 51 isolates evaluated, with the fold change in expression level ranging from 0.01 to 59 relative to that seen with the P. vivax β-tubulin gene and from 0.01 to 24 relative to that seen with the P. vivax aldolase gene. Expression was significantly higher in isolates with the majority of parasites at the ring stage of development (median fold change, 1.7) compared to those at the trophozoite stage (median fold change, 0.5; P < 0.001). Twenty-nine isolates fulfilled the criteria for ex vivo drug susceptibility testing and showed high variability in CQ responses (median, 107.9 [range, 6.5 to 345.7] nM). After controlling for the parasite stage, we found that pvcrt-o expression levels did not correlate with the ex vivo response to CQ or with that to any of the other antimalarials tested. Our results highlight the importance of development-stage composition for measuring pvcrt-o expression and suggest that pvcrt-o transcription is not a primary determinant of ex vivo drug susceptibility. A comprehensive transcriptomic approach is warranted for an in-depth investigation of the role of gene expression levels and P. vivax drug resistance. Copyright © 2015 Pava et al.

Molecular and immunological characterisation of Theileria parva stocks which are components of the 'Muguga cocktail' used for vaccination against East Coast fever in cattle.

PubMed

Bishop, R; Geysen, D; Spooner, P; Skilton, R; Nene, V; Dolan, T; Morzaria, S

2001-01-20

The 'Muguga cocktail' which is composed of three Theileria parva stocks Muguga, Kiambu 5 and Serengeti-transformed has been used extensively for live vaccination against East Coast fever in cattle in eastern, central and southern Africa. Herein we describe the molecular characterisation of the T. parva vaccine stocks using three techniques, an indirect fluorescent antibody test with a panel of anti-schizont monoclonal antibodies (MAb), Southern blotting with four T. parva repetitive DNA probes and polymerase chain reaction (PCR)-based assays detecting polymorphism within four single copy loci encoding antigen genes. The Muguga and Serengeti-transformed stocks exhibited no obvious differences in their reactivity with the panel of MAbs, whereas Kiambu 5 differed with several MAbs. Kiambu 5 DNA was very distinct from the Muguga and Serengeti-transformed isolates in the hybridisation pattern with all four nucleic acid probes, whereas Muguga and Serengeti-transformed isolates exhibited minor differences and could not be discriminated with one of the probes. PCR amplification in combination with restriction fragment length polymorphism analysis indicated that Kiambu 5 was also markedly divergent from the Muguga and Serengeti-transformed stocks within two of the four antigen coding genes. The T. parva Serengeti-transformed stock did not contain a 130 base pair insert within the p67 sporozoite antigen gene, which has been observed previously in most T. parva parasites isolated from buffalo, and could not be discriminated from T. parva Muguga at any of the four single copy loci. Collectively the data indicate that two of the cocktail components T. parva Serengeti-transformed and Muguga are genetically closely related, while the third component Kiambu 5 is quite distinct. Based on the findings, there may be a need to include only one of the T. parva Muguga and Serengeti-transformed components in the immunising cocktail. The study demonstrates the value of molecular characterisation data for monitoring of live vaccines.

Computational synchronization of microarray data with application to Plasmodium falciparum.

PubMed

Zhao, Wei; Dauwels, Justin; Niles, Jacquin C; Cao, Jianshu

2012-06-21

Microarrays are widely used to investigate the blood stage of Plasmodium falciparum infection. Starting with synchronized cells, gene expression levels are continually measured over the 48-hour intra-erythrocytic cycle (IDC). However, the cell population gradually loses synchrony during the experiment. As a result, the microarray measurements are blurred. In this paper, we propose a generalized deconvolution approach to reconstruct the intrinsic expression pattern, and apply it to P. falciparum IDC microarray data. We develop a statistical model for the decay of synchrony among cells, and reconstruct the expression pattern through statistical inference. The proposed method can handle microarray measurements with noise and missing data. The original gene expression patterns become more apparent in the reconstructed profiles, making it easier to analyze and interpret the data. We hypothesize that reconstructed gene expression patterns represent better temporally resolved expression profiles that can be probabilistically modeled to match changes in expression level to IDC transitions. In particular, we identify transcriptionally regulated protein kinases putatively involved in regulating the P. falciparum IDC. By analyzing publicly available microarray data sets for the P. falciparum IDC, protein kinases are ranked in terms of their likelihood to be involved in regulating transitions between the ring, trophozoite and schizont developmental stages of the P. falciparum IDC. In our theoretical framework, a few protein kinases have high probability rankings, and could potentially be involved in regulating these developmental transitions. This study proposes a new methodology for extracting intrinsic expression patterns from microarray data. By applying this method to P. falciparum microarray data, several protein kinases are predicted to play a significant role in the P. falciparum IDC. Earlier experiments have indeed confirmed that several of these kinases are involved in this process. Overall, these results indicate that further functional analysis of these additional putative protein kinases may reveal new insights into how the P. falciparum IDC is regulated.

Sarcocystis meningoencephalitis in a northern gannet (Morus bassanus).

PubMed

Spalding, Marilyn G; Yowell, Charles A; Lindsay, David S; Greiner, Ellis C; Dame, John B

2002-04-01

Sarcocystis sp. schizonts were found in the cerebellum of a northern gannet (Morus bassanus), exhibiting neurologic signs, found on the Florida (USA) east coast. Based upon molecular characterization of DNA isolated from the brain of the gannet, this Sarcocystis sp. appeared to be closely related, if not identical, to an unnamed Sarcocystis sp. typified by isolates 1085 and 1086 collected from feces of a Virginia opossum (Didelphis virginiana) on the east coast of Florida. Because the life cycle of this parasite appears to be land based, urban waste discharge to marine/estuarine environments may be a source of infection for marine species.

Exposure, infection, systemic cytokine levels and antibody responses in young children concurrently exposed to schistosomiasis and malaria

PubMed Central

IMAI, NATSUKO; RUJENI, NADINE; NAUSCH, NORMAN; BOURKE, CLAIRE D.; APPLEBY, LAURA J.; COWAN, GRAEME; GWISAI, REGGIS; MIDZI, NICHOLAS; CAVANAGH, DAVID; MDULUZA, TAKAFIRA; TAYLOR, DAVID; MUTAPI, FRANCISCA

2011-01-01

SUMMARY Despite the overlapping distribution of Schistosoma haematobium and Plasmodium falciparum infections, few studies have investigated early immune responses to both parasites in young children resident in areas co-endemic for the parasites. This study measures infection levels of both parasites and relates them to exposure and immune responses in young children. Levels of IgM, IgE, IgG4 directed against schistosome cercariae, egg and adult worm and IgM, IgG directed against P. falciparum schizonts and the merozoite surface proteins 1 and 2 together with the cytokines IFN-γ, IL-4, IL-5, IL-10 and TNF-α were measured by ELISA in 95 Zimbabwean children aged 1–5 years. Schistosome infection prevalence was 14·7% and that of Plasmodium infection was 0% in the children. 43. 4% of the children showed immunological evidence of exposure to schistosome parasites and 13% showed immunological evidence of exposure to Plasmodium parasites. Schistosome–specific responses, indicative of exposure to parasite antigens, were positively associated with cercariae-specific IgE responses, while Plasmodium-specific responses, indicative of exposure to parasite antigens, were negatively associated with responses associated with protective immunity against Plasmodium. There was no significant association between schistosome-specific and Plasmodium-specific responses. Systemic cytokine levels rose with age as well as with schistosome infection and exposure. Overall the results show that (1) significantly more children are exposed to schistosome and Plasmodium infection than those currently infected and; (2) the development of protective acquired immunity commences in early childhood, although its effects on infection levels and pathology may take many years to become apparent. PMID:21813042

Characterization of the antigen SO7 during development of Eimeria tenella.

PubMed

Fetterer, R H; Jenkins, M C; Miska, K B; Barfield, R C

2007-10-01

The developmental expression of the antigen SO7, which has been previously shown to protect chickens against infection by several Eimeria species, was investigated. Using RT-PCR, mRNA for SO7 was found to be restricted primarily to unsporulated oocysts (0 hr). Western blot (WB) analysis with an antibody to recombinant SO7 (rbSO7) revealed expression of the protein from 6 to 72 hr (fully sporulated) of sporulation and in sporozoites (SZ). SO7 was absent in host-derived second-stage merozoites (MZ) and was present in culture-derived first-stage MZ but at a level of only 25% of that exhibited by SZ. During invasion of Madin-Darby bovine kidney (MDBK) cells by SZ in vitro, the level of SO7 within cells, as determined by WB analysis, remained relatively constant until 48 hr of development and then decreased by about 40% at the next time point (72 hr). The SO7 secreted into the culture media during in vitro development increased to a relative maximum at 48 hr and then decreased to about 20% of maximum at 72 hr. Immunostaining with anti-rbSO7 indicates that SO7 is highly concentrated in both refractile bodies (RB) of SZ, with some limited distribution in the apical complex. Anti-rbSO7 intensively stained the intracellular parasites and the first-stage schizonts during in vitro development of E. tenella in MDBK cells. Upon release from the schizonts, the first-stage merozoites stained with 1 or 2 bright spots typically at each end. The results suggest that SO7 is closely associated with the SZ RB and is developmentally regulated but may not play a direct role in cellular invasion.

Target evaluation of deoxyhypusine synthase from Theileria parva the neglected animal parasite and its relationship to Plasmodium.

PubMed

Njuguna, James T; von Koschitzky, Imke; Gerhardt, Heike; Lämmerhofer, Michael; Choucry, Ali; Pink, Mario; Schmitz-Spahnke, Simone; Bakheit, Mohammed A; Strube, Christina; Kaiser, Annette

2014-08-01

East Coast fever (ECF) is a tick-borne disease caused by the parasite Theileria parva which infects cattle. In Sub-Saharan Africa it leads to enormous economic costs. After a bite of a tick, sporozoites invade the host lymphocytes and develop into schizonts. At this stage the parasite transforms host lymphocytes resulting in the clonal expansion of infected lymphocytes. Animals develop a lymphoma like disorder after infection which is rapidly fatal. Hitherto, a few drugs of the quinone type can cure the disease. However, therapy can only be successful after early diagnosis. The genera Theileria and Plasmodium, which includes the causative agent of human malaria, are closely related apicomplexan parasites. Enzymes of the hypusine pathway, a posttranslational modification in eukaryotic initiation factor EIF-5A, have shown to be druggable targets in Plasmodium. We identified the first enzyme of the hypusine pathway from T. parva, the deoxyhypusine synthase (DHS), which is located on chromosome 2 of the Muguga strain. Transcription is significantly increased in schizonts. The expressed T. parva DHS reveals an open reading frame (ORF) of 370 amino acids after expression in Escherichia coli Rosetta cells with a molecular size of 41.26 kDa and a theoretical pI of 5.26. Screening of the Malaria Box which consists of 400 active compounds resulted in a novel heterocyclic compound with a guanyl spacer which reduced the activity of T. parva DHS to 45%. In sum, the guanyl residue seems to be an important lead structure for inhibition of Theileria DHS. Currently, more different guanyl analogues from the Malaria Box are tested in inhibitor experiments to determine their efficacy. Copyright © 2014 Elsevier Ltd. All rights reserved.

A cyanobacterial serine protease of Plasmodium falciparum is targeted to the apicoplast and plays an important role in its growth and development.

PubMed

Rathore, Sumit; Sinha, Dipto; Asad, Mohd; Böttcher, Thomas; Afrin, Farhat; Chauhan, Virander S; Gupta, Dinesh; Sieber, Stephan A; Mohmmed, Asif

2010-08-01

The prokaryotic ATP-dependent protease machineries such as ClpQY and ClpAP in the malaria parasite may represent potential drug targets. In the present study, we show that the orthologue of cyanobacterial ClpP protease in Plasmodium falciparum (PfClpP) is expressed in the asexual blood stages and possesses serine protease activity. The PfClpP was localized in the apicoplast using a GFP-targeting approach, immunoelectron microscopy and by immunofluorescence assays. A set of cell permeable β-lactones, which specifically bind with the active site of prokaryotic ClpP, were screened using an in vitro protease assay of PfClpP. A PfClpP-specific protease inhibitor was identified in the screen, labelled as U1-lactone. In vitro growth of the asexual stage parasites was significantly inhibited by U1-lactone treatment. The U1-treated parasites showed developmental arrest at the late-schizont stage. We further show that the U1-lactone treatment resulted in formation of abnormal apicoplasts which were not able to grow and segregate in the parasite progeny; these effects were also evident by blockage in the replication of the apicoplast genome. Overall, our data show that the PfClpP protease has confirmed localization in the apicoplast and it plays important role in development of functional apicoplasts. © 2010 Blackwell Publishing Ltd.

First Molecular Characterization of Theileria ornithorhynchi Mackerras, 1959: yet Another Challenge to the Systematics of the Piroplasms.

PubMed

Paparini, Andrea; Macgregor, James; Ryan, Una M; Irwin, Peter J

2015-12-01

Piroplasms, tick-transmitted Apicomplexa of the genera Theileria, Babesia and Cytauxzoon, are blood-borne parasites of clinical and veterinary importance. The order Piroplasmida shows a puzzling systematics characterized by multiple clades, soft polytomies and paraphyletic/polyphyletic genera. In the present study, screening of platypuses (Ornithorhynchus anatinus), was performed to infer the parasite molecular phylogeny. DNA was extracted from blood, ectoparasites and tick eggs and the 18S rRNA- hsp70-genes were used for the phylogenetic reconstructions. Microscopic analyses detected pleomorphic intra-erythrocytic organisms and tetrads consistent with previous descriptions of Theileria ornithorhynchi Mackerras, 1959, but observation of possible schizonts could not be confirmed. DNA sequences obtained from blood and ticks allowed resolving the systematics of the first piroplasm infecting a monotreme host. Molecularly, T. ornithorhynchi formed a novel monophyletic group, basal to most known piroplasms' clades. The ancestral position of this clade, isolated from an ancient lineage of mammalian host appears particularly fascinating. The present paper discusses the inadequacies of the current molecular systematics for the Piroplasmida and the consequences of incomplete sampling, morphology-based classification and ambiguous microscopic identifications. Likely when the current sampling bias is rectified and more sequence data is made available, the phylogenetic position of T. ornithorhynchi will be further contextualized without ambiguity. Copyright © 2015 Elsevier GmbH. All rights reserved.

Primaquine in vivax malaria: an update and review on management issues

PubMed Central

2011-01-01

Primaquine was officially licensed as an anti-malarial drug by the FDA in 1952. It has remained the only FDA licensed drug capable of clearing the intra-hepatic schizonts and hypnozoites of Plasmodium vivax. This update and review focuses on five major aspects of primaquine use in treatment of vivax malaria, namely: a) evidence of efficacy of primaquine for its current indications; b) potential hazards of its widespread use, c) critical analysis of reported resistance against primaquine containing regimens; d) evidence for combining primaquine with artemisinins in areas of chloroquine resistance; and e) the potential for replacement of primaquine with newer drugs. PMID:22152065

Primaquine in vivax malaria: an update and review on management issues.

PubMed

Fernando, Deepika; Rodrigo, Chaturaka; Rajapakse, Senaka

2011-12-12

Primaquine was officially licensed as an anti-malarial drug by the FDA in 1952. It has remained the only FDA licensed drug capable of clearing the intra-hepatic schizonts and hypnozoites of Plasmodium vivax. This update and review focuses on five major aspects of primaquine use in treatment of vivax malaria, namely: a) evidence of efficacy of primaquine for its current indications; b) potential hazards of its widespread use, c) critical analysis of reported resistance against primaquine containing regimens; d) evidence for combining primaquine with artemisinins in areas of chloroquine resistance; and e) the potential for replacement of primaquine with newer drugs.

Theileria parva: effects of irradiation on a culture of parasitized bovine lymphoid cells. [Gamma radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Irvin, A.D.; Brown, C.G.D.; Stagg, D.A.

1975-01-01

Aliquots of a culture of Theileria parva-infected bovine lymphoid cells were irradiated at 0, 300, 600, 900, and 1200 rads. The short-term effects of irradiation were evaluated on examination of Giemsa-stained smears and on autoradiography of cells labeled with (/sup 3/H)thymidine. Irradiation inhibited cell division but parasite division did not appear to be inhibited and macroschizont nuclear particles increased in number, frequently to several hundred per schizont. There was no evidence of an increased percentage switch from macro- to microschizont. Apparently viable cells were still present in all cultures 4 days after irradiation.

The heat shock protein 90 of Plasmodium falciparum and antimalarial activity of its inhibitor, geldanamycin

PubMed Central

Kumar, Rajinder; Musiyenko, Alla; Barik, Sailen

2003-01-01

Background The naturally occurring benzoquinone ansamycin compound, geldanamycin (GA), is a specific inhibitor of heat shock protein 90 (Hsp90) and is a potential anticancer agent. Since Plasmodium falciparum has been reported to have an Hsp90 ortholog, we tested the possibility that GA might inhibit it and thereby display antiparasitic activity. Results We provide direct recombinant DNA evidence for the Hsp90 protein of Plasmodium falciparum, the causative agent of fatal malaria. While the mRNA of Hsp90 was mainly expressed in ring and trophozoite stages, the protein was found in all stages, although schizonts contained relatively lower amounts. In vitro the parasitic Hsp90 exhibited an ATP-binding activity that could be specifically inhibited by GA. Plasmodium growth in human erythrocyte culture was strongly inhibited by GA with an IC50 of 20 nM, compared to the IC50 of 15 nM for chloroquine (CQ) under identical conditions. When used in combination, the two drugs acted synergistically. GA was equally effective against CQ-sensitive and CQ-resistant strains (3D7 and W2, respectively) and on all erythrocytic stages of the parasite. Conclusions Together, these results suggest that an active and essential Hsp90 chaperone cycle exists in Plasmodium and that the ansamycin antibiotics will be an important tool to dissect its role in the parasite. Additionally, the favorable pharmacology of GA, reported in human trials, makes it a promising antimalarial drug. PMID:14514358

The heat shock protein 90 of Plasmodium falciparum and antimalarial activity of its inhibitor, geldanamycin.

PubMed

Kumar, Rajinder; Musiyenko, Alla; Barik, Sailen

2003-09-15

The naturally occurring benzoquinone ansamycin compound, geldanamycin (GA), is a specific inhibitor of heat shock protein 90 (Hsp90) and is a potential anticancer agent. Since Plasmodium falciparum has been reported to have an Hsp90 ortholog, we tested the possibility that GA might inhibit it and thereby display antiparasitic activity. We provide direct recombinant DNA evidence for the Hsp90 protein of Plasmodium falciparum, the causative agent of fatal malaria. While the mRNA of Hsp90 was mainly expressed in ring and trophozoite stages, the protein was found in all stages, although schizonts contained relatively lower amounts. In vitro the parasitic Hsp90 exhibited an ATP-binding activity that could be specifically inhibited by GA. Plasmodium growth in human erythrocyte culture was strongly inhibited by GA with an IC50 of 20 nM, compared to the IC50 of 15 nM for chloroquine (CQ) under identical conditions. When used in combination, the two drugs acted synergistically. GA was equally effective against CQ-sensitive and CQ-resistant strains (3D7 and W2, respectively) and on all erythrocytic stages of the parasite. Together, these results suggest that an active and essential Hsp90 chaperone cycle exists in Plasmodium and that the ansamycin antibiotics will be an important tool to dissect its role in the parasite. Additionally, the favorable pharmacology of GA, reported in human trials, makes it a promising antimalarial drug.

Fudecalone, a new anticoccidial agent produced by Penicillium sp. FO-2030.

PubMed

Tabata, N; Tomoda, H; Masuma, R; Iwai, Y; Omura, S

1995-01-01

Penicillium sp. FO-2030, a soil isolate, was found to produce a new anticoccidial compound. The active compound, designated fudecalone, was isolated from the fermentation broth of the producing strain by solvent extraction, silica gel column chromatography and preparative HPLC. The structure of fudecalone was elucidated to be 3,3a,6,6a,7,8,9,10-octahydro-1-hydroxy-4,7,7-trimethyl-1H-naphtho[1,8a- c]furan-6-one mainly by spectroscopic studies including various NMR measurements. The anticoccidial activity using cell systems indicated that schizont formation of monensin-resistant Eimeria tenella was completely inhibited by fudecalone at concentrations more than 16 microM.

Sarcocystis falcatula-associated encephalitis in a free-ranging great horned owl (Bubo virginianus).

PubMed

Wünschmann, Arno; Rejmanek, Daniel; Cruz-Martinez, Luis; Barr, Bradd C

2009-03-01

A great horned owl (Bubo virginianus) was admitted to a rehabilitation clinic with severe neurologic signs that were unresponsive to supportive care. The animal was euthanatized because of a poor prognosis. Marked granulomatous encephalitis with focal brainstem malacia was detected microscopically. The brainstem was the most severely affected brain location and the only place in which schizonts and merozoites, morphologically compatible with Sarcocystis spp., were detected. Immunohistochemistry with the use of polyclonal antisera indicated the presence of Sarcocystis falcatula. The species identification of the protozoa as S. falcatula was confirmed by polymerase chain reaction. To the author's knowledge, this is the first report of spontaneous S. falcatula-associated encephalitis in a great horned owl.

Evaluation of the ex vivo antimalarial activity of organotin (IV) ethylphenyldithiocarbamate on erythrocytes infected with Plasmodium berghei NK 65.

PubMed

Awang, Normah; Jumat, Hafizah; Ishak, Shafariatul Akmar; Kamaludin, Nurul Farahana

2014-06-01

Malaria is the most destructive and dangerous parasitic disease. The commonness of this disease is getting worse mainly due to the increasing resistance of Plasmodium falciparum against antimalarial drugs. Therefore, the search for new antimalarial drug is urgently needed. This study was carried out to evaluate the effects of dibutyltin (IV) ethylphenyldithiocarbamate (DBEP), diphenyltin (IV) ethylphenyldithiocarbamate (DPEP) and triphenyltin (IV) ethylphenyldithiocarbamate (TPEP) compounds as antimalarial agents. These compounds were evaluated against erythrocytes infected with Plasmodium berghei NK65 via ex vivo. Organotin (IV) ethylphenyldithiocarbamate, [R(n)Sn(C9H10NS2)(4-n)] with R = C4H9 and C6H5 for n = 2; R = C6H5 for n = 3 is chemically synthesised for its potential activities. pLDH assay was employed for determination of the concentration that inhibited 50% of the Plasmodium's activity (IC50) after 24 h treatment at concentration range of 10-0.0000001 mg mL(-1). Plasmodium berghei NK65 was cultured in vitro to determine the different morphology of trophozoite and schizont. Only DPEP and TPEP compounds have antimalarial activity towards P. berghei NK65 at IC50 0.094±0.011 and 0.892±0.088 mg mL(-1), respectively. The IC50 of DPEP and TPEP were lowest at 30% parasitemia with IC50 0.001±0.00009 and 0.0009±0.0001 mg mL(-1), respectively. In vitro culture showed that TPEP was effective towards P. berghei NK65 in trophozoite and schizont morphology with IC50 0.0001±0.00005 and 0.00009±0.00003 μg mL(-1), respectively. In conclusion, DPEP and TPEP have antimalarial effect on erythrocytes infected with P. berghei NK65 and have potential as antimalarial and schizonticidal agents.

Eopolydiexodina (Middle Permian giant fusulinids) from Afghanistan: Biometry, morphometry, paleobiogeography, and end-Guadalupian events

NASA Astrophysics Data System (ADS)

Colpaert, Clémentine; Monnet, Claude; Vachard, Daniel

2015-04-01

The most spectacular macroevolutionary trend presented by the genera of schwagerinoid fusulinids, during the Pennsylvanian -Permian, is an enormous increase in size, which culminated in the Middle Permian with Eopolydiexodina. However, this potential major biogeographic marker, during the Kubergandian-early Midian time interval, is as yet hampered by its poor taxonomic characterization. Hence, Eopolydiexodina is revised here using biometric and morphometric methods applied to large collections from Afghanistan and selected taxa in the literature. These multivariate analyses consist of classical linear test parameters, as well as new area parameters acquired by computer image analysis. The Afghan species are re-defined, and some other species, occasionally described as Cimmerian, are re-discussed. These methods, combined with classical morphological analyses, also permit to conclude that the largest Eopolydiexodina of Afghanistan are microspheric specimens (probably agamonts) of E. afghanensis and E. bithynica. Two megalospheric groups of individuals (probably gamonts and schizonts) are represented in both species, as well as in E. persica and E. darvasica. Due to this presence of gamonts, agamonts and schizonts in several species, Eopolydiexodina is probably the oldest identified trimorphic genus among the large benthic foraminifers. Biostratigraphically, Eopolydiexodina appears restricted to the late Kubergandian to early Midian. The associated Afghan fusulinids (Dunbarula, Kahlerina, Afghanella, Yangchienia, Sumatrina, and Codonofusiella) allow proposing an accurate biostratigraphy of the Eopolydiexodina species in the Murgabian-Midian boundary interval. Paleobiogeographically, Eopolydiexodina was essentially located in the Laurentian and Perigondwanan borders of the Tethys. The possible presence of Eopolydiexodina in the Cimmerian Continent and in some regions of China has never been irrefutably demonstrated. This paleobiological revision of Eopolydiexodina and the biostratigraphic revision of other large Capitanian fusulinids, permit to suggest that the end-Guadalupian event is most probably a protracted succession of last appearance data of giant genera rather than an instantaneous Lilliput effect at the Capitanian/Wuchiapingian boundary.

High mobility group box (HMGB) proteins of Plasmodium falciparum: DNA binding proteins with pro-inflammatory activity.

PubMed

Kumar, Krishan; Singal, Ankita; Rizvi, M Moshahid A; Chauhan, Virander S

2008-06-01

High mobility group box chromosomal protein 1 (HMGB1), known as an abundant, non-histone architectural chromosomal protein, is highly conserved across different species. Homologues of HMGB1 were identified and cloned from malaria parasite, Plasmodium falciparum. Sequence analyses showed that the P. falciparum HMGB1 (PfHMGB1) exhibits 45, 23 and 18%, while PfHMGB2 shares 42, 21 and 17% homology with Saccharomyces cerevisiae, human and mouse HMG box proteins respectively. Parasite PfHMGB1and PfHMGB2 proteins contain one HMG Box domain similar to B-Box of mammalian HMGB1. Electrophoretic Mobility Shift Assay (EMSA) showed that recombinant PfHMGB1 and PfHMGB2 bind to DNA. Immunofluorescence Assay using specific antibodies revealed that these proteins are expressed abundantly in the ring stage nuclei. Significant levels of PfHMGB1 and PfHMGB2 were also present in the parasite cytosol at trophozoite and schizont stages. Both, PfHMGB1 and PfHMGB2 were found to be potent inducers of pro-inflammatory cytokines such as TNFalpha from mouse peritoneal macrophages as analyzed by both reverse transcription PCR and by ELISA. These results suggest that secreted PfHMGB1 and PfHMGB2 may be responsible for eliciting/ triggering host inflammatory immune responses associated with malaria infection.

SARCOCYSTIS NEURONA-ASSOCIATED MENINGOENCEPHALITIS IN A PACIFIC WALRUS ( ODOBENDUS ROSMARUS DIVERGENS).

PubMed

Krol, Lana; Fravel, Vanessa; Procter, Diana G; Colegrove, Kathleen M

2017-12-01

A 21-yr-old intact male walrus ( Odobendus rosmarus divergens) presented with acute onset of shifting lameness, initially associated with breeding behaviors. Further clinical signs manifested, including muscle tremors, anorexia, hematuria, and coughing. Diagnostics were limited, as the animal would not offer behaviors for voluntary sample collection. Signs were addressed with anti-inflammatories, anticonvulsants, and antibiotics. The walrus developed cluster seizures and ultimately, respiratory and cardiac arrest. Postmortem lesions included meningoencephalitis with intra- and extracellular protozoal zoites and schizonts, as well as interstitial pneumonia with intraendothelial protozoa. Immunolabeling of the protozoal organisms revealed Sarcocystis neurona. Previous S. neurona infections in an odobenid have not been reported. Protozoal infection should be considered in all species of captive marine mammals with nonspecific orthopedic, neurological, and respiratory clinical signs.

Human Monoclonal Antibodies to Pf 155, a Major Antigen of Malaria Parasite Plasmodium falciparum

NASA Astrophysics Data System (ADS)

Udomsangpetch, Rachanee; Lundgren, Katarina; Berzins, Klavs; Wahlin, Birgitta; Perlmann, Hedvig; Troye-Blomberg, Marita; Carlsson, Jan; Wahlgren, Mats; Perlmann, Peter; Bjorkman, Anders

1986-01-01

Pf 155, a protein of the human malaria parasite Plasmodium falciparum, is strongly immunogenic in humans and is believed to be a prime candidate for the preparation of a vaccine. Human monoclonal antibodies to Pf 155 were obtained by cloning B cells that had been prepared from an immune donor and transformed with Epstein-Barr virus. When examined by indirect immunofluorescence, these antibodies stained the surface of infected erythrocytes, free merozoites, segmented schizonts, and gametocytes. They bound to a major polypeptide with a relative molecular weight of 155K and to two minor ones (135K and 120K), all having high affinity for human glycophorin. The antibodies strongly inhibited merozoite reinvasion in vitro, suggesting that they might be appropriate reagents for therapeutic administration in vivo.

Disseminated visceral coccidiosis in sandhill cranes

USGS Publications Warehouse

Carpenter, J.W.; Novilla, M.N.; Fayer, R.; Iverson, G.C.

1984-01-01

Disseminated visceral coccidiosis (DVC) caused by Eimeria spp was first recognized as a disease entity in captive sandhill cranes (Grus canadensis) and whooping cranes (G americana) at the Patuxent Wildlife Research Center. Because cranes produced at the Center are reintroduced to the wild to augment wild populations, studies involving both experimentally induced and natural infections were initiated to determine the potential or actual occurrence of DVC in wild Gruidae. Nine sandhill cranes dosed orally with eimerian oocysts of wild origin developed lesions characteristic of DVC. Extraintestinal granulomas associated with developing schizonts were found in 6 birds. Similar lesions were observed in wild sandhill cranes throughout parts of midwestern United States, Alaska, and Saskatchewan. These studies revealed the wide geographic distribution and the high frequency of occurrence of DVC in wild cranes.

Ned-19 inhibition of parasite growth and multiplication suggests a role for NAADP mediated signalling in the asexual development of Plasmodium falciparum.

PubMed

Suárez-Cortés, Pablo; Gambara, Guido; Favia, Annarita; Palombi, Fioretta; Alano, Pietro; Filippini, Antonio

2017-09-12

Although malaria is a preventable and curable human disease, millions of people risk to be infected by the Plasmodium parasites and to develop this illness. Therefore, there is an urgent need to identify new anti-malarial drugs. Ca 2+ signalling regulates different processes in the life cycle of Plasmodium falciparum, representing a suitable target for the development of new drugs. This study investigated for the first time the effect of a highly specific inhibitor of nicotinic acid adenine dinucleotide phosphate (NAADP)-induced Ca 2+ release (Ned-19) on P. falciparum, revealing the inhibitory effect of this compound on the blood stage development of this parasite. Ned-19 inhibits both the transition of the parasite from the early to the late trophozoite stage and the ability of the late trophozoite to develop to the multinucleated schizont stage. In addition, Ned-19 affects spontaneous intracellular Ca 2+ oscillations in ring and trophozoite stage parasites, suggesting that the observed inhibitory effects may be associated to regulation of intracellular Ca 2+ levels. This study highlights the inhibitory effect of Ned-19 on progression of the asexual life cycle of P. falciparum. The observation that Ned-19 inhibits spontaneous Ca 2+ oscillations suggests a potential role of NAADP in regulating Ca 2+ signalling of P. falciparum.

Global Analysis of Apicomplexan Protein S-Acyl Transferases Reveals an Enzyme Essential for Invasion

PubMed Central

Frénal, Karine; Tay, Chwen L; Mueller, Christina; Bushell, Ellen S; Jia, Yonggen; Graindorge, Arnault; Billker, Oliver; Rayner, Julian C; Soldati-Favre, Dominique

2013-01-01

The advent of techniques to study palmitoylation on a whole proteome scale has revealed that it is an important reversible modification that plays a role in regulating multiple biological processes. Palmitoylation can control the affinity of a protein for lipid membranes, which allows it to impact protein trafficking, stability, folding, signalling and interactions. The publication of the palmitome of the schizont stage of Plasmodium falciparum implicated a role for palmitoylation in host cell invasion, protein export and organelle biogenesis. However, nothing is known so far about the repertoire of protein S-acyl transferases (PATs) that catalyse this modification in Apicomplexa. We undertook a comprehensive analysis of the repertoire of Asp-His-His-Cys cysteine-rich domain (DHHC-CRD) PAT family in Toxoplasma gondii and Plasmodium berghei by assessing their localization and essentiality. Unlike functional redundancies reported in other eukaryotes, some apicomplexan-specific DHHCs are essential for parasite growth, and several are targeted to organelles unique to this phylum. Of particular interest is DHHC7, which localizes to rhoptry organelles in all parasites tested, including the major human pathogen P. falciparum. TgDHHC7 interferes with the localization of the rhoptry palmitoylated protein TgARO and affects the apical positioning of the rhoptry organelles. This PAT has a major impact on T. gondii host cell invasion, but not on the parasite’s ability to egress. PMID:23638681

Anti-malarial property of steroidal alkaloid conessine isolated from the bark of Holarrhena antidysenterica.

PubMed

Dua, Virendra K; Verma, Gaurav; Singh, Bikram; Rajan, Aswathy; Bagai, Upma; Agarwal, Dau Dayal; Gupta, N C; Kumar, Sandeep; Rastogi, Ayushi

2013-06-10

In the face of chronic and emerging resistance of parasites to currently available drugs and constant need for new anti-malarials, natural plant products have been the bastion of anti-malarials for thousands of years. Moreover natural plant products and their derivatives have traditionally been a common source of drugs, and represent more than 30% of the current pharmaceutical market. The present study shows evaluation of anti-malarial effects of compound conessine isolated from plant Holarrhena antidysenterica frequently used against malaria in the Garhwal region of north-west Himalaya. In vitro anti-plasmodial activity of compound was assessed using schizont maturation and parasite lactate dehydrogenase (pLDH) assay. Cytotoxic activities of the examined compound were determined on L-6 cells of rat skeletal muscle myoblast. The four-day test for anti-malarial activity against a chloroquine-sensitive Plasmodium berghei NK65 strain in BALB/c mice was used for monitoring in vivo activity of compound. In liver and kidney function test, the activity of alkaline phosphatase (ALP) was examined by p-NPP method, bilirubin by Jendrassik and Grof method. The urea percentage was determined by modified Berthelot method and creatinine by alkaline picrate method in serum of mice using ENZOPAK/CHEMPAK reagent kits. Compound conessine showed in vitro anti-plasmodial activity with its IC₅₀ value 1.9 μg/ml and 1.3 μg/ml using schizont maturation and pLDH assay respectively. The compound showed cytotoxity IC₅₀= 14 μg/ml against L6 cells of rat skeletal muscle myoblast. The isolated compound from plant H. antidysenterica significantly reduced parasitaemia (at 10 mg/kg exhibited 88.95% parasite inhibition) in P. berghei-infected mice. Due to slightly toxic nature (cytotoxicity = 14), biochemical analysis (liver and kidney function test) of the serum from mice after administration of conessine were also observed. The present investigation demonstrates that the compound conessine exhibited substantial anti-malarial property. The isolated compound could be chemically modified to obtain a more potent chemical entity with improved characteristics against malaria.

Development of a rapid HRM qPCR for the diagnosis of the four most prevalent Plasmodium lineages in New Zealand.

PubMed

Schoener, E R; Hunter, S; Howe, L

2017-07-01

Although wildlife rehabilitation and translocations are important tools in wildlife conservation in New Zealand, disease screening of birds has not been standardized. Additionally, the results of the screening programmes are often difficult to interpret due to missing disease data in resident or translocating avian populations. Molecular methods have become the most widespread method for diagnosing avian malaria (Plasmodium spp.) infections. However, these methods can be time-consuming, expensive and are less specific in diagnosing mixed infections. Thus, this study developed a new real-time PCR (qPCR) method that was able to detect and specifically identify infections of the three most common lineages of avian malaria in New Zealand (Plasmodium (Novyella) sp. SYAT05, Plasmodium elongatum GRW6 and Plasmodium spp. LINN1) as well as a less common, pathogenic Plasmodium relictum GRW4 lineage. The assay was also able to discern combinations of these parasites in the same sample and had a detection limit of five parasites per microlitre. Due to concerns relating to the presence of the potentially highly pathogenic P. relictum GRW4 lineage in avian populations, an additional confirmatory high resolution (HRM) qPCR was developed to distinguish between commonly identified P. elongatum GRW6 from P. relictum GRW4. The new qPCR assays were tested using tissue samples containing Plasmodium schizonts from three naturally infected dead birds resulting in the identified infection of P. elongatum GRW6. Thus, these rapid qPCR assays have shown to be cost-effective and rapid screening tools for the detection of Plasmodium infection in New Zealand native birds.

High-resolution three-dimensional imaging of red blood cells parasitized by Plasmodium falciparum and in situ hemozoin crystals using optical diffraction tomography

NASA Astrophysics Data System (ADS)

Kim, Kyoohyun; Yoon, HyeOk; Diez-Silva, Monica; Dao, Ming; Dasari, Ramachandra R.; Park, YongKeun

2014-01-01

We present high-resolution optical tomographic images of human red blood cells (RBC) parasitized by malaria-inducing Plasmodium falciparum (Pf)-RBCs. Three-dimensional (3-D) refractive index (RI) tomograms are reconstructed by recourse to a diffraction algorithm from multiple two-dimensional holograms with various angles of illumination. These 3-D RI tomograms of Pf-RBCs show cellular and subcellular structures of host RBCs and invaded parasites in fine detail. Full asexual intraerythrocytic stages of parasite maturation (ring to trophozoite to schizont stages) are then systematically investigated using optical diffraction tomography algorithms. These analyses provide quantitative information on the structural and chemical characteristics of individual host Pf-RBCs, parasitophorous vacuole, and cytoplasm. The in situ structural evolution and chemical characteristics of subcellular hemozoin crystals are also elucidated.

Clinical Toxoplasma gondii, Hammondia heydorni, and Sarcocystis spp. infections in dogs.

PubMed

Dubey, J P; Ross, A D; Fritz, D

2003-12-01

Concurrent infections with coccidians Toxoplasma gondii, Sarcocystis spp., and a Hammondia heydorni-like parasite were identified in tissues of three littermate pups on a Kelpie dog breeding farm in Australia. In total, 20 pups in four litters had died following vaccination with an attenuated distemper virus vaccine. Toxoplasma gondii tachyzoites were identified immunohistochemically in tissues of two dogs. Sarcocystis sp. sporocysts were seen in the intestinal lamina propria of two dogs. Asexual and sexual stages of H. heydorni-like parasite were found in enterocytes of the small intestine of two dogs. Ultrastructural development of schizonts and gamonts of this parasite is described. None of the protozoa in these dogs reacted with antibodies to Neospora caninum. Feeding of uncooked tissue of sheep was considered to be the likely source of infection for these coccidians in dogs.

High-resolution three-dimensional imaging of red blood cells parasitized by Plasmodium falciparum and in situ hemozoin crystals using optical diffraction tomography

PubMed Central

Kim, Kyoohyun; Yoon, HyeOk; Diez-Silva, Monica; Dao, Ming; Dasari, Ramachandra R.

2013-01-01

Abstract. We present high-resolution optical tomographic images of human red blood cells (RBC) parasitized by malaria-inducing Plasmodium falciparum (Pf)-RBCs. Three-dimensional (3-D) refractive index (RI) tomograms are reconstructed by recourse to a diffraction algorithm from multiple two-dimensional holograms with various angles of illumination. These 3-D RI tomograms of Pf-RBCs show cellular and subcellular structures of host RBCs and invaded parasites in fine detail. Full asexual intraerythrocytic stages of parasite maturation (ring to trophozoite to schizont stages) are then systematically investigated using optical diffraction tomography algorithms. These analyses provide quantitative information on the structural and chemical characteristics of individual host Pf-RBCs, parasitophorous vacuole, and cytoplasm. The in situ structural evolution and chemical characteristics of subcellular hemozoin crystals are also elucidated. PMID:23797986

Evaluation of the indirect fluorescent antibody test as a diagnostic tool for East Coast fever in eastern Zambia.

PubMed

Billiouw, M; Brandt, J; Vercruysse, J; Speybroeck, N; Marcotty, T; Mulumba, M; Berkvens, D

2005-02-28

Serological surveys using the schizont indirect fluorescence antibody test (IFAt) are routinely carried out to monitor the Theileria parva infection prevalence. The present study evaluates the diagnostic accuracy of the IFAt in eastern Zambia, where the transmission of T. parva is highly seasonal. The data set resulted from a sentinel herd (n = 105 animals) study carried out between 1995 and 2000 and was split into an epidemic period, during which the majority of the cattle became infected, and an endemic period with seasonal disease incidence in calves. In the epidemic period the T. parva seroprevalence followed closely the build up of the herd immunity. In the endemic period the seroprevalence fluctuates considerably although most of the animals had been infected. Overall, the diagnostic sensitivity of the IFA test was 55% at cut-off titre 1:40 and 28% at cut-off 1:160. The specificity of the test was 86 and 95%, respectively. A logistic regression model demonstrates that the sensitivity is significantly lower when the T. parva transmission is low (p < 0.01). The analysis of receiver operator characteristic curves classifies the test as moderately accurate (area under the curve, AUC = 0.79) during the epidemic period and less accurate in the endemic period (AUC = 0.63). Neonatal serology surveys yield a better estimate of the infection prevalence. The sensitivity of the neonatal test was 73% at cut-off titre 1:40 and 24% at cut-off 1:160.

Antiplasmodial activity of plant extracts used in west African traditional medicine.

PubMed

Mustofa; Valentin, A; Benoit-Vical, F; Pélissier, Y; Koné-Bamba, D; Mallié, M

2000-11-01

Five plants originating from Ivory Coast were selected after an ethnobotanical survey, Alchornea cordifolia, Mitragyna inermis, Nauclea diderrichii, Pterocarpus santalinoides, and Terminalia glaucescens. Traditional healers for the treatment of malaria commonly used these plants. Extracts of these plants were tested on three strains of Plasmodium falciparum, FcB1-Colombia and FcM29-Cameroon (chloroquine-resistant strains) and a Nigerian chloroquine-sensitive strain. Extracts were obtained by preparing decoction in water of the powdered plant, the technique used by most of the traditional healers. A radioactive micromethod allowed the evaluation of the in vitro activity of the extracts on P. falciparum. Concentrations inhibiting 50% of the parasite growth (IC(50)) ranged from 2.34 to more than 500 microg/ml according to the plant. For the most active plants (A. cordifolia and T. glaucescens) ethanol and pentane extracts were made and tested. The IC(50) values obtained for these extracts ranged from 0.35 to 43.40 microg/ml. The stage specificity of the ethanol extracts of A. cordifolia and T. glaucescens and pentane extract of T. glaucescens on the parasite erythrocytic cycle were determined. The ethanol extract of T. glaucescens showed its highest activity at the transition from the trophozoite to the schizont stages. Cytotoxicity was estimated on human fibroblasts (HeLa) cells and a cytotoxicity/antiplasmodial index was calculated, it ranged between 5 and 21, and the best antiplasmodial extract (T. glaucescens ethanol extract) had the higher index (>20).

Plasmodium falciparum CRK4 directs continuous rounds of DNA replication during schizogony.

PubMed

Ganter, Markus; Goldberg, Jonathan M; Dvorin, Jeffrey D; Paulo, Joao A; King, Jonas G; Tripathi, Abhai K; Paul, Aditya S; Yang, Jing; Coppens, Isabelle; Jiang, Rays H Y; Elsworth, Brendan; Baker, David A; Dinglasan, Rhoel R; Gygi, Steven P; Duraisingh, Manoj T

2017-02-17

Plasmodium parasites, the causative agents of malaria, have evolved a unique cell division cycle in the clinically relevant asexual blood stage of infection 1 . DNA replication commences approximately halfway through the intracellular development following invasion and parasite growth. The schizont stage is associated with multiple rounds of DNA replication and nuclear division without cytokinesis, resulting in a multinucleated cell. Nuclei divide asynchronously through schizogony, with only the final round of DNA replication and segregation being synchronous and coordinated with daughter cell assembly 2,3 . However, the control mechanisms for this divergent mode of replication are unknown. Here, we show that the Plasmodium-specific kinase PfCRK4 is a key cell-cycle regulator that orchestrates multiple rounds of DNA replication throughout schizogony in Plasmodium falciparum. PfCRK4 depletion led to a complete block in nuclear division and profoundly inhibited DNA replication. Quantitative phosphoproteomic profiling identified a set of PfCRK4-regulated phosphoproteins with greatest functional similarity to CDK2 substrates, particularly proteins involved in the origin of replication firing. PfCRK4 was required for initial and subsequent rounds of DNA replication during schizogony and, in addition, was essential for development in the mosquito vector. Our results identified an essential S-phase promoting factor of the unconventional P. falciparum cell cycle. PfCRK4 is required for both a prolonged period of the intraerythrocytic stage of Plasmodium infection, as well as for transmission, revealing a broad window for PfCRK4-targeted chemotherapeutics.

Effects of homeopathic medications Eupatorium perfoliatum and Arsenicum album on parasitemia of Plasmodium berghei-infected mice.

PubMed

Lira-Salazar, G; Marines-Montiel, E; Torres-Monzón, J; Hernández-Hernández, F; Salas-Benito, J S

2006-10-01

Malaria is one of the most important parasitic diseases in the world and a major public health problem because of emerging drug-resistant strains of Plasmodium. A number of synthetic and natural compounds are now being analysed to develop more effective antimalarial drugs. We investigated the effect of homeopathic preparations of Eupatorium perfoliatum and Arsenicum album on parasitemia using a rodent malaria model. We found significant inhibitory effect on parasite multiplication with both medications with a level of 60% for Eupatorium perfoliatum at a 30 CH potency. Arsenicum album 0/6 gave 70% inhibition but this was less stable than Eupatorium perfoliatum. The number of schizonts was higher in animals treated with homeopathic medications. Although the mechanism of action is unknown, these agents would be good candidates as alternative or complementary medications in the treatment of malaria.

Arohynapenes A and B, new anticoccidial agents produced by Penicillium sp. Taxonomy, fermentation, and structure elucidation.

PubMed

Masuma, R; Tabata, N; Tomoda, H; Haneda, K; Iwai, Y; Omura, S

1994-01-01

Penicillium sp. FO-2295, a water isolate, was found to produce a series of new anticoccidial compounds. Two active compounds, designated arohynapenes A and B, were isolated from the fermentation broth of the producing strain by solvent extration and preparative HPLC. Arohynapene A was deduced to be (2E,4E)-5-(5-hydroxy-2,6,8-trimethyl-5,6,7,8-tetrahydronaphtale ne)-2,4- pentadienoic acid, and arohynapene B was (2E,4E)-5-(2-hydroxymethyl-6,8-dimethyl-5,6,7,8-tetrahydronapht alene)-2,4- pentadienoic acid. Arohynapenes inhibited the growth of Eimeria tenella in an in vitro assay using BHK-21 cells as a host. No schizont in the cells was observed at concentrations ranging above 35.0 microM and 7.0 microM for arohynapenes A and B, respectively.

Purification and partial characterization of PfHRP-II protein of Plasmodium falciparum.

PubMed

Ghimire, Prakash; Samantaray, J C; Mirdha, B R; Patra, A K; Panda, A K

2003-12-01

The human malarial parasite Plasmodium falciparum secretes various intra-and extra-cellular proteins during its asexual life cycle in human RBC. Histidine rich protein-II (HRP-II) is one of the most prominent proteins, found to be secreted by P. falciparum throughout the asexual cycle with the peak during mature schizont stage of the parasite development in human IRBC. The high histidine content (35% of the total amino acids in protein) of this protein suggested the potential to bind divalent metal ions. We have demonstrated by metal chelate chromatography, an extraordinary capacity of HRP-II to bind nickel ions (Ni++) and employed this characteristic to purify the extra-cellular HRP-II protein secreted by P. falciparum from culture supernatant. The identity of the purified protein was verified by the relative molecular weight on SDS-PAGE, by reacting with polyclonal antibodies directed against it using Western blot technique.

A statistically derived index for classifying East Coast fever reactions in cattle challenged with Theileria parva under experimental conditions.

PubMed

Rowlands, G J; Musoke, A J; Morzaria, S P; Nagda, S M; Ballingall, K T; McKeever, D J

2000-04-01

A statistically derived disease reaction index based on parasitological, clinical and haematological measurements observed in 309 5 to 8-month-old Boran cattle following laboratory challenge with Theileria parva is described. Principal component analysis was applied to 13 measures including first appearance of schizonts, first appearance of piroplasms and first occurrence of pyrexia, together with the duration and severity of these symptoms, and white blood cell count. The first principal component, which was based on approximately equal contributions of the 13 variables, provided the definition for the disease reaction index, defined on a scale of 0-10. As well as providing a more objective measure of the severity of the reaction, the continuous nature of the index score enables more powerful statistical analysis of the data compared with that which has been previously possible through clinically derived categories of non-, mild, moderate and severe reactions.

Flow cytometry as a tool for analyzing changes in Plasmodium falciparum cell cycle following treatment with indol compounds.

PubMed

Schuck, Desirée Cigaran; Ribeiro, Ramira Yuri; Nery, Arthur A; Ulrich, Henning; Garcia, Célia R S

2011-11-01

Melatonin and its derivatives modulate the Plasmodium falciparum and Plasmodium chabaudi cell cycle. Flow cytometry was employed together with the nucleic acid dye YOYO-1 allowing precise discrimination between mono- and multinucleated forms of P. falciparum-infected red blood cell. The use of YOYO-1 permitted excellent discrimination between uninfected and infected red blood cells as well as between early and late parasite stages. Fluorescence intensities of schizont-stage parasites were about 10-fold greater than those of ring-trophozoite form parasites. Melatonin and related indolic compounds including serotonin, N-acetyl-serotonin and tryptamine induced an increase in the percentage of multinucleated forms compared to non-treated control cultures. YOYO-1 staining of infected erythrocyte and subsequent flow cytometry analysis provides a powerful tool in malaria research for screening of bioactive compounds. Copyright © 2011 International Society for Advancement of Cytometry.

Development and pathology of two undescribed species of microsporidia infecting the predatory mite, Phytoseiulus persimilis Athias-Henriot.

PubMed

Bjøornson, S; Keddie, B A

2000-11-01

Two undescribed species of microsporidia were found in mass-reared Phytoseiulus persimilis Athias-Henriot from two commercial sources during a routine examination of these predators for pathogens. Both microsporidian species were described from specimens that had been prepared for transmission electron microscopy; live specimens were unavailable for examination. One microsporidium, identified as Species A, was described from two specimens obtained from a commercial insectary in North America. All observed stages of this microsporidium were uninucleate. Rounded-to-ovoid schizonts appeared to develop in direct contact with the cytoplasm of lyrate organ cells (ovarian tissue). Mature spores of Species A were elongate-ovoid and measured 2.88 x 1.21 microm. A polar filament coiled 7 to 10 times in the posterior half of the spore. Sporoblasts and spores were observed in the cytoplasm of cells of numerous tissues and in developing eggs within gravid females. A second species, identified as Species B, was described from five specimens obtained from a commercial source in Israel. All observed stages of this microsporidium were uninucleate. Schizonts of Species B were observed within the cytoplasm of cecal wall cells and within the nuclei of lyrate organ cells. Mature spores were ovoid and measured 2.65 x 1.21 microm. A polar filament coiled 3 to 4 times in the posterior half of the spore. Densely packed ribosomes often concealed the polar filament and other internal spore characteristics. Spores were observed in the cytoplasm of cells of numerous tissues and occasionally within the nuclei of lyrate organ cells. Numerous spores and presporal stages were observed within the ovary and developing eggs. The development and pathology of Species A and B were compared to those of Microsporidium phytoseiuli Bjøornson, Steiner and Keddie, a microsporidium previously described from P. persimilis obtained from a commercial source in Europe. The occurrence of three species of microsporidia within P. persimilis from three sources raises questions regarding the origin of these pathogens. Because microsporidia may have profound impact on the performance of P. persimilis, consideration must be given to the identification and exclusion of microsporidia from field-collected specimens or from predators that may be shared among commercial sources.

Plasma uric acid levels correlate with inflammation and disease severity in Malian children with Plasmodium falciparum malaria.

PubMed

Lopera-Mesa, Tatiana M; Mita-Mendoza, Neida K; van de Hoef, Diana L; Doumbia, Saibou; Konaté, Drissa; Doumbouya, Mory; Gu, Wenjuan; Traoré, Karim; Diakité, Seidina A S; Remaley, Alan T; Anderson, Jennifer M; Rodriguez, Ana; Fay, Michael P; Long, Carole A; Diakité, Mahamadou; Fairhurst, Rick M

2012-01-01

Plasmodium falciparum elicits host inflammatory responses that cause the symptoms and severe manifestations of malaria. One proposed mechanism involves formation of immunostimulatory uric acid (UA) precipitates, which are released from sequestered schizonts into microvessels. Another involves hypoxanthine and xanthine, which accumulate in parasitized red blood cells (RBCs) and may be converted by plasma xanthine oxidase to UA at schizont rupture. These two forms of 'parasite-derived' UA stimulate immune cells to produce inflammatory cytokines in vitro. We measured plasma levels of soluble UA and inflammatory cytokines and chemokines (IL-6, IL-10, sTNFRII, MCP-1, IL-8, TNFα, IP-10, IFNγ, GM-CSF, IL-1β) in 470 Malian children presenting with uncomplicated malaria (UM), non-cerebral severe malaria (NCSM) or cerebral malaria (CM). UA levels were elevated in children with NCSM (median 5.74 mg/dl, 1.21-fold increase, 95% CI 1.09-1.35, n = 23, p = 0.0007) and CM (median 5.69 mg/dl, 1.19-fold increase, 95% CI 0.97-1.41, n = 9, p = 0.0890) compared to those with UM (median 4.60 mg/dl, n = 438). In children with UM, parasite density and plasma creatinine levels correlated with UA levels. These UA levels correlated with the levels of seven cytokines [IL-6 (r = 0.259, p<0.00001), IL-10 (r = 0.242, p<0.00001), sTNFRII (r = 0.221, p<0.00001), MCP-1 (r = 0.220, p<0.00001), IL-8 (r = 0.147, p = 0.002), TNFα (r = 0.132, p = 0.006) and IP-10 (r = 0.120, p = 0.012)]. In 39 children, UA levels were 1.49-fold (95% CI 1.34-1.65; p<0.0001) higher during their malaria episode [geometric mean titer (GMT) 4.67 mg/dl] than when they were previously healthy and aparasitemic (GMT 3.14 mg/dl). Elevated UA levels may contribute to the pathogenesis of P. falciparum malaria by activating immune cells to produce inflammatory cytokines. While this study cannot identify the cause of elevated UA levels, their association with parasite density and creatinine levels suggest that parasite-derived UA and renal function may be involved. Defining pathogenic roles for parasite-derived UA precipitates, which we have not directly studied here, requires further investigation. ClinicalTrials.gov NCT00669084.

ROKU: a novel method for identification of tissue-specific genes.

PubMed

Kadota, Koji; Ye, Jiazhen; Nakai, Yuji; Terada, Tohru; Shimizu, Kentaro

2006-06-12

One of the important goals of microarray research is the identification of genes whose expression is considerably higher or lower in some tissues than in others. We would like to have ways of identifying such tissue-specific genes. We describe a method, ROKU, which selects tissue-specific patterns from gene expression data for many tissues and thousands of genes. ROKU ranks genes according to their overall tissue specificity using Shannon entropy and detects tissues specific to each gene if any exist using an outlier detection method. We evaluated the capacity for the detection of various specific expression patterns using synthetic and real data. We observed that ROKU was superior to a conventional entropy-based method in its ability to rank genes according to overall tissue specificity and to detect genes whose expression pattern are specific only to objective tissues. ROKU is useful for the detection of various tissue-specific expression patterns. The framework is also directly applicable to the selection of diagnostic markers for molecular classification of multiple classes.

In vitro antiplasmodial, antileishmanial and antitrypanosomal activities of selected medicinal plants used in the traditional Arabian Peninsular region

PubMed Central

2012-01-01

Background Worldwide particularly in developing countries, a large proportion of the population is at risk for tropical parasitic diseases. Several medicinal plants are still used traditionally against protozoal infections in Yemen and Saudi Arabia. Thus the present study investigated the in vitro antiprotozoal activity of twenty-five plants collected from the Arabian Peninsula. Methods Plant materials were extracted with methanol and screened in vitro against erythrocytic schizonts of Plasmodium falciparum, intracellular amastigotes of Leishmania infantum and Trypanosoma cruzi and free trypomastigotes of T. brucei. Cytotoxic activity was determined against MRC-5 cells to assess selectivity. The criterion for activity was an IC50 < 10 μg/ml (<5 μg/ml for T. brucei) and selectivity index of >4. Results Antiplasmodial activity was found in the extracts of Chrozophora oblongifolia, Ficus ingens, Lavandula dentata and Plectranthus barbatus. Amastigotes of T. cruzi were affected by Grewia erythraea, L. dentata, Tagetes minuta and Vernonia leopoldii. Activity against T. brucei was obtained in G. erythraea, L. dentata, P. barbatus and T. minuta. No relevant activity was found against L. infantum. High levels of cytotoxicity (MRC-5 IC50 < 10 μg/ml) and hence non-specific activities were noted in Cupressus sempervirens, Kanahia laniflora and Kniphofia sumarae. Conclusion The results endorse that medicinal plants can be promising sources of natural products with antiprotozoal activity potential. The results support to some extent the traditional uses of some plants for the treatment of parasitic protozoal diseases. PMID:22520595

Caged Garcinia Xanthones, a Novel Chemical Scaffold with Potent Antimalarial Activity.

PubMed

Ke, Hangjun; Morrisey, Joanne M; Qu, Shiwei; Chantarasriwong, Oraphin; Mather, Michael W; Theodorakis, Emmanuel A; Vaidya, Akhil B

2017-01-01

Caged Garcinia xanthones (CGXs) constitute a family of natural products that are produced by tropical/subtropical trees of the genus Garcinia CGXs have a unique chemical architecture, defined by the presence of a caged scaffold at the C ring of a xanthone moiety, and exhibit a broad range of biological activities. Here we show that synthetic CGXs exhibit antimalarial activity against Plasmodium falciparum, the causative parasite of human malaria, at the intraerythrocytic stages. Their activity can be substantially improved by attaching a triphenylphosphonium group at the A ring of the caged xanthone. Specifically, CR135 and CR142 were found to be highly effective antimalarial inhibitors, with 50% effective concentrations as low as ∼10 nM. CGXs affect malaria parasites at multiple intraerythrocytic stages, with mature stages (trophozoites and schizonts) being more vulnerable than immature rings. Within hours of CGX treatment, malaria parasites display distinct morphological changes, significant reduction of parasitemia (the percentage of infected red blood cells), and aberrant mitochondrial fragmentation. CGXs do not, however, target the mitochondrial electron transport chain, the target of the drug atovaquone and several preclinical candidates. CGXs are cytotoxic to human HEK293 cells at the low micromolar level, which results in a therapeutic window of around 150-fold for the lead compounds. In summary, we show that CGXs are potent antimalarial compounds with structures distinct from those of previously reported antimalarial inhibitors. Our results highlight the potential to further develop Garcinia natural product derivatives as novel antimalarial agents. Copyright © 2016 American Society for Microbiology.

Screening of a library of traditional Chinese medicines to identify anti-malarial compounds and extracts.

PubMed

Nonaka, Motohiro; Murata, Yuho; Takano, Ryo; Han, Yongmei; Bin Kabir, Md Hazzaz; Kato, Kentaro

2018-06-25

Malaria is a major infectious disease in the world. In 2015, approximately 212 million people were infected and 429,000 people were killed by this disease. Plasmodium falciparum, which causes falciparum malaria, is becoming resistant to artemisinin (ART) in Southeast Asia; therefore, new anti-malarial drugs are urgently needed. Some excellent anti-malarial drugs, such as quinine or ART, were originally obtained from natural plants. Hence, the authors screened a natural product library comprising traditional Chinese medicines (TCMs) to identify compounds/extracts with anti-malarial effects. The authors performed three assays: a malaria growth inhibition assay (GIA), a cytotoxicity assay, and a malaria stage-specific GIA. The malaria GIA revealed the anti-malarial ability and half-maximal inhibitory concentrations (IC 50 ) of the natural products, whereas the malaria stage-specific GIA revealed the point in the malaria life cycle where the products exerted their anti-malarial effects. The toxicity of the products to the host cells was evaluated with the cytotoxicity assay. Four natural compounds (berberine chloride, coptisine chloride, palmatine chloride, and dehydrocorydaline nitrate) showed strong anti-malarial effects (IC 50  < 50 nM), and low cytotoxicity (cell viability > 90%) using P. falciparum 3D7 strain. Two natural extracts (Phellodendri cortex and Coptidis rhizoma) also showed strong antiplasmodial effects (IC 50  < 1 µg/ml), and low cytotoxicity (cell viability > 80%). These natural products also demonstrated anti-malarial capability during the trophozoite and schizont stages of the malaria life cycle. The authors identified four compounds (berberine chloride, coptisine chloride, palmatine chloride, and dehydrocorydaline nitrate) and two extracts (Phellodendri cortex and Coptidis rhizoma) with anti-malarial activity, neither of which had previously been described. The IC 50 values of the compounds were comparable to that of chloroquine and better than that of pyrimethamine. These compounds and extracts derived from TCMs thus show promise as potential future anti-malarial drugs.

Genome-wide prediction and analysis of human tissue-selective genes using microarray expression data

PubMed Central

2013-01-01

Background Understanding how genes are expressed specifically in particular tissues is a fundamental question in developmental biology. Many tissue-specific genes are involved in the pathogenesis of complex human diseases. However, experimental identification of tissue-specific genes is time consuming and difficult. The accurate predictions of tissue-specific gene targets could provide useful information for biomarker development and drug target identification. Results In this study, we have developed a machine learning approach for predicting the human tissue-specific genes using microarray expression data. The lists of known tissue-specific genes for different tissues were collected from UniProt database, and the expression data retrieved from the previously compiled dataset according to the lists were used for input vector encoding. Random Forests (RFs) and Support Vector Machines (SVMs) were used to construct accurate classifiers. The RF classifiers were found to outperform SVM models for tissue-specific gene prediction. The results suggest that the candidate genes for brain or liver specific expression can provide valuable information for further experimental studies. Our approach was also applied for identifying tissue-selective gene targets for different types of tissues. Conclusions A machine learning approach has been developed for accurately identifying the candidate genes for tissue specific/selective expression. The approach provides an efficient way to select some interesting genes for developing new biomedical markers and improve our knowledge of tissue-specific expression. PMID:23369200

Hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation system for cancer gene therapy

PubMed Central

Javan, Bita; Shahbazi, Majid

2017-01-01

Transcriptional targeting is the best approach for specific gene therapy. Hypoxia is a common feature of the tumour microenvironment. Therefore, targeting gene expression in hypoxic cells by placing transgene under the control of a hypoxia-responsive promoter can be a good strategy for cancer-specific gene therapy. The hypoxia-inducible gene expression system has been investigated more in suicide gene therapy and it can also be of great help in knocking down cancer gene therapy with siRNAs. However, this system needs to be optimised to have maximum efficacy with minimum side effects in normal tissues. The combination of tissue-/tumour-specific promoters with HRE core sequences has been found to enhance the specificity and efficacy of this system. In this review, hypoxia-inducible gene expression system as well as gene therapy strategies targeting tumour hypoxia will be discussed. This review will also focus on hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy. PMID:28798809

Identification of Novel Tissue-Specific Genes by Analysis of Microarray Databases: A Human and Mouse Model

PubMed Central

Suh, Yeunsu; Davis, Michael E.; Lee, Kichoon

2013-01-01

Understanding the tissue-specific pattern of gene expression is critical in elucidating the molecular mechanisms of tissue development, gene function, and transcriptional regulations of biological processes. Although tissue-specific gene expression information is available in several databases, follow-up strategies to integrate and use these data are limited. The objective of the current study was to identify and evaluate novel tissue-specific genes in human and mouse tissues by performing comparative microarray database analysis and semi-quantitative PCR analysis. We developed a powerful approach to predict tissue-specific genes by analyzing existing microarray data from the NCBI′s Gene Expression Omnibus (GEO) public repository. We investigated and confirmed tissue-specific gene expression in the human and mouse kidney, liver, lung, heart, muscle, and adipose tissue. Applying our novel comparative microarray approach, we confirmed 10 kidney, 11 liver, 11 lung, 11 heart, 8 muscle, and 8 adipose specific genes. The accuracy of this approach was further verified by employing semi-quantitative PCR reaction and by searching for gene function information in existing publications. Three novel tissue-specific genes were discovered by this approach including AMDHD1 (amidohydrolase domain containing 1) in the liver, PRUNE2 (prune homolog 2) in the heart, and ACVR1C (activin A receptor, type IC) in adipose tissue. We further confirmed the tissue-specific expression of these 3 novel genes by real-time PCR. Among them, ACVR1C is adipose tissue-specific and adipocyte-specific in adipose tissue, and can be used as an adipocyte developmental marker. From GEO profiles, we predicted the processes in which AMDHD1 and PRUNE2 may participate. Our approach provides a novel way to identify new sets of tissue-specific genes and to predict functions in which they may be involved. PMID:23741331

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

PubMed Central

2012-01-01

Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2, Tox, and Trim24) and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver. PMID:22475005

ROKU: a novel method for identification of tissue-specific genes

PubMed Central

Kadota, Koji; Ye, Jiazhen; Nakai, Yuji; Terada, Tohru; Shimizu, Kentaro

2006-01-01

Background One of the important goals of microarray research is the identification of genes whose expression is considerably higher or lower in some tissues than in others. We would like to have ways of identifying such tissue-specific genes. Results We describe a method, ROKU, which selects tissue-specific patterns from gene expression data for many tissues and thousands of genes. ROKU ranks genes according to their overall tissue specificity using Shannon entropy and detects tissues specific to each gene if any exist using an outlier detection method. We evaluated the capacity for the detection of various specific expression patterns using synthetic and real data. We observed that ROKU was superior to a conventional entropy-based method in its ability to rank genes according to overall tissue specificity and to detect genes whose expression pattern are specific only to objective tissues. Conclusion ROKU is useful for the detection of various tissue-specific expression patterns. The framework is also directly applicable to the selection of diagnostic markers for molecular classification of multiple classes. PMID:16764735

Disrupting malaria parasite AMA1-RON2 interaction with a small molecule prevents erythrocyte invasion.

PubMed

Srinivasan, Prakash; Yasgar, Adam; Luci, Diane K; Beatty, Wandy L; Hu, Xin; Andersen, John; Narum, David L; Moch, J Kathleen; Sun, Hongmao; Haynes, J David; Maloney, David J; Jadhav, Ajit; Simeonov, Anton; Miller, Louis H

2013-01-01

Plasmodium falciparum resistance to artemisinin derivatives, the first-line antimalarial drug, drives the search for new classes of chemotherapeutic agents. Current discovery is primarily directed against the intracellular forms of the parasite. However, late schizont-infected red blood cells (RBCs) may still rupture and cause disease by sequestration; consequently targeting invasion may reduce disease severity. Merozoite invasion of RBCs requires interaction between two parasite proteins AMA1 and RON2. Here we identify the first inhibitor of this interaction that also blocks merozoite invasion in genetically distinct parasites by screening a library of over 21,000 compounds. We demonstrate that this inhibition is mediated by the small molecule binding to AMA1 and blocking the formation of AMA1-RON complex. Electron microscopy confirms that the inhibitor prevents junction formation, a critical step in invasion that results from AMA1-RON2 binding. This study uncovers a strategy that will allow for highly effective combination therapies alongside existing antimalarial drugs.

A histidine-rich protein 2-based malaria drug sensitivity assay for field use.

PubMed

Noedl, Harald; Attlmayr, Bernhard; Wernsdorfer, Walther H; Kollaritsch, Herwig; Miller, Robert S

2004-12-01

With the spread of antimalarial drug resistance, simple and reliable tools for the assessment of antimalarial drug resistance, particularly in endemic regions and under field conditions, have become more important than ever before. We therefore developed a histidine-rich protein 2 (HRP2)-based drug sensitivity assay for testing of fresh isolates of Plasmodium falciparum in the field. In contrast to the HRP2 laboratory assay, the field assay uses a procedure that further simplifies the handling and culturing of malaria parasites by omitting centrifugation, washing, the use of serum, and dilution with uninfected red blood cells. A total of 40 fresh Plasmodium falciparum isolates were successfully tested for their susceptibility to dihydroartemisinin, mefloquine, quinine, and chloroquine (50% inhibitory concentration [IC50] = 3.43, 61.89, 326.75, and 185.31 nM, respectively). Results very closely matched those obtained with a modified World Health Organization schizont maturation assay (R2 = 0.96, P < 0.001; mean log difference at IC50 = 0.054).

Efficacy of decoquinate against Sarcocystis neurona in cell cultures.

PubMed

Lindsay, David S; Nazir, M Mudasser; Maqbool, Azhar; Ellison, Siobhan P; Strobl, Jeannine S

2013-09-01

Decoquinate is a quinolone anticoccidial approved for use in the prevention of intestinal coccidiosis in farm animals. This compound has good activity against Toxoplasma gondii and Neospora caninum in cell cultures. The drug acts on the parasites' mitochondria. The activity of decoquinate against developing merozoites of 2 isolates of Sarcocystis neurona was examined in cell culture. Merozoite production at 10 days was completely inhibited when decoquinate was used at 20 or 240 nM. The IC50 of decoquinate was 0.5 ± 0.09nM for the Sn6 isolate of S. neurona from a horse and 1.1 ± 0.6 nM for the SnOP15 isolate of S. neurona from an opossum. Levamisole was toxic at 5 μg/ml and no synergism was observed when decoquinate was combined with levamisole and tested against the Sn3YFP isolate of S. neurona. Decoquinate was cidal for developing schizonts of S. neurona at 240 nM. Copyright © 2013 Elsevier B.V. All rights reserved.

Histopathologic and Molecular Characterization of Sarcocystis calchasi Encephalitis in White-winged Doves ( Zenaida asiatica ) and Eurasian Collared Doves ( Streptopelia decaocto ), East-central Texas, USA, 2010-13.

PubMed

Hodo, Carolyn L; Whitley, Derick B; Hamer, Sarah A; Corapi, Wayne V; Snowden, Karen; Heatley, J Jill; Hoffmann, Aline Rodrigues

2016-04-28

Sarcocystis calchasi is a recently described apicomplexan parasite that causes encephalitis in avian hosts. We diagnosed one White-winged Dove ( Zenaida asiatica ) and two Eurasian Collared Doves ( Streptopelia decaocto ) in Texas, US, with a history of neurologic signs with protozoal encephalitis. On histologic examination, all three doves had moderate to severe meningoencephalitis characterized by large numbers of plasma cells, lymphocytes, and macrophages with gliosis and astrocytosis. Brain sections from two doves also contained numerous Mott cells. Protozoal schizonts with rosettes or clusters of individual merozoites consistent with Sarcocystis spp. were seen within areas of inflammation. Sarcocysts were also identified in the skeletal muscle of one dove. The PCR and sequencing of brain and skeletal muscle from two doves revealed 99% identity with S. calchasi. The presence of S. calchasi in fatal cases of encephalitis in doves in Texas suggests that the geographic and host ranges of S. calchasi are broader than previously reported.

Plasmodium falciparum: attenuation by irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waki, S.; Yonome, I.; Suzuki, M.

The effect of irradiation on the in vitro growth of Plasmodium falciparum was investigated. The cultured malarial parasites at selected stages of development were exposed to gamma rays and the sensitivity of each stage was determined. The stages most sensitive to irradiation were the ring forms and the early trophozoites; late trophozoites were relatively insensitive. The greatest resistance was shown when parasites were irradiated at a time of transition from the late trophozoite and schizont stages to young ring forms. The characteristics of radiosensitive variation in the parasite cycle resembled that of mammalian cells. Growth curves of parasites exposed tomore » doses of irradiation upto 150 gray had the same slope as nonirradiated controls but parasites which were exposed to 200 gray exhibited a growth curve which was less steep than that for parasites in other groups. Less than 10 organisms survived from the 10(6) parasites exposed to this high dose of irradiation; the possibility exists of obtaining radiation-attenuated P. falciparum.« less

Susceptibility of human Plasmodium knowlesi infections to anti-malarials

PubMed Central

2013-01-01

Background Evidence suggests that Plasmodium knowlesi malaria in Sarawak, Malaysian Borneo remains zoonotic, meaning anti-malarial drug resistance is unlikely to have developed in the absence of drug selection pressure. Therefore, adequate response to available anti-malarial treatments is assumed. Methods Here the ex vivo sensitivity of human P. knowlesi isolates in Malaysian Borneo were studied, using a WHO schizont maturation assay modified to accommodate the quotidian life cycle of this parasite. The in vitro sensitivities of P. knowlesi H strain adapted from a primate infection to in vitro culture (by measuring the production of Plasmodium lactate dehydrogenase) were also examined together with some assays using Plasmodium falciparum and Plasmodium vivax. Results Plasmodium knowlesi is uniformly highly sensitive to artemisinins, variably and moderately sensitive to chloroquine, and less sensitive to mefloquine. Conclusions Taken together with reports of clinical failures when P. knowlesi is treated with mefloquine, the data suggest that caution is required if using mefloquine in prevention or treatment of P. knowlesi infections, until further studies are undertaken. PMID:24245918

Inferring Gene Family Histories in Yeast Identifies Lineage Specific Expansions

PubMed Central

Ames, Ryan M.; Money, Daniel; Lovell, Simon C.

2014-01-01

The complement of genes found in the genome is a balance between gene gain and gene loss. Knowledge of the specific genes that are gained and lost over evolutionary time allows an understanding of the evolution of biological functions. Here we use new evolutionary models to infer gene family histories across complete yeast genomes; these models allow us to estimate the relative genome-wide rates of gene birth, death, innovation and extinction (loss of an entire family) for the first time. We show that the rates of gene family evolution vary both between gene families and between species. We are also able to identify those families that have experienced rapid lineage specific expansion/contraction and show that these families are enriched for specific functions. Moreover, we find that families with specific functions are repeatedly expanded in multiple species, suggesting the presence of common adaptations and that these family expansions/contractions are not random. Additionally, we identify potential specialisations, unique to specific species, in the functions of lineage specific expanded families. These results suggest that an important mechanism in the evolution of genome content is the presence of lineage-specific gene family changes. PMID:24921666

Transient, Inducible, Placenta-Specific Gene Expression in Mice

PubMed Central

Fan, Xiujun; Petitt, Matthew; Gamboa, Matthew; Huang, Mei; Dhal, Sabita; Druzin, Maurice L.; Wu, Joseph C.

2012-01-01

Molecular understanding of placental functions and pregnancy disorders is limited by the absence of methods for placenta-specific gene manipulation. Although persistent placenta-specific gene expression has been achieved by lentivirus-based gene delivery methods, developmentally and physiologically important placental genes have highly stage-specific functions, requiring controllable, transient expression systems for functional analysis. Here, we describe an inducible, placenta-specific gene expression system that enables high-level, transient transgene expression and monitoring of gene expression by live bioluminescence imaging in mouse placenta at different stages of pregnancy. We used the third generation tetracycline-responsive tranactivator protein Tet-On 3G, with 10- to 100-fold increased sensitivity to doxycycline (Dox) compared with previous versions, enabling unusually sensitive on-off control of gene expression in vivo. Transgenic mice expressing Tet-On 3G were created using a new integrase-based, site-specific approach, yielding high-level transgene expression driven by a ubiquitous promoter. Blastocysts from these mice were transduced with the Tet-On 3G-response element promoter-driving firefly luciferase using lentivirus-mediated placenta-specific gene delivery and transferred into wild-type pseudopregnant recipients for placenta-specific, Dox-inducible gene expression. Systemic Dox administration at various time points during pregnancy led to transient, placenta-specific firefly luciferase expression as early as d 5 of pregnancy in a Dox dose-dependent manner. This system enables, for the first time, reliable pregnancy stage-specific induction of gene expression in the placenta and live monitoring of gene expression during pregnancy. It will be widely applicable to studies of both placental development and pregnancy, and the site-specific Tet-On G3 mouse will be valuable for studies in a broad range of tissues. PMID:23011919

Further evaluation of the NWF filter for the purification of Plasmodium vivax-infected erythrocytes.

PubMed

Li, Jiangyan; Tao, Zhiyong; Li, Qian; Brashear, Awtum; Wang, Ying; Xia, Hui; Fang, Qiang; Cui, Liwang

2017-05-17

Isolation of Plasmodium-infected red blood cells (iRBCs) from clinical blood samples is often required for experiments, such as ex vivo drug assays, in vitro invasion assays and genome sequencing. Current methods for removing white blood cells (WBCs) from malaria-infected blood are time-consuming or costly. A prototype non-woven fabric (NWF) filter was developed for the purification of iRBCs, which showed great efficiency for removing WBCs in a pilot study. Previous work was performed with prototype filters optimized for processing 5-10 mL of blood. With the commercialization of the filters, this study aims to evaluate the efficiency and suitability of the commercial NWF filter for the purification of Plasmodium vivax-infected RBCs in smaller volumes of blood and to compare its performance with that of Plasmodipur ® filters. Forty-three clinical P. vivax blood samples taken from symptomatic patients attending malaria clinics at the China-Myanmar border were processed using the NWF filters in a nearby field laboratory. The numbers of WBCs and iRBCs and morphology of P. vivax parasites in the blood samples before and after NWF filtration were compared. The viability of P. vivax parasites after filtration from 27 blood samples was examined by in vitro short-term culture. In addition, the effectiveness of the NWF filter for removing WBCs was compared with that of the Plasmodipur ® filter in six P. vivax blood samples. Filtration of 1-2 mL of P. vivax-infected blood with the NWF filter removed 99.68% WBCs. The densities of total iRBCs, ring and trophozoite stages before and after filtration were not significantly different (P > 0.05). However, the recovery rates of schizont- and gametocyte-infected RBCs, which were minor parasite stages in the clinical samples, were relatively low. After filtration, the P. vivax parasites did not show apparent morphological changes. Culture of 27 P. vivax-infected blood samples after filtration showed that parasites successfully matured into the schizont stage. The WBC removal rates and iRBC recovery rates were not significantly different between the NWF and Plasmodipur ® filters (P > 0.05). When tested with 1-2 mL of P. vivax-infected blood, the NWF filter could effectively remove WBCs and the recovery rates for ring- and trophozoite-iRBCs were high. P. vivax parasites after filtration could be successfully cultured in vitro to reach maturity. The performance of the NWF and Plasmodipur ® filters for removing WBCs and recovering iRBCs was comparable.

Plasma Uric Acid Levels Correlate with Inflammation and Disease Severity in Malian Children with Plasmodium falciparum Malaria

PubMed Central

Lopera-Mesa, Tatiana M.; Mita-Mendoza, Neida K.; van de Hoef, Diana L.; Doumbia, Saibou; Konaté, Drissa; Doumbouya, Mory; Gu, Wenjuan; Traoré, Karim; Diakité, Seidina A. S.; Remaley, Alan T.; Anderson, Jennifer M.; Rodriguez, Ana; Fay, Michael P.; Long, Carole A.; Diakité, Mahamadou; Fairhurst, Rick M.

2012-01-01

Background Plasmodium falciparum elicits host inflammatory responses that cause the symptoms and severe manifestations of malaria. One proposed mechanism involves formation of immunostimulatory uric acid (UA) precipitates, which are released from sequestered schizonts into microvessels. Another involves hypoxanthine and xanthine, which accumulate in parasitized red blood cells (RBCs) and may be converted by plasma xanthine oxidase to UA at schizont rupture. These two forms of ‘parasite-derived’ UA stimulate immune cells to produce inflammatory cytokines in vitro. Methods and Findings We measured plasma levels of soluble UA and inflammatory cytokines and chemokines (IL-6, IL-10, sTNFRII, MCP-1, IL-8, TNFα, IP-10, IFNγ, GM-CSF, IL-1β) in 470 Malian children presenting with uncomplicated malaria (UM), non-cerebral severe malaria (NCSM) or cerebral malaria (CM). UA levels were elevated in children with NCSM (median 5.74 mg/dl, 1.21-fold increase, 95% CI 1.09–1.35, n = 23, p = 0.0007) and CM (median 5.69 mg/dl, 1.19-fold increase, 95% CI 0.97–1.41, n = 9, p = 0.0890) compared to those with UM (median 4.60 mg/dl, n = 438). In children with UM, parasite density and plasma creatinine levels correlated with UA levels. These UA levels correlated with the levels of seven cytokines [IL-6 (r = 0.259, p<0.00001), IL-10 (r = 0.242, p<0.00001), sTNFRII (r = 0.221, p<0.00001), MCP-1 (r = 0.220, p<0.00001), IL-8 (r = 0.147, p = 0.002), TNFα (r = 0.132, p = 0.006) and IP-10 (r = 0.120, p = 0.012)]. In 39 children, UA levels were 1.49-fold (95% CI 1.34–1.65; p<0.0001) higher during their malaria episode [geometric mean titer (GMT) 4.67 mg/dl] than when they were previously healthy and aparasitemic (GMT 3.14 mg/dl). Conclusions Elevated UA levels may contribute to the pathogenesis of P. falciparum malaria by activating immune cells to produce inflammatory cytokines. While this study cannot identify the cause of elevated UA levels, their association with parasite density and creatinine levels suggest that parasite-derived UA and renal function may be involved. Defining pathogenic roles for parasite-derived UA precipitates, which we have not directly studied here, requires further investigation. Trial Registration ClinicalTrials.gov NCT00669084 PMID:23071567

Topological and organizational properties of the products of house-keeping and tissue-specific genes in protein-protein interaction networks.

PubMed

Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing

2009-03-11

Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene-encoded proteins are attached to the core at more peripheral positions of the networks.

Genome Comparison of Human and Non-Human Malaria Parasites Reveals Species Subset-Specific Genes Potentially Linked to Human Disease

PubMed Central

Frech, Christian; Chen, Nansheng

2011-01-01

Genes underlying important phenotypic differences between Plasmodium species, the causative agents of malaria, are frequently found in only a subset of species and cluster at dynamically evolving subtelomeric regions of chromosomes. We hypothesized that chromosome-internal regions of Plasmodium genomes harbour additional species subset-specific genes that underlie differences in human pathogenicity, human-to-human transmissibility, and human virulence. We combined sequence similarity searches with synteny block analyses to identify species subset-specific genes in chromosome-internal regions of six published Plasmodium genomes, including Plasmodium falciparum, Plasmodium vivax, Plasmodium knowlesi, Plasmodium yoelii, Plasmodium berghei, and Plasmodium chabaudi. To improve comparative analysis, we first revised incorrectly annotated gene models using homology-based gene finders and examined putative subset-specific genes within syntenic contexts. Confirmed subset-specific genes were then analyzed for their role in biological pathways and examined for molecular functions using publicly available databases. We identified 16 genes that are well conserved in the three primate parasites but not found in rodent parasites, including three key enzymes of the thiamine (vitamin B1) biosynthesis pathway. Thirteen genes were found to be present in both human parasites but absent in the monkey parasite P. knowlesi, including genes specifically upregulated in sporozoites or gametocytes that could be linked to parasite transmission success between humans. Furthermore, we propose 15 chromosome-internal P. falciparum-specific genes as new candidate genes underlying increased human virulence and detected a currently uncharacterized cluster of P. vivax-specific genes on chromosome 6 likely involved in erythrocyte invasion. In conclusion, Plasmodium species harbour many chromosome-internal differences in the form of protein-coding genes, some of which are potentially linked to human disease and thus promising leads for future laboratory research. PMID:22215999

Computation and application of tissue-specific gene set weights.

PubMed

Frost, H Robert

2018-04-06

Gene set testing, or pathway analysis, has become a critical tool for the analysis of highdimensional genomic data. Although the function and activity of many genes and higher-level processes is tissue-specific, gene set testing is typically performed in a tissue agnostic fashion, which impacts statistical power and the interpretation and replication of results. To address this challenge, we have developed a bioinformatics approach to compute tissuespecific weights for individual gene sets using information on tissue-specific gene activity from the Human Protein Atlas (HPA). We used this approach to create a public repository of tissue-specific gene set weights for 37 different human tissue types from the HPA and all collections in the Molecular Signatures Database (MSigDB). To demonstrate the validity and utility of these weights, we explored three different applications: the functional characterization of human tissues, multi-tissue analysis for systemic diseases and tissue-specific gene set testing. All data used in the reported analyses is publicly available. An R implementation of the method and tissue-specific weights for MSigDB gene set collections can be downloaded at http://www.dartmouth.edu/∼hrfrost/TissueSpecificGeneSets. rob.frost@dartmouth.edu.

Tissue Non-Specific Genes and Pathways Associated with Diabetes: An Expression Meta-Analysis.

PubMed

Mei, Hao; Li, Lianna; Liu, Shijian; Jiang, Fan; Griswold, Michael; Mosley, Thomas

2017-01-21

We performed expression studies to identify tissue non-specific genes and pathways of diabetes by meta-analysis. We searched curated datasets of the Gene Expression Omnibus (GEO) database and identified 13 and five expression studies of diabetes and insulin responses at various tissues, respectively. We tested differential gene expression by empirical Bayes-based linear method and investigated gene set expression association by knowledge-based enrichment analysis. Meta-analysis by different methods was applied to identify tissue non-specific genes and gene sets. We also proposed pathway mapping analysis to infer functions of the identified gene sets, and correlation and independent analysis to evaluate expression association profile of genes and gene sets between studies and tissues. Our analysis showed that PGRMC1 and HADH genes were significant over diabetes studies, while IRS1 and MPST genes were significant over insulin response studies, and joint analysis showed that HADH and MPST genes were significant over all combined data sets. The pathway analysis identified six significant gene sets over all studies. The KEGG pathway mapping indicated that the significant gene sets are related to diabetes pathogenesis. The results also presented that 12.8% and 59.0% pairwise studies had significantly correlated expression association for genes and gene sets, respectively; moreover, 12.8% pairwise studies had independent expression association for genes, but no studies were observed significantly different for expression association of gene sets. Our analysis indicated that there are both tissue specific and non-specific genes and pathways associated with diabetes pathogenesis. Compared to the gene expression, pathway association tends to be tissue non-specific, and a common pathway influencing diabetes development is activated through different genes at different tissues.

Identification of Single- and Multiple-Class Specific Signature Genes from Gene Expression Profiles by Group Marker Index

PubMed Central

Tsai, Yu-Shuen; Aguan, Kripamoy; Pal, Nikhil R.; Chung, I-Fang

2011-01-01

Informative genes from microarray data can be used to construct prediction model and investigate biological mechanisms. Differentially expressed genes, the main targets of most gene selection methods, can be classified as single- and multiple-class specific signature genes. Here, we present a novel gene selection algorithm based on a Group Marker Index (GMI), which is intuitive, of low-computational complexity, and efficient in identification of both types of genes. Most gene selection methods identify only single-class specific signature genes and cannot identify multiple-class specific signature genes easily. Our algorithm can detect de novo certain conditions of multiple-class specificity of a gene and makes use of a novel non-parametric indicator to assess the discrimination ability between classes. Our method is effective even when the sample size is small as well as when the class sizes are significantly different. To compare the effectiveness and robustness we formulate an intuitive template-based method and use four well-known datasets. We demonstrate that our algorithm outperforms the template-based method in difficult cases with unbalanced distribution. Moreover, the multiple-class specific genes are good biomarkers and play important roles in biological pathways. Our literature survey supports that the proposed method identifies unique multiple-class specific marker genes (not reported earlier to be related to cancer) in the Central Nervous System data. It also discovers unique biomarkers indicating the intrinsic difference between subtypes of lung cancer. We also associate the pathway information with the multiple-class specific signature genes and cross-reference to published studies. We find that the identified genes participate in the pathways directly involved in cancer development in leukemia data. Our method gives a promising way to find genes that can involve in pathways of multiple diseases and hence opens up the possibility of using an existing drug on other diseases as well as designing a single drug for multiple diseases. PMID:21909426

The Drosophila Translational Control Element (TCE) Is Required for High-Level Transcription of Many Genes That Are Specifically Expressed in Testes

PubMed Central

Anderson, Ashley K.; Ohler, Uwe; Wassarman, David A.

2012-01-01

To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE). The TCE functions in the 5′ untranslated region of Mst(3)CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300–400 bp) genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID) subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and understanding the dual role of the TCE in translational and transcriptional regulation. PMID:22984601

The Drosophila Translational Control Element (TCE) is required for high-level transcription of many genes that are specifically expressed in testes.

PubMed

Katzenberger, Rebeccah J; Rach, Elizabeth A; Anderson, Ashley K; Ohler, Uwe; Wassarman, David A

2012-01-01

To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE). The TCE functions in the 5' untranslated region of Mst(3)CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp) genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID) subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and understanding the dual role of the TCE in translational and transcriptional regulation.

The evolution of duplicate gene expression in mammalian organs

PubMed Central

Guschanski, Katerina; Warnefors, Maria; Kaessmann, Henrik

2017-01-01

Gene duplications generate genomic raw material that allows the emergence of novel functions, likely facilitating adaptive evolutionary innovations. However, global assessments of the functional and evolutionary relevance of duplicate genes in mammals were until recently limited by the lack of appropriate comparative data. Here, we report a large-scale study of the expression evolution of DNA-based functional gene duplicates in three major mammalian lineages (placental mammals, marsupials, egg-laying monotremes) and birds, on the basis of RNA sequencing (RNA-seq) data from nine species and eight organs. We observe dynamic changes in tissue expression preference of paralogs with different duplication ages, suggesting differential contribution of paralogs to specific organ functions during vertebrate evolution. Specifically, we show that paralogs that emerged in the common ancestor of bony vertebrates are enriched for genes with brain-specific expression and provide evidence for differential forces underlying the preferential emergence of young testis- and liver-specific expressed genes. Further analyses uncovered that the overall spatial expression profiles of gene families tend to be conserved, with several exceptions of pronounced tissue specificity shifts among lineage-specific gene family expansions. Finally, we trace new lineage-specific genes that may have contributed to the specific biology of mammalian organs, including the little-studied placenta. Overall, our study provides novel and taxonomically broad evidence for the differential contribution of duplicate genes to tissue-specific transcriptomes and for their importance for the phenotypic evolution of vertebrates. PMID:28743766

DNA Hypomethylation in Intragenic and Intergenic Enhancer Chromatin of Muscle-Specific Genes Usually Correlates with their Expression

PubMed Central

Ehrlich, Kenneth C.; Paterson, Heather L.; Lacey, Michelle; Ehrlich, Melanie

2016-01-01

Tissue-specific enhancers are critical for gene regulation. In this study, we help elucidate the contribution of muscle-associated differential DNA methylation to the enhancer activity of highly muscle-specific genes. By bioinformatic analysis of 44 muscle-associated genes, we show that preferential gene expression in skeletal muscle (SkM) correlates with SkM-specific intragenic and intergenic enhancer chromatin and overlapping foci of DNA hypomethylation. Some genes, e.g., CASQ1 and FBXO32, displayed broad regions of both SkM- and heart-specific enhancer chromatin but exhibited focal SkM-specific DNA hypomethylation. Half of the genes had SkM-specific super-enhancers. In contrast to simple enhancer/gene-expression correlations, a super-enhancer was associated with the myogenic MYOD1 gene in both SkM and myoblasts even though SkM has < 1 percent as much MYOD1 expression. Local chromatin differences in this super-enhancer probably contribute to the SkM/myoblast differential expression. Transfection assays confirmed the tissue-specificity of the 0.3-kb core enhancer within MYOD1’s super-enhancer and demonstrated its repression by methylation of its three CG dinucleotides. Our study suggests that DNA hypomethylation increases enhancer tissue-specificity and that SkM super-enhancers sometimes are poised for physiologically important, rapid up-regulation. PMID:28018137

Normal Genetic Variation, Cognition, and Aging

PubMed Central

Greenwood, P. M.; Parasuraman, Raja

2005-01-01

This article reviews the modulation of cognitive function by normal genetic variation. Although the heritability of “g” is well established, the genes that modulate specific cognitive functions are largely unidentified. Application of the allelic association approach to individual differences in cognition has begun to reveal the effects of single nucleotide polymorphisms on specific and general cognitive functions. This article proposes a framework for relating genotype to cognitive phenotype by considering the effect of genetic variation on the protein product of specific genes within the context of the neural basis of particular cognitive domains. Specificity of effects is considered, from genes controlling part of one receptor type to genes controlling agents of neuronal repair, and evidence is reviewed of cognitive modulation by polymorphisms in dopaminergic and cholinergic receptor genes, dopaminergic enzyme genes, and neurotrophic genes. Although allelic variation in certain genes can be reliably linked to cognition—specifically to components of attention, working memory, and executive function in healthy adults—the specificity, generality, and replicability of the effects are not fully known. PMID:15006290

A Plasmodium falciparum copper-binding membrane protein with copper transport motifs

PubMed Central

2012-01-01

Background Copper is an essential catalytic co-factor for metabolically important cellular enzymes, such as cytochrome-c oxidase. Eukaryotic cells acquire copper through a copper transport protein and distribute intracellular copper using molecular chaperones. The copper chelator, neocuproine, inhibits Plasmodium falciparum ring-to-trophozoite transition in vitro, indicating a copper requirement for malaria parasite development. How the malaria parasite acquires or secretes copper still remains to be fully elucidated. Methods PlasmoDB was searched for sequences corresponding to candidate P. falciparum copper-requiring proteins. The amino terminal domain of a putative P. falciparum copper transport protein was cloned and expressed as a maltose binding fusion protein. The copper binding ability of this protein was examined. Copper transport protein-specific anti-peptide antibodies were generated in chickens and used to establish native protein localization in P. falciparum parasites by immunofluorescence microscopy. Results Six P. falciparum copper-requiring protein orthologs and a candidate P. falciparum copper transport protein (PF14_0369), containing characteristic copper transport protein features, were identified in PlasmoDB. The recombinant amino terminal domain of the transport protein bound reduced copper in vitro and within Escherichia coli cells during recombinant expression. Immunolocalization studies tracked the copper binding protein translocating from the erythrocyte plasma membrane in early ring stage to a parasite membrane as the parasites developed to schizonts. The protein appears to be a PEXEL-negative membrane protein. Conclusion Plasmodium falciparum parasites express a native protein with copper transporter characteristics that binds copper in vitro. Localization of the protein to the erythrocyte and parasite plasma membranes could provide a mechanism for the delivery of novel anti-malarial compounds. PMID:23190769

An interplay between 2 signaling pathways: Melatonin-cAMP and IP{sub 3}–Ca{sup 2+} signaling pathways control intraerythrocytic development of the malaria parasite Plasmodium falciparum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Furuyama, Wakako; Enomoto, Masahiro; Mossaad, Ehab

Highlights: • A melatonin receptor antagonist blocked Ca{sup 2+} oscillation in P. falciparum and inhibited parasite growth. • P. falciparum development is controlled by Ca{sup 2+}- and cAMP-signaling pathways. • The cAMP-signaling pathway at ring form and late trophozoite stages governs parasite growth of P. falciparum. - Abstract: Plasmodium falciparum spends most of its asexual life cycle within human erythrocytes, where proliferation and maturation occur. Development into the mature forms of P. falciparum causes severe symptoms due to its distinctive sequestration capability. However, the physiological roles and the molecular mechanisms of signaling pathways that govern development are poorly understood. Ourmore » previous study showed that P. falciparum exhibits stage-specific spontaneous Calcium (Ca{sup 2+}) oscillations in ring and early trophozoites, and the latter was essential for parasite development. In this study, we show that luzindole (LZ), a selective melatonin receptor antagonist, inhibits parasite growth. Analyses of development and morphology of LZ-treated P. falciparum revealed that LZ severely disrupted intraerythrocytic maturation, resulting in parasite death. When LZ was added at ring stage, the parasite could not undergo further development, whereas LZ added at the trophozoite stage inhibited development from early into late schizonts. Live-cell Ca{sup 2+} imaging showed that LZ treatment completely abolished Ca{sup 2+} oscillation in the ring forms while having little effect on early trophozoites. Further, the melatonin-induced cAMP increase observed at ring and late trophozoite stage was attenuated by LZ treatment. These suggest that a complex interplay between IP{sub 3}–Ca{sup 2+} and cAMP signaling pathways is involved in intraerythrocytic development of P. falciparum.« less

Hypoxia/hepatoma dual specific suicide gene expression plasmid delivery using bio-reducible polymer for hepatocellular carcinoma therapy.

PubMed

Kim, Hyun Ah; Nam, Kihoon; Lee, Minhyung; Kim, Sung Wan

2013-10-10

Gene therapy is suggested as a promising alternative strategy of hepatocellular carcinoma (HCC, also called hepatoma) therapy. To achieve a successful and safe gene therapy, tight regulation of gene expression is required to minimize side-effects in normal tissues. In this study, we developed a novel hypoxia and hepatoma dual specific gene expression vector. The constructed vectors were transfected into various cell lines using bio-reducible polymer, PAM-ABP. First, pAFPS-Luc or pAFPL-Luc vector was constructed with the alpha-fectoprotein (AFP) promoter and enhancer for hepatoma tissue specific gene expression. Then, pEpo-AFPL-Luc was constructed by insertion of the erythropoietin (Epo) enhancer for hypoxic cancer specific gene expression. In vitro transfection assay showed that pEpo-AFPL-Luc transfected hepatoma cell increased gene expression under hypoxic condition. To confirm the therapeutic effect of dual specific vector, herpes simplex virus thymidine kinase (HSV-TK) gene was introduced for cancer cell killing. The pEpo-AFPL-TK was transfected into hepatoma cell lines in the presence of ganciclovir (GCV) pro-drug. Caspase-3/7, MTT and TUNEL assays elucidated that pEpo-AFPL-TK transfected cells showed significant increasing of death rate in hypoxic hepatoma cells compared to controls. Therefore, the hypoxia/hepatoma dual specific gene expression vector with the Epo enhancer and AFP promoter may be useful for hepatoma specific gene therapy. © 2013.

A meta-analysis of public microarray data identifies biological regulatory networks in Parkinson's disease.

PubMed

Su, Lining; Wang, Chunjie; Zheng, Chenqing; Wei, Huiping; Song, Xiaoqing

2018-04-13

Parkinson's disease (PD) is a long-term degenerative disease that is caused by environmental and genetic factors. The networks of genes and their regulators that control the progression and development of PD require further elucidation. We examine common differentially expressed genes (DEGs) from several PD blood and substantia nigra (SN) microarray datasets by meta-analysis. Further we screen the PD-specific genes from common DEGs using GCBI. Next, we used a series of bioinformatics software to analyze the miRNAs, lncRNAs and SNPs associated with the common PD-specific genes, and then identify the mTF-miRNA-gene-gTF network. Our results identified 36 common DEGs in PD blood studies and 17 common DEGs in PD SN studies, and five of the genes were previously known to be associated with PD. Further study of the regulatory miRNAs associated with the common PD-specific genes revealed 14 PD-specific miRNAs in our study. Analysis of the mTF-miRNA-gene-gTF network about PD-specific genes revealed two feed-forward loops: one involving the SPRK2 gene, hsa-miR-19a-3p and SPI1, and the second involving the SPRK2 gene, hsa-miR-17-3p and SPI. The long non-coding RNA (lncRNA)-mediated regulatory network identified lncRNAs associated with PD-specific genes and PD-specific miRNAs. Moreover, single nucleotide polymorphism (SNP) analysis of the PD-specific genes identified two significant SNPs, and SNP analysis of the neurodegenerative disease-specific genes identified seven significant SNPs. Most of these SNPs are present in the 3'-untranslated region of genes and are controlled by several miRNAs. Our study identified a total of 53 common DEGs in PD patients compared with healthy controls in blood and brain datasets and five of these genes were previously linked with PD. Regulatory network analysis identified PD-specific miRNAs, associated long non-coding RNA and feed-forward loops, which contribute to our understanding of the mechanisms underlying PD. The SNPs identified in our study can determine whether a genetic variant is associated with PD. Overall, these findings will help guide our study of the complex molecular mechanism of PD.

Gene trap and gene inversion methods for conditional gene inactivation in the mouse

PubMed Central

Xin, Hong-Bo; Deng, Ke-Yu; Shui, Bo; Qu, Shimian; Sun, Qi; Lee, Jane; Greene, Kai Su; Wilson, Jason; Yu, Ying; Feldman, Morris; Kotlikoff, Michael I.

2005-01-01

Conditional inactivation of individual genes in mice using site-specific recombinases is an extremely powerful method for determining the complex roles of mammalian genes in developmental and tissue-specific contexts, a major goal of post-genomic research. However, the process of generating mice with recombinase recognition sequences placed at specific locations within a gene, while maintaining a functional allele, is time consuming, expensive and technically challenging. We describe a system that combines gene trap and site-specific DNA inversion to generate mouse embryonic stem (ES) cell clones for the rapid production of conditional knockout mice, and the use of this system in an initial gene trap screen. Gene trapping should allow the selection of thousands of ES cell clones with defined insertions that can be used to generate conditional knockout mice, thereby providing extensive parallelism that eliminates the time-consuming steps of targeting vector construction and homologous recombination for each gene. PMID:15659575

Major Shifts in Glial Regional Identity Are a Transcriptional Hallmark of Human Brain Aging.

PubMed

Soreq, Lilach; Rose, Jamie; Soreq, Eyal; Hardy, John; Trabzuni, Daniah; Cookson, Mark R; Smith, Colin; Ryten, Mina; Patani, Rickie; Ule, Jernej

2017-01-10

Gene expression studies suggest that aging of the human brain is determined by a complex interplay of molecular events, although both its region- and cell-type-specific consequences remain poorly understood. Here, we extensively characterized aging-altered gene expression changes across ten human brain regions from 480 individuals ranging in age from 16 to 106 years. We show that astrocyte- and oligodendrocyte-specific genes, but not neuron-specific genes, shift their regional expression patterns upon aging, particularly in the hippocampus and substantia nigra, while the expression of microglia- and endothelial-specific genes increase in all brain regions. In line with these changes, high-resolution immunohistochemistry demonstrated decreased numbers of oligodendrocytes and of neuronal subpopulations in the aging brain cortex. Finally, glial-specific genes predict age with greater precision than neuron-specific genes, thus highlighting the need for greater mechanistic understanding of neuron-glia interactions in aging and late-life diseases. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Inheritance of partial resistance against Colletotrichum lindemuthianum in Phaseolus vulgaris and co-localization of quantitative trait loci with genes involved in specific resistance.

PubMed

Geffroy, V; Sévignac, M; De Oliveira, J C; Fouilloux, G; Skroch, P; Thoquet, P; Gepts, P; Langin, T; Dron, M

2000-03-01

Anthracnose, one of the most important diseases of common bean (Phaseolus vulgaris), is caused by the fungus Colletotrichum lindemuthianum. A "candidate gene" approach was used to map anthracnose resistance quantitative trait loci (QTL). Candidate genes included genes for both pathogen recognition (resistance genes and resistance gene analogs [RGAs]) and general plant defense (defense response genes). Two strains of C. lindemuthianum, identified in a world collection of 177 strains, displayed a reproducible and differential aggressiveness toward BAT93 and JaloEEP558, two parental lines of P. vulgaris representing the two major gene pools of this crop. A reliable test was developed to score partial resistance in aerial organs of the plant (stem, leaf, petiole) under controlled growth chamber conditions. BAT93 was more resistant than JaloEEP558 regardless of the organ or strain tested. With a recombinant inbred line (RIL) population derived from a cross between these two parental lines, 10 QTL were located on a genetic map harboring 143 markers, including known defense response genes, anthracnose-specific resistance genes, and RGAs. Eight of the QTL displayed isolate specificity. Two were co-localized with known defense genes (phenylalanine ammonia-lyase and hydroxyproline-rich glycoprotein) and three with anthracnose-specific resistance genes and/or RGAs. Interestingly, two QTL, with different allelic contribution, mapped on linkage group B4 in a 5.0 cM interval containing Andean and Mesoamerican specific resistance genes against C. lindemuthianum and 11 polymorphic fragments revealed with a RGA probe. The possible relationship between genes underlying specific and partial resistance is discussed.

Adjusting for background mutation frequency biases improves the identification of cancer driver genes.

PubMed

Evans, Perry; Avey, Stefan; Kong, Yong; Krauthammer, Michael

2013-09-01

A common goal of tumor sequencing projects is finding genes whose mutations are selected for during tumor development. This is accomplished by choosing genes that have more non-synonymous mutations than expected from an estimated background mutation frequency. While this background frequency is unknown, it can be estimated using both the observed synonymous mutation frequency and the non-synonymous to synonymous mutation ratio. The synonymous mutation frequency can be determined across all genes or in a gene-specific manner. This choice introduces an interesting trade-off. A gene-specific frequency adjusts for an underlying mutation bias, but is difficult to estimate given missing synonymous mutation counts. Using a genome-wide synonymous frequency is more robust, but is less suited for adjusting biases. Studying four evaluation criteria for identifying genes with high non-synonymous mutation burden (reflecting preferential selection of expressed genes, genes with mutations in conserved bases, genes with many protein interactions, and genes that show loss of heterozygosity), we find that the gene-specific synonymous frequency is superior in the gene expression and protein interaction tests. In conclusion, the use of the gene-specific synonymous mutation frequency is well suited for assessing a gene's non-synonymous mutation burden.

The Association of Multiple Interacting Genes with Specific Phenotypes in Rice Using Gene Coexpression Networks1[C][W][OA

PubMed Central

Ficklin, Stephen P.; Luo, Feng; Feltus, F. Alex

2010-01-01

Discovering gene sets underlying the expression of a given phenotype is of great importance, as many phenotypes are the result of complex gene-gene interactions. Gene coexpression networks, built using a set of microarray samples as input, can help elucidate tightly coexpressed gene sets (modules) that are mixed with genes of known and unknown function. Functional enrichment analysis of modules further subdivides the coexpressed gene set into cofunctional gene clusters that may coexist in the module with other functionally related gene clusters. In this study, 45 coexpressed gene modules and 76 cofunctional gene clusters were discovered for rice (Oryza sativa) using a global, knowledge-independent paradigm and the combination of two network construction methodologies. Some clusters were enriched for previously characterized mutant phenotypes, providing evidence for specific gene sets (and their annotated molecular functions) that underlie specific phenotypes. PMID:20668062

The association of multiple interacting genes with specific phenotypes in rice using gene coexpression networks.

PubMed

Ficklin, Stephen P; Luo, Feng; Feltus, F Alex

2010-09-01

Discovering gene sets underlying the expression of a given phenotype is of great importance, as many phenotypes are the result of complex gene-gene interactions. Gene coexpression networks, built using a set of microarray samples as input, can help elucidate tightly coexpressed gene sets (modules) that are mixed with genes of known and unknown function. Functional enrichment analysis of modules further subdivides the coexpressed gene set into cofunctional gene clusters that may coexist in the module with other functionally related gene clusters. In this study, 45 coexpressed gene modules and 76 cofunctional gene clusters were discovered for rice (Oryza sativa) using a global, knowledge-independent paradigm and the combination of two network construction methodologies. Some clusters were enriched for previously characterized mutant phenotypes, providing evidence for specific gene sets (and their annotated molecular functions) that underlie specific phenotypes.

A computational approach to identify cellular heterogeneity and tissue-specific gene regulatory networks.

PubMed

Jambusaria, Ankit; Klomp, Jeff; Hong, Zhigang; Rafii, Shahin; Dai, Yang; Malik, Asrar B; Rehman, Jalees

2018-06-07

The heterogeneity of cells across tissue types represents a major challenge for studying biological mechanisms as well as for therapeutic targeting of distinct tissues. Computational prediction of tissue-specific gene regulatory networks may provide important insights into the mechanisms underlying the cellular heterogeneity of cells in distinct organs and tissues. Using three pathway analysis techniques, gene set enrichment analysis (GSEA), parametric analysis of gene set enrichment (PGSEA), alongside our novel model (HeteroPath), which assesses heterogeneously upregulated and downregulated genes within the context of pathways, we generated distinct tissue-specific gene regulatory networks. We analyzed gene expression data derived from freshly isolated heart, brain, and lung endothelial cells and populations of neurons in the hippocampus, cingulate cortex, and amygdala. In both datasets, we found that HeteroPath segregated the distinct cellular populations by identifying regulatory pathways that were not identified by GSEA or PGSEA. Using simulated datasets, HeteroPath demonstrated robustness that was comparable to what was seen using existing gene set enrichment methods. Furthermore, we generated tissue-specific gene regulatory networks involved in vascular heterogeneity and neuronal heterogeneity by performing motif enrichment of the heterogeneous genes identified by HeteroPath and linking the enriched motifs to regulatory transcription factors in the ENCODE database. HeteroPath assesses contextual bidirectional gene expression within pathways and thus allows for transcriptomic assessment of cellular heterogeneity. Unraveling tissue-specific heterogeneity of gene expression can lead to a better understanding of the molecular underpinnings of tissue-specific phenotypes.

Genes contributing to the development of alcoholism: an overview.

PubMed

Edenberg, Howard J

2012-01-01

Genetic factors (i.e., variations in specific genes) account for a substantial portion of the risk for alcoholism. However, identifying those genes and the specific variations involved is challenging. Researchers have used both case-control and family studies to identify genes related to alcoholism risk. In addition, different strategies such as candidate gene analyses and genome-wide association studies have been used. The strongest effects have been found for specific variants of genes that encode two enzymes involved in alcohol metabolism-alcohol dehydrogenase and aldehyde dehydrogenase. Accumulating evidence indicates that variations in numerous other genes have smaller but measurable effects.

Targeting gene therapy to cancer: a review.

PubMed

Dachs, G U; Dougherty, G J; Stratford, I J; Chaplin, D J

1997-01-01

In recent years the idea of using gene therapy as a modality in the treatment of diseases other than genetically inherited, monogenic disorders has taken root. This is particularly obvious in the field of oncology where currently more than 100 clinical trials have been approved worldwide. This report will summarize some of the exciting progress that has recently been made with respect to both targeting the delivery of potentially therapeutic genes to tumor sites and regulating their expression within the tumor microenvironment. In order to specifically target malignant cells while at the same time sparing normal tissue, cancer gene therapy will need to combine highly selective gene delivery with highly specific gene expression, specific gene product activity, and, possibly, specific drug activation. Although the efficient delivery of DNA to tumor sites remains a formidable task, progress has been made in recent years using both viral (retrovirus, adenovirus, adeno-associated virus) and nonviral (liposomes, gene gun, injection) methods. In this report emphasis will be placed on targeted rather than high-efficiency delivery, although those would need to be combined in the future for effective therapy. To date delivery has been targeted to tumor-specific and tissue-specific antigens, such as epithelial growth factor receptor, c-kit receptor, and folate receptor, and these will be described in some detail. To increase specificity and safety of gene therapy further, the expression of the therapeutic gene needs to be tightly controlled within the target tissue. Targeted gene expression has been analyzed using tissue-specific promoters (breast-, prostate-, and melanoma-specific promoters) and disease-specific promoters (carcinoembryonic antigen, HER-2/neu, Myc-Max response elements, DF3/MUC). Alternatively, expression could be regulated externally with the use of radiation-induced promoters or tetracycline-responsive elements. Another novel possibility that will be discussed is the regulation of therapeutic gene products by tumor-specific gene splicing. Gene expression could also be targeted at conditions specific to the tumor microenvironment, such as glucose deprivation and hypoxia. We have concentrated on hypoxia-targeted gene expression and this report will discuss our progress in detail. Chronic hypoxia occurs in tissue that is more than 100-200 microns away from a functional blood supply. In solid tumors hypoxia is widespread both because cancer cells are more prolific than the invading endothelial cells that make up the blood vessels and because the newly formed blood supply is disorganized. Measurements of oxygen partial pressure in patients' tumors showed a high percentage of severe hypoxia readings (less than 2.5 mmHg), readings not seen in normal tissue. This is a major problem in the treatment of cancer, because hypoxic cells are resistant to radiotherapy and often to chemotherapy. However, severe hypoxia is also a physiological condition specific to tumors, which makes it a potentially exploitable target. We have utilized hypoxia response elements (HRE) derived from the oxygen-regulated phosphoglycerate kinase gene to control gene expression in human tumor cells in vitro and in experimental tumors. The list of genes that have been considered for use in the treatment of cancer is extensive. It includes cytokines and costimulatory cell surface molecules intended to induce an effective systemic immune response against tumor antigens that would not otherwise develop. Other inventive strategies include the use of internally expressed antibodies to target oncogenic proteins (intrabodies) and the use of antisense technology (antisense oligonucleotides, antigenes, and ribozymes). This report will concentrate more on novel genes encoding prodrug activating enzymes, so-called suicide genes (Herpes simplex virus thymidine kinase, Escherichia coli nitroreductase, E. (ABSTRACT TRUNCATED)

Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

PubMed

Firnhaber, Christopher; Hammarlund, Marc

2013-11-01

Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

Sex linkage, sex-specific selection, and the role of recombination in the evolution of sexually dimorphic gene expression.

PubMed

Connallon, Tim; Clark, Andrew G

2010-12-01

Sex-biased genes--genes that are differentially expressed within males and females--are nonrandomly distributed across animal genomes, with sex chromosomes and autosomes often carrying markedly different concentrations of male- and female-biased genes. These linkage patterns are often gene- and lineage-dependent, differing between functional genetic categories and between species. Although sex-specific selection is often hypothesized to shape the evolution of sex-linked and autosomal gene content, population genetics theory has yet to account for many of the gene- and lineage-specific idiosyncrasies emerging from the empirical literature. With the goal of improving the connection between evolutionary theory and a rapidly growing body of genome-wide empirical studies, we extend previous population genetics theory of sex-specific selection by developing and analyzing a biologically informed model that incorporates sex linkage, pleiotropy, recombination, and epistasis, factors that are likely to vary between genes and between species. Our results demonstrate that sex-specific selection and sex-specific recombination rates can generate, and are compatible with, the gene- and species-specific linkage patterns reported in the genomics literature. The theory suggests that sexual selection may strongly influence the architectures of animal genomes, as well as the chromosomal distribution of fixed substitutions underlying sexually dimorphic traits. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

SoxB1-driven transcriptional network underlies neural-specific interpretation of morphogen signals.

PubMed

Oosterveen, Tony; Kurdija, Sanja; Ensterö, Mats; Uhde, Christopher W; Bergsland, Maria; Sandberg, Magnus; Sandberg, Rickard; Muhr, Jonas; Ericson, Johan

2013-04-30

The reiterative deployment of a small cadre of morphogen signals underlies patterning and growth of most tissues during embyogenesis, but how such inductive events result in tissue-specific responses remains poorly understood. By characterizing cis-regulatory modules (CRMs) associated with genes regulated by Sonic hedgehog (Shh), retinoids, or bone morphogenetic proteins in the CNS, we provide evidence that the neural-specific interpretation of morphogen signaling reflects a direct integration of these pathways with SoxB1 proteins at the CRM level. Moreover, expression of SoxB1 proteins in the limb bud confers on mesodermal cells the potential to activate neural-specific target genes upon Shh, retinoid, or bone morphogenetic protein signaling, and the collocation of binding sites for SoxB1 and morphogen-mediatory transcription factors in CRMs faithfully predicts neural-specific gene activity. Thus, an unexpectedly simple transcriptional paradigm appears to conceptually explain the neural-specific interpretation of pleiotropic signaling during vertebrate development. Importantly, genes induced in a SoxB1-dependent manner appear to constitute repressive gene regulatory networks that are directly interlinked at the CRM level to constrain the regional expression of patterning genes. Accordingly, not only does the topology of SoxB1-driven gene regulatory networks provide a tissue-specific mode of gene activation, but it also determines the spatial expression pattern of target genes within the developing neural tube.

Spermatogenesis Drives Rapid Gene Creation and Masculinization of the X Chromosome in Stalk-Eyed Flies (Diopsidae).

PubMed

Baker, Richard H; Narechania, Apurva; DeSalle, Rob; Johns, Philip M; Reinhardt, Josephine A; Wilkinson, Gerald S

2016-03-26

Throughout their evolutionary history, genomes acquire new genetic material that facilitates phenotypic innovation and diversification. Developmental processes associated with reproduction are particularly likely to involve novel genes. Abundant gene creation impacts the evolution of chromosomal gene content and general regulatory mechanisms such as dosage compensation. Numerous studies in model organisms have found complex and, at times contradictory, relationships among these genomic attributes highlighting the need to examine these patterns in other systems characterized by abundant sexual selection. Therefore, we examined the association among novel gene creation, tissue-specific gene expression, and chromosomal gene content within stalk-eyed flies. Flies in this family are characterized by strong sexual selection and the presence of a newly evolved X chromosome. We generated RNA-seq transcriptome data from the testes for three species within the family and from seven additional tissues in the highly dimorphic species,Teleopsis dalmanni Analysis of dipteran gene orthology reveals dramatic testes-specific gene creation in stalk-eyed flies, involving numerous gene families that are highly conserved in other insect groups. Identification of X-linked genes for the three species indicates that the X chromosome arose prior to the diversification of the family. The most striking feature of this X chromosome is that it is highly masculinized, containing nearly twice as many testes-specific genes as expected based on its size. All the major processes that may drive differential sex chromosome gene content-creation of genes with male-specific expression, development of male-specific expression from pre-existing genes, and movement of genes with male-specific expression-are elevated on the X chromosome ofT. dalmanni This masculinization occurs despite evidence that testes expressed genes do not achieve the same levels of gene expression on the X chromosome as they do on the autosomes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Tissue-Specific Profiling Reveals Transcriptome Alterations in Arabidopsis Mutants Lacking Morphological Phenotypes[C][W

PubMed Central

Simon, Marissa; Bruex, Angela; Kainkaryam, Raghunandan M.; Zheng, Xiaohua; Huang, Ling; Woolf, Peter J.; Schiefelbein, John

2013-01-01

Traditional genetic analysis relies on mutants with observable phenotypes. Mutants lacking visible abnormalities may nevertheless exhibit molecular differences useful for defining gene function. To examine this, we analyzed tissue-specific transcript profiles from Arabidopsis thaliana transcription factor gene mutants with known roles in root epidermis development, but lacking a single-gene mutant phenotype due to genetic redundancy. We discovered substantial transcriptional changes in each mutant, preferentially affecting root epidermal genes in a manner consistent with the known double mutant effects. Furthermore, comparing transcript profiles of single and double mutants, we observed remarkable variation in the sensitivity of target genes to the loss of one or both paralogous genes, including preferential effects on specific branches of the epidermal gene network, likely reflecting the pathways of paralog subfunctionalization during evolution. In addition, we analyzed the root epidermal transcriptome of the transparent testa glabra2 mutant to clarify its role in the network. These findings provide insight into the molecular basis of genetic redundancy and duplicate gene diversification at the level of a specific gene regulatory network, and they demonstrate the usefulness of tissue-specific transcript profiling to define gene function in mutants lacking informative visible changes in phenotype. PMID:24014549

A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

PubMed Central

2014-01-01

Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

[Laboratory analysis of the first case of imported oval malaria in Rizhao City].

PubMed

Chao, Li; Ying, Zhang; Ting, Xiao

2016-01-25

To diagnose the first imported case of Plasmodium ovale infection by laboratory detection. The epidemiological data and blood samples of the case were collected, and the samples were detected by the microscopic examination, rapid diagnostic test (RDT) and nested PCR. The patient was a construction worker backing from Congo, Africa. He experienced the symptoms of irregular fever and weakness one month after returning in Lingyang Town, Junxian County. The results of RDT only suggested no- Plasmodium falciparum infection. Under the microscope, it was seen that the infected RBC were obviously disfigured and in irregular shape, the ring forms were thick and big, and also thick granulas in big trophozoite stage and schizont stage were found. The results of PCR showed that the size of amplified product was about 800 bp, which was conformed to that of P. ovale . Though microscopic examination is the golden standard for malaria diagnosis, as P. ovale is difficult to be identified under microscope, the microscopic method combined with PCR test can be used for definite diagnosis.

In vitro activity of tafenoquine alone and in combination with artemisinin against Plasmodium falciparum.

PubMed

Ramharter, Michael; Noedl, Harald; Thimasarn, Krongthong; Wiedermann, Gerhard; Wernsdorfer, Gunther; Wernsdorfer, Walther H

2002-07-01

Emergence and spread of drug-resistant falciparum malaria has created an urgent demand for alternative therapeutic agents. This study was conducted to assess the in vitro blood schizontocidal activity of tafenoquine, the most advanced candidate drug of the 8-aminoquinolines, and of its 1:1 combination with artemisinin in fresh isolates of Plasmodium falciparum in an area with multi-drug resistance, measuring the inhibition of schizont maturation. In 43 successfully tested parasite isolates, the mean effective concentrations (ECs) of tafenoquine were 209 nmol/L for the EC50, and 1,414 nmol/L for the EC90. Tafenoquine showed no significant activity relationships with mefloquine, artemisinin, and chloroquine. With quinine, a highly significant activity relationship was observed at the EC50, but not at the EC90. The EC50, and EC90 of the tafenoquine-artemisinin combination were 15.9 nmol/L and 84.3 nmol/L. The combination was synergistic. Tafenoquine appears to be a promising candidate for treating multidrug-resistant falciparum malaria, especially in combination with artemisinin derivatives.

SpeCond: a method to detect condition-specific gene expression

PubMed Central

2011-01-01

Transcriptomic studies routinely measure expression levels across numerous conditions. These datasets allow identification of genes that are specifically expressed in a small number of conditions. However, there are currently no statistically robust methods for identifying such genes. Here we present SpeCond, a method to detect condition-specific genes that outperforms alternative approaches. We apply the method to a dataset of 32 human tissues to determine 2,673 specifically expressed genes. An implementation of SpeCond is freely available as a Bioconductor package at http://www.bioconductor.org/packages/release/bioc/html/SpeCond.html. PMID:22008066

Identification of rhizome-specific genes by genome-wide differential expression analysis in Oryza longistaminata.

PubMed

Hu, Fengyi; Wang, Di; Zhao, Xiuqin; Zhang, Ting; Sun, Haixi; Zhu, Linghua; Zhang, Fan; Li, Lijuan; Li, Qiong; Tao, Dayun; Fu, Binying; Li, Zhikang

2011-01-24

Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their regulated pathways. Auxin/IAA appears to act as a negative regulator in rhizome development, while GA acts as the activator in rhizome development. Co-localization of the genes specifically expressed in rhizome tips and rhizome internodes with the QTLs for rhizome traits identified a large set of candidate genes for rhizome initiation and development in rice for further confirmation.

A novel non prophage(-like) gene-intervening element within gerE that is reconstituted during sporulation in Bacillus cereus ATCC10987.

PubMed

Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu

2017-09-12

Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

PubMed

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Digital gene expression analysis of the zebra finch genome

PubMed Central

2010-01-01

Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates. PMID:20359325

Genetic analysis of the resistance to eight anthracnose races in the common bean differential cultivar Kaboon.

PubMed

Campa, Ana; Giraldez, Ramón; Ferreira, Juan José

2011-06-01

Resistance to the eight races (3, 7, 19, 31, 81, 449, 453, and 1545) of the pathogenic fungus Colletotrichum lindemuthianum (anthracnose) was evaluated in F(3) families derived from the cross between the anthracnose differential bean cultivars Kaboon and Michelite. Molecular marker analyses were carried out in the F(2) individuals in order to map and characterize the anthracnose resistance genes or gene clusters present in Kaboon. The analysis of the combined segregations indicates that the resistance present in Kaboon against these eight anthracnose races is determined by 13 different race-specific genes grouped in three clusters. One of these clusters, corresponding to locus Co-1 in linkage group (LG) 1, carries two dominant genes conferring specific resistance to races 81 and 1545, respectively, and a gene necessary (dominant complementary gene) for the specific resistance to race 31. A second cluster, corresponding to locus Co-3/9 in LG 4, carries six dominant genes conferring specific resistance to races 3, 7, 19, 449, 453, and 1545, respectively, and the second dominant complementary gene for the specific resistance to race 31. A third cluster of unknown location carries three dominant genes conferring specific resistance to races 449, 453, and 1545, respectively. This is the first time that two anthracnose resistance genes with a complementary mode of action have been mapped in common bean and their relationship with previously known Co- resistance genes established.

Association of 5-hydroxymethylation and 5-methylation of DNA cytosine with tissue-specific gene expression

PubMed Central

Ponnaluri, V. K. Chaithanya; Ehrlich, Kenneth C.; Zhang, Guoqiang; Lacey, Michelle; Johnston, Douglas; Pradhan, Sriharsa; Ehrlich, Melanie

2017-01-01

ABSTRACT Differentially methylated or hydroxymethylated regions (DMRs) in mammalian DNA are often associated with tissue-specific gene expression but the functional relationships are still being unraveled. To elucidate these relationships, we studied 16 human genes containing myogenic DMRs by analyzing profiles of their epigenetics and transcription and quantitatively assaying 5-hydroxymethylcytosine (5hmC) and 5-methylcytosine (5mC) at specific sites in these genes in skeletal muscle (SkM), myoblasts, heart, brain, and diverse other samples. Although most human promoters have little or no methylation regardless of expression, more than half of the genes that we chose to study—owing to their myogenic DMRs—overlapped tissue-specific alternative or cryptic promoters displaying corresponding tissue-specific differences in histone modifications. The 5mC levels in myoblast DMRs were significantly associated with 5hmC levels in SkM at the same site. Hypermethylated myogenic DMRs within CDH15, a muscle- and cerebellum-specific cell adhesion gene, and PITX3, a homeobox gene, were used for transfection in reporter gene constructs. These intragenic DMRs had bidirectional tissue-specific promoter activity that was silenced by in vivo-like methylation. The CDH15 DMR, which was previously associated with an imprinted maternal germline DMR in mice, had especially strong promoter activity in myogenic host cells. These findings are consistent with the controversial hypothesis that intragenic DNA methylation can facilitate transcription and is not just a passive consequence of it. Our results support varied roles for tissue-specific 5mC- or 5hmC-enrichment in suppressing inappropriate gene expression from cryptic or alternative promoters and in increasing the plasticity of gene expression required for development and rapid responses to tissue stress or damage. PMID:27911668

STAT3 or USF2 Contributes to HIF Target Gene Specificity

PubMed Central

Pawlus, Matthew R.; Wang, Liyi; Murakami, Aya; Dai, Guanhai; Hu, Cheng-Jun

2013-01-01

The HIF1- and HIF2-mediated transcriptional responses play critical roles in solid tumor progression. Despite significant similarities, including their binding to promoters of both HIF1 and HIF2 target genes, HIF1 and HIF2 proteins activate unique subsets of target genes under hypoxia. The mechanism for HIF target gene specificity has remained unclear. Using siRNA or inhibitor, we previously reported that STAT3 or USF2 is specifically required for activation of endogenous HIF1 or HIF2 target genes. In this study, using reporter gene assays and chromatin immuno-precipitation, we find that STAT3 or USF2 exhibits specific binding to the promoters of HIF1 or HIF2 target genes respectively even when over-expressed. Functionally, HIF1α interacts with STAT3 to activate HIF1 target gene promoters in a HIF1α HLH/PAS and N-TAD dependent manner while HIF2α interacts with USF2 to activate HIF2 target gene promoters in a HIF2α N-TAD dependent manner. Physically, HIF1α HLH and PAS domains are required for its interaction with STAT3 while both N- and C-TADs of HIF2α are involved in physical interaction with USF2. Importantly, addition of functional USF2 binding sites into a HIF1 target gene promoter increases the basal activity of the promoter as well as its response to HIF2+USF2 activation while replacing HIF binding site with HBS from a HIF2 target gene does not change the specificity of the reporter gene. Importantly, RNA Pol II on HIF1 or HIF2 target genes is primarily associated with HIF1α or HIF2α in a STAT3 or USF2 dependent manner. Thus, we demonstrate here for the first time that HIF target gene specificity is achieved by HIF transcription partners that are required for HIF target gene activation, exhibit specific binding to the promoters of HIF1 or HIF2 target genes and selectively interact with HIF1α or HIF2α protein. PMID:23991099

The Caenorhabditis chemoreceptor gene families.

PubMed

Thomas, James H; Robertson, Hugh M

2008-10-06

Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

The Caenorhabditis chemoreceptor gene families

PubMed Central

Thomas, James H; Robertson, Hugh M

2008-01-01

Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space. PMID:18837995

Homoeolog-specific transcriptional bias in allopolyploid wheat

PubMed Central

2010-01-01

Background Interaction between parental genomes is accompanied by global changes in gene expression which, eventually, contributes to growth vigor and the broader phenotypic diversity of allopolyploid species. In order to gain a better understanding of the effects of allopolyploidization on the regulation of diverged gene networks, we performed a genome-wide analysis of homoeolog-specific gene expression in re-synthesized allohexaploid wheat created by the hybridization of a tetraploid derivative of hexaploid wheat with the diploid ancestor of the wheat D genome Ae. tauschii. Results Affymetrix wheat genome arrays were used for both the discovery of divergent homoeolog-specific mutations and analysis of homoeolog-specific gene expression in re-synthesized allohexaploid wheat. More than 34,000 detectable parent-specific features (PSF) distributed across the wheat genome were used to assess AB genome (could not differentiate A and B genome contributions) and D genome parental expression in the allopolyploid transcriptome. In re-synthesized polyploid 81% of PSFs detected mid-parent levels of gene expression, and only 19% of PSFs showed the evidence of non-additive expression. Non-additive expression in both AB and D genomes was strongly biased toward up-regulation of parental type of gene expression with only 6% and 11% of genes, respectively, being down-regulated. Of all the non-additive gene expression, 84% can be explained by differences in the parental genotypes used to make the allopolyploid. Homoeolog-specific co-regulation of several functional gene categories was found, particularly genes involved in photosynthesis and protein biosynthesis in wheat. Conclusions Here, we have demonstrated that the establishment of interactions between the diverged regulatory networks in allopolyploids is accompanied by massive homoeolog-specific up- and down-regulation of gene expression. This study provides insights into interactions between homoeologous genomes and their role in growth vigor, development, and fertility of allopolyploid species. PMID:20849627

PanGEA: identification of allele specific gene expression using the 454 technology.

PubMed

Kofler, Robert; Teixeira Torres, Tatiana; Lelley, Tamas; Schlötterer, Christian

2009-05-14

Next generation sequencing technologies hold great potential for many biological questions. While mainly used for genomic sequencing, they are also very promising for gene expression profiling. Sequencing of cDNA does not only provide an estimate of the absolute expression level, it can also be used for the identification of allele specific gene expression. We developed PanGEA, a tool which enables a fast and user-friendly analysis of allele specific gene expression using the 454 technology. PanGEA allows mapping of 454-ESTs to genes or whole genomes, displaying gene expression profiles, identification of SNPs and the quantification of allele specific gene expression. The intuitive GUI of PanGEA facilitates a flexible and interactive analysis of the data. PanGEA additionally implements a modification of the Smith-Waterman algorithm which deals with incorrect estimates of homopolymer length as occuring in the 454 technology To our knowledge, PanGEA is the first tool which facilitates the identification of allele specific gene expression. PanGEA is distributed under the Mozilla Public License and available at: http://www.kofler.or.at/bioinformatics/PanGEA

PanGEA: Identification of allele specific gene expression using the 454 technology

PubMed Central

Kofler, Robert; Teixeira Torres, Tatiana; Lelley, Tamas; Schlötterer, Christian

2009-01-01

Background Next generation sequencing technologies hold great potential for many biological questions. While mainly used for genomic sequencing, they are also very promising for gene expression profiling. Sequencing of cDNA does not only provide an estimate of the absolute expression level, it can also be used for the identification of allele specific gene expression. Results We developed PanGEA, a tool which enables a fast and user-friendly analysis of allele specific gene expression using the 454 technology. PanGEA allows mapping of 454-ESTs to genes or whole genomes, displaying gene expression profiles, identification of SNPs and the quantification of allele specific gene expression. The intuitive GUI of PanGEA facilitates a flexible and interactive analysis of the data. PanGEA additionally implements a modification of the Smith-Waterman algorithm which deals with incorrect estimates of homopolymer length as occuring in the 454 technology Conclusion To our knowledge, PanGEA is the first tool which facilitates the identification of allele specific gene expression. PanGEA is distributed under the Mozilla Public License and available at: PMID:19442283

Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

PubMed

Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

2005-05-18

To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong

PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less

Improved methods for haemozoin quantification in tissues yield organ-and parasite-specific information in malaria-infected mice.

PubMed

Deroost, Katrien; Lays, Natacha; Noppen, Sam; Martens, Erik; Opdenakker, Ghislain; Van den Steen, Philippe E

2012-05-14

Despite intensive research, malaria remains a major health concern for non-immune residents and travelers in malaria-endemic regions. Efficient adjunctive therapies against life-threatening complications such as severe malarial anaemia, encephalopathy, placental malaria or respiratory problems are still lacking. Therefore, new insights into the pathogenesis of severe malaria are imperative. Haemozoin (Hz) or malaria pigment is produced during intra-erythrocytic parasite replication, released in the circulation after schizont rupture and accumulates inside multiple organs. Many in vitro and ex vivo immunomodulating effects are described for Hz but in vivo data are limited. This study aimed to improve methods for Hz quantification in tissues and to investigate the accumulation of Hz in different organs from mice infected with Plasmodium parasites with a varying degree of virulence. An improved method for extraction of Hz from tissues was elaborated and coupled to an optimized, quantitative, microtiter plate-based luminescence assay with a high sensitivity. In addition, a technique for measuring Hz by semi-quantitative densitometry, applicable on transmitted light images, was developed. The methods were applied to measure Hz in various organs of C57BL/6 J mice infected with Plasmodium berghei ANKA, P. berghei NK65 or Plasmodium chabaudi AS. The used statistical methods were the Mann-Whitney U test and Pearsons correlation analysis. Most Hz was detected in livers and spleens, lower levels in lungs and kidneys, whereas sub-nanomolar amounts were observed in brains and hearts from infected mice, irrespectively of the parasite strain used. Furthermore, total Hz contents correlated with peripheral parasitaemia and were significantly higher in mice with a lethal P. berghei ANKA or P. berghei NK65-infection than in mice with a self-resolving P. chabaudi AS-infection, despite similar peripheral parasitaemia levels. The developed techniques were useful to quantify Hz in different organs with a high reproducibility and sensitivity. An organ-specific Hz deposition pattern was found and was independent of the parasite strain used. Highest Hz levels were identified in mice infected with lethal parasite strains suggesting that Hz accumulation in tissues is associated with malaria-related mortality.

Malaria-specific metabolite hemozoin mediates the release of several potent endogenous pyrogens (TNF, MIP-1 alpha, and MIP-1 beta) in vitro, and altered thermoregulation in vivo.

PubMed

Sherry, B A; Alava, G; Tracey, K J; Martiney, J; Cerami, A; Slater, A F

1995-01-01

A characteristic feature of malaria infection is the occurrence of periodic bouts of fever. Experimental and clinical studies have strongly implicated inflammatory cytokines, like tumour necrosis factor (TNF), in the induction of these intermittent fevers [Clark et al., Infect Immunol 32:1058-1066, 1981; Clark et al., Am J Pathol 129:192-199, 1987; Karunaweera et al., Proc Natl Acad Sci USA 89:3200-3203, 1992], but the malaria-specific metabolite(s) which induce the production of such endogenous pyrogens have not yet been fully characterized. It is well known that during the course of malaria infection, a unique schizont component, alternatively referred to as "malaria pigment" or hemozoin, is released along with merozoites as the host erythrocyte bursts [Urquhart, Clin Infect Dis 19:117-131, 1994]. We have recently determined that the core structure of hemozoin comprises a novel insoluble polymer of heme units linked by iron-carboxylate bonds [Slater et al., Proc Natl Acad Sci USA 88:325-329, 1991; Slater et al., Nature 355:167-169, 1992]. We now report that purified native, as well as chemically synthesized, hemozoin crystals potently induce the release of several pyrogenic cytokines, including TNF, MIP-1 alpha, and MIP-1 beta, from murine macrophages and human peripheral blood monocytes in vitro. Also, intravenous administration of chemically synthesized preparations of hemozoin to anaesthetized rats results in a marked drop in body temperature. A similar drop in body temperature is observed following the intravenous injection of other well-characterized pyrogenic cytokines (e.g., TNF) which are known to induce a fever response in awake animals, and is thought to reflect the inability of rats to appropriately regulate their body temperature while anaesthetized. As a consequence of its ability to induce pyrogenic cytokines in vitro, and thermal dysregulation in vivo, we propose that this unique parasite metabolite is an important pyrogen released by malaria parasites at schizogomy, which acts by eliciting the production of a group of potent endogenous pyrogens, which include MIP-1 alpha and MIP-1 beta, as well as TNF, in macrophages.

Regulation of Silk Genes by Hox and Homeodomain Proteins in the Terminal Differentiated Silk Gland of the Silkworm Bombyx mori

PubMed Central

Takiya, Shigeharu; Tsubota, Takuya; Kimoto, Mai

2016-01-01

The silk gland of the silkworm Bombyx mori is a long tubular organ that is divided into several subparts along its anteroposterior (AP) axis. As a trait of terminal differentiation of the silk gland, several silk protein genes are expressed with unique regional specificities. Most of the Hox and some of the homeobox genes are also expressed in the differentiated silk gland with regional specificities. The expression patterns of Hox genes in the silk gland roughly correspond to those in embryogenesis showing “colinearity”. The central Hox class protein Antennapedia (Antp) directly regulates the expression of several middle silk gland–specific silk genes, whereas the Lin-1/Isl-1/Mec3 (LIM)-homeodomain transcriptional factor Arrowhead (Awh) regulates the expression of posterior silk gland–specific genes for silk fiber proteins. We summarize our results and discuss the usefulness of the silk gland of Bombyx mori for analyzing the function of Hox genes. Further analyses of the regulatory mechanisms underlying the region-specific expression of silk genes will provide novel insights into the molecular bases for target-gene selection and regulation by Hox and homeodomain proteins. PMID:29615585

Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

PubMed

Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

2016-09-12

Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

A new gene in A. rubens: A sea star Ig kappa gene.

PubMed

Vincent, Nadine; Osteras, Magne; Otten, Patricia; Leclerc, Michel

2014-12-01

The sea star Asterias rubens reacts specifically to the antigen:HRP (horse-radish peroxydase) and produces an antibody anti-HRP. We previously identified a candidate Ig kappa gene corresponding to this manuscript. We show now the gene referred to as: "sea star Ig kappa gene in its specificity".

Identification of regulatory targets of tissue-specific transcription factors: application to retina-specific gene regulation

PubMed Central

Qian, Jiang; Esumi, Noriko; Chen, Yangjian; Wang, Qingliang; Chowers, Itay; Zack, Donald J.

2005-01-01

Identification of tissue-specific gene regulatory networks can yield insights into the molecular basis of a tissue's development, function and pathology. Here, we present a computational approach designed to identify potential regulatory target genes of photoreceptor cell-specific transcription factors (TFs). The approach is based on the hypothesis that genes related to the retina in terms of expression, disease and/or function are more likely to be the targets of retina-specific TFs than other genes. A list of genes that are preferentially expressed in retina was obtained by integrating expressed sequence tag, SAGE and microarray datasets. The regulatory targets of retina-specific TFs are enriched in this set of retina-related genes. A Bayesian approach was employed to integrate information about binding site location relative to a gene's transcription start site. Our method was applied to three retina-specific TFs, CRX, NRL and NR2E3, and a number of potential targets were predicted. To experimentally assess the validity of the bioinformatic predictions, mobility shift, transient transfection and chromatin immunoprecipitation assays were performed with five predicted CRX targets, and the results were suggestive of CRX regulation in 5/5, 3/5 and 4/5 cases, respectively. Together, these experiments strongly suggest that RP1, GUCY2D, ABCA4 are novel targets of CRX. PMID:15967807

Simultaneous coexpression of memory-related and effector-related genes by individual human CD8 T cells depends on antigen specificity and differentiation.

PubMed

Gupta, Bhawna; Iancu, Emanuela M; Gannon, Philippe O; Wieckowski, Sébastien; Baitsch, Lukas; Speiser, Daniel E; Rufer, Nathalie

2012-07-01

Phenotypic and functional cell properties are usually analyzed at the level of defined cell populations but not single cells. Yet, large differences between individual cells may have important functional consequences. It is likely that T-cell-mediated immunity depends on the polyfunctionality of individual T cells, rather than the sum of functions of responding T-cell subpopulations. We performed highly sensitive single-cell gene expression profiling, allowing the direct ex vivo characterization of individual virus-specific and tumor-specific T cells from healthy donors and melanoma patients. We have previously shown that vaccination with the natural tumor peptide Melan-A-induced T cells with superior effector functions as compared with vaccination with the analog peptide optimized for enhanced HLA-A*0201 binding. Here we found that natural peptide vaccination induced tumor-reactive CD8 T cells with frequent coexpression of both memory/homing-associated genes (CD27, IL7R, EOMES, CXCR3, and CCR5) and effector-related genes (IFNG, KLRD1, PRF1, and GZMB), comparable with protective Epstein-Barr virus-specific and cytomegalovirus-specific T cells. In contrast, memory/homing-associated and effector-associated genes were less frequently coexpressed after vaccination with the analog peptide. Remarkably, these findings reveal a previously unknown level of gene expression diversity among vaccine-specific and virus-specific T cells with the simultaneous coexpression of multiple memory/homing-related and effector-related genes by the same cell. Such broad functional gene expression signatures within antigen-specific T cells may be critical for mounting efficient responses to pathogens or tumors. In summary, direct ex vivo high-resolution molecular characterization of individual T cells provides key insights into the processes shaping the functional properties of tumor-specific and virus-specific T cells.

Avirulence Genes in Cereal Powdery Mildews: The Gene-for-Gene Hypothesis 2.0.

PubMed

Bourras, Salim; McNally, Kaitlin E; Müller, Marion C; Wicker, Thomas; Keller, Beat

2016-01-01

The gene-for-gene hypothesis states that for each gene controlling resistance in the host, there is a corresponding, specific gene controlling avirulence in the pathogen. Allelic series of the cereal mildew resistance genes Pm3 and Mla provide an excellent system for genetic and molecular analysis of resistance specificity. Despite this opportunity for molecular research, avirulence genes in mildews remain underexplored. Earlier work in barley powdery mildew (B.g. hordei) has shown that the reaction to some Mla resistance alleles is controlled by multiple genes. Similarly, several genes are involved in the specific interaction of wheat mildew (B.g. tritici) with the Pm3 allelic series. We found that two mildew genes control avirulence on Pm3f: one gene is involved in recognition by the resistance protein as demonstrated by functional studies in wheat and the heterologous host Nicotiana benthamiana. A second gene is a suppressor, and resistance is only observed in mildew genotypes combining the inactive suppressor and the recognized Avr. We propose that such suppressor/avirulence gene combinations provide the basis of specificity in mildews. Depending on the particular gene combinations in a mildew race, different genes will be genetically identified as the "avirulence" gene. Additionally, the observation of two LINE retrotransposon-encoded avirulence genes in B.g. hordei further suggests that the control of avirulence in mildew is more complex than a canonical gene-for-gene interaction. To fully understand the mildew-cereal interactions, more knowledge on avirulence determinants is needed and we propose ways how this can be achieved based on recent advances in the field.

Avirulence Genes in Cereal Powdery Mildews: The Gene-for-Gene Hypothesis 2.0

PubMed Central

Bourras, Salim; McNally, Kaitlin E.; Müller, Marion C.; Wicker, Thomas; Keller, Beat

2016-01-01

The gene-for-gene hypothesis states that for each gene controlling resistance in the host, there is a corresponding, specific gene controlling avirulence in the pathogen. Allelic series of the cereal mildew resistance genes Pm3 and Mla provide an excellent system for genetic and molecular analysis of resistance specificity. Despite this opportunity for molecular research, avirulence genes in mildews remain underexplored. Earlier work in barley powdery mildew (B.g. hordei) has shown that the reaction to some Mla resistance alleles is controlled by multiple genes. Similarly, several genes are involved in the specific interaction of wheat mildew (B.g. tritici) with the Pm3 allelic series. We found that two mildew genes control avirulence on Pm3f: one gene is involved in recognition by the resistance protein as demonstrated by functional studies in wheat and the heterologous host Nicotiana benthamiana. A second gene is a suppressor, and resistance is only observed in mildew genotypes combining the inactive suppressor and the recognized Avr. We propose that such suppressor/avirulence gene combinations provide the basis of specificity in mildews. Depending on the particular gene combinations in a mildew race, different genes will be genetically identified as the “avirulence” gene. Additionally, the observation of two LINE retrotransposon-encoded avirulence genes in B.g. hordei further suggests that the control of avirulence in mildew is more complex than a canonical gene-for-gene interaction. To fully understand the mildew–cereal interactions, more knowledge on avirulence determinants is needed and we propose ways how this can be achieved based on recent advances in the field. PMID:26973683

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Alteration of the gene expression profile of T-cell receptor αβ-modified T-cells with diffuse large B-cell lymphoma specificity.

PubMed

Zha, Xianfeng; Yin, Qingsong; Tan, Huo; Wang, Chunyan; Chen, Shaohua; Yang, Lijian; Li, Bo; Wu, Xiuli; Li, Yangqiu

2013-05-01

Antigen-specific, T-cell receptor (TCR)-modified cytotoxic T lymphocytes (CTLs) that target tumors are an attractive strategy for specific adoptive immunotherapy. Little is known about whether there are any alterations in the gene expression profile after TCR gene transduction in T cells. We constructed TCR gene-redirected CTLs with specificity for diffuse large B-cell lymphoma (DLBCL)-associated antigens to elucidate the gene expression profiles of TCR gene-redirected T-cells, and we further analyzed the gene expression profile pattern of these redirected T-cells by Affymetrix microarrays. The resulting data were analyzed using Bioconductor software, a two-fold cut-off expression change was applied together with anti-correlation of the profile ratios to render the microarray analysis set. The fold change of all genes was calculated by comparing the three TCR gene-modified T-cells and a negative control counterpart. The gene pathways were analyzed using Bioconductor and Kyoto Encyclopedia of Genes and Genomes. Identical genes whose fold change was greater than or equal to 2.0 in all three TCR gene-redirected T-cell groups in comparison with the negative control were identified as the differentially expressed genes. The differentially expressed genes were comprised of 33 up-regulated genes and 1 down-regulated gene including JUNB, FOS, TNF, INF-γ, DUSP2, IL-1B, CXCL1, CXCL2, CXCL9, CCL2, CCL4, and CCL8. These genes are mainly involved in the TCR signaling, mitogen-activated protein kinase signaling, and cytokine-cytokine receptor interaction pathways. In conclusion, we characterized the gene expression profile of DLBCL-specific TCR gene-redirected T-cells. The changes corresponded to an up-regulation in the differentiation and proliferation of the T-cells. These data may help to explain some of the characteristics of the redirected T-cells.

Expression of uncharacterized male germ cell-specific genes and discovery of novel sperm-tail proteins in mice.

PubMed

Kwon, Jun Tae; Ham, Sera; Jeon, Suyeon; Kim, Youil; Oh, Seungmin; Cho, Chunghee

2017-01-01

The identification and characterization of germ cell-specific genes are essential if we hope to comprehensively understand the mechanisms of spermatogenesis and fertilization. Here, we searched the mouse UniGene databases and identified 13 novel genes as being putatively testis-specific or -predominant. Our in silico and in vitro analyses revealed that the expressions of these genes are testis- and germ cell-specific, and that they are regulated in a stage-specific manner during spermatogenesis. We generated antibodies against the proteins encoded by seven of the genes to facilitate their characterization in male germ cells. Immunoblotting and immunofluorescence analyses revealed that one of these proteins was expressed only in testicular germ cells, three were expressed in both testicular germ cells and testicular sperm, and the remaining three were expressed in sperm of the testicular stages and in mature sperm from the epididymis. Further analysis of the latter three proteins showed that they were all associated with cytoskeletal structures in the sperm flagellum. Among them, MORN5, which is predicted to contain three MORN motifs, is conserved between mouse and human sperm. In conclusion, we herein identify 13 authentic genes with male germ cell-specific expression, and provide comprehensive information about these genes and their encoded products. Our finding will facilitate future investigations into the functional roles of these novel genes in spermatogenesis and sperm functions.

Identification, characterization and expression analysis of lineage-specific genes within sweet orange (Citrus sinensis).

PubMed

Xu, Yuantao; Wu, Guizhi; Hao, Baohai; Chen, Lingling; Deng, Xiuxin; Xu, Qiang

2015-11-23

With the availability of rapidly increasing number of genome and transcriptome sequences, lineage-specific genes (LSGs) can be identified and characterized. Like other conserved functional genes, LSGs play important roles in biological evolution and functions. Two set of citrus LSGs, 296 citrus-specific genes (CSGs) and 1039 orphan genes specific to sweet orange, were identified by comparative analysis between the sweet orange genome sequences and 41 genomes and 273 transcriptomes. With the two sets of genes, gene structure and gene expression pattern were investigated. On average, both the CSGs and orphan genes have fewer exons, shorter gene length and higher GC content when compared with those evolutionarily conserved genes (ECs). Expression profiling indicated that most of the LSGs expressed in various tissues of sweet orange and some of them exhibited distinct temporal and spatial expression patterns. Particularly, the orphan genes were preferentially expressed in callus, which is an important pluripotent tissue of citrus. Besides, part of the CSGs and orphan genes expressed responsive to abiotic stress, indicating their potential functions during interaction with environment. This study identified and characterized two sets of LSGs in citrus, dissected their sequence features and expression patterns, and provided valuable clues for future functional analysis of the LSGs in sweet orange.

Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

PubMed

Zhang, Yi-Bing; Liu, Ting-Kai; Jiang, Jun; Shi, Jun; Liu, Ying; Li, Shun; Gui, Jian-Fang

2013-01-01

Gig2 (grass carp reovirus (GCRV)-induced gene 2) is first identified as a novel fish interferon (IFN)-stimulated gene (ISG). Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD) hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose) polymerases (PARPs), and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

More than just orphans: are taxonomically-restricted genes important in evolution?

PubMed

Khalturin, Konstantin; Hemmrich, Georg; Fraune, Sebastian; Augustin, René; Bosch, Thomas C G

2009-09-01

Comparative genome analyses indicate that every taxonomic group so far studied contains 10-20% of genes that lack recognizable homologs in other species. Do such 'orphan' or 'taxonomically-restricted' genes comprise spurious, non-functional ORFs, or does their presence reflect important evolutionary processes? Recent studies in basal metazoans such as Nematostella, Acropora and Hydra have shed light on the function of these genes, and now indicate that they are involved in important species-specific adaptive processes. Here we focus on evidence from Hydra suggesting that taxonomically-restricted genes play a role in the creation of phylum-specific novelties such as cnidocytes, in the generation of morphological diversity, and in the innate defence system. We propose that taxon-specific genes drive morphological specification, enabling organisms to adapt to changing conditions.

Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata

PubMed Central

2011-01-01

Background Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. Results A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. Conclusion The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their regulated pathways. Auxin/IAA appears to act as a negative regulator in rhizome development, while GA acts as the activator in rhizome development. Co-localization of the genes specifically expressed in rhizome tips and rhizome internodes with the QTLs for rhizome traits identified a large set of candidate genes for rhizome initiation and development in rice for further confirmation. PMID:21261937

Nephron segment-specific gene expression using AAV vectors.

PubMed

Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R

2018-02-26

AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Evolutionary expansion and divergence in a large family of primate-specific zinc finger transcription factor genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamilton, A T; Huntley, S; Tran-Gyamfi, M

Although most genes are conserved as one-to-one orthologs in different mammalian orders, certain gene families have evolved to comprise different numbers and types of protein-coding genes through independent series of gene duplications, divergence and gene loss in each evolutionary lineage. One such family encodes KRAB-zinc finger (KRAB-ZNF) genes, which are likely to function as transcriptional repressors. One KRAB-ZNF subfamily, the ZNF91 clade, has expanded specifically in primates to comprise more than 110 loci in the human genome, yielding large gene clusters in human chromosomes 19 and 7 and smaller clusters or isolated copies at other chromosomal locations. Although phylogenetic analysismore » indicates that many of these genes arose before the split between old world monkeys and new world monkeys, the ZNF91 subfamily has continued to expand and diversify throughout the evolution of apes and humans. The paralogous loci are distinguished by sequence divergence within their zinc finger arrays indicating a selection for proteins with different DNA binding specificities. RT-PCR and in situ hybridization data show that some of these ZNF genes can have tissue-specific expression patterns, however many KRAB-ZNFs that are near-ubiquitous could also be playing very specific roles in halting target pathways in all tissues except for a few, where the target is released by the absence of its repressor. The number of variant KRAB-ZNF proteins is increased not only because of the large number of loci, but also because many loci can produce multiple splice variants, which because of the modular structure of these genes may have separate and perhaps even conflicting regulatory roles. The lineage-specific duplication and rapid divergence of this family of transcription factor genes suggests a role in determining species-specific biological differences and the evolution of novel primate traits.« less

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2013-05-14

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2017-09-12

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2011-05-17

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2016-08-09

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genomic features separating ten strains of Neorhizobium galegae with different symbiotic phenotypes.

PubMed

Österman, Janina; Mousavi, Seyed Abdollah; Koskinen, Patrik; Paulin, Lars; Lindström, Kristina

2015-05-02

The symbiotic phenotype of Neorhizobium galegae, with strains specifically fixing nitrogen with either Galega orientalis or G. officinalis, has made it a target in research on determinants of host specificity in nitrogen fixation. The genomic differences between representative strains of the two symbiovars are, however, relatively small. This introduced a need for a dataset representing a larger bacterial population in order to make better conclusions on characteristics typical for a subset of the species. In this study, we produced draft genomes of eight strains of N. galegae having different symbiotic phenotypes, both with regard to host specificity and nitrogen fixation efficiency. These genomes were analysed together with the previously published complete genomes of N. galegae strains HAMBI 540T and HAMBI 1141. The results showed that the presence of an additional rpoN sigma factor gene in the symbiosis gene region is a characteristic specific to symbiovar orientalis, required for nitrogen fixation. Also the nifQ gene was shown to be crucial for functional symbiosis in both symbiovars. Genome-wide analyses identified additional genes characteristic of strains of the same symbiovar and of strains having similar plant growth promoting properties on Galega orientalis. Many of these genes are involved in transcriptional regulation or in metabolic functions. The results of this study confirm that the only symbiosis-related gene that is present in one symbiovar of N. galegae but not in the other is an rpoN gene. The specific function of this gene remains to be determined, however. New genes that were identified as specific for strains of one symbiovar may be involved in determining host specificity, while others are defined as potential determinant genes for differences in efficiency of nitrogen fixation.

5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells

PubMed Central

Malashchuk, Igor; Lajoie, Brian R.; Mardaryev, Andrei N.; Gdula, Michal R.; Sharov, Andrey A.; Kohwi-Shigematsu, Terumi; Fessing, Michael Y.

2017-01-01

Mammalian genomes contain several dozens of large (>0.5 Mbp) lineage-specific gene loci harbouring functionally related genes. However, spatial chromatin folding, organization of the enhancer-promoter networks and their relevance to Topologically Associating Domains (TADs) in these loci remain poorly understood. TADs are principle units of the genome folding and represents the DNA regions within which DNA interacts more frequently and less frequently across the TAD boundary. Here, we used Chromatin Conformation Capture Carbon Copy (5C) technology to characterize spatial chromatin interaction network in the 3.1 Mb Epidermal Differentiation Complex (EDC) locus harbouring 61 functionally related genes that show lineage-specific activation during terminal keratinocyte differentiation in the epidermis. 5C data validated by 3D-FISH demonstrate that the EDC locus is organized into several TADs showing distinct lineage-specific chromatin interaction networks based on their transcription activity and the gene-rich or gene-poor status. Correlation of the 5C results with genome-wide studies for enhancer-specific histone modifications (H3K4me1 and H3K27ac) revealed that the majority of spatial chromatin interactions that involves the gene-rich TADs at the EDC locus in keratinocytes include both intra- and inter-TAD interaction networks, connecting gene promoters and enhancers. Compared to thymocytes in which the EDC locus is mostly transcriptionally inactive, these interactions were found to be keratinocyte-specific. In keratinocytes, the promoter-enhancer anchoring regions in the gene-rich transcriptionally active TADs are enriched for the binding of chromatin architectural proteins CTCF, Rad21 and chromatin remodeler Brg1. In contrast to gene-rich TADs, gene-poor TADs show preferential spatial contacts with each other, do not contain active enhancers and show decreased binding of CTCF, Rad21 and Brg1 in keratinocytes. Thus, spatial interactions between gene promoters and enhancers at the multi-TAD EDC locus in skin epithelial cells are cell type-specific and involve extensive contacts within TADs as well as between different gene-rich TADs, forming the framework for lineage-specific transcription. PMID:28863138

High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

PubMed

Kassir, Yona

2017-01-01

Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

Cohort-specific imputation of gene expression improves prediction of warfarin dose for African Americans.

PubMed

Gottlieb, Assaf; Daneshjou, Roxana; DeGorter, Marianne; Bourgeois, Stephane; Svensson, Peter J; Wadelius, Mia; Deloukas, Panos; Montgomery, Stephen B; Altman, Russ B

2017-11-24

Genome-wide association studies are useful for discovering genotype-phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into "gene level" effects. Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression-on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort.

Specificity of a Rust Resistance Suppressor on 7DL in the Spring Wheat Cultivar Canthatch.

PubMed

Talajoor, Mina; Jin, Yue; Wan, Anmin; Chen, Xianming; Bhavani, Sridhar; Tabe, Linda; Lagudah, Evans; Huang, Li

2015-04-01

The spring wheat 'Canthatch' has been shown to suppress stem rust resistance genes in the background due to the presence of a suppressor gene located on the long arm of chromosome 7D. However, it is unclear whether the suppressor also suppresses resistance genes against leaf rust and stripe rust. In this study, we investigated the specificity of the resistance suppression. To determine whether the suppression is genome origin specific, chromosome location specific, or rust species or race specific, we introduced 11 known rust resistance genes into the Canthatch background, including resistance to leaf, stripe, or stem rusts, originating from A, B, or D genomes and located on different chromosome homologous groups. F1 plants of each cross were tested with the corresponding rust race, and the infection types were scored and compared with the parents. Our results show that the Canthatch 7DL suppressor only suppressed stem rust resistance genes derived from either the A or B genome, and the pattern of the suppression is gene specific and independent of chromosomal location.

Sex-Specific Selection and Sex-Biased Gene Expression in Humans and Flies.

PubMed

Cheng, Changde; Kirkpatrick, Mark

2016-09-01

Sexual dimorphism results from sex-biased gene expression, which evolves when selection acts differently on males and females. While there is an intimate connection between sex-biased gene expression and sex-specific selection, few empirical studies have studied this relationship directly. Here we compare the two on a genome-wide scale in humans and flies. We find a distinctive "Twin Peaks" pattern in humans that relates the strength of sex-specific selection, quantified by genetic divergence between male and female adults at autosomal loci, to the degree of sex-biased expression. Genes with intermediate degrees of sex-biased expression show evidence of ongoing sex-specific selection, while genes with either little or completely sex-biased expression do not. This pattern apparently results from differential viability selection in males and females acting in the current generation. The Twin Peaks pattern is also found in Drosophila using a different measure of sex-specific selection acting on fertility. We develop a simple model that successfully recapitulates the Twin Peaks. Our results suggest that many genes with intermediate sex-biased expression experience ongoing sex-specific selection in humans and flies.

A Novel Method for Gene-Specific Enhancement of Protein Translation by Targeting 5’UTRs of Selected Tumor Suppressors

PubMed Central

Master, Adam; Wójcicka, Anna; Giżewska, Kamilla; Popławski, Piotr; Williams, Graham R.; Nauman, Alicja

2016-01-01

Background Translational control is a mechanism of protein synthesis regulation emerging as an important target for new therapeutics. Naturally occurring microRNAs and synthetic small inhibitory RNAs (siRNAs) are the most recognized regulatory molecules acting via RNA interference. Surprisingly, recent studies have shown that interfering RNAs may also activate gene transcription via the newly discovered phenomenon of small RNA-induced gene activation (RNAa). Thus far, the small activating RNAs (saRNAs) have only been demonstrated as promoter-specific transcriptional activators. Findings We demonstrate that oligonucleotide-based trans-acting factors can also specifically enhance gene expression at the level of protein translation by acting at sequence-specific targets within the messenger RNA 5’-untranslated region (5’UTR). We designed a set of short synthetic oligonucleotides (dGoligos), specifically targeting alternatively spliced 5’UTRs in transcripts expressed from the THRB and CDKN2A suppressor genes. The in vitro translation efficiency of reporter constructs containing alternative TRβ1 5’UTRs was increased by up to more than 55-fold following exposure to specific dGoligos. Moreover, we found that the most folded 5’UTR has higher translational regulatory potential when compared to the weakly folded TRβ1 variant. This suggests such a strategy may be especially applied to enhance translation from relatively inactive transcripts containing long 5’UTRs of complex structure. Significance This report represents the first method for gene-specific translation enhancement using selective trans-acting factors designed to target specific 5’UTR cis-acting elements. This simple strategy may be developed further to complement other available methods for gene expression regulation including gene silencing. The dGoligo-mediated translation-enhancing approach has the potential to be transferred to increase the translation efficiency of any suitable target gene and may have future application in gene therapy strategies to enhance expression of proteins including tumor suppressors. PMID:27171412

Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes

PubMed Central

Premzl, Marko

2015-01-01

Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed. PMID:25941635

Sequence variation at the rice blast resistance gene Pi-km locus: Implications for the development of allele specific markers

USDA-ARS?s Scientific Manuscript database

The recently cloned blast resistance (R) gene Pi-km protects rice crops against specific races of the fungal pathogen Magnaporthe oryzae in a gene-for-gene manner. The use of blast R genes remains the most cost-effective method for an integrated disease management strategy. To facilitate rice breed...

Classification of Genes and Putative Biomarker Identification Using Distribution Metrics on Expression Profiles

PubMed Central

Huang, Hung-Chung; Jupiter, Daniel; VanBuren, Vincent

2010-01-01

Background Identification of genes with switch-like properties will facilitate discovery of regulatory mechanisms that underlie these properties, and will provide knowledge for the appropriate application of Boolean networks in gene regulatory models. As switch-like behavior is likely associated with tissue-specific expression, these gene products are expected to be plausible candidates as tissue-specific biomarkers. Methodology/Principal Findings In a systematic classification of genes and search for biomarkers, gene expression profiles (GEPs) of more than 16,000 genes from 2,145 mouse array samples were analyzed. Four distribution metrics (mean, standard deviation, kurtosis and skewness) were used to classify GEPs into four categories: predominantly-off, predominantly-on, graded (rheostatic), and switch-like genes. The arrays under study were also grouped and examined by tissue type. For example, arrays were categorized as ‘brain group’ and ‘non-brain group’; the Kolmogorov-Smirnov distance and Pearson correlation coefficient were then used to compare GEPs between brain and non-brain for each gene. We were thus able to identify tissue-specific biomarker candidate genes. Conclusions/Significance The methodology employed here may be used to facilitate disease-specific biomarker discovery. PMID:20140228

Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi.

PubMed

Kaulich, Manuel; Lee, Yeon J; Lönn, Peter; Springer, Aaron D; Meade, Bryan R; Dowdy, Steven F

2015-04-20

Gene knockout strategies, RNAi and rescue experiments are all employed to study mammalian gene function. However, the disadvantages of these approaches include: loss of function adaptation, reduced viability and gene overexpression that rarely matches endogenous levels. Here, we developed an endogenous gene knockdown/rescue strategy that combines RNAi selectivity with a highly efficient CRISPR directed recombinant Adeno-Associated Virus (rAAV) mediated gene targeting approach to introduce allele-specific mutations plus an allele-selective siRNA Sensitive (siSN) site that allows for studying gene mutations while maintaining endogenous expression and regulation of the gene of interest. CRISPR/Cas9 plus rAAV targeted gene-replacement and introduction of allele-specific RNAi sensitivity mutations in the CDK2 and CDK1 genes resulted in a >85% site-specific recombination of Neo-resistant clones versus ∼8% for rAAV alone. RNAi knockdown of wild type (WT) Cdk2 with siWT in heterozygotic knockin cells resulted in the mutant Cdk2 phenotype cell cycle arrest, whereas allele specific knockdown of mutant CDK2 with siSN resulted in a wild type phenotype. Together, these observations demonstrate the ability of CRISPR plus rAAV to efficiently recombine a genomic locus and tag it with a selective siRNA sequence that allows for allele-selective phenotypic assays of the gene of interest while it remains expressed and regulated under endogenous control mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

[A mini-review of targeting gene-virotherapy of cancer].

PubMed

Liu, Xin-Yuan; Gu, Jin-Fa

2006-10-01

New progress has been made on the project "targeting gene-virotherapy of cancer" proposed by us, which is "targeting dual gene-virotherapy of cancer". By the use of two genes, all the xenograft tumors in nude mice could be completely eliminated. The researches have been published in international journals, such as Hepatology and Cancer Research (a highlight paper). In this study, a further superior strategy--"double targeting virus-dual gene therapy" was introduced. This strategy was specialized by the use of tumor specific promoter to control the tumor specific suppressor gene, such as alpha-fetoprotein (AFP), which controls hepatoma specific suppressor gene LFIRE or HCCS1. In addition, a second tumor specific promoter, such as hTERT or survivin was used to control E1A or E1B in the construct, as hTERT-E1A-AFP-E1B-HCCS1 or LFIRE, a double tumor specific promoter controlling hepatoma specific LFIRE or HCCS1 gene. By the combined use of this construct with a very strong antitumor construct, such as hTERT-E1A-AFP-E1B-IL-24, a strategy with both excellent tumor killing effect and excellent safety with very little damage to normal cells was obtained. Therefore, double targeting virus-dual gene therapy might be one of the most potential strategies for cancer treatment. Furthermore, a new type of interferon was also introduced, which might be an ideal antitumor drug.

Epigenetic regulation of depot-specific gene expression in adipose tissue.

PubMed

Gehrke, Sandra; Brueckner, Bodo; Schepky, Andreas; Klein, Johannes; Iwen, Alexander; Bosch, Thomas C G; Wenck, Horst; Winnefeld, Marc; Hagemann, Sabine

2013-01-01

In humans, adipose tissue is distributed in subcutaneous abdominal and subcutaneous gluteal depots that comprise a variety of functional differences. Whereas energy storage in gluteal adipose tissue has been shown to mediate a protective effect, an increase of abdominal adipose tissue is associated with metabolic disorders. However, the molecular basis of depot-specific characteristics is not completely understood yet. Using array-based analyses of transcription profiles, we identified a specific set of genes that was differentially expressed between subcutaneous abdominal and gluteal adipose tissue. To investigate the role of epigenetic regulation in depot-specific gene expression, we additionally analyzed genome-wide DNA methylation patterns in abdominal and gluteal depots. By combining both data sets, we identified a highly significant set of depot-specifically expressed genes that appear to be epigenetically regulated. Interestingly, the majority of these genes form part of the homeobox gene family. Moreover, genes involved in fatty acid metabolism were also differentially expressed. Therefore we suppose that changes in gene expression profiles might account for depot-specific differences in lipid composition. Indeed, triglycerides and fatty acids of abdominal adipose tissue were more saturated compared to triglycerides and fatty acids in gluteal adipose tissue. Taken together, our results uncover clear differences between abdominal and gluteal adipose tissue on the gene expression and DNA methylation level as well as in fatty acid composition. Therefore, a detailed molecular characterization of adipose tissue depots will be essential to develop new treatment strategies for metabolic syndrome associated complications.

Leveraging long sequencing reads to investigate R-gene clustering and variation in sugar beet

USDA-ARS?s Scientific Manuscript database

Host-pathogen interactions are of prime importance to modern agriculture. Plants utilize various types of resistance genes to mitigate pathogen damage. Identification of the specific gene responsible for a specific resistance can be difficult due to duplication and clustering within R-gene families....

Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators

PubMed Central

Polstein, Lauren R.; Perez-Pinera, Pablo; Kocak, D. Dewran; Vockley, Christopher M.; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Reddy, Timothy E.; Gersbach, Charles A.

2015-01-01

Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. PMID:26025803

Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

PubMed

Guo, Yong; Qiu, Li-Juan

2013-01-01

The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.

PubMed

Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong

2016-05-20

Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

Genome-wide computational analysis reveals cardiomyocyte-specific transcriptional Cis-regulatory motifs that enable efficient cardiac gene therapy.

PubMed

Rincon, Melvin Y; Sarcar, Shilpita; Danso-Abeam, Dina; Keyaerts, Marleen; Matrai, Janka; Samara-Kuko, Ermira; Acosta-Sanchez, Abel; Athanasopoulos, Takis; Dickson, George; Lahoutte, Tony; De Bleser, Pieter; VandenDriessche, Thierry; Chuah, Marinee K

2015-01-01

Gene therapy is a promising emerging therapeutic modality for the treatment of cardiovascular diseases and hereditary diseases that afflict the heart. Hence, there is a need to develop robust cardiac-specific expression modules that allow for stable expression of the gene of interest in cardiomyocytes. We therefore explored a new approach based on a genome-wide bioinformatics strategy that revealed novel cardiac-specific cis-acting regulatory modules (CS-CRMs). These transcriptional modules contained evolutionary-conserved clusters of putative transcription factor binding sites that correspond to a "molecular signature" associated with robust gene expression in the heart. We then validated these CS-CRMs in vivo using an adeno-associated viral vector serotype 9 that drives a reporter gene from a quintessential cardiac-specific α-myosin heavy chain promoter. Most de novo designed CS-CRMs resulted in a >10-fold increase in cardiac gene expression. The most robust CRMs enhanced cardiac-specific transcription 70- to 100-fold. Expression was sustained and restricted to cardiomyocytes. We then combined the most potent CS-CRM4 with a synthetic heart and muscle-specific promoter (SPc5-12) and obtained a significant 20-fold increase in cardiac gene expression compared to the cytomegalovirus promoter. This study underscores the potential of rational vector design to improve the robustness of cardiac gene therapy.

Functional requirements driving the gene duplication in 12 Drosophila species.

PubMed

Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

2013-08-15

Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

A novel, tissue-specific, Drosophila homeobox gene.

PubMed

Barad, M; Jack, T; Chadwick, R; McGinnis, W

1988-07-01

The homeobox gene family of Drosophila appears to control a variety of position-specific patterning decisions during embryonic and imaginal development. Most of these patterning decisions determine groups of cells on the anterior-posterior axis of the Drosophila germ band. We have isolated a novel homeobox gene from Drosophila, designated H2.0. H2.0 has the most diverged homeobox so far characterized in metazoa, and, in contrast to all previously isolated homeobox genes, H2.0 exhibits a tissue-specific pattern of expression. The cells that accumulate transcripts for this novel gene correspond to the visceral musculature and its anlagen.

Tissue and cell-type co-expression networks of transcription factors and wood component genes in Populus trichocarpa.

PubMed

Shi, Rui; Wang, Jack P; Lin, Ying-Chung; Li, Quanzi; Sun, Ying-Hsuan; Chen, Hao; Sederoff, Ronald R; Chiang, Vincent L

2017-05-01

Co-expression networks based on transcriptomes of Populus trichocarpa major tissues and specific cell types suggest redundant control of cell wall component biosynthetic genes by transcription factors in wood formation. We analyzed the transcriptomes of five tissues (xylem, phloem, shoot, leaf, and root) and two wood forming cell types (fiber and vessel) of Populus trichocarpa to assemble gene co-expression subnetworks associated with wood formation. We identified 165 transcription factors (TFs) that showed xylem-, fiber-, and vessel-specific expression. Of these 165 TFs, 101 co-expressed (correlation coefficient, r > 0.7) with the 45 secondary cell wall cellulose, hemicellulose, and lignin biosynthetic genes. Each cell wall component gene co-expressed on average with 34 TFs, suggesting redundant control of the cell wall component gene expression. Co-expression analysis showed that the 101 TFs and the 45 cell wall component genes each has two distinct groups (groups 1 and 2), based on their co-expression patterns. The group 1 TFs (44 members) are predominantly xylem and fiber specific, and are all highly positively co-expressed with the group 1 cell wall component genes (30 members), suggesting their roles as major wood formation regulators. Group 1 TFs include a lateral organ boundary domain gene (LBD) that has the highest number of positively correlated cell wall component genes (36) and TFs (47). The group 2 TFs have 57 members, including 14 vessel-specific TFs, and are generally less correlated with the cell wall component genes. An exception is a vessel-specific basic helix-loop-helix (bHLH) gene that negatively correlates with 20 cell wall component genes, and may function as a key transcriptional suppressor. The co-expression networks revealed here suggest a well-structured transcriptional homeostasis for cell wall component biosynthesis during wood formation.

A qRT-PCR assay for the expression of all Mal d 1 isoallergen genes

PubMed Central

2013-01-01

Background A considerable number of individuals suffer from oral allergy syndrome (OAS) to apple, resulting in the avoidance of apple consumption. Apple cultivars differ greatly in their allergenic properties, but knowledge of the causes for such differences is incomplete. Mal d 1 is considered the major apple allergen. For Mal d 1, a wide range of isoallergens and variants exist, and they are encoded by a large gene family. To identify the specific proteins/genes that are potentially involved in the allergy, we developed a PCR assay to monitor the expression of each individual Mal d 1 gene. Gene-specific primer pairs were designed for the exploitation of sequence differences among Mal d 1 genes. The specificity of these primers was validated using both in silico and in vitro techniques. Subsequently, this assay was applied to the peel and flesh of fruits from the two cultivars ‘Florina’ and ‘Gala’. Results We successfully developed gene-specific primer pairs for each of the 31 Mal d 1 genes and incorporated them into a qRT-PCR assay. The results from the application of the assay showed that 11 genes were not expressed in fruit. In addition, differential expression was observed among the Mal d 1 genes that were expressed in the fruit. Moreover, the expression levels were tissue and cultivar dependent. Conclusion The assay developed in this study facilitated the first characterisation of the expression levels of all known Mal d 1 genes in a gene-specific manner. Using this assay on different fruit tissues and cultivars, we obtained knowledge concerning gene relevance in allergenicity. This study provides new perspectives for research on both plant breeding and immunotherapy. PMID:23522122

Regulatory systems for hypoxia-inducible gene expression in ischemic heart disease gene therapy.

PubMed

Kim, Hyun Ah; Rhim, Taiyoun; Lee, Minhyung

2011-07-18

Ischemic heart diseases are caused by narrowed coronary arteries that decrease the blood supply to the myocardium. In the ischemic myocardium, hypoxia-responsive genes are up-regulated by hypoxia-inducible factor-1 (HIF-1). Gene therapy for ischemic heart diseases uses genes encoding angiogenic growth factors and anti-apoptotic proteins as therapeutic genes. These genes increase blood supply into the myocardium by angiogenesis and protect cardiomyocytes from cell death. However, non-specific expression of these genes in normal tissues may be harmful, since growth factors and anti-apoptotic proteins may induce tumor growth. Therefore, tight gene regulation is required to limit gene expression to ischemic tissues, to avoid unwanted side effects. For this purpose, various gene expression strategies have been developed for ischemic-specific gene expression. Transcriptional, post-transcriptional, and post-translational regulatory strategies have been developed and evaluated in ischemic heart disease animal models. The regulatory systems can limit therapeutic gene expression to ischemic tissues and increase the efficiency of gene therapy. In this review, recent progresses in ischemic-specific gene expression systems are presented, and their applications to ischemic heart diseases are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

Identification of novel and known oocyte-specific genes using complementary DNA subtraction and microarray analysis in three different species.

PubMed

Vallée, Maud; Gravel, Catherine; Palin, Marie-France; Reghenas, Hélène; Stothard, Paul; Wishart, David S; Sirard, Marc-André

2005-07-01

The main objective of the present study was to identify novel oocyte-specific genes in three different species: bovine, mouse, and Xenopus laevis. To achieve this goal, two powerful technologies were combined: a polymerase chain reaction (PCR)-based cDNA subtraction, and cDNA microarrays. Three subtractive libraries consisting of 3456 clones were established and enriched for oocyte-specific transcripts. Sequencing analysis of the positive insert-containing clones resulted in the following classification: 53% of the clones corresponded to known cDNAs, 26% were classified as uncharacterized cDNAs, and a final 9% were classified as novel sequences. All these clones were used for cDNA microarray preparation. Results from these microarray analyses revealed that in addition to already known oocyte-specific genes, such as GDF9, BMP15, and ZP, known genes with unknown function in the oocyte were identified, such as a MLF1-interacting protein (MLF1IP), B-cell translocation gene 4 (BTG4), and phosphotyrosine-binding protein (xPTB). Furthermore, 15 novel oocyte-specific genes were validated by reverse transcription-PCR to confirm their preferential expression in the oocyte compared to somatic tissues. The results obtained in the present study confirmed that microarray analysis is a robust technique to identify true positives from the suppressive subtractive hybridization experiment. Furthermore, obtaining oocyte-specific genes from three species simultaneously allowed us to look at important genes that are conserved across species. Further characterization of these novel oocyte-specific genes will lead to a better understanding of the molecular mechanisms related to the unique functions found in the oocyte.

Identification of Wnt Pathway Target Genes Regulating the Division and Differentiation of Larval Seam Cells and Vulval Precursor Cells in Caenorhabditis elegans

PubMed Central

Gorrepati, Lakshmi; Krause, Michael W.; Chen, Weiping; Brodigan, Thomas M.; Correa-Mendez, Margarita; Eisenmann, David M.

2015-01-01

The evolutionarily conserved Wnt/β-catenin signaling pathway plays a fundamental role during metazoan development, regulating numerous processes including cell fate specification, cell migration, and stem cell renewal. Wnt ligand binding leads to stabilization of the transcriptional effector β-catenin and upregulation of target gene expression to mediate a cellular response. During larval development of the nematode Caenorhabditis elegans, Wnt/β-catenin pathways act in fate specification of two hypodermal cell types, the ventral vulval precursor cells (VPCs) and the lateral seam cells. Because little is known about targets of the Wnt signaling pathways acting during larval VPC and seam cell differentiation, we sought to identify genes regulated by Wnt signaling in these two hypodermal cell types. We conditionally activated Wnt signaling in larval animals and performed cell type–specific "mRNA tagging" to enrich for VPC and seam cell–specific mRNAs, and then used microarray analysis to examine gene expression compared to control animals. Two hundred thirty-nine genes activated in response to Wnt signaling were identified, and we characterized 50 genes further. The majority of these genes are expressed in seam and/or vulval lineages during normal development, and reduction of function for nine genes caused defects in the proper division, fate specification, fate execution, or differentiation of seam cells and vulval cells. Therefore, the combination of these techniques was successful at identifying potential cell type–specific Wnt pathway target genes from a small number of cells and at increasing our knowledge of the specification and behavior of these C. elegans larval hypodermal cells. PMID:26048561

Identification of Wnt Pathway Target Genes Regulating the Division and Differentiation of Larval Seam Cells and Vulval Precursor Cells in Caenorhabditis elegans.

PubMed

Gorrepati, Lakshmi; Krause, Michael W; Chen, Weiping; Brodigan, Thomas M; Correa-Mendez, Margarita; Eisenmann, David M

2015-06-05

The evolutionarily conserved Wnt/β-catenin signaling pathway plays a fundamental role during metazoan development, regulating numerous processes including cell fate specification, cell migration, and stem cell renewal. Wnt ligand binding leads to stabilization of the transcriptional effector β-catenin and upregulation of target gene expression to mediate a cellular response. During larval development of the nematode Caenorhabditis elegans, Wnt/β-catenin pathways act in fate specification of two hypodermal cell types, the ventral vulval precursor cells (VPCs) and the lateral seam cells. Because little is known about targets of the Wnt signaling pathways acting during larval VPC and seam cell differentiation, we sought to identify genes regulated by Wnt signaling in these two hypodermal cell types. We conditionally activated Wnt signaling in larval animals and performed cell type-specific "mRNA tagging" to enrich for VPC and seam cell-specific mRNAs, and then used microarray analysis to examine gene expression compared to control animals. Two hundred thirty-nine genes activated in response to Wnt signaling were identified, and we characterized 50 genes further. The majority of these genes are expressed in seam and/or vulval lineages during normal development, and reduction of function for nine genes caused defects in the proper division, fate specification, fate execution, or differentiation of seam cells and vulval cells. Therefore, the combination of these techniques was successful at identifying potential cell type-specific Wnt pathway target genes from a small number of cells and at increasing our knowledge of the specification and behavior of these C. elegans larval hypodermal cells. Copyright © 2015 Gorrepati et al.

Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

PubMed

Vieille-Grosjean, I; Huber, P

1995-03-03

The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

Gene-specific cell labeling using MiMIC transposons

PubMed Central

Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.

2015-01-01

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101

Muscle-specific gene expression is underscored by differential stressor responses and coexpression changes.

PubMed

Moreno-Sánchez, Natalia; Rueda, Julia; Reverter, Antonio; Carabaño, María Jesús; Díaz, Clara

2012-03-01

Variations on the transcriptome from one skeletal muscle type to another still remain unknown. The reliable identification of stable gene coexpression networks is essential to unravel gene functions and define biological processes. The differential expression of two distinct muscles, M. flexor digitorum (FD) and M. psoas major (PM), was studied using microarrays in cattle to illustrate muscle-specific transcription patterns and to quantify changes in connectivity regarding the expected gene coexpression pattern. A total of 206 genes were differentially expressed (DE), 94 upregulated in PM and 112 in FD. The distribution of DE genes in pathways and biological functions was explored in the context of system biology. Global interactomes for genes of interest were predicted. Fast/slow twitch genes, genes coding for extracellular matrix, ribosomal and heat shock proteins, and fatty acid uptake centred the specific gene expression patterns per muscle. Genes involved in repairing mechanisms, such as ribosomal and heat shock proteins, suggested a differential ability of muscles to react to similar stressing factors, acting preferentially in slow twitch muscles. Muscle attributes do not seem to be completely explained by the muscle fibre composition. Changes in connectivity accounted for 24% of significant correlations between DE genes. Genes changing their connectivity mostly seem to contribute to the main differential attributes that characterize each specific muscle type. These results underscore the unique flexibility of skeletal muscle where a substantial set of genes are able to change their behavior depending on the circumstances.

Computational prediction of protein interactions related to the invasion of erythrocytes by malarial parasites.

PubMed

Liu, Xuewu; Huang, Yuxiao; Liang, Jiao; Zhang, Shuai; Li, Yinghui; Wang, Jun; Shen, Yan; Xu, Zhikai; Zhao, Ya

2014-11-30

The invasion of red blood cells (RBCs) by malarial parasites is an essential step in the life cycle of Plasmodium falciparum. Human-parasite surface protein interactions play a critical role in this process. Although several interactions between human and parasite proteins have been discovered, the mechanism related to invasion remains poorly understood because numerous human-parasite protein interactions have not yet been identified. High-throughput screening experiments are not feasible for malarial parasites due to difficulty in expressing the parasite proteins. Here, we performed computational prediction of the PPIs involved in malaria parasite invasion to elucidate the mechanism by which invasion occurs. In this study, an expectation maximization algorithm was used to estimate the probabilities of domain-domain interactions (DDIs). Estimates of DDI probabilities were then used to infer PPI probabilities. We found that our prediction performance was better than that based on the information of D. melanogaster alone when information related to the six species was used. Prediction performance was assessed using protein interaction data from S. cerevisiae, indicating that the predicted results were reliable. We then used the estimates of DDI probabilities to infer interactions between 490 parasite and 3,787 human membrane proteins. A small-scale dataset was used to illustrate the usability of our method in predicting interactions between human and parasite proteins. The positive predictive value (PPV) was lower than that observed in S. cerevisiae. We integrated gene expression data to improve prediction accuracy and to reduce false positives. We identified 80 membrane proteins highly expressed in the schizont stage by fast Fourier transform method. Approximately 221 erythrocyte membrane proteins were identified using published mass spectral datasets. A network consisting of 205 interactions was predicted. Results of network analysis suggest that SNARE proteins of parasites and APP of humans may function in the invasion of RBCs by parasites. We predicted a small-scale PPI network that may be involved in parasite invasion of RBCs by integrating DDI information and expression profiles. Experimental studies should be conducted to validate the predicted interactions. The predicted PPIs help elucidate the mechanism of parasite invasion and provide directions for future experimental investigations.

Tissue- and Time-Specific Expression of Otherwise Identical tRNA Genes

PubMed Central

Adir, Idan; Dahan, Orna; Broday, Limor; Pilpel, Yitzhak; Rechavi, Oded

2016-01-01

Codon usage bias affects protein translation because tRNAs that recognize synonymous codons differ in their abundance. Although the current dogma states that tRNA expression is exclusively regulated by intrinsic control elements (A- and B-box sequences), we revealed, using a reporter that monitors the levels of individual tRNA genes in Caenorhabditis elegans, that eight tryptophan tRNA genes, 100% identical in sequence, are expressed in different tissues and change their expression dynamically. Furthermore, the expression levels of the sup-7 tRNA gene at day 6 were found to predict the animal’s lifespan. We discovered that the expression of tRNAs that reside within introns of protein-coding genes is affected by the host gene’s promoter. Pairing between specific Pol II genes and the tRNAs that are contained in their introns is most likely adaptive, since a genome-wide analysis revealed that the presence of specific intronic tRNAs within specific orthologous genes is conserved across Caenorhabditis species. PMID:27560950

The Prx1 limb enhancers: targeted gene expression in developing zebrafish pectoral fins.

PubMed

Hernández-Vega, Amayra; Minguillón, Carolina

2011-08-01

Limbs represent an excellent model to study the induction, growth, and patterning of several organs. A breakthrough to study gene function in various tissues has been the characterization of regulatory elements that allow tissue-specific interference of gene function. The mouse Prx1 promoter has been used to generate limb-specific mutants and overexpress genes in tetrapod limbs. Although zebrafish possess advantages that favor their use to study limb morphogenesis, there is no driver described suitable for specifically interfering with gene function in developing fins. We report the generation of zebrafish lines that express enhanced green fluorescent protein (EGFP) driven by the mouse Prx1 enhancer in developing pectoral fins. We also describe the expression pattern of the zebrafish prrx1 genes and identify three conserved non-coding elements (CNEs) that we use to generate fin-specific EGFP reporter lines. Finally, we show that the mouse and zebrafish regulatory elements may be used to modify gene function in pectoral fins. Copyright © 2011 Wiley-Liss, Inc.

Evolution and cell-type specificity of human-specific genes preferentially expressed in progenitors of fetal neocortex.

PubMed

Florio, Marta; Heide, Michael; Pinson, Anneline; Brandl, Holger; Albert, Mareike; Winkler, Sylke; Wimberger, Pauline; Huttner, Wieland B; Hiller, Michael

2018-03-21

Understanding the molecular basis that underlies the expansion of the neocortex during primate, and notably human, evolution requires the identification of genes that are particularly active in the neural stem and progenitor cells of the developing neocortex. Here, we have used existing transcriptome datasets to carry out a comprehensive screen for protein-coding genes preferentially expressed in progenitors of fetal human neocortex. We show that 15 human-specific genes exhibit such expression, and many of them evolved distinct neural progenitor cell-type expression profiles and levels compared to their ancestral paralogs. Functional studies on one such gene, NOTCH2NL , demonstrate its ability to promote basal progenitor proliferation in mice. An additional 35 human genes with progenitor-enriched expression are shown to have orthologs only in primates. Our study provides a resource of genes that are promising candidates to exert specific, and novel, roles in neocortical development during primate, and notably human, evolution. © 2018, Florio et al.

Evolution and cell-type specificity of human-specific genes preferentially expressed in progenitors of fetal neocortex

PubMed Central

Pinson, Anneline; Brandl, Holger; Albert, Mareike; Winkler, Sylke; Wimberger, Pauline

2018-01-01

Understanding the molecular basis that underlies the expansion of the neocortex during primate, and notably human, evolution requires the identification of genes that are particularly active in the neural stem and progenitor cells of the developing neocortex. Here, we have used existing transcriptome datasets to carry out a comprehensive screen for protein-coding genes preferentially expressed in progenitors of fetal human neocortex. We show that 15 human-specific genes exhibit such expression, and many of them evolved distinct neural progenitor cell-type expression profiles and levels compared to their ancestral paralogs. Functional studies on one such gene, NOTCH2NL, demonstrate its ability to promote basal progenitor proliferation in mice. An additional 35 human genes with progenitor-enriched expression are shown to have orthologs only in primates. Our study provides a resource of genes that are promising candidates to exert specific, and novel, roles in neocortical development during primate, and notably human, evolution. PMID:29561261

GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies

PubMed Central

Amanatiadou, Elsa P.; Papadopoulos, Giorgio L.; Strouboulis, John; Vizirianakis, Ioannis S.

2015-01-01

The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

Gene-specific mechanisms direct glucocorticoid-receptor-driven repression of inflammatory response genes in macrophages

PubMed Central

Sacta, Maria A; Tharmalingam, Bowranigan; Coppo, Maddalena; Rollins, David A; Deochand, Dinesh K; Benjamin, Bradley; Yu, Li; Zhang, Bin; Hu, Xiaoyu; Li, Rong; Chinenov, Yurii

2018-01-01

The glucocorticoid receptor (GR) potently represses macrophage-elicited inflammation, however, the underlying mechanisms remain obscure. Our genome-wide analysis in mouse macrophages reveals that pro-inflammatory paused genes, activated via global negative elongation factor (NELF) dissociation and RNA Polymerase (Pol)2 release from early elongation arrest, and non-paused genes, induced by de novo Pol2 recruitment, are equally susceptible to acute glucocorticoid repression. Moreover, in both cases the dominant mechanism involves rapid GR tethering to p65 at NF-kB-binding sites. Yet, specifically at paused genes, GR activation triggers widespread promoter accumulation of NELF, with myeloid cell-specific NELF deletion conferring glucocorticoid resistance. Conversely, at non-paused genes, GR attenuates the recruitment of p300 and histone acetylation, leading to a failure to assemble BRD4 and Mediator at promoters and enhancers, ultimately blocking Pol2 initiation. Thus, GR displays no preference for a specific pro-inflammatory gene class; however, it effects repression by targeting distinct temporal events and components of transcriptional machinery. PMID:29424686

Whole-Genome Positive Selection and Habitat-Driven Evolution in a Shallow and a Deep-Sea Urchin

PubMed Central

Oliver, Thomas A.; Garfield, David A.; Manier, Mollie K.; Haygood, Ralph; Wray, Gregory A.; Palumbi, Stephen R.

2010-01-01

Comparisons of genomic sequence between divergent species can provide insight into the action of natural selection across many distinct classes of proteins. Here, we examine the extent of positive selection as a function of tissue-specific and stage-specific gene expression in two closely-related sea urchins, the shallow-water Strongylocentrotus purpuratus and the deep-sea Allocentrotus fragilis, which have diverged greatly in their adult but not larval habitats. Genes that are expressed specifically in adult somatic tissue have significantly higher dN/dS ratios than the genome-wide average, whereas those in larvae are indistinguishable from the genome-wide average. Testis-specific genes have the highest dN/dS values, whereas ovary-specific have the lowest. Branch-site models involving the outgroup S. franciscanus indicate greater selection (ωFG) along the A. fragilis branch than along the S. purpuratus branch. The A. fragilis branch also shows a higher proportion of genes under positive selection, including those involved in skeletal development, endocytosis, and sulfur metabolism. Both lineages are approximately equal in enrichment for positive selection of genes involved in immunity, development, and cell–cell communication. The branch-site models further suggest that adult-specific genes have experienced greater positive selection than those expressed in larvae and that ovary-specific genes are more conserved (i.e., experienced greater negative selection) than those expressed specifically in adult somatic tissues and testis. Our results chart the patterns of protein change that have occurred after habitat divergence in these two species and show that the developmental or functional context in which a gene acts can play an important role in how divergent species adapt to new environments. PMID:20935062

Problem-Solving Test: Targeted Gene Disruption

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2008-01-01

Mutational inactivation of a specific gene is the most powerful technique to analyze the biological function of the gene. This approach has been used for a long time in viruses, bacteria, yeast, and fruit fly, but looked quite hopeless in more complex organisms. Targeted inactivation of specific genes (also known as knock-out mutation) in mice is…

DNA context represents transcription regulation of the gene in mouse embryonic stem cells

NASA Astrophysics Data System (ADS)

Ha, Misook; Hong, Soondo

2016-04-01

Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

DNA context represents transcription regulation of the gene in mouse embryonic stem cells.

PubMed

Ha, Misook; Hong, Soondo

2016-04-14

Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

PubMed Central

Sargent, R. Geoffrey; Kim, Soya

2011-01-01

Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

Inflammatory and mitochondrial gene expression data in GPER-deficient cardiomyocytes from male and female mice.

PubMed

Wang, Hao; Sun, Xuming; Chou, Jeff; Lin, Marina; Ferrario, Carlos M; Zapata-Sudo, Gisele; Groban, Leanne

2017-02-01

We previously showed that cardiomyocyte-specific G protein-coupled estrogen receptor (GPER) gene deletion leads to sex-specific adverse effects on cardiac structure and function; alterations which may be due to distinct differences in mitochondrial and inflammatory processes between sexes. Here, we provide the results of Gene Set Enrichment Analysis (GSEA) based on the DNA microarray data from GPER-knockout versus GPER-intact (intact) cardiomyocytes. This article contains complete data on the mitochondrial and inflammatory response-related gene expression changes that were significant in GPER knockout versus intact cardiomyocytes from adult male and female mice. The data are supplemental to our original research article "Cardiomyocyte-specific deletion of the G protein-coupled estrogen receptor (GPER) leads to left ventricular dysfunction and adverse remodeling: a sex-specific gene profiling" (Wang et al., 2016) [1]. Data have been deposited to the Gene Expression Omnibus (GEO) database repository with the dataset identifier GSE86843.

The landscape of genomic imprinting across diverse adult human tissues

PubMed Central

Baran, Yael; Subramaniam, Meena; Biton, Anne; Tukiainen, Taru; Tsang, Emily K.; Rivas, Manuel A.; Pirinen, Matti; Gutierrez-Arcelus, Maria; Smith, Kevin S.; Kukurba, Kim R.; Zhang, Rui; Eng, Celeste; Torgerson, Dara G.; Urbanek, Cydney; Li, Jin Billy; Rodriguez-Santana, Jose R.; Burchard, Esteban G.; Seibold, Max A.; MacArthur, Daniel G.; Montgomery, Stephen B.; Zaitlen, Noah A.; Lappalainen, Tuuli

2015-01-01

Genomic imprinting is an important regulatory mechanism that silences one of the parental copies of a gene. To systematically characterize this phenomenon, we analyze tissue specificity of imprinting from allelic expression data in 1582 primary tissue samples from 178 individuals from the Genotype-Tissue Expression (GTEx) project. We characterize imprinting in 42 genes, including both novel and previously identified genes. Tissue specificity of imprinting is widespread, and gender-specific effects are revealed in a small number of genes in muscle with stronger imprinting in males. IGF2 shows maternal expression in the brain instead of the canonical paternal expression elsewhere. Imprinting appears to have only a subtle impact on tissue-specific expression levels, with genes lacking a systematic expression difference between tissues with imprinted and biallelic expression. In summary, our systematic characterization of imprinting in adult tissues highlights variation in imprinting between genes, individuals, and tissues. PMID:25953952

DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

PubMed

Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

2015-10-01

The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (p<2.2e-16) than HK gene promoters. The entropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gene regulation mediates host specificity of a bacterial pathogen.

PubMed

Killiny, Nabil; Almeida, Rodrigo P P

2011-12-01

Many bacterial plant pathogens have a gene-for-gene relationship that determines host specificity. However, there are pathogens such as the xylem-limited bacterium Xylella fastidiosa that do not carry genes considered essential for the gene-for-gene model, such as those coding for a type III secretion system and effector molecules. Nevertheless, X. fastidiosa subspecies are host specific. A comparison of symptom development and host colonization after infection of plants with several mutant strains in two hosts, grapevines and almonds, indicated that X. fastidiosa virulence mechanisms are similar in those plants. Thus, we tested if modification of gene regulation patterns, by affecting the production of a cell-cell signalling molecule (DSF), impacted host specificity in X. fastidiosa. Results show that disruption of the rpfF locus, required for DSF synthesis, in a strain incapable of causing disease in grapevines, leads to symptom development in that host. These data are indicative that the core machinery required for the colonization of grapevines is present in that strain, and that changes in gene regulation alone can lead X. fastidiosa to exploit a novel host. The study of the evolution and mechanisms of host specificity mediated by gene regulation at the genome level could lead to important insights on the emergence of new diseases. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

Knock-in strategy at 3'-end of Crx gene by CRISPR/Cas9 system shows the gene expression profiles during human photoreceptor differentiation.

PubMed

Homma, Kohei; Usui, Sumiko; Kaneda, Makoto

2017-03-01

Fluorescent reporter gene knock-in induced pluripotent stem cell (iPSC) lines have been used to evaluate the efficiency of differentiation into specific cell lineages. Here, we report a knock-in strategy for the generation of human iPSC reporter lines in which a 2A peptide sequence and a red fluorescent protein (E2-Crimson) gene were inserted at the termination codon of the cone-rod homeobox (Crx) gene, a photoreceptor-specific transcriptional factor gene. The knock-in iPSC lines were differentiated into fluorescence-expressing cells in 3D retinal differentiation culture, and the fluorescent cells also expressed Crx specifically in the nucleus. We found that the fluorescence intensity was positively correlated with the expression levels of Crx mRNA and that fluorescent cells expressed rod photoreceptor-specific genes in the later stage of differentiation. Finally, we treated the fluorescent cells with DAPT, a Notch inhibitor, and found that DAPT-enhanced retinal differentiation was associated with up-regulation of Crx, Otx2 and NeuroD1, and down-regulation of Hes5 and Ngn2. These suggest that this knock-in strategy at the 3'-end of the target gene, combined with the 2A peptide linked to fluorescent proteins, offers a useful tool for labeling specific cell lineages or monitoring expression of any marker genes without affecting the function of the target gene. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Immuno-Navigator, a batch-corrected coexpression database, reveals cell type-specific gene networks in the immune system

PubMed Central

Vandenbon, Alexis; Dinh, Viet H.; Mikami, Norihisa; Kitagawa, Yohko; Teraguchi, Shunsuke; Ohkura, Naganari; Sakaguchi, Shimon

2016-01-01

High-throughput gene expression data are one of the primary resources for exploring complex intracellular dynamics in modern biology. The integration of large amounts of public data may allow us to examine general dynamical relationships between regulators and target genes. However, obstacles for such analyses are study-specific biases or batch effects in the original data. Here we present Immuno-Navigator, a batch-corrected gene expression and coexpression database for 24 cell types of the mouse immune system. We systematically removed batch effects from the underlying gene expression data and showed that this removal considerably improved the consistency between inferred correlations and prior knowledge. The data revealed widespread cell type-specific correlation of expression. Integrated analysis tools allow users to use this correlation of expression for the generation of hypotheses about biological networks and candidate regulators in specific cell types. We show several applications of Immuno-Navigator as examples. In one application we successfully predicted known regulators of importance in naturally occurring Treg cells from their expression correlation with a set of Treg-specific genes. For one high-scoring gene, integrin β8 (Itgb8), we confirmed an association between Itgb8 expression in forkhead box P3 (Foxp3)-positive T cells and Treg-specific epigenetic remodeling. Our results also suggest that the regulation of Treg-specific genes within Treg cells is relatively independent of Foxp3 expression, supporting recent results pointing to a Foxp3-independent component in the development of Treg cells. PMID:27078110

Organ-specific gene expression: the bHLH protein Sage provides tissue specificity to Drosophila FoxA.

PubMed

Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J

2013-05-01

FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.

Organ-specific gene expression: the bHLH protein Sage provides tissue specificity to Drosophila FoxA

PubMed Central

Fox, Rebecca M.; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J.

2013-01-01

FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously. PMID:23578928

Papain-like cysteine proteases in Carica papaya: lineage-specific gene duplication and expansion.

PubMed

Liu, Juan; Sharma, Anupma; Niewiara, Marie Jamille; Singh, Ratnesh; Ming, Ray; Yu, Qingyi

2018-01-06

Papain-like cysteine proteases (PLCPs), a large group of cysteine proteases structurally related to papain, play important roles in plant development, senescence, and defense responses. Papain, the first cysteine protease whose structure was determined by X-ray crystallography, plays a crucial role in protecting papaya from herbivorous insects. Except the four major PLCPs purified and characterized in papaya latex, the rest of the PLCPs in papaya genome are largely unknown. We identified 33 PLCP genes in papaya genome. Phylogenetic analysis clearly separated plant PLCP genes into nine subfamilies. PLCP genes are not equally distributed among the nine subfamilies and the number of PLCPs in each subfamily does not increase or decrease proportionally among the seven selected plant species. Papaya showed clear lineage-specific gene expansion in the subfamily III. Interestingly, all four major PLCPs purified from papaya latex, including papain, chymopapain, glycyl endopeptidase and caricain, were grouped into the lineage-specific expansion branch in the subfamily III. Mapping PLCP genes on chromosomes of five plant species revealed that lineage-specific expansions of PLCP genes were mostly derived from tandem duplications. We estimated divergence time of papaya PLCP genes of subfamily III. The major duplication events leading to lineage-specific expansion of papaya PLCP genes in subfamily III were estimated at 48 MYA, 34 MYA, and 16 MYA. The gene expression patterns of the papaya PLCP genes in different tissues were assessed by transcriptome sequencing and qRT-PCR. Most of the papaya PLCP genes of subfamily III expressed at high levels in leaf and green fruit tissues. Tandem duplications played the dominant role in affecting copy number of PLCPs in plants. Significant variations in size of the PLCP subfamilies among species may reflect genetic adaptation of plant species to different environments. The lineage-specific expansion of papaya PLCPs of subfamily III might have been promoted by the continuous reciprocal selective effects of herbivore attack and plant defense.

Lineage-Specific Evolutionary Histories and Regulation of Major Starch Metabolism Genes during Banana Ripening

PubMed Central

Jourda, Cyril; Cardi, Céline; Gibert, Olivier; Giraldo Toro, Andrès; Ricci, Julien; Mbéguié-A-Mbéguié, Didier; Yahiaoui, Nabila

2016-01-01

Starch is the most widespread and abundant storage carbohydrate in plants. It is also a major feature of cultivated bananas as it accumulates to large amounts during banana fruit development before almost complete conversion to soluble sugars during ripening. Little is known about the structure of major gene families involved in banana starch metabolism and their evolution compared to other species. To identify genes involved in banana starch metabolism and investigate their evolutionary history, we analyzed six gene families playing a crucial role in plant starch biosynthesis and degradation: the ADP-glucose pyrophosphorylases (AGPases), starch synthases (SS), starch branching enzymes (SBE), debranching enzymes (DBE), α-amylases (AMY) and β-amylases (BAM). Using comparative genomics and phylogenetic approaches, these genes were classified into families and sub-families and orthology relationships with functional genes in Eudicots and in grasses were identified. In addition to known ancestral duplications shaping starch metabolism gene families, independent evolution in banana and grasses also occurred through lineage-specific whole genome duplications for specific sub-families of AGPase, SS, SBE, and BAM genes; and through gene-scale duplications for AMY genes. In particular, banana lineage duplications yielded a set of AGPase, SBE and BAM genes that were highly or specifically expressed in banana fruits. Gene expression analysis highlighted a complex transcriptional reprogramming of starch metabolism genes during ripening of banana fruits. A differential regulation of expression between banana gene duplicates was identified for SBE and BAM genes, suggesting that part of starch metabolism regulation in the fruit evolved in the banana lineage. PMID:27994606

Optimization of a gene electrotransfer procedure for efficient intradermal immunization with an hTERT-based DNA vaccine in mice

PubMed Central

Calvet, Christophe Y; Thalmensi, Jessie; Liard, Christelle; Pliquet, Elodie; Bestetti, Thomas; Huet, Thierry; Langlade-Demoyen, Pierre; Mir, Lluis M

2014-01-01

DNA vaccination consists in administering an antigen-encoding plasmid in order to trigger a specific immune response. This specific vaccine strategy is of particular interest to fight against various infectious diseases and cancer. Gene electrotransfer is the most efficient and safest non-viral gene transfer procedure and specific electrical parameters have been developed for several target tissues. Here, a gene electrotransfer protocol into the skin has been optimized in mice for efficient intradermal immunization against the well-known telomerase tumor antigen. First, the luciferase reporter gene was used to evaluate gene electrotransfer efficiency into the skin as a function of the electrical parameters and electrodes, either non-invasive or invasive. In a second time, these parameters were tested for their potency to generate specific cellular CD8 immune responses against telomerase epitopes. These CD8 T-cells were fully functional as they secreted IFNγ and were endowed with specific cytotoxic activity towards target cells. This simple and optimized procedure for efficient gene electrotransfer into the skin using the telomerase antigen is to be used in cancer patients for the phase 1 clinical evaluation of a therapeutic cancer DNA vaccine called INVAC-1. PMID:26015983

Self-focusing therapeutic gene delivery with intelligent gene vector swarms: intra-swarm signalling through receptor transgene expression in targeted cells.

PubMed

Tolmachov, Oleg E

2015-01-01

Gene delivery in vivo that is tightly focused on the intended target cells is essential to maximize the benefits of gene therapy and to reduce unwanted side-effects. Cell surface markers are immediately available for probing by therapeutic gene vectors and are often used to direct gene transfer with these vectors to specific target cell populations. However, it is not unusual for the choice of available extra-cellular markers to be too scarce to provide a reliable definition of the desired therapeutically relevant set of target cells. Therefore, interrogation of intra-cellular determinants of cell-specificity, such as tissue-specific transcription factors, can be vital in order to provide detailed cell-guiding information to gene vector particles. An important improvement in cell-specific gene delivery can be achieved through auto-buildup in vector homing efficiency using intelligent 'self-focusing' of swarms of vector particles on target cells. Vector self-focusing was previously suggested to rely on the release of diffusible chemo-attractants after a successful target-specific hit by 'scout' vector particles. I hypothesize that intelligent self-focusing behaviour of swarms of cell-targeted therapeutic gene vectors can be accomplished without the employment of difficult-to-use diffusible chemo-attractants, instead relying on the intra-swarm signalling through cells expressing a non-diffusible extra-cellular receptor for the gene vectors. In the proposed model, cell-guiding information is gathered by the 'scout' gene vector particles, which: (1) attach to a variety of cells via a weakly binding (low affinity) receptor; (2) successfully facilitate gene transfer into these cells; (3) query intra-cellular determinants of cell-specificity with their transgene expression control elements and (4) direct the cell-specific biosynthesis of a vector-encoded strongly binding (high affinity) cell-surface receptor. Free members of the vector swarm loaded with therapeutic cargo are then attracted to and internalized into the intended target cells via the expressed cognate strongly binding extra-cellular receptor, causing escalation of gene transfer into these cells and increasing the copy number of the therapeutic gene expression modules. Such self-focusing swarms of gene vectors can be either homogeneous, with 'scout' and 'therapeutic' members of the swarm being structurally identical, or, alternatively, heterogeneous (split), with 'scout' and 'therapeutic' members of the swarm being structurally specialized. It is hoped that the proposed self-focusing cell-targeted gene vector swarms with receptor-mediated intra-swarm signalling could be particularly effective in 'top-up' gene delivery scenarios, achieving high-level and sustained expression of therapeutic transgenes that are prone to shut-down through degradation and silencing. Crucially, in contrast to low-precision 'general location' vector guidance by diffusible chemo-attractants, ear-marking non-diffusible receptors can provide high-accuracy targeting of therapeutic vector particles to the specific cell, which has undergone a 'successful cell-specific hit' by a 'scout' vector particle. Opportunities for cell targeting could be expanded, since in the proposed model of self-focusing it could be possible to probe a broad selection of intra-cellular determinants of cell-specificity and not just to rely exclusively on extra-cellular markers of cell-specificity. By employing such self-focusing gene vectors for the improvement of cell-targeted delivery of therapeutic genes, e.g., in cancer therapy or gene addition therapy of recessive genetic diseases, it could be possible to broaden a leeway for the reduction of the vector load and, consequently, to minimize undesired vector cytotoxicity, immune reactions, and the risk of inadvertent genetic modification of germline cells in genetic treatment in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

Maternal Diets Trigger Sex-Specific Divergent Trajectories of Gene Expression and Epigenetic Systems in Mouse Placenta

PubMed Central

Gabory, Anne; Ferry, Laure; Fajardy, Isabelle; Jouneau, Luc; Gothié, Jean-David; Vigé, Alexandre; Fleur, Cécile; Mayeur, Sylvain; Gallou-Kabani, Catherine; Gross, Marie-Sylvie; Attig, Linda; Vambergue, Anne; Lesage, Jean; Reusens, Brigitte; Vieau, Didier; Remacle, Claude; Jais, Jean-Philippe; Junien, Claudine

2012-01-01

Males and females responses to gestational overnutrition set the stage for subsequent sex-specific differences in adult onset non communicable diseases. Placenta, as a widely recognized programming agent, contibutes to the underlying processes. According to our previous findings, a high-fat diet during gestation triggers sex-specific epigenetic alterations within CpG and throughout the genome, together with the deregulation of clusters of imprinted genes. We further investigated the impact of diet and sex on placental histology, transcriptomic and epigenetic signatures in mice. Both basal gene expression and response to maternal high-fat diet were sexually dimorphic in whole placentas. Numerous genes showed sexually dimorphic expression, but only 11 genes regardless of the diet. In line with the key role of genes belonging to the sex chromosomes, 3 of these genes were Y-specific and 3 were X-specific. Amongst all the genes that were differentially expressed under a high-fat diet, only 16 genes were consistently affected in both males and females. The differences were not only quantitative but remarkably qualitative. The biological functions and networks of genes dysregulated differed markedly between the sexes. Seven genes of the epigenetic machinery were dysregulated, due to effects of diet, sex or both, including the Y- and X-linked histone demethylase paralogues Kdm5c and Kdm5d, which could mark differently male and female epigenomes. The DNA methyltransferase cofactor Dnmt3l gene expression was affected, reminiscent of our previous observation of changes in global DNA methylation. Overall, this striking sexual dimorphism of programming trajectories impose a considerable revision of the current dietary interventions protocols. PMID:23144842

Controlling Nuclear Jaks and Stats for Specific Gene Activation by Ifn γ and Other Cytokines: A Possible Steroid-like Connection

PubMed Central

Johnson, Howard M.; Noon-Song, Ezra; Ahmed, Chulbul M.

2011-01-01

The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation. PMID:22924155

Controlling Nuclear Jaks and Stats for Specific Gene Activation by Ifn γ and Other Cytokines: A Possible Steroid-like Connection.

PubMed

Johnson, Howard M; Noon-Song, Ezra; Ahmed, Chulbul M

2011-09-03

The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation.

Sex-Specific Selection and Sex-Biased Gene Expression in Humans and Flies

PubMed Central

Kirkpatrick, Mark

2016-01-01

Sexual dimorphism results from sex-biased gene expression, which evolves when selection acts differently on males and females. While there is an intimate connection between sex-biased gene expression and sex-specific selection, few empirical studies have studied this relationship directly. Here we compare the two on a genome-wide scale in humans and flies. We find a distinctive “Twin Peaks” pattern in humans that relates the strength of sex-specific selection, quantified by genetic divergence between male and female adults at autosomal loci, to the degree of sex-biased expression. Genes with intermediate degrees of sex-biased expression show evidence of ongoing sex-specific selection, while genes with either little or completely sex-biased expression do not. This pattern apparently results from differential viability selection in males and females acting in the current generation. The Twin Peaks pattern is also found in Drosophila using a different measure of sex-specific selection acting on fertility. We develop a simple model that successfully recapitulates the Twin Peaks. Our results suggest that many genes with intermediate sex-biased expression experience ongoing sex-specific selection in humans and flies. PMID:27658217

Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia

PubMed Central

Kojima, Kenji K.

2015-01-01

Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an “archaeal” RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes. PMID:26556480

Gene delivery to the neurulating embryo during culture

EPA Science Inventory

Modulating expression of specific genes during embryogenesis will help elucidate their role in development. Transient overexpression of specific genes can be accomplished by adding additional copies, or else antisense transcripts can be used to block expression. Manipulation of g...

Putative and unique gene sequence utilization for the design of species specific probes as modeled by Lactobacillus plantarum

USDA-ARS?s Scientific Manuscript database

The concept of utilizing putative and unique gene sequences for the design of species specific probes was tested. The abundance profile of assigned functions within the Lactobacillus plantarum genome was used for the identification of the putative and unique gene sequence, csh. The targeted gene (cs...

Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays.

PubMed

Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien

2016-01-01

Salmonella Typhi ( S . Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S . Typhi with other enteric pathogens was performed, and 6 S . Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico . Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro . The diagnostic sensitivities and specificities of each assay were determined using 39 S . Typhi, 62 non-Typhi Salmonella , and 10 non- Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.

The Arabidopsis translatome cell-specific mRNA atlas: Mining suberin and cutin lipid monomer biosynthesis genes as an example for data application.

PubMed

Mustroph, Angelika; Bailey-Serres, Julia

2010-03-01

Plants consist of distinct cell types distinguished by position, morphological features and metabolic activities. We recently developed a method to extract cell-type specific mRNA populations by immunopurification of ribosome-associated mRNAs. Microarray profiles of 21 cell-specific mRNA populations from seedling roots and shoots comprise the Arabidopsis Translatome dataset. This gene expression atlas provides a new tool for the study of cell-specific processes. Here we provide an example of how genes involved in a pathway limited to one or few cell-types can be further characterized and new candidate genes can be predicted. Cells of the root endodermis produce suberin as an inner barrier between the cortex and stele, whereas the shoot epidermal cells form cutin as a barrier to the external environment. Both polymers consist of fatty acid derivates, and share biosynthetic origins. We use the Arabidopsis Translatome dataset to demonstrate the significant cell-specific expression patterns of genes involved in those biosynthetic processes and suggest new candidate genes in the biosynthesis of suberin and cutin.

Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators.

PubMed

Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A

2015-08-01

Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. © 2015 Polstein et al.; Published by Cold Spring Harbor Laboratory Press.

BRD4 localization to lineage-specific enhancers is associated with a distinct transcription factor repertoire

PubMed Central

Najafova, Zeynab; Tirado-Magallanes, Roberto; Subramaniam, Malayannan; Hossan, Tareq; Schmidt, Geske; Nagarajan, Sankari; Baumgart, Simon J.; Mishra, Vivek Kumar; Bedi, Upasana; Hesse, Eric; Knapp, Stefan; Hawse, John R.; Johnsen, Steven A.

2017-01-01

Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we examined the role of BRD4 in promoting lineage-specific gene expression and show that BRD4 is essential for osteoblast differentiation. Genome-wide analyses demonstrate that BRD4 is recruited to the transcriptional start site of differentiation-induced genes. Unexpectedly, while promoter-proximal BRD4 occupancy correlated with gene expression, genes which displayed moderate expression and promoter-proximal BRD4 occupancy were most highly regulated and sensitive to BRD4 inhibition. Therefore, we examined distal BRD4 occupancy and uncovered a specific co-localization of BRD4 with the transcription factors C/EBPb, TEAD1, FOSL2 and JUND at putative osteoblast-specific enhancers. These findings reveal the intricacies of lineage specification and provide new insight into the context-dependent functions of BRD4. PMID:27651452

BRD4 localization to lineage-specific enhancers is associated with a distinct transcription factor repertoire.

PubMed

Najafova, Zeynab; Tirado-Magallanes, Roberto; Subramaniam, Malayannan; Hossan, Tareq; Schmidt, Geske; Nagarajan, Sankari; Baumgart, Simon J; Mishra, Vivek Kumar; Bedi, Upasana; Hesse, Eric; Knapp, Stefan; Hawse, John R; Johnsen, Steven A

2017-01-09

Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we examined the role of BRD4 in promoting lineage-specific gene expression and show that BRD4 is essential for osteoblast differentiation. Genome-wide analyses demonstrate that BRD4 is recruited to the transcriptional start site of differentiation-induced genes. Unexpectedly, while promoter-proximal BRD4 occupancy correlated with gene expression, genes which displayed moderate expression and promoter-proximal BRD4 occupancy were most highly regulated and sensitive to BRD4 inhibition. Therefore, we examined distal BRD4 occupancy and uncovered a specific co-localization of BRD4 with the transcription factors C/EBPb, TEAD1, FOSL2 and JUND at putative osteoblast-specific enhancers. These findings reveal the intricacies of lineage specification and provide new insight into the context-dependent functions of BRD4. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparative analyses of Xanthomonas and Xylella complete genomes.

PubMed

Moreira, Leandro M; De Souza, Robson F; Digiampietri, Luciano A; Da Silva, Ana C R; Setubal, João C

2005-01-01

Computational analyses of four bacterial genomes of the Xanthomonadaceae family reveal new unique genes that may be involved in adaptation, pathogenicity, and host specificity. The Xanthomonas genus presents 3636 unique genes distributed in 1470 families, while Xylella genus presents 1026 unique genes distributed in 375 families. Among Xanthomonas-specific genes, we highlight a large number of cell wall degrading enzymes, proteases, and iron receptors, a set of energy metabolism genes, second copy of the type II secretion system, type III secretion system, flagella and chemotactic machinery, and the xanthomonadin synthesis gene cluster. Important genes unique to the Xylella genus are an additional copy of a type IV pili gene cluster and the complete machinery of colicin V synthesis and secretion. Intersections of gene sets from both genera reveal a cluster of genes homologous to Salmonella's SPI-7 island in Xanthomonas axonopodis pv citri and Xylella fastidiosa 9a5c, which might be involved in host specificity. Each genome also presents important unique genes, such as an HMS cluster, the kdgT gene, and O-antigen in Xanthomonas axonopodis pv citri; a number of avrBS genes and a distinct O-antigen in Xanthomonas campestris pv campestris, a type I restriction-modification system and a nickase gene in Xylella fastidiosa 9a5c, and a type II restriction-modification system and two genes related to peptidoglycan biosynthesis in Xylella fastidiosa temecula 1. All these differences imply a considerable number of gene gains and losses during the divergence of the four lineages, and are associated with structural genome modifications that may have a direct relation with the mode of transmission, adaptation to specific environments and pathogenicity of each organism.

Upregulating endogenous genes by an RNA-programmable artificial transactivator

PubMed Central

Fimiani, Cristina; Goina, Elisa; Mallamaci, Antonello

2015-01-01

To promote expression of endogenous genes ad libitum, we developed a novel, programmable transcription factor prototype. Kept together via an MS2 coat protein/RNA interface, it includes a fixed, polypeptidic transactivating domain and a variable RNA domain that recognizes the desired gene. Thanks to this device, we specifically upregulated five genes, in cell lines and primary cultures of murine pallial precursors. Gene upregulation was small, however sufficient to robustly inhibit neuronal differentiation. The transactivator interacted with target gene chromatin via its RNA cofactor. Its activity was restricted to cells in which the target gene is normally transcribed. Our device might be useful for specific applications. However for this purpose, it will require an improvement of its transactivation power as well as a better characterization of its target specificity and mechanism of action. PMID:26152305

Mutant phenotypes for thousands of bacterial genes of unknown function

DOE PAGES

Price, Morgan N.; Wetmore, Kelly M.; Waters, R. Jordan; ...

2018-05-16

One-third of all protein-coding genes from bacterial genomes cannot be annotated with a function. Here, to investigate the functions of these genes, we present genome-wide mutant fitness data from 32 diverse bacteria across dozens of growth conditions. We identified mutant phenotypes for 11,779 protein-coding genes that had not been annotated with a specific function. Many genes could be associated with a specific condition because the gene affected fitness only in that condition, or with another gene in the same bacterium because they had similar mutant phenotypes. Of the poorly annotated genes, 2,316 had associations that have high confidence because theymore » are conserved in other bacteria. By combining these conserved associations with comparative genomics, we identified putative DNA repair proteins; in addition, we propose specific functions for poorly annotated enzymes and transporters and for uncharacterized protein families. Lastly, our study demonstrates the scalability of microbial genetics and its utility for improving gene annotations.« less

Mutant phenotypes for thousands of bacterial genes of unknown function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Price, Morgan N.; Wetmore, Kelly M.; Waters, R. Jordan

One-third of all protein-coding genes from bacterial genomes cannot be annotated with a function. Here, to investigate the functions of these genes, we present genome-wide mutant fitness data from 32 diverse bacteria across dozens of growth conditions. We identified mutant phenotypes for 11,779 protein-coding genes that had not been annotated with a specific function. Many genes could be associated with a specific condition because the gene affected fitness only in that condition, or with another gene in the same bacterium because they had similar mutant phenotypes. Of the poorly annotated genes, 2,316 had associations that have high confidence because theymore » are conserved in other bacteria. By combining these conserved associations with comparative genomics, we identified putative DNA repair proteins; in addition, we propose specific functions for poorly annotated enzymes and transporters and for uncharacterized protein families. Lastly, our study demonstrates the scalability of microbial genetics and its utility for improving gene annotations.« less

Genome-wide identification of lineage-specific genes in Arabidopsis, Oryza and Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiaohan; Jawdy, Sara; Tschaplinski, Timothy J

2009-01-01

Protein sequences were compared among Arabidopsis, Oryza and Populus to identify differential gene (DG) sets that are in one but not the other two genomes. The DG sets were screened against a plant transcript database, the NR protein database and six newly-sequenced genomes (Carica, Glycine, Medicago, Sorghum, Vitis and Zea) to identify a set of species-specific genes (SS). Gene expression, protein motif and intron number were examined. 192, 641 and 109 SS genes were identified in Arabidopsis, Oryza and Populus, respectively. Some SS genes were preferentially expressed in flowers, roots, xylem and cambium or up-regulated by stress. Six conserved motifsmore » in Arabidopsis and Oryza SS proteins were found in other distant lineages. The SS gene sets were enriched with intronless genes. The results reflect functional and/or anatomical differences between monocots and eudicots or between herbaceous and woody plants. The Populus-specific genes are candidates for carbon sequestration and biofuel research.« less

Learning contextual gene set interaction networks of cancer with condition specificity

PubMed Central

2013-01-01

Background Identifying similarities and differences in the molecular constitutions of various types of cancer is one of the key challenges in cancer research. The appearances of a cancer depend on complex molecular interactions, including gene regulatory networks and gene-environment interactions. This complexity makes it challenging to decipher the molecular origin of the cancer. In recent years, many studies reported methods to uncover heterogeneous depictions of complex cancers, which are often categorized into different subtypes. The challenge is to identify diverse molecular contexts within a cancer, to relate them to different subtypes, and to learn underlying molecular interactions specific to molecular contexts so that we can recommend context-specific treatment to patients. Results In this study, we describe a novel method to discern molecular interactions specific to certain molecular contexts. Unlike conventional approaches to build modular networks of individual genes, our focus is to identify cancer-generic and subtype-specific interactions between contextual gene sets, of which each gene set share coherent transcriptional patterns across a subset of samples, termed contextual gene set. We then apply a novel formulation for quantitating the effect of the samples from each subtype on the calculated strength of interactions observed. Two cancer data sets were analyzed to support the validity of condition-specificity of identified interactions. When compared to an existing approach, the proposed method was much more sensitive in identifying condition-specific interactions even in heterogeneous data set. The results also revealed that network components specific to different types of cancer are related to different biological functions than cancer-generic network components. We found not only the results that are consistent with previous studies, but also new hypotheses on the biological mechanisms specific to certain cancer types that warrant further investigations. Conclusions The analysis on the contextual gene sets and characterization of networks of interaction composed of these sets discovered distinct functional differences underlying various types of cancer. The results show that our method successfully reveals many subtype-specific regions in the identified maps of biological contexts, which well represent biological functions that can be connected to specific subtypes. PMID:23418942

Chamber Specific Gene Expression Landscape of the Zebrafish Heart

PubMed Central

Singh, Angom Ramcharan; Sivadas, Ambily; Sabharwal, Ankit; Vellarikal, Shamsudheen Karuthedath; Jayarajan, Rijith; Verma, Ankit; Kapoor, Shruti; Joshi, Adita; Scaria, Vinod; Sivasubbu, Sridhar

2016-01-01

The organization of structure and function of cardiac chambers in vertebrates is defined by chamber-specific distinct gene expression. This peculiarity and uniqueness of the genetic signatures demonstrates functional resolution attributed to the different chambers of the heart. Altered expression of the cardiac chamber genes can lead to individual chamber related dysfunctions and disease patho-physiologies. Information on transcriptional repertoire of cardiac compartments is important to understand the spectrum of chamber specific anomalies. We have carried out a genome wide transcriptome profiling study of the three cardiac chambers in the zebrafish heart using RNA sequencing. We have captured the gene expression patterns of 13,396 protein coding genes in the three cardiac chambers—atrium, ventricle and bulbus arteriosus. Of these, 7,260 known protein coding genes are highly expressed (≥10 FPKM) in the zebrafish heart. Thus, this study represents nearly an all-inclusive information on the zebrafish cardiac transcriptome. In this study, a total of 96 differentially expressed genes across the three cardiac chambers in zebrafish were identified. The atrium, ventricle and bulbus arteriosus displayed 20, 32 and 44 uniquely expressing genes respectively. We validated the expression of predicted chamber-restricted genes using independent semi-quantitative and qualitative experimental techniques. In addition, we identified 23 putative novel protein coding genes that are specifically restricted to the ventricle and not in the atrium or bulbus arteriosus. In our knowledge, these 23 novel genes have either not been investigated in detail or are sparsely studied. The transcriptome identified in this study includes 68 differentially expressing zebrafish cardiac chamber genes that have a human ortholog. We also carried out spatiotemporal gene expression profiling of the 96 differentially expressed genes throughout the three cardiac chambers in 11 developmental stages and 6 tissue types of zebrafish. We hypothesize that clustering the differentially expressed genes with both known and unknown functions will deliver detailed insights on fundamental gene networks that are important for the development and specification of the cardiac chambers. It is also postulated that this transcriptome atlas will help utilize zebrafish in a better way as a model for studying cardiac development and to explore functional role of gene networks in cardiac disease pathogenesis. PMID:26815362

Gene-specific cell labeling using MiMIC transposons.

PubMed

Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A

2015-04-30

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Ecological adaptation determines functional mammalian olfactory subgenomes

PubMed Central

Hayden, Sara; Bekaert, Michaël; Crider, Tess A.; Mariani, Stefano; Murphy, William J.; Teeling, Emma C.

2010-01-01

The ability to smell is governed by the largest gene family in mammalian genomes, the olfactory receptor (OR) genes. Although these genes are well annotated in the finished human and mouse genomes, we still do not understand which receptors bind specific odorants or how they fully function. Previous comparative studies have been taxonomically limited and mostly focused on the percentage of OR pseudogenes within species. No study has investigated the adaptive changes of functional OR gene families across phylogenetically and ecologically diverse mammals. To determine the extent to which OR gene repertoires have been influenced by habitat, sensory specialization, and other ecological traits, to better understand the functional importance of specific OR gene families and thus the odorants they bind, we compared the functional OR gene repertoires from 50 mammalian genomes. We amplified more than 2000 OR genes in aquatic, semi-aquatic, and flying mammals and coupled these data with 48,000 OR genes from mostly terrestrial mammals, extracted from genomic projects. Phylogenomic, Bayesian assignment, and principle component analyses partitioned species by ecotype (aquatic, semi-aquatic, terrestrial, flying) rather than phylogenetic relatedness, and identified OR families important for each habitat. Functional OR gene repertoires were reduced independently in the multiple origins of aquatic mammals and were significantly divergent in bats. We reject recent neutralist views of olfactory subgenome evolution and correlate specific OR gene families with physiological requirements, a preliminary step toward unraveling the relationship between specific odors and respective OR gene families. PMID:19952139

Selection-driven evolution of sex-biased genes is consistent with sexual selection in Arabidopsis thaliana.

PubMed

Gossmann, Toni I; Schmid, Marc W; Grossniklaus, Ueli; Schmid, Karl J

2014-03-01

Sex-biased genes are genes with a preferential or specific expression in one sex and tend to show an accelerated rate of evolution in animals. Various hypotheses--which are not mutually exclusive--have been put forth to explain observed patterns of rapid evolution. One possible explanation is positive selection, but this has been shown only in few animal species and mostly for male-specific genes. Here, we present a large-scale study that investigates evolutionary patterns of sex-biased genes in the predominantly self-fertilizing plant Arabidopsis thaliana. Unlike most animal species, A. thaliana does not possess sex chromosomes, its flowers develop both male and female sexual organs, and it is characterized by low outcrossing rates. Using cell-specific gene expression data, we identified genes whose expression is enriched in comparison with all other tissues in the male and female gametes (sperm, egg, and central cell), as well as in synergids, pollen, and pollen tubes, which also play an important role in reproduction. Genes specifically expressed in gametes and synergids show higher rates of protein evolution compared with the genome-wide average and no evidence for positive selection. In contrast, pollen- and pollen tube-specific genes not only have lower rates of protein evolution but also exhibit a higher proportion of adaptive amino acid substitutions. We show that this is the result of increased levels of purifying and positive selection among genes with pollen- and pollen tube-specific expression. The increased proportion of adaptive substitutions cannot be explained by the fact that pollen- and pollen tube-expressed genes are enriched in segmental duplications, are on average older, or have a larger effective population size. Our observations are consistent with prezygotic sexual selection as a result of interactions during pollination and pollen tube growth such as pollen tube competition.

Elucidation of the Molecular Mechanisms for Aberrant Expression of Breast Cancer Specific Gene 1 in Invasive and Metastatic Breast Carcinomas

DTIC Science & Technology

2004-06-01

cells in mitosis. Mutations in any of these genes result in failure to arrest Keywords: BCSG I: BubRl; mitotic checkpoint; yeast the cell cycle at G2...AD Award Number: DAMD17-02-1-0534 TITLE: Elucidation of the Molecular Mechanisms for Aberrant Expression of Breast Cancer Specific Gene 1 in Invasive...SUBTITLE 5. FUNDING NUMBERS Elucidation of the Molecular Mechanisms for Aberrant DAMD17-02-1-0534 Expression of Breast Cancer Specific Gene 1 in Invasive

Ex Vivo Drug Susceptibility of Ferroquine against Chloroquine-Resistant Isolates of Plasmodium falciparum and P. vivax▿

PubMed Central

Marfurt, Jutta; Chalfein, Ferryanto; Prayoga, Pak; Wabiser, Frans; Kenangalem, Enny; Piera, Kim A.; MacHunter, Barbara; Tjitra, Emiliana; Anstey, Nicholas M.; Price, Ric N.

2011-01-01

Ferroquine (FQ; SSR97193), a ferrocene-containing 4-aminoquinoline derivate, has potent in vitro efficacy against chloroquine (CQ)-resistant Plasmodium falciparum and CQ-sensitive P. vivax. In the current study, ex vivo FQ activity was tested in multidrug-resistant P. falciparum and P. vivax field isolates using a schizont maturation assay. Although FQ showed excellent activity against CQ-sensitive and -resistant P. falciparum and P. vivax (median 50% inhibitory concentrations [IC50s], 9.6 nM and 18.8 nM, respectively), there was significant cross-susceptibility with the quinoline-based drugs chloroquine, amodiaquine, and piperaquine (for P. falciparum, r = 0.546 to 0.700, P < 0.001; for P. vivax, r = 0.677 to 0.821, P < 0.001). The observed ex vivo cross-susceptibility is likely to reflect similar mechanisms of drug uptake/efflux and modes of drug action of this drug class. However, the potent activity of FQ against resistant isolates of both P. falciparum and P. vivax highlights a promising role for FQ as a lead antimalarial against CQ-resistant Plasmodium and a useful partner drug for artemisinin-based combination therapy. PMID:21730116

An outbreak of sarcocystosis in psittacines and a pigeon in a zoological collection in Brazil.

PubMed

Ecco, R; Luppi, M M; Malta, M C C; Araújo, M R; Guedes, R M C; Shivaprasad, H L

2008-12-01

This report describes an outbreak of acute pulmonary sarcocystosis in different species of captive psittacines and in a Luzon bleeding-heart pigeon (Gallicolumba luzonica) in a zoological collection in Brazil. A majority of the birds were found dead and had exhibited no previous clinical signs. Grossly, pulmonary congestion and edema were the most-common findings. Enlarged and congested livers and spleens were also frequently observed. Microscopically, there was edema, fibrin exudation, congestion, and perivascular and interstitial lymphoplasmacytic infiltration associated with numerous sinuous schizonts of Sarcocystis sp. in the lungs. Mild to moderate myocarditis, hepatitis, splenitis, and interstitial nephritis were also observed in the birds. Immunohistochemistry confirmed Sarcocystis sp. in the capillaries of lungs, hearts, livers, and spleens of most of the birds, but also in the pancreas, kidney, intestine, proventriculus, and brain of a few birds. The probable source of Sarcocystis sp. in these birds was the wild opossum (Didelphis albiventris), a common inhabitant of a local forest that surrounds the Belo Horizonte Zoo (Fundação Zoo-Botânica). This is the first documentation of Sarcocystis infection in psittacines and a pigeon from Brazil.

Treatment of field cases of East Coast fever with halofuginone lactate.

PubMed

Njau, B C; Mkonyi, P A; Mleche, W C; Kitaly, J I; Maiseli, N C

1985-11-01

In a series of field trials 48 (55%) of 88 field cases of East Coast fever treated with halofuginone lactate recovered and survived and 40 (45%) died while 31 (86%) of 36 untreated control animals died of East Coast fever and five (14%) recovered. For cases diagnosed and treated early a 100% recovery rate was achieved. A single dose at 1.2 mg/kg body weight per os was adequate. Recovery rate was only 36% for cases diagnosed and treated at an advanced stage. Such cases required two doses at 1.2 mg/kg or a combination of 1.2 and 2.4 mg/kg body weight given at about two days interval. The temperature dropped to normal levels within 48 h of treatment and schizonts started degenerating as early as 24 h after treatment and had disappeared by 48 to 72 h. Piroplasms were not affected by the drug. Recovered animals remained free of East Coast fever for periods up to 12 months of observation despite continuous tick challenge. It was concluded that, with early detection and treatment augmented with proper tick control, outbreaks of East Coast fever can be effectively controlled with halofuginone lactate.

Tafenoquine and its potential in the treatment and relapse prevention of Plasmodium vivax malaria: the evidence to date.

PubMed

Ebstie, Yehenew A; Abay, Solomon M; Tadesse, Wondmagegn T; Ejigu, Dawit A

2016-01-01

Despite declining global malaria incidence, the disease continues to be a threat to people living in endemic regions. In 2015, an estimated 214 million new malaria cases and 438,000 deaths due to malaria were recorded. Plasmodium vivax is the second most common cause of malaria next to Plasmodium falciparum. Vivax malaria is prevalent especially in Southeast Asia and the Horn of Africa, with enormous challenges in controlling the disease. Some of the challenges faced by vivax malaria-endemic countries include limited access to effective drugs treating liver stages of the parasite (schizonts and hypnozoites), emergence/spread of drug resistance, and misperception of vivax malaria as nonlethal. Primaquine, the only 8-aminoquinoline derivative approved by the US Food and Drug Administration, is intended to clear intrahepatic hypnozoites of P. vivax (radical cure). However, poor adherence to a prolonged treatment course, drug-induced hemolysis in patients with glucose-6-phosphate dehydrogenase deficiency, and the emergence of resistance make it imperative to look for alternative drugs. Therefore, this review focuses on data accrued to date on tafenoquine and gives insight on the potential role of the drug in preventing relapse and radical cure of patients with vivax malaria.

Effect of tamoxifen on the sphingolipid biosynthetic pathway in the different intraerythrocytic stages of the apicomplexa Plasmodium falciparum.

PubMed

Piñero, Tamara A; Landoni, Malena; Duschak, Vilma G; Katzin, Alejandro M; Couto, Alicia S

2018-03-18

Parasites of the genus Plasmodium responsible for Malaria are obligate intracellular pathogens residing in mammalian red blood cells, hepatocytes, or mosquito midgut epithelial cells. Regarding that detailed knowledge on the sphingolipid biosynthetic pathway of the apicomplexan protozoan parasites is scarce, different stages of Plasmodium falciparum were treated with tamoxifen in order to evaluate the effects of this drug on the glycosphingolipid biosynthesis. Thin layer chromatography, High performance reverse phase chromatography and UV-MALDI-TOF mass spectrometry were the tools used for the analysis. In the ring forms, the increase of NBD-phosphatidyl inositol biosynthesis was notorious but differences at NBD-GlcCer levels were undetectable. In trophozoite forms, an abrupt decrease of NBD-acylated GlcDHCer and NBD-GlcDHCer in addition to an increase of NBD-PC biosynthesis was observed. On the contrary, in schizonts, tamoxifen seems not to be producing substantial changes in lipid biosynthesis. Our findings indicate that in this parasite, tamoxifen is exerting an inhibitory action on Glucosylceramidesynthase and sphingomyelin synthase levels. Moreover, regarding that Plasmodium does not biosynthesize inositolphosphoceramides, the accumulation of phosphatidylinositol should indicate an inhibitory action on glycosylinositol phospholipid synthesis. Copyright © 2018 Elsevier Inc. All rights reserved.

Magnetic isolation of Plasmodium falciparum schizonts iRBCs to generate a high parasitaemia and synchronized in vitro culture.

PubMed

Mata-Cantero, Lydia; Lafuente, Maria J; Sanz, Laura; Rodriguez, Manuel S

2014-03-21

The establishment of methods for an in vitro continuous culture of Plasmodium falciparum is essential for gaining knowledge into its biology and for the development of new treatments. Previously, several techniques have been used to synchronize, enrich and concentrate P. falciparum, although obtaining cultures with high parasitaemia continues being a challenging process. Current methods produce high parasitaemia levels of synchronized P. falciparum cultures by frequent changes of culture medium or reducing the haematocrit. However, these methods are time consuming and sometimes lead to the loss of synchrony. A procedure that combines Percoll and sorbitol treatments, the use of magnetic columns, and the optimization of the in vitro culture conditions to reach high parasitaemia levels for synchronized Plasmodium falciparum cultures is described. A new procedure has been established using P. falciparum 3D7, combining previous reported methodologies to achieve in vitro parasite cultures that reach parasitaemia up to 40% at any intra-erythrocytic stage. High parasitaemia levels are obtained only one day after magnetic column purification without compromising the parasite viability and synchrony. The described procedure allows obtaining a large scale synchronized parasite culture at a high parasitaemia with less manipulations than other methods previously described.

Plasmodium berghei Δp52&p36 parasites develop independent of a parasitophorous vacuole membrane in Huh-7 liver cells.

PubMed

Ploemen, Ivo H J; Croes, Huib J; van Gemert, Geert-Jan J; Wijers-Rouw, Mietske; Hermsen, Cornelus C; Sauerwein, Robert W

2012-01-01

The proteins P52 and P36 are expressed in the sporozoite stage of the murine malaria parasite Plasmodium berghei. Δp52&p36 sporozoites lacking expression of both proteins are severely compromised in their capability to develop into liver stage parasites and abort development soon after invasion; presumably due to the absence of a parasitophorous vacuole membrane (PVM). However, a small proportion of P. berghei Δp52&p36 parasites is capable to fully mature in hepatocytes causing breakthrough blood stage infections. We have studied the maturation of replicating Δp52&p36 parasites in cultured Huh-7 hepatocytes. Approximately 50% of Δp52&p36 parasites developed inside the nucleus of the hepatocyte but did not complete maturation and failed to produce merosomes. In contrast cytosolic Δp52&p36 parasites were able to fully mature and produced infectious merozoites. These Δp52&p36 parasites developed into mature schizonts in the absence of an apparent parasitophorous vacuole membrane as shown by immunofluorescence and electron microscopy. Merozoites derived from these maturing Δp52&p36 liver stages were infectious for C57BL/6 mice.

Deciphering Genome Content and Evolutionary Relationships of Isolates from the Fungus Magnaporthe oryzae Attacking Different Host Plants

PubMed Central

Chiapello, Hélène; Mallet, Ludovic; Guérin, Cyprien; Aguileta, Gabriela; Amselem, Joëlle; Kroj, Thomas; Ortega-Abboud, Enrique; Lebrun, Marc-Henri; Henrissat, Bernard; Gendrault, Annie; Rodolphe, François; Tharreau, Didier; Fournier, Elisabeth

2015-01-01

Deciphering the genetic bases of pathogen adaptation to its host is a key question in ecology and evolution. To understand how the fungus Magnaporthe oryzae adapts to different plants, we sequenced eight M. oryzae isolates differing in host specificity (rice, foxtail millet, wheat, and goosegrass), and one Magnaporthe grisea isolate specific of crabgrass. Analysis of Magnaporthe genomes revealed small variation in genome sizes (39–43 Mb) and gene content (12,283–14,781 genes) between isolates. The whole set of Magnaporthe genes comprised 14,966 shared families, 63% of which included genes present in all the nine M. oryzae genomes. The evolutionary relationships among Magnaporthe isolates were inferred using 6,878 single-copy orthologs. The resulting genealogy was mostly bifurcating among the different host-specific lineages, but was reticulate inside the rice lineage. We detected traces of introgression from a nonrice genome in the rice reference 70-15 genome. Among M. oryzae isolates and host-specific lineages, the genome composition in terms of frequencies of genes putatively involved in pathogenicity (effectors, secondary metabolism, cazome) was conserved. However, 529 shared families were found only in nonrice lineages, whereas the rice lineage possessed 86 specific families absent from the nonrice genomes. Our results confirmed that the host specificity of M. oryzae isolates was associated with a divergence between lineages without major gene flow and that, despite the strong conservation of gene families between lineages, adaptation to different hosts, especially to rice, was associated with the presence of a small number of specific gene families. All information was gathered in a public database (http://genome.jouy.inra.fr/gemo). PMID:26454013

New frontier in regenerative medicine: site-specific gene correction in patient-specific induced pluripotent stem cells.

PubMed

Garate, Zita; Davis, Brian R; Quintana-Bustamante, Oscar; Segovia, Jose C

2013-06-01

Advances in cell and gene therapy are opening up new avenues for regenerative medicine. Because of their acquired pluripotency, human induced pluripotent stem cells (hiPSCs) are a promising source of autologous cells for regenerative medicine. They show unlimited self-renewal while retaining the ability, in principle, to differentiate into any cell type of the human body. Since Yamanaka and colleagues first reported the generation of hiPSCs in 2007, significant efforts have been made to understand the reprogramming process and to generate hiPSCs with potential for clinical use. On the other hand, the development of gene-editing platforms to increase homologous recombination efficiency, namely DNA nucleases (zinc finger nucleases, TAL effector nucleases, and meganucleases), is making the application of locus-specific gene therapy in human cells an achievable goal. The generation of patient-specific hiPSC, together with gene correction by homologous recombination, will potentially allow for their clinical application in the near future. In fact, reports have shown targeted gene correction through DNA-Nucleases in patient-specific hiPSCs. Various technologies have been described to reprogram patient cells and to correct these patient hiPSCs. However, no approach has been clearly more efficient and safer than the others. In addition, there are still significant challenges for the clinical application of these technologies, such as inefficient differentiation protocols, genetic instability resulting from the reprogramming process and hiPSC culture itself, the efficacy and specificity of the engineered DNA nucleases, and the overall homologous recombination efficiency. To summarize advances in the generation of gene corrected patient-specific hiPSCs, this review focuses on the available technological platforms, including their strengths and limitations regarding future therapeutic use of gene-corrected hiPSCs.

Discovering hidden relationships between renal diseases and regulated genes through 3D network visualizations

PubMed Central

2010-01-01

Background In a recent study, two-dimensional (2D) network layouts were used to visualize and quantitatively analyze the relationship between chronic renal diseases and regulated genes. The results revealed complex relationships between disease type, gene specificity, and gene regulation type, which led to important insights about the underlying biological pathways. Here we describe an attempt to extend our understanding of these complex relationships by reanalyzing the data using three-dimensional (3D) network layouts, displayed through 2D and 3D viewing methods. Findings The 3D network layout (displayed through the 3D viewing method) revealed that genes implicated in many diseases (non-specific genes) tended to be predominantly down-regulated, whereas genes regulated in a few diseases (disease-specific genes) tended to be up-regulated. This new global relationship was quantitatively validated through comparison to 1000 random permutations of networks of the same size and distribution. Our new finding appeared to be the result of using specific features of the 3D viewing method to analyze the 3D renal network. Conclusions The global relationship between gene regulation and gene specificity is the first clue from human studies that there exist common mechanisms across several renal diseases, which suggest hypotheses for the underlying mechanisms. Furthermore, the study suggests hypotheses for why the 3D visualization helped to make salient a new regularity that was difficult to detect in 2D. Future research that tests these hypotheses should enable a more systematic understanding of when and how to use 3D network visualizations to reveal complex regularities in biological networks. PMID:21070623

Analysis of the SWI/SNF chromatin-remodeling complex during early heart development and BAF250a repression cardiac gene transcription during P19 cell differentiation

PubMed Central

Singh, Ajeet Pratap; Archer, Trevor K.

2014-01-01

The regulatory networks of differentiation programs and the molecular mechanisms of lineage-specific gene regulation in mammalian embryos remain only partially defined. We document differential expression and temporal switching of BRG1-associated factor (BAF) subunits, core pluripotency factors and cardiac-specific genes during post-implantation development and subsequent early organogenesis. Using affinity purification of BRG1 ATPase coupled to mass spectrometry, we characterized the cardiac-enriched remodeling complexes present in E8.5 mouse embryos. The relative abundance and combinatorial assembly of the BAF subunits provides functional specificity to Switch/Sucrose NonFermentable (SWI/SNF) complexes resulting in a unique gene expression profile in the developing heart. Remarkably, the specific depletion of the BAF250a subunit demonstrated differential effects on cardiac-specific gene expression and resulted in arrhythmic contracting cardiomyocytes in vitro. Indeed, the BAF250a physically interacts and functionally cooperates with Nucleosome Remodeling and Histone Deacetylase (NURD) complex subunits to repressively regulate chromatin structure of the cardiac genes by switching open and poised chromatin marks associated with active and repressed gene expression. Finally, BAF250a expression modulates BRG1 occupancy at the loci of cardiac genes regulatory regions in P19 cell differentiation. These findings reveal specialized and novel cardiac-enriched SWI/SNF chromatin-remodeling complexes, which are required for heart formation and critical for cardiac gene expression regulation at the early stages of heart development. PMID:24335282

Lineage-specific expansion of IFIT gene family: an insight into coevolution with IFN gene family.

PubMed

Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang

2013-01-01

In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system.

Mycobacterium tuberculosis strains exhibit differential and strain-specific molecular signatures in pulmonary epithelial cells.

PubMed

Mvubu, Nontobeko Eunice; Pillay, Balakrishna; Gamieldien, Junaid; Bishai, William; Pillay, Manormoney

2016-12-01

Although pulmonary epithelial cells are integral to innate and adaptive immune responses during Mycobacterium tuberculosis infection, global transcriptomic changes in these cells remain largely unknown. Changes in gene expression induced in pulmonary epithelial cells infected with M. tuberculosis F15/LAM4/KZN, F11, F28, Beijing and Unique genotypes were investigated by RNA sequencing (RNA-Seq). The Illumina HiSeq 2000 platform generated 50 bp reads that were mapped to the human genome (Hg19) using Tophat (2.0.10). Differential gene expression induced by the different strains in infected relative to the uninfected cells was quantified and compared using Cufflinks (2.1.0) and MeV (4.0.9), respectively. Gene expression varied among the strains with the total number of genes as follows: F15/LAM4/KZN (1187), Beijing (1252), F11 (1639), F28 (870), Unique (886) and H37Rv (1179). A subset of 292 genes was commonly induced by all strains, where 52 genes were down-regulated while 240 genes were up-regulated. Differentially expressed genes were compared among the strains and the number of induced strain-specific gene signatures were as follows: F15/LAM4/KZN (138), Beijing (52), F11 (255), F28 (55), Unique (186) and H37Rv (125). Strain-specific molecular gene signatures associated with functional pathways were observed only for the Unique and H37Rv strains while certain biological functions may be associated with other strain signatures. This study demonstrated that strains of M. tuberculosis induce differential gene expression and strain-specific molecular signatures in pulmonary epithelial cells. Specific signatures induced by clinical strains of M. tuberculosis can be further explored for novel host-associated biomarkers and adjunctive immunotherapies. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

PubMed

Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

2017-08-01

Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

New insights into polar overdominance in callipyge sheep.

PubMed

Bidwell, C A; Waddell, J N; Taxis, T M; Yu, H; Tellam, R L; Neary, M K; Cockett, N E

2014-08-01

The callipyge phenotype in sheep involves substantial postnatal muscle hypertrophy and other changes to carcass composition. A single nucleotide polymorphism in the DLK1-DIO3 imprinted gene cluster alters gene expression of the paternal allele-specific protein-coding genes and several maternal allele-specific long noncoding RNA and microRNA when the mutation is inherited in cis. The inheritance pattern of the callipyge phenotype is polar overdominant because muscle hypertrophy only occurs in heterozygous animals that inherit a normal maternal allele and the callipyge SNP on the paternal allele (+/C). We examined the changes of gene expression of four major transcripts from the DLK1-DIO3 cluster and four myosin isoforms during the development of muscle hypertrophy in the semimembranosus as well as in the supraspinatus that does not undergo hypertrophy. The homozygous (C/C) animals had an intermediate gene expression pattern for the paternal allele-specific genes and two myosin isoforms, indicating a biological activity that was insufficient to change muscle mass. Transcriptome analysis was conducted by RNA sequencing in the four callipyge genotypes. The data show that homozygous animals (C/C) have lower levels of gene expression at many loci relative to the other three genotypes. A number of the downregulated genes are putative targets of the maternal allele-specific microRNA with gene ontology, indicating regulatory and cell signaling functions. These results suggest that the trans-effect of the maternal noncoding RNA and associated miRNA is to stabilize the expression of a number of regulatory genes at a functional, but low level to make the myofibers of homozygous (C/C) lambs less responsive to hypertrophic stimuli of the paternal allele-specific genes. © 2014 Stichting International Foundation for Animal Genetics.

Massive expression of germ cell-specific genes is a hallmark of cancer and a potential target for novel treatment development.

PubMed

Bruggeman, Jan Willem; Koster, Jan; Lodder, Paul; Repping, Sjoerd; Hamer, Geert

2018-06-15

Cancer cells have been found to frequently express genes that are normally restricted to the testis, often referred to as cancer/testis (CT) antigens or genes. Because germ cell-specific antigens are not recognized as "self" by the innate immune system, CT-genes have previously been suggested as ideal candidate targets for cancer therapy. The use of CT-genes in cancer therapy has thus far been unsuccessful, most likely because their identification has relied on gene expression in whole testis, including the testicular somatic cells, precluding the detection of true germ cell-specific genes. By comparing the transcriptomes of micro-dissected germ cell subtypes, representing the main developmental stages of human spermatogenesis, with the publicly accessible transcriptomes of 2617 samples from 49 different healthy somatic tissues and 9232 samples from 33 tumor types, we here discover hundreds of true germ cell-specific cancer expressed genes. Strikingly, we found these germ cell cancer genes (GC-genes) to be widely expressed in all analyzed tumors. Many GC-genes appeared to be involved in processes that are likely to actively promote tumor viability, proliferation and metastasis. Targeting these true GC-genes thus has the potential to inhibit tumor growth with infertility being the only possible side effect. Moreover, we identified a subset of GC-genes that are not expressed in spermatogonial stem cells. Targeting of this GC-gene subset is predicted to only lead to temporary infertility, as untargeted spermatogonial stem cells can recover spermatogenesis after treatment. Our GC-gene dataset enables improved understanding of tumor biology and provides multiple novel targets for cancer treatment.

Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis.

PubMed

Yamaoka, Yoshio

2008-05-01

Putative virulence genes of Helicobacter pylori are generally classified into three categories: strain-specific genes, phase-variable genes and genes with variable structures/genotypes. Among these, there has recently been considerable interest in strain-specific genes found outside of the cag pathogenicity island, especially genes in the plasticity regions. Nearly half of the strain-specific genes of H. pylori are located in the plasticity regions in strains 26695 and J99. Strain HPAG1, however, seems to lack a typical plasticity region; instead it has 43 HPAG1-specific genes which are either undetectable or incompletely represented in the genomes of strains 26695 and J99. Recent studies showed that certain genes or combination of genes in this region may play important roles in the pathogenesis of H. pylori-associated gastroduodenal diseases. Most previous studies have focused on the plasticity region in strain J99 (jhp0914-jhp0961) and the jhp0947 gene and the duodenal ulcer promoting (dupA) gene are good candidate markers for gastroduodenal diseases although there are some paradoxical findings. The jhp0947 gene is reported to be associated with an increased risk of both duodenal ulcers and gastric cancers, whereas the dupA gene, which encompasses jhp0917 and jhp0918, is reported to be associated with an increased risk of duodenal ulcers and protection against gastric cancers. In addition, recent studies showed that approximately 10-30 % of clinical isolates possess a 16.3 kb type IV secretion apparatus (tfs3) in the plasticity region. Studies on the plasticity region have only just begun, and further investigation is necessary to elucidate the roles of genes in this region in gastroduodenal pathogenesis.

Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis

PubMed Central

Yamaoka, Yoshio

2010-01-01

Putative virulence genes of Helicobacter pylori are generally classified into three categories: strain-specific genes, phase-variable genes and genes with variable structures/genotypes. Among these, there has recently been considerable interest in strain-specific genes found outside of the cag pathogenicity island, especially genes in the plasticity regions. Nearly half of the strain-specific genes of H. pylori are located in the plasticity regions in strains 26695 and J99. Strain HPAG1, however, seems to lack a typical plasticity region; instead it has 43 HPAG1-specific genes which are either undetectable or incompletely represented in the genomes of strains 26695 and J99. Recent studies showed that certain genes or combination of genes in this region may play important roles in the pathogenesis of H. pylori-associated gastroduodenal diseases. Most previous studies have focused on the plasticity region in strain J99 (jhp0914–jhp0961) and the jhp0947 gene and the duodenal ulcer promoting (dupA) gene are good candidate markers for gastroduodenal diseases although there are some paradoxical findings. The jhp0947 gene is reported to be associated with an increased risk of both duodenal ulcers and gastric cancers, whereas the dupA gene, which encompasses jhp0917 and jhp0918, is reported to be associated with an increased risk of duodenal ulcers and protection against gastric cancers. In addition, recent studies showed that approximately 10–30% of clinical isolates possess a 16.3 kb type IV secretion apparatus (tfs3) in the plasticity region. Studies on the plasticity region have only just begun, and further investigation is necessary to elucidate the roles of genes in this region in gastroduodenal pathogenesis. PMID:18436586

Genome Editing of Monkey.

PubMed

Liu, Zhen; Cai, Yijun; Sun, Qiang

2017-01-01

Gene-modified monkey models would be particularly valuable in biomedical and neuroscience research. Virus-based transgenic and programmable nucleases-based site-specific gene editing methods (TALEN, CRISPR-cas9) enable the generation of gene-modified monkeys with gain or loss of function of specific genes. Here, we describe the generation of transgenic and knock-out (KO) monkeys with high efficiency by lentivirus and programmable nucleases.

Gene recovery microdissection (GRM) a process for producing chromosome region-specific libraries of expressed genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christian, A T; Coleman, M A; Tucker, J D

2001-02-08

Gene Recovery Microdissection (GRM) is a unique and cost-effective process for producing chromosome region-specific libraries of expressed genes. It accelerates the pace, reduces the cost, and extends the capabilities of functional genomic research, the means by which scientists will put to life-saving, life-enhancing use their knowledge of any plant or animal genome.

T-Box Genes in the Kidney and Urinary Tract.

PubMed

Kispert, A

2017-01-01

T-box (Tbx) genes encode an ancient group of transcription factors that play important roles in patterning, specification, proliferation, and differentiation programs in vertebrate organogenesis. This is testified by severe organ malformation syndromes in mice homozygous for engineered null alleles of specific T-box genes and by the large number of human inherited organ-specific diseases that have been linked to mutations in these genes. One of the organ systems that has not been associated with loss of specific T-box gene function in human disease for long is the excretory system. However, this has changed with the finding that mutations in TBX18, a member of a vertebrate-specific subgroup within the Tbx1-subfamily of T-box transcription factor genes, cause congenital anomalies of the kidney and urinary tract, predominantly hydroureter and ureteropelvic junction obstruction. Gene expression analyses, loss-of-function studies, and lineage tracing in the mouse suggest a primary role for this transcription factor in specifying the ureteric mesenchyme in the common anlage of the kidney, the ureter, and the bladder. We review the function of Tbx18 in ureterogenesis and discuss the body of evidence that Tbx18 and other members of the T-box gene family, namely, Tbx1, Tbx2, Tbx3, and Tbx20, play additional roles in development and homeostasis of other components of the excretory system in vertebrates. © 2017 Elsevier Inc. All rights reserved.

A Systems Biology Framework Identifies Molecular Underpinnings of Coronary Heart Disease

PubMed Central

Huan, Tianxiao; Zhang, Bin; Wang, Zhi; Joehanes, Roby; Zhu, Jun; Johnson, Andrew D.; Ying, Saixia; Munson, Peter J.; Raghavachari, Nalini; Wang, Richard; Liu, Poching; Courchesne, Paul; Hwang, Shih-Jen; Assimes, Themistocles L.; McPherson, Ruth; Samani, Nilesh J.; Schunkert, Heribert; Meng, Qingying; Suver, Christine; O'Donnell, Christopher J.; Derry, Jonathan; Yang, Xia; Levy, Daniel

2013-01-01

Objective Genetic approaches have identified numerous loci associated with coronary heart disease (CHD). The molecular mechanisms underlying CHD gene-disease associations, however, remain unclear. We hypothesized that genetic variants with both strong and subtle effects drive gene subnetworks that in turn affect CHD. Approach and Results We surveyed CHD-associated molecular interactions by constructing coexpression networks using whole blood gene expression profiles from 188 CHD cases and 188 age- and sex-matched controls. 24 coexpression modules were identified including one case-specific and one control-specific differential module (DM). The DMs were enriched for genes involved in B-cell activation, immune response, and ion transport. By integrating the DMs with altered gene expression associated SNPs (eSNPs) and with results of GWAS of CHD and its risk factors, the control-specific DM was implicated as CHD-causal based on its significant enrichment for both CHD and lipid eSNPs. This causal DM was further integrated with tissue-specific Bayesian networks and protein-protein interaction networks to identify regulatory key driver (KD) genes. Multi-tissue KDs (SPIB and TNFRSF13C) and tissue-specific KDs (e.g. EBF1) were identified. Conclusions Our network-driven integrative analysis not only identified CHD-related genes, but also defined network structure that sheds light on the molecular interactions of genes associated with CHD risk. PMID:23539213

Dehydrin gene expression provides an indicator of low temperature and drought stress: transcriptome-based analysis of barley (Hordeum vulgare L.).

PubMed

Tommasini, Livia; Svensson, Jan T; Rodriguez, Edmundo M; Wahid, Abdul; Malatrasi, Marina; Kato, Kenji; Wanamaker, Steve; Resnik, Josh; Close, Timothy J

2008-11-01

Low temperature and drought have major influences on plant growth and productivity. To identify barley genes involved in responses to these stresses and to specifically test the hypothesis that the dehydrin (Dhn) multigene family can serve as an indicator of the entire transcriptome response, we investigated the response of barley cv. Morex to: (1) gradual drought over 21 days and (2) low temperature including chilling, freeze-thaw cycles, and deacclimation over 33 days. We found 4,153 genes that responded to at least one component of these two stress regimes, about one fourth of all genes called "present" under any condition. About 44% (1,822 of 4,153) responded specifically to drought, whereas only 3.8% (158 of 4,153) were chilling specific and 2.8% (119 of 4,153) freeze-thaw specific, with 34.1% responsive to freeze-thaw and drought. The intersection between chilling and drought (31.9%) was somewhat smaller than the intersection between freeze-thaw and drought, implying an element of osmotic stress response to freeze-thaw. About 82.4% of the responsive genes were similar to Arabidopsis genes. The expression of 13 barley Dhn genes mirrored the global clustering of all transcripts, with specific combinations of Dhn genes providing an excellent indicator of each stress response. Data from these studies provide a robust reference data set for abiotic stress.

Resistance to Colletotrichum lindemuthianum in Phaseolus vulgaris: a case study for mapping two independent genes.

PubMed

Geffroy, Valérie; Sévignac, Mireille; Billant, Paul; Dron, Michel; Langin, Thierry

2008-02-01

Anthracnose, caused by the hemibiotrophic fungal pathogen Colletotrichum lindemuthianum is a devastating disease of common bean. Resistant cultivars are economical means for defense against this pathogen. In the present study, we mapped resistance specificities against 7 C. lindemuthianum strains of various geographical origins revealing differential reactions on BAT93 and JaloEEP558, two parents of a recombinant inbred lines (RILs) population, of Meso-american and Andean origin, respectively. Six strains revealed the segregation of two independent resistance genes. A specific numerical code calculating the LOD score in the case of two independent segregating genes (i.e. genes with duplicate effects) in a RILs population was developed in order to provide a recombination value (r) between each of the two resistance genes and the tested marker. We mapped two closely linked Andean resistance genes (Co-x, Co-w) at the end of linkage group (LG) B1 and mapped one Meso-american resistance genes (Co-u) at the end of LG B2. We also confirmed the complexity of the previously identified B4 resistance gene cluster, because four of the seven tested strains revealed a resistance specificity near Co-y from JaloEEP558 and two strains identified a resistance specificity near Co-9 from BAT93. Resistance genes found within the same cluster confer resistance to different strains of a single pathogen such as the two anthracnose specificities Co-x and Co-w clustered at the end of LG B1. Clustering of resistance specificities to multiple pathogens such as fungi (Co-u) and viruses (I) was also observed at the end of LG B2.

Aberrant DNA methylation of tumor-related genes in oral rinse: a noninvasive method for detection of oral squamous cell carcinoma.

PubMed

Nagata, Satoshi; Hamada, Tomofumi; Yamada, Norishige; Yokoyama, Seiya; Kitamoto, Sho; Kanmura, Yuji; Nomura, Masahiro; Kamikawa, Yoshiaki; Yonezawa, Suguru; Sugihara, Kazumasa

2012-09-01

The early detection of oral squamous cell carcinoma (OSCC) is important, and a screening test with high sensitivity and specificity is urgently needed. Therefore, in this study, the authors investigated the methylation status of tumor-related genes with the objective of establishing a noninvasive method for the detection of OSCC. Oral rinse samples were obtained from 34 patients with OSCC and from 24 healthy individuals (controls). The methylation status of 13 genes was determined by using methylation-specific polymerase chain reaction analysis and was quantified using a microchip electrophoresis system. Promoter methylation in each participant was screened by receiver operating characteristic analysis, and the utility of each gene's methylation status, alone and in combination with other genes, was evaluated as a tool for oral cancer detection. Eight of the 13 genes had significantly higher levels of DNA methylation in samples from patients with OSCC than in controls. The genes E-cadherin (ECAD), transmembrane protein with epidermal growth factor-like and 2 follistatin-like domains 2 (TMEFF2), retinoic acid receptor beta (RARβ), and O-6 methylguanine DNA methyltransferase (MGMT) had high sensitivity (>75%) and specificity for the detection of oral cancer. OSCC was detected with 100% sensitivity and 87.5% specificity using a combination of ECAD, TMEFF2, RARβ, and MGMT and with 97.1% sensitivity and 91.7% specificity using a combination of ECAD, TMEFF2, and MGMT. The aberrant methylation of a combination of marker genes present in oral rinse samples was used to detect OSCC with >90% sensitivity and specificity. The detection of methylated marker genes from oral rinse samples has great potential for the noninvasive detection of OSCC. Copyright © 2012 American Cancer Society.

Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors

PubMed Central

Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael

2012-01-01

Purpose The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer (PCa) tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in PCa cells. The junction of theTMPRSS2 and ERG derived portions of the fusion mRNA constitutes a cancer specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low toxicity treatment for PCa. Experimental Design We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (Type III or Type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of PCa cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. Results The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Conclusions Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with PCa. PMID:23052253

Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors.

PubMed

Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael

2012-12-15

The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in prostate cancer cells. The junction of theTMPRSS2- and ERG-derived portions of the fusion mRNA constitutes a cancer-specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low-toxicity treatment for prostate cancer. We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (type III or type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of prostate cancer cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with prostate cancer. ©2012 AACR.

Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

PubMed

Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

2007-08-01

To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

Gene structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional control.

PubMed

Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T

1993-12-01

CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.

brain-coX: investigating and visualising gene co-expression in seven human brain transcriptomic datasets.

PubMed

Freytag, Saskia; Burgess, Rosemary; Oliver, Karen L; Bahlo, Melanie

2017-06-08

The pathogenesis of neurological and mental health disorders often involves multiple genes, complex interactions, as well as brain- and development-specific biological mechanisms. These characteristics make identification of disease genes for such disorders challenging, as conventional prioritisation tools are not specifically tailored to deal with the complexity of the human brain. Thus, we developed a novel web-application-brain-coX-that offers gene prioritisation with accompanying visualisations based on seven gene expression datasets in the post-mortem human brain, the largest such resource ever assembled. We tested whether our tool can correctly prioritise known genes from 37 brain-specific KEGG pathways and 17 psychiatric conditions. We achieved average sensitivity of nearly 50%, at the same time reaching a specificity of approximately 75%. We also compared brain-coX's performance to that of its main competitors, Endeavour and ToppGene, focusing on the ability to discover novel associations. Using a subset of the curated SFARI autism gene collection we show that brain-coX's prioritisations are most similar to SFARI's own curated gene classifications. brain-coX is the first prioritisation and visualisation web-tool targeted to the human brain and can be freely accessed via http://shiny.bioinf.wehi.edu.au/freytag.s/ .

Replication asynchrony and differential condensation of X chromosomes in female platypus (Ornithorhynchus anatinus).

PubMed

Ho, Kristen K K; Deakin, Janine E; Wright, Megan L; Graves, Jennifer A Marshall; Grützner, Frank

2009-01-01

A common theme in the evolution of sex chromosomes is the massive loss of genes on the sex-specific chromosome (Y or W), leading to a gene imbalance between males (XY) and females (XX) in a male heterogametic species, or between ZZ and ZW in a female heterogametic species. Different mechanisms have evolved to compensate for this difference in dosage of X-borne genes between sexes. In therian mammals, one of the X chromosomes is inactivated, whereas bird dosage compensation is partial and gene-specific. In therian mammals, hallmarks of the inactive X are monoallelic gene expression, late DNA replication and chromatin condensation. Platypuses have five pairs of X chromosomes in females and five X and five Y chromosomes in males. Gene expression analysis suggests a more bird-like partial and gene-specific dosage compensation mechanism. We investigated replication timing and chromosome condensation of three of the five X chromosomes in female platypus. Our data suggest asynchronous replication of X-specific regions on X(1), X(3) and X(5) but show significantly different condensation between homologues for X(3) only, and not for X(1) or X(5). We discuss these results in relation to recent gene expression analysis of X-linked genes, which together give us insights into possible mechanisms of dosage compensation in platypus.

Genome-wide localization and expression profiling establish Sp2 as a sequence-specific transcription factor regulating vitally important genes

PubMed Central

Terrados, Gloria; Finkernagel, Florian; Stielow, Bastian; Sadic, Dennis; Neubert, Juliane; Herdt, Olga; Krause, Michael; Scharfe, Maren; Jarek, Michael; Suske, Guntram

2012-01-01

The transcription factor Sp2 is essential for early mouse development and for proliferation of mouse embryonic fibroblasts in culture. Yet its mechanisms of action and its target genes are largely unknown. In this study, we have combined RNA interference, in vitro DNA binding, chromatin immunoprecipitation sequencing and global gene-expression profiling to investigate the role of Sp2 for cellular functions, to define target sites and to identify genes regulated by Sp2. We show that Sp2 is important for cellular proliferation that it binds to GC-boxes and occupies proximal promoters of genes essential for vital cellular processes including gene expression, replication, metabolism and signalling. Moreover, we identified important key target genes and cellular pathways that are directly regulated by Sp2. Most significantly, Sp2 binds and activates numerous sequence-specific transcription factor and co-activator genes, and represses the whole battery of cholesterol synthesis genes. Our results establish Sp2 as a sequence-specific regulator of vitally important genes. PMID:22684502

Hypoxia as a target for tissue specific gene therapy.

PubMed

Rhim, Taiyoun; Lee, Dong Yun; Lee, Minhyung

2013-12-10

Hypoxia is a hallmark of various ischemic diseases such as ischemic heart disease, ischemic limb, ischemic stroke, and solid tumors. Gene therapies for these diseases have been developed with various therapeutic genes including growth factors, anti-apoptotic genes, and toxins. However, non-specific expression of these therapeutic genes may induce dangerous side effects in the normal tissues. To avoid the side effects, gene expression should be tightly regulated in an oxygen concentration dependent manner. The hypoxia inducible promoters and enhancers have been evaluated as a transcriptional regulation tool for hypoxia inducible gene therapy. The hypoxia inducible UTRs were also used in gene therapy for spinal cord injury as a translational regulation strategy. In addition to transcriptional and translational regulations, post-translational regulation strategies have been developed using the HIF-1α ODD domain. Hypoxia inducible transcriptional, translational, and post-translational regulations are useful for tissue specific gene therapy of ischemic diseases. In this review, hypoxia inducible gene expression systems are discussed and their applications are introduced. Copyright © 2013 Elsevier B.V. All rights reserved.

Genome-wide Analyses of the Structural Gene Families Involved in the Legume-specific 5-Deoxyisoflavonoid Biosynthesis of Lotus japonicus

PubMed Central

Shimada, Norimoto; Sato, Shusei; Akashi, Tomoyoshi; Nakamura, Yasukazu; Tabata, Satoshi; Ayabe, Shin-ichi; Aoki, Toshio

2007-01-01

Abstract A model legume Lotus japonicus (Regel) K. Larsen is one of the subjects of genome sequencing and functional genomics programs. In the course of targeted approaches to the legume genomics, we analyzed the genes encoding enzymes involved in the biosynthesis of the legume-specific 5-deoxyisoflavonoid of L. japonicus, which produces isoflavan phytoalexins on elicitor treatment. The paralogous biosynthetic genes were assigned as comprehensively as possible by biochemical experiments, similarity searches, comparison of the gene structures, and phylogenetic analyses. Among the 10 biosynthetic genes investigated, six comprise multigene families, and in many cases they form gene clusters in the chromosomes. Semi-quantitative reverse transcriptase–PCR analyses showed coordinate up-regulation of most of the genes during phytoalexin induction and complex accumulation patterns of the transcripts in different organs. Some paralogous genes exhibited similar expression specificities, suggesting their genetic redundancy. The molecular evolution of the biosynthetic genes is discussed. The results presented here provide reliable annotations of the genes and genetic markers for comparative and functional genomics of leguminous plants. PMID:17452423

Targeting gene expression selectively in cancer cells by using the progression-elevated gene-3 promoter.

PubMed

Su, Zhao-Zhong; Sarkar, Devanand; Emdad, Luni; Duigou, Gregory J; Young, Charles S H; Ware, Joy; Randolph, Aaron; Valerie, Kristoffer; Fisher, Paul B

2005-01-25

One impediment to effective cancer-specific gene therapy is the rarity of regulatory sequences targeting gene expression selectively in tumor cells. Although many tissue-specific promoters are recognized, few cancer-selective gene promoters are available. Progression-elevated gene-3 (PEG-3) is a rodent gene identified by subtraction hybridization that displays elevated expression as a function of transformation by diversely acting oncogenes, DNA damage, and cancer cell progression. The promoter of PEG-3, PEG-Prom, displays robust expression in a broad spectrum of human cancer cell lines with marginal expression in normal cellular counterparts. Whereas GFP expression, when under the control of a CMV promoter, is detected in both normal and cancer cells, when GFP is expressed under the control of the PEG-Prom, cancer-selective expression is evident. Mutational analysis identifies the AP-1 and PEA-3 transcription factors as primary mediators of selective, cancer-specific expression of the PEG-Prom. Synthesis of apoptosis-inducing genes, under the control of the CMV promoter, inhibits the growth of both normal and cancer cells, whereas PEG-Prom-mediated expression of these genes kills only cancer cells and spares normal cells. The efficacy of the PEG-Prom as part of a cancer gene therapeutic regimen is further documented by in vivo experiments in which PEG-Prom-controlled expression of an apoptosis-inducing gene completely inhibited prostate cancer xenograft growth in nude mice. These compelling observations indicate that the PEG-Prom, with its cancer-specific expression, provides a means of selectively delivering genes to cancer cells, thereby providing a crucial component in developing effective cancer gene therapies.

Genomics of Mature and Immature Olfactory Sensory Neurons

PubMed Central

Nickell, Melissa D.; Breheny, Patrick; Stromberg, Arnold J.; McClintock, Timothy S.

2014-01-01

The continuous replacement of neurons in the olfactory epithelium provides an advantageous model for investigating neuronal differentiation and maturation. By calculating the relative enrichment of every mRNA detected in samples of mature mouse olfactory sensory neurons (OSNs), immature OSNs, and the residual population of neighboring cell types, and then comparing these ratios against the known expression patterns of >300 genes, enrichment criteria that accurately predicted the OSN expression patterns of nearly all genes were determined. We identified 847 immature OSN-specific and 691 mature OSN-specific genes. The control of gene expression by chromatin modification and transcription factors, and neurite growth, protein transport, RNA processing, cholesterol biosynthesis, and apoptosis via death domain receptors, were overrepresented biological processes in immature OSNs. Ion transport (ion channels), presynaptic functions, and cilia-specific processes were overrepresented in mature OSNs. Processes overrepresented among the genes expressed by all OSNs were protein and ion transport, ER overload response, protein catabolism, and the electron transport chain. To more accurately represent gradations in mRNA abundance and identify all genes expressed in each cell type, classification methods were used to produce probabilities of expression in each cell type for every gene. These probabilities, which identified 9,300 genes expressed in OSNs, were 96% accurate at identifying genes expressed in OSNs and 86% accurate at discriminating genes specific to mature and immature OSNs. This OSN gene database not only predicts the genes responsible for the major biological processes active in OSNs, but also identifies thousands of never before studied genes that support OSN phenotypes. PMID:22252456

Tissue-specifically regulated site-specific excision of selectable marker genes in bivalent insecticidal, genetically-modified rice.

PubMed

Hu, Zhan; Ding, Xuezhi; Hu, Shengbiao; Sun, Yunjun; Xia, Liqiu

2013-12-01

Marker-free, genetically-modified rice was created by the tissue-specifically regulated Cre/loxP system, in which the Cre recombinase gene and hygromycin phosphotransferase gene (hpt) were flanked by two directly oriented loxP sites. Cre expression was activated by the tissue-specific promoter OsMADS45 in flower or napin in seed, resulting in simultaneous excision of the recombinase and marker genes. Segregation of T1 progeny was performed to select recombined plants. The excision was confirmed by PCR, Southern blot and sequence analyses indicating that efficiency varied from 10 to 53 % for OsMADS45 and from 12 to 36 % for napin. The expression of cry1Ac and vip3A was detected by RT-PCR analysis in marker-free transgenic rice. These results suggested that our tissue-specifically regulated Cre/loxP system could auto-excise marker genes from transgenic rice and alleviate public concerns about the security of GM crops.

Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

PubMed Central

Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas

2015-01-01

In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

Gene editing for skin diseases: designer nucleases as tools for gene therapy of skin fragility disorders.

PubMed

March, Oliver P; Reichelt, Julia; Koller, Ulrich

2018-04-01

What is the topic of this review? This review concerns current gene editing strategies for blistering skin diseases with respect to individual genetic constellations and distinct conditions. What advances does it highlight? Specificity and safety dominate the discussion of gene editing applications for gene therapy, where a number of tools are implemented. Recent developments in this rapidly progressing field pose further questions regarding which tool is best suited for each particular use. The current treatment of inherited blistering skin diseases, such as epidermolysis bullosa (EB), is largely restricted to wound care and pain management. More effective therapeutic strategies are urgently required, and targeting the genetic basis of these severe diseases is now within reach. Here, we describe current gene editing tools and their potential to correct gene function in monogenetic blistering skin diseases. We present the features of the most frequently used gene editing techniques, transcription activator-like effector nuclease (TALEN) and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9), determining their preferential application for specific genetic conditions, including the type of mutational inheritance, the targeting site within the gene or the possibility to target the mutation specifically. Both tools have traits beneficial in specific situations. Promising developments in the field engender gene editing as a potentially powerful therapeutic option for future clinical applications. © 2017 The Authors. Experimental Physiology © 2017 The Physiological Society.

ROLES OF CELL-INTRINSIC AND MICROENVIRONMENTAL FACTORS IN PHOTORECEPTOR CELL DIFFERENTIATION

PubMed Central

Bradford, Rebecca L.; Wang, Chenwei; Zack, Donald J.; Adler, Ruben

2005-01-01

Photoreceptor differentiation requires the coordinated expression of numerous genes. It is unknown whether those genes share common regulatory mechanisms or are independently regulated by distinct mechanisms. To distinguish between these scenarios, we have used in situ hybridization, RT-PCR and real time PCR to analyze the expression of visual pigments and other photoreceptor-specific genes during chick embryo retinal development in ovo, as well as in retinal cell cultures treated with molecules that regulate the expression of particular visual pigments. In ovo, onset of gene expression was asynchronous, becoming detectable at the time of photoreceptor generation (ED 5–8) for some photoreceptor genes, but only around the time of outer segment formation (ED 14–16) for others. Treatment of retinal cell cultures with activin, staurosporine or CNTF selectively induced or down-regulated specific visual pigment genes, but many cognate rod- or cone-specific genes were not affected by the treatments. These results indicate that many photoreceptor genes are independently regulated during development, are consistent with the existence of at least two distinct stages of gene expression during photoreceptor differentiation, suggest that intrinsic, coordinated regulation of a cascade of gene expression triggered by a commitment to the photoreceptor fate is not a general mechanism of photoreceptor differentiation, and imply that using a single photoreceptor-specific “marker” as a proxy to identify photoreceptor cell fate is problematic. PMID:16120439

The landscape of genomic imprinting across diverse adult human tissues.

PubMed

Baran, Yael; Subramaniam, Meena; Biton, Anne; Tukiainen, Taru; Tsang, Emily K; Rivas, Manuel A; Pirinen, Matti; Gutierrez-Arcelus, Maria; Smith, Kevin S; Kukurba, Kim R; Zhang, Rui; Eng, Celeste; Torgerson, Dara G; Urbanek, Cydney; Li, Jin Billy; Rodriguez-Santana, Jose R; Burchard, Esteban G; Seibold, Max A; MacArthur, Daniel G; Montgomery, Stephen B; Zaitlen, Noah A; Lappalainen, Tuuli

2015-07-01

Genomic imprinting is an important regulatory mechanism that silences one of the parental copies of a gene. To systematically characterize this phenomenon, we analyze tissue specificity of imprinting from allelic expression data in 1582 primary tissue samples from 178 individuals from the Genotype-Tissue Expression (GTEx) project. We characterize imprinting in 42 genes, including both novel and previously identified genes. Tissue specificity of imprinting is widespread, and gender-specific effects are revealed in a small number of genes in muscle with stronger imprinting in males. IGF2 shows maternal expression in the brain instead of the canonical paternal expression elsewhere. Imprinting appears to have only a subtle impact on tissue-specific expression levels, with genes lacking a systematic expression difference between tissues with imprinted and biallelic expression. In summary, our systematic characterization of imprinting in adult tissues highlights variation in imprinting between genes, individuals, and tissues. © 2015 Baran et al.; Published by Cold Spring Harbor Laboratory Press.

CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool.

PubMed

Yang, Fayu; Liu, Changbao; Chen, Ding; Tu, Mengjun; Xie, Haihua; Sun, Huihui; Ge, Xianglian; Tang, Lianchao; Li, Jin; Zheng, Jiayong; Song, Zongming; Qu, Jia; Gu, Feng

2017-06-16

Cre-loxP, as one of the site-specific genetic manipulation tools, offers a method to study the spatial and temporal regulation of gene expression/inactivation in order to decipher gene function. CRISPR/Cas9-mediated targeted genome engineering technologies are sparking a new revolution in biological research. Whether the traditional site-specific genetic manipulation tool and CRISPR/Cas9 could be combined to create a novel genetic tool for highly specific gene editing is not clear. Here, we successfully generated a CRISPR/Cas9-loxP system to perform gene editing in human cells, providing the proof of principle that these two technologies can be used together for the first time. We also showed that distinct non-homologous end-joining (NHEJ) patterns from CRISPR/Cas9-mediated gene editing of the targeting sequence locates at the level of plasmids (episomal) and chromosomes. Specially, the CRISPR/Cas9-mediated NHEJ pattern in the nuclear genome favors deletions (64%-68% at the human AAVS1 locus versus 4%-28% plasmid DNA). CRISPR/Cas9-loxP, a novel site-specific genetic manipulation tool, offers a platform for the dissection of gene function and molecular insights into DNA-repair pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Functional Abstraction as a Method to Discover Knowledge in Gene Ontologies

PubMed Central

Ultsch, Alfred; Lötsch, Jörn

2014-01-01

Computational analyses of functions of gene sets obtained in microarray analyses or by topical database searches are increasingly important in biology. To understand their functions, the sets are usually mapped to Gene Ontology knowledge bases by means of over-representation analysis (ORA). Its result represents the specific knowledge of the functionality of the gene set. However, the specific ontology typically consists of many terms and relationships, hindering the understanding of the ‘main story’. We developed a methodology to identify a comprehensibly small number of GO terms as “headlines” of the specific ontology allowing to understand all central aspects of the roles of the involved genes. The Functional Abstraction method finds a set of headlines that is specific enough to cover all details of a specific ontology and is abstract enough for human comprehension. This method exceeds the classical approaches at ORA abstraction and by focusing on information rather than decorrelation of GO terms, it directly targets human comprehension. Functional abstraction provides, with a maximum of certainty, information value, coverage and conciseness, a representation of the biological functions in a gene set plays a role. This is the necessary means to interpret complex Gene Ontology results thus strengthening the role of functional genomics in biomarker and drug discovery. PMID:24587272

Neuronal cell fate specification in Drosophila.

PubMed

Jan, Y N; Jan, L Y

1994-02-01

Recent work indicates that the Drosophila nervous system develops in a progressive process of cell fate specification. Expression of specific proneural genes in clusters of cells (the proneural clusters) in the cellular blastoderm endows these cells with the potential to form certain types of neural precursors. Intercellular interactions that involve both proneural genes and neurogenic genes then allow the neural precursors to be singled out from the proneural clusters. Expression of neural precursor genes in all neural precursors is likely to account for the universal aspects of neuronal differentiation, such as axonal outgrowth. Selective expression of certain neuronal-type selector genes further specifies the type of neuron(s) that a neural precursor will produce.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

Mutations in MYB3R1 and MYB3R4 Cause Pleiotropic Developmental Defects and Preferential Down-Regulation of Multiple G2/M-Specific Genes in Arabidopsis1[C][W

PubMed Central

Haga, Nozomi; Kobayashi, Kosuke; Suzuki, Takamasa; Maeo, Kenichiro; Kubo, Minoru; Ohtani, Misato; Mitsuda, Nobutaka; Demura, Taku; Nakamura, Kenzo; Jürgens, Gerd; Ito, Masaki

2011-01-01

R1R2R3-Myb proteins represent an evolutionarily conserved class of Myb family proteins important for cell cycle regulation and differentiation in eukaryotic cells. In plants, this class of Myb proteins are believed to regulate the transcription of G2/M phase-specific genes by binding to common cis-elements, called mitosis-specific activator (MSA) elements. In Arabidopsis (Arabidopsis thaliana), MYB3R1 and MYB3R4 act as transcriptional activators and positively regulate cytokinesis by activating the transcription of KNOLLE, which encodes a cytokinesis-specific syntaxin. Here, we show that the double mutation myb3r1 myb3r4 causes pleiotropic developmental defects, some of which are due to deficiency of KNOLLE whereas other are not, suggesting that multiple target genes are involved. Consistently, microarray analysis of the double mutant revealed altered expression of many genes, among which G2/M-specific genes showed significant overrepresentation of the MSA motif and a strong tendency to be down-regulated by the double mutation. Our results demonstrate, on a genome-wide level, the importance of the MYB3R-MSA pathway for regulating G2/M-specific transcription. In addition, MYB3R1 and MYB3R4 may have diverse roles during plant development by regulating G2/M-specific genes with various functions as well as genes possibly unrelated to the cell cycle. PMID:21862669

Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

2012-10-01

To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

The DAL10 gene from Norway spruce (Picea abies) belongs to a potentially gymnosperm-specific subclass of MADS-box genes and is specifically active in seed cones and pollen cones.

PubMed

Carlsbecker, Annelie; Sundström, Jens; Tandre, Karolina; Englund, Marie; Kvarnheden, Anders; Johanson, Urban; Engström, Peter

2003-01-01

Transcription factors encoded by different members of the MADS-box gene family have evolved central roles in the regulation of reproductive organ development in the flowering plants, the angiosperms. Development of the stamens and carpels, the pollen- and seed-bearing organs, involves the B- and C-organ-identity MADS-box genes. B- and C-type gene orthologs with activities specifically in developing pollen- and seed-bearing organs are also present in the distantly related gymnosperms: the conifers and the gnetophytes. We now report on the characterization of DAL10, a novel MADS-box gene from the conifer Norway spruce, which unlike the B- and C-type conifer genes shows no distinct orthology relationship to any angiosperm gene or clade in phylogenetic analyses. Like the B- and C-type genes, it is active specifically in developing pollen cones and seed cones. In situ RNA localization experiments show DAL10 to be expressed in the cone axis, which carry the microsporophylls of the young pollen cone. In contrast, in the seed cone it is expressed both in the cone axis and in the bracts, which subtend the ovuliferous scales. Expression data and the phenotype of transgenic Arabidopsis plants expressing DAL10 suggest that the gene may act upstream to or in concert with the B- and C-type genes in the establishment of reproductive identity of developing cones.

Global transcriptome analysis of the C57BL/6J mouse testis by SAGE: evidence for nonrandom gene order.

PubMed

Divina, Petr; Vlcek, Cestmír; Strnad, Petr; Paces, Václav; Forejt, Jirí

2005-03-05

We generated the gene expression profile of the total testis from the adult C57BL/6J male mice using serial analysis of gene expression (SAGE). Two high-quality SAGE libraries containing a total of 76 854 tags were constructed. An extensive bioinformatic analysis and comparison of SAGE transcriptomes of the total testis, testicular somatic cells and other mouse tissues was performed and the theory of male-biased gene accumulation on the X chromosome was tested. We sorted out 829 genes predominantly expressed from the germinal part and 944 genes from the somatic part of the testis. The genes preferentially and specifically expressed in total testis and testicular somatic cells were identified by comparing the testis SAGE transcriptomes to the available transcriptomes of seven non-testis tissues. We uncovered chromosomal clusters of adjacent genes with preferential expression in total testis and testicular somatic cells by a genome-wide search and found that the clusters encompassed a significantly higher number of genes than expected by chance. We observed a significant 3.2-fold enrichment of the proportion of X-linked genes specific for testicular somatic cells, while the proportions of X-linked genes specific for total testis and for other tissues were comparable. In contrast to the tissue-specific genes, an under-representation of X-linked genes in the total testis transcriptome but not in the transcriptomes of testicular somatic cells and other tissues was detected. Our results provide new evidence in favor of the theory of male-biased genes accumulation on the X chromosome in testicular somatic cells and indicate the opposite action of the meiotic X-inactivation in testicular germ cells.

Global transcriptome analysis of the C57BL/6J mouse testis by SAGE: evidence for nonrandom gene order

PubMed Central

Divina, Petr; Vlček, Čestmír; Strnad, Petr; Pačes, Václav; Forejt, Jiří

2005-01-01

Background We generated the gene expression profile of the total testis from the adult C57BL/6J male mice using serial analysis of gene expression (SAGE). Two high-quality SAGE libraries containing a total of 76 854 tags were constructed. An extensive bioinformatic analysis and comparison of SAGE transcriptomes of the total testis, testicular somatic cells and other mouse tissues was performed and the theory of male-biased gene accumulation on the X chromosome was tested. Results We sorted out 829 genes predominantly expressed from the germinal part and 944 genes from the somatic part of the testis. The genes preferentially and specifically expressed in total testis and testicular somatic cells were identified by comparing the testis SAGE transcriptomes to the available transcriptomes of seven non-testis tissues. We uncovered chromosomal clusters of adjacent genes with preferential expression in total testis and testicular somatic cells by a genome-wide search and found that the clusters encompassed a significantly higher number of genes than expected by chance. We observed a significant 3.2-fold enrichment of the proportion of X-linked genes specific for testicular somatic cells, while the proportions of X-linked genes specific for total testis and for other tissues were comparable. In contrast to the tissue-specific genes, an under-representation of X-linked genes in the total testis transcriptome but not in the transcriptomes of testicular somatic cells and other tissues was detected. Conclusion Our results provide new evidence in favor of the theory of male-biased genes accumulation on the X chromosome in testicular somatic cells and indicate the opposite action of the meiotic X-inactivation in testicular germ cells. PMID:15748293

The Dynein Gene Family in Chlamydomonas Reinhardtii

PubMed Central

Porter, M. E.; Knott, J. A.; Myster, S. H.; Farlow, S. J.

1996-01-01

To correlate dynein heavy chain (Dhc) genes with flagellar mutations and gain insight into the function of specific dynein isoforms, we placed eight members of the Dhc gene family on the genetic map of Chlamydomonas. Using a PCR-based strategy, we cloned 11 Dhc genes from Chlamydomonas. Comparisons with other Dhc genes indicate that two clones correspond to genes encoding the alpha and beta heavy chains of the outer dynein arm. Alignment of the predicted amino acid sequences spanning the nucleotide binding site indicates that the remaining nine clones can be subdivided into three groups that are likely to include representatives of the inner-arm Dhc isoforms. Gene-specific probes reveal that each clone represents a single-copy gene that is expressed as a transcript of the appropriate size (>13 kb) sufficient to encode a high molecular weight Dhc polypeptide. The expression of all nine genes is upregulated in response to deflagellation, suggesting a role in axoneme assembly or motility. Restriction fragment length polymorphisms between divergent C. reinhardtii strains have been used to place each Dhc gene on the genetic map of Chlamydomonas. These studies lay the groundwork for correlating defects in different Dhc genes with specific flagellar mutations. PMID:8889521

Regulatory genes and their roles for improvement of antibiotic biosynthesis in Streptomyces.

PubMed

Lu, Fengjuan; Hou, Yanyan; Zhang, Heming; Chu, Yiwen; Xia, Haiyang; Tian, Yongqiang

2017-08-01

The numerous secondary metabolites in Streptomyces spp. are crucial for various applications. For example, cephamycin C is used as an antibiotic, and avermectin is used as an insecticide. Specifically, antibiotic yield is closely related to many factors, such as the external environment, nutrition (including nitrogen and carbon sources), biosynthetic efficiency and the regulatory mechanisms in producing strains. There are various types of regulatory genes that work in different ways, such as pleiotropic (or global) regulatory genes, cluster-situated regulators, which are also called pathway-specific regulatory genes, and many other regulators. The study of regulatory genes that influence antibiotic biosynthesis in Streptomyces spp. not only provides a theoretical basis for antibiotic biosynthesis in Streptomyces but also helps to increase the yield of antibiotics via molecular manipulation of these regulatory genes. Currently, more and more emphasis is being placed on the regulatory genes of antibiotic biosynthetic gene clusters in Streptomyces spp., and many studies on these genes have been performed to improve the yield of antibiotics in Streptomyces. This paper lists many antibiotic biosynthesis regulatory genes in Streptomyces spp. and focuses on frequently investigated regulatory genes that are involved in pathway-specific regulation and pleiotropic regulation and their applications in genetic engineering.

Coordinated gene expression during gilthead sea bream skeletogenesis and its disruption by nutritional hypervitaminosis A.

PubMed

Fernández, Ignacio; Darias, Maria; Andree, Karl B; Mazurais, David; Zambonino-Infante, Jose Luís; Gisbert, Enric

2011-02-09

Vitamin A (VA) has a key role in vertebrate morphogenesis, determining body patterning and growth through the control of cell proliferation and differentiation processes. VA regulates primary molecular pathways of those processes by the binding of its active metabolite (retinoic acid) to two types of specific nuclear receptors: retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which promote transcription of downstream target genes. This process is well known in most of higher vertebrates; however, scarce information is available regarding fishes. Therefore, in order to gain further knowledge of fish larval development and its disruption by nutritional VA imbalance, the relative expression of some RARs and RXRs, as well as several genes involved in morpho- and skeletogenesis such as peroxisome proliferator-activated receptors (PPARA, PPARB and PPARG); retinol-binding protein (RBP); insulin-like growth factors I and II (IGF1 and IGF2, respectively); bone morphogenetic protein 2 (Bmp2); transforming growth factor β-1 (TGFB1); and genes encoding different extracellular matrix (ECM) proteins such as matrix Gla protein (mgp), osteocalcin (bglap), osteopontin (SPP1), secreted protein acidic and rich in cysteine (SPARC) and type I collagen α1 chain (COL1A1) have been studied in gilthead sea bream. During gilthead sea bream larval development, specific expression profiles for each gene were tightly regulated during fish morphogenesis and correlated with specific morphogenetic events and tissue development. Dietary hypervitaminosis A during early larval development disrupted the normal gene expression profile for genes involved in RA signalling (RARA), VA homeostasis (RBP) and several genes encoding ECM proteins that are linked to skeletogenesis, such as bglap and mgp. Present data reflects the specific gene expression patterns of several genes involved in larval fish RA signalling and skeletogenesis; and how specific gene disruption induced by a nutritional VA imbalance underlie the skeletal deformities. Our results are of basic interest for fish VA signalling and point out some of the potential molecular players involved in fish skeletogenesis. Increased incidences of skeletal deformities in gilthead sea bream fed with hypervitaminosis A were the likely ultimate consequence of specific gene expression disruption at critical development stages.

Coordinated gene expression during gilthead sea bream skeletogenesis and its disruption by nutritional hypervitaminosis A

PubMed Central

2011-01-01

Background Vitamin A (VA) has a key role in vertebrate morphogenesis, determining body patterning and growth through the control of cell proliferation and differentiation processes. VA regulates primary molecular pathways of those processes by the binding of its active metabolite (retinoic acid) to two types of specific nuclear receptors: retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which promote transcription of downstream target genes. This process is well known in most of higher vertebrates; however, scarce information is available regarding fishes. Therefore, in order to gain further knowledge of fish larval development and its disruption by nutritional VA imbalance, the relative expression of some RARs and RXRs, as well as several genes involved in morpho- and skeletogenesis such as peroxisome proliferator-activated receptors (PPARA, PPARB and PPARG); retinol-binding protein (RBP); insulin-like growth factors I and II (IGF1 and IGF2, respectively); bone morphogenetic protein 2 (Bmp2); transforming growth factor β-1 (TGFB1); and genes encoding different extracellular matrix (ECM) proteins such as matrix Gla protein (mgp), osteocalcin (bglap), osteopontin (SPP1), secreted protein acidic and rich in cysteine (SPARC) and type I collagen α1 chain (COL1A1) have been studied in gilthead sea bream. Results During gilthead sea bream larval development, specific expression profiles for each gene were tightly regulated during fish morphogenesis and correlated with specific morphogenetic events and tissue development. Dietary hypervitaminosis A during early larval development disrupted the normal gene expression profile for genes involved in RA signalling (RARA), VA homeostasis (RBP) and several genes encoding ECM proteins that are linked to skeletogenesis, such as bglap and mgp. Conclusions Present data reflects the specific gene expression patterns of several genes involved in larval fish RA signalling and skeletogenesis; and how specific gene disruption induced by a nutritional VA imbalance underlie the skeletal deformities. Our results are of basic interest for fish VA signalling and point out some of the potential molecular players involved in fish skeletogenesis. Increased incidences of skeletal deformities in gilthead sea bream fed with hypervitaminosis A were the likely ultimate consequence of specific gene expression disruption at critical development stages. PMID:21306609

Spleen-dependent regulation of antigenic variation in malaria parasites: Plasmodium knowlesi SICAvar expression profiles in splenic and asplenic hosts.

PubMed

Lapp, Stacey A; Korir-Morrison, Cindy; Jiang, Jianlin; Bai, Yaohui; Corredor, Vladimir; Galinski, Mary R

2013-01-01

Antigenic variation by malaria parasites was first described in Plasmodium knowlesi, which infects humans and macaque monkeys, and subsequently in P. falciparum, the most virulent human parasite. The schizont-infected cell agglutination (SICA) variant proteins encoded by the SICAvar multigene family in P. knowlesi, and Erythrocyte Membrane Protein-1 (EMP-1) antigens encoded by the var multigene family in P. falciparum, are expressed at the surface of infected erythrocytes, are associated with virulence, and serve as determinants of naturally acquired immunity. A parental P. knowlesi clone, Pk1(A+), and a related progeny clone, Pk1(B+)1+, derived by an in vivo induced variant antigen switch, were defined by the expression of distinct SICA variant protein doublets of 210/190 and 205/200 kDa, respectively. Passage of SICA[+] infected erythrocytes through splenectomized rhesus monkeys results in the SICA[-] phenotype, defined by the lack of surface expression and agglutination with variant specific antisera. We have investigated SICAvar RNA and protein expression in Pk1(A+), Pk1(B+)1+, and SICA[-] parasites. The Pk1(A+) and Pk1(B+)1+ parasites express different distinct SICAvar transcript and protein repertoires. By comparison, SICA[-] parasites are characterized by a vast reduction in SICAvar RNA expression, the lack of full-length SICAvar transcript signals on northern blots, and correspondingly, the absence of any SICA protein detected by mass spectrometry. SICA protein expression may be under transcriptional as well as post-transcriptional control, and we show for the first time that the spleen, an organ central to blood-stage immunity in malaria, exerts an influence on these processes. Furthermore, proteomics has enabled the first in-depth characterization of SICA[+] protein phenotypes and we show that the in vivo switch from Pk1(A+) to Pk1(B+)1+ parasites resulted in a complete change in SICA profiles. These results emphasize the importance of studying antigenic variation in the context of the host environment.

Phase I Clinical Trial of a Recombinant Blood Stage Vaccine Candidate for Plasmodium falciparum Malaria Based on MSP1 and EBA175

PubMed Central

Chitnis, Chetan E.; Mukherjee, Paushali; Mehta, Shantanu; Yazdani, Syed Shams; Dhawan, Shikha; Shakri, Ahmad Rushdi; Bharadwaj, Rukmini; Gupta, Puneet Kumar; Hans, Dhiraj; Mazumdar, Suman; Singh, Bijender; Kumar, Sanjeev; Pandey, Gaurav; Parulekar, Varsha; Imbault, Nathalie; Shivyogi, Preethi; Godbole, Girish; Mohan, Krishna; Leroy, Odile; Singh, Kavita; Chauhan, Virander S.

2015-01-01

Background A phase I randomised, controlled, single blind, dose escalation trial was conducted to evaluate safety and immunogenicity of JAIVAC-1, a recombinant blood stage vaccine candidate against Plasmodium falciparum malaria, composed of a physical mixture of two recombinant proteins, PfMSP-119, the 19 kD conserved, C-terminal region of PfMSP-1 and PfF2 the receptor-binding F2 domain of EBA175. Method Healthy malaria naïve Indian male subjects aged 18–45 years were recruited from the volunteer database of study site. Fifteen subjects in each cohort, randomised in a ratio of 2:1 and meeting the protocol specific eligibility criteria, were vaccinated either with three doses (10μg, 25μg and 50μg of each antigen) of JAIVAC-1 formulated with adjuvant Montanide ISA 720 or with standard dosage of Hepatitis B vaccine. Each subject received the assigned vaccine in the deltoid muscle of the upper arms on Day 0, Day 28 and Day 180. Results JAIVAC-1 was well tolerated and no serious adverse event was observed. All JAIVAC-1 subjects sero-converted for PfF2 but elicited poor immune response to PfMSP-119. Dose-response relationship was observed between vaccine dose of PfF2 and antibody response. The antibodies against PfF2 were predominantly of IgG1 and IgG3 isotype. Sera from JAIVAC-1 subjects reacted with late schizonts in a punctate pattern in immunofluorescence assays. Purified IgG from JAIVAC-1 sera displayed significant growth inhibitory activity against Plasmodium falciparum CAMP strain. Conclusion Antigen PfF2 should be retained as a component of a recombinant malaria vaccine but PfMSP-119 construct needs to be optimised to improve its immunogenicity. Trial Registration Clinical Trial Registry, India CTRI/2010/091/000301 PMID:25927360

Identification of Plasmodium falciparum DNA Repair Protein Mre11 with an Evolutionarily Conserved Nuclease Function

PubMed Central

Badugu, Sugith Babu; Nabi, Shaik Abdul; Vaidyam, Pratap; Laskar, Shyamasree; Bhattacharyya, Sunanda; Bhattacharyya, Mrinal Kanti

2015-01-01

The eukaryotic Meiotic Recombination protein 11 (Mre11) plays pivotal roles in the DNA damage response (DDR). Specifically, Mre11 senses and signals DNA double strand breaks (DSB) and facilitates their repair through effector proteins belonging to either homologous recombination (HR) or non-homologous end joining (NHEJ) repair mechanisms. In the human malaria parasite Plasmodium falciparum, HR and alternative-NHEJ have been identified; however, little is known about the upstream factors involved in the DDR of this organism. In this report, we identify a putative ortholog of Mre11 in P. falciparum (PfalMre11) that shares 22% sequence similarity to human Mre11. Homology modeling reveals striking structural resemblance of the predicted PfalMre11 nuclease domain to the nuclease domain of Saccharomyces cerevisiae Mre11 (ScMre11). Complementation analyses reveal functional conservation of PfalMre11 nuclease activity as demonstrated by the ability of the PfalMre11 nuclease domain, in conjunction with the C-terminal domain of ScMre11, to functionally complement an mre11 deficient yeast strain. Functional complementation was virtually abrogated by an amino acid substitution in the PfalMre11 nuclease domain (D398N). PfalMre11 is abundant in the mitotically active trophozoite and schizont stages of P. falciparum and is up-regulated in response to DNA damage, suggesting a role in the DDR. PfalMre11 exhibits physical interaction with PfalRad50. In addition, yeast 2-hybrid studies show that PfalMre11 interacts with ScRad50 and ScXrs2, two important components of the well characterized Mre11-Rad50-Xrs2 complex which is involved in DDR signaling and repair in S. cerevisiae, further supporting a role for PfalMre11 in the DDR. Taken together, these findings provide evidence that PfalMre11 is an evolutionarily conserved component of the DDR in Plasmodium. PMID:25938776

Impairment of the Plasmodium falciparum erythrocytic cycle induced by angiotensin peptides.

PubMed

Saraiva, Victor Barbosa; de Souza Silva, Leandro; Ferreira-DaSilva, Claudio Teixeira; da Silva-Filho, João Luiz; Teixeira-Ferreira, André; Perales, Jonas; Souza, Mariana Conceição; Henriques, Maria das Graças; Caruso-Neves, Celso; de Sá Pinheiro, Ana Acacia

2011-02-18

Plasmodium falciparum causes the most serious complications of malaria and is a public health problem worldwide with over 2 million deaths each year. The erythrocyte invasion mechanisms by Plasmodium sp. have been well described, however the physiological aspects involving host components in this process are still poorly understood. Here, we provide evidence for the role of renin-angiotensin system (RAS) components in reducing erythrocyte invasion by P. falciparum. Angiotensin II (Ang II) reduced erythrocyte invasion in an enriched schizont culture of P. falciparum in a dose-dependent manner. Using mass spectroscopy, we showed that Ang II was metabolized by erythrocytes to Ang IV and Ang-(1-7). Parasite infection decreased Ang-(1-7) and completely abolished Ang IV formation. Similar to Ang II, Ang-(1-7) decreased the level of infection in an A779 (specific antagonist of Ang-(1-7) receptor, MAS)-sensitive manner. 10(-7) M PD123319, an AT(2) receptor antagonist, partially reversed the effects of Ang-(1-7) and Ang II. However, 10(-6) M losartan, an antagonist of the AT(1) receptor, had no effect. Gs protein is a crucial player in the Plasmodium falciparum blood cycle and angiotensin peptides can modulate protein kinase A (PKA) activity; 10(-8) M Ang II or 10(-8) M Ang-(1-7) inhibited this activity in erythrocytes by 60% and this effect was reversed by 10(-7) M A779. 10(-6) M dibutyryl-cAMP increased the level of infection and 10(-7) M PKA inhibitor decreased the level of infection by 30%. These results indicate that the effect of Ang-(1-7) on P. falciparum blood stage involves a MAS-mediated PKA inhibition. Our results indicate a crucial role for Ang II conversion into Ang-(1-7) in controlling the erythrocytic cycle of the malaria parasite, adding new functions to peptides initially described to be involved in the regulation of vascular tonus.

Differential replication dynamics for large and small Vibrio chromosomes affect gene dosage, expression and location

PubMed Central

Dryselius, Rikard; Izutsu, Kaori; Honda, Takeshi; Iida, Tetsuya

2008-01-01

Background Replication of bacterial chromosomes increases copy numbers of genes located near origins of replication relative to genes located near termini. Such differential gene dosage depends on replication rate, doubling time and chromosome size. Although little explored, differential gene dosage may influence both gene expression and location. For vibrios, a diverse family of fast growing gammaproteobacteria, gene dosage may be particularly important as they harbor two chromosomes of different size. Results Here we examined replication dynamics and gene dosage effects for the separate chromosomes of three Vibrio species. We also investigated locations for specific gene types within the genome. The results showed consistently larger gene dosage differences for the large chromosome which also initiated replication long before the small. Accordingly, large chromosome gene expression levels were generally higher and showed an influence from gene dosage. This was reflected by a higher abundance of growth essential and growth contributing genes of which many locate near the origin of replication. In contrast, small chromosome gene expression levels were low and appeared independent of gene dosage. Also, species specific genes are highly abundant and an over-representation of genes involved in transcription could explain its gene dosage independent expression. Conclusion Here we establish a link between replication dynamics and differential gene dosage on one hand and gene expression levels and the location of specific gene types on the other. For vibrios, this relationship appears connected to a polarisation of genetic content between its chromosomes, which may both contribute to and be enhanced by an improved adaptive capacity. PMID:19032792

Gene-carried hepatoma targeting complex induced high gene transfection efficiency with low toxicity and significant antitumor activity.

PubMed

Zhao, Qing-Qing; Hu, Yu-Lan; Zhou, Yang; Li, Ni; Han, Min; Tang, Gu-Ping; Qiu, Feng; Tabata, Yasuhiko; Gao, Jian-Qing

2012-01-01

The success of gene transfection is largely dependent on the development of a vehicle or vector that can efficiently deliver a gene to cells with minimal toxicity. A liver cancer-targeted specific peptide (FQHPSF sequence) was successfully synthesized and linked with chitosan-linked polyethylenimine (CP) to form a new targeted gene delivery vector called CPT (CP/peptide). The structure of CPT was confirmed by (1)H nuclear magnetic resonance spectroscopy and ultraviolet spectrophotometry. The particle size of CPT/ DNA complexes was measured using laser diffraction spectrometry and the cytotoxicity of the copolymer was evaluated by methylthiazol tetrazolium method. The transfection efficiency evaluation of the CP copolymer was performed using luciferase activity assay. Cellular internalization of the CP/DNA complex was observed under confocal laser scanning microscopy. The targeting specificity of the polymer coupled to peptide was measured by competitive inhibition transfection study. The liver targeting specificity of the CPT copolymer in vivo was demonstrated by combining the copolymer with a therapeutic gene, interleukin-12, and assessed by its abilities in suppressing the growth of ascites tumor in mouse model. The results showed that the liver cancer-targeted specific peptide was successfully synthesized and linked with CP to form a new targeted gene delivery vector called CPT. The composition of CPT was confirmed and the vector showed low cytotoxicity and strong targeting specificity to liver tumors in vitro. The in vivo study results showed that interleukin-12 delivered by the new gene vector CPT/DNA significantly enhanced the antitumor effect on ascites tumor-bearing imprinting control region mice as compared with polyethylenimine (25 kDa), CP, and other controls, which further demonstrate the targeting specificity of the new synthesized polymer. The synthesized CPT copolymer was proven to be an effective liver cancer-targeted vector for therapeutic gene delivery, which could be a potential candidate for targeted cancer gene therapy.

The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

PubMed

Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

2012-06-01

Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

An enhancer located in a CpG-island 3' to the TCR/CD3-epsilon gene confers T lymphocyte-specificity to its promoter.

PubMed Central

Clevers, H; Lonberg, N; Dunlap, S; Lacy, E; Terhorst, C

1989-01-01

The gene encoding the CD3-epsilon chain of the T cell receptor (TCR/CD3) complex is uniquely transcribed in all T lymphocyte lineage cells. The human CD3-epsilon gene, when introduced into the mouse germ line, was expressed in correct tissue-specific fashion. The gene was then screened for T lymphocyte-specific cis-acting elements in transient chloramphenicol transferase assays. The promoter (-228 to +100) functioned irrespective of cell type. A 1225 bp enhancer with strict T cell-specificity was found in a DNase I hypersensitive site downstream of the last exon, 12 kb from the promoter. This site was present in T cells only. The CD3-epsilon enhancer did not display sequence similarity with the T cell-specific enhancer of CD3-delta, a related gene co-regulated with CD3-epsilon during intrathymic differentiation. The CD3-epsilon enhancer was unusual in that it constituted a CpG island, and was hypomethylated independent of tissue type. Two HTLV I-transformed T cell lines were identified in which the CD3-epsilon gene was not expressed, and in which the enhancer was inactive. Images PMID:2583122

Identification of mediator complex 26 (Crsp7) gametologs on platypus X1 and Y5 sex chromosomes: a candidate testis-determining gene in monotremes?

PubMed

Tsend-Ayush, Enkhjargal; Kortschak, R Daniel; Bernard, Pascal; Lim, Shu Ly; Ryan, Janelle; Rosenkranz, Ruben; Borodina, Tatiana; Dohm, Juliane C; Himmelbauer, Heinz; Harley, Vincent R; Grützner, Frank

2012-01-01

The basal lineage of monotremes features an extraordinarily complex sex chromosome system which has provided novel insights into the evolution of mammalian sex chromosomes. Recently, sequence information from autosomes, X chromosomes, and XY-shared pseudoautosomal regions has become available. However, no gene has so far been described on any of the Y chromosome-specific regions. We analyzed sequences derived from Y-specific BAC clones to identify genes with potentially male-specific function. Here, we report the identification and characterization of the mediator complex protein gametologs on platypus Y5 (Crspy). We also identified the X-chromosomal copy which unexpectedly maps to X1 (Crspx). Sequence comparison shows extensive divergence between the X and Y copy, but we found no significant positive selection on either gametolog. Expression analysis shows widespread expression of Crspx. Crspy is expressed exclusively in males with particularly strong expression in testis and kidney. Reporter gene assays to investigate whether Crspx/y can act on the recently discovered mouse Sox9 testis-specific enhancer element did reveal a modest effect together with mouse Sox9 + Sf1, but showed overall no significant upregulation of the reporter gene. This is the first report of a differentiated functional male-specific gene on platypus Y chromosomes, providing new insights into sex chromosome evolution and a candidate gene for male-specific function in monotremes.

Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sternberg, E.A.; Spizz, G.; Perry, W.M.

1988-07-01

Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

Converting cancer genes into killer genes.

PubMed Central

Da Costa, L T; Jen, J; He, T C; Chan, T A; Kinzler, K W; Vogelstein, B

1996-01-01

Over the past decade, it has become clear that tumorigenesis is driven by alterations in genes that control cell growth or cell death. Theoretically, the proteins encoded by these genes provide excellent targets for new therapeutic agents. Here, we describe a gene therapy approach to specifically kill tumor cells expressing such oncoproteins. In outline, the target oncoprotein binds to exogenously introduced gene products, resulting in transcriptional activation of a toxic gene. As an example, we show that this approach can be used to specifically kill cells overexpressing a mutant p53 gene in cell culture. The strategy may be generally applicable to neoplastic diseases in which the underlying patterns of genetic alterations or abnormal gene expression are known. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:8633039

Identification of an ancestral resistance gene cluster involved in the coevolution process between Phaseolus vulgaris and its fungal pathogen Colletotrichum lindemuthianum.

PubMed

Geffroy, V; Sicard, D; de Oliveira, J C; Sévignac, M; Cohen, S; Gepts, P; Neema, C; Langin, T; Dron, M

1999-09-01

The recent cloning of plant resistance (R) genes and the sequencing of resistance gene clusters have shed light on the molecular evolution of R genes. However, up to now, no attempt has been made to correlate this molecular evolution with the host-pathogen coevolution process at the population level. Cross-inoculations were carried out between 26 strains of the fungal pathogen Colletotrichum lindemuthianum and 48 Phaseolus vulgaris plants collected in the three centers of diversity of the host species. A high level of diversity for resistance against the pathogen was revealed. Most of the resistance specificities were overcome in sympatric situations, indicating an adaptation of the pathogen to the local host. In contrast, plants were generally resistant to allopatric strains, suggesting that R genes that were efficient against exotic strains but had been overcome locally were maintained in the plant genome. These results indicated that coevolution processes between the two protagonists led to a differentiation for resistance in the three centers of diversity of the host. To improve our understanding of the molecular evolution of these different specificities, a recombinant inbred (RI) population derived from two representative genotypes of the Andean (JaloEEP558) and Mesoamerican (BAT93) gene pools was used to map anthracnose specificities. A gene cluster comprising both Andean (Co-y; Co-z) and Mesoamerican (Co-9) host resistance specificities was identified, suggesting that this locus existed prior to the separation of the two major gene pools of P. vulgaris. Molecular analysis revealed a high level of complexity at this locus. It harbors 11 restriction fragment length polymorphisms when R gene analog (RGA) clones are used. The relationship between the coevolution process and diversification of resistance specificities at resistance gene clusters is discussed.

Comparative and Evolutionary Analysis of Grass Pollen Allergens Using Brachypodium distachyon as a Model System.

PubMed

Sharma, Akanksha; Sharma, Niharika; Bhalla, Prem; Singh, Mohan

2017-01-01

Comparative genomics have facilitated the mining of biological information from a genome sequence, through the detection of similarities and differences with genomes of closely or more distantly related species. By using such comparative approaches, knowledge can be transferred from the model to non-model organisms and insights can be gained in the structural and evolutionary patterns of specific genes. In the absence of sequenced genomes for allergenic grasses, this study was aimed at understanding the structure, organisation and expression profiles of grass pollen allergens using the genomic data from Brachypodium distachyon as it is phylogenetically related to the allergenic grasses. Combining genomic data with the anther RNA-Seq dataset revealed 24 pollen allergen genes belonging to eight allergen groups mapping on the five chromosomes in B. distachyon. High levels of anther-specific expression profiles were observed for the 24 identified putative allergen-encoding genes in Brachypodium. The genomic evidence suggests that gene encoding the group 5 allergen, the most potent trigger of hay fever and allergic asthma originated as a pollen specific orphan gene in a common grass ancestor of Brachypodium and Triticiae clades. Gene structure analysis showed that the putative allergen-encoding genes in Brachypodium either lack or contain reduced number of introns. Promoter analysis of the identified Brachypodium genes revealed the presence of specific cis-regulatory sequences likely responsible for high anther/pollen-specific expression. With the identification of putative allergen-encoding genes in Brachypodium, this study has also described some important plant gene families (e.g. expansin superfamily, EF-Hand family, profilins etc) for the first time in the model plant Brachypodium. Altogether, the present study provides new insights into structural characterization and evolution of pollen allergens and will further serve as a base for their functional characterization in related grass species.

Expression profiles of urbilaterian genes uniquely shared between honey bee and vertebrates

PubMed Central

Matsui, Toshiaki; Yamamoto, Toshiyuki; Wyder, Stefan; Zdobnov, Evgeny M; Kadowaki, Tatsuhiko

2009-01-01

Background Large-scale comparison of metazoan genomes has revealed that a significant fraction of genes of the last common ancestor of Bilateria (Urbilateria) is lost in each animal lineage. This event could be one of the underlying mechanisms involved in generating metazoan diversity. However, the present functions of these ancient genes have not been addressed extensively. To understand the functions and evolutionary mechanisms of such ancient Urbilaterian genes, we carried out comprehensive expression profile analysis of genes shared between vertebrates and honey bees but not with the other sequenced ecdysozoan genomes (honey bee-vertebrate specific, HVS genes) as a model. Results We identified 30 honey bee and 55 mouse HVS genes. Many HVS genes exhibited tissue-selective expression patterns; intriguingly, the expression of 60% of honey bee HVS genes was found to be brain enriched, and 24% of mouse HVS genes were highly expressed in either or both the brain and testis. Moreover, a minimum of 38% of mouse HVS genes demonstrated neuron-enriched expression patterns, and 62% of them exhibited expression in selective brain areas, particularly the forebrain and cerebellum. Furthermore, gene ontology (GO) analysis of HVS genes predicted that 35% of genes are associated with DNA transcription and RNA processing. Conclusion These results suggest that HVS genes include genes that are biased towards expression in the brain and gonads. They also demonstrate that at least some of Urbilaterian genes retained in the specific animal lineage may be selectively maintained to support the species-specific phenotypes. PMID:19138430

Expression profiles of urbilaterian genes uniquely shared between honey bee and vertebrates.

PubMed

Matsui, Toshiaki; Yamamoto, Toshiyuki; Wyder, Stefan; Zdobnov, Evgeny M; Kadowaki, Tatsuhiko

2009-01-12

Large-scale comparison of metazoan genomes has revealed that a significant fraction of genes of the last common ancestor of Bilateria (Urbilateria) is lost in each animal lineage. This event could be one of the underlying mechanisms involved in generating metazoan diversity. However, the present functions of these ancient genes have not been addressed extensively. To understand the functions and evolutionary mechanisms of such ancient Urbilaterian genes, we carried out comprehensive expression profile analysis of genes shared between vertebrates and honey bees but not with the other sequenced ecdysozoan genomes (honey bee-vertebrate specific, HVS genes) as a model. We identified 30 honey bee and 55 mouse HVS genes. Many HVS genes exhibited tissue-selective expression patterns; intriguingly, the expression of 60% of honey bee HVS genes was found to be brain enriched, and 24% of mouse HVS genes were highly expressed in either or both the brain and testis. Moreover, a minimum of 38% of mouse HVS genes demonstrated neuron-enriched expression patterns, and 62% of them exhibited expression in selective brain areas, particularly the forebrain and cerebellum. Furthermore, gene ontology (GO) analysis of HVS genes predicted that 35% of genes are associated with DNA transcription and RNA processing. These results suggest that HVS genes include genes that are biased towards expression in the brain and gonads. They also demonstrate that at least some of Urbilaterian genes retained in the specific animal lineage may be selectively maintained to support the species-specific phenotypes.

On Expression Patterns and Developmental Origin of Human Brain Regions.

PubMed

Kirsch, Lior; Chechik, Gal

2016-08-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

Isolation and characterization of two novel root-specific promoters in rice (Oryza sativa L.).

PubMed

Li, Yuanya; Liu, Shaojun; Yu, Zhiming; Liu, Yu; Wu, Ping

2013-06-01

Novel root-specific promoters are important for developing methods to drive root-specific gene expression for nutrient and water absorption. RT-PCR (reverse transcription polymerase chain reaction) analysis identified high expression levels of Os03g01700 and Os02g37190 in root tissues across developmental stages in comparison with the constitutive genes OsAct1 (rice Actin1 gene), OsUbi1 (rice polyubiquitin rubi1 gene), and OsCc1 (rice cytochrome c gene). The copy numbers of Os03g01700 and Os02g37190 were evaluated by qRT-PCR. The results showed that Os03g01700 and Os02g37190 transcripts were highly accumulated in the examined root tissues but were not detected in young embryos or leaves at the indicated days after germination or in the panicle, in contrast to the ubiquitous expression of OsAct1, OsUbi1, and OsCc1. Additionally, the promoter regions of these two genes were linked to the GUSplus reporter gene and transformed into rice. GUS staining of the transgenic plants showed that the Os03g01700 and Os02g37190 promoters were active in primary and secondary roots throughout the developmental stages, except in root hairs. The GUSPlus transcript levels were also highly root-specific in the transgenic rice. Overall, the two promoters are highly active in the root tissues of rice and can be useful for the root-specific enhancement of target gene(s). Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

On Expression Patterns and Developmental Origin of Human Brain Regions

PubMed Central

Kirsch, Lior; Chechik, Gal

2016-01-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

A simple Gateway-assisted construction system of TALEN genes for plant genome editing.

PubMed

Kusano, Hiroaki; Onodera, Hitomi; Kihira, Miho; Aoki, Hiromi; Matsuzaki, Hikaru; Shimada, Hiroaki

2016-07-25

TALEN is an artificial nuclease being applied for sequence-specific genome editing. For the plant genome editing, a pair of TALEN genes is expressed in the cells, and a binary plasmid for Agrobacterium-mediated transformation should be assembled. We developed a novel procedure using the Gateway-assisted plasmids, named Emerald-Gateway TALEN system. We constructed entry vectors, pPlat plasmids, for construction of a desired TALEN gene using Platinum Gate TALEN kit. We also created destination plasmid, pDual35SGw1301, which allowed two TALEN genes to both DNA strands to recruit using Gateway technology. Resultant TALEN genes were evaluated by the single-strand annealing (SSA) assay in E. coli cells. By this assay, the TALENs recognized the corresponding targets in the divided luciferase gene, and induced a specific recombination to generate an active luciferase gene. Using the TALEN genes constructed, we created a transformant potato cells in which a site-specific mutation occurred at the target site of the GBSS gene. This suggested that our system worked effectively and was applicable as a convenient tool for the plant genome editing.

Knock down of Whitefly Gut Gene Expression and Mortality by Orally Delivered Gut Gene-Specific dsRNAs.

PubMed

Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K

2017-01-01

Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can be applied to functional genomics analyses to facilitate, species-specific dsRNA-mediated control of other non-model hemipterans.

Knowledge-Assisted Approach to Identify Pathways with Differential Dependencies | Office of Cancer Genomics

Cancer.gov

We have previously developed a statistical method to identify gene sets enriched with condition-specific genetic dependencies. The method constructs gene dependency networks from bootstrapped samples in one condition and computes the divergence between distributions of network likelihood scores from different conditions. It was shown to be capable of sensitive and specific identification of pathways with phenotype-specific dysregulation, i.e., rewiring of dependencies between genes in different conditions.

Exploiting CRISPR-Cas nucleases to produce sequence-specific antimicrobials.

PubMed

Bikard, David; Euler, Chad W; Jiang, Wenyan; Nussenzweig, Philip M; Goldberg, Gregory W; Duportet, Xavier; Fischetti, Vincent A; Marraffini, Luciano A

2014-11-01

Antibiotics target conserved bacterial cellular pathways or growth functions and therefore cannot selectively kill specific members of a complex microbial population. Here, we develop programmable, sequence-specific antimicrobials using the RNA-guided nuclease Cas9 (refs.1,2) delivered by a bacteriophage. We show that Cas9, reprogrammed to target virulence genes, kills virulent, but not avirulent, Staphylococcus aureus. Reprogramming the nuclease to target antibiotic resistance genes destroys staphylococcal plasmids that harbor antibiotic resistance genes and immunizes avirulent staphylococci to prevent the spread of plasmid-borne resistance genes. We also show that CRISPR-Cas9 antimicrobials function in vivo to kill S. aureus in a mouse skin colonization model. This technology creates opportunities to manipulate complex bacterial populations in a sequence-specific manner.

Genes Downregulated in Endometriosis Are Located Near the Known Imprinting Genes

PubMed Central

Higashiura, Yumi; Koike, Natsuki; Akasaka, Juria; Uekuri, Chiharu; Iwai, Kana; Niiro, Emiko; Morioka, Sachiko; Yamada, Yuki

2014-01-01

There is now accumulating evidence that endometriosis is a disease associated with an epigenetic disorder. Genomic imprinting is an epigenetic phenomenon known to regulate DNA methylation of either maternal or paternal alleles. We hypothesize that hypermethylated endometriosis-associated genes may be enriched at imprinted gene loci. We sought to determine whether downregulated genes associated with endometriosis susceptibility are associated with chromosomal location of the known paternally and maternally expressed imprinting genes. Gene information has been gathered from National Center for Biotechnology Information database geneimprint.com. Several researchers have identified specific loci with strong DNA methylation in eutopic endometrium and ectopic lesion with endometriosis. Of the 29 hypermethylated genes in endometriosis, 19 genes were located near 45 known imprinted foci. There may be an association of the genomic location between genes specifically downregulated in endometriosis and epigenetically imprinted genes. PMID:24615936

Shared liver-like transcriptional characteristics in liver metastases and corresponding primary colorectal tumors.

PubMed

Cheng, Jun; Song, Xuekun; Ao, Lu; Chen, Rou; Chi, Meirong; Guo, You; Zhang, Jiahui; Li, Hongdong; Zhao, Wenyuan; Guo, Zheng; Wang, Xianlong

2018-01-01

Background & Aims : Primary tumors of colorectal carcinoma (CRC) with liver metastasis might gain some liver-specific characteristics to adapt the liver micro-environment. This study aims to reveal potential liver-like transcriptional characteristics associated with the liver metastasis in primary colorectal carcinoma. Methods: Among the genes up-regulated in normal liver tissues versus normal colorectal tissues, we identified "liver-specific" genes whose expression levels ranked among the bottom 10% ("unexpressed") of all measured genes in both normal colorectal tissues and primary colorectal tumors without metastasis. These liver-specific genes were investigated for their expressions in both the primary tumors and the corresponding liver metastases of seven primary CRC patients with liver metastasis using microdissected samples. Results: Among the 3958 genes detected to be up-regulated in normal liver tissues versus normal colorectal tissues, we identified 12 liver-specific genes and found two of them, ANGPTL3 and CFHR5 , were unexpressed in microdissected primary colorectal tumors without metastasis but expressed in both microdissected liver metastases and corresponding primary colorectal tumors (Fisher's exact test, P < 0.05). Genes co-expressed with ANGPTL3 and CFHR5 were significantly enriched in metabolism pathways characterizing liver tissues, including "starch and sucrose metabolism" and "drug metabolism-cytochrome P450". Conclusions: For primary CRC with liver metastasis, both the liver metastases and corresponding primary colorectal tumors may express some liver-specific genes which may help the tumor cells adapt the liver micro-environment.

A Comprehensive Analysis of Transcript-Supported De Novo Genes in Saccharomyces sensu stricto Yeasts

PubMed Central

Lu, Tzu-Chiao; Leu, Jun-Yi; Lin, Wen-Chang

2017-01-01

Abstract Novel genes arising from random DNA sequences (de novo genes) have been suggested to be widespread in the genomes of different organisms. However, our knowledge about the origin and evolution of de novo genes is still limited. To systematically understand the general features of de novo genes, we established a robust pipeline to analyze >20,000 transcript-supported coding sequences (CDSs) from the budding yeast Saccharomyces cerevisiae. Our analysis pipeline combined phylogeny, synteny, and sequence alignment information to identify possible orthologs across 20 Saccharomycetaceae yeasts and discovered 4,340 S. cerevisiae-specific de novo genes and 8,871 S. sensu stricto-specific de novo genes. We further combine information on CDS positions and transcript structures to show that >65% of de novo genes arose from transcript isoforms of ancient genes, especially in the upstream and internal regions of ancient genes. Fourteen identified de novo genes with high transcript levels were chosen to verify their protein expressions. Ten of them, including eight transcript isoform-associated CDSs, showed translation signals and five proteins exhibited specific cytosolic localizations. Our results suggest that de novo genes frequently arise in the S. sensu stricto complex and have the potential to be quickly integrated into ancient cellular network. PMID:28981695

An internal regulatory element controls troponin I gene expression.

PubMed Central

Yutzey, K E; Kline, R L; Konieczny, S F

1989-01-01

During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, we have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene. Images PMID:2725509

Gene-Based Genome-Wide Association Analysis in European and Asian Populations Identified Novel Genes for Rheumatoid Arthritis.

PubMed

Zhu, Hong; Xia, Wei; Mo, Xing-Bo; Lin, Xiang; Qiu, Ying-Hua; Yi, Neng-Jun; Zhang, Yong-Hong; Deng, Fei-Yan; Lei, Shu-Feng

2016-01-01

Rheumatoid arthritis (RA) is a complex autoimmune disease. Using a gene-based association research strategy, the present study aims to detect unknown susceptibility to RA and to address the ethnic differences in genetic susceptibility to RA between European and Asian populations. Gene-based association analyses were performed with KGG 2.5 by using publicly available large RA datasets (14,361 RA cases and 43,923 controls of European subjects, 4,873 RA cases and 17,642 controls of Asian Subjects). For the newly identified RA-associated genes, gene set enrichment analyses and protein-protein interactions analyses were carried out with DAVID and STRING version 10.0, respectively. Differential expression verification was conducted using 4 GEO datasets. The expression levels of three selected 'highly verified' genes were measured by ELISA among our in-house RA cases and controls. A total of 221 RA-associated genes were newly identified by gene-based association study, including 71'overlapped', 76 'European-specific' and 74 'Asian-specific' genes. Among them, 105 genes had significant differential expressions between RA patients and health controls at least in one dataset, especially for 20 genes including 11 'overlapped' (ABCF1, FLOT1, HLA-F, IER3, TUBB, ZKSCAN4, BTN3A3, HSP90AB1, CUTA, BRD2, HLA-DMA), 5 'European-specific' (PHTF1, RPS18, BAK1, TNFRSF14, SUOX) and 4 'Asian-specific' (RNASET2, HFE, BTN2A2, MAPK13) genes whose differential expressions were significant at least in three datasets. The protein expressions of two selected genes FLOT1 (P value = 1.70E-02) and HLA-DMA (P value = 4.70E-02) in plasma were significantly different in our in-house samples. Our study identified 221 novel RA-associated genes and especially highlighted the importance of 20 candidate genes on RA. The results addressed ethnic genetic background differences for RA susceptibility between European and Asian populations and detected a long list of overlapped or ethnic specific RA genes. The study not only greatly increases our understanding of genetic susceptibility to RA, but also provides important insights into the ethno-genetic homogeneity and heterogeneity of RA in both ethnicities.

Gene Editing and Gene-Based Therapeutics for Cardiomyopathies.

PubMed

Ohiri, Joyce C; McNally, Elizabeth M

2018-04-01

With an increasing understanding of genetic defects leading to cardiomyopathy, focus is shifting to correcting these underlying genetic defects. One approach involves treating mutant RNA through antisense oligonucleotides; the first drug has received regulatory approval to treat specific mutations associated with Duchenne muscular dystrophy. Gene editing is being evaluated in the preclinical setting. For inherited cardiomyopathies, genetic correction strategies require tight specificity for the mutant allele. Gene-editing methods are being tested to create deletions that may be useful to restore protein expression by through the bypass of mutations that restore protein production. Site-specific gene editing, which is required to correct many point mutations, is a less efficient process than inducing deletions. Copyright © 2017 Elsevier Inc. All rights reserved.

[Identification of genes that are specifically/preferentially expressed in developing cotton fibers by mRNA fluorescence differential display (FDD)].

PubMed

Sun, Jie; Li, Yuan-Li; Wang, Ruo-Hai; Xia, Gui-Xian

2004-01-01

Fluorescence differential display (FDD) technique was used to identify genes that are specifically or preferentially expressed in different developmental stages of cotton fiber cells. One hundred and nine differentially displayed cDNA fragments were isolated using 9, 21 and 27 DPA (days postanthesis) fibers as experimental materials. By a combination of two rounds of reverse Northern hybridization and Northern blot analyses, a number of such cDNA fragments were proved to represent fiber-specific/preferential genes. Sequencing determination and database searching indicated that most of these genes are novel. This work is an important step towards cloning the full-length cDNAs and characterizing the cellular functions of aforementioned genes in fiber development.

Mapping Second Chromosome Mutations to Defined Genomic Regions in Drosophila melanogaster

PubMed Central

Kahsai, Lily; Cook, Kevin R.

2017-01-01

Hundreds of Drosophila melanogaster stocks are currently maintained at the Bloomington Drosophila Stock Center with mutations that have not been associated with sequence-defined genes. They have been preserved because they have interesting loss-of-function phenotypes. The experimental value of these mutations would be increased by tying them to specific genomic intervals so that geneticists can more easily associate them with annotated genes. Here, we report the mapping of 85 second chromosome complementation groups in the Bloomington collection to specific, small clusters of contiguous genes or individual genes in the sequenced genome. This information should prove valuable to Drosophila geneticists interested in processes associated with particular phenotypes and those searching for mutations affecting specific sequence-defined genes. PMID:29066472

Combinatorial approaches to gene recognition.

PubMed

Roytberg, M A; Astakhova, T V; Gelfand, M S

1997-01-01

Recognition of genes via exon assembly approaches leads naturally to the use of dynamic programming. We consider the general graph-theoretical formulation of the exon assembly problem and analyze in detail some specific variants: multicriterial optimization in the case of non-linear gene-scoring functions; context-dependent schemes for scoring exons and related procedures for exon filtering; and highly specific recognition of arbitrary gene segments, oligonucleotide probes and polymerase chain reaction (PCR) primers.

Long-range looping of a locus control region drives tissue-specific chromatin packing within a multigene cluster

PubMed Central

Tsai, Yu-Cheng; Cooke, Nancy E.; Liebhaber, Stephen A.

2016-01-01

Abstract The relationships of higher order chromatin organization to mammalian gene expression remain incompletely defined. The human Growth Hormone (hGH) multigene cluster contains five gene paralogs. These genes are selectively activated in either the pituitary or the placenta by distinct components of a remote locus control region (LCR). Prior studies have revealed that appropriate activation of the placental genes is dependent not only on the actions of the LCR, but also on the multigene composition of the cluster itself. Here, we demonstrate that the hGH LCR ‘loops’ over a distance of 28 kb in primary placental nuclei to make specific contacts with the promoters of the two GH genes in the cluster. This long-range interaction sequesters the GH genes from the three hCS genes which co-assemble into a tightly packed ‘hCS chromatin hub’. Elimination of the long-range looping, via specific deletion of the placental LCR components, triggers a dramatic disruption of the hCS chromatin hub. These data reveal a higher-order structural pathway by which long-range looping from an LCR impacts on local chromatin architecture that is linked to tissue-specific gene regulation within a multigene cluster. PMID:26893355

Discovery of cancer common and specific driver gene sets

PubMed Central

2017-01-01

Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295

[The role of integrons in dissemination of antibiotic resistance].

PubMed

Ploy, M C; Lambert, T; Gassama, A; Denis, F

2000-01-01

Bacteria can transfer genetic information to get protection against most antibiotics. The acquisition of resistance genes involves genetic mobile elements such as plasmids and transposons. Another genetic structures, named integrons, have been described and contain one or more gene cassettes located at a specific site. Integrons contain an intI gene encoding a site-specific recombinase belonging to the integrase family and a recombination site attI. A gene cassette includes an open reading frame and, at the 3'-end, a recombination site attC. Integration or excision of cassettes occurs by a site-specific recombination mechanism catalyzed by the integrase. However, insertion can rarely occur, at non-specific sites leading to a stable situation for the cassette. Cassettes are transcribed from a common promoter located in the 5'-conserved segment and expression of distal genes is reduced by the presence of upstream cassettes. Most gene cassettes encode antibiotic resistant determinants but antiseptic resistant genes have also been described. Integrons seem to have a major role in the spread of multidrug resistance in Gram-negative bacteria but integrons in Gram-positive bacteria have been recently described. Moreover, the finding of super-integrons with gene cassettes coding for other determinants (biochemical functions, virulence factors) in different Gram negative bacteria suggests that integrons are probably implied in bacterial genome evolution.

Tissue-specific expression of the gene coding for human Clara cell 10-kD protein, a phospholipase A2-inhibitory protein.

PubMed Central

Peri, A; Cordella-Miele, E; Miele, L; Mukherjee, A B

1993-01-01

Clara cell 10-kD protein (cc10kD), a secretory phospholipase A2 inhibitor, is suggested to be the human counterpart of rabbit uteroglobin (UG). Because cc10kD is expressed constitutively at a very high level in the human respiratory epithelium, the 5' region of its gene may be useful in achieving organ-specific expression of recombinant DNA in gene therapy of diseases such as cystic fibrosis. However, it is important to establish the tissue-specific expression of this gene before designing gene transfer experiments. Since the UG gene in the rabbit is expressed in many other organs besides the lung and the endometrium, we investigated the organ and tissue specificity of human cc10kD gene expression using polymerase chain reaction, nucleotide sequence analysis, immunofluorescence, and Northern blotting. Our results indicate that, in addition to the lung, cc10kD is expressed in several nonrespiratory organs, with a distribution pattern very similar, if not identical, to that of UG in the rabbit. These results underscore the necessity for more detailed analyses of the 5' region of the human cc10kD gene before its usefulness in gene therapy could be fully assessed. These data also suggest that cc10kD and UG may have similar physiological function(s). Images PMID:8227325

Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation

PubMed Central

Pazhamala, Lekha T.; Purohit, Shilp; Saxena, Rachit K.; Garg, Vanika; Krishnamurthy, L.; Verdier, Jerome

2017-01-01

Abstract Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose–proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. PMID:28338822

Chromatin structure of the LCR in the human β-globin locus transcribing the adult δ- and β-globin genes.

PubMed

Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri

2012-03-01

The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Comprehensive gene expression analysis of the NAC gene family under normal growth conditions, hormone treatment, and drought stress conditions in rice using near-isogenic lines (NILs) generated from crossing Aday Selection (drought tolerant) and IR64.

PubMed

Nuruzzaman, Mohammed; Sharoni, Akhter Most; Satoh, Kouji; Moumeni, Ali; Venuprasad, Ramiah; Serraj, Rachid; Kumar, Arvind; Leung, Hei; Attia, Kotb; Kikuchi, Shoshi

2012-05-01

The NAC (NAM, ATAF1/2 and CUC2) genes are plant-specific transcriptional factors known to play diverse roles in various plant developmental processes. We describe the rice (Oryza sativa) OsNAC genes expression profiles (GEPs) under normal and water-deficit treatments (WDTs). The GEPs of the OsNAC genes were analyzed in 25 tissues covering the entire life cycle of Minghui 63. High expression levels of 17 genes were demonstrated in certain tissues under normal conditions suggesting that these genes may play important roles in specific organs. We determined that 16 genes were differentially expressed under at least 1 phytohormone (NAA, GA3, KT, SA, ABA, and JA) treatment. To investigate the GEPs in the root, leaf, and panicle of three rice genotypes [e.g., 2 near-isogenic lines (NILs) and IR64], we used two NILs from a common genetic combination backcross developed by Aday Selection and IR64. WDTs were applied using the fraction of transpirable soil water at severe, mild, and control conditions. Transcriptomic analysis using a 44K oligoarray from Agilent was performed on all the tissue samples. We identified common and specific genes in all tissues from the two NILs under both WDTs, and the majority of the OsNAC genes that were activated were in the drought-tolerant IR77298-14-1-2-B-10 line compared with the drought-susceptible IR77298-14-1-2-B-13 or IR64. In IR77298-14-1-2-B-10, seventeen genes were very specific in their expression levels. Approximately 70 % of the genes from subgroups SNAC and NAM/CUC3 were activated in the leaf, but 37 % genes from subgroup SND were inactivated in the root compared with the control under severe stress conditions. These results provide a useful reference for the cloning of candidate genes from the specific subgroup for further functional analysis.

DLGP: A database for lineage-conserved and lineage-specific gene pairs in animal and plant genomes.

PubMed

Wang, Dapeng

2016-01-15

The conservation of gene organization in the genome with lineage-specificity is an invaluable resource to decipher their potential functionality with diverse selective constraints, especially in higher animals and plants. Gene pairs appear to be the minimal structure for such kind of gene clusters that tend to reside in their preferred locations, representing the distinctive genomic characteristics in single species or a given lineage. Despite gene families having been investigated in a widespread manner, the definition of gene pair families in various taxa still lacks adequate attention. To address this issue, we report DLGP (http://lcgbase.big.ac.cn/DLGP/) that stores the pre-calculated lineage-based gene pairs in currently available 134 animal and plant genomes and inspect them under the same analytical framework, bringing out a set of innovational features. First, the taxonomy or lineage has been classified into four levels such as Kingdom, Phylum, Class and Order. It adopts all-to-all comparison strategy to identify the possible conserved gene pairs in all species for each gene pair in certain species and reckon those that are conserved in over a significant proportion of species in a given lineage (e.g. Primates, Diptera or Poales) as the lineage-conserved gene pairs. Furthermore, it predicts the lineage-specific gene pairs by retaining the above-mentioned lineage-conserved gene pairs that are not conserved in any other lineages. Second, it carries out pairwise comparison for the gene pairs between two compared species and creates the table including all the conserved gene pairs and the image elucidating the conservation degree of gene pairs in chromosomal level. Third, it supplies gene order browser to extend gene pairs to gene clusters, allowing users to view the evolution dynamics in the gene context in an intuitive manner. This database will be able to facilitate the particular comparison between animals and plants, between vertebrates and arthropods, and between monocots and eudicots, accounting for the significant contribution of gene pairs to speciation and diversification in specific lineages. Copyright © 2015 Elsevier Inc. All rights reserved.

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

PubMed Central

Ding, Jian; Lin, Zhi-Qiang; Jiang, Jian-Ming; Seidman, Christine E.; Seidman, Jonathan G.; Pu, William T.; Wang, Da-Zhi

2016-01-01

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimalimmunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations. PMID:28060283

The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical beta-cell nuclear complexes.

PubMed Central

German, M S; Moss, L G; Wang, J; Rutter, W J

1992-01-01

The pancreatic beta cell makes several unique gene products, including insulin, islet amyloid polypeptide (IAPP), and beta-cell-specific glucokinase (beta GK). The functions of isolated portions of the insulin, IAPP, and beta GK promoters were studied by using transient expression and DNA binding assays. A short portion (-247 to -197 bp) of the rat insulin I gene, the FF minienhancer, contains three interacting transcriptional regulatory elements. The FF minienhancer binds at least two nuclear complexes with limited tissue distribution. Sequences similar to that of the FF minienhancer are present in the 5' flanking DNA of the human IAPP and rat beta GK genes and also the rat insulin II and mouse insulin I and II genes. Similar minienhancer constructs from the insulin and IAPP genes function as cell-specific transcriptional regulatory elements and compete for binding of the same nuclear factors, while the beta GK construct competes for protein binding but functions poorly as a minienhancer. These observations suggest that the patterns of expression of the beta-cell-specific genes result in part from sharing the same transcriptional regulators. Images PMID:1549125

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.

PubMed

Ding, Jian; Lin, Zhi-Qiang; Jiang, Jian-Ming; Seidman, Christine E; Seidman, Jonathan G; Pu, William T; Wang, Da-Zhi

2016-12-17

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

Transcriptome analysis reveals the same 17 S-locus F-box genes in two haplotypes of the self-incompatibility locus of Petunia inflata.

PubMed

Williams, Justin S; Der, Joshua P; dePamphilis, Claude W; Kao, Teh-Hui

2014-07-01

Petunia possesses self-incompatibility, by which pistils reject self-pollen but accept non-self-pollen for fertilization. Self-/non-self-recognition between pollen and pistil is regulated by the pistil-specific S-RNase gene and by multiple pollen-specific S-locus F-box (SLF) genes. To date, 10 SLF genes have been identified by various methods, and seven have been shown to be involved in pollen specificity. For a given S-haplotype, each SLF interacts with a subset of its non-self S-RNases, and an as yet unknown number of SLFs are thought to collectively mediate ubiquitination and degradation of all non-self S-RNases to allow cross-compatible pollination. To identify a complete suite of SLF genes of P. inflata, we used a de novo RNA-seq approach to analyze the pollen transcriptomes of S2-haplotype and S3-haplotype, as well as the leaf transcriptome of the S3S3 genotype. We searched for genes that fit several criteria established from the properties of the known SLF genes and identified the same seven new SLF genes in S2-haplotype and S3-haplotype, suggesting that a total of 17 SLF genes constitute pollen specificity in each S-haplotype. This finding lays the foundation for understanding how multiple SLF genes evolved and the biochemical basis for differential interactions between SLF proteins and S-RNases. © 2014 American Society of Plant Biologists. All rights reserved.

Comparative genetics of disease resistance within the solanaceae.

PubMed Central

Grube, R C; Radwanski, E R; Jahn, M

2000-01-01

Genomic positions of phenotypically defined disease resistance genes (R genes) and R gene homologues were analyzed in three solanaceous crop genera, Lycopersicon (tomato), Solanum (potato), and Capsicum (pepper). R genes occurred at corresponding positions in two or more genomes more frequently than expected by chance; however, in only two cases, both involving Phytophthora spp., did genes at corresponding positions have specificity for closely related pathogen taxa. In contrast, resistances to Globodera spp., potato virus Y, tobacco mosaic virus, and tomato spotted wilt virus were mapped in two or more genera and did not occur in corresponding positions. Without exception, pepper homologues of the cloned R genes Sw-5, N, Pto, Prf, and I2 were found in syntenous positions in other solanaceous genomes and in some cases also mapped to additional positions near phenotypically defined solanaceous R genes. This detailed analysis and synthesis of all available data for solanaceous R genes suggests a working hypothesis regarding the evolution of R genes. Specifically, while the taxonomic specificity of host R genes may be evolving rapidly, general functions of R alleles (e.g., initiation of resistance response) may be conserved at homologous loci in related plant genera. PMID:10835406

Tissue Specificity and Dynamics of Sex-Biased Gene Expression in a Common Frog Population with Differentiated, Yet Homomorphic, Sex Chromosomes.

PubMed

Ma, Wen-Juan; Veltsos, Paris; Toups, Melissa A; Rodrigues, Nicolas; Sermier, Roberto; Jeffries, Daniel L; Perrin, Nicolas

2018-06-12

Sex-biased genes are central to the study of sexual selection, sexual antagonism, and sex chromosome evolution. We describe a comprehensive de novo assembled transcriptome in the common frog Rana temporaria based on five developmental stages and three adult tissues from both sexes, obtained from a population with karyotypically homomorphic but genetically differentiated sex chromosomes. This allows the study of sex-biased gene expression throughout development, and its effect on the rate of gene evolution while accounting for pleiotropic expression, which is known to negatively correlate with the evolutionary rate. Overall, sex-biased genes had little overlap among developmental stages and adult tissues. Late developmental stages and gonad tissues had the highest numbers of stage- or tissue-specific genes. We find that pleiotropic gene expression is a better predictor than sex bias for the evolutionary rate of genes, though it often interacts with sex bias. Although genetically differentiated, the sex chromosomes were not enriched in sex-biased genes, possibly due to a very recent arrest of XY recombination. These results extend our understanding of the developmental dynamics, tissue specificity, and genomic localization of sex-biased genes.

Specific resistances against Pseudomonas syringae effectors AvrB and AvrRpm1 have evolved differently in common bean, soybean, and Arabidopsis

PubMed Central

Chen, Nicolas W. G.; Sévignac, Mireille; Thareau, Vincent; Magdelenat, Ghislaine; David, Perrine; Ashfield, Tom; Innes, Roger W.; Geffroy, Valérie

2010-01-01

Summary In plants, the evolution of specific resistance is poorly understood. Pseudomonas syringae effectors AvrB and AvrRpm1 are recognized by phylogenetically distinct resistance (R) proteins in Arabidopsis (Brassicaceae) and soybean (Glycine max, Fabaceae). In soybean, these resistances are encoded by two tightly linked R genes Rpg1-b and Rpg1-r. To study the evolution of these specific resistances, we investigated AvrB- and AvrRpm1-induced responses in common bean (Phaseolus vulgaris, Fabaceae).Common bean genotypes of various geographical origins were inoculated with P. syringae strains expressing AvrB or AvrRpm1. A common bean recombinant-inbred-line (RIL) population was used to map R genes to AvrRpm1.No common bean genotypes recognized AvrB. By contrast, multiple genotypes responded to AvrRpm1, and two independent R genes conferring AvrRpm1-specific resistance were mapped to the ends of linkage group B11 (Rpsar-1) and B8 (Rpsar-2). Rpsar-1 is located in a region syntenic with the soybean Rpg1 cluster. However, mapping of specific Rpg1 homologous genes suggests that AvrRpm1 recognition evolved independently in common bean and soybean.The conservation of genomic position of AvrRpm1-specific genes between soybean and common bean suggests a model whereby specific clusters of R genes are predisposed to evolve recognition of the same effector molecules. PMID:20561214

CHRFAM7A: a human-specific α7-nicotinic acetylcholine receptor gene shows differential responsiveness of human intestinal epithelial cells to LPS

PubMed Central

Dang, Xitong; Eliceiri, Brian P.; Baird, Andrew; Costantini, Todd W.

2015-01-01

The human genome contains a unique, distinct, and human-specific α7-nicotinic acetylcholine receptor (α7nAChR) gene [CHRNA7 (gene-encoding α7-nicotinic acetylcholine receptor)] called CHRFAM7A (gene-encoding dup-α7-nicotinic acetylcholine receptor) on a locus of chromosome 15 associated with mental illness, including schizophrenia. Located 5′ upstream from the “wild-type” CHRNA7 gene that is found in other vertebrates, we demonstrate CHRFAM7A expression in a broad range of epithelial cells and sequenced the CHRFAM7A transcript found in normal human fetal small intestine epithelial (FHs) cells to prove its identity. We then compared its expression to CHRNA7 in 11 gut epithelial cell lines, showed that there is a differential response to LPS when compared to CHRNA7, and characterized the CHRFAM7A promoter. We report that both CHRFAM7A and CHRNA7 gene expression are widely distributed in human epithelial cell lines but that the levels of CHRFAM7A gene expression vary up to 5000-fold between different gut epithelial cells. A 3-hour treatment of epithelial cells with 100 ng/ml LPS increased CHRFAM7A gene expression by almost 1000-fold but had little effect on CHRNA7 gene expression. Mapping the regulatory elements responsible for CHRFAM7A gene expression identifies a 1 kb sequence in the UTR of the CHRFAM7A gene that is modulated by LPS. Taken together, these data establish the presence, identity, and differential regulation of the human-specific CHRFAM7A gene in human gut epithelial cells. In light of the fact that CHRFAM7A expression is reported to modulate ligand binding to, and alter the activity of, the wild-type α7nAChR ligand-gated pentameric ion channel, the findings point to the existence of a species-specific α7nAChR response that might regulate gut epithelial function in a human-specific fashion.—Dang, X., Eliceiri, B. P., Baird, A., Costantini, T. W. CHRFAM7A: a human-specific α7-nicotinic acetylcholine receptor gene shows differential responsiveness of human intestinal epithelial cells to LPS. PMID:25681457

TALE-mediated epigenetic suppression of CDKN2A increases replication in human fibroblasts.

PubMed

Bernstein, Diana L; Le Lay, John E; Ruano, Elena G; Kaestner, Klaus H

2015-05-01

Current strategies to alter disease-associated epigenetic modifications target ubiquitously expressed epigenetic regulators. This approach does not allow specific genes to be controlled in specific cell types; therefore, tools to selectively target epigenetic modifications in the desired cell type and strategies to more efficiently correct aberrant gene expression in disease are needed. Here, we have developed a method for directing DNA methylation to specific gene loci by conjugating catalytic domains of DNA methyltransferases (DNMTs) to engineered transcription activator-like effectors (TALEs). We demonstrated that these TALE-DNMTs direct DNA methylation specifically to the targeted gene locus in human cells. Further, we determined that minimizing direct nucleotide sequence repeats within the TALE moiety permits efficient lentivirus transduction, allowing easy targeting of primary cell types. Finally, we demonstrated that directed DNA methylation with a TALE-DNMT targeting the CDKN2A locus, which encodes the cyclin-dependent kinase inhibitor p16, decreased CDKN2A expression and increased replication of primary human fibroblasts, as intended. Moreover, overexpression of p16 in these cells reversed the proliferative phenotype, demonstrating the specificity of our epigenetic targeting. Together, our results demonstrate that TALE-DNMTs can selectively target specific genes and suggest that this strategy has potential application for the development of locus-specific epigenetic therapeutics.

TALE-mediated epigenetic suppression of CDKN2A increases replication in human fibroblasts

PubMed Central

Bernstein, Diana L.; Le Lay, John E.; Ruano, Elena G.; Kaestner, Klaus H.

2015-01-01

Current strategies to alter disease-associated epigenetic modifications target ubiquitously expressed epigenetic regulators. This approach does not allow specific genes to be controlled in specific cell types; therefore, tools to selectively target epigenetic modifications in the desired cell type and strategies to more efficiently correct aberrant gene expression in disease are needed. Here, we have developed a method for directing DNA methylation to specific gene loci by conjugating catalytic domains of DNA methyltransferases (DNMTs) to engineered transcription activator–like effectors (TALEs). We demonstrated that these TALE-DNMTs direct DNA methylation specifically to the targeted gene locus in human cells. Further, we determined that minimizing direct nucleotide sequence repeats within the TALE moiety permits efficient lentivirus transduction, allowing easy targeting of primary cell types. Finally, we demonstrated that directed DNA methylation with a TALE-DNMT targeting the CDKN2A locus, which encodes the cyclin-dependent kinase inhibitor p16, decreased CDKN2A expression and increased replication of primary human fibroblasts, as intended. Moreover, overexpression of p16 in these cells reversed the proliferative phenotype, demonstrating the specificity of our epigenetic targeting. Together, our results demonstrate that TALE-DNMTs can selectively target specific genes and suggest that this strategy has potential application for the development of locus-specific epigenetic therapeutics. PMID:25866970

Surface Diversity in Mycoplasma agalactiae Is Driven by Site-Specific DNA Inversions within the vpma Multigene Locus

PubMed Central

Glew, Michelle D.; Marenda, Marc; Rosengarten, Renate; Citti, Christine

2002-01-01

The ruminant pathogen Mycoplasma agalactiae possesses a family of abundantly expressed variable surface lipoproteins called Vpmas. Phenotypic switches between Vpma members have previously been correlated with DNA rearrangements within a locus of vpma genes and are proposed to play an important role in disease pathogenesis. In this study, six vpma genes were characterized in the M. agalactiae type strain PG2. All vpma genes clustered within an 8-kb region and shared highly conserved 5′ untranslated regions, lipoprotein signal sequences, and short N-terminal sequences. Analyses of the vpma loci from consecutive clonal isolates showed that vpma DNA rearrangements were site specific and that cleavage and strand exchange occurred within a minimal region of 21 bp located within the 5′ untranslated region of all vpma genes. This process controlled expression of vpma genes by effectively linking the open reading frame (ORF) of a silent gene to a unique active promoter sequence within the locus. An ORF (xer1) immediately adjacent to one end of the vpma locus did not undergo rearrangement and had significant homology to a distinct subset of genes belonging to the λ integrase family of site-specific xer recombinases. It is proposed that xer1 codes for a site-specific recombinase that is not involved in chromosome dimer resolution but rather is responsible for the observed vpma-specific recombination in M. agalactiae. PMID:12374833

The pea END1 promoter drives anther-specific gene expression in different plant species.

PubMed

Gómez, María D; Beltrán, José-Pío; Cañas, Luis A

2004-10-01

END1 was isolated by an immunosubtractive approach intended to identify specific proteins present in the different pea (Pisum sativum L.) floral organs and the genes encoding them. Following this strategy we obtained a monoclonal antibody (mAbA1) that specifically recognized a 26-kDa protein (END1) only detected in anther tissues. Northern blot assays showed that END1 is expressed specifically in the anther. In situ hybridization and immunolocalization assays corroborated the specific expression of END1 in the epidermis, connective, endothecium and middle layer cells during the different stages of anther development. END1 is the first anther-specific gene isolated from pea. The absence of a practicable pea transformation method together with the fact that no END1 homologue gene exists in Arabidopsis prevented us from carrying out END1 functional studies. However, we designed functional studies with the END1 promoter in different dicot species, as the specific spatial and temporal expression pattern of END1 suggested, among other things, the possibility of using its promoter region for biotechnological applications. Using different constructs to drive the uidA (beta-glucuronidase) gene controlled by the 2.7-kb isolated promoter sequence we have proven that the END1 promoter is fully functional in the anthers of transgenic Arabidopsis thaliana (L.) Heynh., Nicotiana tabacum L. (tobacco) and Lycopersicon esculentum Mill. (tomato) plants. The presence in the -330-bp region of the promoter sequence of three putative CArG boxes also suggests that END1 could be a target gene of MADS-box proteins and that, subsequently, it would be activated by genes controlling floral organ identity.

Characterization of two distinct dual specificity phosphatases encoded in alternative open reading frames of a single gene located on human chromosome 10q22.2.

PubMed

Chen, Hsu-Hsin; Luche, Ralf; Wei, Bo; Tonks, Nicholas K

2004-10-01

Dual specificity phosphatases (DSPs) are members of the protein-tyrosine phosphatase superfamily that dephosphorylate both phosphotyrosine and phosphoserine/threonine residues in vitro. Many DSPs have been found to play important roles in various aspects of cellular function and to be involved in human disease. We have identified a gene located on human chromosome 10q22.2, which utilizes alternative open reading frames (ORFs) to encode the following two distinct DSPs: the previously described testis and skeletal muscle-specific dual specificity phosphatase (TMDP) and a novel DSP, muscle-restricted dual specificity phosphatase (MDSP). Use of alternative ORFs encoding distinct proteins from a single gene is extremely rare in eukaryotes, and in all previously reported cases the two proteins produced from one gene are unrelated. To our knowledge this is the first example of a gene from which two distinct proteins of the same family are expressed using alternative ORFs. Here we provide evidence that both MDSP and TMDP proteins are expressed in vivo and are restricted to specific tissues, skeletal muscle and testis, respectively. Most interestingly, the protein expression profiles of both MDSP and TMDP during mouse postnatal development are strikingly similar. MDSP is expressed at very low levels in myotubes and early postnatal muscle. TMDP is not detectable in testis lysate in the first 3 weeks of life. The expression of both MDSP and TMDP proteins was markedly increased at approximately the 3rd week after birth and continued to increase gradually into adulthood, implying that the physiological functions of both DSPs are specific to the mature/late-developing organs. The conserved gene structure and the similarity in postnatal expression profile of these two proteins suggest biological significance of the unusual gene arrangement.

Cardiomyocyte-specific deletion of the G protein-coupled estrogen receptor (GPER) leads to left ventricular dysfunction and adverse remodeling: A sex-specific gene profiling analysis.

PubMed

Wang, Hao; Sun, Xuming; Chou, Jeff; Lin, Marina; Ferrario, Carlos M; Zapata-Sudo, Gisele; Groban, Leanne

2017-08-01

Activation of G protein-coupled estrogen receptor (GPER) by its agonist, G1, protects the heart from stressors such as pressure-overload, ischemia, a high-salt diet, estrogen loss, and aging, in various male and female animal models. Due to nonspecific effects of G1, the exact functions of cardiac GPER cannot be concluded from studies using systemic G1 administration. Moreover, global knockdown of GPER affects glucose homeostasis, blood pressure, and many other cardiovascular-related systems, thereby confounding interpretation of its direct cardiac actions. We generated a cardiomyocyte-specific GPER knockout (KO) mouse model to specifically investigate the functions of GPER in cardiomyocytes. Compared to wild type mice, cardiomyocyte-specific GPER KO mice exhibited adverse alterations in cardiac structure and impaired systolic and diastolic function, as measured by echocardiography. Gene deletion effects on left ventricular dimensions were more profound in male KO mice compared to female KO mice. Analysis of DNA microarray data from isolated cardiomyocytes of wild type and KO mice revealed sex-based differences in gene expression profiles affecting multiple transcriptional networks. Gene Set Enrichment Analysis (GSEA) revealed that mitochondrial genes are enriched in GPER KO females, whereas inflammatory response genes are enriched in GPER KO males, compared to their wild type counterparts of the same sex. The cardiomyocyte-specific GPER KO mouse model provides us with a powerful tool to study the functions of GPER in cardiomyocytes. The gene expression profiles of the GPER KO mice provide foundational information for further study of the mechanisms underlying sex-specific cardioprotection by GPER. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparative genomic analysis of SET domain family reveals the origin, expansion, and putative function of the arthropod-specific SmydA genes as histone modifiers in insects.

PubMed

Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling; Wang, Xianhui; Kang, Le

2017-06-01

The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain-containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. © The Authors 2017. Published by Oxford University Press.

Comparative genomic analysis of SET domain family reveals the origin, expansion, and putative function of the arthropod-specific SmydA genes as histone modifiers in insects

PubMed Central

Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling

2017-01-01

Abstract The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain–containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. PMID:28444351

An internal regulatory element controls troponin I gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F.

1989-04-01

During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein genemore » has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.« less

76 FR 43993 - Notice of Availability for Exclusive, Non-Exclusive, or Partially-Exclusive Licensing of an...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-22

... Agents by Measuring Distinct Pattern in the Levels of Expression of Specific Genes AGENCY: Department of... Measuring Distinct Pattern in the Levels of Expression of Specific Genes,'' issued November 13, 2001. The... determining a difference in the detected amount of protein/gene expression between exposed and unexposed...

Cre/lox-recombinase-mediated cassette exchange for reversible site-specific genomic targeting of the disease vector, Aedes aegypti

USDA-ARS?s Scientific Manuscript database

Site-specific genome modification is an important tool for mosquito functional genomics studies that help to uncover gene functions, identify gene regulatory elements, and perform comparative gene expression studies, all of which contribute to a better understanding of mosquito biology and are thus ...

Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element

PubMed Central

Hao, Hailing; Li, Ying; Tzatzalos, Evangeline; Gilbert, Jordana; Zala, Dhara; Bhaumik, Mantu; Cai, Li

2014-01-01

Precise control of lineage-specific gene expression in the neural stem/progenitor cells is crucial for generation of the diversity of neuronal and glial cell types in the central nervous system (CNS). The mechanism underlying such gene regulation, however, is not fully elucidated. Here, we report that a 377 bp evolutionarily conserved DNA fragment (CR5), located approximately 32 kbp upstream of Olig2 transcription start site, acts as a cis-regulator for gene expression in the development of the neonatal forebrain. CR5 is active in a time-specific and brain region-restricted manner. CR5 activity is not detected in the embryonic stage, but it is exclusively in a subset of Sox5+ cells in the neonatal ventral forebrain. Furthermore, we show that Sox5 binding motif in CR5 is important for this cell-specific gene regulatory activity; mutation of Sox5 binding motif in CR5 alters reporter gene expression with different cellular composition. Together, our study provides new insights into the regulation of cell-specific gene expression during CNS development. PMID:24954155

Activation of a C. elegans Antennapedia homologue in migrating cells controls their direction of migration.

PubMed

Salser, S J; Kenyon, C

1992-01-16

Anterior-posterior patterning in insects, vertebrates and nematodes involves members of conserved Antennapedia-class homeobox gene clusters (HOM-C) that are thought to give specific body regions their identities. The effects of these genes on region-specific body structures have been described extensively, particularly in Drosophila, but little is known about how HOM-C genes affect the behaviours of cells that migrate into their domains of function. In Caenorhabditis elegans, the Antennapedia-like HOM-C gene mab-5 not only specifies postembryonic fates of cells in a posterior body region, but also influences the migration of mesodermal and neural cells that move through this region. Here we show that as one neuroblast migrates into this posterior region, it switches on mab-5 gene expression; mab-5 then acts as a developmental switch to control the migratory behaviour of the neuroblast descendants. HOM-C genes can therefore not only direct region-specific patterns of cell division and differentiation, but can also act within migrating cells to programme region-specific migratory behaviour.

Drosophila CLOCK target gene characterization: implications for circadian tissue-specific gene expression

PubMed Central

Abruzzi, Katharine Compton; Rodriguez, Joseph; Menet, Jerome S.; Desrochers, Jennifer; Zadina, Abigail; Luo, Weifei; Tkachev, Sasha; Rosbash, Michael

2011-01-01

CLOCK (CLK) is a master transcriptional regulator of the circadian clock in Drosophila. To identify CLK direct target genes and address circadian transcriptional regulation in Drosophila, we performed chromatin immunoprecipitation (ChIP) tiling array assays (ChIP–chip) with a number of circadian proteins. CLK binding cycles on at least 800 sites with maximal binding in the early night. The CLK partner protein CYCLE (CYC) is on most of these sites. The CLK/CYC heterodimer is joined 4–6 h later by the transcriptional repressor PERIOD (PER), indicating that the majority of CLK targets are regulated similarly to core circadian genes. About 30% of target genes also show cycling RNA polymerase II (Pol II) binding. Many of these generate cycling RNAs despite not being documented in prior RNA cycling studies. This is due in part to different RNA isoforms and to fly head tissue heterogeneity. CLK has specific targets in different tissues, implying that important CLK partner proteins and/or mechanisms contribute to gene-specific and tissue-specific regulation. PMID:22085964

Biodiversity of mannose-specific adhesion in Lactobacillus plantarum revisited: strain-specific domain composition of the mannose-adhesin.

PubMed

Gross, G; Snel, J; Boekhorst, J; Smits, M A; Kleerebezem, M

2010-03-01

Recently, we have identified the mannose-specific adhesin encoding gene (msa) of Lactobacillus plantarum. In the current study, structure and function of this potentially probiotic effector gene were further investigated, exploring genetic diversity of msa in L. plantarum in relation to mannose adhesion capacity. The results demonstrate that there is considerable variation in quantitative in vitro mannose adhesion capacity, which is paralleled by msa gene sequence variation. The msa genes of different L. plantarum strains encode proteins with variable domain composition. Construction of L. plantarum 299v mutant strains revealed that the msa gene product is the key-protein for mannose adhesion, also in a strain with high mannose adhering capacity. However, no straightforward correlation between adhesion capacity and domain composition of Msa in L. plantarum could be identified. Nevertheless, differences in Msa sequences in combination with variable genetic background of specific bacterial strains appears to determine mannose adhesion capacity and potentially affects probiotic properties. These findings exemplify the strain-specificity of probiotic characteristics and illustrate the need for careful and molecular selection of new candidate probiotics.

Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

PubMed

Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

2002-04-24

The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes

PubMed Central

Dodds, Peter N.; Lawrence, Gregory J.; Catanzariti, Ann-Maree; Teh, Trazel; Wang, Ching-I. A.; Ayliffe, Michael A.; Kobe, Bostjan; Ellis, Jeffrey G.

2006-01-01

Plant resistance proteins (R proteins) recognize corresponding pathogen avirulence (Avr) proteins either indirectly through detection of changes in their host protein targets or through direct R–Avr protein interaction. Although indirect recognition imposes selection against Avr effector function, pathogen effector molecules recognized through direct interaction may overcome resistance through sequence diversification rather than loss of function. Here we show that the flax rust fungus AvrL567 genes, whose products are recognized by the L5, L6, and L7 R proteins of flax, are highly diverse, with 12 sequence variants identified from six rust strains. Seven AvrL567 variants derived from Avr alleles induce necrotic responses when expressed in flax plants containing corresponding resistance genes (R genes), whereas five variants from avr alleles do not. Differences in recognition specificity between AvrL567 variants and evidence for diversifying selection acting on these genes suggest they have been involved in a gene-specific arms race with the corresponding flax R genes. Yeast two-hybrid assays indicate that recognition is based on direct R–Avr protein interaction and recapitulate the interaction specificity observed in planta. Biochemical analysis of Escherichia coli-produced AvrL567 proteins shows that variants that escape recognition nevertheless maintain a conserved structure and stability, suggesting that the amino acid sequence differences directly affect the R–Avr protein interaction. We suggest that direct recognition associated with high genetic diversity at corresponding R and Avr gene loci represents an alternative outcome of plant–pathogen coevolution to indirect recognition associated with simple balanced polymorphisms for functional and nonfunctional R and Avr genes. PMID:16731621

Rapidly Evolving Toll-3/4 Genes Encode Male-Specific Toll-Like Receptors in Drosophila.

PubMed

Levin, Tera C; Malik, Harmit S

2017-09-01

Animal Toll-like receptors (TLRs) have evolved through a pattern of duplication and divergence. Whereas mammalian TLRs directly recognize microbial ligands, Drosophila Tolls bind endogenous ligands downstream of both developmental and immune signaling cascades. Here, we find that most Toll genes in Drosophila evolve slowly with little gene turnover (gains/losses), consistent with their important roles in development and indirect roles in microbial recognition. In contrast, we find that the Toll-3/4 genes have experienced an unusually rapid rate of gene gains and losses, resulting in lineage-specific Toll-3/4s and vastly different gene repertoires among Drosophila species, from zero copies (e.g., D. mojavensis) to nineteen copies (e.g., D. willistoni). In D. willistoni, we find strong evidence for positive selection in Toll-3/4 genes, localized specifically to an extracellular region predicted to overlap with the binding site of Spätzle, the only known ligand of insect Tolls. However, because Spätzle genes are not experiencing similar selective pressures, we hypothesize that Toll-3/4s may be rapidly evolving because they bind to a different ligand, akin to TLRs outside of insects. We further find that most Drosophila Toll-3/4 genes are either weakly expressed or expressed exclusively in males, specifically in the germline. Unlike other Toll genes in D. melanogaster, Toll-3, and Toll-4 have apparently escaped from essential developmental roles, as knockdowns have no substantial effects on viability or male fertility. Based on these findings, we propose that the Toll-3/4 genes represent an exceptionally rapidly evolving lineage of Drosophila Toll genes, which play an unusual, as-yet-undiscovered role in the male germline. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Rapidly Evolving Toll-3/4 Genes Encode Male-Specific Toll-Like Receptors in Drosophila

PubMed Central

Levin, Tera C.; Malik, Harmit S.

2017-01-01

Abstract Animal Toll-like receptors (TLRs) have evolved through a pattern of duplication and divergence. Whereas mammalian TLRs directly recognize microbial ligands, Drosophila Tolls bind endogenous ligands downstream of both developmental and immune signaling cascades. Here, we find that most Toll genes in Drosophila evolve slowly with little gene turnover (gains/losses), consistent with their important roles in development and indirect roles in microbial recognition. In contrast, we find that the Toll-3/4 genes have experienced an unusually rapid rate of gene gains and losses, resulting in lineage-specific Toll-3/4s and vastly different gene repertoires among Drosophila species, from zero copies (e.g., D. mojavensis) to nineteen copies (e.g., D. willistoni). In D. willistoni, we find strong evidence for positive selection in Toll-3/4 genes, localized specifically to an extracellular region predicted to overlap with the binding site of Spätzle, the only known ligand of insect Tolls. However, because Spätzle genes are not experiencing similar selective pressures, we hypothesize that Toll-3/4s may be rapidly evolving because they bind to a different ligand, akin to TLRs outside of insects. We further find that most Drosophila Toll-3/4 genes are either weakly expressed or expressed exclusively in males, specifically in the germline. Unlike other Toll genes in D. melanogaster, Toll-3, and Toll-4 have apparently escaped from essential developmental roles, as knockdowns have no substantial effects on viability or male fertility. Based on these findings, we propose that the Toll-3/4 genes represent an exceptionally rapidly evolving lineage of Drosophila Toll genes, which play an unusual, as-yet-undiscovered role in the male germline. PMID:28541576

Genome-wide histone state profiling of fibroblasts from the opossum, Monodelphis domestica, identifies the first marsupial-specific imprinted gene

PubMed Central

2014-01-01

Background Imprinted genes have been extensively documented in eutherian mammals and found to exhibit significant interspecific variation in the suites of genes that are imprinted and in their regulation between tissues and developmental stages. Much less is known about imprinted loci in metatherian (marsupial) mammals, wherein studies have been limited to a small number of genes previously known to be imprinted in eutherians. We describe the first ab initio search for imprinted marsupial genes, in fibroblasts from the opossum, Monodelphis domestica, based on a genome-wide ChIP-seq strategy to identify promoters that are simultaneously marked by mutually exclusive, transcriptionally opposing histone modifications. Results We identified a novel imprinted gene (Meis1) and two additional monoallelically expressed genes, one of which (Cstb) showed allele-specific, but non-imprinted expression. Imprinted vs. allele-specific expression could not be resolved for the third monoallelically expressed gene (Rpl17). Transcriptionally opposing histone modifications H3K4me3, H3K9Ac, and H3K9me3 were found at the promoters of all three genes, but differential DNA methylation was not detected at CpG islands at any of these promoters. Conclusions In generating the first genome-wide histone modification profiles for a marsupial, we identified the first gene that is imprinted in a marsupial but not in eutherian mammals. This outcome demonstrates the practicality of an ab initio discovery strategy and implicates histone modification, but not differential DNA methylation, as a conserved mechanism for marking imprinted genes in all therian mammals. Our findings suggest that marsupials use multiple epigenetic mechanisms for imprinting and support the concept that lineage-specific selective forces can produce sets of imprinted genes that differ between metatherian and eutherian lines. PMID:24484454

Misregulation of spermatogenesis genes in Drosophila hybrids is lineage-specific and driven by the combined effects of sterility and fast male regulatory divergence.

PubMed

Gomes, S; Civetta, A

2014-09-01

Hybrid male sterility is a common outcome of crosses between different species. Gene expression studies have found that a number of spermatogenesis genes are differentially expressed in sterile hybrid males, compared with parental species. Late-stage sperm development genes are particularly likely to be misexpressed, with fewer early-stage genes affected. Thus, a link has been posited between misexpression and sterility. A more recent alternative explanation for hybrid gene misexpression has been that it is independent of sterility and driven by divergent evolution of male-specific regulatory elements between species (faster male hypothesis). The faster male hypothesis predicts that misregulation of spermatogenesis genes should be independent of sterility and approximately the same in both hybrids, whereas sterility should only affect gene expression in sterile hybrids. To test the faster male hypothesis vs. the effect of sterility on gene misexpression, we analyse spermatogenesis gene expression in different species pairs of the Drosophila phylogeny, where hybrid male sterility occurs in only one direction of the interspecies cross (i.e. unidirectional sterility). We find significant differences among genes in misexpression with effects that are lineage-specific and caused by sterility or fast male regulatory divergence. © 2014 The Authors. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.

In silico identification and comparative analysis of differentially expressed genes in human and mouse tissues

PubMed Central

Pao, Sheng-Ying; Lin, Win-Li; Hwang, Ming-Jing

2006-01-01

Background Screening for differentially expressed genes on the genomic scale and comparative analysis of the expression profiles of orthologous genes between species to study gene function and regulation are becoming increasingly feasible. Expressed sequence tags (ESTs) are an excellent source of data for such studies using bioinformatic approaches because of the rich libraries and tremendous amount of data now available in the public domain. However, any large-scale EST-based bioinformatics analysis must deal with the heterogeneous, and often ambiguous, tissue and organ terms used to describe EST libraries. Results To deal with the issue of tissue source, in this work, we carefully screened and organized more than 8 million human and mouse ESTs into 157 human and 108 mouse tissue/organ categories, to which we applied an established statistic test using different thresholds of the p value to identify genes differentially expressed in different tissues. Further analysis of the tissue distribution and level of expression of human and mouse orthologous genes showed that tissue-specific orthologs tended to have more similar expression patterns than those lacking significant tissue specificity. On the other hand, a number of orthologs were found to have significant disparity in their expression profiles, hinting at novel functions, divergent regulation, or new ortholog relationships. Conclusion Comprehensive statistics on the tissue-specific expression of human and mouse genes were obtained in this very large-scale, EST-based analysis. These statistical results have been organized into a database, freely accessible at our website , for easy searching of human and mouse tissue-specific genes and for investigating gene expression profiles in the context of comparative genomics. Comparative analysis showed that, although highly tissue-specific genes tend to exhibit similar expression profiles in human and mouse, there are significant exceptions, indicating that orthologous genes, while sharing basic genomic properties, could result in distinct phenotypes. PMID:16626500

FlpStop, a tool for conditional gene control in Drosophila

PubMed Central

Fisher, Yvette E; Yang, Helen H; Isaacman-Beck, Jesse; Xie, Marjorie; Gohl, Daryl M; Clandinin, Thomas R

2017-01-01

Manipulating gene function cell type-specifically is a common experimental goal in Drosophila research and has been central to studies of neural development, circuit computation, and behavior. However, current cell type-specific gene disruption techniques in flies often reduce gene activity incompletely or rely on cell division. Here we describe FlpStop, a generalizable tool for conditional gene disruption and rescue in post-mitotic cells. In proof-of-principle experiments, we manipulated apterous, a regulator of wing development. Next, we produced conditional null alleles of Glutamic acid decarboxylase 1 (Gad1) and Resistant to dieldrin (Rdl), genes vital for GABAergic neurotransmission, as well as cacophony (cac) and paralytic (para), voltage-gated ion channels central to neuronal excitability. To demonstrate the utility of this approach, we manipulated cac in a specific visual interneuron type and discovered differential regulation of calcium signals across subcellular compartments. Thus, FlpStop will facilitate investigations into the interactions between genes, circuits, and computation. DOI: http://dx.doi.org/10.7554/eLife.22279.001 PMID:28211790

Cancer vulnerabilities unveiled by genomic loss

PubMed Central

Nijhawan, Deepak; Zack, Travis I.; Ren, Yin; Strickland, Matthew R.; Lamothe, Rebecca; Schumacher, Steven E.; Tsherniak, Aviad; Besche, Henrike C.; Rosenbluh, Joseph; Shehata, Shyemaa; Cowley, Glenn S.; Weir, Barbara A.; Goldberg, Alfred L.; Mesirov, Jill P.; Root, David E.; Bhatia, Sangeeta N.; Beroukhim, Rameen; Hahn, William C.

2012-01-01

Summary Due to genome instability, most cancers exhibit loss of regions containing tumor suppressor genes and collateral loss of other genes. To identify cancer-specific vulnerabilities that are the result of copy-number losses, we performed integrated analyses of genome-wide copy-number and RNAi profiles and identified 56 genes for which gene suppression specifically inhibited the proliferation of cells harboring partial copy-number loss of that gene. These CYCLOPS (Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS) genes are enriched for spliceosome, proteasome and ribosome components. One CYCLOPS gene, PSMC2, encodes an essential member of the 19S proteasome. Normal cells express excess PSMC2, which resides in a complex with PSMC1, PSMD2, and PSMD5 and acts as a reservoir protecting cells from PSMC2 suppression. Cells harboring partial PSMC2 copy-number loss lack this complex and die after PSMC2 suppression. These observations define a distinct class of cancer-specific liabilities resulting from genome instability. PMID:22901813

Zinc-finger protein-targeted gene regulation: Genomewide single-gene specificity

PubMed Central

Tan, Siyuan; Guschin, Dmitry; Davalos, Albert; Lee, Ya-Li; Snowden, Andrew W.; Jouvenot, Yann; Zhang, H. Steven; Howes, Katherine; McNamara, Andrew R.; Lai, Albert; Ullman, Chris; Reynolds, Lindsey; Moore, Michael; Isalan, Mark; Berg, Lutz-Peter; Campos, Bradley; Qi, Hong; Spratt, S. Kaye; Case, Casey C.; Pabo, Carl O.; Campisi, Judith; Gregory, Philip D.

2003-01-01

Zinc-finger protein transcription factors (ZFP TFs) can be designed to control the expression of any desired target gene, and thus provide potential therapeutic tools for the study and treatment of disease. Here we report that a ZFP TF can repress target gene expression with single-gene specificity within the human genome. A ZFP TF repressor that binds an 18-bp recognition sequence within the promoter of the endogenous CHK2 gene gives a >10-fold reduction in CHK2 mRNA and protein. This level of repression was sufficient to generate a functional phenotype, as demonstrated by the loss of DNA damage-induced CHK2-dependent p53 phosphorylation. We determined the specificity of repression by using DNA microarrays and found that the ZFP TF repressed a single gene (CHK2) within the monitored genome in two different cell types. These data demonstrate the utility of ZFP TFs as precise tools for target validation, and highlight their potential as clinical therapeutics. PMID:14514889

Identification and resolution of artifacts in the interpretation of imprinted gene expression.

PubMed

Proudhon, Charlotte; Bourc'his, Déborah

2010-12-01

Genomic imprinting refers to genes that are epigenetically programmed in the germline to express exclusively or preferentially one allele in a parent-of-origin manner. Expression-based genome-wide screening for the identification of imprinted genes has failed to uncover a significant number of new imprinted genes, probably because of the high tissue- and developmental-stage specificity of imprinted gene expression. A very large number of technical and biological artifacts can also lead to the erroneous evidence of imprinted gene expression. In this article, we focus on three common sources of potential confounding effects: (i) random monoallelic expression in monoclonal cell populations, (ii) genetically determined monoallelic expression and (iii) contamination or infiltration of embryonic tissues with maternal material. This last situation specifically applies to genes that occur as maternally expressed in the placenta. Beside the use of reciprocal crosses that are instrumental to confirm the parental specificity of expression, we provide additional methods for the detection and elimination of these situations that can be misinterpreted as cases of imprinted expression.

Epigenetic regulation of BDNF gene transcription in the consolidation of fear memory.

PubMed

Lubin, Farah D; Roth, Tania L; Sweatt, J David

2008-10-15

Long-term memory formation requires selective changes in gene expression. Here, we determined the contribution of chromatin remodeling to learning-induced changes in brain-derived neurotrophic factor (bdnf) gene expression in the adult hippocampus. Contextual fear learning induced differential regulation of exon-specific bdnf mRNAs (I, IV, VI, IX) that was associated with changes in bdnf DNA methylation and altered local chromatin structure. Infusions of zebularine (a DNA methyltransferase inhibitor) significantly altered bdnf DNA methylation and triggered changes in exon-specific bdnf mRNA levels, indicating that altered DNA methylation is sufficient to drive differential bdnf transcript regulation in the hippocampus. In addition, NMDA receptor blockade prevented memory-associated alterations in bdnf DNA methylation, resulting in a block of altered bdnf gene expression in hippocampus and a deficit in memory formation. These results suggest epigenetic modification of the bdnf gene as a mechanism for isoform-specific gene readout during memory consolidation.

Identification of the two rotavirus genes determining neutralization specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Offit, P.A.; Blavat, G.

1986-01-01

Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities.

Therapeutic Gene Editing Safety and Specificity.

PubMed

Lux, Christopher T; Scharenberg, Andrew M

2017-10-01

Therapeutic gene editing is significant for medical advancement. Safety is intricately linked to the specificity of the editing tools used to cut at precise genomic targets. Improvements can be achieved by thoughtful design of nucleases and repair templates, analysis of off-target editing, and careful utilization of viral vectors. Advancements in DNA repair mechanisms and development of new generations of tools improve targeting of specific sequences while minimizing risks. It is important to plot a safe course for future clinical trials. This article reviews safety and specificity for therapeutic gene editing to spur dialogue and advancement. Copyright © 2017 Elsevier Inc. All rights reserved.

Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells

PubMed Central

Soucie, Erinn L.; Weng, Ziming; Geirsdóttir, Laufey; Molawi, Kaaweh; Maurizio, Julien; Fenouil, Romain; Mossadegh-Keller, Noushine; Gimenez, Gregory; VanHille, Laurent; Beniazza, Meryam; Favret, Jeremy; Berruyer, Carole; Perrin, Pierre; Hacohen, Nir; Andrau, J.-C.; Ferrier, Pierre; Dubreuil, Patrice; Sidow, Arend; Sieweke, Michael H.

2016-01-01

Differentiated macrophages can self-renew in tissues and expand long-term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network controlling self-renewal. Single cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down-regulation of Maf transcription factors. The network also controls embryonic stem cell self-renewal but is associated with distinct embryonic stem cell-specific enhancers. This indicates that distinct lineage-specific enhancer platforms regulate a shared network of genes that control self-renewal potential in both stem and mature cells. PMID:26797145

Development of sequence-specific antimicrobials based on programmable CRISPR-Cas nucleases

PubMed Central

Bikard, David; Euler, Chad; Jiang, Wenyan; Nussenzweig, Philip M.; Goldberg, Gregory W.; Duportet, Xavier; Fischetti, Vincent A.; Marraffini, Luciano A.

2014-01-01

Antibiotics target conserved bacterial cellular pathways or growth functions and therefore cannot selectively kill specific members of a complex microbial population. Here, we develop programmable, sequence-specific antimicrobials using the RNA-guided nuclease Cas91, 2 delivered by a bacteriophage. We show that Cas9 re-programmed to target virulence genes kills virulent, but not avirulent, Staphylococcus aureus. Re-programming the nuclease to target antibiotic resistance genes destroys staphylococcal plasmids that harbor antibiotic resistance genes3, 4 and immunizes avirulent staphylococci to prevent the spread of plasmid-borne resistance genes. We also demonstrate the approach in vivo, showing its efficacy against S. aureus in a mouse skin colonization model. This new technology creates opportunities to manipulate complex bacterial populations in a sequence-specific manner. PMID:25282355

Specific genetic modifications of domestic animals by gene targeting and animal cloning

PubMed Central

Wang, Bin; Zhou, Jiangfeng

2003-01-01

The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined. PMID:14614774

Positive Selection Linked with Generation of Novel Mammalian Dentition Patterns.

PubMed

Machado, João Paulo; Philip, Siby; Maldonado, Emanuel; O'Brien, Stephen J; Johnson, Warren E; Antunes, Agostinho

2016-09-11

A diverse group of genes are involved in the tooth development of mammals. Several studies, focused mainly on mice and rats, have provided a detailed depiction of the processes coordinating tooth formation and shape. Here we surveyed 236 tooth-associated genes in 39 mammalian genomes and tested for signatures of selection to assess patterns of molecular adaptation in genes regulating mammalian dentition. Of the 236 genes, 31 (∼13.1%) showed strong signatures of positive selection that may be responsible for the phenotypic diversity observed in mammalian dentition. Mammalian-specific tooth-associated genes had accelerated mutation rates compared with older genes found across all vertebrates. More recently evolved genes had fewer interactions (either genetic or physical), were associated with fewer Gene Ontology terms and had faster evolutionary rates compared with older genes. The introns of these positively selected genes also exhibited accelerated evolutionary rates, which may reflect additional adaptive pressure in the intronic regions that are associated with regulatory processes that influence tooth-gene networks. The positively selected genes were mainly involved in processes like mineralization and structural organization of tooth specific tissues such as enamel and dentin. Of the 236 analyzed genes, 12 mammalian-specific genes (younger genes) provided insights on diversification of mammalian teeth as they have higher evolutionary rates and exhibit different expression profiles compared with older genes. Our results suggest that the evolution and development of mammalian dentition occurred in part through positive selection acting on genes that previously had other functions. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Epigenetic events underlie the pathogenesis of sinonasal papillomas.

PubMed

Stephen, Josena K; Vaught, Lori E; Chen, Kang M; Sethi, Seema; Shah, Veena; Benninger, Michael S; Gardner, Glendon M; Schweitzer, Vanessa G; Khan, Mumtaz; Worsham, Maria J

2007-10-01

Benign inverted papillomas have been reported as monoclonal but lacking common genetic alterations identified in squamous cell carcinoma of the head and neck. Epigenetic changes alter the heritable state of gene expression and chromatin organization without change in DNA sequence. We investigated whether epigenetic events of aberrant promoter hypermethylation in genes known to be involved in squamous head and neck cancer underlie the pathogenesis of sinonasal papillomas. Ten formalin-fixed paraffin DNA samples from three inverted papilloma cases, two exophytic (everted) papilloma cases, and two cases with inverted and exophytic components were studied. DNA was obtained from microdissected areas of normal and papilloma areas and examined using a panel of 41 gene probes, designed to interrogate 35 unique genes for aberrant methylation status (22 genes) using the methylation-specific multiplex-ligation-specific polymerase assay. Methylation-specific PCR was employed to confirm aberrant methylation detected by the methylation-specific multiplex-ligation-specific polymerase assay. All seven cases indicated at least one epigenetic event of aberrant promoter hypermethylation. The CDKN2B gene was a consistent target of aberrant methylation in six of seven cases. Methylation-specific PCR confirmed hypermethylation of CDKN2B. Recurrent biopsies from two inverted papilloma cases had common epigenetic events. Promoter hypermethylation of CDKN2B was a consistent epigenetic event. Common epigenetic alterations in recurrent biopsies underscore a monoclonal origin for these lesions. Epigenetic events contribute to the underlying pathogenesis of benign inverted and exophytic papillomas. As a consistent target of aberrant promoter hypermethylation, CDKN2B may serve as an important epigenetic biomarker for gene reactivation studies.

Gene expression profiling of rat spermatogonia and Sertoli cells reveals signaling pathways from stem cells to niche and testicular cancer cells to surrounding stroma

PubMed Central

2011-01-01

Background Stem cells and their niches are studied in many systems, but mammalian germ stem cells (GSC) and their niches are still poorly understood. In rat testis, spermatogonia and undifferentiated Sertoli cells proliferate before puberty, but at puberty most spermatogonia enter spermatogenesis, and Sertoli cells differentiate to support this program. Thus, pre-pubertal spermatogonia might possess GSC potential and pre-pubertal Sertoli cells niche functions. We hypothesized that the different stem cell pools at pre-puberty and maturity provide a model for the identification of stem cell and niche-specific genes. We compared the transcript profiles of spermatogonia and Sertoli cells from pre-pubertal and pubertal rats and examined how these related to genes expressed in testicular cancers, which might originate from inappropriate communication between GSCs and Sertoli cells. Results The pre-pubertal spermatogonia-specific gene set comprised known stem cell and spermatogonial stem cell (SSC) markers. Similarly, the pre-pubertal Sertoli cell-specific gene set comprised known niche gene transcripts. A large fraction of these specifically enriched transcripts encoded trans-membrane, extra-cellular, and secreted proteins highlighting stem cell to niche communication. Comparing selective gene sets established in this study with published gene expression data of testicular cancers and their stroma, we identified sets expressed genes shared between testicular tumors and pre-pubertal spermatogonia, and tumor stroma and pre-pubertal Sertoli cells with statistic significance. Conclusions Our data suggest that SSC and their niche specifically express complementary factors for cell communication and that the same factors might be implicated in the communication between tumor cells and their micro-enviroment in testicular cancer. PMID:21232125

Microarray-based analysis of gene expression in lycopersicon esculentum seedling roots in response to cadmium, chromium, mercury, and lead.

PubMed

Hou, Jing; Liu, Xinhui; Wang, Juan; Zhao, Shengnan; Cui, Baoshan

2015-02-03

The effects of heavy metals in agricultural soils have received special attention due to their potential for accumulation in crops, which can affect species at all trophic levels. Therefore, there is a critical need for reliable bioassays for assessing risk levels due to heavy metals in agricultural soil. In the present study, we used microarrays to investigate changes in gene expression of Lycopersicon esculentum in response to Cd-, Cr-, Hg-, or Pb-spiked soil. Exposure to (1)/10 median lethal concentrations (LC50) of Cd, Cr, Hg, or Pb for 7 days resulted in expression changes in 29 Cd-specific, 58 Cr-specific, 192 Hg-specific and 864 Pb-specific genes as determined by microarray analysis, whereas conventional morphological and physiological bioassays did not reveal any toxicant stresses. Hierarchical clustering analysis showed that the characteristic gene expression profiles induced by Cd, Cr, Hg, and Pb were distinct from not only the control but also one another. Furthermore, a total of three genes related to "ion transport" for Cd, 14 genes related to "external encapsulating structure organization", "reproductive developmental process", "lipid metabolic process" and "response to stimulus" for Cr, 11 genes related to "cellular metabolic process" and "cellular response to stimulus" for Hg, 78 genes related to 20 biological processes (e.g., DNA metabolic process, monosaccharide catabolic process, cell division) for Pb were identified and selected as their potential biomarkers. These findings demonstrated that microarray-based analysis of Lycopersicon esculentum was a sensitive tool for the early detection of potential toxicity of heavy metals in agricultural soil, as well as an effective tool for identifying the heavy metal-specific genes, which should be useful for assessing risk levels due to heavy metals in agricultural soil.

Mammalian-specific genomic functions: Newly acquired traits generated by genomic imprinting and LTR retrotransposon-derived genes in mammals

PubMed Central

KANEKO-ISHINO, Tomoko; ISHINO, Fumitoshi

2015-01-01

Mammals, including human beings, have evolved a unique viviparous reproductive system and a highly developed central nervous system. How did these unique characteristics emerge in mammalian evolution, and what kinds of changes did occur in the mammalian genomes as evolution proceeded? A key conceptual term in approaching these issues is “mammalian-specific genomic functions”, a concept covering both mammalian-specific epigenetics and genetics. Genomic imprinting and LTR retrotransposon-derived genes are reviewed as the representative, mammalian-specific genomic functions that are essential not only for the current mammalian developmental system, but also mammalian evolution itself. First, the essential roles of genomic imprinting in mammalian development, especially related to viviparous reproduction via placental function, as well as the emergence of genomic imprinting in mammalian evolution, are discussed. Second, we introduce the novel concept of “mammalian-specific traits generated by mammalian-specific genes from LTR retrotransposons”, based on the finding that LTR retrotransposons served as a critical driving force in the mammalian evolution via generating mammalian-specific genes. PMID:26666304

Mammalian-specific genomic functions: Newly acquired traits generated by genomic imprinting and LTR retrotransposon-derived genes in mammals.

PubMed

Kaneko-Ishino, Tomoko; Ishino, Fumitoshi

2015-01-01

Mammals, including human beings, have evolved a unique viviparous reproductive system and a highly developed central nervous system. How did these unique characteristics emerge in mammalian evolution, and what kinds of changes did occur in the mammalian genomes as evolution proceeded? A key conceptual term in approaching these issues is "mammalian-specific genomic functions", a concept covering both mammalian-specific epigenetics and genetics. Genomic imprinting and LTR retrotransposon-derived genes are reviewed as the representative, mammalian-specific genomic functions that are essential not only for the current mammalian developmental system, but also mammalian evolution itself. First, the essential roles of genomic imprinting in mammalian development, especially related to viviparous reproduction via placental function, as well as the emergence of genomic imprinting in mammalian evolution, are discussed. Second, we introduce the novel concept of "mammalian-specific traits generated by mammalian-specific genes from LTR retrotransposons", based on the finding that LTR retrotransposons served as a critical driving force in the mammalian evolution via generating mammalian-specific genes.

Human active X-specific DNA methylation events showing stability across time and tissues

PubMed Central

Joo, Jihoon Eric; Novakovic, Boris; Cruickshank, Mark; Doyle, Lex W; Craig, Jeffrey M; Saffery, Richard

2014-01-01

The phenomenon of X chromosome inactivation in female mammals is well characterised and remains the archetypal example of dosage compensation via monoallelic expression. The temporal series of events that culminates in inactive X-specific gene silencing by DNA methylation has revealed a ‘patchwork' of gene inactivation along the chromosome, with approximately 15% of genes escaping. Such genes are therefore potentially subject to sex-specific imbalance between males and females. Aside from XIST, the non-coding RNA on the X chromosome destined to be inactivated, very little is known about the extent of loci that may be selectively silenced on the active X chromosome (Xa). Using longitudinal array-based DNA methylation profiling of two human tissues, we have identified specific and widespread active X-specific DNA methylation showing stability over time and across tissues of disparate origin. Our panel of X-chromosome loci subject to methylation on Xa reflects a potentially novel mechanism for controlling female-specific X inactivation and sex-specific dimorphisms in humans. Further work is needed to investigate these phenomena. PMID:24713664

Enhancer connectome in primary human cells identifies target genes of disease-associated DNA elements

PubMed Central

Mumbach, Maxwell R; Satpathy, Ansuman T; Boyle, Evan A; Dai, Chao; Gowen, Benjamin G; Cho, Seung Woo; Nguyen, Michelle L; Rubin, Adam J; Granja, Jeffrey M; Kazane, Katelynn R; Wei, Yuning; Nguyen, Trieu; Greenside, Peyton G; Corces, M Ryan; Tycko, Josh; Simeonov, Dimitre R; Suliman, Nabeela; Li, Rui; Xu, Jin; Flynn, Ryan A; Kundaje, Anshul; Khavari, Paul A; Marson, Alexander; Corn, Jacob E; Quertermous, Thomas; Greenleaf, William J; Chang, Howard Y

2018-01-01

The challenge of linking intergenic mutations to target genes has limited molecular understanding of human diseases. Here we show that H3K27ac HiChIP generates high-resolution contact maps of active enhancers and target genes in rare primary human T cell subtypes and coronary artery smooth muscle cells. Differentiation of naive T cells into T helper 17 cells or regulatory T cells creates subtype-specific enhancer–promoter interactions, specifically at regions of shared DNA accessibility. These data provide a principled means of assigning molecular functions to autoimmune and cardiovascular disease risk variants, linking hundreds of noncoding variants to putative gene targets. Target genes identified with HiChIP are further supported by CRISPR interference and activation at linked enhancers, by the presence of expression quantitative trait loci, and by allele-specific enhancer loops in patient-derived primary cells. The majority of disease-associated enhancers contact genes beyond the nearest gene in the linear genome, leading to a fourfold increase in the number of potential target genes for autoimmune and cardiovascular diseases. PMID:28945252

Differential gene expression in HIV/SIV-associated and spontaneous lymphomas

PubMed Central

2005-01-01

Diffuse large B-cell lymphoma (DLBCL) is more prevalent and more often fatal in HIV-infected patients and SIV-infected monkeys compared to immune-competent individuals. Molecular, biological, and immunological data indicate that virus-associated lymphomagenesis is similar in both infected hosts. To find genes specifically overexpressed in HIV/SIV-associated and non-HIV/SIV-associated DLBCL we compared gene expression profiles of HIV/SIV-related and non-HIV-related lymphomas using subtractive hybridization and Northern blot analysis. Our experimental approach allowed us to detect two genes (a-myb and pub) upregulated solely in HIV/SIV-associated DLBCLs potentially involved in virus-specific lymphomagenesis in human and monkey. Downregulation of the pub gene was observed in all non-HIV-associated lymphomas investigated. In addition, we have found genes upregulated in both non-HIV- and HIV-associated lymphomas. Among those were genes both with known (set, ND4, SMG-1) and unknown functions. In summary, we have demonstrated that simultaneous transcriptional upregulation of at least two genes (a-myb and pub) was specific for AIDS-associated lymphomas. PMID:16239949

Gene Expression by Mouse Inner Ear Hair Cells during Development

PubMed Central

Scheffer, Déborah I.; Shen, Jun

2015-01-01

Hair cells of the inner ear are essential for hearing and balance. As a consequence, pathogenic variants in genes specifically expressed in hair cells often cause hereditary deafness. Hair cells are few in number and not easily isolated from the adjacent supporting cells, so the biochemistry and molecular biology of hair cells can be difficult to study. To study gene expression in hair cells, we developed a protocol for hair cell isolation by FACS. With nearly pure hair cells and surrounding cells, from cochlea and utricle and from E16 to P7, we performed a comprehensive cell type-specific RNA-Seq study of gene expression during mouse inner ear development. Expression profiling revealed new hair cell genes with distinct expression patterns: some are specific for vestibular hair cells, others for cochlear hair cells, and some are expressed just before or after maturation of mechanosensitivity. We found that many of the known hereditary deafness genes are much more highly expressed in hair cells than surrounding cells, suggesting that genes preferentially expressed in hair cells are good candidates for unknown deafness genes. PMID:25904789

[Analysis of tissue-specific differentially methylated genes with differential gene expression in non-small cell lung cancer].

PubMed

Yin, L G; Zou, Z Q; Zhao, H Y; Zhang, C L; Shen, J G; Qi, L; Qi, M; Xue, Z Q

2014-01-01

Adenocarcinoma (ADC) and squamous cell carcinomas (SCC) are two subtypes of non-small cell lung carcinomas which are regarded as the leading cause of cancer-related malignancy worldwide. The aim of this study is to detect the differentially methylated loci (DMLs) and differentially methylated genes (DMGs) of these two tumor sets, and then to illustrate the different expression level of specific methylated genes. Using TCGA database and Illumina HumanMethylation 27 arrays, we first screened the DMGs and DMLs in tumor samples. Then, we explored the BiologicalProcess terms of hypermethylated and hypomethylated genes using Functional Gene Ontology (GO) catalogues. Hypermethylation intensively occurred in CpG-island, whereas hypomethylation was located in non-CpG-island. Most SCC and ADC hypermethylated genes involved GO function of DNA dependenit regulation of transcription, and hypomethylated genes mainly 'enriched in the term of immune responses. Additionally, the expression level of specific differentially methylated genesis distinctbetween ADC and SCC. It is concluded that ADC and SCC have different methylated status that might play an important role in carcinogenesis.

Applicability of the chymopapain gene used as endogenous reference gene for transgenic huanong no. 1 papaya detection.

PubMed

Guo, Jinchao; Yang, Litao; Liu, Xin; Zhang, Haibo; Qian, Bingjun; Zhang, Dabing

2009-08-12

The virus-resistant papaya (Carica papaya L.), Huanong no. 1, was the genetically modified (GM) fruit approved for growing in China in 2006. To implement the labeling regulation of GM papaya and its derivates, the development of papaya endogenous reference gene is very necessary for GM papaya detection. Herein, we reported one papaya specific gene, Chymopapain (CHY), as one suitable endogenous reference gene, used for GM papaya identification. Thereafter, we established the conventional and real-time quantitative PCR assays of the CHY gene. In the CHY conventional PCR assay, the limit of detection (LOD) was 25 copies of haploid papaya genome. In the CHY real-time quantitative PCR assay, both the LOD and the limit of quantification (LOQ) were as low as 12.5 copies of haploid papaya genome. Furthermore, we revealed the construct-specific sequence of Chinese GM papaya Huanong no. 1 and developed its conventional and quantitative PCR systems employing the CHY gene as endogenous reference gene. This work is useful for papaya specific identification and GM papaya detection.

Efficient disruption of Zebrafish genes using a Gal4-containing gene trap

PubMed Central

2013-01-01

Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702

Tissue-specific NETs alter genome organization and regulation even in a heterologous system.

PubMed

de Las Heras, Jose I; Zuleger, Nikolaj; Batrakou, Dzmitry G; Czapiewski, Rafal; Kerr, Alastair R W; Schirmer, Eric C

2017-01-02

Different cell types exhibit distinct patterns of 3D genome organization that correlate with changes in gene expression in tissue and differentiation systems. Several tissue-specific nuclear envelope transmembrane proteins (NETs) have been found to influence the spatial positioning of genes and chromosomes that normally occurs during tissue differentiation. Here we study 3 such NETs: NET29, NET39, and NET47, which are expressed preferentially in fat, muscle and liver, respectively. We found that even when exogenously expressed in a heterologous system they can specify particular genome organization patterns and alter gene expression. Each NET affected largely different subsets of genes. Notably, the liver-specific NET47 upregulated many genes in HT1080 fibroblast cells that are normally upregulated in hepatogenesis, showing that tissue-specific NETs can favor expression patterns associated with the tissue where the NET is normally expressed. Similarly, global profiling of peripheral chromatin after exogenous expression of these NETs using lamin B1 DamID revealed that each NET affected the nuclear positioning of distinct sets of genomic regions with a significant tissue-specific component. Thus NET influences on genome organization can contribute to gene expression changes associated with differentiation even in the absence of other factors and overt cellular differentiation changes.

Generation of TALE-Based Designer Epigenome Modifiers.

PubMed

Nitsch, Sandra; Mussolino, Claudio

2018-01-01

Manipulation of gene expression can be facilitated by editing the genome or the epigenome. Precise genome editing is traditionally achieved by using designer nucleases which are generally exploited to eliminate a specific gene product. Upon the introduction of a site-specific DNA double-strand break (DSB) by the nuclease, endogenous DSB repair mechanisms are in turn harnessed to induce DNA sequence changes that can result in target gene inactivation. Minimal off-target effects can be obtained by endowing designer nucleases with the highly specific DNA-binding domain (DBD) derived from transcription activator-like effectors (TALEs). In contrast, epigenome editing allows gene expression control without inducing changes in the DNA sequence by specifically altering epigenetic marks, as histone tails modifications or DNA methylation patterns within promoter or enhancer regions. Importantly, this approach allows both up- and downregulation of the target gene expression, and the effect is generally reversible. TALE-based designer epigenome modifiers combine the high specificity of TALE-derived DBDs with the power of epigenetic modifier domains to induce fast and long-lasting changes in the epigenetic landscape of a target gene and control its expression. Here we provide a detailed description for the generation of TALE-based designer epigenome modifiers and of a suitable reporter cell line to easily monitor their activity.

Specific gene delivery to liver sinusoidal and artery endothelial cells.

PubMed

Abel, Tobias; El Filali, Ebtisam; Waern, Johan; Schneider, Irene C; Yuan, Qinggong; Münch, Robert C; Hick, Meike; Warnecke, Gregor; Madrahimov, Nodir; Kontermann, Roland E; Schüttrumpf, Jörg; Müller, Ulrike C; Seppen, Jurgen; Ott, Michael; Buchholz, Christian J

2013-09-19

Different types of endothelial cells (EC) fulfill distinct tasks depending on their microenvironment. ECs are therefore difficult to genetically manipulate ex vivo for functional studies or gene therapy. We assessed lentiviral vectors (LVs) targeted to the EC surface marker CD105 for in vivo gene delivery. The mouse CD105-specific vector, mCD105-LV, transduced only CD105-positive cells in primary liver cell cultures. Upon systemic injection, strong reporter gene expression was detected in liver where mCD105-LV specifically transduced liver sinusoidal ECs (LSECs) but not Kupffer cells, which were mainly transduced by nontargeted LVs. Tumor ECs were specifically targeted upon intratumoral vector injection. Delivery of the erythropoietin gene with mCD105-LV resulted in substantially increased erythropoietin and hematocrit levels. The human CD105-specific vector (huCD105-LV) transduced exclusively human LSECs in mice transplanted with human liver ECs. Interestingly, when applied at higher dose and in absence of target cells in the liver, huCD105-LV transduced ECs of a human artery transplanted into the descending mouse aorta. The data demonstrate for the first time targeted gene delivery to specialized ECs upon systemic vector administration. This strategy offers novel options to better understand the physiological functions of ECs and to treat genetic diseases such as those affecting blood factors.

Diversity of human copy number variation and multicopy genes.

PubMed

Sudmant, Peter H; Kitzman, Jacob O; Antonacci, Francesca; Alkan, Can; Malig, Maika; Tsalenko, Anya; Sampas, Nick; Bruhn, Laurakay; Shendure, Jay; Eichler, Evan E

2010-10-29

Copy number variants affect both disease and normal phenotypic variation, but those lying within heavily duplicated, highly identical sequence have been difficult to assay. By analyzing short-read mapping depth for 159 human genomes, we demonstrated accurate estimation of absolute copy number for duplications as small as 1.9 kilobase pairs, ranging from 0 to 48 copies. We identified 4.1 million "singly unique nucleotide" positions informative in distinguishing specific copies and used them to genotype the copy and content of specific paralogs within highly duplicated gene families. These data identify human-specific expansions in genes associated with brain development, reveal extensive population genetic diversity, and detect signatures consistent with gene conversion in the human species. Our approach makes ~1000 genes accessible to genetic studies of disease association.

[Design of primers to DNA of lactic acid bacteria].

PubMed

Lashchevskiĭ, V V; Kovalenko, N K

2003-01-01

Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

Combination Antiangiogenic and Immunomodulatory Gene Therapy for Breast Cancer

DTIC Science & Technology

2002-06-01

Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a positive control. The samples were run on a...cultured cells and specific primers for Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a...positive control. Arrows indicate the 500 bp, 410 bp and 109 bp amplified products of Flk-1, endoglin and G3PDH , respectively. Fig 3. Viral replication

Integrating Molecular Imaging Approaches to Monitor Prostate Targeted Suicide and Anti-angiogenic Gene Therapy

DTIC Science & Technology

2005-02-01

tissue-specific expression of prostate-specific antigen. Cancer Res. 57: 495–499. 11. Schuur, E. R ., Henderson, G . A., Kmetec, L. A., Miller, J. D...Lamparski, H. G ., and Henderson, D. R . (1996). Prostate-specific antigen expression is regulated by an up- stream enhancer. J. Biol. Chem. 271: 7043...5: 223–232. 29. Blasberg, R . G ., and Tjuvajev, J. G . (1999). Herpes simplex virus thymidine kinase as a marker/reporter gene for PET imaging of gene

The in Vitro Antigenicity of Plasmodium vivax Rhoptry Neck Protein 2 (PvRON2) B- and T-Epitopes Selected by HLA-DRB1 Binding Profile

PubMed Central

López, Carolina; Yepes-Pérez, Yoelis; Díaz-Arévalo, Diana; Patarroyo, Manuel E.; Patarroyo, Manuel A.

2018-01-01

Malaria caused by Plasmodium vivax is a neglected disease which is responsible for the highest morbidity in both Americas and Asia. Despite continuous public health efforts to prevent malarial infection, an effective antimalarial vaccine is still urgently needed. P. vivax vaccine development involves analyzing naturally-infected patients' immune response to the specific proteins involved in red blood cell invasion. The P. vivax rhoptry neck protein 2 (PvRON2) is a highly conserved protein which is expressed in late schizont rhoptries; it interacts directly with AMA-1 and might be involved in moving-junction formation. Bioinformatics approaches were used here to select B- and T-cell epitopes. Eleven high-affinity binding peptides were selected using the NetMHCIIpan-3.0 in silico prediction tool; their in vitro binding to HLA-DRB1*0401, HLA-DRB1*0701, HLA-DRB1*1101 or HLA-DRB1*1302 was experimentally assessed. Four peptides (39152 (HLA-DRB1*04 and 11), 39047 (HLA-DRB1*07), 39154 (HLADRB1*13) and universal peptide 39153) evoked a naturally-acquired T-cell immune response in P. vivax-exposed individuals from two endemic areas in Colombia. All four peptides had an SI greater than 2 in proliferation assays; however, only peptides 39154 and 39153 had significant differences compared to the control group. Peptide 39047 was able to significantly stimulate TNF and IL-10 production while 39154 stimulated TNF production. Allele-specific peptides (but not the universal one) were able to stimulate IL-6 production; however, none induced IFN-γ production. The Bepipred 1.0 tool was used for selecting four B-cell epitopes in silico regarding humoral response. Peptide 39041 was the only one recognized by P. vivax-exposed individuals' sera and had significant differences concerning IgG subclasses; an IgG2 > IgG4 profile was observed for this peptide, agreeing with a protection-inducing role against P. falciparum and P. vivax as previously described for antigens such as RESA and MSP2. The bioinformatics results and in vitro evaluation reported here highlighted two T-cell epitopes (39047 and 39154) being recognized by memory cells and a B-cell epitope (39041) identified by P. vivax-exposed individuals' sera which could be used as potential candidates when designing a subunit-based vaccine. PMID:29868512

The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes.

PubMed

Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques

2011-02-01

The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they display a different cellular localization compared to that of the gsdf gene indicating that the later gene is not co-regulated. Interestingly, our study identifies new clustered genes that are specifically expressed in previtellogenic oocytes (nup54, aff1, klhl8, sdad1). Copyright © 2010 Elsevier B.V. All rights reserved.

Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data.

PubMed

Hettne, Kristina M; Boorsma, André; van Dartel, Dorien A M; Goeman, Jelle J; de Jong, Esther; Piersma, Aldert H; Stierum, Rob H; Kleinjans, Jos C; Kors, Jan A

2013-01-29

Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values < 0.05) of the next-gen TM-derived gene sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.

Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

PubMed Central

2013-01-01

Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values < 0.05) of the next-gen TM-derived gene sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect. PMID:23356878

Inference of cancer-specific gene regulatory networks using soft computing rules.

PubMed

Wang, Xiaosheng; Gotoh, Osamu

2010-03-24

Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

Multifunctionality and diversity of GDSL esterase/lipase gene family in rice (Oryza sativa L. japonica) genome: new insights from bioinformatics analysis

PubMed Central

2012-01-01

Background GDSL esterases/lipases are a newly discovered subclass of lipolytic enzymes that are very important and attractive research subjects because of their multifunctional properties, such as broad substrate specificity and regiospecificity. Compared with the current knowledge regarding these enzymes in bacteria, our understanding of the plant GDSL enzymes is very limited, although the GDSL gene family in plant species include numerous members in many fully sequenced plant genomes. Only two genes from a large rice GDSL esterase/lipase gene family were previously characterised, and the majority of the members remain unknown. In the present study, we describe the rice OsGELP (Oryza sativa GDSL esterase/lipase protein) gene family at the genomic and proteomic levels, and use this knowledge to provide insights into the multifunctionality of the rice OsGELP enzymes. Results In this study, an extensive bioinformatics analysis identified 114 genes in the rice OsGELP gene family. A complete overview of this family in rice is presented, including the chromosome locations, gene structures, phylogeny, and protein motifs. Among the OsGELPs and the plant GDSL esterase/lipase proteins of known functions, 41 motifs were found that represent the core secondary structure elements or appear specifically in different phylogenetic subclades. The specification and distribution of identified putative conserved clade-common and -specific peptide motifs, and their location on the predicted protein three dimensional structure may possibly signify their functional roles. Potentially important regions for substrate specificity are highlighted, in accordance with protein three-dimensional model and location of the phylogenetic specific conserved motifs. The differential expression of some representative genes were confirmed by quantitative real-time PCR. The phylogenetic analysis, together with protein motif architectures, and the expression profiling were analysed to predict the possible biological functions of the rice OsGELP genes. Conclusions Our current genomic analysis, for the first time, presents fundamental information on the organization of the rice OsGELP gene family. With combination of the genomic, phylogenetic, microarray expression, protein motif distribution, and protein structure analyses, we were able to create supported basis for the functional prediction of many members in the rice GDSL esterase/lipase family. The present study provides a platform for the selection of candidate genes for further detailed functional study. PMID:22793791

Using the TIGR gene index databases for biological discovery.

PubMed

Lee, Yuandan; Quackenbush, John

2003-11-01

The TIGR Gene Index web pages provide access to analyses of ESTs and gene sequences for nearly 60 species, as well as a number of resources derived from these. Each species-specific database is presented using a common format with a homepage. A variety of methods exist that allow users to search each species-specific database. Methods implemented currently include nucleotide or protein sequence queries using WU-BLAST, text-based searches using various sequence identifiers, searches by gene, tissue and library name, and searches using functional classes through Gene Ontology assignments. This protocol provides guidance for using the Gene Index Databases to extract information.

Correct Hox gene expression established independently of position in Caenorhabditis elegans.

PubMed

Cowing, D; Kenyon, C

1996-07-25

The Hox genes are expressed in a conserved sequence of spatial domains along the anteroposterior (A/P) body axes of many organisms. In Drosophila, position-specific signals located along the A/P axis establish the pattern of Hox gene expression. In the nematode Caenorhabditis elegans, it is not known how the pattern of Hox gene expression is established. C. elegans uses lineal control mechanisms and local cell interactions to specify early blastomere identities. However, many cells expressing the same Hox gene are unrelated by lineage, suggesting that, as in Drosophila, domains of Hox gene expression may be defined by cell-extrinsic A/P positional signals. To test this, we have investigated whether posterior mesodermal and ectodermal cells will express their normal posterior Hox gene when they are mispositioned in the anterior. Surprisingly, we find that correct Hox gene expression does not depend on cell position, but is highly correlated with cell lineage. Thus, although the most striking feature of Hox gene expression is its positional specificity, in C. elegans the pattern is achieved, at least in part, by a lineage-specific control system that operates without regard to A/P position.

IDP-ASE: haplotyping and quantifying allele-specific expression at the gene and gene isoform level by hybrid sequencing

PubMed Central

Deonovic, Benjamin; Wang, Yunhao; Weirather, Jason; Wang, Xiu-Jie; Au, Kin Fai

2017-01-01

Abstract Allele-specific expression (ASE) is a fundamental problem in studying gene regulation and diploid transcriptome profiles, with two key challenges: (i) haplotyping and (ii) estimation of ASE at the gene isoform level. Existing ASE analysis methods are limited by a dependence on haplotyping from laborious experiments or extra genome/family trio data. In addition, there is a lack of methods for gene isoform level ASE analysis. We developed a tool, IDP-ASE, for full ASE analysis. By innovative integration of Third Generation Sequencing (TGS) long reads with Second Generation Sequencing (SGS) short reads, the accuracy of haplotyping and ASE quantification at the gene and gene isoform level was greatly improved as demonstrated by the gold standard data GM12878 data and semi-simulation data. In addition to methodology development, applications of IDP-ASE to human embryonic stem cells and breast cancer cells indicate that the imbalance of ASE and non-uniformity of gene isoform ASE is widespread, including tumorigenesis relevant genes and pluripotency markers. These results show that gene isoform expression and allele-specific expression cooperate to provide high diversity and complexity of gene regulation and expression, highlighting the importance of studying ASE at the gene isoform level. Our study provides a robust bioinformatics solution to understand ASE using RNA sequencing data only. PMID:27899656

Accelerated recruitment of new brain development genes into the human genome.

PubMed

Zhang, Yong E; Landback, Patrick; Vibranovski, Maria D; Long, Manyuan

2011-10-01

How the human brain evolved has attracted tremendous interests for decades. Motivated by case studies of primate-specific genes implicated in brain function, we examined whether or not the young genes, those emerging genome-wide in the lineages specific to the primates or rodents, showed distinct spatial and temporal patterns of transcription compared to old genes, which had existed before primate and rodent split. We found consistent patterns across different sources of expression data: there is a significantly larger proportion of young genes expressed in the fetal or infant brain of humans than in mouse, and more young genes in humans have expression biased toward early developing brains than old genes. Most of these young genes are expressed in the evolutionarily newest part of human brain, the neocortex. Remarkably, we also identified a number of human-specific genes which are expressed in the prefrontal cortex, which is implicated in complex cognitive behaviors. The young genes upregulated in the early developing human brain play diverse functional roles, with a significant enrichment of transcription factors. Genes originating from different mechanisms show a similar expression bias in the developing brain. Moreover, we found that the young genes upregulated in early brain development showed rapid protein evolution compared to old genes also expressed in the fetal brain. Strikingly, genes expressed in the neocortex arose soon after its morphological origin. These four lines of evidence suggest that positive selection for brain function may have contributed to the origination of young genes expressed in the developing brain. These data demonstrate a striking recruitment of new genes into the early development of the human brain.

Genome organization and characteristics of soybean microRNAs

PubMed Central

2012-01-01

Background microRNAs (miRNAs) are key regulators of gene expression and play important roles in many aspects of plant biology. The role(s) of miRNAs in nitrogen-fixing root nodules of leguminous plants such as soybean is not well understood. We examined a library of small RNAs from Bradyrhizobium japonicum-inoculated soybean roots and identified novel miRNAs. In order to enhance our understanding of miRNA evolution, diversification and function, we classified all known soybean miRNAs based on their phylogenetic conservation (conserved, legume- and soybean-specific miRNAs) and examined their genome organization, family characteristics and target diversity. We predicted targets of these miRNAs and experimentally validated several of them. We also examined organ-specific expression of selected miRNAs and their targets. Results We identified 120 previously unknown miRNA genes from soybean including 5 novel miRNA families. In the soybean genome, genes encoding miRNAs are primarily intergenic and a small percentage were intragenic or less than 1000 bp from a protein-coding gene, suggesting potential co-regulation between the miRNA and its parent gene. Difference in number and orientation of tandemly duplicated miRNA genes between orthologous genomic loci indicated continuous evolution and diversification. Conserved miRNA families are often larger in size and produce less diverse mature miRNAs than legume- and soybean-specific families. In addition, the majority of conserved and legume-specific miRNA families produce 21 nt long mature miRNAs with distinct nucleotide distribution and regulate a more conserved set of target mRNAs compared to soybean-specific families. A set of nodule-specific target mRNAs and their cognate regulatory miRNAs had inverse expression between root and nodule tissues suggesting that spatial restriction of target gene transcripts by miRNAs might govern nodule-specific gene expression in soybean. Conclusions Genome organization of soybean miRNAs suggests that they are actively evolving. Distinct family characteristics of soybean miRNAs suggest continuous diversification of function. Inverse organ-specific expression between selected miRNAs and their targets in the roots and nodules, suggested a potential role for these miRNAs in regulating nodule development. PMID:22559273

The Role of Multiple Transcription Factors In Archaeal Gene Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Charles J. Daniels

2008-09-23

Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcaniimore » was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of specific tfb genes and the regulation of nitrogen metabolism and other global cellular responses.« less

The use of cell microinjection for the in vivo analysis of viral transcriptional regulatory protein domains.

PubMed

Green, Maurice; Thorburn, Andrew; Kern, Robert; Loewenstein, Paul M

2007-01-01

Microinjection of mammalian cells provides a powerful method for analyzing in vivo functions of viral genes and viral gene products. By microinjection, a controlled amount (ranging from several to many thousands of copies) of a viral or cellular gene, a protein product of a gene, a polypeptide fragment encoding a specific protein domain, or an RNA molecule can be delivered into a target cell and the functional consequences analyzed. Microinjection can be used to deliver antibody targeted to a specific protein domain in order to analyze the requirement of the protein for specific cell functions such as cell cycle progression, transcription of specific genes, or intracellular transport. This chapter describes examples of the successful use of microinjection to probe adenovirus E1A regulatory mechanisms. Detailed methods are provided for manual and semiautomatic microinjection of mammalian cells as well as bioassay protocols for microinjected cells including immunofluorescence, colorimetic, in situ hybridization, and autoradiography.

Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy

PubMed Central

Bengtsson, Niclas E.; Hall, John K.; Odom, Guy L.; Phelps, Michael P.; Andrus, Colin R.; Hawkins, R. David; Hauschka, Stephen D.; Chamberlain, Joel R.; Chamberlain, Jeffrey S.

2017-01-01

Gene replacement therapies utilizing adeno-associated viral (AAV) vectors hold great promise for treating Duchenne muscular dystrophy (DMD). A related approach uses AAV vectors to edit specific regions of the DMD gene using CRISPR/Cas9. Here we develop multiple approaches for editing the mutation in dystrophic mdx4cv mice using single and dual AAV vector delivery of a muscle-specific Cas9 cassette together with single-guide RNA cassettes and, in one approach, a dystrophin homology region to fully correct the mutation. Muscle-restricted Cas9 expression enables direct editing of the mutation, multi-exon deletion or complete gene correction via homologous recombination in myogenic cells. Treated muscles express dystrophin in up to 70% of the myogenic area and increased force generation following intramuscular delivery. Furthermore, systemic administration of the vectors results in widespread expression of dystrophin in both skeletal and cardiac muscles. Our results demonstrate that AAV-mediated muscle-specific gene editing has significant potential for therapy of neuromuscular disorders. PMID:28195574

High-throughput identification of antigen-specific TCRs by TCR gene capture.

PubMed

Linnemann, Carsten; Heemskerk, Bianca; Kvistborg, Pia; Kluin, Roelof J C; Bolotin, Dmitriy A; Chen, Xiaojing; Bresser, Kaspar; Nieuwland, Marja; Schotte, Remko; Michels, Samira; Gomez-Eerland, Raquel; Jahn, Lorenz; Hombrink, Pleun; Legrand, Nicolas; Shu, Chengyi Jenny; Mamedov, Ilgar Z; Velds, Arno; Blank, Christian U; Haanen, John B A G; Turchaninova, Maria A; Kerkhoven, Ron M; Spits, Hergen; Hadrup, Sine Reker; Heemskerk, Mirjam H M; Blankenstein, Thomas; Chudakov, Dmitriy M; Bendle, Gavin M; Schumacher, Ton N M

2013-11-01

The transfer of T cell receptor (TCR) genes into patient T cells is a promising approach for the treatment of both viral infections and cancer. Although efficient methods exist to identify antibodies for the treatment of these diseases, comparable strategies to identify TCRs have been lacking. We have developed a high-throughput DNA-based strategy to identify TCR sequences by the capture and sequencing of genomic DNA fragments encoding the TCR genes. We establish the value of this approach by assembling a large library of cancer germline tumor antigen-reactive TCRs. Furthermore, by exploiting the quantitative nature of TCR gene capture, we show the feasibility of identifying antigen-specific TCRs in oligoclonal T cell populations from either human material or TCR-humanized mice. Finally, we demonstrate the ability to identify tumor-reactive TCRs within intratumoral T cell subsets without knowledge of antigen specificities, which may be the first step toward the development of autologous TCR gene therapy to target patient-specific neoantigens in human cancer.

PlantGI: a database for searching gene indices in agricultural plants developed at NIAB, Korea

PubMed Central

Kim, Chang Kug; Choi, Ji Weon; Park, DongSuk; Kang, Man Jung; Seol, Young-Joo; Hyun, Do Yoon; Hahn, Jang Ho

2008-01-01

The Plant Gene Index (PlantGI) database is developed as a web-based search system with search capabilities for keywords to provide information on gene indices specifically for agricultural plants. The database contains specific Gene Index information for ten agricultural species, namely, rice, Chinese cabbage, wheat, maize, soybean, barley, mushroom, Arabidopsis, hot pepper and tomato. PlantGI differs from other Gene Index databases in being specific to agricultural plant species and thus complements services from similar other developments. The database includes options for interactive mining of EST CONTIGS and assembled EST data for user specific keyword queries. The current version of PlantGI contains a total of 34,000 EST CONTIGS data for rice (8488 records), wheat (8560 records), maize (4570 records), soybean (3726 records), barley (3417 records), Chinese cabbage (3602 records), tomato (1236 records), hot pepper (998 records), mushroom (130 records) and Arabidopsis (8 records). Availability The database is available for free at http://www.niab.go.kr/nabic/. PMID:18685722

Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation.

PubMed

Pazhamala, Lekha T; Purohit, Shilp; Saxena, Rachit K; Garg, Vanika; Krishnamurthy, L; Verdier, Jerome; Varshney, Rajeev K

2017-04-01

Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose-proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

PubMed Central

Martin, Elizabeth M.; Fry, Rebecca C.

2016-01-01

Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

Epigenetic determinants of ovarian clear cell carcinoma biology

PubMed Central

Yamaguchi, Ken; Huang, Zhiqing; Matsumura, Noriomi; Mandai, Masaki; Okamoto, Takako; Baba, Tsukasa; Konishi, Ikuo; Berchuck, Andrew; Murphy, Susan K.

2015-01-01

Targeted approaches have revealed frequent epigenetic alterations in ovarian cancer, but the scope and relation of these changes to histologic subtype of disease is unclear. Genome-wide methylation and expression data for 14 clear cell carcinoma (CCC), 32 non-CCC, and 4 corresponding normal cell lines were generated to determine how methylation profiles differ between cells of different histological derivations of ovarian cancer. Consensus clustering showed that CCC is epigenetically distinct. Inverse relationships between expression and methylation in CCC were identified, suggesting functional regulation by methylation, and included 22 hypomethylated (UM) genes and 276 hypermethylated (HM) genes. Categorical and pathway analyses indicated that the CCC-specific UM genes were involved in response to stress and many contain hepatocyte nuclear factor (HNF) 1 binding sites, while the CCC-specific HM genes included members of the estrogen receptor alpha (ERalpha) network and genes involved in tumor development. We independently validated the methylation status of 17 of these pathway-specific genes, and confirmed increased expression of HNF1 network genes and repression of ERalpha pathway genes in CCC cell lines and primary cancer tissues relative to non-CCC specimens. Treatment of three CCC cell lines with the demethylating agent Decitabine significantly induced expression for all five genes analyzed. Coordinate changes in pathway expression were confirmed using two primary ovarian cancer datasets (p<0.0001 for both). Our results suggest that methylation regulates specific pathways and biological functions in CCC, with hypomethylation influencing the characteristic biology of the disease while hypermethylation contributes to the carcinogenic process. PMID:24382740

Alternative Polyadenylation Directs Tissue-Specific miRNA Targeting in Caenorhabditis elegans Somatic Tissues

PubMed Central

Blazie, Stephen M.; Geissel, Heather C.; Wilky, Henry; Joshi, Rajan; Newbern, Jason; Mangone, Marco

2017-01-01

mRNA expression dynamics promote and maintain the identity of somatic tissues in living organisms; however, their impact in post-transcriptional gene regulation in these processes is not fully understood. Here, we applied the PAT-Seq approach to systematically isolate, sequence, and map tissue-specific mRNA from five highly studied Caenorhabditis elegans somatic tissues: GABAergic and NMDA neurons, arcade and intestinal valve cells, seam cells, and hypodermal tissues, and studied their mRNA expression dynamics. The integration of these datasets with previously profiled transcriptomes of intestine, pharynx, and body muscle tissues, precisely assigns tissue-specific expression dynamics for 60% of all annotated C. elegans protein-coding genes, providing an important resource for the scientific community. The mapping of 15,956 unique high-quality tissue-specific polyA sites in all eight somatic tissues reveals extensive tissue-specific 3′untranslated region (3′UTR) isoform switching through alternative polyadenylation (APA) . Almost all ubiquitously transcribed genes use APA and harbor miRNA targets in their 3′UTRs, which are commonly lost in a tissue-specific manner, suggesting widespread usage of post-transcriptional gene regulation modulated through APA to fine tune tissue-specific protein expression. Within this pool, the human disease gene C. elegans orthologs rack-1 and tct-1 use APA to switch to shorter 3′UTR isoforms in order to evade miRNA regulation in the body muscle tissue, resulting in increased protein expression needed for proper body muscle function. Our results highlight a major positive regulatory role for APA, allowing genes to counteract miRNA regulation on a tissue-specific basis. PMID:28348061

Alternative Polyadenylation Directs Tissue-Specific miRNA Targeting in Caenorhabditis elegans Somatic Tissues.

PubMed

Blazie, Stephen M; Geissel, Heather C; Wilky, Henry; Joshi, Rajan; Newbern, Jason; Mangone, Marco

2017-06-01

mRNA expression dynamics promote and maintain the identity of somatic tissues in living organisms; however, their impact in post-transcriptional gene regulation in these processes is not fully understood. Here, we applied the PAT-Seq approach to systematically isolate, sequence, and map tissue-specific mRNA from five highly studied Caenorhabditis elegans somatic tissues: GABAergic and NMDA neurons, arcade and intestinal valve cells, seam cells, and hypodermal tissues, and studied their mRNA expression dynamics. The integration of these datasets with previously profiled transcriptomes of intestine, pharynx, and body muscle tissues, precisely assigns tissue-specific expression dynamics for 60% of all annotated C. elegans protein-coding genes, providing an important resource for the scientific community. The mapping of 15,956 unique high-quality tissue-specific polyA sites in all eight somatic tissues reveals extensive tissue-specific 3'untranslated region (3'UTR) isoform switching through alternative polyadenylation (APA) . Almost all ubiquitously transcribed genes use APA and harbor miRNA targets in their 3'UTRs, which are commonly lost in a tissue-specific manner, suggesting widespread usage of post-transcriptional gene regulation modulated through APA to fine tune tissue-specific protein expression. Within this pool, the human disease gene C. elegans orthologs rack-1 and tct-1 use APA to switch to shorter 3'UTR isoforms in order to evade miRNA regulation in the body muscle tissue, resulting in increased protein expression needed for proper body muscle function. Our results highlight a major positive regulatory role for APA, allowing genes to counteract miRNA regulation on a tissue-specific basis. Copyright © 2017 Blazie et al.

Host Specificity of Salmonella typhimurium Deoxyribonucleic Acid Restriction and Modification

PubMed Central

Slocum, Harvey; Boyer, Herbert W.

1973-01-01

The restriction and modification genes of Salmonella typhimurium which lie near the thr locus were transferred to a restrictionless mutant of Escherichia coli. These genes were found to be allelic to the E. coli K, B, and A restriction and modification genes. E. coli recombinants with the restriction and modification host specificity of S. typhimurium restricted phage λ that had been modified by each of the seven known host specificities of E. coli at efficiency of plating levels of about 10−2. Phage λ modified with the S. typhimurium host specificity was restricted by six of the seven E. coli host specificities but not by the RII (fi− R-factor controlled) host specificity. It is proposed that the restriction and modification enzymes of this S. typhimurium host specificity have two substrates, one of which is a substrate for the RII host specificity enzymes. PMID:4570605

From pollen tubes to infection threads: recruitment of Medicago floral pectic genes for symbiosis.

PubMed

Rodríguez-Llorente, Ignacio D; Pérez-Hormaeche, Javier; El Mounadi, Kaoutar; Dary, Mohammed; Caviedes, Miguel A; Cosson, Viviane; Kondorosi, Adam; Ratet, Pascal; Palomares, Antonio J

2004-08-01

While the biology of nitrogen-fixing root nodules has been extensively studied, little is known about the evolutionary events that predisposed legume plants to form symbiosis with rhizobia. We have studied the presence and the expression of two pectic gene families in Medicago, polygalacturonases (PGs) and pectin methyl esterases (PMEs) during the early steps of the Sinorhizobium meliloti-Medicago interaction and compared them with related pollen-specific genes. First, we have compared the expression of MsPG3, a PG gene specifically expressed during the symbiotic interaction, with the expression of MsPG11, a highly homologous pollen-specific gene, using promoter-gus fusions in transgenic M. truncatula and tobacco plants. These results demonstrated that the symbiotic promoter functions as a pollen-specific promoter in the non-legume host. Second, we have identified the presence of a gene family of at least eight differentially expressed PMEs in Medicago. One subfamily is represented by one symbiotic gene (MtPER) and two pollen-expressed genes (MtPEF1 and MtPEF2) that are clustered in the M. truncatula genome. The promoter-gus studies presented in this work and the homology between plant PGs, together with the analysis of the PME locus structure and MtPER expression studies, suggest that the symbiotic MsPG3 and MtPER could have as ancestors pollen-expressed genes involved in polar tip growth processes during pollen tube elongation. Moreover, they could have been recruited after gene duplication in the symbiotic interaction to facilitate polar tip growth during infection thread formation.

Using a periclinal chimera to unravel layer-specific gene expression in plants

PubMed Central

Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J

2013-01-01

Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. PMID:23725542

DNA Microarray Gene Expression Profile of Marginal Zone versus Follicular B cells and Idiotype Positive Marginal Zone B cells Before and After Immunization with Streptococcus pneumoniae 1

PubMed Central

Liu, Jiabin; Behrens, Timothy W.; Kearney, John F.

2014-01-01

Marginal Zone (MZ) B cells play an important role in the clearance of blood-borne bacterial infections via rapid T-independent IgM responses. We have previously demonstrated that MZ B cells respond rapidly and robustly to bacterial particulates. To determine the MZ-specific genes that are expressed to allow for this response, MZ and Follicular (FO) B cells were sort-purified and analyzed via DNA microarray analysis. We identified 181 genes that were significantly different between the two B cell populations. 99 genes were more highly expressed in MZ B cells while 82 genes were more highly expressed in FO B cells. To further understand the molecular mechanisms by which MZ B cells respond so rapidly to bacterial challenge, idiotype positive and negative MZ B cells were sort-purified before (0 hour) or after (1 hour) i.v. immunization with heat killed Streptococcus pneumoniae, R36A, and analyzed via DNA microarray analysis. We identified genes specifically up regulated or down regulated at 1 hour following immunization in the idiotype positive MZ B cells. These results give insight into the gene expression pattern in resting MZ vs. FO B cells and the specific regulation of gene expression in antigen-specific MZ B cells following interaction with antigen. PMID:18453586

Sexual dimorphic floral development in dioecious plants revealed by transcriptome, phytohormone, and DNA methylation analysis in Populus tomentosa.

PubMed

Song, Yuepeng; Ma, Kaifeng; Ci, Dong; Chen, Qingqing; Tian, Jiaxing; Zhang, Deqiang

2013-12-01

Dioecious plants have evolved sex-specific floral development mechanisms. However, the precise gene expression patterns in dioecious plant flower development remain unclear. Here, we used andromonoecious poplar, an exceptional model system, to eliminate the confounding effects of genetic background of dioecious plants. Comparative transcriptome and physiological analysis allowed us to characterize sex-specific development of female and male flowers. Transcriptome analysis identified genes significantly differentially expressed between the sexes, including genes related to floral development, phytohormone synthesis and metabolism, and DNA methylation. Correlation analysis revealed a significant correlation between phytohormone signaling and gene expression, identifying specific phytohormone-responsive genes and their cis-regulatory elements. Two genes related to DNA methylation, METHYLTRANSFERASE1 (MET1) and DECREASED DNA METHYLATION 1 (DDM1), which are located in the sex determination region of Chromosome XIX, have differential expression between female and male flowers. A time-course analysis revealed that MET1 and DDM1 expression may produce different DNA methylation levels in female and male flowers. Understanding the interactions of phytohormone signaling, DNA methylation and target gene expression should lead to a better understanding of sexual differences in floral development. Thus, this study identifies a set of candidate genes for further studies of poplar sexual dimorphism and relates sex-specific floral development to physiological and epigenetic changes.

Loss of lager specific genes and subtelomeric regions define two different Saccharomyces cerevisiae lineages for Saccharomyces pastorianus Group I and II strains.

PubMed

Monerawela, Chandre; James, Tharappel C; Wolfe, Kenneth H; Bond, Ursula

2015-03-01

Lager yeasts, Saccharomyces pastorianus, are interspecies hybrids between S. cerevisiae and S. eubayanus and are classified into Group I and Group II clades. The genome of the Group II strain, Weihenstephan 34/70, contains eight so-called 'lager-specific' genes that are located in subtelomeric regions. We evaluated the origins of these genes through bioinformatic and PCR analyses of Saccharomyces genomes. We determined that four are of cerevisiae origin while four originate from S. eubayanus. The Group I yeasts contain all four S. eubayanus genes but individual strains contain only a subset of the cerevisiae genes. We identified S. cerevisiae strains that contain all four cerevisiae 'lager-specific' genes, and distinct patterns of loss of these genes in other strains. Analysis of the subtelomeric regions uncovered patterns of loss in different S. cerevisiae strains. We identify two classes of S. cerevisiae strains: ale yeasts (Foster O) and stout yeasts with patterns of 'lager-specific' genes and subtelomeric regions identical to Group I and II S. pastorianus yeasts, respectively. These findings lead us to propose that Group I and II S. pastorianus strains originate from separate hybridization events involving different S. cerevisiae lineages. Using the combined bioinformatic and PCR data, we describe a potential classification map for industrial yeasts. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

A fungal avirulence factor encoded in a highly plastic genomic region triggers partial resistance to septoria tritici blotch.

PubMed

Meile, Lukas; Croll, Daniel; Brunner, Patrick C; Plissonneau, Clémence; Hartmann, Fanny E; McDonald, Bruce A; Sánchez-Vallet, Andrea

2018-04-25

Cultivar-strain specificity in the wheat-Zymoseptoria tritici pathosystem determines the infection outcome and is controlled by resistance genes on the host side, many of which have been identified. On the pathogen side, however, the molecular determinants of specificity remain largely unknown. We used genetic mapping, targeted gene disruption and allele swapping to characterise the recognition of the new avirulence factor Avr3D1. We then combined population genetic and comparative genomic analyses to characterise the evolutionary trajectory of Avr3D1. Avr3D1 is specifically recognised by wheat cultivars harbouring the Stb7 resistance gene, triggering a strong defence response without preventing pathogen infection and reproduction. Avr3D1 resides in a cluster of putative effector genes located in a genome region populated by independent transposable element insertions. The gene was present in all 132 investigated strains and is highly polymorphic, with 30 different protein variants identified. We demonstrated that specific amino acid substitutions in Avr3D1 led to evasion of recognition. These results demonstrate that quantitative resistance and gene-for-gene interactions are not mutually exclusive. Localising avirulence genes in highly plastic genomic regions probably facilitates accelerated evolution that enables escape from recognition by resistance proteins. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

Brain region-specific gene expression changes after chronic intermittent ethanol exposure and early withdrawal in C57BL/6J mice

PubMed Central

Melendez, Roberto I.; McGinty, Jacqueline F.; Kalivas, Peter W.; Becker, Howard C.

2014-01-01

Neuroadaptations that participate in the ontogeny of alcohol dependence are likely a result of altered gene expression in various brain regions. The present study investigated brain region-specific changes in the pattern and magnitude of gene expression immediately following chronic intermittent ethanol (CIE) exposure and 8 hours following final ethanol exposure [i.e. early withdrawal (EWD)]. High-density oligonucleotide microarrays (Affymetrix 430A 2.0, Affymetrix, Santa Clara, CA, USA) and bioinformatics analysis were used to characterize gene expression and function in the prefrontal cortex (PFC), hippocampus (HPC) and nucleus accumbens (NAc) of C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME, USA). Gene expression levels were determined using gene chip robust multi-array average followed by statistical analysis of microarrays and validated by quantitative real-time reverse transcription polymerase chain reaction and Western blot analysis. Results indicated that immediately following CIE exposure, changes in gene expression were strikingly greater in the PFC (284 genes) compared with the HPC (16 genes) and NAc (32 genes). Bioinformatics analysis revealed that most of the transcriptionally responsive genes in the PFC were involved in Ras/MAPK signaling, notch signaling or ubiquitination. In contrast, during EWD, changes in gene expression were greatest in the HPC (139 genes) compared with the PFC (four genes) and NAc (eight genes). The most transcriptionally responsive genes in the HPC were involved in mRNA processing or actin dynamics. Of the few genes detected in the NAc, the most representatives were involved in circadian rhythms. Overall, these findings indicate that brain region-specific and time-dependent neuroadaptive alterations in gene expression play an integral role in the development of alcohol dependence and withdrawal. PMID:21812870

Co-expression network with protein-protein interaction and transcription regulation in malaria parasite Plasmodium falciparum.

PubMed

Yu, Fu-Dong; Yang, Shao-You; Li, Yuan-Yuan; Hu, Wei

2013-04-10

Malaria continues to be one of the most severe global infectious diseases, as a major threat to human health and economic development. Network-based biological analysis is a promising approach to uncover key genes and biological processes from a network viewpoint, which could not be recognized from individual gene-based signatures. We integrated gene co-expression profile with protein-protein interaction and transcriptional regulation information to construct a comprehensive gene co-expression network of Plasmodium falciparum. Based on this network, we identified 10 core modules by using ICE (Iterative Clique Enumeration) algorithm, which were essential for malaria parasite development in intraerythrocytic developmental cycle (IDC) stages. In each module, all genes were highly correlated probably due to co-regulation or formation of a protein complex. Some of these genes were recognized to be differentially coexpressed among three close-by IDC stages. The gene of prpf8 (PFD0265w) encoding pre-mRNA processing splicing factor 8 product was identified as DCGs (differentially co-expressed genes) among IDC stages, although this gene function was seldom reported in previous researches. Integrating the species-specific gene prediction and differential co-expression gene detection, we found some modules could perform species-specific functions according to some of genes in these modules were species-specific genes, like the module 10. Furthermore, in order to reveal the underlying mechanisms of the erythrocyte invasion by P. falciparum, Steiner Tree algorithm was employed to identify the invasion subnetwork from our gene co-expression network. The subnetwork-based analysis indicated that some important Plasmodium parasite specific genes could corporate with each other and be co-regulated during the parasite invasion process, which including a head-to-head gene pair of PfRH2a (PF13_0198) and PfRH2b (MAL13P1.176). This study based on gene co-expression network could shed new insights on the mechanisms of pathogenesis, even virulence and P. falciparum development. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

A novel RNA binding protein affects rbcL gene expression and is specific to bundle sheath chloroplasts in C4 plants

PubMed Central

2013-01-01

Background Plants that utilize the highly efficient C4 pathway of photosynthesis typically possess kranz-type leaf anatomy that consists of two morphologically and functionally distinct photosynthetic cell types, the bundle sheath (BS) and mesophyll (M) cells. These two cell types differentially express many genes that are required for C4 capability and function. In mature C4 leaves, the plastidic rbcL gene, encoding the large subunit of the primary CO2 fixation enzyme Rubisco, is expressed specifically within BS cells. Numerous studies have demonstrated that BS-specific rbcL gene expression is regulated predominantly at post-transcriptional levels, through the control of translation and mRNA stability. The identification of regulatory factors associated with C4 patterns of rbcL gene expression has been an elusive goal for many years. Results RLSB, encoded by the nuclear RLSB gene, is an S1-domain RNA binding protein purified from C4 chloroplasts based on its specific binding to plastid-encoded rbcL mRNA in vitro. Co-localized with LSU to chloroplasts, RLSB is highly conserved across many plant species. Most significantly, RLSB localizes specifically to leaf bundle sheath (BS) cells in C4 plants. Comparative analysis using maize (C4) and Arabidopsis (C3) reveals its tight association with rbcL gene expression in both plants. Reduced RLSB expression (through insertion mutation or RNA silencing, respectively) led to reductions in rbcL mRNA accumulation and LSU production. Additional developmental effects, such as virescent/yellow leaves, were likely associated with decreased photosynthetic function and disruption of associated signaling networks. Conclusions Reductions in RLSB expression, due to insertion mutation or gene silencing, are strictly correlated with reductions in rbcL gene expression in both maize and Arabidopsis. In both plants, accumulation of rbcL mRNA as well as synthesis of LSU protein were affected. These findings suggest that specific accumulation and binding of the RLSB binding protein to rbcL mRNA within BS chloroplasts may be one determinant leading to the characteristic cell type-specific localization of Rubisco in C4 plants. Evolutionary modification of RLSB expression, from a C3 “default” state to BS cell-specificity, could represent one mechanism by which rbcL expression has become restricted to only one cell type in C4 plants. PMID:24053212

Differential C3NET reveals disease networks of direct physical interactions

PubMed Central

2011-01-01

Background Genes might have different gene interactions in different cell conditions, which might be mapped into different networks. Differential analysis of gene networks allows spotting condition-specific interactions that, for instance, form disease networks if the conditions are a disease, such as cancer, and normal. This could potentially allow developing better and subtly targeted drugs to cure cancer. Differential network analysis with direct physical gene interactions needs to be explored in this endeavour. Results C3NET is a recently introduced information theory based gene network inference algorithm that infers direct physical gene interactions from expression data, which was shown to give consistently higher inference performances over various networks than its competitors. In this paper, we present, DC3net, an approach to employ C3NET in inferring disease networks. We apply DC3net on a synthetic and real prostate cancer datasets, which show promising results. With loose cutoffs, we predicted 18583 interactions from tumor and normal samples in total. Although there are no reference interactions databases for the specific conditions of our samples in the literature, we found verifications for 54 of our predicted direct physical interactions from only four of the biological interaction databases. As an example, we predicted that RAD50 with TRF2 have prostate cancer specific interaction that turned out to be having validation from the literature. It is known that RAD50 complex associates with TRF2 in the S phase of cell cycle, which suggests that this predicted interaction may promote telomere maintenance in tumor cells in order to allow tumor cells to divide indefinitely. Our enrichment analysis suggests that the identified tumor specific gene interactions may be potentially important in driving the growth in prostate cancer. Additionally, we found that the highest connected subnetwork of our predicted tumor specific network is enriched for all proliferation genes, which further suggests that the genes in this network may serve in the process of oncogenesis. Conclusions Our approach reveals disease specific interactions. It may help to make experimental follow-up studies more cost and time efficient by prioritizing disease relevant parts of the global gene network. PMID:21777411