Searching for cellular partners of hantaviral nonstructural protein NSs: Y2H screening of mouse cDNA library and analysis of cellular interactome.

PubMed

Rönnberg, Tuomas; Jääskeläinen, Kirsi; Blot, Guillaume; Parviainen, Ville; Vaheri, Antti; Renkonen, Risto; Bouloy, Michele; Plyusnin, Alexander

2012-01-01

Hantaviruses (Bunyaviridae) are negative-strand RNA viruses with a tripartite genome. The small (S) segment encodes the nucleocapsid protein and, in some hantaviruses, also the nonstructural protein (NSs). The aim of this study was to find potential cellular partners for the hantaviral NSs protein. Toward this aim, yeast two-hybrid (Y2H) screening of mouse cDNA library was performed followed by a search for potential NSs protein counterparts via analyzing a cellular interactome. The resulting interaction network was shown to form logical, clustered structures. Furthermore, several potential binding partners for the NSs protein, for instance ACBD3, were identified and, to prove the principle, interaction between NSs and ACBD3 proteins was demonstrated biochemically.

The construction of cDNA library and the screening of related antigen of ascitic tumor cells of ovarian cancer.

PubMed

Hou, Q; Chen, K; Shan, Z

2015-01-01

To construct the cDNA library of the ascites tumor cells of ovarian cancer, which can be used to screen the related antigen for the early diagnosis of ovarian cancer and therapeutic targets of immune treatment. Four cases of ovarian serous cystadenocarcinoma, two cases of ovarian mucinous cystadenocarcinoma, and two cases of ovarian endometrial carcinoma in patients with ascitic tumor cells which were used to construct the cDNA library. To screen the ovarian cancer antigen gene, evaluate the enzyme, and analyze nucleotide sequence, serological analysis of recombinant tumor cDNA expression libraries (SEREX) and suppression subtractive hybridization technique (SSH) techniques were utilized. The detection method of recombinant expression-based serological mini-arrays (SMARTA) was used to detect the ovarian cancer antigen and the positive reaction of 105 cases of ovarian cancer patients and 105 normal women's autoantibodies correspondingly in serum. After two rounds of serologic screening and glycosides sequencing analysis, 59 candidates of ovarian cancer antigen gene fragments were finally identified, which corresponded to 50 genes. They were then divided into six categories: (1) the homologous genes which related to the known ovarian cancer genes, such as BARD 1 gene, etc; (2) the homologous genes which were associated with other tumors, such as TM4SFI gene, etc; (3) the genes which were expressed in a special organization, such as ILF3, FXR1 gene, etc; (4) the genes which were the same with some protein genes of special function, such as TIZ, ClD gene; (5) the homologous genes which possessed the same source with embryonic genes, such as PKHD1 gene, etc; (6) the remaining genes were the unknown genes without the homologous sequence in the gene pool, such as OV-189 genes. SEREX technology combined with SSH method is an effective research strategy which can filter tumor antigen with high specific character; the corresponding autoantibodies of TM4SFl, ClD, TIZ, BARDI, FXRI, and OV-189 gene's recombinant antigen in serum can be regarded as the biomarkers which are used to diagnose ovarian cancer. The combination of multiple antigen detection can improve diagnostic efficiency.

Complementary DNA libraries: an overview.

PubMed

Ying, Shao-Yao

2004-07-01

The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

PubMed

Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

2004-03-01

The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

Construction of cDNA expression library of watermelon for isolation of ClWRKY1 transcription factors gene involved in resistance to Fusarium wilt.

PubMed

Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun

2014-08-01

Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.

A Novel Approach to the Elucidation of the Mechanism of Development of Androgen-Independent Growth of Prostate Cancer

DTIC Science & Technology

2001-01-01

with 1.0 with differential hybridization to the two probes. Phage plaques corresponding ml of RIPA buffer with protease inhibitors (PBS, 1% NP40, 0.5...hybridized to radiolabeled probe prepared from plaque-purified phage . at 10,000 X g for 20 min; supernatants were collected and centrifuged again to...Screening. Lambda phage plaques from the primary unamplified Differential expression screening of cDNA libraries constructed CWR22 library were plated

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Construction of high quality Gateway™ entry libraries and their application to yeast two-hybrid for the monocot model plant Brachypodium distachyon.

PubMed

Cao, Shuanghe; Siriwardana, Chamindika L; Kumimoto, Roderick W; Holt, Ben F

2011-05-19

Monocots, especially the temperate grasses, represent some of the most agriculturally important crops for both current food needs and future biofuel development. Because most of the agriculturally important grass species are difficult to study (e.g., they often have large, repetitive genomes and can be difficult to grow in laboratory settings), developing genetically tractable model systems is essential. Brachypodium distachyon (hereafter Brachypodium) is an emerging model system for the temperate grasses. To fully realize the potential of this model system, publicly accessible discovery tools are essential. High quality cDNA libraries that can be readily adapted for multiple downstream purposes are a needed resource. Additionally, yeast two-hybrid (Y2H) libraries are an important discovery tool for protein-protein interactions and are not currently available for Brachypodium. We describe the creation of two high quality, publicly available Gateway™ cDNA entry libraries and their derived Y2H libraries for Brachypodium. The first entry library represents cloned cDNA populations from both short day (SD, 8/16-h light/dark) and long day (LD, 20/4-h light/dark) grown plants, while the second library was generated from hormone treated tissues. Both libraries have extensive genome coverage (~5 × 107 primary clones each) and average clone lengths of ~1.5 Kb. These entry libraries were then used to create two recombination-derived Y2H libraries. Initial proof-of-concept screens demonstrated that a protein with known interaction partners could readily re-isolate those partners, as well as novel interactors. Accessible community resources are a hallmark of successful biological model systems. Brachypodium has the potential to be a broadly useful model system for the grasses, but still requires many of these resources. The Gateway™ compatible entry libraries created here will facilitate studies for multiple user-defined purposes and the derived Y2H libraries can be immediately applied to large scale screening and discovery of novel protein-protein interactions. All libraries are freely available for distribution to the research community.

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

[cDNA library construction from panicle meristem of finger millet].

PubMed

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.

PubMed

Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S

2003-06-01

The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Characterization of embryo-specific genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1989-01-01

The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less

A tolerance gene for prenylated flavonoid encodes a 26S proteasome regulatory subunit in Sophora flavescens.

PubMed

Shitan, Nobukazu; Kamimoto, Yoshihisa; Minami, Shota; Kubo, Mizuki; Ito, Kozue; Moriyasu, Masataka; Yazaki, Kazufumi

2011-01-01

Yeast functional screening with a Sophora flavescens cDNA library was performed to identify the genes involved in the tolerant mechanism to the self-producing prenylated flavonoid sophoraflavanone G (SFG). One cDNA, which conferred SFG tolerance, encoded a regulatory particle triple-A ATPase 2 (SfRPT2), a member of the 26S proteasome subunit. The yeast transformant of SfRPT2 showed reduced SFG accumulation in the cells.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1998-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1998-11-03

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

Metatranscriptomics of Soil Eukaryotic Communities.

PubMed

Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2016-01-01

Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries

PubMed Central

Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

2008-01-01

Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700

EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.

PubMed

Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

2008-04-10

Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.

Using genome-wide CRISPR library screening with library resistant DCK to find new sources of Ara-C drug resistance in AML.

PubMed

Kurata, Morito; Rathe, Susan K; Bailey, Natashay J; Aumann, Natalie K; Jones, Justine M; Veldhuijzen, G Willemijn; Moriarity, Branden S; Largaespada, David A

2016-11-03

Acute myeloid leukemia (AML) can display de novo or acquired resistance to cytosine arabinoside (Ara-C), a primary component of induction chemotherapy. To identify genes capable of independently imposing Ara-C resistance, we applied a genome-wide CRISPR library to human U937 cells and exposed to them to Ara-C. Interestingly, all drug resistant clones contained guide RNAs for DCK. To avoid DCK gene modification, gRNA resistant DCK cDNA was created by the introduction of silent mutations. The CRISPR screening was repeated using the gRNA resistant DCK, and loss of SLC29A was identified as also being capable of conveying Ara-C drug resistance. To determine if loss of Dck results in increased sensitivity to other drugs, we conducted a screen of 446 FDA approved drugs using two Dck-defective BXH-2 derived murine AML cell lines and their Ara-C sensitive parental lines. Both cell lines showed an increase in sensitivity to prednisolone. Guide RNA resistant cDNA rescue was a legitimate strategy and multiple DCK or SLC29A deficient human cell clones were established with one clone becoming prednisolone sensitive. Dck-defective leukemic cells may become prednisolone sensitive indicating prednisolone may be an effective adjuvant therapy in some cases of DCK-negative AML.

Gene expression in the pulp of ripening bananas. Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products and cDNA cloning of 25 different ripening-related mRNAs.

PubMed Central

Medina-Suárez, R; Manning, K; Fletcher, J; Aked, J; Bird, C R; Seymour, G B

1997-01-01

mRNA was extracted from the pulp and peel of preclimacteric (d 0) bananas (Musa AAA group, cv Grand Nain) and those exposed to ethylene gas for 24 h and stored in air alone for a further 1 (d 2) and 4 d (d 5). Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products from the pulp and peel of these fruits revealed significant up-regulation of numerous transcripts during ripening. The majority of the changes were initiated by d 2, with the level of these messages increasing during the remainder of the ripening period. Pulp tissue from d 2 was used for the construction of a cDNA library. This library was differentially screened for ripening-related clones using cDNA from d-0 and d-2 pulp by a novel microtiter plate method. In the primary screen 250 up- and down-regulated clones were isolated. Of these, 59 differentially expressed clones were obtained from the secondary screen. All of these cDNAs were partially sequenced and grouped into families after database searches. Twenty-five nonredundant groups of pulp clones were identified. These encoded enzymes were involved in ethylene biosynthesis, respiration, starch metabolism, cell wall degradation, and several other key metabolic events. We describe the analysis of these clones and their possible involvement in ripening. PMID:9342865

Constructing and detecting a cDNA library for mites.

PubMed

Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

2015-10-01

RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

Normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1997-06-10

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Structure and chromosomal localization of the human PD-1 gene (PDCD1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shinohara, T.; Ishida, Y.; Kawaichi, M.

1994-10-01

A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.

cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cool, D.E.; Tonks, N.K.; Charbonneau, H.

1989-07-01

A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

[Cloning and characterization of a novel rat gene RSD-7 differentially expressed in testis].

PubMed

Zhang, Xiao-dong; Gou, Da-wei; Miao, Shi-ying; Zhang, Jian-chao; Zong, Shu-dong; Wang, Lin-fang

2003-06-01

To isolate and identify the differentially expressed genes in spermatogenesis for the understanding molecular mechanism of spermatogenesis. Screening of the cDNA library, Northern blot, expression and purification in E. coli with GST expression system, immunocytochemical staining of testis sections were used. (1) A cDNA fragment designated as RSD-7 was isolated from rat testis cDNA library. It was 1,238 bp in length, coding a protein of 232 amino acids with the GenBank accession number AF315467. The encoding protein of RSD-7 cDNA had a Ubiquitin-like domain. (2) Northern blot indicated that RSD-7 was uniquely expressed in rat testis, and in the testis RSD-7 emerged on the 30th postnatal day and expressed until 120th postnatal day. (3) Expression and purification of RSD-7 protein in E. coli with GST expression system and were used to obtain anti-RSD-7 antibody. (4) Immunolocalization of RSD-7 in rat testis revealed that it is expressed only in Sertoli cells. Transcription pattern of RSD-7 and localization of RSD-7 protein in testis have been made, which established the base for the functional study of RSD-7.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1996-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1996-01-09

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Identification of differentially-expressed genes potentially implicated in drought response in pitaya (Hylocereus undatus) by suppression subtractive hybridization and cDNA microarray analysis.

PubMed

Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng

2014-01-01

Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.

Development and Application of a Salmonid EST Database and cDNA Microarray: Data Mining and Interspecific Hybridization Characteristics

PubMed Central

Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.

2004-01-01

We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987

[Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

PubMed

Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

2003-07-01

Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

PubMed

Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

2004-12-15

cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

Cloning and characterization of a Candida albicans maltase gene involved in sucrose utilization.

PubMed Central

Geber, A; Williamson, P R; Rex, J H; Sweeney, E C; Bennett, J E

1992-01-01

In order to isolate the structural gene involved in sucrose utilization, we screened a sucrose-induced Candida albicans cDNA library for clones expressing alpha-glucosidase activity. The C. albicans maltase structural gene (CAMAL2) was isolated. No other clones expressing alpha-glucosidase activity. were detected. A genomic CAMAL2 clone was obtained by screening a size-selected genomic library with the cDNA clone. DNA sequence analysis reveals that CAMAL2 encodes a 570-amino-acid protein which shares 50% identity with the maltase structural gene (MAL62) of Saccharomyces carlsbergensis. The substrate specificity of the recombinant protein purified from Escherichia coli identifies the enzyme as a maltase. Northern (RNA) analysis reveals that transcription of CAMAL2 is induced by maltose and sucrose and repressed by glucose. These results suggest that assimilation of sucrose in C. albicans relies on an inducible maltase enzyme. The family of genes controlling sucrose utilization in C. albicans shares similarities with the MAL gene family of Saccharomyces cerevisiae and provides a model system for studying gene regulation in this pathogenic yeast. Images PMID:1400249

Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

PubMed

Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

2003-09-01

The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

Identification of transcripts related to high egg production in the chicken hypothalamus and pituitary gland.

PubMed

Shiue, Yow-Ling; Chen, Lih-Ren; Chen, Chih-Feng; Chen, Yi-Ling; Ju, Jhy-Phen; Chao, Ching-Hsien; Lin, Yuan-Ping; Kuo, Yu-Ming; Tang, Pin-Chi; Lee, Yen-Pai

2006-09-15

To identify transcripts related to high egg production expressed specifically in the hypothalamus and pituitary gland of the chicken, two subtracted cDNA libraries were constructed. Two divergently selected strains of Taiwan Country Chickens (TCCs), B (sire line) and L2 (dam line) were used; they had originated from a single population and were further subjected (since 1982) to selection for egg production to 40 wk of age and body weight/comb size, respectively. A total of 324 and 370 clones were identified from the L2-B (L2-subtract-B) and the B-L2 subtracted cDNA libraries, respectively. After sequencing and annotation, 175 and 136 transcripts that represented 53 known and 65 unknown non-redundant sequences were characterized in the L2-B subtracted cDNA library. Quantitative reverse-transcription (RT)-PCR was used to screen the mRNA expression levels of 32 randomly selected transcripts in another 78 laying hens from five different strains. These strains included the two original strains (B and L2) used to construct the subtracted cDNA libraries and an additional three commercial strains, i.e., Black- and Red-feather TCCs and Single-Comb White Leghorn (WL) layer. The mRNA expression levels of 16 transcripts were significantly higher in the L2 than in the B strain, whereas the mRNA expression levels of nine transcripts, BDH, NCAM1, PCDHA@, PGDS, PLAG1, PRL, SAR1A, SCG2 and STMN2, were significantly higher in two high egg production strains, L2 and Single-Comb WL; this indicated their usefulness as molecular markers of high egg production.

Miniaturization Technologies for Efficient Single-Cell Library Preparation for Next-Generation Sequencing.

PubMed

Mora-Castilla, Sergio; To, Cuong; Vaezeslami, Soheila; Morey, Robert; Srinivasan, Srimeenakshi; Dumdie, Jennifer N; Cook-Andersen, Heidi; Jenkins, Joby; Laurent, Louise C

2016-08-01

As the cost of next-generation sequencing has decreased, library preparation costs have become a more significant proportion of the total cost, especially for high-throughput applications such as single-cell RNA profiling. Here, we have applied novel technologies to scale down reaction volumes for library preparation. Our system consisted of in vitro differentiated human embryonic stem cells representing two stages of pancreatic differentiation, for which we prepared multiple biological and technical replicates. We used the Fluidigm (San Francisco, CA) C1 single-cell Autoprep System for single-cell complementary DNA (cDNA) generation and an enzyme-based tagmentation system (Nextera XT; Illumina, San Diego, CA) with a nanoliter liquid handler (mosquito HTS; TTP Labtech, Royston, UK) for library preparation, reducing the reaction volume down to 2 µL and using as little as 20 pg of input cDNA. The resulting sequencing data were bioinformatically analyzed and correlated among the different library reaction volumes. Our results showed that decreasing the reaction volume did not interfere with the quality or the reproducibility of the sequencing data, and the transcriptional data from the scaled-down libraries allowed us to distinguish between single cells. Thus, we have developed a process to enable efficient and cost-effective high-throughput single-cell transcriptome sequencing. © 2016 Society for Laboratory Automation and Screening.

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

PubMed Central

Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

1990-01-01

Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

PubMed

Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

1997-04-01

A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

Suppression subtractive hybridization identified differentially expressed genes in lung adenocarcinoma: ERGIC3 as a novel lung cancer-related gene

PubMed Central

2013-01-01

Background To understand the carcinogenesis caused by accumulated genetic and epigenetic alterations and seek novel biomarkers for various cancers, studying differentially expressed genes between cancerous and normal tissues is crucial. In the study, two cDNA libraries of lung cancer were constructed and screened for identification of differentially expressed genes. Methods Two cDNA libraries of differentially expressed genes were constructed using lung adenocarcinoma tissue and adjacent nonmalignant lung tissue by suppression subtractive hybridization. The data of the cDNA libraries were then analyzed and compared using bioinformatics analysis. Levels of mRNA and protein were measured by quantitative real-time polymerase chain reaction (q-RT-PCR) and western blot respectively, as well as expression and localization of proteins were determined by immunostaining. Gene functions were investigated using proliferation and migration assays after gene silencing and gene over-expression. Results Two libraries of differentially expressed genes were obtained. The forward-subtracted library (FSL) and the reverse-subtracted library (RSL) contained 177 and 59 genes, respectively. Bioinformatic analysis demonstrated that these genes were involved in a wide range of cellular functions. The vast majority of these genes were newly identified to be abnormally expressed in lung cancer. In the first stage of the screening for 16 genes, we compared lung cancer tissues with their adjacent non-malignant tissues at the mRNA level, and found six genes (ERGIC3, DDR1, HSP90B1, SDC1, RPSA, and LPCAT1) from the FSL were significantly up-regulated while two genes (GPX3 and TIMP3) from the RSL were significantly down-regulated (P < 0.05). The ERGIC3 protein was also over-expressed in lung cancer tissues and cultured cells, and expression of ERGIC3 was correlated with the differentiated degree and histological type of lung cancer. The up-regulation of ERGIC3 could promote cellular migration and proliferation in vitro. Conclusions The two libraries of differentially expressed genes may provide the basis for new insights or clues for finding novel lung cancer-related genes; several genes were newly found in lung cancer with ERGIC3 seeming a novel lung cancer-related gene. ERGIC3 may play an active role in the development and progression of lung cancer. PMID:23374247

cDNA library construction of two human Demodexspecies.

PubMed

Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

2017-06-01

The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin

PubMed Central

Loit, Evelin; Melnyk, Charles W; MacFarlane, Amanda J; Scott, Fraser W; Altosaar, Illimar

2009-01-01

Background Exposure to dietary wheat proteins in genetically susceptible individuals has been associated with increased risk for the development of Type 1 diabetes (T1D). Recently, a wheat protein encoded by cDNA WP5212 has been shown to be antigenic in mice, rats and humans with autoimmune T1D. To investigate the genomic origin of the identified wheat protein cDNA, a hexaploid wheat genomic library from Glenlea cultivar was screened. Results Three unique wheat globulin genes, Glo-3A, Glo3-B and Glo-3C, were identified. We describe the genomic structure of these genes and their expression pattern in wheat seeds. The Glo-3A gene shared 99% identity with the cDNA of WP5212 at the nucleotide and deduced amino acid level, indicating that we have identified the gene(s) encoding wheat protein WP5212. Southern analysis revealed the presence of multiple copies of Glo-3-like sequences in all wheat samples, including hexaploid, tetraploid and diploid species wheat seed. Aleurone and embryo tissue specificity of WP5212 gene expression, suggested by promoter region analysis, which demonstrated an absence of endosperm specific cis elements, was confirmed by immunofluorescence microscopy using anti-WP5212 antibodies. Conclusion Taken together, the results indicate that a diverse group of globulins exists in wheat, some of which could be associated with the pathogenesis of T1D in some susceptible individuals. These data expand our knowledge of specific wheat globulins and will enable further elucidation of their role in wheat biology and human health. PMID:19615078

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Cloning and Expression of cDNA for Rat Heme Oxygenase

NASA Astrophysics Data System (ADS)

Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

1985-12-01

Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Culbert, A.A.; Wallis, G.A.; Kadler, K.E.

The brittleness of bone in people with lethal (type II) osteogenesis imperfecta, a heritable disorder caused by mutations in the type I collagen genes, arises from the deposition of abnormal collagen in the bone matrix. The inability of the abnormal collagen to participate in mineralization may be caused by its failure to interact with other bone proteins. Here, we have designed a strategy to isolate the genes important for mineralization of collagen during bone formation. Cells isolated from 16-day embryonic chick calvaria and seeded post-confluence in culture deposited a mineralized matrix over a period of 2 weeks. Chick skin fibroblastsmore » seeded and cultured under the same conditions did not mineralize. Using RT-PCR, we prepared short cDNAs ({approximately}300 bp) corresponding to the 3{prime} ends of mRNA from fibroblasts and separately from the mineralizing calvarial cells. Subtractive cDNA hybridization generated a pool of cDNAs that were specific to mineralizing calvarial cells but not to fibroblasts. Screening of 100,000 plaques of a chick bone ZAP Express cDNA library with this pool of mineralizing-specific cDNAs identified ten clones which comprised full-length cDNAs for the bone proteins osteopontin (eight of the ten positives), bone sialoprotein II (one of the ten positives), and cystatin (one of the ten positives). cDNAs for type I collagen, fibronectin, alkaline phosphatase, house-keeping genes, and other genes expressed in fibroblasts were not identified in this preliminary screen. The pool of short cDNAs is likely to comprise cDNAs for further bone-specific genes and will be used to screen the entire bone cDNA library of 4.2 million clones. 30 refs., 4 figs.« less

Molecular cloning of toxins expressed by the venom gland of Lasiodora sp.

PubMed

Vieira, A L G; Moura, M B; Babá, E H; Chávez-Olórtegui, C; Kalapothakis, E; Castro, I M

2004-12-15

The present work describes the identification of toxins expressed by the venom gland of the spider Lasiodora sp. The toxins LTx1, LTx2 and LTx3 were identified by the screening of a cDNA library. These toxins showed significant similarity at the amino acid level with spider toxins from Lasiodora parahybana, Eurypelma californicum, Brachypelma smithii, Selenocosmia huwena.

Selective interaction between Chloroplast B ATPase and TGB1 retards severe symptoms caused by Alternanthera mosaic virus infection

USDA-ARS?s Scientific Manuscript database

The multifunctional triple gene block protein 1 (TGB1) of the Potexvirus Alternanthera mosaic virus (AltMV) has been reported to have silencing suppressor, cell-to-cell movement, and helicase functions. Yeast two hybrid screening using an Arabidopsis thaliana cDNA library with TGB1 as bait, and co-p...

Identification of a novel pathway involving a GATA transcription factor in yeast and possibly plant Zn uptake and homeostasis

USDA-ARS?s Scientific Manuscript database

To gain a better understanding of the regulation of Zn homeostasis in plants and the degree of conservation of Zn homeostasis between plants and yeast, a cDNA library from the Zn/Cd hyperaccumulating plant species, Nocceae caerulescens, was screened for its ability to restore growth under Zn limitin...

A computational search for box C/D snoRNA genes in the Drosophila melanogaster genome.

PubMed

Accardo, M C; Giordano, E; Riccardo, S; Digilio, F A; Iazzetti, G; Calogero, R A; Furia, M

2004-12-12

In eukaryotes, the family of non-coding RNA genes includes a number of genes encoding small nucleolar RNAs (mainly C/D and H/ACA snoRNAs), which act as guides in the maturation or post-transcriptional modifications of target RNA molecules. Since in Drosophila melanogaster (Dm) only few examples of snoRNAs have been identified so far by cDNA libraries screening, integration of the molecular data with in silico identification of these types of genes could throw light on their organization in the Dm genome. We have performed a computational screening of the Dm genome for C/D snoRNA genes, followed by experimental validation of the putative candidates. Few of the 26 confirmed snoRNAs had been recognized by cDNA library analysis. Organization of the Dm genome was also found to be more variegated than previously suspected, with snoRNA genes nested in both the introns and exons of protein-coding genes. This finding suggests that the presence of additional mechanisms of snoRNA biogenesis based on the alternative production of overlapping mRNA/snoRNA molecules. Additional information is available at http://www.bioinformatica.unito.it/bioinformatics/snoRNAs.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

PubMed

Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

2017-08-01

Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

PubMed Central

Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

2014-01-01

The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

Characterization of embryo-specific genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Z.R.

1988-01-01

The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less

Searching for microbial protein over-expression in a complex matrix using automated high throughput MS-based proteomics tools.

PubMed

Akeroyd, Michiel; Olsthoorn, Maurien; Gerritsma, Jort; Gutker-Vermaas, Diana; Ekkelkamp, Laurens; van Rij, Tjeerd; Klaassen, Paul; Plugge, Wim; Smit, Ed; Strupat, Kerstin; Wenzel, Thibaut; van Tilborg, Marcel; van der Hoeven, Rob

2013-03-10

In the discovery of new enzymes genomic and cDNA expression libraries containing thousands of differential clones are generated to obtain biodiversity. These libraries need to be screened for the activity of interest. Removing so-called empty and redundant clones significantly reduces the size of these expression libraries and therefore speeds up new enzyme discovery. Here, we present a sensitive, generic workflow for high throughput screening of successful microbial protein over-expression in microtiter plates containing a complex matrix based on mass spectrometry techniques. MALDI-LTQ-Orbitrap screening followed by principal component analysis and peptide mass fingerprinting was developed to obtain a throughput of ∼12,000 samples per week. Alternatively, a UHPLC-MS(2) approach including MS(2) protein identification was developed for microorganisms with a complex protein secretome with a throughput of ∼2000 samples per week. TCA-induced protein precipitation enhanced by addition of bovine serum albumin is used for protein purification prior to MS detection. We show that this generic workflow can effectively reduce large expression libraries from fungi and bacteria to their minimal size by detection of successful protein over-expression using MS. Copyright © 2012 Elsevier B.V. All rights reserved.

Identification and genetic mapping of a homeobox gene to the 4p16. 1 region of human chromosome 4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stadler, H.S.; Padanilam, B.J.; Solursh, M.

1992-12-01

A human craniofacial cDNA library was screened with a degenerate oligonucleotide probe based on the conserved third helix of homeobox genes. From this screening, we identified a homeobox gene, H6, which shared only 57-65% amino acid identity to previously reported homeodomains. H6 was physically mapped to the 4P16.1 region by using somatic cell hybrids containing specific deletions of human chromosome 4. Linkage data from a single-stranded conformational polymorphism derived from the 3[prime] untranslated region of the H6 cDNA placed this homeobox gene more than 20 centimorgans proximal of the previously mapped HOX7 gene on chromosome 4. Identity comparisons of themore » H6 Homeodomain with previously reported homeodomains reveal the highest identities to be with the Nk class of homeobox genes in Drosophila melanogaster. 53 refs., 5 figs., 2 tabs.« less

Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission.

PubMed

Wu, Zhencai; Burns, Jacqueline K

2003-04-01

The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.

A tick B-cell inhibitory protein from salivary glands of the hard tick, Hyalomma asiaticum asiaticum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu Da; Department of Life Science and Technology, Changshu Institute of Technology, Changshu 215500; Liang Jiangguo

2006-05-05

Some studies done to date suggest that B-cell inhibitory factor occurred in tick saliva. In this study, a novel protein having B-cell inhibitory activity was purified and characterized from the salivary glands of the hard tick, Hyalomma asiaticum asiaticum. This protein was named B-cell inhibitory factor (BIF). The cDNA encoding BIF was cloned by cDNA library screening. The predicted protein from the cDNA sequence is composed of 138 amino acids including the mature BIF. No similarity was found by Blast search. The lipopolysaccharide-induced B-cell proliferation was inhibited by BIF. This is First report of the identification and characterization of B-cellmore » inhibitory protein from tick. The current study facilitates the study of identifying the interaction among tick, Borrelia burgdorferi, the causative agent of Lyme disease, and host.« less

Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism

PubMed Central

Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang

2013-01-01

Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972

Cloning of Sucrose:Sucrose 1-Fructosyltransferase from Onion and Synthesis of Structurally Defined Fructan Molecules from Sucrose1

PubMed Central

Vijn, Irma; van Dijken, Anja; Lüscher, Marcel; Bos, Antoine; Smeets, Edward; Weisbeek, Peter; Wiemken, Andres; Smeekens, Sjef

1998-01-01

Sucrose (Suc):Suc 1-fructosyltransferase (1-SST) is the key enzyme in plant fructan biosynthesis, since it catalyzes de novo fructan synthesis from Suc. We have cloned 1-SST from onion (Allium cepa) by screening a cDNA library using acid invertase from tulip (Tulipa gesneriana) as a probe. Expression assays in tobacco (Nicotiana plumbaginifolia) protoplasts showed the formation of 1-kestose from Suc. In addition, an onion acid invertase clone was isolated from the same cDNA library. Protein extracts of tobacco protoplasts transformed with this clone showed extensive Suc-hydrolyzing activity. Conditions that induced fructan accumulation in onion leaves also induced 1-SST mRNA accumulation, whereas the acid invertase mRNA level decreased. Structurally different fructan molecules could be produced from Suc by a combined incubation of protein extract of protoplasts transformed with 1-SST and protein extract of protoplasts transformed with either the onion fructan:fructan 6G-fructosyltransferase or the barley Suc:fructan 6-fructosyltransferase. PMID:9701606

Expression cloning of a gibberellin 20-oxidase, a multifunctional enzyme involved in gibberellin biosynthesis.

PubMed Central

Lange, T; Hedden, P; Graebe, J E

1994-01-01

In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921

Construction of cDNA library from intestine, mesentery and coelomocyte of Apostichopus japonicus Selenka infected with Vibrio sp. and a preliminary analysis of immunity-related genes

NASA Astrophysics Data System (ADS)

Liu, Hongzhan; Zheng, Fengrong; Sun, Xiuqin; Cai, Yimei

2012-06-01

The aquaculture of sea cucumber Apostichopus japonicus (Echinodermata, Holothuroidea) has grown rapidly during recent years and has become an important sector of the marine industry in Northern China. However, with the rapid growth of the industry and the use of non-standard culture techniques, epidemic diseases of A. japonicus now pose increasing problems to the industry. To screen the genes with stress response to bacterial infection in sea cucumber at a genome wide level, we constructed a cDNA library from A. japonicus Selenka (Aspidochirotida: Stichopodidae) after infecting them with Vibrio sp. for 48 h. Total RNA was extracted from the intestine, mesentery and coelomocyte of infected sea cucumber using Trizol and mRNA was isolated by Oligotex mRNA Kits. The ligated cDNAs were transformed into DH5α, and a library of 3.24×105 clones (3.24×105 cfu mL-1) was obtained with the sizes of inserted fragments ranging from 0.8 to 2.5 kb. Sequencing the cDNA clones resulted in a total of 1106 ESTs that passed the quality control. BlastX and BlastN searches have identified 168 (31.5%) ESTs sharing significant homology with known sequences in NCBI protein or nucleotide databases. Among a panel of 25 putative immunity-related genes, serum lectin isoform, complement component 3, complement component 3-like genes were further studied by real-time PCR and they all increased more than 5 fold in response to Vibrio sp. challenge. Our library provides a valuable molecular tool for future study of invertebrate immunity against bacterial infection and our gene expression data indicates the importance of the immune system in the evolution and development of sea cucumber.

[Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

1997-02-01

The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

PubMed Central

Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

2000-01-01

Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

PubMed Central

Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

1991-01-01

Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

Isolation and expression analysis of cDNAs that are associated with alternate bearing in Olea europaea L. cv. Ayvalık

PubMed Central

2013-01-01

Background Olive cDNA libraries to isolate candidate genes that can help enlightening the molecular mechanism of periodicity and / or fruit production were constructed and analyzed. For this purpose, cDNA libraries from the leaves of trees in “on year” and in “off year” in July (when fruits start to appear) and in November (harvest time) were constructed. Randomly selected 100 positive clones from each library were analyzed with respect to sequence and size. A fruit-flesh cDNA library was also constructed and characterized to confirm the reliability of each library’s temporal and spatial properties. Results Quantitative real-time RT-PCR (qRT-PCR) analyses of the cDNA libraries confirmed cDNA molecules that are associated with different developmental stages (e. g. “on year” leaves in July, “off year” leaves in July, leaves in November) and fruits. Hence, a number of candidate cDNAs associated with “on year” and “off year” were isolated. Comparison of the detected cDNAs to the current EST database of GenBank along with other non - redundant databases of NCBI revealed homologs of previously described genes along with several unknown cDNAs. Of around 500 screened cDNAs, 48 cDNA elements were obtained after eliminating ribosomal RNA sequences. These independent transcripts were analyzed using BLAST searches (cutoff E-value of 1.0E-5) against the KEGG and GenBank nucleotide databases and 37 putative transcripts corresponding to known gene functions were annotated with gene names and Gene Ontology (GO) terms. Transcripts in the biological process were found to be related with metabolic process (27%), cellular process (23%), response to stimulus (17%), localization process (8.5%), multicellular organismal process (6.25%), developmental process (6.25%) and reproduction (4.2%). Conclusions A putative P450 monooxigenase expressed fivefold more in the “on year” than that of “off year” leaves in July. Two putative dehydrins expressed significantly more in “on year” leaves than that of “off year” leaves in November. Homologs of UDP – glucose epimerase, acyl - CoA binding protein, triose phosphate isomerase and a putative nuclear core anchor protein were significant in fruits only, while a homolog of an embryo binding protein / small GTPase regulator was detected in “on year” leaves only. One of the two unknown cDNAs was specific to leaves in July while the other was detected in all of the libraries except fruits. KEGG pathway analyses for the obtained sequences correlated with essential metabolisms such as galactose metabolism, amino sugar and nucleotide sugar metabolisms and photosynthesis. Detailed analysis of the results presents candidate cDNAs that can be used to dissect further the genetic basis of fruit production and / or alternate bearing which causes significant economical loss for olive growers. PMID:23552171

Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.

PubMed

Sugimoto, H; Hayashi, H; Yamashita, S

1996-03-29

A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.

A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.

PubMed

Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S

1997-07-01

A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

PubMed Central

Eberwine, James; Bartfai, Tamas

2011-01-01

We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

Novel transcripts of the estrogen receptor α gene in channel catfish

USGS Publications Warehouse

Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian

2000-01-01

Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.

Novel isoprenylated proteins identified by an expression library screen.

PubMed

Biermann, B J; Morehead, T A; Tate, S E; Price, J R; Randall, S K; Crowell, D N

1994-10-14

Isoprenylated proteins are involved in eukaryotic cell growth and signal transduction. The protein determinant for prenylation is a short carboxyl-terminal motif containing a cysteine, to which the isoprenoid is covalently attached via thioether linkage. To date, isoprenylated proteins have almost all been identified by demonstrating the attachment of an isoprenoid to previously known proteins. Thus, many isoprenylated proteins probably remain undiscovered. To identify novel isoprenylated proteins for subsequent biochemical study, colony blots of a Glycine max cDNA expression library were [3H]farnesyl-labeled in vitro. Proteins identified by this screen contained several different carboxyl termini that conform to consensus farnesylation motifs. These proteins included known farnesylated proteins (DnaJ homologs) and several novel proteins, two of which contained six or more tandem repeats of a hexapeptide having the consensus sequence (E/G)(G/P)EK(P/K)K. Thus, plants contain a diverse array of genes encoding farnesylated proteins, and our results indicate that fundamental differences in the identities of farnesylated proteins may exist between plants and other eukaryotes. Expression library screening by direct labeling can be adapted to identify isoprenylated proteins from other organisms, as well as proteins with other post-translational modifications.

Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

PubMed

Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

2008-12-01

Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

Construction of a cDNA library for miniature pig mandibular deciduous molars

PubMed Central

2014-01-01

Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690

Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

PubMed

Eberwine, James; Bartfai, Tamas

2011-03-01

We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

Gibberellin (GA3) enhances cell wall invertase activity and mRNA levels in elongating dwarf pea (Pisum sativum) shoots

NASA Technical Reports Server (NTRS)

Wu, L. L.; Mitchell, J. P.; Cohn, N. S.; Kaufman, P. B.

1993-01-01

The invertase (EC 3.2.1.26) purified from cell walls of dwarf pea stems to homogeneity has a molecular mass of 64 kilodaltons (kD). Poly(A)+RNA was isolated from shoots of dwarf pea plants, and a cDNA library was constructed using lambda gt11 as an expression vector. The expression cDNA library was screened with polyclonal antibodies against pea cell wall invertase. One invertase cDNA clone was characterized as a full-length cDNA with 1,863 base pairs. Compared with other known invertases, one homologous region in the amino acid sequence was found. The conserved motif, Asn-Asp-Pro-Asn-Gly, is located near the N-terminal end of invertase. Northern blot analysis showed that the amount of invertase mRNA (1.86 kb) was rapidly induced to a maximal level 4 h after GA3 treatment, then gradually decreased to the control level. The mRNA level at 4 h in GA3-treated peas was fivefold higher than that of the control group. The maximal increase in activity of pea cell wall invertase elicited by GA3 occcured at 8 h after GA3 treatment. This invertase isoform was shown immunocytochemically to be localized in the cell walls, where a 10-fold higher accumulation occurred in GA3-treated tissue compared with control tissue. This study indicates that the expression of the pea shoot cell-wall invertase gene could be regulated by GA3 at transcriptional and/or translational levels.

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

NASA Technical Reports Server (NTRS)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

Activity-based metagenomic screening and biochemical characterization of bovine ruminal protozoan glycoside hydrolases.

PubMed

Findley, Seth D; Mormile, Melanie R; Sommer-Hurley, Andrea; Zhang, Xue-Cheng; Tipton, Peter; Arnett, Krista; Porter, James H; Kerley, Monty; Stacey, Gary

2011-11-01

The rumen, the foregut of herbivorous ruminant animals such as cattle, functions as a bioreactor to process complex plant material. Among the numerous and diverse microbes involved in ruminal digestion are the ruminal protozoans, which are single-celled, ciliated eukaryotic organisms. An activity-based screen was executed to identify genes encoding fibrolytic enzymes present in the metatranscriptome of a bovine ruminal protozoan-enriched cDNA expression library. Of the four novel genes identified, two were characterized in biochemical assays. Our results provide evidence for the effective use of functional metagenomics to retrieve novel enzymes from microbial populations that cannot be maintained in axenic cultures.

Identification of antigens by monoclonal antibody PD4 and its expression in Escherichia coli

PubMed Central

Ning, Jin-Ying; Sun, Guo-Xun; Huang, Su; Ma, Hong; An, Ping; Meng, Lin; Song, Shu-Mei; Wu, Jian; Shou, Cheng-Chao

2003-01-01

AIM: To clone and express the antigen of monoclonal antibody (MAb) PD4 for further investigation of its function. METHODS: MGC803 cDNA expression library was constructed and screened with PD4 as probes to clone the antigen. After failed in the library screening, immunoprecipitation and SDS-polyacrylamide gel electrophoresis were applied to purify the antigen for sequence analysis. The antigen coming from Mycoplasma hyorhinis (M. hyorhinis) was further confirmed with Western blot analysis by infecting M. hyorhinis -free HeLa cells and eliminating the M. hyorhinis from MGC803 cells. The full p37 gene was cloned by PCR and expressed successfully in Escherichia coli after site-directed mutations. Immunofluorescence assay was used to demonstrate if p37 protein could directly bind to gastric tumor cell AGS. RESULTS: The cDNA library constructed with MGC803 cells was screened by MAb PD4 as probes. Unfortunately, the positive clones identified with MAb PD4 were also reacted with unrelated antibodies. Then, immunoprecipitation was performed and the purified antigen was identified to be a membrane protein of Mycoplasma hyorhinis (M. hyorhinis) by sequencing of N-terminal amino acid residues. The membrane protein was intensively verified with Western blot by eliminating M. hyorhinis from MGC803 cells and by infecting M. hyorhinis-free HeLa cells. The full p37 gene was cloned and expressed successfully in Escherichia coli after site-directed mutations. Immunofluorescence demonstrated that p37 protein could directly bind to gastric tumor cell AGS. CONCLUSION: The antigen recognized by MAb PD4 is from M. hyorhinis, which suggests the actions involved in MAb PD4 is possibly mediated by p37 protein or M. hyorhinis. As p37 protein can bind directly to tumor cells, the pathogenic role of p37 involved in tumorigenesis justifies further investigation. PMID:14562370

Molecular cloning of a novel receptor tyrosine kinase, tif, highly expressed in human ovary and testis.

PubMed

Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J

1994-03-01

Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.

Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

PubMed

Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

2010-04-01

We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

PubMed Central

Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

2010-01-01

Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

EPA Science Inventory

A Bioinformatic Strategy to Rapidly Characterize cDNA Libraries

G. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.
1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

An efficient and sensitive method for preparing cDNA libraries from scarce biological samples

PubMed Central

Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor

2015-01-01

The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322

A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

PubMed

Gadkar, Vijay J; Filion, Martin

2013-06-01

In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

PubMed

Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

1996-08-01

The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

PubMed Central

Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

2010-01-01

In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

Comparison of the efficiency of antibody selection from semi-synthetic scFv and non-immune Fab phage display libraries against protein targets for rapid development of diagnostic immunoassays.

PubMed

Chan, Conrad E Z; Chan, Annie H Y; Lim, Angeline P C; Hanson, Brendon J

2011-10-28

Rapid development of diagnostic immunoassays against novel emerging or genetically modified pathogens in an emergency situation is dependent on the timely isolation of specific antibodies. Non-immune antibody phage display libraries are an efficient in vitro method for selecting monoclonal antibodies and hence ideal in these circumstances. Such libraries can be constructed from a variety of sources e.g. B cell cDNA or synthetically generated, and use a variety of antibody formats, typically scFv or Fab. However, antibody source and format can impact on the quality of antibodies generated and hence the effectiveness of this methodology for the timely production of antibodies. We have carried out a comparative screening of two antibody libraries, a semi-synthetic scFv library and a human-derived Fab library against the protective antigen toxin component of Bacillus anthracis and the epsilon toxin of Clostridium botulinum. We have shown that while the synthetic library produced a diverse collection of specific scFv-phage, these contained a high frequency of unnatural amber stops and glycosylation sites which limited their conversion to IgG, and also a high number which lost specificity when expressed as IgG. In contrast, these limitations were overcome by the use of a natural human library. Antibodies from both libraries could be used to develop sandwich ELISA assays with similar sensitivity. However, the ease and speed with which full-length IgG could be generated from the human-derived Fab library makes screening this type of library the preferable method for rapid antibody generation for diagnostic assay development. Copyright © 2011 Elsevier B.V. All rights reserved.

Rapid isolation of novel FK506 binding proteins from multiple organisms using gDNA and cDNA T7 phage display.

PubMed

Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter

2009-10-01

Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.

Identification of Novel Pro-Migratory, Cancer-Associated Genes Using Quantitative, Microscopy-Based Screening

PubMed Central

Naffar-Abu-Amara, Suha; Shay, Tal; Galun, Meirav; Cohen, Naomi; Isakoff, Steven J.; Kam, Zvi; Geiger, Benjamin

2008-01-01

Background Cell migration is a highly complex process, regulated by multiple genes, signaling pathways and external stimuli. To discover genes or pharmacological agents that can modulate the migratory activity of cells, screening strategies that enable the monitoring of diverse migratory parameters in a large number of samples are necessary. Methodology In the present study, we describe the development of a quantitative, high-throughput cell migration assay, based on a modified phagokinetic tracks (PKT) procedure, and apply it for identifying novel pro-migratory genes in a cancer-related gene library. In brief, cells are seeded on fibronectin-coated 96-well plates, covered with a monolayer of carboxylated latex beads. Motile cells clear the beads, located along their migratory paths, forming tracks that are visualized using an automated, transmitted-light screening microscope. The tracks are then segmented and characterized by multi-parametric, morphometric analysis, resolving a variety of morphological and kinetic features. Conclusions In this screen we identified 4 novel genes derived from breast carcinoma related cDNA library, whose over-expression induces major alteration in the migration of the stationary MCF7 cells. This approach can serve for high throughput screening for novel ways to modulate cellular migration in pathological states such as tumor metastasis and invasion. PMID:18213366

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

PubMed

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

PubMed Central

Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

1998-01-01

Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

PubMed

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

USDA-ARS?s Scientific Manuscript database

Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

PubMed Central

Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

1993-01-01

A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

Expression, Gene Cloning, and Characterization of Five Novel Phytases from Four Basidiomycete Fungi: Peniophora lycii, Agrocybe pediades, a Ceriporia sp., and Trametes pubescens

PubMed Central

Lassen, Søren F.; Breinholt, Jens; Østergaard, Peter R.; Brugger, Roland; Bischoff, Andrea; Wyss, Markus; Fuglsang, Claus C.

2001-01-01

Phytases catalyze the hydrolysis of phosphomonoester bonds of phytate (myo-inositol hexakisphosphate), thereby creating lower forms of myo-inositol phosphates and inorganic phosphate. In this study, cDNA expression libraries were constructed from four basidiomycete fungi (Peniophora lycii, Agrocybe pediades, a Ceriporia sp., and Trametes pubescens) and screened for phytase activity in yeast. One full-length phytase-encoding cDNA was isolated from each library, except for the Ceriporia sp. library where two different phytase-encoding cDNAs were found. All five phytases were expressed in Aspergillus oryzae, purified, and characterized. The phytases revealed temperature optima between 40 and 60°C and pH optima at 5.0 to 6.0, except for the P. lycii phytase, which has a pH optimum at 4.0 to 5.0. They exhibited specific activities in the range of 400 to 1,200 U · mg, of protein−1 and were capable of hydrolyzing phytate down to myo-inositol monophosphate. Surprisingly, 1H nuclear magnetic resonance analysis of the hydrolysis of phytate by all five basidiomycete phytases showed a preference for initial attack at the 6-phosphate group of phytic acid, a characteristic that was believed so far not to be seen with fungal phytases. Accordingly, the basidiomycete phytases described here should be grouped as 6-phytases (EC 3.1.3.26). PMID:11571175

MytiBase: a knowledgebase of mussel (M. galloprovincialis) transcribed sequences

PubMed Central

Venier, Paola; De Pittà, Cristiano; Bernante, Filippo; Varotto, Laura; De Nardi, Barbara; Bovo, Giuseppe; Roch, Philippe; Novoa, Beatriz; Figueras, Antonio; Pallavicini, Alberto; Lanfranchi, Gerolamo

2009-01-01

Background Although Bivalves are among the most studied marine organisms due to their ecological role, economic importance and use in pollution biomonitoring, very little information is available on the genome sequences of mussels. This study reports the functional analysis of a large-scale Expressed Sequence Tag (EST) sequencing from different tissues of Mytilus galloprovincialis (the Mediterranean mussel) challenged with toxic pollutants, temperature and potentially pathogenic bacteria. Results We have constructed and sequenced seventeen cDNA libraries from different Mediterranean mussel tissues: gills, digestive gland, foot, anterior and posterior adductor muscle, mantle and haemocytes. A total of 24,939 clones were sequenced from these libraries generating 18,788 high-quality ESTs which were assembled into 2,446 overlapping clusters and 4,666 singletons resulting in a total of 7,112 non-redundant sequences. In particular, a high-quality normalized cDNA library (Nor01) was constructed as determined by the high rate of gene discovery (65.6%). Bioinformatic screening of the non-redundant M. galloprovincialis sequences identified 159 microsatellite-containing ESTs. Clusters, consensuses, related similarities and gene ontology searches have been organized in a dedicated, searchable database . Conclusion We defined the first species-specific catalogue of M. galloprovincialis ESTs including 7,112 unique transcribed sequences. Putative microsatellite markers were identified. This annotated catalogue represents a valuable platform for expression studies, marker validation and genetic linkage analysis for investigations in the biology of Mediterranean mussels. PMID:19203376

The yeast two hybrid system in a screen for proteins interacting with axolotl (Ambystoma mexicanum) Msx1 during early limb regeneration.

PubMed

Abuqarn, Mehtap; Allmeling, Christina; Amshoff, Inga; Menger, Bjoern; Nasser, Inas; Vogt, Peter M; Reimers, Kerstin

2011-07-01

Urodele amphibians are exceptional in their ability to regenerate complex body structures such as limbs. Limb regeneration depends on a process called dedifferentiation. Under an inductive wound epidermis terminally differentiated cells transform to pluripotent progenitor cells that coordinately proliferate and eventually redifferentiate to form the new appendage. Recent studies have developed molecular models integrating a set of genes that might have important functions in the control of regenerative cellular plasticity. Among them is Msx1, which induced dedifferentiation in mammalian myotubes in vitro. Herein, we screened for interaction partners of axolotl Msx1 using a yeast two hybrid system. A two hybrid cDNA library of 5-day-old wound epidermis and underlying tissue containing more than 2×10⁶ cDNAs was constructed and used in the screen. 34 resulting cDNA clones were isolated and sequenced. We then compared sequences of the isolated clones to annotated EST contigs of the Salamander EST database (BLASTn) to identify presumptive orthologs. We subsequently searched all no-hit clone sequences against non redundant NCBI sequence databases using BLASTx. It is the first time, that the yeast two hybrid system was adapted to the axolotl animal model and successfully used in a screen for proteins interacting with Msx1 in the context of amphibian limb regeneration. 2011 Elsevier B.V. All rights reserved.

Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library.

PubMed

Zhou, Hui; Zhao, Jin; Yu, Chuan-He; Luo, Qing-Jun; Chen, Yue-Qin; Xiao, Yu; Qu, Liang-Hu

2004-02-18

By construction and screen of mouse nucleolar cDNA library, a novel mammalian small nucleolar RNAs (snoRNA) was identified. The novel snoRNA, 70 nt in length, displays structural features typical of C/D box snoRNA family. The snoRNA possesses an 11-nt-long rRNA antisense element and is predicted to guide the 2'-O-methylation of mouse 28S rRNA at G4043, a site unknown so far to be modified in vertebrates. The comparison of functional element of snoRNA guides among eukaryotes reveals that the novel snoRNA is a mammalian counterpart of yeast snR38 despite highly divergent sequence between them. Mouse and human snR38 and other cognates in distant vertebrates were positively detected with slight length variability. As expected, the rRNA ribose-methylation site predicted by mouse snR38 was precisely mapped by specific-primer extension assay. Furthermore, our analyses show that mouse and human snR38 gene have multiple variants and are nested in the introns of different host genes with unknown function. Thus, snR38 is a phylogenetically conserved methylation guide but exhibits different genomic organization in eukaryotes.

ORF phage display to identify cellular proteins with different functions.

PubMed

Li, Wei

2012-09-01

Open reading frame (ORF) phage display is a new branch of phage display aimed at improving its efficiency to identify cellular proteins with specific binding or functional activities. Despite the success of phage display with antibody libraries and random peptide libraries, phage display with cDNA libraries of cellular proteins identifies a high percentage of non-ORF clones encoding unnatural short peptides with minimal biological implications. This is mainly because of the uncontrollable reading frames of cellular proteins in conventional cDNA libraries. ORF phage display solves this problem by eliminating non-ORF clones to generate ORF cDNA libraries. Here I summarize the procedures of ORF phage display, discuss the factors influencing its efficiency, present examples of its versatile applications, and highlight evidence of its capability of identifying biologically relevant cellular proteins. ORF phage display coupled with different selection strategies is capable of delineating diverse functions of cellular proteins with unique advantages. Copyright © 2012 Elsevier Inc. All rights reserved.

Screening of binding proteins that interact with Chinese sacbrood virus VP3 capsid protein in Apis cerana larvae cDNA library by the yeast two-hybrid method.

PubMed

Fei, Dongliang; Wei, Dong; Yu, Xiaolei; Yue, Jinjin; Li, Ming; Sun, Li; Jiang, Lili; Li, Yijing; Diao, Qingyun; Ma, Mingxiao

2018-03-15

Chinese sacbrood virus (CSBV) causes larval death and apiary collapse of Apis cerana. VP3 is a capsid protein of CSBV but its function is poorly understood. To determine the function of VP3 and screen for novel binding proteins that interact with VP3, we conducted yeast two-hybrid screening, glutathione S-transferase pull-down, and co-immunoprecipitation assays. Galectin (GAL) is a protein involved in immune regulation and host-pathogen interactions. The yeast two-hybrid screen implicated GAL as a major VP3-binding candidate. The assays showed that the VP3 interacted with GAL. Identification of these cellular targets and clarifying their contributions to the host-pathogen interaction may be useful for the development of novel therapeutic and prevention strategies against CSBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

An open reading frame in intron seven of the sea urchin DNA-methyltransferase gene codes for a functional AP1 endonuclease.

PubMed

Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita

2002-08-01

Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.

Cloning of human cDNA encoding a novel heptahelix receptor expressed in Burkitt's lymphoma and widely distributed in brain and peripheral tissues.

PubMed

Owman, C; Blay, P; Nilsson, C; Lolait, S J

1996-11-12

Using PCR with degenerate primers and screening of a human B-cell lymphoblast cDNA library, a full-length cDNA encoding a 375-amino-acid protein was isolated. It contains seven regions of hydrophobic amino acids probably representing membrane-spanning domains of a novel heptahelix receptor, tentatively named CMKRL2. It shows nearly 30% overall identity with the high-affinity IL8 receptor and similar degree of homology with other chemoattractant receptors, including the "fusin" coreceptors for HIV1. Measurements of various transduction pathways following application of a panel of chemokines to transfected cells failed to evoke any reproducible response. Although the natural ligand for CMKRL2 could, thus, not be identified, receptor expression in spleen and lymph nodes as well as in Burkitt's lymphoma (irrespective of EBV status) supports a functional role in activated B-cells. Receptor message was ubiquitously distributed in normal peripheral tissues and CNS, suggesting that CMKRL2 is expressed in widespread cell populations, such as macrophages and neuroglia.

Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

PubMed

Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

1995-12-12

Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

Identification of genes differentially expressed in association with acquired cisplatin resistance

PubMed Central

Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G

2000-01-01

The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653

Construction and application of EST library from Setaria italica in response to dehydration stress.

PubMed

Zhang, Jinpeng; Liu, Tingsong; Fu, Junjie; Zhu, Yun; Jia, Jinping; Zheng, Jun; Zhao, Yinhe; Zhang, Ying; Wang, Guoying

2007-07-01

Foxtail millet is a gramineous crop with low water requirement. Despite its high water use efficiency, less attention has been paid to the molecular genetics of foxtail millet. This article reports the construction of subtracted cDNA libraries from foxtail millet seedlings under dehydration stress and the expression profile analysis of 1947 UniESTs from the subtracted cDNA libraries by a cDNA microarray. The results showed that 95 and 57 ESTs were upregulated by dehydration stress, respectively, in roots and shoots of seedlings and that 10 and 27 ESTs were downregulated, respectively, in roots and shoots. The expression profile analysis showed that genes induced in foxtail millet roots were different from those in shoots during dehydration stress and that the early response to dehydration stress in foxtail millet roots was the activation of the glycolysis metabolism. Moreover, protein degradation pathway may also play a pivotal role in drought-tolerant responses of foxtail millet. Finally, Northern blot analysis validated well the cDNA microarray data.

BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.

1998-01-01

We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.

Differential cDNA cloning by enzymatic degrading subtraction (EDS).

PubMed Central

Zeng, J; Gorski, R A; Hamer, D

1994-01-01

We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268

Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

PubMed

Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

2007-06-01

As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

PubMed Central

2011-01-01

Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559

Genomic resources for songbird research and their use in characterizing gene expression during brain development

PubMed Central

Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

2007-01-01

Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

Temporal and Spatial Expression of a Polygalacturonase during Leaf and Flower Abscission in Oilseed Rape and Arabidopsis1

PubMed Central

González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan

2002-01-01

During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157

RING-type ubiquitin ligase McCPN1 catalyzes UBC8-dependent protein ubiquitination and interacts with Argonaute 4 in halophyte ice plant.

PubMed

Li, Chang-Hua; Chiang, Chih-Pin; Yang, Jun-Yi; Ma, Chia-Jou; Chen, Yu-Chan; Yen, Hungchen Emilie

2014-07-01

RING-type copines are a small family of plant-specific RING-type ubiquitin ligases. They contain an N-terminal myristoylation site for membrane anchoring, a central copine domain for substrate recognition, and a C-terminal RING domain for E2 docking. RING-type copine McCPN1 (copine1) from halophyte ice plant (Mesembryanthemum crystallinum L.) was previously identified from a salt-induced cDNA library. In this work, we characterize the activity, expression, and localization of McCPN1 in ice plant. An in vitro ubiquitination assay of McCPN1 was performed using two ice plant UBCs, McUBC1 and McUBC2, characterized from the same salt-induced cDNA library. The results showed that McUBC2, a member of the UBC8 family, stimulated the autoubiquitination activity of McCPN1, while McUBC1, a homolog of the UBC35 family, did not. The results indicate that McCPN1 has selective E2-dependent E3 ligase activity. We found that McCPN1 localizes primarily on the plasma membrane and in the nucleus of plant cells. Under salt stress, the accumulation of McCPN1 in the roots increases. A yeast two-hybrid screen was used to search for potential McCPN1-interacting partners using a library constructed from salt-stressed ice plants. Screening with full-length McCPN1 identified several independent clones containing partial Argonaute 4 (AGO4) sequence. Subsequent agro-infiltration, protoplast two-hybrid analysis, and bimolecular fluorescence complementation assay confirmed that McCPN1 and AGO4 interacted in vivo in the nucleus of plant cells. The possible involvement of a catalyzed degradation of AGO4 by McCPN1 in response to salt stress is discussed. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants.

PubMed

Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

2002-06-15

To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.

Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis

PubMed Central

Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.

1999-01-01

With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933

The Drosophila gene collection: Identification of putative full-length cDNAs for 70 percent of D. melanogaster genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stapleton, Mark; Liao, Guochun; Brokstein, Peter

2002-08-12

Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less

Construction of Rabbit Immune Antibody Libraries.

PubMed

Nguyen, Thi Thu Ha; Lee, Jong Seo; Shim, Hyunbo

2018-01-01

Rabbits have distinct advantages over mice as a source of target-specific antibodies. They produce higher affinity antibodies than mice, and may elicit strong immune response against antigens or epitopes that are poorly immunogenic or tolerated in mice. However, a great majority of currently available monoclonal antibodies are of murine origin because of the wider availability of murine fusion partner cell lines and well-established tools and protocols for fusion and cloning of mouse hybridoma. Phage-display selection of antibody libraries is an alternative method to hybridoma technology for the generation of target-specific monoclonal antibodies. High-affinity monoclonal antibodies from nonmurine species can readily be obtained by constructing immune antibody libraries from B cells of the immunized animal and screening the library by phage display. In this article, we describe the construction of a rabbit immune Fab library for the facile isolation of rabbit monoclonal antibodies. After immunization, B-cell cDNA is obtained from the spleen of the animal, from which antibody variable domain repertoires are amplified and assembled into a Fab repertoire by PCR. The Fab genes are then cloned into a phagemid vector and transformed to E. coli, from which a phage-displayed immune Fab library is rescued. Such a library can be biopanned against the immunization antigen for rapid identification of high-affinity, target-specific rabbit monoclonal antibodies.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

1994-07-15

The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

PubMed

Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

2005-01-01

We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

Errors in CGAP xProfiler and cDNA DGED: the importance of library parsing and gene selection algorithms.

PubMed

Milnthorpe, Andrew T; Soloviev, Mikhail

2011-04-15

The Cancer Genome Anatomy Project (CGAP) xProfiler and cDNA Digital Gene Expression Displayer (DGED) have been made available to the scientific community over a decade ago and since then were used widely to find genes which are differentially expressed between cancer and normal tissues. The tissue types are usually chosen according to the ontology hierarchy developed by NCBI. The xProfiler uses an internally available flat file database to determine the presence or absence of genes in the chosen libraries, while cDNA DGED uses the publicly available UniGene Expression and Gene relational databases to count the sequences found for each gene in the presented libraries. We discovered that the CGAP approach often includes libraries from dependent or irrelevant tissues (one third of libraries were incorrect on average, with some tissue searches no correct libraries being selected at all). We also discovered that the CGAP approach reported genes from outside the selected libraries and may omit genes found within the libraries. Other errors include the incorrect estimation of the significance values and inaccurate settings for the library size cut-off values. We advocated a revised approach to finding libraries associated with tissues. In doing so, libraries from dependent or irrelevant tissues do not get included in the final library pool. We also revised the method for determining the presence or absence of a gene by searching the UniGene relational database, revised calculation of statistical significance and sorted the library cut-off filter. Our results justify re-evaluation of all previously reported results where NCBI CGAP expression data and tools were used.

Errors in CGAP xProfiler and cDNA DGED: the importance of library parsing and gene selection algorithms

PubMed Central

2011-01-01

Background The Cancer Genome Anatomy Project (CGAP) xProfiler and cDNA Digital Gene Expression Displayer (DGED) have been made available to the scientific community over a decade ago and since then were used widely to find genes which are differentially expressed between cancer and normal tissues. The tissue types are usually chosen according to the ontology hierarchy developed by NCBI. The xProfiler uses an internally available flat file database to determine the presence or absence of genes in the chosen libraries, while cDNA DGED uses the publicly available UniGene Expression and Gene relational databases to count the sequences found for each gene in the presented libraries. Results We discovered that the CGAP approach often includes libraries from dependent or irrelevant tissues (one third of libraries were incorrect on average, with some tissue searches no correct libraries being selected at all). We also discovered that the CGAP approach reported genes from outside the selected libraries and may omit genes found within the libraries. Other errors include the incorrect estimation of the significance values and inaccurate settings for the library size cut-off values. We advocated a revised approach to finding libraries associated with tissues. In doing so, libraries from dependent or irrelevant tissues do not get included in the final library pool. We also revised the method for determining the presence or absence of a gene by searching the UniGene relational database, revised calculation of statistical significance and sorted the library cut-off filter. Conclusion Our results justify re-evaluation of all previously reported results where NCBI CGAP expression data and tools were used. PMID:21496233

Characterization of hampin/MSL1 as a node in the nuclear interactome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dmitriev, Ruslan I.; Korneenko, Tatyana V.; Department of Physiology, Pharmacology, Metabolism, and Cardiovascular Sciences, University of Toledo College of Medicine, Toledo, OH 43614

2007-04-20

Hampin, homolog of Drosophila MSL1, is a partner of histone acetyltransferase MYST1/MOF. Functions of these proteins remain poorly understood beyond their participation in chromatin remodeling complex MSL. In order to identify new proteins interacting with hampin, we screened a mouse cDNA library in yeast two-hybrid system with mouse hampin as bait and found five high-confidence interactors: MYST1, TPR proteins TTC4 and KIAA0103, NOP17 (homolog of a yeast nucleolar protein), and transcription factor GC BP. Subsequently, all these proteins were used as baits in library screenings and more new interactions were found: tumor suppressor RASSF1C and spliceosome component PRP3 for KIAA0103,more » ring finger RNF10 for RASSF1C, and RNA polymerase II regulator NELF-C for MYST1. The majority of the observed interactions was confirmed in vitro by pull-down of bacterially expressed proteins. Reconstruction of a fragment of mammalian interactome suggests that hampin may be linked to diverse regulatory processes in the nucleus.« less

The EML4-ALK oncogene: targeting an essential growth driver in human cancer.

PubMed

Mano, Hiroyuki

2015-01-01

Targeting of essential growth drivers represents an ideal approach to cancer treatment. To identify such molecules in clinical specimens, we developed a highly sensitive functional screening system based on the preparation of retroviral cDNA expression libraries. By screening such a library of lung adenocarcinoma with a focus formation assay, we discovered the EML4-ALK fusion-type oncogene. A small chromosomal inversion thus leads to fusion of the amino-terminal portion of the microtubule-associated protein EML4 to the intracellular kinase domain of ALK, a receptor-type protein tyrosine kinase. Constitutive dimerization of EML4-ALK mediated by a dimerization motif of EML4 results in kinase activation. Specific inhibitors of the kinase activity of ALK have been developed as therapeutic drugs for EML4-ALK-positive lung cancer, three of which (crizotinib, ceritinib, and alectinib) have already been approved for clinical use. An overall clinical response rate of 93.5% for alectinib has shown that agents that target essential growth drivers can become magic bullets for cancer treatment.

The EML4-ALK oncogene: targeting an essential growth driver in human cancer

PubMed Central

MANO, Hiroyuki

2015-01-01

Targeting of essential growth drivers represents an ideal approach to cancer treatment. To identify such molecules in clinical specimens, we developed a highly sensitive functional screening system based on the preparation of retroviral cDNA expression libraries. By screening such a library of lung adenocarcinoma with a focus formation assay, we discovered the EML4-ALK fusion-type oncogene. A small chromosomal inversion thus leads to fusion of the amino-terminal portion of the microtubule-associated protein EML4 to the intracellular kinase domain of ALK, a receptor-type protein tyrosine kinase. Constitutive dimerization of EML4-ALK mediated by a dimerization motif of EML4 results in kinase activation. Specific inhibitors of the kinase activity of ALK have been developed as therapeutic drugs for EML4-ALK–positive lung cancer, three of which (crizotinib, ceritinib, and alectinib) have already been approved for clinical use. An overall clinical response rate of 93.5% for alectinib has shown that agents that target essential growth drivers can become magic bullets for cancer treatment. PMID:25971657

Regulating ehrlich and demethiolation pathways for alcohols production by the expression of ubiquitin-protein ligase gene HUWE1.

PubMed

Zhang, Quan; Jia, Kai-Zhi; Xia, Shi-Tao; Xu, Yang-Hua; Liu, Rui-Sang; Li, Hong-Mei; Tang, Ya-Jie

2016-02-10

Ehrlich and demethiolation pathways as two competing branches converted amino acid into alcohols. Controlling both pathways offers considerable potential for industrial applications including alcohols overproduction, flavor-quality control and developing new flavors. While how to regulate ehrlich and demethiolation pathways is still not applicable. Taking the conversion of methionine into methionol and methanethiol for example, we constructed two suppression subtractive cDNA libraries of Clonostachys rosea by using suppression subtractive hybridization (SSH) technology for screening regulators controlling the conversion. E3 ubiquitin-protein ligase gene HUWE1 screened from forward SSH library was validated to be related with the biosynthesis of end products. Overexpressing HUWE1 in C. rosea and S. cerevisiae significantly increased the biosynthesis of methanethiol and its derivatives in demethiolation pathway, while suppressed the biosynthesis of methional and methionol in ehrlich pathway. These results attained the directional regulation of both pathways by overexpressing HUWE1. Thus, HUWE1 has potential to be a key target for controlling and enhancing alcohols production by metabolic engineering.

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Molecular cloning and expression of rat brain endopeptidase 3.4.24.16.

PubMed

Dauch, P; Vincent, J P; Checler, F

1995-11-10

We have isolated by immunological screening of a lambda ZAPII cDNA library constructed from rat brain mRNAs a cDNA clone encoding endopeptidase 3.4.24.16. The longest open reading frame encodes a 704-amino acid protein with a theoretical molecular mass of 80,202 daltons and bears the consensus sequence of the zinc metalloprotease family. The sequence exhibits a 60.2% homology with those of another zinc metallopeptidase, endopeptidase 3.4.24.15. Northern blot analysis reveals two mRNA species of about 3 and 5 kilobases in rat brain, ileum, kidney, and testis. We have transiently transfected COS-7 cells with pcDNA3 containing the cloned cDNA and established the overexpression of a 70-75-kDa immunoreactive protein. This protein hydrolyzes QFS, a quenched fluorimetric substrate of endopeptidase 3.4.24.16, and cleaves neurotensin at a single peptide bond, leading to the formation of neurotensin (1-10) and neurotensin (11-13). QFS and neurotensin hydrolysis are potently inhibited by the selective endopeptidase 3.4.24.16 dipeptide blocker Pro-Ile and by dithiothreitol, while the enzymatic activity remains unaffected by phosphoramidon and captopril, the specific inhibitors of endopeptidase 3.4.24.11 and angiotensin-converting enzyme, respectively. Altogether, these physicochemical, biochemical, and immunological properties unambiguously identify endopeptidase 3.4.24.16 as the protein encoded by the isolated cDNA clone.

The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

PubMed

Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

1990-01-05

We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Proteomic screening of variola virus reveals a unique NF-kappaB inhibitor that is highly conserved among pathogenic orthopoxviruses.

PubMed

Mohamed, Mohamed R; Rahman, Masmudur M; Lanchbury, Jerry S; Shattuck, Donna; Neff, Chris; Dufford, Max; van Buuren, Nick; Fagan, Katharine; Barry, Michele; Smith, Scott; Damon, Inger; McFadden, Grant

2009-06-02

Identification of the binary interactions between viral and host proteins has become a valuable tool for investigating viral tropism and pathogenesis. Here, we present the first systematic protein interaction screening of the unique variola virus proteome by using yeast 2-hybrid screening against a variety of human cDNA libraries. Several protein-protein interactions were identified, including an interaction between variola G1R, an ankryin/F-box containing protein, and human nuclear factor kappa-B1 (NF-kappaB1)/p105. This represents the first direct interaction between a pathogen-encoded protein and NF-kappaB1/p105. Orthologs of G1R are present in a variety of pathogenic orthopoxviruses, but not in vaccinia virus, and expression of any one of these viral proteins blocks NF-kappaB signaling in human cells. Thus, proteomic screening of variola virus has the potential to uncover modulators of the human innate antiviral responses.

A simple and novel method for RNA-seq library preparation of single cell cDNA analysis by hyperactive Tn5 transposase.

PubMed

Brouilette, Scott; Kuersten, Scott; Mein, Charles; Bozek, Monika; Terry, Anna; Dias, Kerith-Rae; Bhaw-Rosun, Leena; Shintani, Yasunori; Coppen, Steven; Ikebe, Chiho; Sawhney, Vinit; Campbell, Niall; Kaneko, Masahiro; Tano, Nobuko; Ishida, Hidekazu; Suzuki, Ken; Yashiro, Kenta

2012-10-01

Deep sequencing of single cell-derived cDNAs offers novel insights into oncogenesis and embryogenesis. However, traditional library preparation for RNA-seq analysis requires multiple steps with consequent sample loss and stochastic variation at each step significantly affecting output. Thus, a simpler and better protocol is desirable. The recently developed hyperactive Tn5-mediated library preparation, which brings high quality libraries, is likely one of the solutions. Here, we tested the applicability of hyperactive Tn5-mediated library preparation to deep sequencing of single cell cDNA, optimized the protocol, and compared it with the conventional method based on sonication. This new technique does not require any expensive or special equipment, which secures wider availability. A library was constructed from only 100 ng of cDNA, which enables the saving of precious specimens. Only a few steps of robust enzymatic reaction resulted in saved time, enabling more specimens to be prepared at once, and with a more reproducible size distribution among the different specimens. The obtained RNA-seq results were comparable to the conventional method. Thus, this Tn5-mediated preparation is applicable for anyone who aims to carry out deep sequencing for single cell cDNAs. Copyright © 2012 Wiley Periodicals, Inc.

Sequence evaluation of four specific cDNA libraries for developmental genomics of sunflower.

PubMed

Tamborindeguy, C; Ben, C; Liboz, T; Gentzbittel, L

2004-04-01

Four different cDNA libraries were constructed from sunflower protoplasts growing under embryogenic and non-embryogenic conditions: one standard library from each condition and two subtractive libraries in opposite sense. A total of 22,876 cDNA clones were obtained and 4800 ESTs were sequenced, giving rise to 2479 high quality ESTs representing an unigene set of 1502 sequences. This set was compared with ESTs represented in public databases using the programs BLASTN and BLASTX, and its members were classified according to putative function using the catalog in the Kyoto Encyclopedia of Genes and Genomes (KEGG). Some 33% of sequences failed to align with existing plant ESTs and therefore represent putative novel genes. The libraries show a low level of redundancy and, on average, 50% of the present ESTs have not been previously reported for sunflower. Several potentially interesting genes were identified, based on their homology with genes involved in animal zygotic division or plant embryogenesis. We also identified two ESTs that show significantly different levels of expression under embryogenic and non-embryogenic conditions. The libraries described here represent an original and valuable resource for the discovery of yet unknown genes putatively involved in dicot embryogenesis and improving our knowledge of the mechanisms involved in polarity acquisition by plant embryos.

Evolution of the feruloyl esterase MtFae1a from Myceliophthora thermophila towards improved catalysts for antioxidants synthesis.

PubMed

Varriale, Simona; Cerullo, Gabriella; Antonopoulou, Io; Christakopoulos, Paul; Rova, Ulrika; Tron, Thierry; Fauré, Régis; Jütten, Peter; Piechot, Alexander; Brás, Joana L A; Fontes, Carlos M G A; Faraco, Vincenza

2018-06-01

The chemical syntheses currently employed for industrial purposes, including in the manufacture of cosmetics, present limitations such as unwanted side reactions and the need for harsh chemical reaction conditions. In order to overcome these drawbacks, novel enzymes are developed to catalyze the targeted bioconversions. In the present study, a methodology for the construction and the automated screening of evolved variants library of a Type B feruloyl esterase from Myceliophthora thermophila (MtFae1a) was developed and applied to generation of 30,000 mutants and their screening for selecting the variants with higher activity than the wild-type enzyme. The library was generated by error-prone PCR of mtfae1a cDNA and expressed in Saccharomyces cerevisiae. Screening for extracellular enzymatic activity towards 4-nitrocatechol-1-yl ferulate, a new substrate developed ad hoc for high-throughput assays of feruloyl esterases, led to the selection of 30 improved enzyme variants. The best four variants and the wild-type MtFae1a were investigated in docking experiments with hydroxycinnamic acid esters using a model of 3D structure of MtFae1a. These variants were also used as biocatalysts in transesterification reactions leading to different target products in detergentless microemulsions and showed enhanced synthetic activities, although the screening strategy had been based on improved hydrolytic activity.

Construction and Evaluation of Normalized cDNA Libraries Enriched with Full-Length Sequences for Rapid Discovery of New Genes from Sisal (Agave sisalana Perr.) Different Developmental Stages

PubMed Central

Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

2012-01-01

To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing. PMID:23202944

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

PubMed

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Evidence of accelerated evolution and ectodermal-specific expression of presumptive BDS toxin cDNAs from Anemonia viridis.

PubMed

Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela

2013-10-30

Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.

Construction and characterization of a normalized cDNA library of Nannochloropsis oculata (Eustigmatophyceae)

NASA Astrophysics Data System (ADS)

Yu, Jianzhong; Ma, Xiaolei; Pan, Kehou; Yang, Guanpin; Yu, Wengong

2010-07-01

We constructed and characterized a normalized cDNA library of Nannochloropsis oculata CS-179, and obtained 905 nonredundant sequences (NRSs) ranging from 431-1 756 bp in length. Among them, 496 were very similar to nonredundant ones in the GenBank ( E ≤1.0e-05), and 349 ESTs had significant hits with the clusters of eukaryotic orthologous groups (KOG). Bases G and/or C at the third position of codons of 14 amino acid residues suggested a strong bias in the conserved domain of 362 NRSs (>60%). We also identified the unigenes encoding phosphorus and nitrogen transporters, suggesting that N. oculata could efficiently transport and metabolize phosphorus and nitrogen, and recognized the unigenes that involved in biosynthesis and storage of both fatty acids and polyunsaturated fatty acids (PUFAs), which will facilitate the demonstration of eicosapentaenoic acid (EPA) biosynthesis pathway of N. oculata. In comparison with the original cDNA library, the normalized library significantly increased the efficiencies of random sequencing and rarely expressed genes discovering, and decreased the frequency of abundant gene sequences.

[Construction of a phage antibody library and screening of anti-epidermal growth factor receptor variant III single chain antibody].

PubMed

Han, Dong-gang; Duan, Xiao-yi; Guo, You-min; Zhou, Qi; Wang, Quan-ying; Yang, Guang-xiao

2010-01-01

To obtain specific anti-epidermal growth factor receptor variant III (EGFRvIII) single chain antibody (ScFv) by phage antibody library display system. The total RNA was extracted from the spleen B cells of BALB/c mice immunized with pep-3-OVA protein, and the first-strand cDNA was synthesized by reverse transcription. Antibody VH and VL gene fragments were amplified and joined to a ScFv gene with the linker. The ScFv gene was ligated into the phagemid vector pCANTAB5E, which was transformed into competent E. coli TG1. The transformed cells were then infected with M13KO7 helper phage to yield the recombinant phage to construct the phage ScFv library. Pep-3-BSA protein was used to screen the phage antibody library and ELISA carried out to characterize the activity of the antibody. The VH and VL gene fragments of the antibody were about 350 bp and 320 bp in length as analyzed by agarose gel electrophoresis. The ScFv gene was 780 bp, consistent with the expected length. The recombinant phagemid with ScFv gene insert was rescued, and an immune phage ScFv library with the content of 5.0x10(6) was constructed. The recombinant ScFv phage had a titer of 3.0x10(4) cfu/ml, and the fourth phage harvest yielded 56 times as much as that of the first one. SDS-PAGE demonstrated a molecular mass of the soluble ScFv of about 28 kD. ELISA results indicated good specificity of the ScFv to bind EGFRvIII. An immune phage ScFv library is successfully constructed, and the ScFv antibody fragment is capable of specific binding to EGFRvIII.

Molecular imprint of enzyme active site by camel nanobodies: rapid and efficient approach to produce abzymes with alliinase activity.

PubMed

Li, Jiang-Wei; Xia, Lijie; Su, Youhong; Liu, Hongchun; Xia, Xueqing; Lu, Qinxia; Yang, Chunjin; Reheman, Kalbinur

2012-04-20

Screening of inhibitory Ab1 antibodies is a critical step for producing catalytic antibodies in the anti-idiotypic approach. However, the incompatible surface of the active site of the enzyme and the antigen-binding site of heterotetrameric conventional antibodies become the limiting step. Because camelid-derived nanobodies possess the potential to preferentially bind to the active site of enzymes due to their small size and long CDR3, we have developed a novel approach to produce antibodies with alliinase activities by exploiting the molecular mimicry of camel nanobodies. By screening the camelid-derived variable region of the heavy chain cDNA phage display library with alliinase, we obtained an inhibitory nanobody VHHA4 that recognizes the active site. Further screening with VHHA4 from the same variable domain of the heavy chain of a heavy-chain antibody library led to a higher incidence of anti-idiotypic Ab2 abzymes with alliinase activities. One of the abzymes, VHHC10, showed the highest activity that can be inhibited by Ab1 VHHA4 and alliinase competitive inhibitor penicillamine and significantly suppressed the B16 tumor cell growth in the presence of alliin in vitro. The results highlight the feasibility of producing abzymes via anti-idiotypic nanobody approach.

A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

NASA Technical Reports Server (NTRS)

Reddy, A. S.; Reddy, V. S.; Golovkin, M.

2000-01-01

Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

A novel 53-kDa nodulin of the symbiosome membrane of soybean nodules, controlled by Bradyrhizobium japonicum.

PubMed

Winzer, T; Bairl, A; Linder, M; Linder, D; Werner, D; Müller, P

1999-03-01

A nodule-specific 53-kDa protein (GmNOD53b) of the symbiosome membrane from soybean was isolated and its LysC digestion products were microsequenced. cDNA clones of this novel nodulin, obtained from cDNA library screening with an RT-PCR (reverse-transcriptase polymerase chain reaction)-generated hybridization probe exhibited no homology to proteins identified so far. The expression of GmNOD53b coincides with the onset of nitrogen fixation. Therefore, it is a late nodulin. Among other changes, the GmNOD53b is significantly reduced in nodules infected with the Bradyrhizobium japonicum mutant 184 on the protein level as well as on the level of mRNA expression, compared with the wild-type infected nodules. The reduction of GmNOD53b mRNA is related to an inactivation of the sipF gene in B. japonicum 184, coding for a functionally active signal peptidase.

Cloning and expression analysis of a gene that shows developmental regulation upon tuberization in potato.

PubMed

Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S

1997-01-01

Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.

Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

NASA Astrophysics Data System (ADS)

Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

1995-12-01

Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

Cloning of a new member of the insulin gene superfamily (INSL4) expressed in human placenta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chassin, D.; Laurent, A.; Janneau, J.L.

1995-09-20

A new member of the insulin gene superfamily was identified by screening a subtracted cDNA library of first-trimester human placenta and, hence, was tentatively named early placenta insulin-like peptide (EPIL). In this paper, we report the cloning and sequencing of the EPIL cDNA and the EPIL gene (INSL4). Comparison of the deduced amino acid sequence of the early placenta insulin-like peptide revealed significant overall and structural homologies with members of the insulin-like hormone superfamily. Moreover, the organization of the early placenta insulin-like gene, which is composed of two exons and one intron, is similiar to that of insulin and relaxin.more » By in situ hybridization, the INSL4 gene was assigned to band p24 of the short arm of chromosome 9. RT-PCR analysis of EPIL tissue distribution revealed that its transcripts are expressed in the placenta and uterus. 22 refs., 3 figs.« less

Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

PubMed

Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

2015-10-26

Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

Characterization of the venom from the Australian scorpion Urodacus yaschenkoi: Molecular mass analysis of components, cDNA sequences and peptides with antimicrobial activity.

PubMed

Luna-Ramírez, Karen; Quintero-Hernández, Veronica; Vargas-Jaimes, Leonel; Batista, Cesar V F; Winkel, Kenneth D; Possani, Lourival D

2013-03-01

The Urodacidae scorpions are the most widely distributed of the four families in Australia and represent half of the species in the continent, yet their venoms remain largely unstudied. This communication reports the first results of a proteome analysis of the venom of the scorpion Urodacus yaschenkoi performed by mass fingerprinting, after high performance liquid chromatography (HPLC) separation. A total of 74 fractions were obtained by HPLC separation allowing the identification of approximately 274 different molecular masses with molecular weights varying from 287 to 43,437 Da. The most abundant peptides were those from 1 K Da and 4-5 K Da representing antimicrobial peptides and putative potassium channel toxins, respectively. Three such peptides were chemically synthesized and tested against Gram-positive and Gram-negative bacteria showing minimum inhibitory concentration in the low micromolar range, but with moderate hemolytic activity. It also reports a transcriptome analysis of the venom glands of the same scorpion species, undertaken by constructing a cDNA library and conducting random sequencing screening of the transcripts. From the resultant cDNA library 172 expressed sequence tags (ESTs) were analyzed. These transcripts were further clustered into 120 unique sequences (23 contigs and 97 singlets). The identified putative proteins can be assorted in several groups, such as those implicated in common cellular processes, putative neurotoxins and antimicrobial peptides. The scorpion U. yaschenkoi is not known to be dangerous to humans and its venom contains peptides similar to those of Opisthacanthus cayaporum (antibacterial), Scorpio maurus palmatus (maurocalcin), Opistophthalmus carinatus (opistoporines) and Hadrurus gerstchi (scorpine-like molecules), amongst others. Copyright © 2012 Elsevier Ltd. All rights reserved.

Submesoscale characteristics and transcription of a fatty acid elongase gene from a freshwater green microalgae, Myrmecia incisa Reisigl

NASA Astrophysics Data System (ADS)

Yu, Shuiyan; Liu, Shicheng; Li, Chunyang; Zhou, Zhigang

2011-01-01

Myrmecia incisa is a green coccoid freshwater microalgae, which is rich in arachidonic acid (ArA, C20: 4ω-6, δ5, 8, 11, 14), a long chain polyunsaturated fatty acid (PUFA), especially under nitrogen starvation stress. A cDNA library of M. incisa was constructed with λ phage vectors and a 545 nt expressed sequence tag (EST) was screened from this library as a putative elongase gene due to its 56% and 49% identity to Marchantia polymorpha L. and Ostreococcus tauri Courties et Chrétiennot-Dinet, respectively. Based upon this EST sequence, an elongase gene designated MiFAE was isolated from M. incisa via 5'/3' rapid amplification of cDNA ends (RACE). The cDNA sequence was 1 331 bp long and included a 33 bp 5'-untranslated region (UTR) and a 431 bp 3'-UTR with a typical poly-A tail. The 867 bp ORF encoded a predicted protein of 288 amino acids. This protein was characterized by a conserved histidine-rich box and a MYxYY motif that was present in other members of the elongase family. The genomic DNA sequence of MiFAE was found to be interrupted by three introns with splicing sites of Introns I (81 bp), II (81 bp), and III (67 bp) that conformed to the GT-AG rule. Quantitative real-time PCR showed that the transcription level of MiFAE in this microalga under nitrogen starvation was higher than that under normal condition. Prior to the ArA content accumulation, the transcription of MiFAE was enhanced, suggesting that it was possibly responsible for the ArA accumulation in this microalga cultured under nitrogen starvation conditions.

Identification of TPIT and other novel autoantigens in lymphocytic hypophysitis; immunoscreening of a pituitary cDNA library and development of immunoprecipitation assays

PubMed Central

Smith, Casey Jo Anne; Bensing, Sophie; Burns, Christine; Robinson, Phillip J; Kasperlik-Zaluska, Anna A; Scott, Rodney J; Kämpe, Olle; Crock, Patricia A

2012-01-01

Background Lymphocytic hypophysitis is an organ-specific autoimmune disease of the pituitary gland. A specific and sensitive serological test currently does not exist to aid in the diagnosis. Objective To identify target autoantigens in lymphocytic hypophysitis and develop a diagnostic assay for these proteins. Design/methods A pituitary cDNA expression library was immunoscreened using sera from four patients with lymphocytic hypophysitis. Relevant cDNA clones from screening, along with previously identified autoantigens pituitary gland-specific factor 1a and 2 (PGSF1a and PGSF2) and neuron-specific enolase (NSE) were tested in an in vitro transcription and translation immunoprecipitation assay. The corticotroph-specific transcription factor, TPIT, was investigated separately as a candidate autoantigen. Results Significantly positive autoantibody reactivity against TPIT was found in 9/86 hypophysitis patients vs 1/90 controls (P=0.018). The reactivity against TPIT was not specific for lymphocytic hypophysitis with autoantibodies detectable in the sera from patients with other autoimmune endocrine diseases. Autoantibodies were also detected against chromodomain-helicase-DNA binding protein 8, presynaptic cytomatrix protein (piccolo), Ca2+-dependent secretion activator, PGSF2 and NSE in serum samples from patients with lymphocytic hypophysitis, but at a frequency that did not differ from healthy controls. Importantly, 8/86 patients with lymphocytic hypophysitis had autoantibodies against any two autoantigens in comparison with 0/90 controls (P=0.0093). Conclusions TPIT, a corticotroph-specific transcription factor, was identified as a target autoantigen in 10.5% of patients with lymphocytic hypophysitis. Further autoantigens related to vesicle processing were also identified as potential autoantigens with different immunoreactivity patterns in patients and controls. PMID:22193973

Elevation of Autoantibody in Patients with Ischemic Stroke.

PubMed

Yoshida, Yoichi; Hiwasa, Takaki; Machida, Toshio; Kobayashi, Eiichi; Mine, Seiichiro; Matsushima, Jun; Takiguchi, Masaki; Iwadate, Yasuo

2018-05-31

Recent clinical research has revealed a significant correlation between atherosclerosis, one of the primary etiologies of ischemic stroke, and the immune system. Assuming that "disease-specific autoantibodies are produced in the sera of patients with ischemic stroke," we investigated multiple arteriosclerosis-related antibodies using the serological identification of antigens by recombinant cDNA expression cloning (SEREX), an established method for identifying antigenic proteins. We either screened a human aortic endothelial cell cDNA library or conducted protein array screening using the sera from patients with ischemic stroke, such as carotid artery stenosis or transient ischemic attack (TIA). Next, we measured serum antibody levels using amplified luminescent proximity homogeneous assay-linked immunosorbent assay (AlphaLISA) in patient/healthy donor (HD) cohorts and identified several antigens, the antibody levels of which were significantly higher in patients with ischemic stroke than in HDs. This review introduced the method of identifying antigens by the SEREX and protein microarray and summarized antigenic proteins. In particular, it focused on anti-replication protein A2 antibody and anti-programmed cell death 11 antibody, which are significantly related to atherosclerotic plaque and ischemic brain tissue, respectively, and proposed the mechanism of elevated autoantibody levels against them. Furthermore, this review suggests a possibility of clinical application as an atherosclerotic disease diagnostic marker for TIA or cerebral infarction.

Ethylene Responsive Factor MeERF72 Negatively Regulates Sucrose synthase 1 Gene in Cassava.

PubMed

Liu, Chen; Chen, Xin; Ma, Ping'an; Zhang, Shengkui; Zeng, Changying; Jiang, Xingyu; Wang, Wenquan

2018-04-25

Cassava, an important food and industrial crop globally, is characterized by its powerful starch accumulation in its storage root. However, the underlying molecular mechanism for this feature remains unclear. Sucrose synthase initializes the conversion of sucrose to starch, and, to a certain extent, its enzyme activity can represent sink strength. To understand the modulation of MeSus gene family, the relatively high expressed member in storage root, MeSus1 , its promoter was used as bait to screen cassava storage root full-length cDNA library through a yeast one-hybrid system. An ethylene responsive factor cDNA, designated as MeERF72 according to its homolog in Arabidopsis , was screened out. The transcript level of MeERF72 was induced by ethylene, drought, and salt treatments and repressed by abscisic acid, Auxin, gibberellin, salicylic acid, and low and high temperatures. The MeERF72 protein has a conserved APETALA2 domain in its N-terminus and an activated domain of 30 amino acids in its C-terminus, can bind to MeSus1 promoter in vitro and in vivo, and represses the promoter activity of MeSus1 . MeERF72 is a transcription factor that can negatively regulate the expression level of MeSus1 in cassava.

The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Brody, L.C.; Martin, L.S.

1993-05-01

Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less

Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

PubMed Central

Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

2013-01-01

In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

Construction of a full-length enriched cDNA library and preliminary analysis of expressed sequence tags from Bengal Tiger Panthera tigris tigris.

PubMed

Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

2013-05-24

In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

AAV-mediated in vivo functional selection of tissue-protective factors against ischaemia

PubMed Central

Ruozi, Giulia; Bortolotti, Francesca; Falcione, Antonella; Dal Ferro, Matteo; Ukovich, Laura; Macedo, Antero; Zentilin, Lorena; Filigheddu, Nicoletta; Cappellari, Gianluca Gortan; Baldini, Giovanna; Zweyer, Marina; Barazzoni, Rocco; Graziani, Andrea; Zacchigna, Serena; Giacca, Mauro

2015-01-01

Functional screening of expression libraries in vivo would offer the possibility of identifying novel biotherapeutics without a priori knowledge of their biochemical function. Here we describe a procedure for the functional selection of tissue-protective factors based on the in vivo delivery of arrayed cDNA libraries from the mouse secretome using adeno-associated virus (AAV) vectors. Application of this technique, which we call FunSel, in the context of acute ischaemia, revealed that the peptide ghrelin protects skeletal muscle and heart from ischaemic damage. When delivered to the heart using an AAV9 vector, ghrelin markedly reduces infarct size and preserves cardiac function over time. This protective activity associates with the capacity of ghrelin to sustain autophagy and remove dysfunctional mitochondria after myocardial infarction. Our findings describe an innovative tool to identify biological therapeutics and reveal a novel role of ghrelin as an inducer of myoprotective autophagy. PMID:26066847

Identification of host cell proteins which interact with herpes simplex virus type 1 tegument protein pUL37.

PubMed

Kelly, Barbara J; Diefenbach, Eve; Fraefel, Cornel; Diefenbach, Russell J

2012-01-20

The herpes simplex virus type 1 (HSV-1) structural tegument protein pUL37, which is conserved across the Herpesviridae family, is known to be essential for secondary envelopment during the egress of viral particles. To shed light on additional roles of pUL37 during viral replication a yeast two-hybrid screen of a human brain cDNA library was undertaken. This screen identified ten host cell proteins as potential pUL37 interactors. One of the interactors, serine threonine kinase TAOK3, was subsequently confirmed to interact with pUL37 using an in vitro pulldown assay. Such host cell/pUL37 interactions provide further insights into the multifunctional role of this herpesviral tegument protein. Copyright © 2011 Elsevier Inc. All rights reserved.

The construction of an EST database for Bombyx mori and its application

PubMed Central

Mita, Kazuei; Morimyo, Mitsuoki; Okano, Kazuhiro; Koike, Yoshiko; Nohata, Junko; Kawasaki, Hideki; Kadono-Okuda, Keiko; Yamamoto, Kimiko; Suzuki, Masataka G.; Shimada, Toru; Goldsmith, Marian R.; Maeda, Susumu

2003-01-01

To build a foundation for the complete genome analysis of Bombyx mori, we have constructed an EST database. Because gene expression patterns deeply depend on tissues as well as developmental stages, we analyzed many cDNA libraries prepared from various tissues and different developmental stages to cover the entire set of Bombyx genes. So far, the Bombyx EST database contains 35,000 ESTs from 36 cDNA libraries, which are grouped into ≈11,000 nonredundant ESTs with the average length of 1.25 kb. The comparison with FlyBase suggests that the present EST database, SilkBase, covers >55% of all genes of Bombyx. The fraction of library-specific ESTs in each cDNA library indicates that we have not yet reached saturation, showing the validity of our strategy for constructing an EST database to cover all genes. To tackle the coming saturation problem, we have checked two methods, subtraction and normalization, to increase coverage and decrease the number of housekeeping genes, resulting in a 5–11% increase of library-specific ESTs. The identification of a number of genes and comprehensive cloning of gene families have already emerged from the SilkBase search. Direct links of SilkBase with FlyBase and WormBase provide ready identification of candidate Lepidoptera-specific genes. PMID:14614147

Biological Bases of Space Radiation Risk

NASA Technical Reports Server (NTRS)

1997-01-01

In this session, Session JP4, the discussion focuses on the following topics: Hematopoiesis Dynamics in Irradiated Mammals, Mathematical Modeling; Estimating Health Risks in Space from Galactic Cosmic Rays; Failure of Heavy Ions to Affect Physiological Integrity of the Corneal Endothelial Monolayer; Application of an Unbiased Two-Gel CDNA Library Screening Method to Expression Monitoring of Genes in Irradiated Versus Control Cells; Detection of Radiation-Induced DNA Strand Breaks in Mammalian Cells By Enzymatic Post-Labeling; Evaluation of Bleomycin-Induced Chromosome Aberrations Under Microgravity Conditions in Human Lymphocytes, Using "Fish" Techniques; Technical Description of the Space Exposure Biology Assembly Seba on ISS; and Cytogenetic Research in Biological Dosimetry.

Retroviral expression screening of oncogenes in natural killer cell leukemia.

PubMed

Choi, Young Lim; Moriuchi, Ryozo; Osawa, Mitsujiro; Iwama, Atsushi; Makishima, Hideki; Wada, Tomoaki; Kisanuki, Hiroyuki; Kaneda, Ruri; Ota, Jun; Koinuma, Koji; Ishikawa, Madoka; Takada, Shuji; Yamashita, Yoshihiro; Oshimi, Kazuo; Mano, Hiroyuki

2005-08-01

Aggressive natural killer cell leukemia (ANKL) is an intractable malignancy that is characterized by the outgrowth of NK cells. To identify transforming genes in ANKL, we constructed a retroviral cDNA expression library from an ANKL cell line KHYG-1. Infection of 3T3 cells with recombinant retroviruses yielded 33 transformed foci. Nucleotide sequencing of the DNA inserts recovered from these foci revealed that 31 of them encoded KRAS2 with a glycine-to-alanine mutation at codon 12. Mutation-specific PCR analysis indicated that the KRAS mutation was present only in KHYG-1 cells, not in another ANKL cell line or in clinical specimens (n=8).

Cyborg lectins: novel leguminous lectins with unique specificities.

PubMed

Yamamoto, K; Maruyama, I N; Osawa, T

2000-01-01

Bauhinia purpurea lectin (BPA) is one of the beta-galactose-binding leguminous lectins. Leguminous lectins contain a long metal-binding loop, part of which determines their carbohydrate-binding specificities. Random mutations were introduced into a portion of the cDNA coding BPA that corresponds to the carbohydrate-binding loop of the lectin. An library of the mutant lectin expressed on the surface of lambda foo phages was screened by the panning method. Several phage clones with an affinity for mannose or N-acetylglucosamine were isolated. These results indicate the possibility of making artificial lectins (so-called "cyborg lectins") with distinct and desired carbohydrate-binding specificities.

Discovering Protein-Coding Genes from the Environment: Time for the Eukaryotes?

PubMed

Marmeisse, Roland; Kellner, Harald; Fraissinet-Tachet, Laurence; Luis, Patricia

2017-09-01

Eukaryotic microorganisms from diverse environments encompass a large number of taxa, many of them still unknown to science. One strategy to mine these organisms for genes of biotechnological relevance is to use a pool of eukaryotic mRNA directly extracted from environmental samples. Recent reports demonstrate that the resulting metatranscriptomic cDNA libraries can be screened by expression in yeast for a wide range of genes and functions from many of the different eukaryotic taxa. In combination with novel emerging high-throughput technologies, we anticipate that this approach should contribute to exploring the functional diversity of the eukaryotic microbiota. Copyright © 2017 Elsevier Ltd. All rights reserved.

Gene discovery in Eimeria tenella by immunoscreening cDNA expression libraries of sporozoites and schizonts with chicken intestinal antibodies.

PubMed

Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie

2003-04-02

Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.

Anti-liver-kidney microsome antibody type 1 recognizes human cytochrome P450 db1.

PubMed

Gueguen, M; Yamamoto, A M; Bernard, O; Alvarez, F

1989-03-15

Anti-liver-kidney microsome antibody type 1 (LKM1), present in the sera of a group of children with autoimmune hepatitis, was recently shown to recognize a 50 kDa protein identified as rat liver cytochromes P450 db1 and db2. High homology between these two members of the rat P450 IID subfamily and human P450 db1 suggested that anti-LKM1 antibody is directed against this human protein. To test this hypothesis, a human liver cDNA expression library in phage lambda GT-11 was screened using rat P450 db1 cDNA as a probe. Two human cDNA clones were found to be identical to human P450 db1 by restriction mapping. Immunoblot analysis using as antigen, the purified fusion protein from one of the human cDNA clones showed that only anti-LKM1 with anti-50 kDa reactivity recognized the fusion protein. This fusion protein was further used to develop an ELISA test that was shown to be specific for sera of children with this disease. These results: 1) identify the human liver antigen recognized by anti-LKM1 auto-antibodies as cytochrome P450 db1, 2) allow to speculate that mutation on the human P450 db1 gene could alter its expression in the hepatocyte and make it auto-antigenic, 3) provide a simple and specific diagnostic test for this disease.

Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

1997-01-01

A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

PubMed

Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

2001-08-17

Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

PubMed

Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

2004-05-01

Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons

PubMed Central

Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S

2016-01-01

A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679

[Screening and identification of anoikis-resistant gene UBCH7 in esophageal cancer cells].

PubMed

Yang, Yang; Wang, Bo-Shi; Wang, Xiao-Min; Zhang, Yu; Wang, Ming-Rong; Jia, Xue-Mei

2012-02-01

Anoikis is a kind of programmed cell death induced by loss of extracellular matrix (ECM) adhesion, which is one of key factors for homestasis. Resistance to anoikis is required for tumor cell metastasis. We have previously shown several anoikis-resistance genes in esophageal squamous cell carcinoma (ESCC). In order to find novel anoikis-resistant genes in ESCC, we constructed retroviral cDNA library using total RNA from ESCC cell lines. NIH 3T3 cells, which are sensitive to anoikis, were infected with the library constructed. The cells were cultured in soft agar, and the clones which can survive in detached states were selected. The cDNAs inserted into the anoikis-resistant NIH3T3 clones were amplified using retroviral specific primers. Sequencing analysis showed that a cDNA fragment inserted into the anoikis-resistant clone contains full coding sequence (ORF) of human UBCH7/UBE2L3 gene. By infection with retrovirus encoding UBCH7 ORF (pMSCV-UBCH7), forced expression of UBCH7 increased the anoikis-resistance of NIH3T3 cells. More importantly, knockdown of UBCH7 expression by siRNA transfection reduced the anoikis-resistant ability of esophageal cancer MLuC1 cells. The data suggest that UBCH7/UBE2L3 gene would be involved in anoikis-resistance in ESCC.

Evaluation and Adaptation of a Laboratory-Based cDNA Library Preparation Protocol for Retrospective Sequencing of Archived MicroRNAs from up to 35-Year-Old Clinical FFPE Specimens

PubMed Central

Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J.; Rohan, Thomas; Ben-Dov, Iddo Z.

2017-01-01

Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens. PMID:28335433

Non-biased and efficient global amplification of a single-cell cDNA library

PubMed Central

Huang, Huan; Goto, Mari; Tsunoda, Hiroyuki; Sun, Lizhou; Taniguchi, Kiyomi; Matsunaga, Hiroko; Kambara, Hideki

2014-01-01

Analysis of single-cell gene expression promises a more precise understanding of molecular mechanisms of a living system. Most techniques only allow studies of the expressions for limited numbers of gene species. When amplification of cDNA was carried out for analysing more genes, amplification biases were frequently reported. A non-biased and efficient global-amplification method, which uses a single-cell cDNA library immobilized on beads, was developed for analysing entire gene expressions for single cells. Every step in this analysis from reverse transcription to cDNA amplification was optimized. By removing degrading excess primers, the bias due to the digestion of cDNA was prevented. Since the residual reagents, which affect the efficiency of each subsequent reaction, could be removed by washing beads, the conditions for uniform and maximized amplification of cDNAs were achieved. The differences in the amplification rates for randomly selected eight genes were within 1.5-folds, which could be negligible for most of the applications of single-cell analysis. The global amplification gives a large amount of amplified cDNA (>100 μg) from a single cell (2-pg mRNA), and that amount is enough for downstream analysis. The proposed global-amplification method was used to analyse transcript ratios of multiple cDNA targets (from several copies to several thousand copies) quantitatively. PMID:24141095

Carbohydrate active enzymes revealed in Coptotermes formosanus transcriptome

USDA-ARS?s Scientific Manuscript database

A normalized cDNA library of Coptotermes formosanus was constructed using mixed RNA isolated from workers, soldiers, nymphs and alates of both sexes. Sequencing of this library generated 131,637 EST and 25,939 unigenes were assembled. Carbohydrate active enzymes (CAZymes) revealed in this library we...

Genetic Regulation in the Aiptasia pallida Symbiosis - Performance Report, Year 1.

DTIC Science & Technology

1997-02-01

and symbiotic zooxanthellae is one developed for serial analysis of gene expression (SAGE). We initially tested the SAGE protocol with cDNA generated...technically difficult. We are now focusing on constructing representative cDNA libraries from cultured and symbiotic zooxanthellae and will sequence

Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

PubMed Central

Wu, S; Kriz, A L; Widholm, J M

1994-01-01

The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490

Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

PubMed Central

Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.

2010-01-01

PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within the large intradiscal loop also suggests an important function for this domain. PMID:12766040

Powerful workhorses for antimicrobial peptide expression and characterization.

PubMed

Li, Chun; Blencke, Hans-Matti; Paulsen, Victoria; Haug, Tor; Stensvåg, Klara

2010-01-01

Discovery of antimicrobial peptides (AMP) is to a large extent based on screening of fractions of natural samples in bacterial growth inhibition assays. However, the use of bacteria is not limited to screening for antimicrobial substances. In later steps, bioengineered "bugs" can be applied to both production and characterization of AMPs. Here we describe the idea to use genetically modified Escherichia coli strains for both these purposes. This approach allowed us to investigate SpStrongylocins 1 and 2 from the purple sea urchin Strongylocentrotus purpuratus only based on sequence information from a cDNA library and without previous direct isolation or chemical synthesis of these peptides. The recombinant peptides are proved active against all bacterial strains tested. An assay based on a recombinant E. coli sensor strain expressing insect luciferase, revealed that SpStrongylocins are not interfering with membrane integrity and are therefore likely to have intracellular targets. © 2010 Landes Bioscience

VpWRKY3, a biotic and abiotic stress-related transcription factor from the Chinese wild Vitis pseudoreticulata.

PubMed

Zhu, Ziguo; Shi, Jiangli; Cao, Jiangling; He, Mingyang; Wang, Yuejin

2012-11-01

Chinese wild grapevine Vitis pseudoreticulata accession 'Baihe-35-1' is identified as the precious resource with multiple resistances to pathogens. A directional cDNA library was constructed from the young leaves inoculated with Erysiphe necator. A total of 3,500 clones were sequenced, yielding 1,727 unigenes. Among them, 762 unigenes were annotated and classified into three classes, respectively, using Gene Ontology, including 22 ESTs related to transcription regulator activity. A novel WRKY transcription factor was isolated from the library, and designated as VpWRKY3 (GenBank Accession No. JF500755). The full-length cDNA is 1,280 bp, encoding a WRKY protein of 320 amino acids. VpWRKY3 is localized to nucleus and functions as a transcriptional activator. QRT-PCR analysis showed that the VpWRKY3 specifically accumulated in response to pathogen, salicylic acid, ethylene and drought stress. Overexpression of VpWRKY3 in tobacco increased the resistance to Ralstonia solanacearum, indicating that VpWRKY3 participates in defense response. Furthermore, VpWRKY3 is also involved in abscisic acid signal pathway and salt stress. This experiment provided an important basis for understanding the defense mechanisms mediated by WRKY genes in China wild grapevine. Generation of the EST collection from the cDNA library provided valuable information for the grapevine breeding. Key message We constructed a cDNA library from Chinese wild grapevine leaves inoculated with powdery mildew. VpWRKY3 was isolated and demonstrated that it was involved in biotic and abiotic stress responses.

EXPRESSION OF THE SPERMATOGENIC CELL-SPECIFIC GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE (GAPDS) IN RAT TESTIS

EPA Science Inventory

The spermatogenic cell-specific variant of glyceraldehyde 3-phosphate dehydrogenase (GAPDS) has been cloned from a rat testis cDNA library and its pattern of expression determined. A 1417 nucleotide cDNA has been found to encode an enzyme with substantial homology to mouse GAPDS...

Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2008-01-01

Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq

PubMed Central

Stork, Cheryl; Zheng, Sika

2017-01-01

UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263

Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, L.A.

1994-05-06

We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

PM19, a barley (Hordeum vulgare L.) gene encoding a putative plasma membrane protein, is expressed during embryo development and dormancy.

PubMed

Ranford, Julia C; Bryce, James H; Morris, Peter C

2002-01-01

A barley (Hordeum vulgare L.) cDNA, PM19, encoding a putative plasma membrane protein was isolated through differential screening of a dormant wild oat embryo library. PM19 is expressed in barley embryos from mid-embryogenesis up to maturity. PM19 mRNA levels decline upon germination, whereas dormant embryos retained high levels of message for up to 72 h of imbibition. PM19 mRNA levels also remained high or were reinduced in non-dormant embryos by treatments that prevented germination (250 mm NaCl, 10% sorbitol, or 50 microm ABA). The PM19 protein sequence is highly conserved in monocotyledonous and dicotyledonous plants.

Triterpenoid Saponin Biosynthetic Pathway Profiling and Candidate Gene Mining of the Ilex asprella Root Using RNA-Seq

PubMed Central

Zheng, Xiasheng; Xu, Hui; Ma, Xinye; Zhan, Ruoting; Chen, Weiwen

2014-01-01

Ilex asprella, which contains abundant α-amyrin type triterpenoid saponins, is an anti-influenza herbal drug widely used in south China. In this work, we first analysed the transcriptome of the I. asprella root using RNA-Seq, which provided a dataset for functional gene mining. mRNA was isolated from the total RNA of the I. asprella root and reverse-transcribed into cDNA. Then, the cDNA library was sequenced using an Illumina HiSeq™ 2000, which generated 55,028,452 clean reads. De novo assembly of these reads generated 51,865 unigenes, in which 39,269 unigenes were annotated (75.71% yield). According to the structures of the triterpenoid saponins of I. asprella, a putative biosynthetic pathway downstream of 2,3-oxidosqualene was proposed and candidate unigenes in the transcriptome data that were potentially involved in the pathway were screened using homology-based BLAST and phylogenetic analysis. Further amplification and functional analysis of these putative unigenes will provide insight into the biosynthesis of Ilex triterpenoid saponins. PMID:24722569

Identification and sequencing of members of a drought-induced multigene family in Atriplex canescens (salt bush)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jing Chen; Cairney, J.; Newton, R.J.

1991-05-01

Atriplex canescens (Pursh.) Nutt. is known to have a high degree of morphological and physiological drought-tolerance, which appears to be related to molecular responses. A cDNA library, constructed from drought-induced messenger RNA, was differentially screened with radioactively labelled cDNA probes synthesized from mRNA extracted from stressed and non-stressed Atriplex. Two clones named 19-3 and 27-3, whose expression is induced by drought-stress, have been characterized. Sequence analysis shows that they are more than 96% homologous. Each clone has an open reading frame which specifies a protein of 95 amino acids (12.77 kDa and 12.74 kDa respectively.) In vitro transcription and translationmore » of each clone results in a single protein of apparent molecular weight 8.6 kDa. The disparity in size may be due to secondary structure, dictated, at least in part, by a highly charged carboxy terminus which may be important for the function of these proteins in drought tolerance.« less

Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

PubMed

Yokozaki, H; Tahara, H; Oue, N; Tahara, E

2000-01-01

A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

Isolation and genetic mapping of a Coffea canephora phenylalanine ammonia-lyase gene (CcPAL1) and its involvement in the accumulation of caffeoyl quinic acids.

PubMed

Mahesh, Venkataramaiah; Rakotomalala, Jean Jacques; Le Gal, Lénaïg; Vigne, Hélène; de Kochko, Alexandre; Hamon, Serge; Noirot, Michel; Campa, Claudine

2006-09-01

Biosynthesis of caffeoylquinic acids occurs via the phenylpropanoid pathway in which the phenylalanine ammonia-lyase (PAL) acts as a key-control enzyme. A full-length cDNA (pF6), corresponding to a PAL gene (CcPAL1), was isolated by screening a Coffea canephora fruit cDNA library and its corresponding genomic sequence was characterized. Amplification of total DNA from seven Coffea species revealed differences in intronic length. This interspecific polymorphism was used to locate the gene on a genetic map established for a backcross progeny between Coffea pseudozanguebariae and C. dewevrei. The CcPAL1 gene was found on the same linkage group, but genetically independent, as a caffeoyl-coenzyme A-O-methyltransferase gene, another gene intervening in the phenylpropanoid pathway. In the same backcross, a lower caffeoylquinic acid content was observed in seeds harvested from plants harbouring the C. pseudozanguebariae CcPAL1 allele. Involvement of the CcPAL1 allelic form in the differential accumulation of caffeoylquinic acids in coffee green beans is then discussed.

Cloning and expression of a Ca(2+)-inhibitable adenylyl cyclase from NCB-20 cells.

PubMed Central

Yoshimura, M; Cooper, D M

1992-01-01

A cDNA that encodes an adenylyl cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] has been cloned from NCB-20 cells, in which adenylyl cyclase activity is inhibited by Ca2+ at physiological concentrations. The cDNA clone (5.8 kilobases) was isolated by polymerase chain reaction (PCR) using degenerate primers designed by comparison of three adenylyl cyclase sequences (types I, II, and III) and subsequent library screening. Northern analysis revealed expression of mRNA (6.1 kilobases) corresponding to this cDNA in cardiac tissue, which is a prominent source of Ca(2+)-inhibitable adenylyl cyclase. The clone encodes a protein of 1165 amino acids, whose hydrophilicity profile was very similar to those of other mammalian adenylyl cyclases that have recently been cloned. A noticeable difference between this protein and other adenylyl cyclases was a lengthy aminoterminal region before the first transmembrane span. Transient expression of this cDNA in the human embryonic kidney cell line 293 revealed a 3-fold increase in cAMP production in response to forskolin compared with control transfected cells. In purified plasma membranes from transfected cells, increased adenylyl cyclase activity was also detected, which was susceptible to inhibition by submicromolar Ca2+. Thus, this adenylyl cyclase seems to represent the Ca(2+)-inhibitable form that is encountered in NCB-20 cells, cardiac tissue, and elsewhere. Its identification should permit a determination of the structural features that determine the mode of regulation of adenylyl cyclase by Ca2+. Images PMID:1379717

Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

PubMed Central

Matthews, R J; Cahir, E D; Thomas, M L

1990-01-01

Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.

PubMed

Mattsson, J G; Ljunggren, E L; Bergström, K

2001-05-01

The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.

Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

PubMed Central

Huebner, K; Druck, T; Croce, C M; Thiesen, H J

1991-01-01

cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

Analysis of expressed sequence tags from the four main developmental stages of Trypanosoma congolense

PubMed Central

Helm, Jared R.; Hertz-Fowler, Christiane; Aslett, Martin; Berriman, Matthew; Sanders, Mandy; Quail, Michael A.; Soares, Marcelo B.; Bonaldo, Maria F.; Sakurai, Tatsuya; Inoue, Noboru; Donelson, John E.

2009-01-01

Trypanosoma congolense is one of the most economically important pathogens of livestock in Africa. Culture-derived parasites of each of the three main insect stages of the T. congolense life cycle, i.e., the procyclic, epimastigote and metacyclic stages, and bloodstream stage parasites isolated from infected mice, were used to construct stage-specific cDNA libraries and expressed sequence tags (ESTs or cDNA clones) in each library were sequenced. Thirteen EST clusters encoding different variant surface glycoproteins (VSGs) were detected in the metacyclic library and twenty-six VSG EST clusters were found in the bloodstream library, six of which are shared by the metacyclic library. Rare VSG ESTs are present in the epimastigote library, and none were detected in the procyclic library. ESTs encoding enzymes that catalyze oxidative phosphorylation and amino acid metabolism are about twice as abundant in the procyclic and epimastigote stages as in the metacyclic and bloodstream stages. In contrast, ESTs encoding enzymes involved in glycolysis, the citric acid cycle and nucleotide metabolism are about the same in all four developmental stages. Cysteine proteases, kinases and phosphatases are the most abundant enzyme groups represented by the ESTs. All four libraries contain T. congolense-specific expressed sequences not present in the T. brucei and T. cruzi genomes. Normalized cDNA libraries were constructed from the metacyclic and bloodstream stages, and found to be further enriched for T. congolense-specific ESTs. Given that cultured T. congolense offers an experimental advantage over other African trypanosome species, these ESTs provide a basis for further investigation of the molecular properties of these four developmental stages, especially the epimastigote and metacyclic stages for which it is difficult to obtain large quantities of organisms. The T. congolense EST databases are available at: http://www.sanger.ac.uk/Projects/T_congolense/EST_index.shtml. PMID:19559733

Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression

PubMed Central

Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

2015-01-01

The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree. PMID:26147807

Mutated BRAF Emerges as a Major Effector of Recurrence in a Murine Melanoma Model After Treatment With Immunomodulatory Agents.

PubMed

Zaidi, Shane; Blanchard, Miran; Shim, Kevin; Ilett, Elizabeth; Rajani, Karishma; Parrish, Christopher; Boisgerault, Nicolas; Kottke, Tim; Thompson, Jill; Celis, Esteban; Pulido, Jose; Selby, Peter; Pandha, Hardev; Melcher, Alan; Harrington, Kevin; Vile, Richard

2015-05-01

We used a VSV-cDNA library to treat recurrent melanoma, identifying immunogenic antigens, allowing us to target recurrences with immunotherapy or chemotherapy. Primary B16 melanoma tumors were induced to regress by frontline therapy. Mice with recurrent tumors were treated with VSV-cDNA immunotherapy. A Th17 recall response was used to screen the VSV-cDNA library for individual viruses encoding rejection antigens, subsequently targeted using immunotherapy or chemotherapy. Recurrent tumors were effectively treated with a VSV-cDNA library using cDNA from recurrent B16 tumors. Recurrence-associated rejection antigens identified included Topoisomerase-IIα, YB-1, cdc7 kinase, and BRAF. Fourteen out of 16 recurrent tumors carried BRAF mutations (595-605 region) following frontline therapy, even though the parental B16 tumors were BRAF wild type. The emergence of mutated BRAF-containing recurrences served as an excellent target for BRAF-specific immune-(VSV-BRAF), or chemo-(PLX-4720) therapies. Successful PLX-4720 therapy of recurrent tumors was associated with the development of a broad spectrum of T-cell responses. VSV-cDNA technology can be used to identify recurrence specific antigens. Emergence of mutated BRAF may be a major effector of melanoma recurrence which could serve as a target for chemo or immune therapy. This study suggests a rationale for offering patients with initially wild-type BRAF melanomas an additional biopsy to screen for mutant BRAF upon recurrence.

Mutated BRAF Emerges as a Major Effector of Recurrence in a Murine Melanoma Model After Treatment With Immunomodulatory Agents

PubMed Central

Zaidi, Shane; Blanchard, Miran; Shim, Kevin; Ilett, Elizabeth; Rajani, Karishma; Parrish, Christopher; Boisgerault, Nicolas; Kottke, Tim; Thompson, Jill; Celis, Esteban; Pulido, Jose; Selby, Peter; Pandha, Hardev; Melcher, Alan; Harrington, Kevin; Vile, Richard

2015-01-01

We used a VSV-cDNA library to treat recurrent melanoma, identifying immunogenic antigens, allowing us to target recurrences with immunotherapy or chemotherapy. Primary B16 melanoma tumors were induced to regress by frontline therapy. Mice with recurrent tumors were treated with VSV-cDNA immunotherapy. A Th17 recall response was used to screen the VSV-cDNA library for individual viruses encoding rejection antigens, subsequently targeted using immunotherapy or chemotherapy. Recurrent tumors were effectively treated with a VSV-cDNA library using cDNA from recurrent B16 tumors. Recurrence-associated rejection antigens identified included Topoisomerase-IIα, YB-1, cdc7 kinase, and BRAF. Fourteen out of 16 recurrent tumors carried BRAF mutations (595–605 region) following frontline therapy, even though the parental B16 tumors were BRAF wild type. The emergence of mutated BRAF-containing recurrences served as an excellent target for BRAF-specific immune-(VSV-BRAF), or chemo-(PLX-4720) therapies. Successful PLX-4720 therapy of recurrent tumors was associated with the development of a broad spectrum of T-cell responses. VSV-cDNA technology can be used to identify recurrence specific antigens. Emergence of mutated BRAF may be a major effector of melanoma recurrence which could serve as a target for chemo or immune therapy. This study suggests a rationale for offering patients with initially wild-type BRAF melanomas an additional biopsy to screen for mutant BRAF upon recurrence. PMID:25544599

Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression.

PubMed Central

Fukasawa, K; Fukasawa, K M; Kanai, M; Fujii, S; Hirose, J; Harada, M

1998-01-01

We have purified dipeptidyl peptidase III (EC 3.4.14.4) from human placenta. It had a pH optimum of 8.8 and readily hydrolysed Arg-Arg-beta-naphthylamide. Monoamino acid-, Gly-Phe-, Gly-Pro- and Bz-Arg-beta-naphthylamides were not hydrolysed at all. The enzyme was inhibited by p-chloromercuriphenylsulphonic acid, metal chelators and 3,4-dichloroisocoumarin and contained 1 mol of zinc per mol of enzyme. The zinc dissociation constant was 250 fM at pH 7. 4 as determined by the zinc binding study. We isolated, by immunological screening of a Uni-ZAP XR cDNA library constructed from rat liver mRNA species, a cDNA clone with 2633 bp encoding the rat enzyme. The longest open reading frame encodes a 827-residue protein with a theoretical molecular mass of 92790 Da. Escherichia coli SOLR cells were infected with the pBluescript phagemid containing the cloned cDNA and established the overexpression of a protein that hydrolysed Arg-Arg-beta-naphthylamide. The recombinant protein was purified and the amino acid sequence of the protein was confirmed. We presumed that the putative zinc-binding domain involved in catalysis was present in the recombinant enzyme. It was a novel zinc-binding motif in that one amino acid residue was inserted into the conserved HEXXH motif characteristic of the metalloproteinases. PMID:9425109

Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.

PubMed Central

Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E

1994-01-01

A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404

Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

PubMed Central

Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

1987-01-01

The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

Sequence and structural implications of a bovine corneal keratan sulfate proteoglycan core protein. Protein 37B represents bovine lumican and proteins 37A and 25 are unique

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Brown, S. J.; Vergnes, J. P.; Hassell, J. R.; Mann, M. M.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1993-01-01

Amino acid sequence from tryptic peptides of three different bovine corneal keratan sulfate proteoglycan (KSPG) core proteins (designated 37A, 37B, and 25) showed similarities to the sequence of a chicken KSPG core protein lumican. Bovine lumican cDNA was isolated from a bovine corneal expression library by screening with chicken lumican cDNA. The bovine cDNA codes for a 342-amino acid protein, M(r) 38,712, containing amino acid sequences identified in the 37B KSPG core protein. The bovine lumican is 68% identical to chicken lumican, with an 83% identity excluding the N-terminal 40 amino acids. Location of 6 cysteine and 4 consensus N-glycosylation sites in the bovine sequence were identical to those in chicken lumican. Bovine lumican had about 50% identity to bovine fibromodulin and 20% identity to bovine decorin and biglycan. About two-thirds of the lumican protein consists of a series of 10 amino acid leucine-rich repeats that occur in regions of calculated high beta-hydrophobic moment, suggesting that the leucine-rich repeats contribute to beta-sheet formation in these proteins. Sequences obtained from 37A and 25 core proteins were absent in bovine lumican, thus predicting a unique primary structure and separate mRNA for each of the three bovine KSPG core proteins.

Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

PubMed

Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

1987-01-01

cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

Characterization of avian T-cell receptor γ genes

PubMed Central

Six, Adrien; Rast, Jonathan P.; McCormack, Wayne T.; Dunon, Dominique; Courtois, David; Li, Yue; Chen, Chen-lo H.; Cooper, Max D.

1996-01-01

In birds and mammals T cells develop along two discrete pathways characterized by expression of either the αβ or the γδ T-cell antigen receptors (TCRs). To gain further insight into the evolutionary significance of the γδ T-cell lineage, the present studies sought to define the chicken TCRγ locus. A splenic cDNA library was screened with two polymerase chain reaction products obtained from genomic DNA using primers for highly conserved regions of TCR and immunoglobulin genes. This strategy yielded cDNA clones with characteristics of mammalian TCR γ chains, including canonical residues considered important for proper folding and stability. Northern blot analysis with the TCRγ cDNA probe revealed 1.9-kb transcripts in the thymus, spleen, and a γδ T-cell line, but not in B or αβ T-cell lines. Three multimember Vγ subfamilies, three Jγ gene segments, and a single constant region Cγ gene were identified in the avian TCRγ locus. Members of each of the three Vγ subfamilies were found to undergo rearrangement in parallel during the first wave of thymocyte development. TCRγ repertoire diversification was initiated on embryonic day 10 by an apparently random pattern of V-Jγ recombination, nuclease activity, and P- and N-nucleotide additions to generate a diverse repertoire of avian TCRγ genes early in ontogeny. PMID:8986811

Physical mapping of the torsion dystonia region of human chromosome 9q34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozelius, L.J.; Hewett, J.; Shalish, C.

1994-09-01

Torsion dystonia is a syndrome characterized by loss of voluntary movements appearing as sustained muscle contractions and/or abnormal postures. The DYT1 gene is responsible for a subtype of torsion dystonia in which onset of symptoms tends to occur in a limb at an early age (mean 13 years) and to progress to a generalized state. Expression of the disease gene follows an autosomal dominant mode of inheritance with reduced penetrance. We initially mapped this gene to human chromosome 9q34 and have now defined its location to a < 1 cM region near the ASS locus based on historic recombination eventsmore » around a founder mutation in the Ashkenazic Jewish population. Using the CEPH YAC library and a chromosome 9 flow-sorted YAC library, we have generated a YAC contig spanning about 500 kb of this region. These YACs are being used to identify cosmids by direct hybridization to chromosome 9-specific cosmid libraries. Cosmids are being aligned by restriction digest patterns and by hybridization with oligonucleotide repeat probes. In addition, the cosmids are being {open_quotes}trapped{close_quotes} by exon amplification and these exons used to screen cDNA libraries. Thus far we have identified several candidate transcripts in this region.« less

Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA

USDA-ARS?s Scientific Manuscript database

Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...

Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1

NASA Astrophysics Data System (ADS)

Gao, Lan; Li, Hao-Ming

2017-08-01

Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

PubMed

Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

2017-02-03

This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene expression in S. aurata with an emphasis upon immunity and the immune response.

Sorghum Expressed Sequence Tags Identify Signature Genes for Drought, Pathogenesis, and Skotomorphogenesis from a Milestone Set of 16,801 Unique Transcripts1[w

PubMed Central

Pratt, Lee H.; Liang, Chun; Shah, Manish; Sun, Feng; Wang, Haiming; Reid, St. Patrick; Gingle, Alan R.; Paterson, Andrew H.; Wing, Rod; Dean, Ralph; Klein, Robert; Nguyen, Henry T.; Ma, Hong-mei; Zhao, Xin; Morishige, Daryl T.; Mullet, John E.; Cordonnier-Pratt, Marie-Michèle

2005-01-01

Improved knowledge of the sorghum transcriptome will enhance basic understanding of how plants respond to stresses and serve as a source of genes of value to agriculture. Toward this goal, Sorghum bicolor L. Moench cDNA libraries were prepared from light- and dark-grown seedlings, drought-stressed plants, Colletotrichum-infected seedlings and plants, ovaries, embryos, and immature panicles. Other libraries were prepared with meristems from Sorghum propinquum (Kunth) Hitchc. that had been photoperiodically induced to flower, and with rhizomes from S. propinquum and johnsongrass (Sorghum halepense L. Pers.). A total of 117,682 expressed sequence tags (ESTs) were obtained representing both 3′ and 5′ sequences from about half that number of cDNA clones. A total of 16,801 unique transcripts, representing tentative UniScripts (TUs), were identified from 55,783 3′ ESTs. Of these TUs, 9,032 are represented by two or more ESTs. Collectively, these libraries were predicted to contain a total of approximately 31,000 TUs. Individual libraries, however, were predicted to contain no more than about 6,000 to 9,000, with the exception of light-grown seedlings, which yielded an estimate of close to 13,000. In addition, each library exhibits about the same level of complexity with respect to both the number of TUs preferentially expressed in that library and the frequency with which two or more ESTs is found in only that library. These results indicate that the sorghum genome is expressed in highly selective fashion in the individual organs and in response to the environmental conditions surveyed here. Close to 2,000 differentially expressed TUs were identified among the cDNA libraries examined, of which 775 were differentially expressed at a confidence level of 98%. From these 775 TUs, signature genes were identified defining drought, Colletotrichum infection, skotomorphogenesis (etiolation), ovary, immature panicle, and embryo. PMID:16169961

Illumina sequencing of green stink bug nymph and adult cdna to identify potential rnai gene targets

USDA-ARS?s Scientific Manuscript database

Whole-body transcriptomes for nymphs and adults of the green stink bug, Acrosternum hilare (Say), were sequenced on an Illumina® Genome Analyzer IIx sequencer. The insects were collected from sites in North Carolina and Virginia, USA. The cDNA library for each sample was sequenced on one lane of an...

Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

PubMed

Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

2003-01-01

A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

Molecular characterization of an ependymin precursor from goldfish brain.

PubMed

Königstorfer, A; Sterrer, S; Eckerskorn, C; Lottspeich, F; Schmidt, R; Hoffmann, W

1989-01-01

Ependymins are thought to be implicated in fundamental processes involved in plasticity of the goldfish CNS. Gas-phase sequencing of purified ependymins beta and gamma revealed that they share the same N-terminal sequence. Each sequence displays microheterogeneities at several positions. Based on the protein sequences obtained, we constructed synthetic oligonucleotides and used them as hybridization probes for screening cDNA libraries of goldfish brain. In this article we describe the full-length sequence of a mRNA encoding a precursor of ependymins. A cleavable signal sequence characteristic of secretory proteins is located at the N-terminal end, followed directly by the ependymin sequence. Also, two potential N-glycosylation sites were detected. A computer search revealed that ependymins form a novel family of unique proteins.

Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reilly, D.S.; Nussbaum, R.L.

1994-09-01

The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

Molecular characterization of a cDNA encoding copper/zinc superoxide dismutase from cultured cells of Manihot esculenta.

PubMed

Shin, Seung-Yong; Lee, Haeng-Soon; Kwon, Suk-Yoon; Kwon, Soon-Tae; Kwak, Sang-Soo

2005-01-01

Superoxide dismutase (SOD) cDNA, mSOD2, encoding cytosolic copper/zinc SOD (CuZnSOD) cDNA was isolated from suspension-cultured cells of cassava (Manihot esculenta Crantz) by cDNA library screening, and its expression was investigated in relation to environmental stress. mSOD2 is 774 bp in length with an open reading frame (ORF) of 152 amino acids, corresponding to a protein of predicted molecular mass 15 kDa and a pI of 5.22. One copy of the mSOD2 gene was found to be present in the cassava genome by Southern analysis using an mSOD2 cDNA-specific probe. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed diverse expression patterns for the mSOD2 gene in various tissues of intact cassava plants, at various stages of the growth in suspension cultures, and in the leaf tissues exposed to different stresses. The mSOD2 gene was highly expressed in suspension-cultured cells and in the stems of intact plants. However, it was expressed at low levels in leaves and roots. During suspension cell growth, the mSOD2 transcript progressively increased during culture. Moreover, the mSOD2 gene in excised cassava leaves responded to various stresses in different ways. In particular, it was highly induced in leaf tissue by several abiotic stresses, including high temperature (37 degrees C), chilling (4 degrees C), methyl viologen (MV) exposure, and wounding treatment. These results indicate that the mSOD2 gene is involved in the antioxidative process triggered by oxidative stress induced by environmental change.

Human ESP1/CRP2, a member of the LIM domain protein family: Characterization of the cDNA and assignment of the gene locus to chromosome 14q32.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro

1996-01-15

The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

Differential expression of a novel seven transmembrane domain protein in epididymal fat from aged and diabetic mice.

PubMed

Yang, H; Egan, J M; Rodgers, B D; Bernier, M; Montrose-Rafizadeh, C

1999-06-01

To identify novel seven transmembrane domain proteins from 3T3-L1 adipocytes, we used PCR to amplify 3T3-L1 adipocyte complementary DNA (cDNA) with primers homologous to the N- and C-termini of pancreatic glucagon-like peptide-1 (GLP-1) receptor. We screened a cDNA library prepared from fully differentiated 3T3-L1 adipocytes using a 500-bp cDNA PCR product probe. Herein describes the isolation and characterization of a 1.6-kb cDNA clone that encodes a novel 298-amino acid protein that we termed TPRA40 (transmembrane domain protein of 40 kDa regulated in adipocytes). TPRA40 has seven putative transmembrane domains and shows little homology with the known GLP-1 receptor or with other G protein-coupled receptors. The levels of TPRA40 mRNA and protein were higher in 3T3-L1 adipocytes than in 3T3-L1 fibroblasts. TPRA40 is present in a number of mouse and human tissues. Interestingly, TPRA40 mRNA levels were significantly increased by 2- to 3-fold in epididymal fat of 24-month-old mice vs. young controls as well as in db/db and ob/ob mice vs. nondiabetic control littermates. No difference in TPRA40 mRNA levels was observed in brain, heart, skeletal muscle, liver, or kidney. Furthermore, no difference in TPRA40 expression was detected in brown fat of ob/ob mice when compared with age-matched controls. Taken together, these data suggest that TPRA40 represents a novel membrane-associated protein whose expression in white adipose tissue is altered with aging and type 2 diabetes.

Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

PubMed Central

Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jakob; Gilchrist, Michael J; Panitz, Frank; Jørgensen, Claus; Scheibye-Knudsen, Karsten; Arvin, Troels; Lumholdt, Steen; Sawera, Milena; Green, Trine; Nielsen, Bente J; Havgaard, Jakob H; Rosenkilde, Carina; Wang, Jun; Li, Heng; Li, Ruiqiang; Liu, Bin; Hu, Songnian; Dong, Wei; Li, Wei; Yu, Jun; Wang, Jian; Stærfeldt, Hans-Henrik; Wernersson, Rasmus; Madsen, Lone B; Thomsen, Bo; Hornshøj, Henrik; Bujie, Zhan; Wang, Xuegang; Wang, Xuefei; Bolund, Lars; Brunak, Søren; Yang, Huanming; Bendixen, Christian; Fredholm, Merete

2007-01-01

Background Knowledge of the structure of gene expression is essential for mammalian transcriptomics research. We analyzed a collection of more than one million porcine expressed sequence tags (ESTs), of which two-thirds were generated in the Sino-Danish Pig Genome Project and one-third are from public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. Results Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which approximately 25% have a high confidence match to UniProt. Approximately 6,000 new porcine gene clusters were identified. Expression analysis based on the non-normalized libraries resulted in the following findings. The distribution of cluster sizes is scaling invariant. Brain and testes are among the tissues with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression of genes between different tissues, in particular brain/spinal cord, and found patterns of correlation between genes that share expression in pairs of libraries. Finally, there was remarkable agreement in expression between specialized tissues according to Gene Ontology categories. Conclusion This EST collection, the largest to date in pig, represents an essential resource for annotation, comparative genomics, assembly of the pig genome sequence, and further porcine transcription studies. PMID:17407547

Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

PubMed

Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

1997-11-01

Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Evidence that noncoding RNA dutA is a multicopy suppressor of Dictyostelium discoideum STAT protein Dd-STATa.

PubMed

Shimada, Nao; Kawata, Takefumi

2007-06-01

Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism.

Evidence that Noncoding RNA dutA Is a Multicopy Suppressor of Dictyostelium discoideum STAT Protein Dd-STATa▿

PubMed Central

Shimada, Nao; Kawata, Takefumi

2007-01-01

Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism. PMID:17435008

Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L.) Taub)

PubMed Central

Naoumkina, Marina; Torres-Jerez, Ivone; Allen, Stacy; He, Ji; Zhao, Patrick X; Dixon, Richard A; May, Gregory D

2007-01-01

Background Guar, Cyamopsis tetragonoloba (L.) Taub, is a member of the Leguminosae (Fabaceae) family and is economically the most important of the four species in the genus. The endosperm of guar seed is a rich source of mucilage or gum, which forms a viscous gel in cold water, and is used as an emulsifier, thickener and stabilizer in a wide range of foods and industrial applications. Guar gum is a galactomannan, consisting of a linear (1→4)-β-linked D-mannan backbone with single-unit, (1→6)-linked, α-D-galactopyranosyl side chains. To better understand regulation of guar seed development and galactomannan metabolism we created cDNA libraries and a resulting EST dataset from different developmental stages of guar seeds. Results A database of 16,476 guar seed ESTs was constructed, with 8,163 and 8,313 ESTs derived from cDNA libraries I and II, respectively. Library I was constructed from seeds at an early developmental stage (15–25 days after flowering, DAF), and library II from seeds at 30–40 DAF. Quite different sets of genes were represented in these two libraries. Approximately 27% of the clones were not similar to known sequences, suggesting that these ESTs represent novel genes or may represent non-coding RNA. The high flux of energy into carbohydrate and storage protein synthesis in guar seeds was reflected by a high representation of genes annotated as involved in signal transduction, carbohydrate metabolism, chaperone and proteolytic processes, and translation and ribosome structure. Guar unigenes involved in galactomannan metabolism were identified. Among the seed storage proteins, the most abundant contig represented a conglutin accounting for 3.7% of the total ESTs from both libraries. Conclusion The present EST collection and its annotation provide a resource for understanding guar seed biology and galactomannan metabolism. PMID:18034910

[Construction and analysis of a forward and reverse subtractive cDNA library from leaves and stem of Polygonum sibiricum Laxm. under salt stress].

PubMed

Liu, Guan-Jun; Liu, Ming-Kun; Xu, Zhi-Ru; Yan, Xiu-Feng; Wei, Zhi-Gang; Yang, Chuan-Ping

2009-04-01

Using cDNAs prepared from the leaves and stems of Polygonum sibiricum Laxm. treated with NaHCO3 stress for 48 h as testers and cDNAs from unstressed P. sibiricum leaves and stems as drivers library, suppression subtractive hybridization (SSH) was employed to construct a cDNA subtracted library, which contained 2 282 valid sequences including 598 ESTs in the stems forward SSH library and 490 ESTs in the stem reverse SSH library, 627 ESTs in the leaf forward SSH library and 567 in the leaf reverse SSH library. According to the functional catalogue of MIPs and the comparison of the reverse and forward SSH libraries of the stem and leaf, the responses to NaHCO3 stress were different between leaf and stem, except for the same trend in cell rescue defense and transport facilitation. The trend in the metabolism, energy, photosynthesis, protein synthesis, transcription, and signal transduction was opposite. RT-PCR analysis demonstrated that the expression of 12 putative stress related genes in the NaHCO3-treated leaves and stems was different from that in the untreated leaves and stems. This indicated that different mechanisms might be responsible for reactions of leaf and stem in P. sibiricum. The results from this study are useful in understanding the molecular mechanism of saline-alkali tolerance in P. sibiricum.

Efficient identification of tubby-binding proteins by an improved system of T7 phage display.

PubMed

Caberoy, Nora B; Zhou, Yixiong; Jiang, Xiaoyu; Alvarado, Gabriela; Li, Wei

2010-01-01

Mutation in the tubby gene causes adult-onset obesity, progressive retinal, and cochlear degeneration with unknown mechanism. In contrast, mutations in tubby-like protein 1 (Tulp1), whose C-terminus is highly homologous to tubby, only lead to retinal degeneration. We speculate that their diverse N-terminus may define their distinct disease profile. To elucidate the binding partners of tubby, we used tubby N-terminus (tubby-N) as bait to identify unknown binding proteins with open-reading-frame (ORF) phage display. T7 phage display was engineered with three improvements: high-quality ORF phage display cDNA library, specific phage elution by protease cleavage, and dual phage display for sensitive high throughput screening. The new system is capable of identifying unknown bait-binding proteins in as fast as approximately 4-7 days. While phage display with conventional cDNA libraries identifies high percentage of out-of-frame unnatural short peptides, all 28 tubby-N-binding clones identified by ORF phage display were ORFs. They encode 16 proteins, including 8 nuclear proteins. Fourteen proteins were analyzed by yeast two-hybrid assay and protein pull-down assay with ten of them independently verified. Comparative binding analyses revealed several proteins binding to both tubby and Tulp1 as well as one tubby-specific binding protein. These data suggest that tubby-N is capable of interacting with multiple nuclear and cytoplasmic protein binding partners. These results demonstrated that the newly-engineered ORF phage display is a powerful technology to identify unknown protein-protein interactions. (c) 2009 John Wiley & Sons, Ltd.

A Calcium-Dependent Protein Kinase Is Systemically Induced upon Wounding in Tomato Plants1

PubMed Central

Chico, José Manuel; Raíces, Marcela; Téllez-Iñón, María Teresa; Ulloa, Rita María

2002-01-01

A full-length cDNA clone (LeCDPK1) from tomato (Lycopersicon esculentum) encoding a calcium-dependent protein kinase (CDPK) was isolated by screening a cDNA library from tomato cell cultures exposed to Cladosporium fulvum elicitor preparations. The predicted amino acid sequence of the cDNA reveals a high degree of similarity with other members of the CDPK family. LeCDPK1 has a putative N-terminal myristoylation sequence and presents a possible palmitoylation site. The in vitro translated protein conserves the biochemical properties of a member of the CDPK family. In addition, CDPK activity was detected in soluble and particulate extracts of tomato leaves. Basal levels of LeCDPK1 mRNA were detected by northern-blot analysis in roots, stems, leaves, and flowers of tomato plants. The expression of LeCDPK1 was rapidly and transiently enhanced in detached tomato leaves treated with pathogen elicitors and H2O2. Moreover, when tomato greenhouse plants were subjected to mechanical wounding, a transient increase of LeCDPK1 steady-state mRNA levels was detected locally at the site of the injury and systemically in distant non-wounded leaves. The increase observed in LeCDPK1 mRNA upon wounding correlates with an increase in the amount and in the activity of a soluble CDPK detected in extracts of tomato leaves, suggesting that this kinase is part of physiological plant defense mechanisms against biotic or abiotic attacks. PMID:11788771

Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)

NASA Technical Reports Server (NTRS)

Shibata, K.; Abe, S.; Davies, E.

2001-01-01

Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.

Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujita, R.; Yan, D.; McHenry, C.

1994-09-01

Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less

Targeted disruption of the murine Facc gene: Towards the establishment of a mouse model for Fanconi anemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, M.; Auerbach, W.; Buchwald, M.

1994-09-01

Fanconi anemia (FA) is an autosomal recessive disease characterized by bone marrow failure, congenital malformations and predisposition to malignancies. The gene responsible for the defect in FA group C has been cloned and designated the Fanconi Anemia Complementation Group C gene (FACC). A murine cDNA for this gene (Facc) was also cloned. Here we report our progress in the establishment of a mouse model for FA. The mouse Facc cDNA was used as probe to screen a genomic library of mouse strain 129. More than twenty positive clones were isolated. Three of them were mapped and found to be overlappingmore » clones, encompassing the genomic region from exon 8 to the end of the 3{prime} UTR of the mouse cDNA. A targeting vector was constructed using the most 5{prime} mouse genomic sequence available. The end result of the homologous recombination is that exon 8 is deleted and the neo gene is inserted. The last exon, exon 14, is essential for the complementing function of the FACC gene product; the disruption in the middle of the murine Facc gene should render this locus biologically inactive. This targeting vector was linearized and electroporated into R1 embryonic stem (ES) cells which were derived from the 129 mouse. Of 102 clones screened, 19 positive cell lines were identified. Four targeted cell lines have been used to produce chimeric mice. 129-derived ES cells were aggregated ex vivo into the morulas derived from CD1 mice and then implanted into foster mothers. 22 chimeras have been obtained. Moderately and strongly chimeric mice have been bred to test for germline transmission. Progeny with the expected coat color derived from 2 chimeras are currently being examined to confirm transmission of the targeted allele.« less

ESTminer: a Web interface for mining EST contig and cluster databases.

PubMed

Huang, Yecheng; Pumphrey, Janie; Gingle, Alan R

2005-03-01

ESTminer is a Web application and database schema for interactive mining of expressed sequence tag (EST) contig and cluster datasets. The Web interface contains a query frame that allows the selection of contigs/clusters with specific cDNA library makeup or a threshold number of members. The results are displayed as color-coded tree nodes, where the color indicates the fractional size of each cDNA library component. The nodes are expandable, revealing library statistics as well as EST or contig members, with links to sequence data, GenBank records or user configurable links. Also, the interface allows 'queries within queries' where the result set of a query is further filtered by the subsequent query. ESTminer is implemented in Java/JSP and the package, including MySQL and Oracle schema creation scripts, is available from http://cggc.agtec.uga.edu/Data/download.asp agingle@uga.edu.

Towards isolation of the gene for X-linked retinitis pigmentosa (RP3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dry, K.L.; Aldred, M.A.; Hardwick, L.J.

1994-09-01

Until recently the region of interest containing the gene for X-linked retinitis pigmentosa (RP3) was thought to lie between CYBB (Xp21.1) and the proximal end of the deletion in patient BB (JBBprox). This region was thought to span 100-150 kb. Here we present new mapping data to show that the distance between the 5{prime} (most proximal) end of CYBB and JBBprox is only 50 kb. Recently Roux et al. (1994) have described the isolation of a gene within this region but this showed no disease-associated changes. Further evidence from mapping the deletion in patient NF (who suffered from McLead`s syndromemore » and CGD but not RP) and from linkage analysis of our RP3 families with a new dinucleotide repeat suggests that the gene must extend proximally from JBBprox. In order to extend the region of search we have constructed a YAC contig spanning 800 kb to OTC. We are continuing our search for the RP3 gene using a variety of strategies including exon trapping and cDNA enrichment as well as direct screening of cDNA libraries with subclones from this region.« less

Identification and activity of a lower eukaryotic serine proteinase inhibitor (serpin) from Cyanea capillata: analysis of a jellyfish serpin, jellypin.

PubMed

Cole, Elisabeth B; Miller, David; Rometo, David; Greenberg, Robert M; Brömme, Dieter; Cataltepe, Sule; Pak, Stephen C; Mills, David R; Silverman, Gary A; Luke, Cliff J

2004-09-21

Delineating the phylogenetic relationships among members of a protein family can provide a high degree of insight into the evolution of domain structure and function relationships. To identify an early metazoan member of the high molecular weight serine proteinase inhibitor (serpin) superfamily, we initiated a cDNA library screen of the cnidarian, Cyanea capillata. We identified one serpin cDNA encoding for a full-length serpin, jellypin. Phylogenetic analysis using the deduced amino acid sequence showed that jellypin was most similar to the platyhelminthe Echinococcus multiocularis serpin and the clade P serpins, suggesting that this serpin evolved approximately 1000 million years ago (MYA). Modeling of jellypin showed that it contained all the functional elements of an inhibitory serpin. In vitro biochemical analysis confirmed that jellypin was an inhibitor of the S1 clan SA family of serine proteinases. Analysis of the interactions between the human serine proteinases, chymotrypsin, cathepsin G, and elastase, showed that jellypin inhibited these enzymes in the classical serpin manner, forming a SDS stable enzyme/inhibitor complex. These data suggest that the coevolution of serpin structure and inhibitory function date back to at least early metazoan evolution, approximately 1000 MYA.

Antagonistic effect of disulfide-rich peptide aptamers selected by cDNA display on interleukin-6-dependent cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nemoto, Naoto, E-mail: nemoto@fms.saitama-u.ac.jp; Innovation Center for Startups, National Institute of Advanced Industrial Science and Technology, 2-2-2 Marunouchi, Chiyoda-ku, Tokyo 100-0005; Janusys Corporation, 508, Saitama Industrial Technology Center, Skip City, 3-12-18 Kami-Aoki, Kawaguchi, Saitama 333-0844

2012-04-27

Highlights: Black-Right-Pointing-Pointer Disulfide-rich peptide aptamer inhibits IL-6-dependent cell proliferation. Black-Right-Pointing-Pointer Disulfide bond of peptide aptamer is essential for its affinity to IL-6R. Black-Right-Pointing-Pointer Inhibitory effect of peptide depends on number and pattern of its disulfide bonds. -- Abstract: Several engineered protein scaffolds have been developed recently to circumvent particular disadvantages of antibodies such as their large size and complex composition, low stability, and high production costs. We previously identified peptide aptamers containing one or two disulfide-bonds as an alternative ligand to the interleukin-6 receptor (IL-6R). Peptide aptamers (32 amino acids in length) were screened from a random peptide library bymore » in vitro peptide selection using the evolutionary molecular engineering method 'cDNA display'. In this report, the antagonistic activity of the peptide aptamers were examined by an in vitro competition enzyme-linked immunosorbent assay (ELISA) and an IL-6-dependent cell proliferation assay. The results revealed that a disulfide-rich peptide aptamer inhibited IL-6-dependent cell proliferation with similar efficacy to an anti-IL-6R monoclonal antibody.« less

Fructose-bisphosphate aldolase and pyruvate kinase, two novel immunogens in Madurella mycetomatis.

PubMed

de Klerk, Nele; de Vogel, Corné; Fahal, Ahmed; van Belkum, Alex; van de Sande, Wendy W J

2012-02-01

Eumycetoma, a chronic granulomatous disease characterized by a subcutaneous mass, multiple sinuses and purulent discharge containing grains, remains difficult to diagnose and treat. Madurella mycetomatis is the most common causative agent of eumycetoma. Using a serum pool from patients with active mycetoma, we screened a M. mycetomatis-specific λgt11 cDNA library which was shown to contain 8% of cDNA inserts encoding proteins involved in glycolysis. Two of these enzymes, fructose-bisphosphate aldolase (FBA) and pyruvate kinase (PK), were produced in vitro and their antigenicity was studied with bead-based flow cytometry. It appeared that both FBA and PK IgG antibodies were present in eumycetoma patient sera. However, only FBA antibody levels were found to be significantly higher in eumycetoma patient sera when compared to healthy Sudanese controls. Furthermore, FBA and PK were also found to be expressed on the hyphae present in the mycetoma grain. In conclusion, this study presents two new antigenic proteins of M. mycetomatis next to the translationally controlled tumour protein (TCTP): the glycolytic enzymes FBA and PK. These antigens might be useful as vaccine-candidates in the prevention of mycetoma.

Wheat germ-based protein libraries for the functional characterisation of the Arabidopsis E2 ubiquitin conjugating enzymes and the RING-type E3 ubiquitin ligase enzymes.

PubMed

Ramadan, Abdelaziz; Nemoto, Keiichirou; Seki, Motoaki; Shinozaki, Kazuo; Takeda, Hiroyuki; Takahashi, Hirotaka; Sawasaki, Tatsuya

2015-11-10

Protein ubiquitination is a ubiquitous mechanism in eukaryotes. In Arabidopsis, ubiquitin modification is mainly mediated by two ubiquitin activating enzymes (E1s), 37 ubiquitin conjugating enzymes (E2s), and more than 1300 predicted ubiquitin ligase enzymes (E3s), of which ~470 are RING-type E3s. A large proportion of the RING E3's gene products have yet to be characterised in vitro, likely because of the laborious work involved in large-scale cDNA cloning and protein expression, purification, and characterisation. In addition, several E2s, which might be necessary for the activity of certain E3 ligases, cannot be expressed by Escherichia coli or cultured insect cells and, therefore, remain uncharacterised. Using the RIKEN Arabidopsis full-length cDNA library (RAFL) with the 'split-primer' PCR method and a wheat germ cell-free system, we established protein libraries of Arabidopsis E2 and RING E3 enzymes. We expressed 35 Arabidopsis E2s including six enzymes that have not been previously expressed, and 204 RING proteins, most of which had not been functionally characterised. Thioester assays using dithiothreitol (DTT) showed DTT-sensitive ubiquitin thioester formation for all E2s expressed. In expression assays of RING proteins, 31 proteins showed high molecular smears, which are probably the result of their functional activity. The activities of another 27 RING proteins were evaluated with AtUBC10 and/or a group of different E2s. All the 27 RING E3s tested showed ubiquitin ligase activity, including 17 RING E3s. Their activities are reported for the first time. The wheat germ cell-free system used in our study, which is a eukaryotic expression system and more closely resembles the endogenous expression of plant proteins, is very suitable for expressing Arabidopsis E2s and RING E3s in their functional form. In addition, the protein libraries described here can be used for further understanding E2-E3 specificities and as platforms for protein-protein interaction screening.

Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.

PubMed

Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R

2007-02-01

To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.

Identification of tumor-restricted antigens NY-BR-1, SCP-1, and a new cancer/testis-like antigen NW-BR-3 by serological screening of a testicular library with breast cancer serum.

PubMed

Jäger, Dirk; Unkelbach, Marc; Frei, Claudia; Bert, Florian; Scanlan, Matthew J; Jäger, Elke; Old, Lloyd J; Chen, Yao-Tseng; Knuth, Alexander

2002-06-28

Serological analysis of recombinant cDNA expression libraries (SEREX) has led to the identification of several categories of new tumor antigens. We analyzed a testicular cDNA expression library with serum obtained from a breast cancer patient and isolated 13 genes designated NW-BR-1 through NW-BR-13. Of these, 3 showed tumor-restricted expression (NW-BR-1, -2 and -3), the others being expressed ubiquitously. NW-BR-3, representing 9 of 24 primary clones, showed tissue-restricted mRNA expression, being expressed in normal testis but not in 15 other normal tissues tested by Northern blotting. RT-PCR analysis showed strong NW-BR-3 expression in normal testis, weak expression in brain, kidney, trachea, uterus and normal prostate, and was negative in liver, heart, lung, colon, small intestine, bone marrow, breast, thymus, muscle, spleen, and stomach. NW-BR-3 mRNA expression was found in different tumor tissues and tumor cell lines by RT-PCR, thus showing a 'cancer/testis' (CT)-like mRNA expression pattern. NW-BR-3 shares 71% nucleotide and amino acid homology to a mouse gene cloned from mouse testicular tissue. Based on the mRNA expression pattern, NW-BR-3 represents a new candidate target gene for cancer immunotherapy. NW-BR-1 and NW-BR-2 also showed tumor-restricted mRNA expression. NW-BR-1 is a partial clone of the breast differentiation antigen NY-BR-1 previously identified by SEREX. NY-BR-1 is expressed in normal breast, testis and 80% of breast cancers. NW-BR-2 is identical to the CT antigen SCP-1, initially isolated by SEREX analysis of renal cancer. This study provides further evidence that SEREX is a powerful tool to identify new tumor antigens potentially relevant for immunotherapy approaches.

Expressed sequence tag analysis of adult human optic nerve for NEIBank: Identification of cell type and tissue markers

PubMed Central

Bernstein, Steven L; Guo, Yan; Peterson, Katherine; Wistow, Graeme

2009-01-01

Background The optic nerve is a pure white matter central nervous system (CNS) tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON) and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST) analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR) and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data provide an initial overview of gene expression patterns in this tissue. The data provide clues for tissue-specific and species-specific properties of human ON that will help in design of therapeutic models. PMID:19778450

Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, W.; Emanuel, B.S.; Siegert, J.

1994-09-01

DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design

PubMed Central

Ramsey, John S; Wilson, Alex CC; de Vos, Martin; Sun, Qi; Tamborindeguy, Cecilia; Winfield, Agnese; Malloch, Gaynor; Smith, Dawn M; Fenton, Brian; Gray, Stewart M; Jander, Georg

2007-01-01

Background The green peach aphid, Myzus persicae (Sulzer), is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs). Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection). The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible interactions with its host plants, complementing ongoing work illuminating plant molecular responses to phloem-feeding insects. PMID:18021414

Diagnostic utility of alpha-methylacyl CoA racemase (P504S) on prostate needle biopsy.

PubMed

Jiang, Zhong; Woda, Bruce A

2004-11-01

Alpha-methylacyl CoA racemase (AMACR), also known as P504S, was identified by the analysis of cDNA library subtraction in conjunction with high throughput microarray screening from prostate tissue and has been proven to be one of the very few biomarkers that can distinguish cancer from benign cells with high sensitivity and specificity for prostate carcinoma. It is a successful example of the translation of molecular findings into clinical practice. This review focuses on the study of AMACR (P504S) expression in small focal prostate cancer and atypical small acinar proliferation (ASAP) on needle biopsies and emphasizes the utility of AMACR (P504S) in routine surgical pathology practice. We also discuss the potential pitfalls and caveats in the interpretation of immunostaining results.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Hae Jin; Park, Joongkyu; Seo, Su Ryeon

Down syndrome is mainly caused by a trisomy of chromosome 21. The Down syndrome critical region 2 (DSCR2) gene is located within a part of chromosome 21, the Down syndrome critical region (DSCR). To investigate the function of DSCR2, we sought to identify DSCR2-interacting proteins using yeast two-hybrid assays. A human fetal brain cDNA library was screened, and DSCR2 was found to interact with a member of the nuclear receptor superfamily, peroxisome proliferator-activated receptor {beta}, (PPAR{beta}). A co-immunoprecipitation assay demonstrated that DSCR2 physically interacts with PPAR{beta} in mammalian HEK293 cells. DSCR2 also inhibited the ligand-induced transcriptional activity of PPAR{beta}. Furthermore,more » PPAR{beta} also decreased the solubility of DSCR2, which increased levels of insoluble DSCR2.« less

[Identification of proteins interacting with the circadian clock protein PER1 in tumors using bacterial two-hybrid system technique].

PubMed

Zhang, Yu; Yao, Youlin; Jiang, Siyuan; Lu, Yilu; Liu, Yunqiang; Tao, Dachang; Zhang, Sizhong; Ma, Yongxin

2015-04-01

To identify protein-protein interaction partners of PER1 (period circadian protein homolog 1), key component of the molecular oscillation system of the circadian rhythm in tumors using bacterial two-hybrid system technique. Human cervical carcinoma cell Hela library was adopted. Recombinant bait plasmid pBT-PER1 and pTRG cDNA plasmid library were cotransformed into the two-hybrid system reporter strain cultured in a special selective medium. Target clones were screened. After isolating the positive clones, the target clones were sequenced and analyzed. Fourteen protein coding genes were identified, 4 of which were found to contain whole coding regions of genes, which included optic atrophy 3 protein (OPA3) associated with mitochondrial dynamics and homo sapiens cutA divalent cation tolerance homolog of E. coli (CUTA) associated with copper metabolism. There were also cellular events related proteins and proteins which are involved in biochemical reaction and signal transduction-related proteins. Identification of potential interacting proteins with PER1 in tumors may provide us new insights into the functions of the circadian clock protein PER1 during tumorigenesis.

Comparative Genomics as a Foundation for Evo-Devo Studies in Birds.

PubMed

Grayson, Phil; Sin, Simon Y W; Sackton, Timothy B; Edwards, Scott V

2017-01-01

Developmental genomics is a rapidly growing field, and high-quality genomes are a useful foundation for comparative developmental studies. A high-quality genome forms an essential reference onto which the data from numerous assays and experiments, including ChIP-seq, ATAC-seq, and RNA-seq, can be mapped. A genome also streamlines and simplifies the development of primers used to amplify putative regulatory regions for enhancer screens, cDNA probes for in situ hybridization, microRNAs (miRNAs) or short hairpin RNAs (shRNA) for RNA interference (RNAi) knockdowns, mRNAs for misexpression studies, and even guide RNAs (gRNAs) for CRISPR knockouts. Finally, much can be gleaned from comparative genomics alone, including the identification of highly conserved putative regulatory regions. This chapter provides an overview of laboratory and bioinformatics protocols for DNA extraction, library preparation, library quantification, and genome assembly, from fresh or frozen tissue to a draft avian genome. Generating a high-quality draft genome can provide a developmental research group with excellent resources for their study organism, opening the doors to many additional assays and experiments.

Human parainfluenza virus type 2 V protein inhibits caspase-1.

PubMed

Ohta, Keisuke; Matsumoto, Yusuke; Nishio, Machiko

2018-04-01

The multifunctional V protein of human parainfluenza virus type 2 (hPIV2) plays important roles in controlling viral genome replication, inhibiting the host interferon response and promoting virus growth. We screened a yeast two-hybrid library using V protein as bait to identify host factors that are important for other functions of V. One of several positive clones isolated from HeLa cell-derived cDNA library encodes caspase-1. We found that the C-terminal region of V interacts with the C-terminal region of caspase-1 in mammalian cells. Moreover, the V protein repressed caspase-1 activity and the formation of interleukin-1β (IL-1β) in a dose-dependent manner. IL-1β secretion induced by wild-type hPIV2 infection in human monocytic THP-1 cells was significantly lower than that induced by recombinant hPIV2 lacking V protein or having a mutant V. These data suggest that hPIV2 V protein inhibits caspase-1-mediated maturation of IL-1β via its interaction with caspase-1.

A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library.

PubMed

Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson

2015-04-09

Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.

Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

PubMed

Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

2013-05-01

One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

PubMed Central

Woods, D E; Edge, M D; Colten, H R

1984-01-01

Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

Expression of Ornithine Decarboxylase Is Transiently Increased by Pollination, 2,4-Dichlorophenoxyacetic Acid, and Gibberellic Acid in Tomato Ovaries1

PubMed Central

Alabadí, David; Carbonell, Juan

1998-01-01

A cDNA encoding for a functional ornithine decarboxylase has been isolated from a cDNA library of carpels of tomato (Lycopersicon esculentum Mill.). Ornithine decarboxylase in tomato is represented by a single-copy gene that we show to be up-regulated during early fruit growth induced by 2,4-dichlorophenoxyacetic acid and gibberellic acid. PMID:9733552

The mining of pearl formation genes in pearl oyster Pinctada fucata by cDNA suppression subtractive hybridization.

PubMed

Wang, Ning; Kinoshita, Shigeharu; Nomura, Naoko; Riho, Chihiro; Maeyama, Kaoru; Nagai, Kiyohito; Watabe, Shugo

2012-04-01

Recent researches revealed the regional preference of biomineralization gene transcription in the pearl oyster Pinctada fucata: it transcribed mainly the genes responsible for nacre secretion in mantle pallial, whereas the ones regulating calcite shells expressed in mantle edge. This study took use of this character and constructed the forward and reverse suppression subtractive hybridization (SSH) cDNA libraries. A total of 669 cDNA clones were sequenced and 360 expressed sequence tags (ESTs) greater than 100 bp were generated. Functional annotation associated 95 ESTs with specific functions, and 79 among them were identified from P. fucata at the first time. In the forward SSH cDNA library, it recognized mass amount of nacre protein genes, biomineralization genes dominantly expressed in the mantle pallial, calcium-ion-binding genes, and other biomineralization-related genes important for pearl formation. Real-time PCR showed that all the examined genes were distributed in oyster mantle tissues with a consistence to the SSH design. The detection of their RNA transcripts in pearl sac confirmed that the identified genes were certainly involved in pearl formation. Therefore, the data from this work will initiate a new round of pearl formation gene study and shed new insights into molluscan biomineralization.

Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

PubMed Central

2011-01-01

Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934

Upregulated Genes In Sporadic, Idiopathic Pulmonary Arterial Hypertension

PubMed Central

Edgar, Alasdair J; Chacón, Matilde R; Bishop, Anne E; Yacoub, Magdi H; Polak, Julia M

2006-01-01

Background To elucidate further the pathogenesis of sporadic, idiopathic pulmonary arterial hypertension (IPAH) and identify potential therapeutic avenues, differential gene expression in IPAH was examined by suppression subtractive hybridisation (SSH). Methods Peripheral lung samples were obtained immediately after removal from patients undergoing lung transplant for IPAH without familial disease, and control tissues consisted of similarly sampled pieces of donor lungs not utilised during transplantation. Pools of lung mRNA from IPAH cases containing plexiform lesions and normal donor lungs were used to generate the tester and driver cDNA libraries, respectively. A subtracted IPAH cDNA library was made by SSH. Clones isolated from this subtracted library were examined for up regulated expression in IPAH using dot blot arrays of positive colony PCR products using both pooled cDNA libraries as probes. Clones verified as being upregulated were sequenced. For two genes the increase in expression was verified by northern blotting and data analysed using Student's unpaired two-tailed t-test. Results We present preliminary findings concerning candidate genes upregulated in IPAH. Twenty-seven upregulated genes were identified out of 192 clones examined. Upregulation in individual cases of IPAH was shown by northern blot for tissue inhibitor of metalloproteinase-3 and decorin (P < 0.01) compared with the housekeeping gene glyceraldehydes-3-phosphate dehydrogenase. Conclusion Four of the up regulated genes, magic roundabout, hevin, thrombomodulin and sucrose non-fermenting protein-related kinase-1 are expressed specifically by endothelial cells and one, muscleblind-1, by muscle cells, suggesting that they may be associated with plexiform lesions and hypertrophic arterial wall remodelling, respectively. PMID:16390543

Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

PubMed Central

Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu

2007-01-01

Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

PubMed

Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

2011-10-01

Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

PubMed Central

Craig, R K; Hall, L; Parker, D; Campbell, P N

1981-01-01

A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

PubMed Central

DeWitt, D L; Smith, W L

1988-01-01

Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

Emerging techniques for the discovery and validation of therapeutic targets for skeletal diseases.

PubMed

Cho, Christine H; Nuttall, Mark E

2002-12-01

Advances in genomics and proteomics have revolutionised the drug discovery process and target validation. Identification of novel therapeutic targets for chronic skeletal diseases is an extremely challenging process based on the difficulty of obtaining high-quality human diseased versus normal tissue samples. The quality of tissue and genomic information obtained from the sample is critical to identifying disease-related genes. Using a genomics-based approach, novel genes or genes with similar homology to existing genes can be identified from cDNA libraries generated from normal versus diseased tissue. High-quality cDNA libraries are prepared from uncontaminated homogeneous cell populations harvested from tissue sections of interest. Localised gene expression analysis and confirmation are obtained through in situ hybridisation or immunohistochemical studies. Cells overexpressing the recombinant protein are subsequently designed for primary cell-based high-throughput assays that are capable of screening large compound banks for potential hits. Afterwards, secondary functional assays are used to test promising compounds. The same overexpressing cells are used in the secondary assay to test protein activity and functionality as well as screen for small-molecule agonists or antagonists. Once a hit is generated, a structure-activity relationship of the compound is optimised for better oral bioavailability and pharmacokinetics allowing the compound to progress into development. Parallel efforts from proteomics, as well as genetics/transgenics, bioinformatics and combinatorial chemistry, and improvements in high-throughput automation technologies, allow the drug discovery process to meet the demands of the medicinal market. This review discusses and illustrates how different approaches are incorporated into the discovery and validation of novel targets and, consequently, the development of potentially therapeutic agents in the areas of osteoporosis and osteoarthritis. While current treatments exist in the form of hormone replacement therapy, antiresorptive and anabolic agents for osteoporosis, there are no disease-modifying therapies for the treatment of the most common human joint disease, osteoarthritis. A massive market potential for improved options with better safety and efficacy still remains. Therefore, the application of genomics and proteomics for both diseases should provide much needed novel therapeutic approaches to treating these major world health problems.

Next generation sequencing technology: a powerful tool for the genome characterization of sugarcane mosaic virus from Sorghum almum

USDA-ARS?s Scientific Manuscript database

Next generation sequencing (NGS) technology was used to analyze the occurrence of viruses in Sorghum almum plants in Florida exhibiting mosaic symptoms. Total RNA was extracted from symptomatic leaves and used as a template for cDNA library preparation. The resulting library was sequenced on an Illu...

Cloning and characterization of a novel oocyte-specific gene encoding an F-Box protein in rainbow trout (Oncorhynchus mykiss)

USDA-ARS?s Scientific Manuscript database

Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by ESTs only from the oocyte library. The novel...

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

Isolation and characterization of a J domain protein that interacts with ARC1 from ornamental kale (Brassica oleracea var. acephala).

PubMed

Lan, Xingguo; Yang, Jia; Cao, Mingming; Wang, Yanhong; Kawabata, Saneyuki; Li, Yuhua

2015-05-01

A novel J domain protein, JDP1, was isolated from ornamental kale. The C-terminus of JDP1 specifically interacted with ARC1, which has a conserved role in self-incompatibility signaling. Armadillo (ARM)-repeat containing 1 (ARC1) plays a conserved role in self-incompatibility signaling across the Brassicaceae and functions downstream of the S-locus receptor kinase. Here, we identified a J domain protein 1 (JDP1) that interacts with ARC1 using a yeast two-hybrid screen against a stigma cDNA library from ornamental kale (Brassica oleracea var. acephala). JDP1, a 38.4-kDa protein with 344 amino acids, is a member of the Hsp40 family. Fragment JDP1(57-344), originally isolated from a yeast two-hybrid cDNA library, interacted specifically with ARC1 in yeast two-hybrid assays. The N-terminus of JDP1 (JDP1(1-68)) contains a J domain, and the C-terminus of JDP1 (JDP1(69-344)) contains an X domain of unknown function. However, JDP1(69-344) was required and sufficient for interaction with ARC1 in yeast two-hybrid assays and in vitro binding assays. Moreover, JDP1(69-344) regulated the trafficking of ARC1 from the cytoplasm to the plasma membrane by interacting with ARC1 in Arabidopsis mesophyll protoplasts. Finally, Tyr(8) in the JDP1 N-terminal region was identified to be the specific site for regulating the interaction between JDP1 and BoARC1 in yeast two-hybrid assays. Possible roles of JDP1 as an interactor with ARC1 in Brassica are discussed.

Flower-predominant expression of a gene encoding a novel class I chitinase in rice (Oryza sativa L.).

PubMed

Takakura, Y; Ito, T; Saito, H; Inoue, T; Komari, T; Kuwata, S

2000-04-01

A flower-predominant cDNA for a gene, termed OsChia 1;175, was isolated from a cDNA library of rice pistils. Northern blot and RT-PCR analyses revealed that the OsChia 1;175 gene is highly expressed in floral organs (pistils, stamens and lodicules at the heading stage) but not or at an extremely low level in vegetative organs. OsChia 1;175 encodes a protein that consists of 340 amino acid residues, and the putative mature protein shows 52% to 63% amino acid identity to class I chitinases of rice or other plants. The phylogenetic tree shows that the OsChia 1;175 protein is a new type of plant class I chitinase in rice. The expression of OsChia 1;175 in vegetative organs is not induced by several chemicals, UV, and wounding. The soluble putative mature OsChia 1;175 protein expressed in Escherichia coli exhibited chitinase activity in the assay with colloidal chitin as a substrate. Genomic Southern analysis revealed that the OsChia 1;175 gene was organized as a low-copy gene family. The rice genomic library was screened and a genome clone corresponding to OsChia 1;175 was isolated. The transcription start sites of the OsChia 1;175 gene were mapped by primer extension analysis. The 1.2 kb putative promoter region of the OsChia 1;175 gene was fused to the GUS (beta-glucuronidase) gene, and this chimeric gene was introduced to rice by Agrobacterium-mediated transformation. The flower-predominant gene expression was identified also in the transgenic rice plants. The high promoter activity was detected in the stigmas, styles, stamens and lodicules in transgenic plants. The possible functions of OsChia 1;175 are discussed.

Characterization of early follicular cDNA library suggests evidence for genetic polymorphisms in the inbred strain C108 of Bombyx mori.

PubMed

Mills, D R; Goldsmith, M R

2000-04-01

Recent work towards the completion of a saturated molecular genetic linkage map for the lepidopteran silkworm, Bombyx mori (n = 28), has provided evidence for existing polymorphisms in the inbred strain C108. Two inbred parental strains, p50 and C108, were crossed to produce the F1 (P/C) hybrid offspring. The populations used in this project were comprised of a combination of 29 F2 (F1 x F1) and 31 reciprocal backcross (P/C x C/C, P/C x P/P) progeny. All restriction fragment length polymorphisms (RFLPs) for the initial analysis were hybridized with anonymous probes derived from a random early follicular cDNA (Rcf) library from Bombyx. A total of 19 Rcf probes were selected as showing scorable codominant polymorphic patterns when screened against F2 and backcross DNAs digested with the restriction enzymes EcoRI, HindIII, or PstI, and Southern blotted to nylon membranes for hybridization. Of the newly reported Rcf probes, 7 (37%) were characterized as producing 'simple' polymorphic patterns, while 12 (63%) were characterized as producing 'complex' polymorphic patterns. Further characterization of the complex patterns subdivided this group into two general classes: polymorphisms that contained an additional allele, and multiple bands that contained an easily scored two banded polymorphism. Because the extra allele class was limited to the (P/C x C/C) backcross progeny, it is suggested that the inbred parental strain C108 harbors polymorphic loci that are inherited in a simple Mendelian fashion. A genetic analysis discussing plausible origins and maintenance of these polymorphisms is presented.

Identification of antigenic regions on VP2 of African horsesickness virus serotype 3 by using phage-displayed epitope libraries.

PubMed

Bentley, L; Fehrsen, J; Jordaan, F; Huismans, H; du Plessis, D H

2000-04-01

VP2 is an outer capsid protein of African horsesickness virus (AHSV) and is recognized by serotype-discriminatory neutralizing antibodies. With the objective of locating its antigenic regions, a filamentous phage library was constructed that displayed peptides derived from the fragmentation of a cDNA copy of the gene encoding VP2. Peptides ranging in size from approximately 30 to 100 amino acids were fused with pIII, the attachment protein of the display vector, fUSE2. To ensure maximum diversity, the final library consisted of three sub-libraries. The first utilized enzymatically fragmented DNA encoding only the VP2 gene, the second included plasmid sequences, while the third included a PCR step designed to allow different peptide-encoding sequences to recombine before ligation into the vector. The resulting composite library was subjected to immunoaffinity selection with AHSV-specific polyclonal chicken IgY, polyclonal horse immunoglobulins and a monoclonal antibody (MAb) known to neutralize AHSV. Antigenic peptides were located by sequencing the DNA of phages bound by the antibodies. Most antigenic determinants capable of being mapped by this method were located in the N-terminal half of VP2. Important binding areas were mapped with high resolution by identifying the minimum overlapping areas of the selected peptides. The MAb was also used to screen a random 17-mer epitope library. Sequences that may be part of a discontinuous neutralization epitope were identified. The amino acid sequences of the antigenic regions on VP2 of serotype 3 were compared with corresponding regions on three other serotypes, revealing regions with the potential to discriminate AHSV serotypes serologically.

RNA-Seq analysis to capture the transcriptome landscape of a single cell

PubMed Central

Tang, Fuchou; Barbacioru, Catalin; Nordman, Ellen; Xu, Nanlan; Bashkirov, Vladimir I; Lao, Kaiqin; Surani, M. Azim

2013-01-01

We describe here a protocol for digital transcriptome analysis in a single mouse blastomere using a deep sequencing approach. An individual blastomere was first isolated and put into lysate buffer by mouth pipette. Reverse transcription was then performed directly on the whole cell lysate. After this, the free primers were removed by Exonuclease I and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase. Then the single cell cDNAs were amplified by 20 plus 9 cycles of PCR. Then 100-200 ng of these amplified cDNAs were used to construct a sequencing library. The sequencing library can be used for deep sequencing using the SOLiD system. Compared with the cDNA microarray technique, our assay can capture up to 75% more genes expressed in early embryos. The protocol can generate deep sequencing libraries within 6 days for 16 single cell samples. PMID:20203668

Role of messenger RNA-ribosome complex in complementary DNA display.

PubMed

Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke

2013-07-15

In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.

Phosducin-like protein: an ethanol-responsive potential modulator of guanine nucleotide-binding protein function.

PubMed

Miles, M F; Barhite, S; Sganga, M; Elliott, M

1993-11-15

Acute and chronic exposure to ethanol produces specific changes in several signal transduction cascades. Such alterations in signaling are thought to be a crucial aspect of the central nervous system's adaptive response, which occurs with chronic exposure to ethanol. We have recently identified and isolated several genes whose expression is specifically induced by ethanol in neural cell cultures. The product of one of these genes has extensive sequence homology to phosducin, a phosphoprotein expressed in retina and pineal gland that modulates trimeric guanine nucleotide-binding protein (G protein) function by binding to G-protein beta gamma subunits. We identified from a rat brain cDNA library an isolate encoding the phosducin-like protein (PhLP), which has 41% identity and 65% amino acid homology to phosducin. PhLP cDNA is expressed in all tissues screened by RNA blot-hybridization analysis and shows marked evolutionary conservation on Southern hybridization. We have identified four forms of PhLP cDNA varying only in their 5' ends, probably due to alternative splicing. This 5'-end variation generates two predicted forms of PhLP protein that differ by 79 aa at the NH2 terminus. Treatment of NG108-15 cells for 24 hr with concentrations of ethanol seen in actively drinking alcoholics (25-100 mM) causes up to a 3-fold increase in PhLP mRNA levels. Induction of PhLP by ethanol could account for at least some of the widespread alterations in signal transduction and G-protein function that are known to occur with chronic exposure to ethanol.

Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

PubMed

Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

2011-09-01

Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

Single-Cell RNA Sequencing of Glioblastoma Cells.

PubMed

Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

2018-01-01

Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

Analysis of beta-carotene hydroxylase gene cDNA isolated from the American oil-palm (Elaeis oleifera) mesocarp tissue cDNA library

PubMed Central

Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H

2010-01-01

It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789

EST resources and establishment and validation of a 16k cDNA microarray from Atlantic cod (Gadus morhua).

PubMed

Edvardsen, Rolf B; Malde, Ketil; Mittelholzer, Christian; Taranger, Geir Lasse; Nilsen, Frank

2011-03-01

The Atlantic cod, Gadus morhua, is an important species both for traditional fishery and increasingly also in fish farming. The Atlantic cod is also under potential threat from various environmental changes such as pollution and climate change, but the biological impact of such changes are not well known, in particular when it comes to sublethal effects that can be difficult to assert. Modern molecular and genomic approaches have revolutionized biological research during the last decade, and offer new avenues to study biological functions and e.g. the impact of anthropogenic activities at different life-stages for a given organism. In order to develop genomic data and genomic tools for Atlantic cod we conducted a program were we constructed 20 cDNA libraries, and produced and analyzed 44006 expressed sequence tags (ESTs) from these. Several tissues are represented in the multiple cDNA libraries, that differ in either sexual maturation or immulogical stimulation. This approach allowed us to identify genes that are expressed in particular tissues, life-stages or in response to specific stimuli, and also gives us information about potential functions of the transcripts. The ESTs were used to construct a 16k cDNA microarray to further investigate the cod transcriptome. Microarray analyses were preformed on pylorus, pituitary gland, spleen and testis of sexually maturing male cod. The four different tissues displayed tissue specific transcriptomes demonstrating that the cDNA array is working as expected and will prove to be a powerful tool in further experiments. Copyright © 2010 Elsevier Inc. All rights reserved.

Two potato proteins, including a novel RING finger protein (HIP1), interact with the potyviral multifunctional protein HCpro.

PubMed

Guo, Deyin; Spetz, Carl; Saarma, Mart; Valkonen, Jari P T

2003-05-01

Potyviral helper-component proteinase (HCpro) is a multifunctional protein exerting its cellular functions in interaction with putative host proteins. In this study, cellular protein partners of the HCpro encoded by Potato virus A (PVA) (genus Potyvirus) were screened in a potato leaf cDNA library using a yeast two-hybrid system. Two cellular proteins were obtained that interact specifically with PVA HCpro in yeast and in the two in vitro binding assays used. Both proteins are encoded by single-copy genes in the potato genome. Analysis of the deduced amino acid sequences revealed that one (HIP1) of the two HCpro interactors is a novel RING finger protein. The sequence of the other protein (HIP2) showed no resemblance to the protein sequences available from databanks and has known biological functions.

Characterization of HbWRKY1, a WRKY transcription factor from Hevea brasiliensis that negatively regulates HbSRPP.

PubMed

Wang, Ying; Guo, Dong; Li, Hui-Liang; Peng, Shi-Qing

2013-10-01

Small rubber particle protein (SRPP) is a major component of Hevea brasiliensis (H. brasiliensis) latex, which is involved in natural rubber (NR) biosynthesis. However, little information is available on the regulation of SRPP gene (HbSRPP) expression. To study the transcriptional regulation of HbSRPP, the yeast one-hybrid experiment was performed to screen the latex cDNA library using the HbSRPP promoter as bait. One cDNA that encodes the WRKY transcription factor, designated as HbWRKY1, was isolated from H. brasiliensis. HbWRKY1 contains a 1437 bp open reading frame that encodes 478 amino acids. The deduced HbWRKY1 protein was predicted to possess two conserved WRKY domains and a C2H2 zinc-finger motif. HbWRKY1 was expressed at different levels, with the highest transcription in the flower, followed by the bark, latex, and leaf. Furthermore, the co-expression of pHbSRP::GUS with CaMV35S::HbWRKY1 significantly decreased the GUS activity in transgenic tobacco, indicating that HbWRKY1 significantly suppressed the HbSRPP promoter. These results suggested that HbWRKY1 maybe a negative transcription regulator of HbSRPP involved in NR biosynthesis in H. brasiliensis. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo

PubMed Central

Martínez de Alba, Angel Emilio; Sägesser, Rudolf; Tabler, Martin; Tsagris, Mina

2003-01-01

For the identification of RNA-binding proteins that specifically interact with potato spindle tuber viroid (PSTVd), we subjected a tomato cDNA expression library prepared from viroid-infected leaves to an RNA ligand screening procedure. We repeatedly identified cDNA clones that expressed a protein of 602 amino acids. The protein contains a bromodomain and was termed viroid RNA-binding protein 1 (VIRP1). The specificity of interaction of VIRP1 with viroid RNA was studied by different methodologies, which included Northwestern blotting, plaque lift, and electrophoretic mobility shift assays. VIRP1 interacted strongly and specifically with monomeric and oligomeric PSTVd positive-strand RNA transcripts. Other RNAs, for example, U1 RNA, did not bind to VIRP1. Further, we could immunoprecipitate complexes from infected tomato leaves that contained VIRP1 and viroid RNA in vivo. Analysis of the protein sequence revealed that VIRP1 is a member of a newly identified family of transcriptional regulators associated with chromatin remodeling. VIRP1 is the first member of this family of proteins, for which a specific RNA-binding activity is shown. A possible role of VIRP1 in viroid replication and in RNA mediated chromatin remodeling is discussed. PMID:12915580

Arabidopsis chloroplast chaperonin 10 is a calmodulin-binding protein

NASA Technical Reports Server (NTRS)

Yang, T.; Poovaiah, B. W.

2000-01-01

Calcium regulates diverse cellular activities in plants through the action of calmodulin (CaM). By using (35)S-labeled CaM to screen an Arabidopsis seedling cDNA expression library, a cDNA designated as AtCh-CPN10 (Arabidopsis thaliana chloroplast chaperonin 10) was cloned. Chloroplast CPN10, a nuclear-encoded protein, is a functional homolog of E. coli GroES. It is believed that CPN60 and CPN10 are involved in the assembly of Rubisco, a key enzyme involved in the photosynthetic pathway. Northern analysis revealed that AtCh-CPN10 is highly expressed in green tissues. The recombinant AtCh-CPN10 binds to CaM in a calcium-dependent manner. Deletion mutants revealed that there is only one CaM-binding site in the last 31 amino acids of the AtCh-CPN10 at the C-terminal end. The CaM-binding region in AtCh-CPN10 has higher homology to other chloroplast CPN10s in comparison to GroES and mitochondrial CPN10s, suggesting that CaM may only bind to chloroplast CPN10s. Furthermore, the results also suggest that the calcium/CaM messenger system is involved in regulating Rubisco assembly in the chloroplast, thereby influencing photosynthesis. Copyright 2000 Academic Press.

Melanin biosynthesis in the fungus Curvularia lunata (teleomorph: Cochliobolus lunatus).

PubMed

Lanisnik Rizner, Tea; Wheeler, Michael H

2003-02-01

Curvularia lunata (teleomorph: Cochliobolus lunatus) is a known plant and human pathogen. Tricyclazole, a specific inhibitor of pentaketide melanin biosynthesis, blocked the biosynthesis of melanin in Curvularia lunata and caused the accumulation of the melanin metabolites flaviolin and 2-hydroxyjuglone. This showed that melanin in Curvularia lunata is produced by a pentaketide pathway from 1,8-dihydroxynaphthalene. The 1,3,8-trihydroxynaphthalene reductase (3HNR) gene, associated with the melanin pathway of Curvularia lunata, was identified and characterized. An alignment of 3HNR sequences enabled the design of primers covering conserved regions. A PCR-amplified fragment of Curvularia lunata genomic DNA was used for screening the cDNA library. Three independent cDNA clones revealed an 801-bp open reading frame encoding a 267 amino acid protein. The protein was expressed in Escherichia coli and purified to homogeneity. The predicted amino acid sequence of the 28.6-kDa protein demonstrated homology to other fungal 3HNR and other members of the short-chain dehydrogenase super family. Northern analyses revealed that 3HNR from Curvularia lunata is expressed synchronously with melanization after 3 days of Curvularia lunata growth in malt extract medium. No 3HNR reductase gene expression nor melanization was observed when Curvularia lunata was grown in yeast nitrogen base medium.

A protein that interacts with members of the nuclear hormone receptor family: identification and cDNA cloning.

PubMed Central

Zeiner, M; Gehring, U

1995-01-01

In search of proteins which interact with activated steroid hormone receptors, we screened a human liver lambda gt11 expression library with the glucocorticoid receptor. We identified and cloned a cDNA sequence of 1322 bp that encodes a protein of 274 aa. This protein consists predominantly of hydrophilic amino acids and contains a putative bipartite nuclear localization signal. The in vitro translated receptor-associating protein runs in SDS/polyacrylamide gels with an apparent molecular mass of 46 kDa. By use of the bacterially expressed fusion protein with glutathione S-transferase we have found that interaction is not limited to the glucocorticoid receptor but included other nuclear receptors--most notably, the estrogen and thyroid receptors. Binding also occurs with the glucocorticoid receptor complexed with the antiglucocorticoid RU 38486, with the estrogen receptor complexed with the antiestrogen 4-hydroxytamoxifen or ICI 164,384, and even with receptors not complexed with ligand. Association with steroid hormone receptors depends on prior receptor activation--i.e., release from heat shock proteins. The sequence identified here appears to be a general partner protein for nuclear hormone receptors, with the gene being expressed in a variety of mammalian tissues. Images Fig. 2 Fig. 3 Fig. 4 PMID:8524784

Isolation of nine gene sequences induced by silica in murine macrophages

DOE Office of Scientific and Technical Information (OSTI.GOV)

Segade, F.; Claudio, E.; Wrobel, K.

1995-03-01

Macrophage activation by silica is the initial step in the development of silicosis. To identify genes that might be involved in silica-mediated activation, RAW 264.7 mouse macrophages were treated with silica for 48 h, and a subtracted cDNA library enriched for silica-induced genes (SIG) was constructed and differently screened. Nine cDNA clones (designated SIG-12, -14, -20, -41, -61, -81, -91, and -111) were partially sequenced and compared with sequences in GenBank/EMBL databases. SIG-12, -14, and -20 corresponded to the genes for ribosomal proteins L13A, L32, and L26, respectively. SIG-61 is the mouse homologue of p21 RhoC. SIG-91 is identical tomore » the 67-kDa high-affinity laminin receptor. Four genes were not identified and are novel. All of the mRNAs corresponding to the nine cloned cDNAs were inducible by silica. Steady-state levels of mRNAs in RAW 264.7 cells treated with various macrophage activators and inducers of signal transduction pathways were determined. A complex pattern of induction and repression was found, indicating that upon phagocytosis of silica particles, many regulatory mechanisms of genes expression are simultaneously triggered. 55 refs., 4 figs., 1 tab.« less

Akt regulates drug-induced cell death through Bcl-w downregulation.

PubMed

Garofalo, Michela; Quintavalle, Cristina; Zanca, Ciro; De Rienzo, Assunta; Romano, Giulia; Acunzo, Mario; Puca, Loredana; Incoronato, Mariarosaria; Croce, Carlo M; Condorelli, Gerolama

2008-01-01

Akt is a serine threonine kinase with a major role in transducing survival signals and regulating proteins involved in apoptosis. To find new interactors of Akt involved in cell survival, we performed a two-hybrid screening in yeast using human full-length Akt c-DNA as bait and a murine c-DNA library as prey. Among the 80 clones obtained, two were identified as Bcl-w. Bcl-w is a member of the Bcl-2 family that is essential for the regulation of cellular survival, and that is up-regulated in different human tumors, such as gastric and colorectal carcinomas. Direct interaction of Bcl-w with Akt was confirmed by immunoprecipitation assays. Subsequently, we addressed the function of this interaction: by interfering with the activity or amount of Akt, we have demonstrated that Akt modulates the amount of Bcl-w protein. We have found that inhibition of Akt activity may promote apoptosis through the downregulation of Bcl-w protein and the consequential reduction in interaction of Bcl-w with pro-apoptotic members of the Bcl-2 family. Our data provide evidence that Bcl-w is a new member of the Akt pathway and that Akt may induce anti-apoptotic signals at least in part through the regulation of the amount and activity of Bcl-w.

Molecular cloning and structural characterization of Ecdysis Triggering Hormone from Choristoneura fumiferana.

PubMed

P, Bhagath Kumar; K, Kasi Viswanath; S, Tuleshwori Devi; R, Sampath Kumar; Doucet, Daniel; Retnakaran, Arthur; Krell, Peter J; Feng, Qili; Ampasala, Dinakara Rao

2016-07-01

At the end of each stadium, insects undergo a precisely orchestrated process known as ecdysis which results in the replacement of the old cuticle with a new one. This physiological event is necessary to accommodate growth in arthropods since they have a rigid chitinous exoskeleton. Ecdysis is initiated by the direct action of Ecdysis Triggering Hormones on the central nervous system. Choristoneura fumiferana is a major defoliator of coniferous forests in Eastern North America. It is assumed that, studies on the ecdysis behavior of this pest might lead to the development of novel pest management strategies. Hence in this study, the cDNA of CfETH was cloned. The open reading frame of the cDNA sequence was found to encode three putative peptides viz., Pre-Ecdysis Triggering Hormone (PETH), Ecdysis Triggering Hormone (ETH), and Ecdysis Triggering Hormone Associated Peptide (ETH-AP). The CfETH transcript was detected in the epidermal tissue of larval and pupal stages, but not in eggs and adults. In order to explore the structural conformation of ETH, ab initio modelling and Molecular Dynamics (MD) Simulations were performed. Further, a library of insecticides was generated and virtual screening was performed to identify the compounds displaying high binding capacity to ETH. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of UQCRB as an oxymatrine recognizing protein using a T7 phage display screen.

PubMed

Sun, Yan-Hui; Zhang, Xiao-Yuan; Xie, Wei-Qun; Liu, Guang-Jian; He, Xi-Xin; Huang, Ya-Li; Zhang, Guang-Xian; Wang, Jian; Kuang, Zao-Yuan; Zhang, Ren

2016-12-04

Sophora flavescens Aiton (Radix Sophorae Flavescentis, Kushen) is used in traditional Chinese medicine to treat chronic hepatitis B (CHB), and has the ability to clear heat and dampness from the body. Oxymatrine is one of the major bioactive compounds extracted from Sophora flavescens Aiton and constitutes more than 90% of the oxymatrine injection commonly used for CHB treatment in clinics in China. We aim to analyze the protein binding target of oxymatrine in treating CHB by screening a T7 phage display cDNA library of human CHB and examine the biochemistry of protein-ligand binding between oxymatrine and its ligands. A T7 phage cDNA library of human CHB was biopanned by affinity selection using oxymatrine as bait. The interaction of oxymatrine with its candidate binding protein was investigated by affinity assay, molecular docking, Isothermal Titration Calorimetry (ITC) and Surface Plasmon Resonance (SPR). A library of potential oxymatrine binding peptides was generated. Ubiquinol-cytochrome c reductase binding protein (UQCRB) was one of the candidate binding proteins of oxymatrine. UQCRB-displaying T7 phage binding numbers in the oxymatrine group were significantly higher than that in the control group, biotin group, and matrine group (p<0.05 or p<0.01). Three-dimensional structure modeling of the UQCRB with oxymatrine showed that their binding interfaces matched and oxymatrine inserted into a deeper pocket of UQCRB, which mainly involved amino acid residues Tyr21, Arg33, Tyr83, Glu84, Asp86, Pro88, and Glu91. The binding affinity constant (Kb) from SPR was 4.2mM. The Kb from ITC experiment was 3.9mM and stoichiometry was fixed as 1, which fit very well with the result of SPR. The binding of oxymatrine to UQCRB was driven by strong enthalpy forces such as hydrogen bonds and polar interactions as the heat released was about 157kcal/mol and ΔG was less than zero. In this study, using the T7 phage display system, we have identified UQCRB as a direct binding protein of oxymatrine. Furthermore, the specificity and molecular interaction of oxymatrine with UQCRB were also determined. The binding of UQCRB to oxymatrine suggests that UQCRB is a potential target of oxymatrine in treating CHB. These results provide new understanding into the mechanism of oxymatrine and insights into the strategy on the treatment of CHB. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

PubMed

Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

1997-12-01

A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

RICD: a rice indica cDNA database resource for rice functional genomics.

PubMed

Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

2008-11-26

The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

Exploration for the Salinity Tolerance-Related Genes from Xero-Halophyte Atriplex canescens Exploiting Yeast Functional Screening System

PubMed Central

Li, Jingtao; Sun, Xinhua; Liu, Yanzhi; Wang, Xueliang; Zhang, Hao; Pan, Hongyu

2017-01-01

Plant productivity is limited by salinity stress, both in natural and agricultural systems. Identification of salt stress-related genes from halophyte can provide insights into mechanisms of salt stress tolerance in plants. Atriplex canescens is a xero-halophyte that exhibits optimum growth in the presence of 400 mM NaCl. A cDNA library derived from highly salt-treated A. canescens plants was constructed based on a yeast expression system. A total of 53 transgenic yeast clones expressing enhanced salt tolerance were selected from 105 transformants. Their plasmids were sequenced and the gene characteristics were annotated using a BLASTX search. Retransformation of yeast cells with the selected plasmids conferred salt tolerance to the resulting transformants. The expression patterns of 28 of these stress-related genes were further investigated in A. canescens leaves by quantitative reverse transcription-PCR. In this study, we provided a rapid and robust assay system for large-scale screening of genes for varied abiotic stress tolerance with high efficiency in A. canescens. PMID:29149055

Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.

PubMed

Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K

2009-09-01

We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.

Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

PubMed

Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

2013-11-01

Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

PubMed

Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

1991-08-01

1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

Cloning, in Vitro expression, and novel phylogenetic classification of a channel catfish estrogen receptor

USGS Publications Warehouse

Xia, Z.; Patino, R.; Gale, W.L.; Maule, A.G.; Densmore, L.D.

1999-01-01

We obtained two channel catfish estrogen receptor (ccER) cDNA from liver of female fish using RT–PCR. The two fragments were identical in sequence except that the smaller one had an out-of-frame deletion in the E domain, suggesting the existence of ccER splice variants. The larger fragment was used to screen a cDNA library from liver of a prepubescent female. A cDNA was obtained that encoded a 581-amino-acid ER with a deduced molecular weight of 63.8 kDa. Extracts of COS-7 cells transfected with ccER cDNA bound estrogen with high affinity (Kd = 4.7 nM) and specificity. Maximum parsimony and Neighbor Joining analyses were used to generate a phylogenetic classification of ccER on the basis of 18 full-length ER sequences. The tree suggested the existence of two major ER branches. One branch contained two clearly divergent clades which included all piscine ER (except Japanese eel ER) and all tetrapod ERα, respectively. The second major branch contained the eel ER and the mammalian ERβ. The high degree of divergence between the eel ER and mammalian ERβ suggested that they also represent distinct piscine and tetrapod ER. These data suggest that ERα and ERβ are present throughout vertebrates and that these two major ER types evolved by duplication of an ancestral ER gene. Sequence alignments with other members of the nuclear hormone receptor superfamily indicated the presence of 8 amino acids in the E domain that align exclusively among ER. Four of these amino acids have not received prior research attention and their function is unknown. The novel finding of putative ER splice variants in a nonmammalian vertebrate and the novel phylogenetic classification of ER offer new perspectives in understanding the diversification and function of ER.

Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3-Endoglucanase, in Soybean.

PubMed

Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O

1990-06-01

Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.

An annotated cDNA library of juvenile Euprymna scolopes with and without colonization by the symbiont Vibrio fischeri

PubMed Central

Chun, Carlene K; Scheetz, Todd E; Bonaldo, Maria de Fatima; Brown, Bartley; Clemens, Anik; Crookes-Goodson, Wendy J; Crouch, Keith; DeMartini, Tad; Eyestone, Mari; Goodson, Michael S; Janssens, Bernadette; Kimbell, Jennifer L; Koropatnick, Tanya A; Kucaba, Tamara; Smith, Christina; Stewart, Jennifer J; Tong, Deyan; Troll, Joshua V; Webster, Sarahrose; Winhall-Rice, Jane; Yap, Cory; Casavant, Thomas L; McFall-Ngai, Margaret J; Soares, M Bento

2006-01-01

Background Biologists are becoming increasingly aware that the interaction of animals, including humans, with their coevolved bacterial partners is essential for health. This growing awareness has been a driving force for the development of models for the study of beneficial animal-bacterial interactions. In the squid-vibrio model, symbiotic Vibrio fischeri induce dramatic developmental changes in the light organ of host Euprymna scolopes over the first hours to days of their partnership. We report here the creation of a juvenile light-organ specific EST database. Results We generated eleven cDNA libraries from the light organ of E. scolopes at developmentally significant time points with and without colonization by V. fischeri. Single pass 3' sequencing efforts generated 42,564 expressed sequence tags (ESTs) of which 35,421 passed our quality criteria and were then clustered via the UIcluster program into 13,962 nonredundant sequences. The cDNA clones representing these nonredundant sequences were sequenced from the 5' end of the vector and 58% of these resulting sequences overlapped significantly with the associated 3' sequence to generate 8,067 contigs with an average sequence length of 1,065 bp. All sequences were annotated with BLASTX (E-value < -03) and Gene Ontology (GO). Conclusion Both the number of ESTs generated from each library and GO categorizations are reflective of the activity state of the light organ during these early stages of symbiosis. Future analyses of the sequences identified in these libraries promise to provide valuable information not only about pathways involved in colonization and early development of the squid light organ, but also about pathways conserved in response to bacterial colonization across the animal kingdom. PMID:16780587

Distinct profiles of expressed sequence tags during intestinal regeneration in the sea cucumber Holothuria glaberrima

PubMed Central

Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.

2010-01-01

Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180

The interdependence between screening methods and screening libraries.

PubMed

Shelat, Anang A; Guy, R Kiplin

2007-06-01

The most common methods for discovery of chemical compounds capable of manipulating biological function involves some form of screening. The success of such screens is highly dependent on the chemical materials - commonly referred to as libraries - that are assayed. Classic methods for the design of screening libraries have depended on knowledge of target structure and relevant pharmacophores for target focus, and on simple count-based measures to assess other properties. The recent proliferation of two novel screening paradigms, structure-based screening and high-content screening, prompts a profound rethink about the ideal composition of small-molecule screening libraries. We suggest that currently utilized libraries are not optimal for addressing new targets by high-throughput screening, or complex phenotypes by high-content screening.

Fibrinolysis in Tumor Associated Angiogenesis

DTIC Science & Technology

2005-07-01

tPA expression in mammary vessel assays and in animals with use of retroviral vectors to deliver antisense RNA . We still intend to use that strategy...pads of nude mice. RNA obtained from tumor- and mam- mary fat pad-associated endothelial cells was used to synthesize cDNA and cDNA libraries, which... RNA (mRNA) for tPA and MT1-MMP, with some upregulation of uPA expression. BODY 1. Confirm differential expression of tPA and MT1-MIP with GAPDH control

Comparative Analysis of Expressed Genes from Cacao Meristems Infected by Moniliophthora perniciosa

PubMed Central

Gesteira, Abelmon S.; Micheli, Fabienne; Carels, Nicolas; Da Silva, Aline C.; Gramacho, Karina P.; Schuster, Ivan; Macêdo, Joci N.; Pereira, Gonçalo A. G.; Cascardo, Júlio C. M.

2007-01-01

Background and Aims Witches' broom disease is caused by the hemibiotrophic basidiomycete Moniliophthora perniciosa, and is one of the most important diseases of cacao in the western hemisphere. Because very little is known about the global process of such disease development, expressed sequence tags (ESTs) were used to identify genes expressed during the Theobroma cacao–Moniliophthora perniciosa interaction. Methods Two cDNA libraries corresponding to the resistant (RT) and susceptible (SP) cacao–M. perniciosa interactions were constructed from total RNA, using the DB SMART Creator cDNA library kit (Clontech). Clones were randomly selected, sequenced from the 5′ end and analysed using bioinformatics tools including in silico analysis of the differential gene expression. Key Results A total of 6884 ESTs were generated from the RT and SP cDNA libraries. These ESTs were composed of 2585 singlets and 341 contigs for a total of 2926 non-redundant sequences. The redundancy of the libraries was low and their specificity high when compared with the few other cacao libraries already published. Sequence analysis allowed the assignment of a putative functional category for 54 % of sequences, whereas approx. 22 % of sequences corresponded to unknown function and approx. 24 % of sequences did not show any significant similarity with other proteins present in the database. Despite the similar overall distribution of the sequences in functional categories between the two libraries, qualitative differences were observed. Genes involved during the defence response to pathogen infection or in programmed cell death were identified, such as pathogenesis related-proteins, trypsin inhibitor or oxalate oxidase, and some of them showed an in silico differential expression between the resistant and the susceptible interactions. Conclusions As far as is known this is the first EST resource from the cacao–M. perniciosa interaction and it is believed that it will provide a significant contribution to the understanding of the molecular mechanisms of the resistance and susceptibility of cacao to M. perniciosa, to develop strategies to control witches broom, and as a source of polymorphism for molecular marker development and marker-assisted selection. PMID:17557832

Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples.

PubMed

Grant, Susan; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

2006-01-01

Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at -20 degrees C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes.

Isolating Viral and Host RNA Sequences from Archival Material and Production of cDNA Libraries for High-Throughput DNA Sequencing

PubMed Central

Xiao, Yongli; Sheng, Zong-Mei; Taubenberger, Jeffery K.

2015-01-01

The vast majority of surgical biopsy and post-mortem tissue samples are formalin-fixed and paraffin-embedded (FFPE), but this process leads to RNA degradation that limits gene expression analysis. As an example, the viral RNA genome of the 1918 pandemic influenza A virus was previously determined in a 9-year effort by overlapping RT-PCR from post-mortem samples. Using the protocols described here, the full genome of the 1918 virus at high coverage was determined in one high-throughput sequencing run of a cDNA library derived from total RNA of a 1918 FFPE sample after duplex-specific nuclease treatments. This basic methodological approach should assist in the analysis of FFPE tissue samples isolated over the past century from a variety of infectious diseases. PMID:26344216

Molecular analysis of the biological bleaching of kraft pulps by Trametes versicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dumonceaux, T.J.; Archibald, F.S.

1996-10-01

Biological bleaching of kraft pulps by the fungus Trametes versicolor, based on the biodegradation of the recalcitrant polymer, lignin, could replace chlorine-based bleaching in Canadian pulp and paper mills. Enzymes that may be involved in lignin degradation include manganese peroxidase (MnP), laccase, and cellobiose-quinone oxidoreductase (CBQase). All three of these enzymatic activities are thought to interact extensively in cyclic oxidation/reduction reactions which ultimately bring about the degradation of lignin. We have constructed a cDNA library from T versicolor with the aim of isolating clones encoding factors that are relevant to biobleaching. We first determined the optimum growth conditions for expressionmore » of bleaching-related mRNA. A clear induction of bleaching ability was observed when the fungus was preincubated with 0.25% acid-washed pulp; the augmentation of bleaching was not explained by differences in MnP or laccase levels, suggesting that the expression of either CBQase or unidentified biobleaching factors was responsible for the increased pulp brightness. mRNA isolated from induced cultures was used to construct a cDNA library in a XZAP vector. This library has been probed with a degenerate oligonucleotide probe based upon a peptide sequence derived from purified CBQase, resulting in the identification of several hybridizing cDNA molecules. The CBQase clone will be used to examine in further detail the potential role of this enzyme in pulp biobleaching and lignin degradation.« less

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

PubMed

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-07-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data

PubMed Central

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-01-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users. PMID:20501601

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robbins, P.F.; El-Gamil, M.; Li, Y.F.

The role of tumor-specific T cells in mediating the regression of metastatic melanoma has been suggested by the clinical response of patients to treatment with tumor-infiltrating lymphocytes (TIL). A number of Ags recognized by class I-restricted melanoma-specific T cells have recently been isolated, raising the hope that this will lead to the development of improved therapies. In this study, we report the cloning of a tumor Ag recognized by T cells from melanoma patient 888. Previously, we reported that TIL 888, grown from the tumor of this patient, recognized tyrosinase in an HLA-A24 -restricted fashion. This line, when infused intomore » the autologous patient, resulted in complete regression of multiple metastases. Three years later, a second TIL line, TIL 1290, was isolated from a recurrent pelvic tumor. Infusion of a mixture of TIL 888 and TIL 1290 cell lines into the patient resulted in complete regression of a residual abdominal mass and the patient remains disease-free 2 yr later. The TIL 1290 cell line, which recognized melanoma in an HLAA-A24-restricted manner, failed to recognize tyrosinase. TIL 1290 was then used to screen an 888 melanoma cDNA library, and an Ag was isolated that did not correspond to any found in sequence databases. This gene, termed p15, was found to be expressed in a variety of normal tissues, and a peptide epitope recognized by TIL 1290 was found to represent the product of an nonmutated gene. Screening of additional cDNA pools resulted in the isolation of a second clone which stimulated TIL 1290. This clone also appeared to represent a transcript of the p15 gene, indicating that this gene may encode the predominant Ag recognized by TIL 1290. 27 refs., 4 figs., 5 tabs.« less

Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.

PubMed

Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin

2009-01-01

Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Gene-based SSR markers for common bean (Phaseolus vulgaris L.) derived from root and leaf tissue ESTs: an integration of the BMc series.

PubMed

Blair, Matthew W; Hurtado, Natalia; Chavarro, Carolina M; Muñoz-Torres, Monica C; Giraldo, Martha C; Pedraza, Fabio; Tomkins, Jeff; Wing, Rod

2011-03-22

Sequencing of cDNA libraries for the development of expressed sequence tags (ESTs) as well as for the discovery of simple sequence repeats (SSRs) has been a common method of developing microsatellites or SSR-based markers. In this research, our objective was to further sequence and develop common bean microsatellites from leaf and root cDNA libraries derived from the Andean gene pool accession G19833 and the Mesoamerican gene pool accession DOR364, mapping parents of a commonly used reference map. The root libraries were made from high and low phosphorus treated plants. A total of 3,123 EST sequences from leaf and root cDNA libraries were screened and used for direct simple sequence repeat discovery. From these EST sequences we found 184 microsatellites; the majority containing tri-nucleotide motifs, many of which were GC rich (ACC, AGC and AGG in particular). Di-nucleotide motif microsatellites were about half as common as the tri-nucleotide motif microsatellites but most of these were AGn microsatellites with a moderate number of ATn microsatellites in root ESTs followed by few ACn and no GCn microsatellites. Out of the 184 new SSR loci, 120 new microsatellite markers were developed in the BMc (Bean Microsatellites from cDNAs) series and these were evaluated for their capacity to distinguish bean diversity in a germplasm panel of 18 genotypes. We developed a database with images of the microsatellites and their polymorphism information content (PIC), which averaged 0.310 for polymorphic markers. The present study produced information about microsatellite frequency in root and leaf tissues of two important genotypes for common bean genomics: namely G19833, the Andean genotype selected for whole genome shotgun sequencing from race Peru, and DOR364 a race Mesoamerica subgroup 2 genotype that is a small-red seeded, released variety in Central America. Both race Peru and Mesoamerica subgroup 2 (small red beans) have been understudied in comparison to race Nueva Granada and Mesoamerica subgroup 1 (black beans) both with regards to gene expression and as sources of markers. However, we found few differences between SSR type and frequency between the G19833 leaf and DOR364 root tissue-derived ESTs. Overall, our work adds to the analysis of microsatellite frequency evaluation for common bean and provides a new set of 120 BMc markers which combined with the 248 previously developed BMc markers brings the total in this series to 368 markers. Once we include BMd markers, which are derived from GenBank sequences, the current total of gene-based markers from our laboratory surpasses 500 markers. These markers are basic for studies of the transcriptome of common bean and can form anchor points for genetic mapping studies in the future.

Library fingerprints: a novel approach to the screening of virtual libraries.

PubMed

Klon, Anthony E; Diller, David J

2007-01-01

We propose a novel method to prioritize libraries for combinatorial synthesis and high-throughput screening that assesses the viability of a particular library on the basis of the aggregate physical-chemical properties of the compounds using a naïve Bayesian classifier. This approach prioritizes collections of related compounds according to the aggregate values of their physical-chemical parameters in contrast to single-compound screening. The method is also shown to be useful in screening existing noncombinatorial libraries when the compounds in these libraries have been previously clustered according to their molecular graphs. We show that the method used here is comparable or superior to the single-compound virtual screening of combinatorial libraries and noncombinatorial libraries and is superior to the pairwise Tanimoto similarity searching of a collection of combinatorial libraries.

cDNA cloning and analysis of betaine aldehyde dehydrogenase, a salt inducible enzyme in sugar beet

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCue, K.F.; Hanson, A.D.

1990-05-01

Betaine accumulates and serves as a compatible osmolyte in some plants subjected to drought or salinity stress. The last enzyme in the betaine biosynthetic pathway is betaine aldehyde dehydrogenase (BADH). The activity of BADH increases in response to increasing salinity levels. This increase in activity corresponds to an increase in protein detectable by immunoblotting, and to an increase in the translatable BADH mRNA. BADH was cloned from a cDNA library constructed in {lambda}gt10 using poly(A){sup +} RNA from sugar beets salinized to 500 mM NaCl. cDNAs were size selected (>1kb) before ligation into the vector, and the library was screenedmore » with a spinach BADH cDNA probe. Three nearly full length clones obtained were confirmed as BADH by their nucleotide and deduced amino acid homology to spinach BADH. Clones averaged 1.8 kb and contained open reading frames of 500 amino acids at 80% identity with spinach BADH. RNA gel blot analysis of poly(A){sup +} RNA indicated that salinization to 500 mM NaCl resulted in a 5-fold increase of BADH mRNA level.« less

A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

PubMed

Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

2000-06-30

For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

PubMed

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Construction of a cDNA library for sea cucumber Acaudina leucoprocta and differential expression of ferritin peptide

NASA Astrophysics Data System (ADS)

Zhou, Jun; Hou, Fujing; Li, Ye; Su, Xiurong; Li, Taiwu; Jin, Chunhua

2016-07-01

Acaudina leucoprocta is an edible sea cucumber of economic interest that is widely distributed in China. Little information is available concerning the molecular genetics of this species although such knowledge would contribute to a better understanding of the optimal conditions for its aquaculture and its mechanisms of defense against disease. Therefore, we constructed a cDNA library and, based on bioinformatics analysis of the sequences, the functions of 75% of the cDNAs were identified, including those involved in cell structure, energy metabolism, mitochondrial function, and signal transduction pathways. Approximately 25% of genes in the library were unmatched. The gene for A. leucoprocta ferritin was also cloned. The predicted amino-acid sequence of ferritin displayed significant homology with other sea-cucumber counterparts but indicated that it was a new member of the ferritin family. Semiquantitative real-time RT-PCR indicated the highest levels of ferritin mRNA expression in the intestine. A polyclonal antibody of ferritin was also produced. These data provide a set of molecular tools essential for further studies of the functions of ferritin protein in A. leucoprocta.

A database of annotated tentative orthologs from crop abiotic stress transcripts.

PubMed

Balaji, Jayashree; Crouch, Jonathan H; Petite, Prasad V N S; Hoisington, David A

2006-10-07

A minimal requirement to initiate a comparative genomics study on plant responses to abiotic stresses is a dataset of orthologous sequences. The availability of a large amount of sequence information, including those derived from stress cDNA libraries allow for the identification of stress related genes and orthologs associated with the stress response. Orthologous sequences serve as tools to explore genes and their relationships across species. For this purpose, ESTs from stress cDNA libraries across 16 crop species including 6 important cereal crops and 10 dicots were systematically collated and subjected to bioinformatics analysis such as clustering, grouping of tentative orthologous sets, identification of protein motifs/patterns in the predicted protein sequence, and annotation with stress conditions, tissue/library source and putative function. All data are available to the scientific community at http://intranet.icrisat.org/gt1/tog/homepage.htm. We believe that the availability of annotated plant abiotic stress ortholog sets will be a valuable resource for researchers studying the biology of environmental stresses in plant systems, molecular evolution and genomics.

Generation of thermostable Moloney murine leukemia virus reverse transcriptase variants using site saturation mutagenesis library and cell-free protein expression system.

PubMed

Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi

2017-12-01

We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.

Design of compound libraries for fragment screening

NASA Astrophysics Data System (ADS)

Blomberg, Niklas; Cosgrove, David A.; Kenny, Peter W.; Kolmodin, Karin

2009-08-01

Approaches to the design of libraries for fragment screening are illustrated with reference to a 20 k generic fragment screening library and a 1.2 k generic NMR screening library. Tools and methods for library design that have been developed within AstraZeneca are described, including Foyfi fingerprints and the Flush program for neighborhood characterization. It will be shown how Flush and the BigPicker, which selects maximally diverse sets of compounds, are used to apply the Core and Layer method for library design. Approaches to partitioning libraries into cocktails are also described.

Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues.

PubMed

Bown, David P; Gatehouse, John A

2004-05-01

Carboxypeptidases were purified from guts of larvae of corn earworm (Helicoverpa armigera), a lepidopteran crop pest, by affinity chromatography on immobilized potato carboxypeptidase inhibitor, and characterized by N-terminal sequencing. A larval gut cDNA library was screened using probes based on these protein sequences. cDNA HaCA42 encoded a carboxypeptidase with sequence similarity to enzymes of clan MC [Barrett, A. J., Rawlings, N. D. & Woessner, J. F. (1998) Handbook of Proteolytic Enzymes. Academic Press, London.], but with a novel predicted specificity towards C-terminal acidic residues. This carboxypeptidase was expressed as a recombinant proprotein in the yeast Pichia pastoris. The expressed protein could be activated by treatment with bovine trypsin; degradation of bound pro-region, rather than cleavage of pro-region from mature protein, was the rate-limiting step in activation. Activated HaCA42 carboxypeptidase hydrolysed a synthetic substrate for glutamate carboxypeptidases (FAEE, C-terminal Glu), but did not hydrolyse substrates for carboxypeptidase A or B (FAPP or FAAK, C-terminal Phe or Lys) or methotrexate, cleaved by clan MH glutamate carboxypeptidases. The enzyme was highly specific for C-terminal glutamate in peptide substrates, with slow hydrolysis of C-terminal aspartate also observed. Glutamate carboxypeptidase activity was present in larval gut extract from H. armigera. The HaCA42 protein is the first glutamate-specific metallocarboxypeptidase from clan MC to be identified and characterized. The genome of Drosophila melanogaster contains genes encoding enzymes with similar sequences and predicted specificity, and a cDNA encoding a similar enzyme has been isolated from gut tissue in tsetse fly. We suggest that digestive carboxypeptidases with sequence similarity to the classical mammalian enzymes, but with specificity towards C-terminal glutamate, are widely distributed in insects.

The VBP and a1/EBP leucine zipper factors bind overlapping subsets of avian retroviral long terminal repeat CCAAT/enhancer elements.

PubMed

Smith, C D; Baglia, L A; Curristin, S M; Ruddell, A

1994-10-01

Two long terminal repeat (LTR) enhancer-binding proteins which may regulate high rates of avian leukosis virus (ALV) LTR-enhanced c-myc transcription during bursal lymphomagenesis have been identified (A. Ruddell, M. Linial, and M. Groudine, Mol. Cell. Biol. 9:5660-5668, 1989). The genes encoding the a1/EBP and a3/EBP binding factors were cloned by expression screening of a lambda gt11 cDNA library from chicken bursal lymphoma cells. The a1/EBP cDNA encodes a novel leucine zipper transcription factor (W. Bowers and A. Ruddell, J. Virol. 66:6578-6586, 1992). The partial a3/EBP cDNA clone encodes amino acids 84 to 313 of vitellogenin gene-binding protein (VBP), a leucine zipper factor that binds the avian vitellogenin II gene promoter (S. Iyer, D. Davis, and J. Burch, Mol. Cell. Biol. 11:4863-4875, 1991). Multiple VBP mRNAs are expressed in B cells in a pattern identical to that previously observed for VBP in other cell types. The LTR-binding activities of VBP, a1/EBP, and B-cell nuclear extract protein were compared and mapped by gel shift, DNase I footprinting, and methylation interference assays. The purified VBP and a1/EBP bacterial fusion proteins bind overlapping but distinct subsets of CCAAT/enhancer elements in the closely related ALV and Rous sarcoma virus (RSV) LTR enhancers. Protein binding to these CCAAT/enhancer elements accounts for most of the labile LTR enhancer-binding activity observed in B-cell nuclear extracts. VBP and a1/EBP could mediate the high rates of ALV and RSV LTR-enhanced transcription in bursal lymphoma cells and many other cell types.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Simultaneous display of two large proteins on the head and tail of bacteriophage lambda.

PubMed

Pavoni, Emiliano; Vaccaro, Paola; D'Alessio, Valeria; De Santis, Rita; Minenkova, Olga

2013-09-30

Consistent progress in the development of bacteriophage lambda display platform as an alternative to filamentous phage display system was achieved in the recent years. The lambda phage has been engineered to display efficiently multiple copies of peptides or even large protein domains providing a powerful tool for screening libraries of peptides, proteins and cDNA. In the present work we describe an original method for dual display of large proteins on the surface of lambda particles. An anti-CEA single-chain antibody fragment and green fluorescent protein or alkaline phosphatase were simultaneously displayed by engineering both gpD and gpV lambda proteins. Here we show that such modified phage particles can be used for the detection of target molecules in vitro and in vivo. Dual expression of functional moieties on the surface of the lambda phage might open the way to generation of a new class of diagnostic and therapeutic targeted nanoparticles.

A Novel mRNA Level Subtraction Method for Quick Identification of Target-Orientated Uniquely Expressed Genes Between Peanut Immature Pod and Leaf

PubMed Central

2010-01-01

Subtraction technique has been broadly applied for target gene discovery. However, most current protocols apply relative differential subtraction and result in great amount clone mixtures of unique and differentially expressed genes. This makes it more difficult to identify unique or target-orientated expressed genes. In this study, we developed a novel method for subtraction at mRNA level by integrating magnetic particle technology into driver preparation and tester–driver hybridization to facilitate uniquely expressed gene discovery between peanut immature pod and leaf through a single round subtraction. The resulting target clones were further validated through polymerase chain reaction screening using peanut immature pod and leaf cDNA libraries as templates. This study has resulted in identifying several genes expressed uniquely in immature peanut pod. These target genes can be used for future peanut functional genome and genetic engineering research. PMID:21406066

Molecular and Physiological Analysis of a Heat-Shock Response in Wheat 1

PubMed Central

McElwain, Elizabeth F.; Spiker, Steven

1992-01-01

We have isolated two cDNA clones from wheat (Triticum aestivum L. var Stephens), designated WHSP16.8 and WHSP16.9, that are highly similar in sequence to the low molecular weight heat-shock protein genes previously isolated from soybean. RNA blot analysis confirms that these sequences are present in heat-shocked wheat seedlings, but not in control tissues. The WHSP16.8 and WHSP16.9 cDNAs were isolated by screening a lambda gt11 expression library with antibodies to HMGc (a chromosomal protein of wheat). Immunoblot analysis has demonstrated that the antibodies raised against HMGc also recognize a group of proteins that are induced by heat shock and have molecular weights (estimated by sodium dodecyl sulfate electrophoresis) consistent with the molecular weights of the proteins deduced from the sequences of the cDNAs. ImagesFigure 3Figure 4Figure 5 PMID:16669058

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Identification of drought-responsive genes in roots of upland rice (Oryza sativa L)

PubMed Central

Rabello, Aline R; Guimarães, Cléber M; Rangel, Paulo HN; da Silva, Felipe R; Seixas, Daniela; de Souza, Emanuel; Brasileiro, Ana CM; Spehar, Carlos R; Ferreira, Márcio E; Mehta, Ângela

2008-01-01

Background Rice (Oryza sativa L.) germplasm represents an extraordinary source of genes that control traits of agronomic importance such as drought tolerance. This diversity is the basis for the development of new cultivars better adapted to water restriction conditions, in particular for upland rice, which is grown under rainfall. The analyses of subtractive cDNA libraries and differential protein expression of drought tolerant and susceptible genotypes can contribute to the understanding of the genetic control of water use efficiency in rice. Results Two subtractive libraries were constructed using cDNA of drought susceptible and tolerant genotypes submitted to stress against cDNA of well-watered plants. In silico analysis revealed 463 reads, which were grouped into 282 clusters. Several genes expressed exclusively in the tolerant or susceptible genotypes were identified. Additionally, proteome analysis of roots from stressed plants was performed and 22 proteins putatively associated to drought tolerance were identified by mass spectrometry. Conclusion Several genes and proteins involved in drought-response, as well as genes with no described homologs were identified. Genes exclusively expressed in the tolerant genotype were, in general, related to maintenance of turgor and cell integrity. In contrast, in the susceptible genotype, expression of genes involved in protection against cell damage was not detected. Several protein families identified in the proteomic analysis were not detected in the cDNA analysis. There is an indication that the mechanisms of susceptibility to drought in upland rice are similar to those of lowland varieties. PMID:18922162

A large-scale full-length cDNA analysis to explore the budding yeast transcriptome

PubMed Central

Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi

2006-01-01

We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987

cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

PubMed

Abolhassani, Mohsen; Roux, Kenneth H

2009-06-01

Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

PubMed

de Bellocq, J Goüy; Leirs, H

2009-09-01

Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

Isolation and characterization of a cDNA encoding a membrane bound acyl-CoA binding protein from Agave americana L. epidermis.

PubMed

Guerrero, Consuelo; Martín-Rufián, M; Reina, José J; Heredia, Antonio

2006-01-01

A cDNA encoding an acyl-CoA binding protein (ACBP) homologue has been cloned from a cDNA library made from mRNA isolated from epidermis of young leaves of Agave americana L. The derived amino acid sequence reveals a protein corresponding to the membrane-associated form of ACBPs only previously described in Arabidopsis and rice. Northern blot analysis showed that the A. americana ACBP gene is mainly expressed in the epidermis of mature zone of the leaves. The epidermis of A. americana leaves have a well developed cuticle with the highest amounts of the cuticular components waxes, cutin and cutan suggesting a potential role of the protein in cuticle formation.

Isolation of epidermal cells and cDNA cloning of TNF decoy receptor 3 of conger eel, Conger myriaster.

PubMed

Tsutsui, Shigeyuki; Yoshino, Yuko; Matsui, Saho; Nakamura, Osamu; Muramoto, Koji; Watanabe, Tasuku

2008-03-01

By using EDTA and a trypsin solution, we established a method for isolating the epidermal cells of the conger eel, Conger myriaster. We then identified TNF decoy receptor (DcR) cDNA in the species from a suppression subtractive hybridization library prepared from the epidermal cells stimulated with LPS. The full-length cDNA of conger TNF DcR (conDcR) consisted of 1479 base pairs, and the protein comprised 286 amino acid residues. Phylogenetic analysis indicated that conDcR was clustered into a DcR3 branch. ConDcR is likely to act as an important immune-regulating factor in inhibiting the apoptosis-inducing effect of TNF in the skin of conger eel.

Flow cytometric purification of Colletotrichum higginsianum biotrophic hyphae from Arabidopsis leaves for stage-specific transcriptome analysis.

PubMed

Takahara, Hiroyuki; Dolf, Andreas; Endl, Elmar; O'Connell, Richard

2009-08-01

Generation of stage-specific cDNA libraries is a powerful approach to identify pathogen genes that are differentially expressed during plant infection. Biotrophic pathogens develop specialized infection structures inside living plant cells, but sampling the transcriptome of these structures is problematic due to the low ratio of fungal to plant RNA, and the lack of efficient methods to isolate them from infected plants. Here we established a method, based on fluorescence-activated cell sorting (FACS), to purify the intracellular biotrophic hyphae of Colletotrichum higginsianum from homogenates of infected Arabidopsis leaves. Specific selection of viable hyphae using a fluorescent vital marker provided intact RNA for cDNA library construction. Pilot-scale sequencing showed that the library was enriched with plant-induced and pathogenicity-related fungal genes, including some encoding small, soluble secreted proteins that represent candidate fungal effectors. The high purity of the hyphae (94%) prevented contamination of the library by sequences derived from host cells or other fungal cell types. RT-PCR confirmed that genes identified in the FACS-purified hyphae were also expressed in planta. The method has wide applicability for isolating the infection structures of other plant pathogens, and will facilitate cell-specific transcriptome analysis via deep sequencing and microarray hybridization, as well as proteomic analyses.

Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

PubMed Central

2010-01-01

Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

SSHscreen and SSHdb, generic software for microarray based gene discovery: application to the stress response in cowpea

PubMed Central

2010-01-01

Background Suppression subtractive hybridization is a popular technique for gene discovery from non-model organisms without an annotated genome sequence, such as cowpea (Vigna unguiculata (L.) Walp). We aimed to use this method to enrich for genes expressed during drought stress in a drought tolerant cowpea line. However, current methods were inefficient in screening libraries and management of the sequence data, and thus there was a need to develop software tools to facilitate the process. Results Forward and reverse cDNA libraries enriched for cowpea drought response genes were screened on microarrays, and the R software package SSHscreen 2.0.1 was developed (i) to normalize the data effectively using spike-in control spot normalization, and (ii) to select clones for sequencing based on the calculation of enrichment ratios with associated statistics. Enrichment ratio 3 values for each clone showed that 62% of the forward library and 34% of the reverse library clones were significantly differentially expressed by drought stress (adjusted p value < 0.05). Enrichment ratio 2 calculations showed that > 88% of the clones in both libraries were derived from rare transcripts in the original tester samples, thus supporting the notion that suppression subtractive hybridization enriches for rare transcripts. A set of 118 clones were chosen for sequencing, and drought-induced cowpea genes were identified, the most interesting encoding a late embryogenesis abundant Lea5 protein, a glutathione S-transferase, a thaumatin, a universal stress protein, and a wound induced protein. A lipid transfer protein and several components of photosynthesis were down-regulated by the drought stress. Reverse transcriptase quantitative PCR confirmed the enrichment ratio values for the selected cowpea genes. SSHdb, a web-accessible database, was developed to manage the clone sequences and combine the SSHscreen data with sequence annotations derived from BLAST and Blast2GO. The self-BLAST function within SSHdb grouped redundant clones together and illustrated that the SSHscreen plots are a useful tool for choosing anonymous clones for sequencing, since redundant clones cluster together on the enrichment ratio plots. Conclusions We developed the SSHscreen-SSHdb software pipeline, which greatly facilitates gene discovery using suppression subtractive hybridization by improving the selection of clones for sequencing after screening the library on a small number of microarrays. Annotation of the sequence information and collaboration was further enhanced through a web-based SSHdb database, and we illustrated this through identification of drought responsive genes from cowpea, which can now be investigated in gene function studies. SSH is a popular and powerful gene discovery tool, and therefore this pipeline will have application for gene discovery in any biological system, particularly non-model organisms. SSHscreen 2.0.1 and a link to SSHdb are available from http://microarray.up.ac.za/SSHscreen. PMID:20359330

A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

PubMed Central

Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

2009-01-01

Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

Automated recycling of chemistry for virtual screening and library design.

PubMed

Vainio, Mikko J; Kogej, Thierry; Raubacher, Florian

2012-07-23

An early stage drug discovery project needs to identify a number of chemically diverse and attractive compounds. These hit compounds are typically found through high-throughput screening campaigns. The diversity of the chemical libraries used in screening is therefore important. In this study, we describe a virtual high-throughput screening system called Virtual Library. The system automatically "recycles" validated synthetic protocols and available starting materials to generate a large number of virtual compound libraries, and allows for fast searches in the generated libraries using a 2D fingerprint based screening method. Virtual Library links the returned virtual hit compounds back to experimental protocols to quickly assess the synthetic accessibility of the hits. The system can be used as an idea generator for library design to enrich the screening collection and to explore the structure-activity landscape around a specific active compound.

Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

PubMed

Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

2002-09-01

A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

Cloning, annotation and expression analysis of mycoparasitism-related genes in Trichoderma harzianum 88.

PubMed

Yao, Lin; Yang, Qian; Song, Jinzhu; Tan, Chong; Guo, Changhong; Wang, Li; Qu, Lianhai; Wang, Yun

2013-04-01

Trichoderma harzianum 88, a filamentous soil fungus, is an effective biocontrol agent against several plant pathogens. High-throughput sequencing was used here to study the mycoparasitism mechanisms of T. harzianum 88. Plate confrontation tests of T. harzianum 88 against plant pathogens were conducted, and a cDNA library was constructed from T. harzianum 88 mycelia in the presence of plant pathogen cell walls. Randomly selected transcripts from the cDNA library were compared with eukaryotic plant and fungal genomes. Of the 1,386 transcripts sequenced, the most abundant Gene Ontology (GO) classification group was "physiological process". Differential expression of 19 genes was confirmed by real-time RT-PCR at different mycoparasitism stages against plant pathogens. Gene expression analysis revealed the transcription of various genes involved in mycoparasitism of T. harzianum 88. Our study provides helpful insights into the mechanisms of T. harzianum 88-plant pathogen interactions.

Identification of Eukaryotic Open Reading Frames in Metagenomic cDNA Libraries Made from Environmental Samples†

PubMed Central

Grant, Susan; Grant, William D.; Cowan, Don A.; Jones, Brian E.; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

2006-01-01

Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at −20°C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes. PMID:16391035

Comparative analyses of structural features and scaffold diversity for purchasable compound libraries.

PubMed

Shang, Jun; Sun, Huiyong; Liu, Hui; Chen, Fu; Tian, Sheng; Pan, Peichen; Li, Dan; Kong, Dexin; Hou, Tingjun

2017-04-21

Large purchasable screening libraries of small molecules afforded by commercial vendors are indispensable sources for virtual screening (VS). Selecting an optimal screening library for a specific VS campaign is quite important to improve the success rates and avoid wasting resources in later experimental phases. Analysis of the structural features and molecular diversity for different screening libraries can provide valuable information to the decision making process when selecting screening libraries for VS. In this study, the structural features and scaffold diversity of eleven purchasable screening libraries and Traditional Chinese Medicine Compound Database (TCMCD) were analyzed and compared. Their scaffold diversity represented by the Murcko frameworks and Level 1 scaffolds was characterized by the scaffold counts and cumulative scaffold frequency plots, and visualized by Tree Maps and SAR Maps. The analysis demonstrates that, based on the standardized subsets with similar molecular weight distributions, Chembridge, ChemicalBlock, Mucle, TCMCD and VitasM are more structurally diverse than the others. Compared with all purchasable screening libraries, TCMCD has the highest structural complexity indeed but more conservative molecular scaffolds. Moreover, we found that some representative scaffolds were important components of drug candidates against different drug targets, such as kinases and guanosine-binding protein coupled receptors, and therefore the molecules containing pharmacologically important scaffolds found in screening libraries might be potential inhibitors against the relevant targets. This study may provide valuable perspective on which purchasable compound libraries are better for you to screen. Graphical abstract Selecting diverse compound libraries with scaffold analyses.

Identification and Cloning of Centaurin-α

PubMed Central

Hammonds-Odie, Latanya P.; Jackson, Trevor R.; Profit, Adam A.; Blader, Ira J.; Turck, Christoph W.; Prestwich, Glenn D.; Theibert, Anne B.

2015-01-01

Using an affinity resin and photoaffinity label based on phospholipid analogs of inositol 1,3,4,5-tetrakisphosphate (InsP4), we have isolated, characterized, and cloned a 46-kDa protein from rat brain, which we have named centaurin-α. Binding specificity was determined using displacement of 1-O-[3H](3-[4-benzoyldihydrocinnamidyl]propyl)-InsP4 photoaffinity labeling. Centaurin-α displayed highest affinity for phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) (IC50 = 120 nm), whereas InsP4, PtdInsP2, and InsP3 bound with 5-, 12-, and >50-fold lower affinity, respectively. Screening a rat brain cDNA library with a polymerase chain reaction product, generated using partial amino acid sequence from tryptic peptides, yielded a full-length clone. The 2,450-base pair cDNA contained an open reading frame (ORF) encoding a novel protein of 419 amino acids. Northern analysis revealed a 2.5-kilobase transcript that is highly expressed in brain. The deduced sequence contains a novel putative zinc finger motif, 10 ankyrin-like repeats, and shows homology to recently identified yeast and mammalian Arf GTPase-activating proteins. Given the specificity of binding and enrichment in brain, centaurin-α is a candidate PtdInsP3 receptor that may link the activation of phosphoinositide 3-kinase to downstream responses in the brain. PMID:8702546

Expression of calmodulin mRNA in rat olfactory neuroepithelium.

PubMed

Biffo, S; Goren, T; Khew-Goodall, Y S; Miara, J; Margolis, F L

1991-04-01

A calmodulin (CaM) cDNA was isolated by differential hybridization screening of a lambda gt10 library prepared from rat olfactory mucosa. This cDNA fragment, containing most of the open reading frame of the rat CaMI gene, was subcloned and used to characterize steady-state expression of CaM mRNA in rat olfactory neuroepithelium and bulb. Within the bulb mitral cells are the primary neuronal population expressing CaM mRNA. The major CaM mRNA expressed in the olfactory mucosa is 1.7 kb with smaller contributions from mRNAs of 4.0 and 1.4 kb. CaM mRNA was primarily associated with the olfactory neurons and, despite the cellular complexity of the tissue and the known involvement of CaM in diverse cellular processes, was only minimally evident in sustentacular cells, gland cells or respiratory epithelium. Following bulbectomy CaM mRNA declines in the olfactory neuroepithelium as does olfactory marker protein (OMP) mRNA. In contrast to the latter, CaM mRNA makes a partial recovery by one month after surgery. These results, coupled with those from in situ hybridization, indicate that CaM mRNA is expressed in both mature and immature olfactory neurons. The program regulating CaM gene expression in olfactory neurons is distinct from those controlling expression of B50/GAP43 in immature, or OMP in mature, neurons respectively.

Molecular identification and partial sequence analysis of an aryl hydrocarbon receptor from beluga (Delphinapterus leucas)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, B.A.; Hahn, M.E.

1995-12-31

The aryl hydrocarbon receptor (AhR) mediates the effects of many common and potentially toxic organic hydrocarbons, including some polychlorinated biphenyls and dioxins. Since small cetaceans often inhabit industrially polluted coastal waters, comparison of the molecular structure and function of this protein in cetaeans with other marine and mammalian species is important for evaluating the sensitivity of cetaceans to these pollutants. An AhR protein has been identified in beluga liver by photoaffinity labeling. In the present study, the authors sought to clone and sequence an AhR cDNA from beluga as a prelude to studying its structure and function, using reverse-transcription polymerasemore » chain reaction (RT-PCR) and degenerate primers, a 515 base pair fragment was amplified, cloned and sequenced, revealing homology to the PAS domain (ligand binding and dimerization region) of AhRs from terrestrial mammals. This portion of the putative beluga AhR has 82% amino acid and 81% nucleotide sequence identity to the mouse AhR, and 63% amino acid and 64% nucleotide sequence identity to an AhR from the marine fish Fundulus heteroclitus. A beluga cDNA library was synthesized and is currently being screened with the PCR-generated fragment to obtain the complete coding sequence. This is the first molecular evidence of AhR presence in cetaceans.« less

Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

PubMed

Feng, X; Happ, G M

1996-11-14

The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

Virtual screening methods as tools for drug lead discovery from large chemical libraries.

PubMed

Ma, X H; Zhu, F; Liu, X; Shi, Z; Zhang, J X; Yang, S Y; Wei, Y Q; Chen, Y Z

2012-01-01

Virtual screening methods have been developed and explored as useful tools for searching drug lead compounds from chemical libraries, including large libraries that have become publically available. In this review, we discussed the new developments in exploring virtual screening methods for enhanced performance in searching large chemical libraries, their applications in screening libraries of ~ 1 million or more compounds in the last five years, the difficulties in their applications, and the strategies for further improving these methods.

Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization

PubMed Central

Sahu, Binod B; Shaw, Birendra P

2009-01-01

Background Despite wealth of information generated on salt tolerance mechanism, its basics still remain elusive. Thus, there is a need of continued effort to understand the salt tolerance mechanism using suitable biotechnological techniques and test plants (species) to enable development of salt tolerant cultivars of interest. Therefore, the present study was undertaken to generate information on salt stress responsive genes in a natural halophyte, Suaeda maritima, using PCR-based suppression subtractive hybridization (PCR-SSH) technique. Results Forward and reverse SSH cDNA libraries were constructed after exposing the young plants to 425 mM NaCl for 24 h. From the forward SSH cDNA library, 429 high quality ESTs were obtained. BLASTX search and TIGR assembler programme revealed overexpression of 167 unigenes comprising 89 singletons and 78 contigs with ESTs redundancy of 81.8%. Among the unigenes, 32.5% were found to be of special interest, indicating novel function of these genes with regard to salt tolerance. Literature search for the known unigenes revealed that only 17 of them were salt-inducible. A comparative analysis of the existing SSH cDNA libraries for NaCl stress in plants showed that only a few overexpressing unigenes were common in them. Moreover, the present study also showed increased expression of phosphoethanolamine N-methyltransferase gene, indicating the possible accumulation of a much studied osmoticum, glycinebetaine, in halophyte under salt stress. Functional categorization of the proteins as per the Munich database in general revealed that salt tolerance could be largely determined by the proteins involved in transcription, signal transduction, protein activity regulation and cell differentiation and organogenesis. Conclusion The study provided a clear indication of possible vital role of glycinebetaine in the salt tolerance process in S. maritima. However, the salt-induced expression of a large number of genes involved in a wide range of cellular functions was indicative of highly complex nature of the process as such. Most of the salt inducible genes, nonetheless, appeared to be species-specific. In light of the observations made, it is reasonable to emphasize that a comparative analysis of ESTs from SSH cDNA libraries generated systematically for a few halophytes with varying salt exposure time may clearly identify the key salt tolerance determinant genes to a minimum number, highly desirable for any genetic manipulation adventure. PMID:19497134

Mixture-based combinatorial libraries from small individual peptide libraries: a case study on α1-antitrypsin deficiency.

PubMed

Chang, Yi-Pin; Chu, Yen-Ho

2014-05-16

The design, synthesis and screening of diversity-oriented peptide libraries using a "libraries from libraries" strategy for the development of inhibitors of α1-antitrypsin deficiency are described. The major buttress of the biochemical approach presented here is the use of well-established solid-phase split-and-mix method for the generation of mixture-based libraries. The combinatorial technique iterative deconvolution was employed for library screening. While molecular diversity is the general consideration of combinatorial libraries, exquisite design through systematic screening of small individual libraries is a prerequisite for effective library screening and can avoid potential problems in some cases. This review will also illustrate how large peptide libraries were designed, as well as how a conformation-sensitive assay was developed based on the mechanism of the conformational disease. Finally, the combinatorially selected peptide inhibitor capable of blocking abnormal protein aggregation will be characterized by biophysical, cellular and computational methods.

In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

PubMed Central

Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

2005-01-01

The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

PubMed Central

Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

2009-01-01

Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

Large-scale DNA Barcode Library Generation for Biomolecule Identification in High-throughput Screens.

PubMed

Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio

2017-10-24

High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.

Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

NASA Astrophysics Data System (ADS)

Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

2016-12-01

Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

PubMed Central

Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

2016-01-01

Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato. PMID:27929131

Modulation of Ca(v)3.1 T-type Ca2+ channels by the ran binding protein RanBPM.

PubMed

Kim, Taehyun; Kim, Sunoh; Yun, Hyung-Mun; Chung, Kwang Chul; Han, Ye Sun; Shin, Hee-Sup; Rhim, Hyewhon

2009-01-02

In order to study the currently unknown cellular signaling pathways of Ca(v)3.1 T-type Ca(2+) channels (Ca(v)3.1 channels), we performed a yeast two-hybrid screening using intracellular domains of Ca(v)3.1 alpha1 subunit as bait. After screening the human brain cDNA library, several proteins, including RanBPM, were identified as interacting with Ca(v)3.1 channels. RanBPM was found to bind to the cytoplasmic intracellular loop between transmembrane domains I and II of Ca(v)3.1 channels. Using whole-cell patch-clamp techniques, we found that Ca(v)3.1 currents were increased by the expression of RanBPM in HEK293/Ca(v)3.1 cells. We next examined whether RanBPM affected the biophysical properties and plasma membrane expression of Ca(v)3.1 channels. Furthermore, we showed that the PKC activator inhibited Ca(v)3.1 currents, an effect that was abolished by the expression of RanBPM. These results suggest that RanBPM could be a key regulator of Ca(v)3.1 channel-mediated signaling pathways.

Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

PubMed Central

Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

1987-01-01

Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

PubMed

Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

1999-12-01

An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

High-throughput cell-based screening reveals a role for ZNF131 as a repressor of ERalpha signaling

PubMed Central

Han, Xiao; Guo, Jinhai; Deng, Weiwei; Zhang, Chenying; Du, Peige; Shi, Taiping; Ma, Dalong

2008-01-01

Background Estrogen receptor α (ERα) is a transcription factor whose activity is affected by multiple regulatory cofactors. In an effort to identify the human genes involved in the regulation of ERα, we constructed a high-throughput, cell-based, functional screening platform by linking a response element (ERE) with a reporter gene. This allowed the cellular activity of ERα, in cells cotransfected with the candidate gene, to be quantified in the presence or absence of its cognate ligand E2. Results From a library of 570 human cDNA clones, we identified zinc finger protein 131 (ZNF131) as a repressor of ERα mediated transactivation. ZNF131 is a typical member of the BTB/POZ family of transcription factors, and shows both ubiquitous expression and a high degree of sequence conservation. The luciferase reporter gene assay revealed that ZNF131 inhibits ligand-dependent transactivation by ERα in a dose-dependent manner. Electrophoretic mobility shift assay clearly demonstrated that the interaction between ZNF131 and ERα interrupts or prevents ERα binding to the estrogen response element (ERE). In addition, ZNF131 was able to suppress the expression of pS2, an ERα target gene. Conclusion We suggest that the functional screening platform we constructed can be applied for high-throughput genomic screening candidate ERα-related genes. This in turn may provide new insights into the underlying molecular mechanisms of ERα regulation in mammalian cells. PMID:18847501

Negative Regulators of Insulin Signaling Revealed in a Genome-Wide Functional Screen

PubMed Central

Pitman, Jeffrey L.; Orth, Anthony P.; Gekakis, Nicholas

2009-01-01

Background Type 2 diabetes develops due to a combination of insulin resistance and β-cell failure and current therapeutics aim at both of these underlying causes. Several negative regulators of insulin signaling are known and are the subject of drug discovery efforts. We sought to identify novel contributors to insulin resistance and hence potentially novel targets for therapeutic intervention. Methodology An arrayed cDNA library encoding 18,441 human transcripts was screened for inhibitors of insulin signaling and revealed known inhibitors and numerous potential novel regulators. The novel hits included proteins of various functional classes such as kinases, phosphatases, transcription factors, and GTPase associated proteins. A series of secondary assays confirmed the relevance of the primary screen hits to insulin signaling and provided further insight into their modes of action. Conclusion/Significance Among the novel hits was PALD (KIAA1274, paladin), a previously uncharacterized protein that when overexpressed led to inhibition of insulin's ability to down regulate a FOXO1A-driven reporter gene, reduced upstream insulin-stimulated AKT phosphorylation, and decreased insulin receptor (IR) abundance. Conversely, knockdown of PALD gene expression resulted in increased IR abundance, enhanced insulin-stimulated AKT phosphorylation, and an improvement in insulin's ability to suppress FOXO1A-driven reporter gene activity. The present data demonstrate that the application of arrayed genome-wide screening technologies to insulin signaling is fruitful and is likely to reveal novel drug targets for insulin resistance and the metabolic syndrome. PMID:19727444

Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

PubMed Central

Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

1995-01-01

We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

Isolation and characterization of a cDNA clone specific for avian vitellogenin II.

PubMed Central

Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L

1982-01-01

A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527

Genes expressed during the development and ripening of watermelon fruit.

PubMed

Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S

2006-11-01

A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.

Expression and permeation properties of the K(+) channel Kir7.1 in the retinal pigment epithelium.

PubMed

Shimura, M; Yuan, Y; Chang, J T; Zhang, S; Campochiaro, P A; Zack, D J; Hughes, B A

2001-03-01

Bovine Kir7.1 clones were obtained from a retinal pigment epithelium (RPE)-subtracted cDNA library. Human RPE cDNA library screening resulted in clones encoding full-length human Kir7.1. Northern blot analysis indicated that bovine Kir7.1 is highly expressed in the RPE. Human Kir7.1 channels were expressed in Xenopus oocytes and studied using the two-electrode voltage-clamp technique. The macroscopic Kir7.1 conductance exhibited mild inward rectification and an inverse dependence on extracellular K+ concentration ([K+]o). The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.013) > Na+ (0.003) approximately Li+ (0.001) and the sequence based on conductance ratios was Rb+ (9.5) > K+ (1.0) > Na+ (0.458) > Cs+ (0.331) > Li+ (0.139). Non-stationary noise analysis of Rb+ currents in cell-attached patches yielded a unitary conductance for Kir7.1 of approximately 2 pS. In whole-cell recordings from freshly isolated bovine RPE cells, the predominant current was a mild inwardly rectifying K+ current that exhibited an inverse dependence of conductance on [K+]o. The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.021) > Na+ (0.003) approximately Li+ (0.002) and the sequence based on conductance ratios was Rb+ (8.9) > K+ (1.0) > Na+ (0.59) > Cs+ (0.23) > Li+ (0.08). In cell-attached recordings with Rb+ in the pipette, inwardly rectifying currents were observed in nine of 12 patches of RPE apical membrane but in only one of 13 basolateral membrane patches. Non-stationary noise analysis of Rb+ currents in cell-attached apical membrane patches yielded a unitary conductance for RPE Kir of approximately 2 pS. On the basis of this molecular and electrophysiological evidence, we conclude that Kir7.1 channel subunits comprise the K+ conductance of the RPE apical membrane.

Developing Novel Therapeutics Targeting Undifferentiated and Castration-Resistant Prostate Cancer Stem Cells

DTIC Science & Technology

2016-10-01

identify PCSC- specific homing peptides ; and 2) To perform unbiased drug library screening to identify novel PCSC-targeting chemicals. In the past...display library (PDL) screening in PSA-/lo PCa cells to identify PCSC- specific homing peptides ; and 2) To perform unbiased drug library screening to...Goals of the Project (SOW): Aim 1: To perform phage display library (PDL) screening in PSA-/lo PCa cells to identify PCSC- specific homing peptides

A reliable computational workflow for the selection of optimal screening libraries.

PubMed

Gilad, Yocheved; Nadassy, Katalin; Senderowitz, Hanoch

2015-01-01

The experimental screening of compound collections is a common starting point in many drug discovery projects. Successes of such screening campaigns critically depend on the quality of the screened library. Many libraries are currently available from different vendors yet the selection of the optimal screening library for a specific project is challenging. We have devised a novel workflow for the rational selection of project-specific screening libraries. The workflow accepts as input a set of virtual candidate libraries and applies the following steps to each library: (1) data curation; (2) assessment of ADME/T profile; (3) assessment of the number of promiscuous binders/frequent HTS hitters; (4) assessment of internal diversity; (5) assessment of similarity to known active compound(s) (optional); (6) assessment of similarity to in-house or otherwise accessible compound collections (optional). For ADME/T profiling, Lipinski's and Veber's rule-based filters were implemented and a new blood brain barrier permeation model was developed and validated (85 and 74 % success rate for training set and test set, respectively). Diversity and similarity descriptors which demonstrated best performances in terms of their ability to select either diverse or focused sets of compounds from three databases (Drug Bank, CMC and CHEMBL) were identified and used for diversity and similarity assessments. The workflow was used to analyze nine common screening libraries available from six vendors. The results of this analysis are reported for each library providing an assessment of its quality. Furthermore, a consensus approach was developed to combine the results of these analyses into a single score for selecting the optimal library under different scenarios. We have devised and tested a new workflow for the rational selection of screening libraries under different scenarios. The current workflow was implemented using the Pipeline Pilot software yet due to the usage of generic components, it can be easily adapted and reproduced by computational groups interested in rational selection of screening libraries. Furthermore, the workflow could be readily modified to include additional components. This workflow has been routinely used in our laboratory for the selection of libraries in multiple projects and consistently selects libraries which are well balanced across multiple parameters.Graphical abstract.

Identification of mRNA transcript and screening of amino acids in response to interaction of salinity and nitrate in aquatic fern Azolla caroliniana.

PubMed

Tammam, A A; Mostafa, E M

2012-06-01

The mechanisms by which Azolla caroliniana respond to salt stress in absence and presence of nitrate is investigated. Screening of amino acid and differential display is used to compare overall differences in gene expression between salinity-stressed and unstressed Azolla caroliniana by quantitative reverse transcriptase polymerase chain reaction (RT-PC R). Results showed that under saline conditions, aspartic acid, glutamic acid, alanine and leucine were the amino acids found to be abundant in Azolla caroliniana, accounting for 11.26%, 8.66%, 9.43%, and 12.36%, respectively. Following salinity stress, a decrease in free glutamate concomitant with a parallel decrease in free proline was indeed evident. Interaction between nitrate and salinity stress increased proline content significantly. By screening a cDNA library, we have identified protein products by homology with known proteins. The RNA transcripts encoding protein influencing secondary metabolites and vacuolar Na+/H+ antiporter that facilitate the transport system. The databasematched under interaction of nitrate and 50 mM NaCl were associated with wall biosynthesis, disease resistance, metabolite transport and protein regulator, other gene for metabolism of steroids and secondary transport. Results obtained from this research could represent a key step in understanding the molecular mechanism of salt tolerance of Azolla caroliniana in the presence and absence of nitrate.

Simulated Screens of DNA Encoded Libraries: The Potential Influence of Chemical Synthesis Fidelity on Interpretation of Structure-Activity Relationships.

PubMed

Satz, Alexander L

2016-07-11

Simulated screening of DNA encoded libraries indicates that the presence of truncated byproducts complicates the relationship between library member enrichment and equilibrium association constant (these truncates result from incomplete chemical reactions during library synthesis). Further, simulations indicate that some patterns observed in reported experimental data may result from the presence of truncated byproducts in the library mixture and not structure-activity relationships. Potential experimental methods of minimizing the presence of truncates are assessed via simulation; the relationship between enrichment and equilibrium association constant for libraries of differing purities is investigated. Data aggregation techniques are demonstrated that allow for more accurate analysis of screening results, in particular when the screened library contains significant quantities of truncates.

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

HUNT: launch of a full-length cDNA database from the Helix Research Institute.

PubMed

Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

2001-01-01

The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

High impact technologies for natural products screening.

PubMed

Koehn, Frank E

2008-01-01

Natural products have historically been a rich source of lead molecules in drug discovery. However, natural products have been de-emphasized as high throughput screening resources in the recent past, in part because of difficulties in obtaining high quality natural products screening libraries, or in applying modern screening assays to these libraries. In addition, natural products programs based on screening of extract libraries, bioassay-guided isolation, structure elucidation and subsequent production scale-up are challenged to meet the rapid cycle times that are characteristic of the modern HTS approach. Fortunately, new technologies in mass spectrometry, NMR and other spectroscopic techniques can greatly facilitate the first components of the process - namely the efficient creation of high-quality natural products libraries, bimolecular target or cell-based screening, and early hit characterization. The success of any high throughput screening campaign is dependent on the quality of the chemical library. The construction and maintenance of a high quality natural products library, whether based on microbial, plant, marine or other sources is a costly endeavor. The library itself may be composed of samples that are themselves mixtures - such as crude extracts, semi-pure mixtures or single purified natural products. Each of these library designs carries with it distinctive advantages and disadvantages. Crude extract libraries have lower resource requirements for sample preparation, but high requirements for identification of the bioactive constituents. Pre-fractionated libraries can be an effective strategy to alleviate interferences encountered with crude libraries, and may shorten the time needed to identify the active principle. Purified natural product libraries require substantial resources for preparation, but offer the advantage that the hit detection process is reduced to that of synthetic single component libraries. Whether the natural products library consists of crude or partially fractionated mixtures, the library contents should be profiled to identify the known components present - a process known as dereplication. The use of mass spectrometry and HPLC-mass spectrometry together with spectral databases is a powerful tool in the chemometric profiling of bio-sources for natural product production. High throughput, high sensitivity flow NMR is an emerging tool in this area as well. Whether by cell based or biomolecular target based assays, screening of natural product extract libraries continues to furnish novel lead molecules for further drug development, despite challenges in the analysis and prioritization of natural products hits. Spectroscopic techniques are now being used to directly screen natural product and synthetic libraries. Mass spectrometry in the form of methods such as ESI-ICRFTMS, and FACS-MS as well as NMR methods such as SAR by NMR and STD-NMR have been utilized to effectively screen molecular libraries. Overall, emerging advances in mass spectrometry, NMR and other technologies are making it possible to overcome the challenges encountered in screening natural products libraries in today's drug discovery environment. As we apply these technologies and develop them even further, we can look forward to increased impact of natural products in the HTS based drug discovery.

Analysis of Current DNA Encoded Library Screening Data Indicates Higher False Negative Rates for Numerically Larger Libraries.

PubMed

Satz, Alexander L; Hochstrasser, Remo; Petersen, Ann C

2017-04-10

To optimize future DNA-encoded library design, we have attempted to quantify the library size at which the signal becomes undetectable. To accomplish this we (i) have calculated that percent yields of individual library members following a screen range from 0.002 to 1%, (ii) extrapolated that ∼1 million copies per library member are required at the outset of a screen, and (iii) from this extrapolation predict that false negative rates will begin to outweigh the benefit of increased diversity at library sizes >10 8 . The above analysis is based upon a large internal data set comprising multiple screens, targets, and libraries; we also augmented our internal data with all currently available literature data. In theory, high false negative rates may be overcome by employing larger amounts of library; however, we argue that using more than currently reported amounts of library (≫10 nmoles) is impractical. The above conclusions may be generally applicable to other DNA encoded library platforms, particularly those platforms that do not allow for library amplification.

Sequence of Spider Aciniform and Piriform Silks

DTIC Science & Technology

2001-09-19

7/98nd subtan-6/01 4. TITLE AND SUBTITLE Sequence of Spider Aciniform and Piriform Silks 5. FUNDING NUMBERS DAAD19-01-1-0569 6...aciniform glands from Argiope trifasciata were used to construct a cDNA library. The library was probed with various DNA probes based on known spider silk ...sequence in a number of other spider silks . The 5’end of the clone still appears to be repetitive sequence and thus it is unlikely to be a full-length

Improving RNA-Seq expression estimates by correcting for fragment bias

PubMed Central

2011-01-01

The biochemistry of RNA-Seq library preparation results in cDNA fragments that are not uniformly distributed within the transcripts they represent. This non-uniformity must be accounted for when estimating expression levels, and we show how to perform the needed corrections using a likelihood based approach. We find improvements in expression estimates as measured by correlation with independently performed qRT-PCR and show that correction of bias leads to improved replicability of results across libraries and sequencing technologies. PMID:21410973

DNA Damage and Oxidative Stress in Dyskeratosis Congenita: Analysis of Pathways and Therapeutic Stategies Using CPISPR and iPSC Model Systems

DTIC Science & Technology

2017-06-01

Milestone Achieved: HRPO/ACURO Approval 6 Finished Major Task 2 CRISPR knockout/RNAseq Viral infection/prep 3-6 CRISPR KO virus library prep...finished; RNA-Seq: ~75% Cell manipulation 3-6 CRISPR KO virus infection: 50%; Single cDNA infections: finished Bioinformatics 1 CRISPR KO library...characterization 1-3 Finished Update: production of iPSC clones harboring DC mutations generated by CRISPR : Design 1 Finished Update: production of

Peregrine

PubMed Central

Langevin, Stanley A.; Bent, Zachary W.; Solberg, Owen D.; Curtis, Deanna J.; Lane, Pamela D.; Williams, Kelly P.; Schoeniger, Joseph S.; Sinha, Anupama; Lane, Todd W.; Branda, Steven S.

2013-01-01

Use of second generation sequencing (SGS) technologies for transcriptional profiling (RNA-Seq) has revolutionized transcriptomics, enabling measurement of RNA abundances with unprecedented specificity and sensitivity and the discovery of novel RNA species. Preparation of RNA-Seq libraries requires conversion of the RNA starting material into cDNA flanked by platform-specific adaptor sequences. Each of the published methods and commercial kits currently available for RNA-Seq library preparation suffers from at least one major drawback, including long processing times, large starting material requirements, uneven coverage, loss of strand information and high cost. We report the development of a new RNA-Seq library preparation technique that produces representative, strand-specific RNA-Seq libraries from small amounts of starting material in a fast, simple and cost-effective manner. Additionally, we have developed a new quantitative PCR-based assay for precisely determining the number of PCR cycles to perform for optimal enrichment of the final library, a key step in all SGS library preparation workflows. PMID:23558773

Sequencing cDNAs: An Introduction to DNA Sequence Analysis in the Undergraduate Molecular Genetics Course.

ERIC Educational Resources Information Center

Galewsky, Samuel

2000-01-01

Introduces a series of molecular genetics laboratories where students pick a single colony from a Drosophila melanogester embryo cDNA library and purify the plasmid, then analyze the insert through restriction digests and gel electrophoresis. (Author/YDS)

Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species

PubMed Central

Bychenko, Oksana S.; Sukhanova, Lyubov V.; Azhikina, Tatyana L.; Skvortsov, Timofey A.; Belomestnykh, Tuyana V.; Sverdlov, Eugene D.

2014-01-01

The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. PMID:24719892

Sequence analysis of 497 mouse brain ESTs expressed in the substantia nigra

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, G.J.; Savioz, A.; Davies, R.W.

1997-01-15

The use of subtracted, region-specific cDNA libraries combined with single-pass cDNA sequencing allows the discovery of novel genes and facilitates molecular description of the tissue or region involved. We report the sequence of 497 mouse expressed sequence tags (ESTs) from two subtracted libraries enriched for cDNAs expressed in the substantia nigra, a brain region with important roles in movement control and Parkinson disease. Of these, 238 ESTs give no database matches and therefore derive from novel genes. A further 115 ESTs show sequence similarity to ESTs from other organisms, which themselves do not yield any significant database matches to genesmore » of known function. Fifty-six ESTs show sequence similarity to previously identified genes whose mouse homologues have not been reported. The total number of ESTs reported that are new for the mouse is 407, which, together with the 90 ESTs corresponding to known mouse genes or cDNAs, contributes to the molecular description of the substantia nigra. 21 refs., 4 tabs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela

To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

PubMed

Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

2016-08-24

To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway

PubMed Central

2012-01-01

Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893

[Chemical databases and virtual screening].

PubMed

Rognan, Didier; Bonnet, Pascal

2014-12-01

A prerequisite to any virtual screening is the definition of compound libraries to be screened. As we describe here, various sources are available. The selection of the proper library is usually project-dependent but at least as important as the screening method itself. This review details the main compound libraries that are available for virtual screening and guide the reader to the best possible selection according to its needs. © 2014 médecine/sciences – Inserm.

Antituberculosis activity of the molecular libraries screening center network library.

PubMed

Maddry, Joseph A; Ananthan, Subramaniam; Goldman, Robert C; Hobrath, Judith V; Kwong, Cecil D; Maddox, Clinton; Rasmussen, Lynn; Reynolds, Robert C; Secrist, John A; Sosa, Melinda I; White, E Lucile; Zhang, Wei

2009-09-01

There is an urgent need for the discovery and development of new antitubercular agents that target novel biochemical pathways and treat drug-resistant forms of the disease. One approach to addressing this need is through high-throughput screening of drug-like small molecule libraries against the whole bacterium in order to identify a variety of new, active scaffolds that will stimulate additional biological research and drug discovery. Through the Molecular Libraries Screening Center Network, the NIAID Tuberculosis Antimicrobial Acquisition and Coordinating Facility tested a 215,110-compound library against Mycobacterium tuberculosis strain H37Rv. A medicinal chemistry survey of the results from the screening campaign is reported herein.

The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

PubMed

Tsapara, Anna; Matter, Karl; Balda, Maria S

2006-03-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

PubMed Central

Tsapara, Anna; Matter, Karl; Balda, Maria S.

2006-01-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

Identification of a new C-type lectin, TES-70, secreted by infective larvae of Toxocara canis, which binds to host ligands.

PubMed

Loukas, A; Doedens, A; Hintz, M; Maizels, R M

2000-11-01

Infective larvae of the dog roundworm Toxocara canis survive in the tissues of their hosts for extended periods in a state of developmental arrest, successfully evading immune destruction. This survival strategy is thought to be mediated by T. canis excretory/secretory (TES) products which downregulate or divert the immune response. We purified one of the major TES products, TES-70 and gained amino acid sequence from 4 tryptic peptides. These peptides were matched to a predicted protein from a cDNA that was isolated by expression screening a T. canis cDNA library with mouse anti-TES serum. The predicted protein (Tc-CTL-4) is similar to, but larger than, Tc-CTL-1, a 32-kDa C-type lectin secreted by T. canis larvae. Tc-CTL-4 has a signal peptide, 2 Cys-rich domains and a C-terminal calcium-dependent C-type lectin domain that shares sequence similarity with host immune cell receptors such as macrophage mannose receptor and CD23. The lectin domain was expressed in bacteria and antiserum to the purified recombinant protein was used to confirm that Tc-ctl-4 did encode the native TES-70 glycoprotein. TES-70 selectively bound to ligands on the surface of Madin-Darby Canine Kidney cells in vitro in a calcium-dependent manner, inhibitable by mammalian serum, indicating that a host glycan is the native ligand for this new parasite lectin.

AcT-2: a novel myotropic and antimicrobial type 2 tryptophyllin from the skin secretion of the Central American red-eyed leaf frog, Agalychnis callidryas.

PubMed

Ge, Lilin; Lyu, Peng; Zhou, Mei; Zhang, Huiling; Wan, Yuantai; Li, Bin; Li, Renjie; Wang, Lei; Chen, Tianbao; Shaw, Chris

2014-01-01

Tryptophyllins are a diverse family of amphibian peptides originally found in extracts of phyllomedusine frog skin by chemical means. Their biological activities remain obscure. Here we describe the isolation and preliminary pharmacological characterization of a novel type 2 tryptophyllin, named AcT-2, from the skin secretion of the red-eyed leaf frog, Agalychnis callidryas. The peptide was initially identified during smooth muscle pharmacological screening of skin secretion HPLC fractions and the unique primary structure--GMRPPWF-NH2--was established by both Edman degradation and electrospray MS/MS fragmentation sequencing. A. cDNA encoding the biosynthetic precursor of AcT-2 was successfully cloned from a skin secretion-derived cDNA library by means of RACE PCR and this contained an open-reading frame consisting of 62 amino acid residues with a single AcT-2 encoding sequence located towards the C-terminus. A synthetic replicate of AcT-2 was found to relax arterial smooth muscle (EC50 = 5.1 nM) and to contract rat urinary bladder smooth muscle (EC50 = 9.3 μ M). The peptide could also inhibit the growth of the microorganisms, Staphylococcus aureus, (MIC = 256 mg/L) Escherichia coli (MIC = 512 mg/L), and Candida albicans (128 mg/L). AcT-2 is thus the first amphibian skin tryptophyllin found to possess both myotropic and antimicrobial activities.

Definition of tumor-associated antigens in hepatocellular carcinoma.

PubMed

Stenner-Liewen, F; Luo, G; Sahin, U; Tureci, O; Koslovski, M; Kautz, I; Liewen, H; Pfreundschuh, M

2000-03-01

With an estimated annual incidence of about one million cases, hepatocellular carcinoma (HCC) is one of the most common neoplasms worldwide. Of all malignant diseases, it is the major cause of death in some regions of Africa and Asia. The pathogenic mechanisms responsible for HCC are not well defined, and therapeutic means, especially in inoperable HCCs, are still unsatisfactory and await improvement. In the quest for tumor antigens exploitable for gene therapy, we studied immune responses in the context of HCC. A cDNA library derived from a human HCC sample was screened using the SEREX approach. Nineteen distinct antigens reactive with autologous IgG were identified. Sequence analysis revealed three of the cDNA clones to code for hitherto unknown proteins and 16 known genes products. Proteins as diverse in function as LDH, albumin, and kinectin were found. Furthermore, proteins involved in the transcription/translation machinery had elicited an immune response in the autologous host. A panel of allogenic sera including sera from patients with hepatitis, liver cirrhosis, HCC, and other tumor entities, as well as sera from normal individuals, was used for frequency analysis of antibody responses. Whereas allogenic sera of HCC patients detected most antigens at a high percentage, control sera were rarely antibody-positive. The nature of the major fraction of antigens described here are linked to liver. Thus, our findings demonstrate not only the complexity of the humoral immune response against HCC, but may also offer new insight into mechanisms underlying transformation of the liver cell.

Identification and characterization of INMAP, a novel interphase nucleus and mitotic apparatus protein that is involved in spindle formation and cell cycle progression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Enzhi; Lei, Yan; Liu, Qian

2009-04-15

A novel protein that associates with interphase nucleus and mitotic apparatus (INMAP) was identified by screening HeLa cDNA expression library with an autoimmune serum followed by tandem mass spectrometry. Its complete cDNA sequence of 1.818 kb encodes 343 amino acids with predicted molecular mass of 38.2 kDa and numerous phosphorylation sites. The sequence is identical with nucleotides 1-1800 bp of an unnamed gene (GenBank accession no. (7022388)) and highly homologous with the 3'-terminal sequence of POLR3B. A monoclonal antibody against INMAP reacted with similar proteins in S. cerevisiae, Mel and HeLa cells, suggesting that it is a conserved protein. Confocalmore » microscopy using either GFP-INMAP fusion protein or labeling with the monoclonal antibody revealed that the protein localizes as distinct dots in the interphase nucleus, but during mitosis associates closely with the spindle. Double immunolabeling using specific antibodies showed that the INMAP co-localizes with {alpha}-tubulin, {gamma}-tubulin, and NuMA. INMAP also co-immunoprecipitated with these proteins in their native state. Stable overexpression of INMAP in HeLa cell lines leads to defects in the spindle, mitotic arrest, formation of polycentrosomal and multinuclear cells, inhibition of growth, and apoptosis. We propose that INMAP is a novel protein that plays essential role in spindle formation and cell-cycle progression.« less

Characterization and mapping of the mouse NDP (Norrie disease) locus (Ndp).

PubMed

Battinelli, E M; Boyd, Y; Craig, I W; Breakefield, X O; Chen, Z Y

1996-02-01

Norrie disease is a severe X-linked recessive neurological disorder characterized by congenital blindness with progressive loss of hearing. Over half of Norrie patients also manifest different degrees of mental retardation. The gene for Norrie disease (NDP) has recently been cloned and characterized. With the human NDP cDNA, mouse genomic phage libraries were screened for the homolog of the gene. Comparison between mouse and human genomic DNA blots hybridized with the NDP cDNA, as well as analysis of phage clones, shows that the mouse NDP gene is 29 kb in size (28 kb for the human gene). The organization in the two species is very similar. Both have three exons with similar-sized introns and identical exon-intron boundaries between exon 2 and 3. The mouse open reading frame is 393 bp and, like the human coding sequence, is encoded in exons 2 and 3. The absence of six nucleotides in the second mouse exon results in the encoded protein being two amino acids smaller than its human counterpart. The overall homology between the human and mouse NDP protein is 95% and is particularly high (99%) in exon 3, consistent with the apparent functional importance of this region. Analysis of transcription initiation sites suggests the presence of multiple start sites associated with expression of the mouse NDP gene. Pedigree analysis of an interspecific mouse backcross localizes the mouse NDP gene close to Maoa in the conserved segment, which runs from CYBB to PFC in both human and mouse.

Molecular cloning and functional characterization of borneol dehydrogenase from the glandular trichomes of Lavandula x intermedia.

PubMed

Sarker, Lukman S; Galata, Mariana; Demissie, Zerihun A; Mahmoud, Soheil S

2012-12-15

Several varieties of Lavandula x intermedia (lavandins) are cultivated for their essential oils (EOs) for use in cosmetic, hygiene and personal care products. These EOs are mainly constituted of monoterpenes including camphor, which contributes an off odor reducing the olfactory appeal of the oil. We have recently constructed a cDNA library from the glandular trichomes (the sites of EO synthesis) of L. x intermedia plants. Here, we describe the cloning of a borneol dehydrogenase cDNA (LiBDH) from this library. The 780 bp open reading frame of the cDNA encoded a 259 amino acid short chain alcohol dehydrogenase with a predicted molecular mass of ca. 27.5 kDa. The recombinant LiBDH was expressed in Escherichia coli, purified by Ni-NTA agarose affinity chromatography, and functionally characterized in vitro. The bacterially produced enzyme specifically converted borneol to camphor as the only product with K(m) and k(cat) values of 53 μM and 4.0 × 10(-4) s(-1), respectively. The LiBDH transcripts were specifically expressed in glandular trichomes of mature flowers indicating that like other Lavandula monoterpene synthases the expression of this gene is regulated in a tissue-specific manner. The cloning of LiBDH has far reaching implications in improving the quality of Lavandula EOs through metabolic engineering. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification of genes from the Treacher Collins candidate region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, M.; Dixon, J.; Edwards, S.

Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

A new virus from the family Tombusviridae infecting sugarcane

USDA-ARS?s Scientific Manuscript database

Sugarcane is an economically important crop cultivated in tropical and sub-tropical regions worldwide. Viral diseases are one of the major constraints for sugarcane production. Total RNA was extracted from leaves exhibiting mosaic symptoms on a sugarcane quarantine accession. A cDNA library was cons...

Daytime soybean transcriptome fluctuations during water deficit stress

USDA-ARS?s Scientific Manuscript database

Since drought can seriously affect plant growth and development and little is known about how the oscillations of gene expression during the drought stress-acclimation response in soybean is affected, we applied Illumina technology to sequence 36 cDNA libraries synthesized from control and drought-s...

Generation of an arrayed CRISPR-Cas9 library targeting epigenetic regulators: from high-content screens to in vivo assays

PubMed Central

2017-01-01

ABSTRACT The CRISPR-Cas9 system has revolutionized genome engineering, allowing precise modification of DNA in various organisms. The most popular method for conducting CRISPR-based functional screens involves the use of pooled lentiviral libraries in selection screens coupled with next-generation sequencing. Screens employing genome-scale pooled small guide RNA (sgRNA) libraries are demanding, particularly when complex assays are used. Furthermore, pooled libraries are not suitable for microscopy-based high-content screens or for systematic interrogation of protein function. To overcome these limitations and exploit CRISPR-based technologies to comprehensively investigate epigenetic mechanisms, we have generated a focused sgRNA library targeting 450 epigenetic regulators with multiple sgRNAs in human cells. The lentiviral library is available both in an arrayed and pooled format and allows temporally-controlled induction of gene knock-out. Characterization of the library showed high editing activity of most sgRNAs and efficient knock-out at the protein level in polyclonal populations. The sgRNA library can be used for both selection and high-content screens, as well as for targeted investigation of selected proteins without requiring isolation of knock-out clones. Using a variety of functional assays we show that the library is suitable for both in vitro and in vivo applications, representing a unique resource to study epigenetic mechanisms in physiological and pathological conditions. PMID:29327641

APPLICATION OF CDNA MICROARRAY TECHNOLOGY TO IN VITRO TOXICOLOGY AND THE SELECTION OF GENES FOR A REAL TIME RT-PCR-BASED SCREEN FOR OXIDATIVE STRESS IN HEP-G2 CELLS

EPA Science Inventory

Large-scale analysis of gene expression using cDNA microarrays promises the
rapid detection of the mode of toxicity for drugs and other chemicals. cDNA
microarrays were used to examine chemically-induced alterations of gene
expression in HepG2 cells exposed to oxidative ...

Characterization by Suppression Subtractive Hybridization of Transcripts That Are Differentially Expressed in Leaves of Anthracnose-Resistant Ramie Cultivar.

PubMed

Xuxia, Wang; Jie, Chen; Bo, Wang; Lijun, Liu; Hui, Jiang; Diluo, Tang; Dingxiang, Peng

2012-01-01

For the purpose of screening putative anthracnose resistance-related genes of ramie ( Boehmeria nivea L. Gaud), a cDNA library was constructed by suppression subtractive hybridization using anthracnose-resistant cultivar Huazhu no. 4. The cDNAs from Huazhu no. 4, which were infected with Colletotrichum gloeosporioides , were used as the tester and cDNAs from uninfected Huazhu no. 4 as the driver. Sequencing analysis and homology searching showed that these clones represented 132 single genes, which were assigned to functional categories, including 14 putative cellular functions, according to categories established for Arabidopsis . These 132 genes included 35 disease resistance and stress tolerance-related genes including putative heat-shock protein 90, metallothionein, PR-1.2 protein, catalase gene, WRKY family genes, and proteinase inhibitor-like protein. Partial disease-related genes were further analyzed by reverse transcription PCR and RNA gel blot. These expressed sequence tags are the first anthracnose resistance-related expressed sequence tags reported in ramie.

Polypyrimidine tract-binding protein influences negative strand RNA synthesis of dengue virus.

PubMed

Jiang, Linbin; Yao, Huiling; Duan, Xiaoqun; Lu, Xi; Liu, Yongming

2009-07-24

Flavivirus non-structural protein 4A (NS4A) induces membrane rearrangements to form viral replication complex and functions as interferon antagonist. However, other non-structural roles of NS4A protein in relation to virus life-cycle are poorly defined. This study elucidated if dengue virus (DENV) NS4A protein interacts with host proteins and contributes to viral pathogenesis by screening human liver cDNA yeast-two-hybrid library. Our study identified polypyrimidine tract-binding protein (PTB) as a novel interacting partner of DENV NS4A protein. We reported for the first time that PTB influenced DENV production. Gene-silencing studies showed that PTB did not have an effect on DENV entry and DENV RNA translation. Further functional studies revealed that PTB influenced DENV production by modulating negative strand RNA synthesis. This is the first study that enlightens the interaction of DENV NS4A protein with PTB, in addition to demonstrating the novel role of PTB in relation to mosquito-borne flavivirus life-cycle.

Simultaneous display of two large proteins on the head and tail of bacteriophage lambda

PubMed Central

2013-01-01

Background Consistent progress in the development of bacteriophage lambda display platform as an alternative to filamentous phage display system was achieved in the recent years. The lambda phage has been engineered to display efficiently multiple copies of peptides or even large protein domains providing a powerful tool for screening libraries of peptides, proteins and cDNA. Results In the present work we describe an original method for dual display of large proteins on the surface of lambda particles. An anti-CEA single-chain antibody fragment and green fluorescent protein or alkaline phosphatase were simultaneously displayed by engineering both gpD and gpV lambda proteins. Conclusions Here we show that such modified phage particles can be used for the detection of target molecules in vitro and in vivo. Dual expression of functional moieties on the surface of the lambda phage might open the way to generation of a new class of diagnostic and therapeutic targeted nanoparticles. PMID:24073829

Cloning and expression analysis of Zmglp1, a new germin-like protein gene in maize.

PubMed

Fan, Zhanmin; Gu, Hongya; Chen, Xiaowei; Song, Hui; Wang, Qian; Liu, Meihua; Qu, Li-Jia; Chen, Zhangliang

2005-06-17

The cDNA and genomic DNA of a green tissue-specific gene were cloned from maize (Zea mays L.) using cDNA-amplified fragment length polymorphism (cDNA-AFLP) and library screening. The deduced protein was highly similar to Hordeum vulgare germin-like protein 1 (HvGLP1), and the maize gene was therefore designated Zmglp1. Northern blot specifically detected the mRNA of Zmglp1 in young whorl leaves at the early-whorl stage. However, at the late-whorl, tassel, and silk stages, Zmglp1 transcripts were highly abundant in young whorl leaves; less abundant in mature leaves, young tassels, and cobs; and not detectable in roots, immature kernels, and stalks. RNA in situ hybridization revealed that Zmglp1 expressed only in mesophyllous, phloem, and guard cells in the young whorl leaves. Deletion analysis of the promoter in transgenic Arabidopsis resulted in the identification of several regions containing important regulatory cis-elements controlling the expression levels and circadian rhythm-oscillated patterns of Zmglp1.

VHL negatively regulates SARS coronavirus replication by modulating nsp16 ubiquitination and stability.

PubMed

Yu, Xiao; Chen, Shuliang; Hou, Panpan; Wang, Min; Chen, Yu; Guo, Deyin

2015-04-03

Eukaryotic cellular and most viral RNAs carry a 5'-terminal cap structure, a 5'-5' triphosphate linkage between the 5' end of the RNA and a guanosine nucleotide (cap-0). SARS coronavirus (SARS-CoV) nonstructural protein nsp16 functions as a methyltransferase, to methylate mRNA cap-0 structure at the ribose 2'-O position of the first nucleotide to form cap-1 structures. However, whether there is interplay between nsp16 and host proteins was not yet clear. In this report, we identified several potential cellular nsp16-interacting proteins from a human thymus cDNA library by yeast two-hybrid screening. VHL, one of these proteins, was proven to interact with nsp16 both in vitro and in vivo. Further studies showed that VHL can inhibit SARS-CoV replication by regulating nsp16 ubiquitination and promoting its degradation. Our results have revealed the role of cellular VHL in the regulation of SARS-CoV replication. Copyright © 2015 Elsevier Inc. All rights reserved.

Single-round selection yields a unique retroviral envelope utilizing GPR172A as its host receptor.

PubMed

Mazari, Peter M; Linder-Basso, Daniela; Sarangi, Anindita; Chang, Yehchung; Roth, Monica J

2009-04-07

The recognition by a viral envelope of its cognate host-cell receptor is the initial critical step in defining the viral host-range and tissue specificity. This study combines a single-round of selection of a random envelope library with a parallel cDNA screen for receptor function to identify a distinct retroviral envelope/receptor pair. The 11-aa targeting domain of the modified feline leukemia virus envelope consists of a constrained peptide. Critical to the binding of the constrained peptide envelope to its cellular receptor are a pair of internal cysteines and an essential Trp required for maintenance of titers >10(5) lacZ staining units per milliliter. The receptor used for viral entry is the human GPR172A protein, a G-protein-coupled receptor isolated from osteosarcoma cells. The ability to generate unique envelopes capable of using tissue- or disease-specific receptors marks an advance in the development of efficient gene-therapy vectors.

Isolation and Identification of miRNAs in Jatropha curcas

PubMed Central

Wang, Chun Ming; Liu, Peng; Sun, Fei; Li, Lei; Liu, Peng; Ye, Jian; Yue, Gen Hua

2012-01-01

MicroRNAs (miRNAs) are small noncoding RNAs that play crucial regulatory roles by targeting mRNAs for silencing. To identify miRNAs in Jatropha curcas L, a bioenergy crop, cDNA clones from two small RNA libraries of leaves and seeds were sequenced and analyzed using bioinformatic tools. Fifty-two putative miRNAs were found from the two libraries, among them six were identical to known miRNAs and 46 were novel. Differential expression patterns of 15 miRNAs in root, stem, leave, fruit and seed were detected using quantitative real-time PCR. Ten miRNAs were highly expressed in fruit or seed, implying that they may be involved in seed development or fatty acids synthesis in seed. Moreover, 28 targets of the isolated miRNAs were predicted from a jatropha cDNA library database. The miRNA target genes were predicted to encode a broad range of proteins. Sixteen targets had clear BLASTX hits to the Uniprot database and were associated with genes belonging to the three major gene ontology categories of biological process, cellular component, and molecular function. Four targets were identified for JcumiR004. By silencing JcumiR004 primary miRNA, expressions of the four target genes were up-regulated and oil composition were modulated significantly, indicating diverse functions of JcumiR004. PMID:22419887

Isolation and characterization of a novel calmodulin-binding protein from potato

NASA Technical Reports Server (NTRS)

Reddy, Anireddy S N.; Day, Irene S.; Narasimhulu, S. B.; Safadi, Farida; Reddy, Vaka S.; Golovkin, Maxim; Harnly, Melissa J.

2002-01-01

Tuberization in potato is controlled by hormonal and environmental signals. Ca(2+), an important intracellular messenger, and calmodulin (CaM), one of the primary Ca(2+) sensors, have been implicated in controlling diverse cellular processes in plants including tuberization. The regulation of cellular processes by CaM involves its interaction with other proteins. To understand the role of Ca(2+)/CaM in tuberization, we have screened an expression library prepared from developing tubers with biotinylated CaM. This screening resulted in isolation of a cDNA encoding a novel CaM-binding protein (potato calmodulin-binding protein (PCBP)). Ca(2+)-dependent binding of the cDNA-encoded protein to CaM is confirmed by (35)S-labeled CaM. The full-length cDNA is 5 kb long and encodes a protein of 1309 amino acids. The deduced amino acid sequence showed significant similarity with a hypothetical protein from another plant, Arabidopsis. However, no homologs of PCBP are found in nonplant systems, suggesting that it is likely to be specific to plants. Using truncated versions of the protein and a synthetic peptide in CaM binding assays we mapped the CaM-binding region to a 20-amino acid stretch (residues 1216-1237). The bacterially expressed protein containing the CaM-binding domain interacted with three CaM isoforms (CaM2, CaM4, and CaM6). PCBP is encoded by a single gene and is expressed differentially in the tissues tested. The expression of CaM, PCBP, and another CaM-binding protein is similar in different tissues and organs. The predicted protein contained seven putative nuclear localization signals and several strong PEST motifs. Fusion of the N-terminal region of the protein containing six of the seven nuclear localization signals to the reporter gene beta-glucuronidase targeted the reporter gene to the nucleus, suggesting a nuclear role for PCBP.

Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants.

PubMed

Chung, Eunsook; Kim, Soo-Yong; Yi, So Young; Choi, Doil

2003-06-30

Osmotic stress-related genes were selected from an EST database constructed from 7 cDNA libraries from different tissues of the hot pepper. A full-length cDNA of Capsicum annuum dehydrin (Cadhn), a late embryogenesis abundant (lea) gene, was selected from the 5' single pass sequenced cDNA clones and sequenced. The deduced polypeptide has 87% identity with potato dehydrin C17, but very little identity with the dehydrin genes of other organisms. It contains a serine-tract (S-segment) and 3 conserved lysine-rich domains (K-segments). Southern blot analysis showed that 2 copies are present in the hot pepper genome. Cadhn was induced by osmotic stress in leaf tissues as well as by the application of abscisic acid. The RNA was most abundant in green fruit. The expression of several osmotic stress-related genes was examined and Cadhn proved to be the most abundantly expressed of these in response to osmotic stress.

The mathematics of a successful deconvolution: a quantitative assessment of mixture-based combinatorial libraries screened against two formylpeptide receptors.

PubMed

Santos, Radleigh G; Appel, Jon R; Giulianotti, Marc A; Edwards, Bruce S; Sklar, Larry A; Houghten, Richard A; Pinilla, Clemencia

2013-05-30

In the past 20 years, synthetic combinatorial methods have fundamentally advanced the ability to synthesize and screen large numbers of compounds for drug discovery and basic research. Mixture-based libraries and positional scanning deconvolution combine two approaches for the rapid identification of specific scaffolds and active ligands. Here we present a quantitative assessment of the screening of 32 positional scanning libraries in the identification of highly specific and selective ligands for two formylpeptide receptors. We also compare and contrast two mixture-based library approaches using a mathematical model to facilitate the selection of active scaffolds and libraries to be pursued for further evaluation. The flexibility demonstrated in the differently formatted mixture-based libraries allows for their screening in a wide range of assays.

Peregrine: A rapid and unbiased method to produce strand-specific RNA-Seq libraries from small quantities of starting material.

PubMed

Langevin, Stanley A; Bent, Zachary W; Solberg, Owen D; Curtis, Deanna J; Lane, Pamela D; Williams, Kelly P; Schoeniger, Joseph S; Sinha, Anupama; Lane, Todd W; Branda, Steven S

2013-04-01

Use of second generation sequencing (SGS) technologies for transcriptional profiling (RNA-Seq) has revolutionized transcriptomics, enabling measurement of RNA abundances with unprecedented specificity and sensitivity and the discovery of novel RNA species. Preparation of RNA-Seq libraries requires conversion of the RNA starting material into cDNA flanked by platform-specific adaptor sequences. Each of the published methods and commercial kits currently available for RNA-Seq library preparation suffers from at least one major drawback, including long processing times, large starting material requirements, uneven coverage, loss of strand information and high cost. We report the development of a new RNA-Seq library preparation technique that produces representative, strand-specific RNA-Seq libraries from small amounts of starting material in a fast, simple and cost-effective manner. Additionally, we have developed a new quantitative PCR-based assay for precisely determining the number of PCR cycles to perform for optimal enrichment of the final library, a key step in all SGS library preparation workflows.

A fluorescent bimolecular complementation screen reveals MAF1, RNF7 and SETD3 as PCNA-associated proteins in human cells

PubMed Central

Cooper, Simon E; Hodimont, Elsie; Green, Catherine M

2015-01-01

The proliferating cell nuclear antigen (PCNA) is a conserved component of DNA replication factories, and interactions with PCNA mediate the recruitment of many essential DNA replication enzymes to these sites of DNA synthesis. A complete description of the structure and composition of these factories remains elusive, and a better knowledge of them will improve our understanding of how the maintenance of genome and epigenetic stability is achieved. To fully characterize the set of proteins that interact with PCNA we developed a bimolecular fluorescence complementation (BiFC) screen for PCNA-interactors in human cells. This 2-hybrid type screen for interactors from a human cDNA library is rapid and efficient. The fluorescent read-out for protein interaction enables facile selection of interacting clones, and we combined this with next generation sequencing to identify the cDNAs encoding the interacting proteins. This method was able to reproducibly identify previously characterized PCNA-interactors but importantly also identified RNF7, Maf1 and SetD3 as PCNA-interacting proteins. We validated these interactions by co-immunoprecipitation from human cell extracts and by interaction analyses using recombinant proteins. These results show that the BiFC screen is a valuable method for the identification of protein-protein interactions in living mammalian cells. This approach has potentially wide application as it is high throughput and readily automated. We suggest that, given this interaction with PCNA, Maf1, RNF7, and SetD3 are potentially involved in DNA replication, DNA repair, or associated processes. PMID:26030842

Elevation of autoantibody level against PDCD11 in patients with transient ischemic attack

PubMed Central

Yoshida, Yoichi; Wang, Hao; Hiwasa, Takaki; Machida, Toshio; Kobayashi, Eiichi; Mine, Seiichiro; Tomiyoshi, Go; Nakamura, Rika; Shinmen, Natsuko; Kuroda, Hideyuki; Takizawa, Hirotaka; Kashiwado, Koichi; Kamitsukasa, Ikuo; Shin, Hideo; Wada, Takeshi; Aotsuka, Akiyo; Nishi, Eiichiro; Ohno, Mikiko; Takemoto, Minoru; Yokote, Koutaro; Takahashi, Sho; Matsushima, Jun; Zhang, Xiao-Meng; Takiguchi, Masaki; Iwadate, Yasuo

2018-01-01

Background Disease specific autoantibodies have been detected in the sera of patients with atherosclerosis-related diseases, such as cerebral infarction, cardiovascular disease. In the present study, we aimed to identify novel autoantibodies responsible for transient ischemic attack (TIA), a prodromal condition for cerebral infarction. Methods To identify candidate antigens, we screened a human aortic endothelial cell cDNA library using sera from 20 patients with TIA. Serum antibody levels were measured using amplified luminescent proximity homogeneous assay-linked immunosorbent assay (AlphaLISA) in 2 independent patient/healthy donor (HD) cohorts (n = 192 and n = 906 in the second screening and validation cohort, respectively). Results First screening identified 3 candidate antigens. Of these, programmed cell death 11 (PDCD11) was determined to be associated with stroke (p < 0.0001), as evidenced from the second screening using AlphaLISA. The validation cohort revealed significantly higher antibody levels against PDCD11 (PDCD11-Ab levels) in patients with TIA than in HDs. Multivariate logistic regression analysis indicated that the predictive value of PDCD11-Ab levels for TIA [Odds ratio (OR): 2.44, 95% confidence interval (CI): 1.33-4.57, p = 0.0039] was not inferior to other known risk factors for ischemic stroke, including age (OR: 4.97, 95% CI: 2.67–9.48, p < 0.0001); hypertension (OR: 3.21, 95% CI: 1.76–5.86, p = 0.0001); and diabetes (OR: 4.31, 95% CI: 1.74–11.2, p = 0.0015). Conclusion Serum PDCD11-Ab level may serve as a potential biomarker for TIA. PMID:29507658

Interaction proteins of invertase and invertase inhibitor in cold-stored potato tubers suggested a protein complex underlying post-translational regulation of invertase.

PubMed

Lin, Yuan; Liu, Jun; Liu, Xun; Ou, Yongbin; Li, Meng; Zhang, Huiling; Song, Botao; Xie, Conghua

2013-12-01

The activity of vacuolar invertase (VI) is vital to potato cold-induced sweetening (CIS). A post-translational regulation of VI activity has been proposed which involves invertase inhibitor (VIH), but the mechanism for the interaction between VI and VIH has not been fully understood. To identify the potential partners of VI and VIH, two cDNA libraries were respectively constructed from CIS-resistant wild potato species Solanum berthaultii and CIS-sensitive potato cultivar AC035-01 for the yeast two-hybrid analysis. The StvacINV1 (one of the potato VIs) and StInvInh2B (one of the potato VIHs), previously identified to be associated with potato CIS, were used as baits to screen the two libraries. Through positive selection and sequencing, 27 potential target proteins of StvacINV1 and eight of StInvInh2B were clarified. The Kunitz-type protein inhibitors were captured by StvacINV1 in both libraries and the interaction between them was confirmed by bimolecular fluorescence complementation assay in tobacco cells, reinforcing a fundamental interaction between VI and VIH. Notably, a sucrose non-fermenting-1-related protein kinase 1 was captured by both the baits, suggesting that a protein complex could be necessary for fine turning of the invertase activity. The target proteins clarified in present research provide a route to elucidate the mechanism by which the VI activity can be subtly modulated. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Mutations in the glucose-6-phosphatase gene that cause glycogen storage disease type 1a

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, J.Y.; Lei, K.J.; Shelly, L.L.

1994-09-01

Glycogen storage disease (GSD) type la (von Gierke disease) is caused by the deficiency of glucose-6-phosphatase (G6Pase), the key enzyme in glucose homeostasis. The disease presents with clinical manifestations of severe hypoglycemia, hepatomegaly, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. We have succeeded in isolating a murine G6Pase cDNA from a normal mouse liver cDNA library by differentially screening method. We then isolated the human G6Pase cDNA and gene. To date, we have characterized the G6Pase genes of twelve GSD type la patients and uncovered a total of six different mutations. The mutations are comprised of R83C (an Arg atmore » codon 83 to a Cys), Q347X (a Gly at codon 347 to a stop codon), 459insTA (a two basepair insertion at nucleotide 459 yielding a truncated G6Pase of 129 residues), R295C (an Arg at codon 295 to a Cys), G222R (a Gly at codon 222 to an Arg) and {delta}F327 (a codon deletion for Phe-327 at nucleotides 1058 to 1060). The relative incidences of these mutations are 37.5% (R83C), 33.3% (Q347X), 16.6% (459insTA), 4.2% (G222R), 4.2% (R295C) and 4.2% ({delta}F327). Site-directed mutagenesis and transient expression assays demonstrated that the R83C, Q347X, R295C, and {delta}F327 mutations abolished whereas the G222R mutation greatly reduced G6Pase activity. We further characterized the structure-function requirements of amino acids 83, 222, and 295 in G6Pase catalysis. The identification of mutations in GSD type la patients has unequivocally established the molecular basis of the type la disorder. Knowledge of the mutations may be applied to prenatal diagnosis and opens the way for developing and evaluating new therapeutic approaches.« less

A candidate gene for X-linked Ocular Albinism (OA1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bassi, M.T.; Schiaffino, V.; Rugarli, E.

1994-09-01

Ocular Albinism of the Nettleship-Fall type 1 (OA1) is the most common form of ocular albinism. It is transmitted as an X-linked recessive trait with affected males showing severe reduction of visual acuity, nystagmus, strabismus, photophobia. Ophthalmologic examination reveals foveal hypoplasia, hypopigmentation of the retina and iris translucency. Microscopic examination of melanocytes suggests that the underlying defect in OA1 is an abnormality in melanosome formation. Recently we assembled a 350 kb cosmid contig spanning the entire critical region on Xp22.3, which measures approximately 110 kb. A minimum set of cosmids was used to identify transcribed sequences using both cDNA selectionmore » and exon amplification. Two putative exons recovered by exon amplification strategy were found to be highly conserved throughout evolution and, therefore, they were used as probes for the screening of fetal and adult retina cDNA libraries. This led to the isolation of clones spanning a full-length cDNA which measures 7.6 kb. Sequence analysis revealed that the predicted protein product shows homology with syntrophines and a Xenopus laevis apical protein. The gene covers approximately 170 kb of DNA and spans the entire critical region for OA1, being deleted in two patients with contiguous gene deletion including OA1 and in one patient with isolated OA1. Therefore, this new gene represents a very strong candidate for involvement in OA1 (an alternative, but unlikely possibility to be considered is that the true OA1 gene lies within an intron of the former). Northern analysis revealed very high level of expression in retina and melanoma. Unlike most Xp22.3 genes, this gene is conserved in the mouse. We are currently performing SSCP analysis and direct sequencing of exons on DNAs from approximately 60 unrelated patients with OA1 for mutation detection.« less

Analysis of the antibody repertoire of lymphoma patients.

PubMed

Huang, Shaoming; Preuss, Klaus-Dieter; Xie, Xiaoxun; Regitz, Evi; Pfreundschuh, Michael

2002-12-01

Cancer testis or cancer germline antigens (CGA) are promising vaccine candidates because they are expressed only in malignant but not in normal tissues, except for germ cells in the testis. Since non-Hodgkin's lymphomas (NHL) express the known CGA at low frequencies, we aimed at increasing the number of CGA with frequent expression in NHL by screening a cDNA expression library derived from normal testis for reactivity with high-titered IgG antibodies in the sera of lymphoma patients using SEREX, the serological identification of antigens by recombinant cDNA expression cloning. The analysis of 1.6x10(6) clones with the sera of 25 lymphoma patients revealed 42 clones which coded for 23 antigens, 12 of which had already been included in the SEREX databank. Four cDNA clones coded for unknown and 19 for known genes. Three antigens reacted only with the serum by which they had been detected, 9 antigens reacted with the sera of several NHL patients, but not with that of healthy controls, and 11 antigens reacted with both normal and NHL sera. Most of the antigens were ubiquitously expressed. Only HOM-NHL-6, HOM-NHL-8, HOM-NHL-21 and HOM-NHL-23 showed a restricted expression pattern. HOM-NHL-6 and HOM-NHL-8 were homologous to the previously described CGA NY-ESO-1 and HOM-TES-14/SCP-1, respectively. HOM-NHL-21 was expressed in rare cases of lymphomas, but not in normal tissues except for testis and brain, while HOM-NHL-23 appeared to be a testis-specific antigen. In summary, using the antibody repertoire of these 25 NHL patients, no new CGA were detected. The number of CGA detectable by the classical SEREX approach appears to be limited, and novel strategies are necessary to identify antigens that can serve as a vaccine target in a broad spectrum of NHL patients.

Expressed sequence tag analysis of guinea pig (Cavia porcellus) eye tissues for NEIBank

PubMed Central

Simpanya, Mukoma F.; Wistow, Graeme; Gao, James; David, Larry L.; Giblin, Frank J.

2008-01-01

Purpose To characterize gene expression patterns in guinea pig ocular tissues and identify orthologs of human genes from NEIBank expressed sequence tags. Methods RNA was extracted from dissected eye tissues of 2.5-month-old guinea pigs to make three unamplified and unnormalized cDNA libraries in the pCMVSport-6 vector for the lens, retina, and eye minus lens and retina. Over 4,000 clones were sequenced from each library and were analyzed using GRIST for clustering and gene identification. Lens crystallin EST data were validated using two-dimensional electrophoresis (2-DE), matrix assisted laser desorption (MALDI), and electrospray ionization mass spectrometry (ESIMS). Results Combined data from the three libraries generated a total of 6,694 distinctive gene clusters, with each library having between 1,000 and 3,000 clusters. Approximately 60% of the total gene clusters were novel cDNA sequences and had significant homologies to other mammalian sequences in GenBank. Complete cDNA sequences were obtained for many guinea pig lens proteins, including αA/αAinsert-, γN-, and γS-crystallins, lengsin and GRIFIN. The ratio of αA- to αB-crystallin on 2-DE gels was 8: 1 in the lens nucleus and 6.5: 1 in the cortex. Analysis of ESTs, genome sequence, and proteins (by MALDI), did not reveal any evidence for the presence of γD-, γE-, and γF-crystallin in the guinea pig. Predicted masses of many guinea pig lens crystallins were confirmed by ESIMS analysis. For the retina, orthologs of human phototransduction genes were found, such as Rhodopsin, S-antigen (Sag, Arrestin), and Transducin. The guinea-pig ortholog of NRL, a key rod photoreceptor-specific transcription factor, was also represented in EST data. In the ‘rest-of-eye’ library, the most abundant transcripts included decorin and keratin 12, representative of the cornea. Conclusions Genomic analysis of guinea pig eye tissues provides sequence-verified clones for future studies. Guinea pig orthologs of many human eye specific genes were identified. Guinea pig gene structures were similar to their human and rodent gene counterparts. Surprisingly, no orthologs of γD-, γE-, and γF-crystallin were found in EST, proteomic, or the current guinea pig genome data. PMID:19104676

Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.

PubMed Central

Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E

1987-01-01

We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

[Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

PubMed

Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

2006-05-01

Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

Selecting, Acquiring, and Using Small Molecule Libraries for High-Throughput Screening

PubMed Central

Dandapani, Sivaraman; Rosse, Gerard; Southall, Noel; Salvino, Joseph M.; Thomas, Craig J.

2015-01-01

The selection, acquisition and use of high quality small molecule libraries for screening is an essential aspect of drug discovery and chemical biology programs. Screening libraries continue to evolve as researchers gain a greater appreciation of the suitability of small molecules for specific biological targets, processes and environments. The decisions surrounding the make-up of any given small molecule library is informed by a multitude of variables and opinions vary on best-practices. The fitness of any collection relies upon upfront filtering to avoiding problematic compounds, assess appropriate physicochemical properties, install the ideal level of structural uniqueness and determine the desired extent of molecular complexity. These criteria are under constant evaluation and revision as academic and industrial organizations seek out collections that yield ever improving results from their screening portfolios. Practical questions including cost, compound management, screening sophistication and assay objective also play a significant role in the choice of library composition. This overview attempts to offer advice to all organizations engaged in small molecule screening based upon current best practices and theoretical considerations in library selection and acquisition. PMID:26705509

Selecting, Acquiring, and Using Small Molecule Libraries for High-Throughput Screening.

PubMed

Dandapani, Sivaraman; Rosse, Gerard; Southall, Noel; Salvino, Joseph M; Thomas, Craig J

The selection, acquisition and use of high quality small molecule libraries for screening is an essential aspect of drug discovery and chemical biology programs. Screening libraries continue to evolve as researchers gain a greater appreciation of the suitability of small molecules for specific biological targets, processes and environments. The decisions surrounding the make-up of any given small molecule library is informed by a multitude of variables and opinions vary on best-practices. The fitness of any collection relies upon upfront filtering to avoiding problematic compounds, assess appropriate physicochemical properties, install the ideal level of structural uniqueness and determine the desired extent of molecular complexity. These criteria are under constant evaluation and revision as academic and industrial organizations seek out collections that yield ever improving results from their screening portfolios. Practical questions including cost, compound management, screening sophistication and assay objective also play a significant role in the choice of library composition. This overview attempts to offer advice to all organizations engaged in small molecule screening based upon current best practices and theoretical considerations in library selection and acquisition.

Identifying differentially expressed genes in leaves of Glycine tomentella in the presence of the fungal pathogen Phakopsora pachyrhizi

USDA-ARS?s Scientific Manuscript database

Transcription profiles of Glycine tomentella genotypes having different responses to soybean rust, caused by the fungal pathogen Phakopsora pachyrhizi, were compared using suppression subtractive hybridization (SSH). Four cDNA libraries were constructed from infected and non-infected leaves of resis...

Identification of genes differentially expressed during ripening of banana.

PubMed

Manrique-Trujillo, Sandra Mabel; Ramírez-López, Ana Cecilia; Ibarra-Laclette, Enrique; Gómez-Lim, Miguel Angel

2007-08-01

The banana (Musa acuminata, subgroup Cavendish 'Grand Nain') is a climacteric fruit of economic importance. A better understanding of the banana ripening process is needed to improve fruit quality and to extend shelf life. Eighty-four up-regulated unigenes were identified by differential screening of a banana fruit cDNA subtraction library at a late ripening stage. The ripening stages in this study were defined according to the peel color index (PCI). Unigene sequences were analyzed with different databases to assign a putative identification. The expression patterns of 36 transcripts confirmed as positive by differential screening were analyzed comparing the PCI 1, PCI 5 and PCI 7 ripening stages. Expression profiles were obtained for unigenes annotated as orcinol O-methyltransferase, putative alcohol dehydrogenase, ubiquitin-protein ligase, chorismate mutase and two unigenes with non-significant matches with any reported sequence. Similar expression profiles were observed in banana pulp and peel. Our results show differential expression of a group of genes involved in processes associated with fruit ripening, such as stress, detoxification, cytoskeleton and biosynthesis of volatile compounds. Some of the identified genes had not been characterized in banana fruit. Besides providing an overview of gene expression programs and metabolic pathways at late stages of banana fruit ripening, this study contributes to increasing the information available on banana fruit ESTs.

Determination of a Screening Metric for High Diversity DNA Libraries.

PubMed

Guido, Nicholas J; Handerson, Steven; Joseph, Elaine M; Leake, Devin; Kung, Li A

2016-01-01

The fields of antibody engineering, enzyme optimization and pathway construction rely increasingly on screening complex variant DNA libraries. These highly diverse libraries allow researchers to sample a maximized sequence space; and therefore, more rapidly identify proteins with significantly improved activity. The current state of the art in synthetic biology allows for libraries with billions of variants, pushing the limits of researchers' ability to qualify libraries for screening by measuring the traditional quality metrics of fidelity and diversity of variants. Instead, when screening variant libraries, researchers typically use a generic, and often insufficient, oversampling rate based on a common rule-of-thumb. We have developed methods to calculate a library-specific oversampling metric, based on fidelity, diversity, and representation of variants, which informs researchers, prior to screening the library, of the amount of oversampling required to ensure that the desired fraction of variant molecules will be sampled. To derive this oversampling metric, we developed a novel alignment tool to efficiently measure frequency counts of individual nucleotide variant positions using next-generation sequencing data. Next, we apply a method based on the "coupon collector" probability theory to construct a curve of upper bound estimates of the sampling size required for any desired variant coverage. The calculated oversampling metric will guide researchers to maximize their efficiency in using highly variant libraries.

The Mathematics of a Successful Deconvolution: A Quantitative Assessment of Mixture-Based Combinatorial Libraries Screened Against Two Formylpeptide Receptors

PubMed Central

Santos, Radleigh G.; Appel, Jon R.; Giulianotti, Marc A.; Edwards, Bruce S.; Sklar, Larry A.; Houghten, Richard A.; Pinilla, Clemencia

2014-01-01

In the past 20 years, synthetic combinatorial methods have fundamentally advanced the ability to synthesize and screen large numbers of compounds for drug discovery and basic research. Mixture-based libraries and positional scanning deconvolution combine two approaches for the rapid identification of specific scaffolds and active ligands. Here we present a quantitative assessment of the screening of 32 positional scanning libraries in the identification of highly specific and selective ligands for two formylpeptide receptors. We also compare and contrast two mixture-based library approaches using a mathematical model to facilitate the selection of active scaffolds and libraries to be pursued for further evaluation. The flexibility demonstrated in the differently formatted mixture-based libraries allows for their screening in a wide range of assays. PMID:23722730

Next-generation libraries for robust RNA interference-based genome-wide screens

PubMed Central

Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

2015-01-01

Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction.

PubMed

Townsley, Brad T; Covington, Michael F; Ichihashi, Yasunori; Zumstein, Kristina; Sinha, Neelima R

2015-01-01

Next Generation Sequencing (NGS) is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq) has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing the terminal breathing of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq) reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE) libraries and can easily extend to full transcript coverage shotgun (SHO) type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries.

Rational and random mutagenesis of firefly luciferase to identify an efficient emitter of red bioluminescence

NASA Astrophysics Data System (ADS)

Branchini, Bruce R.; Southworth, Tara L.; Khattak, Neelum F.; Murtiashaw, Martha H.; Fleet, Sarah E.

2004-06-01

Firefly luciferase, which emits yellow-green (557 nm) light, and the corresponding cDNA have been used successfully as a bioluminescence reporter of gene expression. One particularly exciting application is in the area of in vivo bioluminescence imaging. Our interest is in developing improved reagents by identifying Photinus pyralis luciferase mutants that efficiently emit red bioluminescence. In this way, the proven advantages of the P. pyralis protein can be combined with the potential advantages of a red-shifted emitter. Using site-directed mutagenesis techniques, we have identified many mutants emitting red bioluminescence. Unfortunately, these enzymes generally have significantly decreased bioluminescence activity. Interestingly, we discovered a mutation, Ile351Ala, that produced a moderate 16 nm red-shift, while maintaining excellent bioluminescence activity. We then undertook a random mutagenesis approach to identify luciferase mutants that emit further red-shifted bioluminescence with minimal loss of activity. Libraries of mutants were created using an error-prone PCR method and the Ile351Ala luciferase mutant as the template DNA. The libraries were screened by in vivo bacterial assays and the promising mutants were purified to enable accurate determination of bioluminescence emission spectra and total bioluminescence activity. We will report the characterization results, including the identification of the randomly altered amino acids, of several mutants that catalyze bioluminescence with emission maxima of approximately 600 nm.

Evaluation and Design of Genome-Wide CRISPR/SpCas9 Knockout Screens

PubMed Central

Hart, Traver; Tong, Amy Hin Yan; Chan, Katie; Van Leeuwen, Jolanda; Seetharaman, Ashwin; Aregger, Michael; Chandrashekhar, Megha; Hustedt, Nicole; Seth, Sahil; Noonan, Avery; Habsid, Andrea; Sizova, Olga; Nedyalkova, Lyudmila; Climie, Ryan; Tworzyanski, Leanne; Lawson, Keith; Sartori, Maria Augusta; Alibeh, Sabriyeh; Tieu, David; Masud, Sanna; Mero, Patricia; Weiss, Alexander; Brown, Kevin R.; Usaj, Matej; Billmann, Maximilian; Rahman, Mahfuzur; Costanzo, Michael; Myers, Chad L.; Andrews, Brenda J.; Boone, Charles; Durocher, Daniel; Moffat, Jason

2017-01-01

The adaptation of CRISPR/SpCas9 technology to mammalian cell lines is transforming the study of human functional genomics. Pooled libraries of CRISPR guide RNAs (gRNAs) targeting human protein-coding genes and encoded in viral vectors have been used to systematically create gene knockouts in a variety of human cancer and immortalized cell lines, in an effort to identify whether these knockouts cause cellular fitness defects. Previous work has shown that CRISPR screens are more sensitive and specific than pooled-library shRNA screens in similar assays, but currently there exists significant variability across CRISPR library designs and experimental protocols. In this study, we reanalyze 17 genome-scale knockout screens in human cell lines from three research groups, using three different genome-scale gRNA libraries. Using the Bayesian Analysis of Gene Essentiality algorithm to identify essential genes, we refine and expand our previously defined set of human core essential genes from 360 to 684 genes. We use this expanded set of reference core essential genes, CEG2, plus empirical data from six CRISPR knockout screens to guide the design of a sequence-optimized gRNA library, the Toronto KnockOut version 3.0 (TKOv3) library. We then demonstrate the high effectiveness of the library relative to reference sets of essential and nonessential genes, as well as other screens using similar approaches. The optimized TKOv3 library, combined with the CEG2 reference set, provide an efficient, highly optimized platform for performing and assessing gene knockout screens in human cell lines. PMID:28655737

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

Construction and characterization of normalized cDNA libraries by 454 pyrosequencing and estimation of DNA methylation levels in three distantly related termite species.

PubMed

Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

2013-01-01

In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.

Construction and Characterization of Normalized cDNA Libraries by 454 Pyrosequencing and Estimation of DNA Methylation Levels in Three Distantly Related Termite Species

PubMed Central

Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

2013-01-01

In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800

Quantitative screening of yeast surface-displayed polypeptide libraries by magnetic bead capture.

PubMed

Yeung, Yik A; Wittrup, K Dane

2002-01-01

Magnetic bead capture is demonstrated here to be a feasible alternative for quantitative screening of favorable mutants from a cell-displayed polypeptide library. Flow cytometric sorting with fluorescent probes has been employed previously for high throughput screening for either novel binders or improved mutants. However, many laboratories do not have ready access to this technology as a result of the limited availability and high cost of cytometers, restricting the use of cell-displayed libraries. Using streptavidin-coated magnetic beads and biotinylated ligands, an alternative approach to cell-based library screening for improved mutants was developed. Magnetic bead capture probability of labeled cells is shown to be closely correlated with the surface ligand density. A single-pass enrichment ratio of 9400 +/- 1800-fold, at the expense of 85 +/- 6% binder losses, is achieved from screening a library that contains one antibody-displaying cell (binder) in 1.1 x 10(5) nondisplaying cells. Additionally, kinetic screening for an initial high affinity to low affinity (7.7-fold lower) mutant ratio of 1:95,000, the magnetic bead capture method attains a single-pass enrichment ratio of 600 +/- 200-fold with a 75 +/- 24% probability of loss for the higher affinity mutant. The observed high loss probabilities can be straightforwardly compensated for by library oversampling, given the inherently parallel nature of the screen. Overall, these results demonstrate that magnetic beads are capable of quantitatively screening for novel binders and improved mutants. The described methods are directly analogous to procedures in common use for phage display and should lower the barriers to entry for use of cell surface display libraries.

cDNA Microarray Screening in Food Safety

PubMed Central

ROY, SASHWATI; SEN, CHANDAN K

2009-01-01

The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests. PMID:16466843

Microarray analysis identified Puccinia striiformis f. sp. tritici genes involved in infection and sporulation.

USDA-ARS?s Scientific Manuscript database

Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...

A database of expressed genes from the new world screwworm, Cochliomyia hominivorax (Coquerel) (Diptera: Calliphoridae)

USDA-ARS?s Scientific Manuscript database

We used an expressed sequence tag and 454 pyrosequencing approach to initiate a study of the genome of the New World Screwworm, Cochliomyia hominivorax (Coquerel). Two normalized cDNA libraries were constructed from RNA isolated from embryos and 2nd instar larvae from the Panama 95 strain. Approxima...

DNA sequences of Pima (Gossypium barbadense L.) cotton leaf for examining transcriptome diversity and SNP biomarker discovery

USDA-ARS?s Scientific Manuscript database

As an initial step to explore the transcriptome genetic diversity and to discover single nucleotide polymorphic (SNP)-biomarkers for marker assisted breeding within Pima (Gossypium barbadense L.) cotton, leaves from 25 day plants of three diverse genotypes were used to develop cDNA libraries. Using ...

A novel protein involved in heart development in Ambystoma mexicanum is localized in endoplasmic reticulum.

PubMed

Jia, P; Zhang, C; Huang, X P; Poda, M; Akbas, F; Lemanski, S L; Erginel-Unaltuna, N; Lemanski, L F

2008-11-01

The discovery of the naturally occurring cardiac non-function (c) animal strain in Ambystoma mexicanum (axolotl) provides a valuable animal model to study cardiomyocyte differentiation. In homozygous mutant animals (c/c), rhythmic contractions of the embryonic heart are absent due to a lack of organized myofibrils. We have previously cloned a partial sequence of a peptide cDNA (N1) from an anterior-endoderm-conditioned-medium RNA library that had been shown to be able to rescue the mutant phenotype. In the current studies we have fully cloned the N1 full length cDNA sequence from the library. N1 protein has been detected in both adult heart and skeletal muscle but not in any other adult tissues. GFP-tagged expression of the N1 protein has revealed localization of the N1 protein in the endoplasmic reticulum (ER). Results from in situ hybridization experiments have confirmed the dramatic decrease of expression of N1 mRNA in mutant (c/c) embryos indicating that the N1 gene is involved in heart development.

Identification and characterization of antimicrobial peptide, defensin, in the taiga tick, Ixodes persulcatus.

PubMed

Saito, Y; Konnai, S; Yamada, S; Imamura, S; Nishikado, H; Ito, T; Onuma, M; Ohashi, K

2009-08-01

Ixodes persulcatus is the primary vector for human tick-borne diseases in Japan. A cDNA library was constructed from whole body homogenates of fed nymphs of I. persulcatus. From this library, one cDNA encoding defensin-like antimicrobial peptide was identified. The amino-acid sequence showed high similarity to those of the defensins of other ticks and arthropods. I. persulcatus defensin mRNA transcripts were detected at all life cycle stages of fed ticks and found to be predominantly expressed in the midguts of adult female ticks, but not in the salivary glands, a finding corroborated by Western blotting analysis. To investigate the function of I. persulcatus defensin, we examined its antibacterial activity by evaluation of growth of several bacterial strains in the presence of the synthetic peptide. The defensin from I. persulcatus markedly inhibited the growth of Gram-positive bacteria including Staphylococcus aureus, Bacillus subtilis and Corynebacterium renale, but not Gram-negative bacteria except Escherichia coli O157. In conclusion, these results suggest that I. persulcatus defensin may be playing a significant role in the defence against microbes from bloodmeals.

Expressed sequence tags (ESTs) and phylogenetic analysis of floral genes from a paleoherb species, Asarum caudigerum.

PubMed

Zhao, Yinhe; Wang, Guoying; Zhang, Jinpeng; Yang, Junbo; Peng, Shang; Gao, Lianming; Li, Chengyun; Hu, Jinyong; Li, Dezhu; Gao, Lizhi

2006-07-01

Asarum caudigerum (Aristolochiaceae) is an important species of paleoherb in relation to understanding the origin and evolution of angiosperm flowers, due to its basal position in the angiosperms. The aim of this study was to isolate floral-related genes from A. caudigerum, and to infer evolutionary relationships among florally expression-related genes, to further illustrate the origin and diversification of flowers in angiosperms. A subtracted floral cDNA library was constructed from floral buds using suppression subtractive hybridization (SSH). The cDNA of floral buds and leaves at the seedling stage were used as a tester and a driver, respectively. To further identify the function of putative MADS-box transcription factors, phylogenetic trees were reconstructed in order to infer evolutionary relationships within the MADS-box gene family. In the forward-subtracted floral cDNA library, 1920 clones were randomly sequenced, from which 567 unique expressed sequence tags (ESTs) were obtained. Among them, 127 genes failed to show significant similarity to any published sequences in GenBank and thus are putatively novel genes. Phylogenetic analysis indicated that a total of 29 MADS-box transcription factors were members of the APETALA3(AP3) subfamily, while nine others were putative MADS-box transcription factors that formed a cluster with MADS-box genes isolated from Amborella, the basal-most angiosperm, and those from the gymnosperms. This suggests that the origin of A. caudigerum is intermediate between the angiosperms and gymnosperms.

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

PubMed

Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

1999-10-06

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

Heterologous Array Analysis in Pinaceae: Hybridization of Pinus Taeda cDNA Arrays With cDNA From Needles and Embryogenic Cultures of P. Taeda, P. Sylvestris or Picea Abies

PubMed Central

van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov

2002-01-01

Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Transcription profiling using RNA-Seq demonstrates expression differences in the body walls of juvenile albino and normal sea cucumbers Apostichopus japonicus

NASA Astrophysics Data System (ADS)

Ma, Deyou; Yang, Hongsheng; Sun, Lina; Chen, Muyan

2014-01-01

Sea cucumbers Apostichopus japonicus are one of the most important aquaculture species in China. Their normal body color is black to fit their surroundings. Wild albinos are rare and hard to breed. To understand the differences between albino and normal (control) sea cucumbers at the transcriptional level, we sequenced the transcriptomes in their body-wall tissues using RNA-Seq high-throughput sequencing. Approximately 4.876 million (M) and 4.884 M 200-nucleotide-long cDNA reads were produced in the cDNA libraries derived from the body walls of albino and control samples, respectively. A total of 9 561 (46.89%) putative genes were identified from among the RNA-Seq reads in both libraries. After filtering, 837 significantly differentially regulated genes were identified in the albino library compared with in the control library, and 3.6% of the differentially expressed genes (DEGs) were found to have changed those more than five-fold. The expression levels of 10 DEGs were checked by real-time PCR and the results were in full accord with the RNA-Seq expression trends, although the amplitude of the differences in expression levels was lower in all cases. A series of pathways were significantly enriched for the DEGs. These pathways were closely related to phagocytosis, the complement and coagulation cascades, apoptosis-related diseases, cytokine-cytokine receptor interaction, and cell adhesion. The differences in gene expression and enriched pathways between the albino and control sea cucumbers offer control targets for cultivating excellent albino A. japonicus strains in the future.

Construction of a full-length cDNA Library from Chinese oak silkworm pupa and identification of a KK-42-binding protein gene in relation to pupa-diapause termination.

PubMed

Li, Yu-Ping; Xia, Run-Xi; Wang, Huan; Li, Xi-Sheng; Liu, Yan-Qun; Wei, Zhao-Jun; Lu, Cheng; Xiang, Zhong-Huai

2009-06-24

In this study we successfully constructed a full-length cDNA library from Chinese oak silkworm, Antheraea pernyi, the most well-known wild silkworm used for silk production and insect food. Total RNA was extracted from a single fresh female pupa at the diapause stage. The titer of the library was 5 x 10(5) cfu/ml and the proportion of recombinant clones was approximately 95%. Expressed sequence tag (EST) analysis was used to characterize the library. A total of 175 clustered ESTs consisting of 24 contigs and 151 singlets were generated from 250 effective sequences. Of the 175 unigenes, 97 (55.4%) were known genes but only five from A. pernyi, 37 (21.2%) were known ESTs without function annotation, and 41 (23.4%) were novel ESTs. By EST sequencing, a gene coding KK-42-binding protein in A. pernyi (named as ApKK42-BP; GenBank accession no. FJ744151) was identified and characterized. Protein sequence analysis showed that ApKK42-BP was not a membrane protein but an extracellular protein with a signal peptide at position 1-18, and contained two putative conserved domains, abhydro_lipase and abhydrolase_1, suggesting it may be a member of lipase superfamily. Expression analysis based on number of ESTs showed that ApKK42-BP was an abundant gene in the period of diapause stage, suggesting it may also be involved in pupa-diapause termination.

Construction of a full-length cDNA Library from Chinese oak silkworm pupa and identification of a KK-42-binding protein gene in relation to pupa-diapause termination

PubMed Central

Li, Yu-Ping; Xia, Run-Xi; Wang, Huan; Li, Xi-Sheng; Liu, Yan-Qun; Wei, Zhao-Jun; Lu, Cheng; Xiang, Zhong-Huai

2009-01-01

In this study we successfully constructed a full-length cDNA library from Chinese oak silkworm, Antheraea pernyi, the most well-known wild silkworm used for silk production and insect food. Total RNA was extracted from a single fresh female pupa at the diapause stage. The titer of the library was 5 × 105 cfu/ml and the proportion of recombinant clones was approximately 95%. Expressed sequence tag (EST) analysis was used to characterize the library. A total of 175 clustered ESTs consisting of 24 contigs and 151 singlets were generated from 250 effective sequences. Of the 175 unigenes, 97 (55.4%) were known genes but only five from A. pernyi, 37 (21.2%) were known ESTs without function annotation, and 41 (23.4%) were novel ESTs. By EST sequencing, a gene coding KK-42-binding protein in A. pernyi (named as ApKK42-BP; GenBank accession no. FJ744151) was identified and characterized. Protein sequence analysis showed that ApKK42-BP was not a membrane protein but an extracellular protein with a signal peptide at position 1-18, and contained two putative conserved domains, abhydro_lipase and abhydrolase_1, suggesting it may be a member of lipase superfamily. Expression analysis based on number of ESTs showed that ApKK42-BP was an abundant gene in the period of diapause stage, suggesting it may also be involved in pupa-diapause termination. PMID:19564928

The Relative Abundance and Transcriptional Activity of Marine Sponge-Associated Microorganisms Emphasizing Groups Involved in Sulfur Cycle.

PubMed

Jensen, Sigmund; Fortunato, Sofia A V; Hoffmann, Friederike; Hoem, Solveig; Rapp, Hans Tore; Øvreås, Lise; Torsvik, Vigdis L

2017-04-01

During the last decades, our knowledge about the activity of sponge-associated microorganisms and their contribution to biogeochemical cycling has gradually increased. Functional groups involved in carbon and nitrogen metabolism are well documented, whereas knowledge about microorganisms involved in the sulfur cycle is still limited. Both sulfate reduction and sulfide oxidation has been detected in the cold water sponge Geodia barretti from Korsfjord in Norway, and with specimens from this site, the present study aims to identify extant versus active sponge-associated microbiota with focus on sulfur metabolism. Comparative analysis of small subunit ribosomal RNA (16S rRNA) gene (DNA) and transcript (complementary DNA (cDNA)) libraries revealed profound differences. The transcript library was predominated by Chloroflexi despite their low abundance in the gene library. An opposite result was found for Acidobacteria. Proteobacteria were detected in both libraries with representatives of the Alpha- and Gammaproteobacteria related to clades with presumably thiotrophic bacteria from sponges and other marine invertebrates. Sequences that clustered with sponge-associated Deltaproteobacteria were remotely related to cultivated sulfate-reducing bacteria. The microbes involved in sulfur cycling were identified by the functional gene aprA (adenosine-5'-phosphosulfate reductase) and its transcript. Of the aprA sequences (DNA and cDNA), 87 % affiliated with sulfur-oxidizing bacteria. They clustered with Alphaproteobacteria and with clades of deep-branching Gammaproteobacteria. The remaining sequences clustered with sulfate-reducing Archaea of the phylum Euryarchaeota. These results indicate an active role of yet uncharacterized Bacteria and Archaea in the sponge's sulfur cycle.

Wide screening of phage-displayed libraries identifies immune targets in planta.

PubMed

Rioja, Cristina; Van Wees, Saskia C; Charlton, Keith A; Pieterse, Corné M J; Lorenzo, Oscar; García-Sánchez, Susana

2013-01-01

Microbe-Associated Molecular Patterns and virulence effectors are recognized by plants as a first step to mount a defence response against potential pathogens. This recognition involves a large family of extracellular membrane receptors and other immune proteins located in different sub-cellular compartments. We have used phage-display technology to express and select for Arabidopsis proteins able to bind bacterial pathogens. To rapidly identify microbe-bound phage, we developed a monitoring method based on microarrays. This combined strategy allowed for a genome-wide screening of plant proteins involved in pathogen perception. Two phage libraries for high-throughput selection were constructed from cDNA of plants infected with Pseudomonas aeruginosa PA14, or from combined samples of the virulent isolate DC3000 of Pseudomonas syringae pv. tomato and its avirulent variant avrRpt2. These three pathosystems represent different degrees in the specificity of plant-microbe interactions. Libraries cover up to 2 × 10(7) different plant transcripts that can be displayed as functional proteins on the surface of T7 bacteriophage. A number of these were selected in a bio-panning assay for binding to Pseudomonas cells. Among the selected clones we isolated the ethylene response factor ATERF-1, which was able to bind the three bacterial strains in competition assays. ATERF-1 was rapidly exported from the nucleus upon infiltration of either alive or heat-killed Pseudomonas. Moreover, aterf-1 mutants exhibited enhanced susceptibility to infection. These findings suggest that ATERF-1 contains a microbe-recognition domain with a role in plant defence. To identify other putative pathogen-binding proteins on a genome-wide scale, the copy number of selected-vs.-total clones was compared by hybridizing phage cDNAs with Arabidopsis microarrays. Microarray analysis revealed a set of 472 candidates with significant fold change. Within this set defence-related genes, including well-known targets of bacterial effectors, are over-represented. Other genes non-previously related to defence can be associated through this study with general or strain-specific recognition of Pseudomonas.

Sequence and pattern of expression of a bovine homologue of a human mitochondrial transport protein associated with Grave's disease.

PubMed

Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F

1992-01-01

A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hev ein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

CDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection.

PubMed

Yi, S Y; Yu, S H; Choi, D

1999-06-30

Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.

Transcriptome Analysis in Venom Gland of the Predatory Giant Ant Dinoponera quadriceps: Insights into the Polypeptide Toxin Arsenal of Hymenopterans

PubMed Central

Chong, Cheong-Meng; Leung, Siu Wai; Prieto-da-Silva, Álvaro R. B.; Havt, Alexandre; Quinet, Yves P.; Martins, Alice M. C.; Lee, Simon M. Y.; Rádis-Baptista, Gandhi

2014-01-01

Background Dinoponera quadriceps is a predatory giant ant that inhabits the Neotropical region and subdues its prey (insects) with stings that deliver a toxic cocktail of molecules. Human accidents occasionally occur and cause local pain and systemic symptoms. A comprehensive study of the D. quadriceps venom gland transcriptome is required to advance our knowledge about the toxin repertoire of the giant ant venom and to understand the physiopathological basis of Hymenoptera envenomation. Results We conducted a transcriptome analysis of a cDNA library from the D. quadriceps venom gland with Sanger sequencing in combination with whole-transcriptome shotgun deep sequencing. From the cDNA library, a total of 420 independent clones were analyzed. Although the proportion of dinoponeratoxin isoform precursors was high, the first giant ant venom inhibitor cysteine-knot (ICK) toxin was found. The deep next generation sequencing yielded a total of 2,514,767 raw reads that were assembled into 18,546 contigs. A BLAST search of the assembled contigs against non-redundant and Swiss-Prot databases showed that 6,463 contigs corresponded to BLASTx hits and indicated an interesting diversity of transcripts related to venom gene expression. The majority of these venom-related sequences code for a major polypeptide core, which comprises venom allergens, lethal-like proteins and esterases, and a minor peptide framework composed of inter-specific structurally conserved cysteine-rich toxins. Both the cDNA library and deep sequencing yielded large proportions of contigs that showed no similarities with known sequences. Conclusions To our knowledge, this is the first report of the venom gland transcriptome of the New World giant ant D. quadriceps. The glandular venom system was dissected, and the toxin arsenal was revealed; this process brought to light novel sequences that included an ICK-folded toxins, allergen proteins, esterases (phospholipases and carboxylesterases), and lethal-like toxins. These findings contribute to the understanding of the ecology, behavior and venomics of hymenopterans. PMID:24498135

Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiktorowicz, J.E.; Whitman, J.M.

1986-05-01

Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

High throughput screening using acoustic droplet ejection to combine protein crystals and chemical libraries on crystallization plates at high density

DOE PAGES

Teplitsky, Ella; Joshi, Karan; Ericson, Daniel L.; ...

2015-07-01

We describe a high throughput method for screening up to 1728 distinct chemicals with protein crystals on a single microplate. Acoustic droplet ejection (ADE) was used to co-position 2.5 nL of protein, precipitant, and chemicals on a MiTeGen in situ-1 crystallization plate™ for screening by co-crystallization or soaking. ADE-transferred droplets follow a precise trajectory which allows all components to be transferred through small apertures in the microplate lid. The apertures were large enough for 2.5 nL droplets to pass through them, but small enough so that they did not disrupt the internal environment created by the mother liquor. Using thismore » system, thermolysin and trypsin crystals were efficiently screened for binding to a heavy-metal mini-library. Fluorescence and X-ray diffraction were used to confirm that each chemical in the heavy-metal library was correctly paired with the intended protein crystal. Moreover, a fragment mini-library was screened to observe two known lysozyme We describe a high throughput method for screening up to 1728 distinct chemicals with protein crystals on a single microplate. Acoustic droplet ejection (ADE) was used to co-position 2.5 nL of protein, precipitant, and chemicals on a MiTeGen in situ-1 crystallization plate™ for screening by co-crystallization or soaking. ADE-transferred droplets follow a precise trajectory which allows all components to be transferred through small apertures in the microplate lid. The apertures were large enough for 2.5 nL droplets to pass through them, but small enough so that they did not disrupt the internal environment created by the mother liquor. Using this system, thermolysin and trypsin crystals were efficiently screened for binding to a heavy-metal mini-library. Fluorescence and X-ray diffraction were used to confirm that each chemical in the heavy-metal library was correctly paired with the intended protein crystal. A fragment mini-library was screened to observe two known lysozyme ligands using both co-crystallization and soaking. A similar approach was used to identify multiple, novel thaumatin binding sites for ascorbic acid. This technology pushes towards a faster, automated, and more flexible strategy for high throughput screening of chemical libraries (such as fragment libraries) using as little as 2.5 nL of each component.ds using both co-crystallization and soaking. We used a A similar approach to identify multiple, novel thaumatin binding sites for ascorbic acid. This technology pushes towards a faster, automated, and more flexible strategy for high throughput screening of chemical libraries (such as fragment libraries) using as little as 2.5 nL of each component.« less

Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

PubMed Central

Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

2011-01-01

To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

The midgut transcriptome of Lutzomyia longipalpis: comparative analysis of cDNA libraries from sugar-fed, blood-fed, post-digested and Leishmania infantum chagasi-infected sand flies.

PubMed

Jochim, Ryan C; Teixeira, Clarissa R; Laughinghouse, Andre; Mu, Jianbing; Oliveira, Fabiano; Gomes, Regis B; Elnaiem, Dia-Eldin; Valenzuela, Jesus G

2008-01-14

In the life cycle of Leishmania within the alimentary canal of sand flies the parasites have to survive the hostile environment of blood meal digestion, escape the blood bolus and attach to the midgut epithelium before differentiating into the infective metacyclic stages. The molecular interactions between the Leishmania parasites and the gut of the sand fly are poorly understood. In the present work we sequenced five cDNA libraries constructed from midgut tissue from the sand fly Lutzomyia longipalpis and analyzed the transcripts present following sugar feeding, blood feeding and after the blood meal has been processed and excreted, both in the presence and absence of Leishmania infantum chagasi. Comparative analysis of the transcripts from sugar-fed and blood-fed cDNA libraries resulted in the identification of transcripts differentially expressed during blood feeding. This included upregulated transcripts such as four distinct microvillar-like proteins (LuloMVP1, 2, 4 and 5), two peritrophin like proteins, a trypsin like protein (Lltryp1), two chymotrypsin like proteins (LuloChym1A and 2) and an unknown protein. Downregulated transcripts by blood feeding were a microvillar-like protein (LuloMVP3), a trypsin like protein (Lltryp2) and an astacin-like metalloprotease (LuloAstacin). Furthermore, a comparative analysis between blood-fed and Leishmania infected midgut cDNA libraries resulted in the identification of the transcripts that were differentially expressed due to the presence of Leishmania in the gut of the sand fly. This included down regulated transcripts such as four microvillar-like proteins (LuloMVP1,2, 4 and 5), a Chymotrypsin (LuloChym1A) and a carboxypeptidase (LuloCpepA1), among others. Upregulated midgut transcripts in the presence of Leishmania were a peritrophin like protein (LuloPer1), a trypsin-like protein (Lltryp2) and an unknown protein. This transcriptome analysis represents the largest set of sequence data reported from a specific sand fly tissue and provides further information of the transcripts present in the sand fly Lutzomyia longipalpis. This analysis provides the detailed information of molecules present in the midgut of this sand fly and the transcripts potentially modulated by blood feeding and by the presence of the Leishmania parasite. More importantly, this analysis suggests that Leishmania infantum chagasi alters the expression profile of certain midgut transcripts in the sand fly during blood meal digestion and that this modulation may be relevant for the survival and establishment of the parasite in the gut of the fly. Moreover, this analysis suggests that these changes may be occurring during the digestion of the blood meal and not afterwards.

The Missing Link in Leguminous Pterocarpan Biosynthesis is a Dirigent Domain-Containing Protein with Isoflavanol Dehydratase Activity

PubMed Central

Uchida, Kai; Akashi, Tomoyoshi

2017-01-01

Pterocarpan forms the basic structure of leguminous phytoalexins, and most of the isoflavonoid pathway genes encoding the enzymes responsible for its biosynthesis have been identified. However, the last step of pterocarpan biosynthesis is a ring closure reaction, and the enzyme that catalyzes this step, 2′-hydroxyisoflavanol 4,2′-dehydratase or pterocarpan synthase (PTS), remains as an unidentified ‘missing link’. This last ring formation is assumed to be the key step in determining the stereochemistry of pterocarpans, which plays a role in their antimicrobial activity. In this study, a cDNA clone encoding PTS from Glycyrrhiza echinata (GePTS1) was identified through functional expression fractionation screening of a cDNA library, which requires no sequence information, and orthologs from soybean (GmPTS1) and Lotus japonicus (LjPTS1) were also identified. These proteins were heterologously expressed in Escherichia coli and biochemically characterized. Surprisingly, the proteins were found to include amino acid motifs characteristic of dirigent proteins, some of which control stereospecific phenoxy radical coupling in lignan biosynthesis. The stereospecificity of substrates and products was examined using four substrate stereoisomers with hydroxy and methoxy derivatives at C-4′. The results showed that the 4R configuration was essential for the PTS reaction, and (−)- and (+)-pterocarpans were produced depending on the stereochemistry at C-3. In suspension-cultured soybean cells, levels of the GmPTS1 transcript increased temporarily prior to the peak in phytoalexin accumulation, strongly supporting the possible involvement of PTS in pterocarpan biosynthesis. PMID:28394400

Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.

PubMed

Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun

2015-12-01

Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Homologous expression of a mutated beta-tubulin gene does not confer benomyl resistance on Trichoderma virens.

PubMed

Mukherjee, M; Hadar, R; Mukherjee, P K; Horwitz, B A

2003-01-01

To clone the beta-tubulins and to induce resistance to benzimidazoles in the biocontrol fungus Trichoderma virens through site-directed mutagenesis. Two beta-tubulin genes have been cloned using PCR amplification followed by the screening of a T. virens cDNA library. The full-length cDNA clones, coding for 445 and 446 amino acids, have been designated as T. virens tub1 and T. virens tub2. A sequence alignment of these two tubulins with tubulins from other filamentous fungi has shown the presence of some unique amino acid sequences not found in those positions in other beta-tubulins. Constitutive expression of the tub2 gene with a histidine to tyrosine substitution at position 6 (known to impart benomyl/methyl benzimadazol-2-yl carbamate resistance in other fungi), under the Pgpd promoter of Aspergillus nidulans, did not impart resistance to benomyl. The homologous expression of tub2 gene with a histidine to tyrosine mutation at position +6, which is known to impart benomyl tolerance in other fungi, does not impart resistance in T. virens. Unlike other Trichoderma spp., T. virens, has been difficult to mutate for benomyl tolerance. The present study, through site-directed mutagenesis, shows that a mutation known to impart benomyl tolerance in T. viride and other fungi does not impart resistance in this fungus. Understanding the mechanisms of this phenomenon will have a profound impact in plant-disease management, as many plant pathogenic fungi develop resistance to this group of fungicides forcing its withdrawal after a short period of use.

A Novel Kinesin-Like Protein with a Calmodulin-Binding Domain

NASA Technical Reports Server (NTRS)

Wang, W.; Takezawa, D.; Narasimhulu, S. B.; Reddy, A. S. N.; Poovaiah, B. W.

1996-01-01

Calcium regulates diverse developmental processes in plants through the action of calmodulin. A cDNA expression library from developing anthers of tobacco was screened with S-35-labeled calmodulin to isolate cDNAs encoding calmodulin-binding proteins. Among several clones isolated, a kinesin-like gene (TCK1) that encodes a calmodulin-binding kinesin-like protein was obtained. The TCK1 cDNA encodes a protein with 1265 amino acid residues. Its structural features are very similar to those of known kinesin heavy chains and kinesin-like proteins from plants and animals, with one distinct exception. Unlike other known kinesin-like proteins, TCK1 contains a calmodulin-binding domain which distinguishes it from all other known kinesin genes. Escherichia coli-expressed TCK1 binds calmodulin in a Ca(2+)-dependent manner. In addition to the presence of a calmodulin-binding domain at the carboxyl terminal, it also has a leucine zipper motif in the stalk region. The amino acid sequence at the carboxyl terminal of TCK1 has striking homology with the mechanochemical motor domain of kinesins. The motor domain has ATPase activity that is stimulated by microtubules. Southern blot analysis revealed that TCK1 is coded by a single gene. Expression studies indicated that TCKI is expressed in all of the tissues tested. Its expression is highest in the stigma and anther, especially during the early stages of anther development. Our results suggest that Ca(2+)/calmodulin may play an important role in the function of this microtubule-associated motor protein and may be involved in the regulation of microtubule-based intracellular transport.

Cloning and expression of the rat homologue of the Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schmitt, I.; Epplen, J.T.; Riess, O.

1994-09-01

Huntington`s disease (HD) is an autosomal dominant neurodegenerative disorder which is manifested usually in adult life. The age of onset is variable and leads to progressive symptoms including involuntary choreatic movements and various cognitive and psychiatric disturbances. Recently, a gene (IT15) was cloned containing a (CAG){sub n} repeat which is elongated and unstable in HD patients. IT15 is widely expressed in human tissues but unrelated to any known deduced protein sequence. To further investigate the HD gene, 15 rat cDNA libraries were screened. 24 clones have been identified covering the Huntingtin gene. Comparison of the Huntingtin gene between human andmore » rat revealed homologies between 80% and 87% at the DNA level and about 90% at the protein level. These analyses will help to define biologically important sequence regions, e.g., via evolutionary conservation. One clone contains the (CAG){sub n} repeat which consists of eight triplets compared to seven triplets in the mouse and a median of 17 in human. As in humans there are two transcripts arising from differential 3{prime}-polyadenylation. In the 3{prime}UTR a stretch of about 280 bp is exchanged for a 250 bp fragment with no homology in rodents and man. The cDNA clones are currently used to study Huntingtin gene expression during development in rodent tissues. RNA in situ hybridization of embryonic sections shows predominant signals in all neuronal tissues. In contrast to previously published data Huntingtin mRNA expression in testis is increased in spermatocytes vs. spermatogonia.« less

Traf2 interacts with Smad4 and regulates BMP signaling pathway in MC3T3-E1 osteoblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shimada, Koichi, E-mail: shimada-ki@dent.nihon-u.ac.jp; Division of Advanced Dental Treatment, Dental Research Center, Nihon University School of Dentistry, Tokyo; Ikeda, Kyoko

2009-12-18

Bone morphogenetic proteins (BMPs) play important roles in osteoblast differentiation and maturation. In mammals, the BMP-induced receptor-regulated Smads form complexes with Smad4. These complexes translocate and accumulate in the nucleus, where they regulate the transcription of various target genes. However, the function of Smad4 remains unclear. We performed a yeast two-hybrid screen using Smad4 as bait and a cDNA library derived from bone marrow, to indentify the proteins interacting with Smad4. cDNA clones for Tumor necrosis factor (TNF) receptor-associated factor 2 (Traf2) were identified, and the interaction between the endogenous proteins was confirmed in the mouse osteoblast cell line MC3T3-E1.more » To investigate the function of Traf2, we silenced it with siRNA. The level of BMP-2 protein in the medium, the expression levels of the Bmp2 gene and BMP-induced transcription factor genes, including Runx2, Dlx5, Msx2, and Sp7, and the phosphorylated-Smad1 protein level were increased in cells transfected with Traf2 siRNA. The nuclear accumulation of Smad1 increased with TNF-{alpha} stimulation for 30 min at Traf2 silencing. These results suggest that the TNF-{alpha}-stimulated nuclear accumulation of Smad1 may be dependent on Traf2. Thus, the interaction between Traf2 and Smad4 may play a role in the cross-talk between TNF-{alpha} and BMP signaling pathways.« less

Grb-IR: A SH2-Domain-Containing Protein that Binds to the Insulin Receptor and Inhibits Its Function

NASA Astrophysics Data System (ADS)

Liu, Feng; Roth, Richard A.

1995-10-01

To identify potential signaling molecules involved in mediating insulin-induced biological responses, a yeast two-hybrid screen was performed with the cytoplasmic domain of the human insulin receptor (IR) as bait to trap high-affinity interacting proteins encoded by human liver or HeLa cDNA libraries. A SH2-domain-containing protein was identified that binds with high affinity in vitro to the autophosphorylated IR. The mRNA for this protein was found by Northern blot analyses to be highest in skeletal muscle and was also detected in fat by PCR. To study the role of this protein in insulin signaling, a full-length cDNA encoding this protein (called Grb-IR) was isolated and stably expressed in Chinese hamster ovary cells overexpressing the human IR. Insulin treatment of these cells resulted in the in situ formation of a complex of the IR and the 60-kDa Grb-IR. Although almost 75% of the Grb-IR protein was bound to the IR, it was only weakly tyrosine-phosphorylated. The formation of this complex appeared to inhibit the insulin-induced increase in tyrosine phosphorylation of two endogenous substrates, a 60-kDa GTPase-activating-protein-associated protein and, to a lesser extent, IR substrate 1. The subsequent association of this latter protein with phosphatidylinositol 3-kinase also appeared to be inhibited. These findings raise the possibility that Grb-IR is a SH2-domain-containing protein that directly complexes with the IR and serves to inhibit signaling or redirect the IR signaling pathway.

Yeast two-hybrid cloning of a novel zinc finger protein that interacts with the multifunctional transcription factor YY1.

PubMed Central

Kalenik, J L; Chen, D; Bradley, M E; Chen, S J; Lee, T C

1997-01-01

Muscle-restricted transcription of sarcomeric actin genes is negatively controlled by the zinc finger protein YY1, which is down-regulated at the protein level during myogenic differentiation. To identify cellular proteins that might mediate the function/stability of YY1 in muscle cells, we screened an adult human muscle cDNA library using the yeast two-hybrid cloning system. We report the isolation and characterization of a novel protein termed YAF2 (YY1- associated factor 2) that interacts with YY1. The YAF2 cDNA encodes a 180 amino acid basic protein (pI 10.5) containing a single N-terminal C2-X10-C2 zinc finger. Lysine clusters are present that may function as a nuclear localization signal. Domain mapping analysis shows that the first and second zinc fingers of YY1 are targeted for YAF2 protein interaction. In contrast to the down-regulation of YY1, YAF2 message levels increase during in vitro differentiation of both rat skeletal and cardiac muscle cells. YAF2 appears to have a promyogenic regulatory role, since overexpression of YAF2 in C2 myoblasts stimulates myogenic promoter activity normally restricted by YY1. Co-transfection of YY1 reverses the stimulatory effect of YAF2. YAF2 also greatly potentiates proteolytic cleavage of YY1 by the calcium- activated protease m-calpain. The isolation of YAF2 may help in understanding the mechanisms through which inhibitors of myogenic transcription may be antagonized or eliminated by proteolysis during muscle development. PMID:9016636

Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

PubMed Central

2013-01-01

Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome. PMID:24010766

Unprecedented genomic diversity of AhR1 and AhR2 genes in Atlantic salmon (Salmo salar L.).

PubMed

Hansson, Maria C; Wittzell, Håkan; Persson, Kerstin; von Schantz, Torbjörn

2004-06-24

Aryl hydrocarbon receptor (AhR) genes encode proteins involved in mediating the toxic responses induced by several environmental pollutants. Here, we describe the identification of the first two AhR1 (alpha and beta) genes and two additional AhR2 (alpha and beta) genes in the tetraploid species Atlantic salmon (Salmo salar L.) from a cosmid library screening. Cosmid clones containing genomic salmon AhR sequences were isolated using a cDNA clone containing the coding region of the Atlantic salmon AhR2gamma as a probe. Screening revealed 14 positive clones, from which four were chosen for further analyses. One of the cosmids contained genomic AhR sequences that were highly similar to the rainbow trout (Oncorhynchus mykiss) AhR2alpha and beta genes. SMART RACE amplified two complete, highly similar but not identical AhR type 2 sequences from salmon cDNA, which from phylogenetic analyses were determined as the rainbow trout AhR2alpha and beta orthologs. The salmon AhR2alpha and beta encode proteins of 1071 and 1058 residues, respectively, and encompass characteristic AhR sequence elements like a basic-helix-loop-helix (bHLH) and two PER-ARNT-SIM (PAS) domains. Both genes are transcribed in liver, spleen and muscle tissues of adult salmon. A second cosmid contained partial sequences, which were identical to the previously characterized AhR2gamma gene. The last two cosmids contained partial genomic AhR sequences, which were more similar to other AhR type 1 fish genes than the four characterized salmon AhR2 genes. However, attempts to amplify the corresponding complete cDNA sequences of the inserts proved very difficult, suggesting that these genes are non-functional or very weakly transcribed in the examined tissues. Phylogenetic analyses of the conserved regions did, however, clearly indicate that these two AhRs belong to the AhR type 1 clade and have been assigned as the Atlantic salmon AhR1alpha and AhR1beta genes. Taken together, these findings demonstrate that multiple AhR genes are present in Atlantic salmon genome, which likely is a consequence of previous genome duplications in the evolutionary past of salmonids. Plausible explanations for the high incidence of AhR genes in fish and more specifically in salmonids, like rapid divergences in specialized functions, are discussed.

Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

PubMed

Yi, S Y; Hwang, B K

1998-10-31

Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

PubMed Central

Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

1993-01-01

Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

Purification and characterization of bovine cone arrestin (cArr).

PubMed

Maeda, T; Ohguro, H; Sohma, H; Kuroki, Y; Wada, H; Okisaka, S; Murakami, A

2000-03-31

To elucidate the quenching mechanism of phototransduction in vertebrate cone photoreceptors, a cDNA clone encoding cone specific arrestin (cArr) was isolated from a bovine retinal cDNA library using a human cArr cDNA probe. Affinity-purified anti-peptide antibody specific to cArr was prepared. Immunohistochemical staining displayed specific labeling of cArr in cone photoreceptors and immunoblotting identified a 46 kDa protein band. We purified cArr from bovine retinas by sequential column chromatography using DEAE-cellulose, gel filtration and mono Q columns. Binding studies revealed no binding of cArr to rhodopsin regardless of whether it was bleached and/or phosphorylated. cArr also failed to bind to heparin-Sepharose under conditions which rod arrestin (rArr) bound to the column. The present data suggest that cArr may play a role in the quenching of phototransduction in cone photoreceptors and that its activity therein is different to that of rArr.

Eimeria tenella enolase and pyruvate kinase: a likely role in glycolysis and in others functions.

PubMed

Labbé, Marie; Péroval, Marylène; Bourdieu, Christiane; Girard-Misguich, Fabienne; Péry, Pierre

2006-12-01

Two cDNA codings for glycolytic enzymes were cloned from a cDNA library constructed from the schizont stage of the avian parasite Eimeria tenella. Enolase and pyruvate kinase cDNA were fully sequenced and compared with sequences of enzymes from other organisms. Although these enzymes were already detected in the sporozoite stage, their expression was enhanced during the first schizogony in accordance with the anaerobic conditions of this part of the life cycle of the parasite. Under activating conditions, microscopic observations suggest that these glycolytic enzymes were relocalised inside sporozoites and moreover were in part secreted. The enzymes were also localised at the apex of the first generation of merozoites. Enolase was partly observed inside the nucleus of sporozoites and schizonts. Taken together, these results suggest that glycolytic enzymes not only have a function in glycolysis during anaerobic intracellular stages but may also participate in the invasion process and, for enolase, in the control of gene regulation.

Molecular analysis of ARF1 expression profiles during development of physic nut (Jatropha curcas L.).

PubMed

Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang

2011-03-01

A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.

Nitrate-induced genes in tomato roots. Array analysis reveals novel genes that may play a role in nitrogen nutrition.

PubMed

Wang, Y H; Garvin, D F; Kochian, L V

2001-09-01

A subtractive tomato (Lycopersicon esculentum) root cDNA library enriched in genes up-regulated by changes in plant mineral status was screened with labeled mRNA from roots of both nitrate-induced and mineral nutrient-deficient (-nitrogen [N], -phosphorus, -potassium [K], -sulfur, -magnesium, -calcium, -iron, -zinc, and -copper) tomato plants. A subset of cDNAs was selected from this library based on mineral nutrient-related changes in expression. Additional cDNAs were selected from a second mineral-deficient tomato root library based on sequence homology to known genes. These selection processes yielded a set of 1,280 mineral nutrition-related cDNAs that were arrayed on nylon membranes for further analysis. These high-density arrays were hybridized with mRNA from tomato plants exposed to nitrate at different time points after N was withheld for 48 h, for plants that were grown on nitrate/ammonium for 5 weeks prior to the withholding of N. One hundred-fifteen genes were found to be up-regulated by nitrate resupply. Among these genes were several previously identified as nitrate responsive, including nitrate transporters, nitrate and nitrite reductase, and metabolic enzymes such as transaldolase, transketolase, malate dehydrogenase, asparagine synthetase, and histidine decarboxylase. We also identified 14 novel nitrate-inducible genes, including: (a) water channels, (b) root phosphate and K(+) transporters, (c) genes potentially involved in transcriptional regulation, (d) stress response genes, and (e) ribosomal protein genes. In addition, both families of nitrate transporters were also found to be inducible by phosphate, K, and iron deficiencies. The identification of these novel nitrate-inducible genes is providing avenues of research that will yield new insights into the molecular basis of plant N nutrition, as well as possible networking between the regulation of N, phosphorus, and K nutrition.

The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika

2010-01-27

Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set ofmore » tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in EST library sequencing approaches, and thus represent a rich resource for studies of environmental genomics.« less

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

A universal next generation sequencing protocol to generate non-infectious barcoded cDNA libraries from high containment RNA viruses

USDA-ARS?s Scientific Manuscript database

Several biosafety level (BSL)-3/4 pathogens are high consequence, single-stranded RNA viruses and their genomes, when introduced into permissive cells, are infectious. Moreover many of these viruses are Select Agents (SAs), and their genomes are also considered SAs. For this reason cDNAs and/or th...

Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

USDA-ARS?s Scientific Manuscript database

Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...